ES2422874A1 - In vitro method of prognosis of severe hepatic fibrosis (Machine-translation by Google Translate, not legally binding) - Google Patents

Abstract

In vitro method for the prognosis of severe hepatic fibrosis. The present invention relates to an in vitro method for obtaining useful data for the prognosis of severe hepatic fibrosis in chronic hepatitis c characterized by the detection of the genetic polymorphism rs3778216 of the hdac2 gene or anyone who is in linkage disequilibrium with it. It also refers to an in vitro method for the prognosis and/or diagnosis of said pathology characterized by the detection of said polymorphisms and the determination of clinical variables or other polymorphisms. The present invention also relates to the use of the polymorphism rs3778216 of the hdac2 gene or any that is in linkage disequilibrium with it as a prognostic marker of severe hepatic fibrosis and also to the use of a kit comprising probes for its detection. (Machine-translation by Google Translate, not legally binding)

Description

In vitro method of prognosis of severe hepatic fibrosis.

The present invention relates to an in vitro method of prognosis and / or diagnosis of severe hepatic fibrosis for chronic liver diseases, preferably chronic hepatitis C, which is characterized by the detection of the rs3778216 genetic polymorphism of the HDAC2 gene or whatever is found in linkage imbalance with him (r20,8). The inclusion of the determination of a clinical variable, preferably the determination of the concentration of aspartate aminotransferase (AST), in an isolated biological sample allows the diagnosis of hepatic fibrosis F> 2 in patients with chronic hepatitis C. Therefore, the invention It could be framed in the medical field.

STATE OF THE TECHNIQUE

Hepatic fibrosis is a pathology characterized by excessive accumulation of extracellular matrix in the hepatic parenchyma that leads to a structural and functional alteration of this organ. Liver fibrosis is common in chronic liver diseases such as hepatitis caused by hepatitis C virus, hepatitis caused by hepatitis B virus, non-alcoholic fatty liver disease and alcoholic liver disease (Poynard, T et al. Adv Clin Chem 2008, 46: 131-160).

Hepatitis C virus (HCV) infection is one of the leading causes of global chronic liver disease, affecting approximately 170 million people (Brown, R.S. Nature 2005, 436: 973-978.). Current antiviral therapy consists of pegylated interferon alpha plus ribavirin; however, a high variability in the response rate obtained with this treatment is observed. This variability is associated with both viral factors and patient factors.

One of the most important viral factors is the viral genotype. Thus, the eradication of the hepatitis C virus is especially difficult in patients infected with viral genotype 1, reaching a response rate close to 50% of treated patients while patients with viral genotypes 2 and 3 respond approximately 70%.

Patient factors that influence the outcome of antiviral treatment include sex, age or body mass index. In addition, different polymorphisms have recently been described in the IL-28B gene, which codes for interferon A3, which significantly influence the response to treatment, highlighting the importance of the patient's genetic profile in the response to these drugs (Suppiah, V et al. Nat Genet 2009, 41 (10): 1100-4. Tanaka, Y. et al. Nat Genet 2009, 41 (10): 1105-9. Ge, D. et al. Nature 2009, 461 (7262 ): 399-401).

The failure of the therapy has important clinical repercussions because this disease frequently evolves to fibrosis, being able to trigger cirrhosis and hepatocellular carcinoma (HCC), of expensive management and which constitute the main cause of liver transplantation. Similar to the response to treatment, the progression and prognosis of chronic hepatitis C (HCC) is very variable among different patients, indicating the relevance of inter-individual genetic variability in the pathogenesis of HCC.

The diagnosis of liver fibrosis is traditionally made from a liver biopsy. The METAVIR scale allows assessing the degree of liver fibrosis classified in 5 stages (Bedossa, P., Poynard, T. Hepatology 1996, 24 (2): 289-293): light or absent fibrosis (liver without fibrosis or portal fibrosis without lobar septa, F0 and F1), moderate fibrosis (portal fibrosis with few septa, F2), severe fibrosis (numerous incomplete septa with liver architecture distortion, but without cirrhosis, F3), and cirrhosis (F4). Depending on the stage, the patient's prognosis is better or worse, the cirrhosis stage (F4) being the most severe. However, this technique is invasive, limited by problems of variability due to the size of the biopsy, subjective interpretation, difficult periodic repetition and high economic cost. For these reasons, non-invasive diagnostic tests are needed that can replace liver biopsy based on safer indirect tests for the patient and lower socioeconomic cost.

Thus, several indices such as APRI or, more recently, FIB-4, were developed that combine various fibrogenic markers in peripheral blood in a simple relationship (Wai, C.T. et al. Hepatology 2003, 38 (2): 518-26. Sterling,

R.K.

 et al. Hepatology 2006, 43 (6): 1317-25). Subsequently, other indices were established to diagnose the progression of the disease in the liver and its severity, which included the measurement and analysis in mathematical functions (logistic regression) of the levels of said biological markers together with other clinical variables to provide a score. of fibrosis, such as Fibrotest, ELF, Fibrometer, Fibrospect, and Hepascore (Imbert-Bismut,

F.

 et al. Lancet 2001, 357 (9262): 1069-75. Rosenberg, W.M. et al. Gastroenterology 2004, 127 (6): 1704-13. Limes,

P.

 et al. Hepatology 2005, 42 (6): 1373-81. Patel, K. et al. J Hepatol 2004, 41 (6): 935-42. Adams, L.A. et al. Clin Chem 2005, 51 (10): 1867-73.), Among others (for a review of all these methods see Pinzani, M. Hepatology 2011, 54 (4): 1476-7). Despite the validity of these scales to diagnose liver fibrosis, compiled in a recent meta-analysis, the need for liver biopsy to discriminate certain stages of fibrosis is still proposed (Poynard, T. et al. Advances in Clinical Chemistry 2008, 46 : 131-156).

On the other hand, other non-invasive systems for the diagnosis of hepatic fibrosis have been developed by physical methods, for example ultrasound elastometry, which assesses liver stiffness (SLE). However, the rate of classification errors using a single liver stiffness cutoff prevents its application to detect patients with absence of fibrosis or minimal fibrosis. In addition, this technique is not available in all health centers due to its cost, and the fact that in some countries it has not been validated as a diagnostic method.

Recently, it has been proposed that the combination of various fibrosis biomarkers, clinical and demographic markers, together with the results of imaging tests (such as Fibroscan ™ or ARFI) can abolish the need for biopsy to diagnose the presence and / or severity of liver pathology in most cases, especially for certain stages of fibrosis (Cales, P. and Boursier, J. WO 2010/097472).

Despite the various methods discussed to diagnose the severity of liver fibrosis in patients with HCC, the availability of tests capable of assessing a patient's predisposition to develop fibrosis is still very limited. Although chronic hepatitis C is a disease of slow evolution, which requires decades to progress to advanced fibrosis in most cases, there is a subgroup of patients with a faster progression rate, as described in the literature (Seeff , LB Liver Int 2009, 29: 89–99. Marcellin,

P. et al. Hepatology 2002, 36: S47–56). The variability in the rate of evolution of this disease among the different patients reflects the great clinical utility of identifying genetic risk markers when establishing therapeutic criteria that minimize costs and adverse effects. In addition, the risk factors identified to date only explain 30% of the cases that progress to severe fibrosis and cirrhosis, indicating the importance of the genetic profile of patients when developing cirrhosis and / or CHC with greater or less speed.

In this sense, various single nucleotide polymorphisms (SNPs) have been characterized in genes involved in the regulation of the HCV immune response (IFN, TNF, IL-10, LDL, MCP-2), associated with the progression of fibrosis in patients with HCC (Missiha, SB et al. Gastroenterology 2008, 134 (6): 1699-714. Bataller, R. et al. Hepatology 2003, 37 (3): 493-503. Powell, EE et al. Hepatology 2000, 31 (4): 828-33 Romero-Gómez, M. et al. Liver Int. 2011, 4: 443-460). However, these studies have raised significant controversy because many of them have been conducted in small patient cohorts and have not been confirmed in independent series. Recently, a region has been described in the IFNGR2 gene (Nalpas, B. et al. Gut 2010, 59: 11201126), which includes different polymorphisms (rs9976971, rs10600672, rs2284553 and rs17882748) associated with stages of liver fibrosis 3 and 4 ( compared to a comparator group of patients with stages of fibrosis 0 and 1). However, this method does not analyze the influence of other clinical risk variables associated with fibrosis, nor does it establish a predictive model. Likewise, this study does not take into account patients who are in a stage of moderate fibrosis (F = 2), the majority group in this pathology.

On the other hand, it has been described that prolonged treatment with pegylated interferon alfa (of high economic cost and with significant adverse effects) significantly decreases the progression of cirrhosis to HCC, so the characterization of genetic polymorphisms related to the progression of this disease acquires great clinical and pharmacoeconomic relevance.

Interestingly, Huang et al. (Hepatology 2007, 46: 297-306, US2010 / 0216154A1 and US2011 / 0129831A1) described a cirrhosis risk scale (CRS) for patients with chronic HCV infection based on an algorithm from the evaluation of seven SNPs in various genes Candidates (AZIN 1 (on chromosome 8), TLR4 (on chromosome 9), TRPM5 (on chromosome 11), AQP2 (on chromosome 12), and three other polymorphisms (on chromosomes 1, 3 and 15)) , showing the combination of these 7 markers an AUCROC (AUC-Area Under Curve or area under the curve; ROC-Receiver Operating Characteristic or receiver operational characteristic) of 0.73, which increased to 0.76 if other variables were included clinics Although this method has been subsequently validated by other authors as a predictor of progression of HCC to fibrosis and cirrhosis, both from mild stages (Trepo, E. et al. J Hepatol 2011, 55 (1): 38-44) and from stages moderate and severe (Marcolongo, M. et al. Hepatology 2009, 50 (4): 1038-44. Curto, TM et al. Pharmacogenet Genomics 2011, 21 (12): 851-60) in the study by Marcolongo et al, These results were validated only in men with an AUCROC of 0.73 while in the study by Curto et al. they did not observe that the CRS score was predictive of clinical evolution.

Therefore, due to the remarkable evolution of chronic liver disease due to hepatitis C virus infection to liver fibrosis and cirrhosis, the main cause of liver failure and transplantation, the development of alternative non-invasive prognostic / diagnostic methods is necessary. of evolution of the patients affected to stages of severe fibrosis, which would be a tool of great clinical relevance.

DESCRIPTION OF THE INVENTION

The present invention describes a simple and precise method of prognosis and diagnosis of liver disease progression, preferably chronic hepatitis C, at stages of fibrosis, preferably at severe stages of fibrosis (F> 2) that requires one or a low number of markers. genetic and that can include at least one clinical variable, and that presents high predictive level (AUCROCs), sensitivity and specificity.

The present invention relates to an in vitro method of obtaining useful data for the prognosis and / or diagnosis of severe hepatic fibrosis (F> 2) characterized by the detection of the rs3778216 genetic polymorphism of the HDAC2 gene

or any of those in linkage disequilibrium with it (R2 0.8), in the isolated biological sample of a subject suffering from chronic liver disease. Preferably the hepatopathy is hepatitis C. The invention also relates to methods for the prognosis and / or diagnosis of severe hepatic fibrosis in subjects with a chronic liver disease, preferably chronic hepatitis C, comprising the detection of said polymorphisms, and the association of a specific genotype of at least one of said polymorphisms with the risk of suffering from severe hepatic fibrosis. These methods may also include the determination of other variables such as the concentration of aspartate aminotransferase (AST).

In the present invention, independent and significant association data of the G / G genotype of the rs3778216 genetic polymorphism of the HDAC2 gene is shown with the probability of developing severe hepatic fibrosis in patients infected with hepatitis C virus. In addition, the methods of the invention are able to predict the evolution to severe hepatic fibrosis of a patient with chronic liver disease. The present invention shows the utility of determining the genetic polymorphism rs3778216 of the HDAC2 gene as a marker for the prognosis of severe hepatic fibrosis. In addition, results of the utility of the methods of the invention in predicting the prognosis of severe hepatic fibrosis are shown. The rs3778216 polymorphism of the HDAC2 gene is independently and significantly associated with the probability of developing fibrosis, and more specifically severe fibrosis (F> 2), in patients infected with the hepatitis C virus (logistic regression, p = 0.028) .

The rs3778216 genetic polymorphism of the HDAC2 gene, reference number of the Human Genome Variation Society (HGVS) NM_001527.3: c.165 + 507G> A or NC_000006.11: g.114280563C> T, or also called rs3778216, refers to an SNP located at position 114280563 of chromosome 6 of homo sapiens (NCBI GenBank access number of the sequence of chromosome 6 of homo sapiens: NT_025741.15). The rs3778216 polymorphism is located in an intron of the HDAC2 gene. The genotypes can be homozygous of adenines (A / A), heterozygous adenine / guanine (A / G) or homozygous of guanine (G / G).

In the present invention the presence of at least one A allele in the rs3778216 polymorphism is protective, while carrying the G / G genotype increases the risk of severe hepatic fibrosis. The HDAC2 gene refers to the polynucleotide sequence that codes for the protein called histone deacetylase 2 or "histone deacetylase 2" (HDAC2) (with access number to the NCBI Reference Sequence: NC_000006.11 and NM_001527.3).

Since the rs3778216 polymorphism has utility in the diagnosis and prognosis of severe hepatic fibrosis, any other polymorphism that is in linkage disequilibrium with it (that is, it is inherited and in conjunction with it), would have the same capacity. The polymorphism rs3778216 of the HDAC2 gene (NT_025741.15) is in linkage disequilibrium, for example with the polymorphisms rs13209064, rs13213007, rs13201727, rs13216873, rs13194921, rs13204434, rs12665202125442, 245132205452, 2125445, 2132205455, 2125442, 5132202, 5252125455, 2121, 5132202, 5132202, 5132202, 5251202, 5251202, 5251202 0.8 in the Caucasian population. Therefore, any of these SNPs may be associated with severe hepatic fibrosis, since they are inherited in block together with the rs3778216 polymorphism (Table 1). The genotypes associated with the increased risk of each of these polymorphisms in linkage disequilibrium with the genotype G / G of SNP rs3778216 are: genotype A / A of the genetic polymorphism rs13212298; C / C genotype of the genetic polymorphism rs12665655; genotype A / A of the genetic polymorphism rs13204445; T / T genotype of the genetic polymorphism rs13204434; genotype A / A of the genetic polymorphism rs13194921; T / T genotype of the genetic polymorphism rs13209064; C / C genotype of the genetic polymorphism rs13213007; T / T genotype of the genetic polymorphism rs13216873; G / G genotype of the genetic polymorphism rs12660414; T / T genotype of the genetic polymorphism rs2025191; genotype A / A of the genetic polymorphism rs13201727; C / C genotype of the genetic polymorphism rs1322453.

For all these reasons, a first aspect of the invention relates to an in vitro method of obtaining useful data for the prognosis and / or diagnosis of severe hepatic fibrosis characterized by the detection of at least one genetic polymorphism of the HDAC2 gene selected from the list comprising: rs3778216, rs13209064, rs13213007, rs13201727, rs13216873, rs13194921, rs13204434, rs12665655, rs13204445, rs12660414, rs2025191, rs1322453 and rs132 we see in which we are referred to in this chronic sample. as the first method of the invention. In a preferred embodiment of this aspect of the invention the polymorphism of the HDAC2 gene is the rs3778216 polymorphism.

The term "in vitro" refers to the method of the invention being performed outside the subject's body.

The term "prognosis" in the present invention refers to the ability to detect asymptomatic patients or subjects who have a high probability of developing severe hepatic fibrosis, even if they do not present such pathology at the time of diagnosis. The term "prognosis" also refers to the ability to detect previously diagnosed subjects of fibrosis in stages of mild or moderate fibrosis with a high probability of suffering a worsening of the disease, that is, of developing severe fibrosis.

"Diagnosis" in the present invention is understood as the determination of the stage of liver fibrosis at a specific time in its development. In the present invention, "diagnosis" refers to the determination of a stage of severe hepatic fibrosis (F> 2).

A model is considered predictive when the AUCROC is greater than 0.5. The AUCROC is defined as the probability of correctly classifying a pair of case and control individuals, randomly selected from the population, using the results obtained by applying the mathematical model (combination of variables independently associated with fibrosis). The AUCROC by agreement is between 0.5 and 1: the closer to 1 is the AUCROC value of a variable, the more accurate and predictive it is considered. The sensitivity of the diagnostic test is the probability of obtaining a positive result when the individual has the disease. It measures its ability to detect the characteristic studied when it is present. The specificity of a test indicates the probability of obtaining a negative result when the individual does not have the disease, in this case F> 2 (Burgueño MJ et al. Med Clin (Barc) 1995, 104: 661-670).

In the present invention, "hepatic fibrosis" is understood as the intrahepatic accumulation of fibrous connective tissue that originates as a result of a chronic reparative, reactive or inflammatory process of the liver, which entails the structural and functional alteration of the hepatic parenchyma.

"Severe hepatic fibrosis" is understood as the accumulation of extracellular matrix fibers, for example collagen, which occurs in chronic liver diseases. This definition, in the present invention includes stages F> 2 (which includes both F = 3 and F = 4) according to the METAVIR scale. Hepatic fibrosis is classified according to the METAVIR scale, according to which there are 5 stages (Bedossa, P. and Poynard, T. Hepatology 1996, 24 (2): 289-293): F0

or absent fibrosis, where the liver has no fibrosis; F1 or light fibrosis, refers to portal fibrosis without lobar septa; F2 or moderate fibrosis, refers to portal fibrosis with few septa; F3 or severe fibrosis, where there are numerous incomplete septa with hepatic architecture distortion but without cirrhosis; and F4 very serious fibrosis or cirrhosis. Depending on the stage, the patient's prognosis is better or worse, the cirrhosis stage (F4) being the most severe. Fibrosis can result in cirrhosis, liver failure, portal hypertension and often the patient requires a liver transplant.

By "hepatopathology", "hepatopathy" or "liver pathology" is understood in the present invention, as that liver disease that may be due to different etiologies, among them may be caused by chronic hepatitis C, which leads to the dysfunction of said organ.

In the present invention "chronic hepatitis C" refers to liver disease caused by hepatitis C virus infection that generally results in chronic liver inflammation, which can result in liver fibrosis, cirrhosis and liver carcinoma (Yano, M et al. Hepatology 1996, 23: 1334-1340. Brown, RS Nature 2005, 436: 973-978).

The term "genetic polymorphism" refers to a variation in the nucleotide sequence of the deoxyribonucleic acid (DNA) chain that has at least a frequency of 1% in individuals in a population. Genetic polymorphisms can be variations of one or more nucleotides. Single nucleotide polymorphisms, "single nucleotide polymorphism" or SNP, generally give rise to two alleles. SNPs or polymorphisms may contain information about the variation of a single polymorphism or the information of a haplotype if they are SNP tags or "tagSNP".

Haplotype is a combination of alleles of different loci of a chromosome that are transmitted together. A haplotype can be a locus, several loci, or an entire chromosome depending on the number of recombination events that have occurred between a given set of loci.

In the present invention we refer to "haplotype" as a set of polymorphisms (SNPs) that are inherited in block with measures of linkage imbalance r2 0.8 and that are identified by genotyping of one of the polymorphisms included in said haplotype .

“Linkage disequilibrium” (LD of “linkage disequilibrium”) is the property of some genes of not segregating independently, that is, they have a recombination frequency of less than 50%. This is usually due to the fact that the two loci involved are located on the same chromosome, which makes it impossible to transfer them to the progeny at random with the separation of the chromosomes in anaphase (Reich, DE et al. Nature 2001, 411 (6834): 199-204).

"R2" is a measure of linkage imbalance between two genetic markers. Two SNPs that have not been separated by recombination (total LD) show a r2 = 1. In such a case the genotyping of both SNPs would be redundant (Pritchard, J.K. and Przeworski, M. Am J Hum Genet 2001, 69 (1): 1-14). Therefore, using the data provided by the Hapmap with an R2> 0.8 we would be able to see virtually all SNPs of a haplotype by genotyping its tagSNP (from Bakker, PI et al. Nature Genetics 2005, 37 (11 ): 1217-23).

The terms "polynucleotide", "nucleotide sequence", "nucleotide sequence", "nucleic acid" and "oligonucleotide" are used interchangeably herein, and refer to a polymeric form of nucleotides of any length, which may be, or no, chemically or biochemically modified.

The terms "amino acid sequence" or "protein" are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which may or may not be chemically or biochemically modified. The term "residue" corresponds to an amino acid.

The polymorphism detection can be performed by any method known to the person skilled in the art for this purpose. For example, it can be performed by genotyping kits, sequencing or by PCR amplification (polymerase chain reaction) and subsequent restriction enzyme analysis or by real-time PCR. Genotyping kits may contain fluorophores-labeled oligonucleotides and may require hybridization of these with an isolated biological sample from a subject.

The term "sequencing," as used herein, refers to the determination of the nucleotides of a template nucleic acid and its order.

The term "amplification", as used herein, refers to the increase in the number of copies of a template nucleic acid, where it can be made using fluorescent probes. In a preferred embodiment, the amplification takes place by real-time PCR.

The term "template nucleic acid" or "template", as used herein, refers to a single or double stranded nucleic acid molecule that is to be amplified or sequenced.

The increase in the number of copies of a template nucleic acid is carried out by complementary DNA synthesis through conditions that allow it.

The conditions that allow the synthesis of complementary DNA refers to the conditions under which the incorporation of the nucleotides into a nascent DNA can take place by means of complementarity of bases with the template nucleic acid.

Conditions under which sequencing or amplification is performed generally include (a) contacting a template nucleic acid with a polymerase in a mixture that further comprises a primer, a bivalent cation, (eg, Mg2 +), and nucleotides, generally, dNTPs and, at least, one ddNTP, and (b) subjecting said mixture to a temperature sufficient for the polymerase to initiate the incorporation of the nucleotides into the primer by complementing bases with the template nucleic acid, and giving rise to a population of complementary DNA molecules of different sizes. The separation of said population from complementary DNA molecules, generally, by electrophoresis, allows the nucleotide sequence to be determined.

The term "primer", as used herein, refers to an oligonucleotide capable of acting as the starting point of DNA synthesis when hybridized with the template nucleic acid. Preferably, the primer is a deoxyribose oligonucleotide.

Primers can be prepared by any suitable method, including, but not limited to, cloning and restriction of appropriate sequences and direct chemical synthesis. The primers can be designed to hybridize with specific nucleotide sequences in the template nucleic acid (specific primers) or can be synthesized at random (arbitrary primers).

The term "specific primer", as used herein, refers to a primer whose sequence is complementary to a specific nucleotide sequence in the template nucleic acid to be amplified or sequenced.

The term "arbitrary primer" refers to a primer whose sequence is synthesized at random and that is used to initiate DNA synthesis at random positions of the template nucleic acid to be amplified or sequenced. A population of different arbitrary primers is often used. The term "arbitrary primers" refers to a set of primers whose sequence is synthesized at random and that is used to initiate DNA synthesis at random positions of the template nucleic acid that is to be amplified or sequenced.

The term "hybridization," as used herein, refers to the pairing of two complementary single stranded DNA molecules to give a double stranded molecule. Preferably, the complementarity is 100%. That is, in the region of complementarity each nucleotide of one of the two nucleic acid molecules can form hydrogen bonds with a nucleotide present in the other nucleic acid molecule. However, those with normal experience in the field will recognize that two nucleic acid molecules that have a region with complementarity less than 100% can also hybridize.

The term "nucleotide", as used herein, refers to an organic molecule formed by the covalent bond of a pentose, a nitrogen base and a phosphate group. The term "nucleotide" includes deoxyribonucleoside triphosphates, such as, but not limited to, dATP, dCTP, dITP, dUTP, dGTP, dTTP, or derivatives thereof. The term nucleotide also includes dideoxypyribonucleoside triphosphates (ddNTPs), such as ddATP, ddCTP, ddGTP, ddITP, ddTTP or derivatives thereof.

In accordance with the present invention a "nucleotide" or a "primer" can be labeled or labeled by techniques well known in the state of the art. Detectable labels include, for example, radioactive isotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels or enzymatic labels.

The term "biological sample" in the present invention refers to any sample that allows obtaining DNA from the individual from which said sample was obtained, and includes, but is not limited to, tissues and / or biological fluids of an individual, obtained by any method known by an expert in the field that serves this purpose. The biological sample could be, for example, but not limited to, a tissue or a fluid sample, such as blood, plasma, serum, oral mucosa, bronchoalveolar lavage, lymph or ascites fluid. Within the biological samples, one of the most useful is the oral mucosa since it is easily obtained and does not imply any alteration for the individual. Therefore, preferably the sample is oral blood and / or mucosa, more preferably, peripheral blood and / or oral mucosa. Likewise, the biological sample can be, for example, but not limited, fresh, frozen, fixed

or fixed and embedded in paraffin.

"Subject" means an individual susceptible to severe liver fibrosis. Preferably the subject is a human.

On the other hand, the results reveal that the inclusion of the rs3778216 genetic polymorphism of the HDAC2 gene together with the determination of the concentration of the AST enzyme (serum levels prior to treatment or last determination available in the case of untreated individuals) in the biological sample Isolated from a subject is a diagnostic method of severe liver fibrosis with a highly predictive AUCROC. Therefore, a preferred embodiment of the first aspect of the invention relates to an in vitro method of obtaining useful data for the prognosis of severe hepatic fibrosis characterized by the detection of at least one genetic polymorphism of the HDAC2 gene selected from the list comprising rs3778216 . of aspartate aminotransferase (AST).

In the present invention it has been observed that the predictive value of the method of prognosis and / or diagnosis of severe hepatic fibrosis characterized by the detection of the rs3778216 polymorphism of the HDAC2 gene or any that is in linkage disequilibrium with it, alone or in combination with AST, is greater when the rs2030171 genetic polymorphisms of the STAT1 gene and / or the rs12436555 polymorphism of the ISGF3G gene, or any that are in linkage disequilibrium with them are also detected.

The rs2030171 polymorphism of the STAT1 gene refers to the reference number of the Human Genome Variation Society (HGVS) NC_000002.11: g.191869163G> A, NG_008294.1: g.14814C> T, NM_007315 .3: c.372 + 3126C> T, NM_139266.2: c.372 + 3126C> T or also called rs2030171 refers to an SNP located at position 191869163 of chromosome 2 of homo sapiens (GenBank access number of the chromosome 2 sequence of homo sapiens: NT_005403.17). The association with a worse prognosis, that is, developing severe hepatic fibrosis, is obtained when the subject is a carrier of the A allele of the A / G genetic polymorphism of the rs12436555 of the ISGF3G gene and / or is a carrier of the G / G genotype of the genetic polymorphism. A / G rs2030171 of the STAT1 gene. The detection of these polymorphisms can be performed just like that of the rs3778216 polymorphism or by other techniques known to the person skilled in the art for this purpose. The rs2030171 polymorphism is located in an intron of the STAT1 gene. Genotypes can be homozygous of adenines (A / A), heterozygous adenine / guanine A / G or homozygous of guanine (G / G). In the present invention the presence of at least one A allele in the rs2030171 polymorphism is protective while carrying the G / G genotype increases the risk of severe hepatic fibrosis.

The rs2030171 polymorphism of the STAT1 gene (NT_025741.15) is in linkage disequilibrium with the rs13029247, rs10173099, rs10199181 and rs6745710 polymorphisms of the same gene with a value of r2 0.8 in the Caucasian population. Therefore, any of these SNPs may be associated with severe hepatic fibrosis (F> 2) since they are inherited in block together with rs2030171 (Table 1). The genotypes associated with the increased risk of each of these polymorphisms in linkage disequilibrium with the G / G genotype of SNP rs2030171 are: T / T genotype of the genetic polymorphism rs13029247; C / C genotype of the rs10173099 genetic polymorphism; T / T genotype of the rs10199181 genetic polymorphism and C / C genotype of the rs6745710 genetic polymorphism.

The rs12436555 polymorphism of the ISGF3G gene refers to a reference number of the Human Genome Variation Society (HGVS) NC_000014.8: g.24634825G> A, NM_006084.4: c.992-231G> A or also called rs12436555 refers to an SNP located at position 24634825 of chromosome 14 of homo sapiens (GenBank accession number of chromosome 14 sequence of homo sapiens: NT_026437.12). The rs12436555 polymorphism is located in an intron of the ISGF3-GAMMA gene (also known as the p48 protein or "interferon regulatory factor 9"). Genotypes can be homozygous of adenines (A / A), heterozygous adenine / guanine A / G or homozygous of guanine (G / G). In the present invention the presence of at least one A allele in the rs12436555 polymorphism increases the risk of severe hepatic fibrosis while bearing the G / G genotype is protective.

The rs12436555 polymorphism of the ISGF3G gene (NT_026437.12) is in linkage imbalance with the rs10583 and 12432194 polymorphisms (TM9SF1 and ISGF3G gene, respectively) with a value of r2 0.8 for both in the Caucasian population. Therefore, it may be associated with severe hepatic fibrosis since they are inherited in block together with rs12436555 (Table 1). The genotypes associated with the increased risk of each of these polymorphisms in linkage disequilibrium with the A allele of the rs12436555 polymorphism are: carrier of at least one T allele of the rs12432194 genetic polymorphism of the ISGF3G gene; carrier of at least one A allele of the rs10583 genetic polymorphism of the TM9SF1 gene.

For everything described herein, another preferred embodiment of the first aspect of the invention relates to an in vitro method of obtaining useful data for the prognosis of severe hepatic fibrosis characterized by the detection of at least one genetic polymorphism of the HDAC2 gene selected from the list comprising rs3778216, rs13209064, rs13213007, rs13201727, rs13216873, rs13194921, rs13204434, rs12665655, rs13204445, rs12660414, rs2025191, rs1322453, and rs132789, in which the subject of chronic disease is treated in a chronic AST levels are detected, at least one genetic polymorphism of the STAT1 gene selected from the list comprising rs2030171, rs13029247, rs10173099, rs10199181, and rs6745710, and / or at least one genetic polymorphism of the ISGF3G gene or the TM9SF1 gene selected list comprising: rs12436555, rs12432194 and rs10583. In a more preferred embodiment, the STAT1 gene polymorphism is rs2030171. In another more preferred embodiment, the genetic polymorphism of the ISGF3G gene is rs12436555.

On the other hand, taking into account everything previously described, a second aspect of the present invention relates to an in vitro method for the prognosis and / or diagnosis of severe liver fibrosis in a subject suffering from chronic hepatitis C characterized by:

to.

The detection of at least one genetic polymorphism of the HDAC2 gene selected from the list comprising: rs3778216, rs13209064, rs13213007, rs13201727, rs13216873, rs13194921, rs13204434, rs12665655, rs13204445, rs12660214 and rs12660214 biological subjects ,

b.

the association of genotype G / G of the genetic polymorphism rs3778216, of the genotype A / A of the genetic polymorphism rs13212298, of the genotype C / C of the genetic polymorphism rs12665655, of the genotype A / A of the genetic polymorphism rs13204445, of the genotype T / T of the genetic polymorphism rs13204434, of the A / A genotype of the genetic polymorphism rs13194921, of the T / T genotype of the genetic polymorphism rs13209064, of the C / C genotype of the genetic polymorphism rs13213007, of the T / T genotype of the genetic polymorphism rs13216873 of the genotype G rs12660414, of the T / T genotype of the genetic polymorphism rs2025191, of the A / A genotype of the genetic polymorphism rs13201727, and / or of the C / C genotype of the genetic polymorphism rs1322453 of the HDAC2 gene at a prognosis and / or diagnosis of severe hepatic fibrosis.

In a preferred embodiment of this aspect of the invention the polymorphism of step (a) is rs3778216 and the genotype that is associated with a prognosis and / or diagnosis of severe hepatic fibrosis in step (b) is the G / G genotype of the polymorphism. Genetic RS3778216.

Aspartate aminotransferase (AST), also called glutamic oxalacetic transaminase (GOT), is an enzyme present in the liver as well as in other organs such as heart and skeletal muscle (NCBI Accession Number: NP_002070.1). The present invention demonstrates that the second method of the invention is even more predictive when it includes the determination of AST concentration than when it only includes the detection of the rs3778216 polymorphism of the HDAC2 gene or any of the linkage disequilibrium polymorphisms with this . Likewise, the AUCROC of the AST variable, one of the most used risk markers in the various scales of severe hepatic fibrosis, is more accurate if the determination of rs3778216 of the HDAC2 gene is included in the model. The detection of AST can be performed by any method known to the person skilled in the art for this purpose, such as by validated methods (Bergmeyer, HU et al. J Clin Chem Clin Biochem 1986, 24: 497-510) or by In vitro blood analysis using the Cobas® kit (Roche) in accordance with the International Federation of Clinical Chemistry (IFCC). Briefly, the technique consists of adding to the sample a TRIS pH7.8 buffer, an indicator enzyme (malate dehydrogenase or MDH), a coenzyme (LDH) and alpha-ketoglutarate. The AST enzyme catalyzes this equilibrium reaction:

a-ketoglutarate + L-aspartate Q L-glutamate + oxaloacetate

The increase in oxaloacetate is determined in the indicator reaction that is catalyzed by malatodehydrogenase:

oxaloacetate + NADH + H + Q L-malate + NAD +

NADH oxidizes to NAD +. The rate of decrease of NADH is measured photometrically and is directly proportional to the rate of formation of oxaloacetate and thus, to the activity of AST. AST levels greater than 40 U / l are associated with a worse evolution of fibrosis.

Therefore, a preferred embodiment of the second method of the invention refers to an in vitro method for the diagnosis of severe hepatic fibrosis where in step (a) the AST levels are also detected in the isolated biological sample, and the association A diagnosis of step (b) is obtained if the AST values are greater than 40 U / l.

Any of the methods described in the present invention may comprise, in addition to the determination of AST, and polymorphisms, the determination of other clinical variables, such as, but not limited to, age, sex, determination of other transaminases such as for example, alanine aminotransferase (ALT, or also called pyruvic glutamic transaminase, GPT), platelet count, albumin level, or viral load (preferably viral load of hepatitis C virus) in the case of hepatopathies caused by viruses. Preferably the other clinical variable used is age, in which case, a subject's age over 40 years would be associated with a worse diagnosis and prognosis of the patient.

Therefore, another preferred embodiment of the second method of the invention relates to an in vitro method for the prognosis and / or diagnosis of severe liver fibrosis where in step (a) the patient's age is also analyzed, and the association with a Prognosis and / or diagnosis of F> 2 from step (b) is obtained if the patient's age is over 40 years.

On the other hand, due to what has been previously described, a preferred embodiment of the second aspect of the invention refers to a method where in step (a) at least one genetic polymorphism of the STAT1 gene selected from the list comprising: rs2030171 is also detected. , rs13029247, rs10173099, rs10199181 and rs6745710, and / or at least one genetic polymorphism of the ISGF3G gene or of the TM9SF1 gene selected from the list comprising: rs12436555, rs12432194 and rs10583. In a more preferred embodiment, the STAT1 gene polymorphism is rs2030171. In another more preferred embodiment, the genetic polymorphism of the ISGF3G gene is rs12436555.

Another preferred embodiment of the second aspect of the invention relates to the method where the prognosis and / or diagnosis of severe hepatic fibrosis in step (b) is obtained when in addition the subject is a carrier of the genotype G / G of the genetic polymorphism rs2030171, of the genotype T / T of the genetic polymorphism rs13029247, of the C / C genotype of the genetic polymorphism rs10173099, of the T / T genotype of the genetic polymorphism rs10199181, or of the C / C genotype of the genetic polymorphism rs6745710 of the STAT1 gene, and / or the prognosis and / or Diagnosis of severe hepatic fibrosis in step (b) is obtained when the subject is also a carrier of the A allele of the genetic polymorphism rs12436555 or of the T allele of the genetic polymorphism rs12432194 of the ISGF3G gene, or of the A allele of the genetic polymorphism rs10583 of the TM9SF1 gene. In a more preferred embodiment, the genotype of the STAT1 gene that is associated with a prognosis and / or diagnosis of severe liver fibrosis in step (b) is the G / G genotype of the rs2030171 genetic polymorphism. In another more preferred embodiment, the genotype of the ISGF3G gene that is associated with a prognosis and / or diagnosis of severe liver fibrosis in step (b) is the A allele of the rs12436555 genetic polymorphism.

A preferred embodiment of the first and second aspects of the invention relates to the method where the biological sample is selected from the list comprising tissue, blood, plasma, serum, oral mucosa, lymph and / or any other biological sample that allows DNA to be extracted. . Preferably the biological sample is oral blood or mucosa, more preferably the blood is peripheral blood. Another preferred embodiment relates to the method where the biological sample is fresh, frozen, fixed or fixed and embedded in paraffin.

Another preferred embodiment of the first and second aspects of the invention relates to the method where the detection of polymorphism is performed by hybridization with labeled probes, preferably with fluorescence.

Another preferred embodiment of the first and second aspects of the invention relates to the method where the subject is a human.

A third aspect of the invention relates to the in vitro use of at least one genetic polymorphism HDAC2 selected from the list comprising gene: rs3778216, rs13209064, rs13213007, rs13201727, rs13216873, rs13194921, rs13204434, rs12665655, rs13204445, rs12660414, rs2025191, rs1322453 and rs13212298 as a prognostic marker and / or diagnosis of severe hepatic fibrosis in a subject suffering from chronic hepatitis C. In a preferred embodiment of this aspect of the invention, the genetic polymorphism is the rs3778216 polymorphism.

In the present invention, "prognostic marker" is understood as that polymorphism that serves to determine the evolution or not of hepatic fibrosis to severe hepatic fibrosis.

Another preferred embodiment relates to the in vitro use of at least one genetic polymorphism of the HDAC2 gene selected from the list comprising: rs3778216, rs13209064, rs13213007, rs13201727, rs13216873, rs13194921, rs13204434, rs12665655, rs13204445, rs13204445, rs13204445, rs13204445, rs13204445, rs13204445, rs13204445 as a prognostic marker and / or diagnosis of severe hepatic fibrosis in a subject suffering from chronic hepatitis C where it is also used in combination with the concentration of AST.

Another preferred embodiment of the third aspect of the invention relates to the in vitro use of at least one genetic polymorphism of the HDAC2 gene selected from the list comprising: rs3778216, rs13209064, rs13213007, rs13201727, rs13216873, rs13194921, rs13204434, rs12665204, rs12665654, rs1266565445, rs12665654, rs12665654, rs12665654, rs12665654 , rs2025191, rs1322453 and rs13212298 as a prognostic marker and / or diagnosis of severe hepatic fibrosis in a subject suffering from chronic hepatitis C where it is also used in combination with the concentration of AST, age, at least one genetic polymorphism of the selected STAT1 gene from the list comprising: rs2030171, rs13029247, rs10173099, rs10199181, and rs6745710, and / or at least one genetic polymorphism of the ISGF3G gene or of the TM9SF1 gene selected from the list comprising: rs12436555, rs12432193 and rs12432193. In a more preferred embodiment the polymorphism of the STAT1 gene is polymorphisms 2030171. In another more preferred embodiment the polymorphism of the ISGF3G gene is rs12436555.

In another preferred embodiment of the third aspect of the invention, the subject is a human.

A fourth aspect of the invention relates to the use of a kit comprising probes that detect at least one genetic polymorphism of the HDAC2 gene selected from the list comprising: rs3778216, rs13209064, rs13213007, rs13201727, rs13216873, rs13194921, rs13204434, rs12205345, rs12205345, rs12204434, rs12205345, rs12204444 , rs12660414, rs2025191, rs1322453 and rs13212298 to obtain useful data for the prognosis of severe hepatic fibrosis in a subject suffering from chronic hepatitis C. In a preferred embodiment of this aspect of the invention, the polymorphism is the rs3778216 polymorphism. In a more preferred embodiment of this aspect of the invention the probes that detect the rs3778216 genetic polymorphism are SEQ ID NO: 4 (SN1 O1 rs3778216-table 2), SEQ ID NO: 5 (SNP O2 rs3778216-table 2) and / or SEQ ID NO: 6 (O3 of SNP rs3778216-table 2).

In the present invention the term "probes" refers to oligonucleotides of a size between 20 to 50 nucleotides that hybridize with the DNA sequence that flanks and / or contains the polymorphism of interest. These probes are usually marked with some fluorophore that allows the polymorphism to be identified.

The sequence detected in the examples of the present invention for the detection of the rs3778216 genetic polymorphism is (SEQ ID NO: 1), where [T / C] is the rs3778216 polymorphism recognized by probes that hybridize for base complementarity (A / G) . Specifically for this work, GoldenGate Genotyping Assay (Illumina) probes have been used in which three oligonucleotides are used for the detection of a polymorphism of interest, two of them (O1 and O2) are specific for each of the possible alleles of the SNP (in this case step A or G) and hybridize in the 5 'direction and the third oligonucleotide (O3) serves as a locus specificity control and hybridizes several downstream bases of the polymorphism (3' sense). After the hybridization, a PCR (polymerase chain reaction) is carried out which allows the desired sequence to be elongated using primers labeled with the cyclophoreophores Cy3 and Cy5. The PCR product is subjected to subsequent hybridization in a support matrix (plate)

or array that allows the determination of the genotype of the subject (Table 2).

The probes indicated above are those used in the examples, but there are other methods known to a person skilled in the art to detect polymorphisms. Thus, for example, but without limiting another alternative is to use primers and fluorescent probes for hybridization in a real-time thermal cycler (for example, Roche's LightCycler®). These probes are oligonucleotides that hybridize in the DNA sample, one labeled at its 3 'terminal (donor fluorophore) and the other labeled at its 5' end (acceptor fluorophore) with the 3'-hydroxyl end blocked with a phosphate to avoid your extension. The probes are located in the same chain without overlapping with the primers, covering the sequence in which the mutation is found. The detection of the mutation is produced by the phenomenon of fluorescence resonance energy transfer (FRET), which is produced by the excitation of fluorescein whose emission wavelength overlaps with that of acceptor fluorophore excitation. The dissociation curves are based on the application of an increasing temperature gradient after PCR to monitor the dissociation kinetics of the amplified fragments that have hybridized with the probes. The hybrid formed between probe and wild-type DNA will have a greater stability than that formed between the probe and the mutated DNA, since in this case the complementarity is not absolute. The greater stability of the junction between the probe and the wild DNA will be reflected in a higher dissociation or melting temperature (Tm). Differences in the temperature of dissociation of hybrids will allow us to perfectly discriminate between wild-type and mutated-type DNA.

You can also use probes that use Taqman technology. This assay uses the 5 ′ nuclease activity of the polymerase together with two probes (TaqMan) to discriminate between the two alleles of a SNP. Each of the TaqMan probes are complementary to the two alleles of an SNP and each has a "quencher" at its 3 ’end and a fluorescent molecule at the 5’ end. During the PCR ring-extension phase, the probe hybridizes to the amplicons and the DNA polymerase breaks it, resulting in an increase in fluorescence because the quencher is no longer in the vicinity. Fluorescence is detected using the RealTime ABI PRISM® 7900 Sequence Detector.

There are a multitude of systems that allow the identification of SNPs through the use of hybridization probes coupled to a fluorophore that by means of real-time PCR allow the identification of alleles of a SNP in a patient's sample, such as, but not limited to, LightSNP, Taqman, SnapShot or MLPA.

A preferred embodiment of the fourth aspect of the invention relates to the use of a kit comprising the elements necessary to determine the concentration of AST.

In the present description, "necessary elements" are understood to determine the concentration of AST all those reagents necessary to carry out any of the methods of the invention described hereinbefore (buffers, enzymes, coenzymes and substrates). On the other hand, the kits can include all the necessary supports and containers for their start-up and optimization (plastic tubes, plates, reagents, etc.). The kits may also contain other molecules, genes, proteins or probes of interest, which serve as positive and negative controls. Preferably, the kits further comprise the instructions for carrying out the methods of the invention.

An even more preferred embodiment of the fourth aspect of the invention relates to the use of a kit that further comprises probes that detect at least one genetic polymorphism of the STAT1 gene selected from the list comprising: rs2030171, rs13029247, rs10173099, rs10199181, and rs6745710, and / or at least one genetic polymorphism of the ISGF3G gene or of the TM9SF1 gene selected from the list comprising: rs12436555, rs12432194 and rs10583. In an even more preferred embodiment of this aspect of the invention the genetic polymorphism of the STAT1 gene is rs2030171 and / or the genetic polymorphism of the ISGF3G gene is rs12436555. In a particular embodiment of this aspect of the invention, the probes that detect the rs2030171 polymorphism are SEQ ID NO: 7 (O1 of SNP rs2030171-table 2), SEQ ID NO: 8 (O2 of SNP rs2030171-table 2) and / or SEQ ID NO: 9 (O3 of SNP rs2030171-table 2), and the probes that detect the polymorphism rs12436555 are SEQ ID NO: 10 (O1 of SNP rs12436555-table 2), SEQ ID NO: 11 (O2 of SNP rs12436555 -Table 2) and / or SEQ ID NO: 12 (O3 of SNP rs12436555-table 2).

The probes and oligonucleotides used (SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9) are shown in Table 2, and allowed us to determine in the sequence (SEQ ID NO: 2) the SNP polymorphism rs2030171 [ A / G] of the STAT1 gene.

The probes and oligonucleotides used (SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12) are shown in Table 2, and allowed us to determine in the sequence SEQ ID NO: 3 and the polymorphism [A / G ] rs12436555 of the ISGF3G gene.

In general, the kit of the invention comprises all those reagents necessary to carry out the method of the invention as described above. The kit can also include, without any limitation, buffers, enzymes, such as, but not limited to, polymerases, cofactors to obtain optimal activity of these, dNTPs, a magnesium salt, probes, fluorochromes, agents to prevent contamination , etc. The kit may also contain other molecules, genes, proteins or probes of interest, which serve as positive and negative controls; as well as another pair (s) of primers for the amplification of one or several control nucleotide sequences. On the other hand, the kit can include all the supports and containers necessary for commissioning and optimization. Preferably, the kit further comprises instructions for carrying out the method of the invention.

In another preferred embodiment of the fourth aspect of the invention, the subject is a human.

Throughout the description and the claims the word "comprises" and its variants are not intended to exclude other technical characteristics, additives, components or steps. For those skilled in the art, other objects, advantages and features of the invention will be derived partly from the description and partly from the practice of the invention. The following examples and figures are provided by way of illustration, and are not intended to be limiting of the present invention.

DESCRIPTION OF THE FIGURES

FIG. 1. The rs3778216 polymorphism of HDAC2 is associated with the stage of fibrosis. The results of 176 patients with chronic hepatitis C with mild or moderate fibrosis (F <= 2, n = 132) or severe fibrosis (F> 2, n = 44) are shown. A, carriers of at least one A allele (adenosine, n = 85); G / G, carriers of the two G alleles (guanine, n = 91).

FIG. 2. AUROC of prognostic methods of liver fibrosis. The area under the curve (AUC of English “area under the curve”) by agreement is between 0.5 and 1. The reference line represents the minimum value (0.5). The results of the specificity and sensitivity of the methods that include the patient's age (age), the determination of the AST concentration, the detection of the genetic polymorphism rs3778216 of the HDAC2 gene (HDAC2 rs3778216) are shown. The predictive power data of each significantly associated variable are shown: A, AUCROC of each of the variables significantly associated with fibrosis; B, AUCROC of the combination of variables significantly associated with fibrosis; and C, AUCROC of the combination of variables significantly associated with fibrosis (HDAC2, age and AST) plus the polymorphisms rs2030171 and rs12436555.

EXAMPLES OF REALIZATION

The following specific examples provided in this patent document serve to illustrate the nature of the present invention. These examples are included for illustrative purposes only and should not be construed as limitations on the invention claimed herein. Therefore, the examples described below illustrate the invention without limiting its scope of application.

The invention will now be illustrated by tests carried out by the inventors, which demonstrates the usefulness of the method of the invention.

Example 1: Prognostic methods of severe liver fibrosis

Patients: The degree of liver fibrosis was determined by the pathological study of liver tissue (from biopsy) and the degree of fibrosis was classified using the METAVIR scale. The biopsy was extracted using a needle according to the Menghini technique (HEPAFIX®). In the present invention, the 185 patients studied were divided into two stages: moderate fibrosis (F2, n = 138) and severe fibrosis (F> 2, n = 47).

Materials and methods: Hepatitis C virus infection was confirmed by detecting viral RNA in patients' serum, determining viral load and viral genotype using the COBAS AMPLICOR® assay kit (Roche Molecular Systems, Branchburg, NJ) . The rest of the clinical parameters analyzed (ALT, AST and GGT) were determined in the routine laboratory of our center as part of the usual clinical practice of the treatment and follow-up of these patients by validated methods (Bergmeyer, HU et al. J Clin Chem Clin Biochem 1986, 24: 497-510) for in vitro diagnosis using the Cobas® kit (Roche) in accordance with the International Federation of Clinical Chemistry (IFCC). The detection of these parameters was made from serum or plasma extracted from a peripheral blood sample.

A DNA sample was isolated, from a peripheral blood sample collected in a 10ml tube anticoagulated with EDTA, using the Magna Pure DNA Isolation kit® extraction kit (Roche Diagnosis, Mannheim, Germany) according to the instructions of the maker. The DNA sample was stored at -80 ° C until use.

Genotyping of the samples was performed using the Illumina GoldenGate® Genotyping Assay kit (Illumina Inc., San Diego, California, USA). In the present invention, a DNA chip design was performed by selecting polymorphisms located in the 11 histone deacetylase genes. The sequences of the genes that code for these enzymes have the following accession number (NCBI Reference Sequence): HDAC1 (NT_032977.9), HDAC2 (NT_025741.15), HDAC3 (NT_029289.11), HDAC4 (NT_022173.11), HDAC5 (NT_010783.15), HDAC6 (NT_079573.4), HDAC7 (NT_029419.12), HDAC8 (NT_011669.17), HDAC9 (NT_007819.17), HDAC10 (NT_011526.7) and HDAC11 (NT_022517.18). The SNP rs2030171 of the STAT1 gene (NT_005403.17) and rs12436555 of the ISGF3G gene (NT_026437.12) were also determined in the DNA chip. The polymorphisms selected for this study were mostly taqSNPs (SNPs used as markers of a haplotype that include several associated SNPs in linkage disequilibrium (LD), (r2 0.8) that allow us to analyze several SNPs determining a single SNP, and that also presented a minority allele frequency greater than 5% in the

5 Caucasian population. Table 1 shows all SNPs that are in linkage imbalance with a r2 0.8 for SNPs rs3778216, rs2030171 and rs12436555, described in the Hapmap project for the different populations (of Bakker, PI et al. Nature Genetics 2005, 37 (11): 1217-23). Table 2 shows the sequences of the probes and primers used in the detection of the SNPs of interest for this invention, as well as the sequence that includes the polymorphisms studied.

Results: After the study of 27 genetic polymorphisms located in 11 histone deacetylase genes (HDACs) we have developed a method based on the predictive value of the genetic variant of the HDAC2 gene (rs3778216), which is significantly associated with stages of fibrosis severe liver disease (F> 2) in 176 HCC patients (Table 3). They have been compared with other polymorphisms of the same gene and other genes of the

15 HDACs, and the results indicate that only the G / G genotype of this polymorphism is independently and significantly associated with the probability of presenting severe stages of fibrosis in these patients (F> 2). The method is of high predictive value when combining the detection of this polymorphism with clinical variables (AST and age). Table 4 shows the clinical variables analyzed in this invention and their statistical association with stages of severe fibrosis.

20 The rs3778216 polymorphism of HDAC2 shows a significant association with the stage of fibrosis, both in the univariate analysis (Table 3 and Figure 1) and when the analysis is adjusted for other clinical variables (multivariate analysis, Table 3). Logistic regression analysis showed that the G / G genotype of rs3778216 (p 0.05) was associated with stages of severe fibrosis (F> 2). The multivariate logistic regression analysis included other

25 clinical variables of the patient (age and AST) associated in the scientific literature (Martínez, S.M. et al. Aliment Pharmacol Ther 2001, 33: 138-148) with the risk of suffering from severe fibrosis stages in HCC. To determine the predictive power of each independent variable (Figure 2A) and its additive influence (Figure 2B) we perform the following logistic regression models obtaining their corresponding AUCROC, specificity and sensitivity (Table 5). As can be seen, the model that includes the three variables (age, AST and rs3778216 of the gene

30 HDAC2) independently associated with fibrosis (F> 2), is the one that shows a higher predictive value (AUC = 0.795) with high sensitivity and specificity (90% and 62%, respectively).

In addition, it should be noted that the analysis of the previous model, together with the polymorphisms rs2030171 of the STAT1 gene and rs12436555 of the ISGF3G gene (Table 5), allows us to identify patients with severe fibrosis (F> 2) in a way

35 highly predictive (AUC = 0.84, sensitivity 89% and specificity 73%), as can be seen in Table 6.

Table 1. List of SNPs in linkage imbalance (r2> 0.8) with the polymorphisms rs3778216, rs2030171 and rs12436555 in the reference Caucasian population (CEU) of the Hapmap project.

Sequence (NCBI Reference Sequence)

Position on chromosome 6 Gen SNP (NCBI Reference Sequence) Gen position Alleles (strand +) Alleles (strand -) Surrounding sequence

NT_025741.15

 114280563 HDAC2 rs3778216 intron C / T G / A SEQ ID NO: 1

NT_025741.15

 114242899 HDAC2 rs13212298 3’upstream T / C A / G SEQ ID NO: 13

NT_025741.15

 114248499 HDAC2 rs12665655 3’upstream G / T AC SEQ ID NO: 14

NT_025741.15

 114265587 HDAC2 rs13204445 intron T / C A / G SEQ ID NO: 15

NT_025741.15

 114274848 HDAC2 rs13204434 intron A / G T / C SEQ ID NO: 16

NT_025741.15

 114276024 HDAC2 rs13194921 intron T / C A / G SEQ ID NO: 17

NT_025741.15

 114276069 HDAC2 rs13209064 intron A / C T / G SEQ ID NO: 18

NT_025741.15

 114282481 HDAC2 rs13213007 intron G / A C / T SEQ ID NO: 19

NT_025741.15

 114283388 HDAC2 rs13216873 intron A / T T / A SEQ ID NO: 20

NT_025741.15

 114284589 HDAC2 rs12660414 intron C / G G / C SEQ ID NO: 21

NT_025741.15

 114288218 HDAC2 rs2025191 intron A / G T / C SEQ ID NO: 22

NT_025741.15

 114289913 HDAC2 rs13201727 intron T / C A / G SEQ ID NO: 23

NT_025741.15

 114291582 HDAC2 rs1322453 intron G / C C / G SEQ ID NO: 24

Sequence (NCBI Reference Sequence)

Position on chromosome 2 Gen SNP (NCBI Reference Sequence) Gen position Alleles (strand +) Alleles (strand -) Surrounding sequence

NT_005403.17

 191869163 STAT1 rs2030171 intron G / A C / T SEQ ID NO: 2

NT_005403.17

 191866658 STAT1 rs13029247 intron T / C A / G SEQ ID NO: 25

NT_005403.17

 191867332 STAT1 rs10173099 intron C / T G / A SEQ ID NO: 26

NT_005403.17

 191873553 STAT1 rs10199181 intron T / A A / T SEQ ID NO: 27

NT_005403.17

 191878654 STAT1 rs6745710 intron C / G G / C SEQ ID NO: 28

Sequence (NCBI Reference Sequence)

Position on chromosome 14 Gen SNP (NCBI Reference Sequence) Gen position Alleles (strand +) Alleles (strand -) Surrounding sequence

NT_026437.12

 24634825 ISGF3G rs12436555 intron A / G T / C SEQ ID NO: 3

NT_026437.12

 24636025 ISGF3G rs12432194 3’upstream T / C A / G SEQ ID NO: 29

NT_026437.12

 24662177 TM9SF1 rs10583 Arg215His A / G T / C SEQ ID NO: 30

Table 2. Sequence of the oligonucleotides used in the DNA chip (Golden Gate Assay, Illumina) for the detection of polymorphisms rs3778216 (HDAC2 gene), rs2030171 (STAT1 gene) and rs12436555 (ISGF3G gene).

SNP Sequence O1 O2 O3

rs3778216

TTTAAATATTTCTTTTCTCC CCAAATAGCTAATTGTCGT GTCTGTATTTGTTTATACAT A [T / C] CCTCATCTTTATCTA CAAAAACATTAAGGCAGCT GTTGCACTTGTGTTATCTG TACTATG (SEQ ID NO: 1)

ACTTCGTCAGT AACGGACCCTT AATGTTTTTGT AGATAAAGATG AGGA (SEQ ID NO: 4)

GAGTCGAGGT CATATCGTCCT TAATGTTTTTGT AGATAAAGATG AGGG (SEQ ID NO: 5)

ATGTATAAACA AATACAGACAC GACATGGTCAC CACGCTTTGCA CGAGTCTGCCT ATAGTGAGTC (SEQ ID NO: 6)

rs2030171

rs12436555

GTTACTCCAGACCCCAGAG CAAAGAAAAGTCTTCTGCT CAGGAAGGGGGTCCTTTC CAAT [A / G] GAGTGAGCAGT TGTCCAAGTAAGGGAATAG GCACTCCATGGGTGTGAGA AGTTCCAGCCA (SEQ ID NO: 2)

GGCACATCTGAGTTAGCAG CCAGGGCTGCTACCTGGG AGGACTCTAAACTCTCCCA GCAGAGAGCTTGTC [A / G] G GCTGTGCTGTGATCTGCTA CTTCTAAGCACTTATATGA GGCAGGGGCACCCTTTCC TATTTGCACATGG (SEQ ID NO: 3)

ACTTCGTCAGT AACGGACGAG GAAGGGGGTC CTTTCCAATA (SEQ ID NO: 7)

ACTTCGTCAGT AACGGACACTC TCCCAGCAGA GAGCTTGTCA (SEQ ID NO: 10) GAGTCGAGGT CATATCGTGAG GAAGGGGGTC CTTTCCAATG (SEQ ID NO: 8)

GAGTCGAGGT CATATCGTACT CTCCCAGCAGA GAGCTTGTCG (SEQ ID NO: 11)

AGTGAGCAGTT GTCCAAGTAAG TGCGTTGCGAC TACCGATACGT GTCTGCCTATA GTGAGTC (SEQ ID NO: 9)

GCTGTGCTGTG ATCTGCTACTC GTAAGGTGGC GTGACGACTAA GTCTGCCTATA GTGAGTC (SEQ ID NO: 12)

In the section sequence the previous and subsequent sequence that flank the polymorphisms are collected, the nucleotide in which the polymorphism occurs is highlighted in bold. O1 and O2 oligonucleotides are complementary to the nucleotide that causes the polymorphism and O3 is a locus specific oligonucleotide.

Table 3. Logistic regression analysis for HDAC.

GENO

GEN

SNP KIND FS2 F> 2 OR (95% CI) p OR (95% CI) p

HDAC1

rs1741981 A / C 62 (45.3%) 19 (42.2%) one

1.04 (0.51-

A / G

66 (48.2%) 21 (46.7%) 2.11)  0.63 ns ns

1.81 (0.54-

G / G

9 (6.6%) 5 (11.1%) 6.07)

HDAC2

rs9481408 G / G 76 (55.5%) 19 (42.2%) one

1.96 (0.96-

A / G

47 (34.3%) 23 (51.1%) 3.97)  0.13 ns ns

0.86 (0.22-

A / C

14 (10.2%) 3 (6.7%) 3.29)

rs2243356

T / T 45 (33.8%) 12 (28.6%) one

1.04 (0.46-

A / T

65 (48.9%) 18 (42.9%) 2.37)  0.36 ns ns

1.96 (0.76-

A / C

23 (17.3%) 12 (28.6%) 5.03)

rs13203445

A / C 47 (34.8%) 13 (29.6%) one

1.06 (0.48-

A / G

65 (48.1%) 19 (43.2%) 2.35)  0.35 ns ns

1.89 (0.74-

G / G

23 (17%) 12 (27.3%) 4.78)

A / G

 rs3778216

A / C 70 (53%) 15 (34.1%) one one

G / G

62 (47%) 29 (65.9%) 2.2 (1,074.35) 0.028 2.23 (1,014.89)  0.045

HDAC3

rs1421896 DC 45 (37.8%) 14 (35%) one

1.39 (0.64-

A / C

53 (44.5%) 23 (57.5%) 3.03)  0.18 ns ns

0.46 (0.12-

A / C

21 (17.6%) 3 (7.5%) 1.77)

rs976552

A / C 78 (60.9%) 25 (54.4%) one

1.45 (0.72-

A / C

43 (33.6%) 20 (43.5%) 2.91)  0.36 ns ns

0.45 (0.05-

DC

7 (5.5%) 1 (2.2%) 3.80)

rs2530223

G / G 50 (36.8%) 16 (35.6%) one

1.31 (0.63-

A / G

62 (45.6%) 26 (57.8%) 2.71)  0.12 ns ns

0.39 (0.10-

A / C

24 (17.6%) 3 (6.7%) 1.47)

HDAC4

rs4852010 G / G 55 (40.4%) 21 (47.7%) one

0.77 (0.37-

A / G

65 (47.8%) 19 (43.2%) 1.57)  0.68 ns ns

0.65 (0.20-

A / C

16 (11.8%) 4 (9.1%) 2.19)

rs895808

A / C 50 (37.9%) 24 (52.2%) one

0.58 (0.28-

A / C

57 (43.2%) 16 (34.8%) 1.22)  0.23 ns ns

0.50 (0.18-

DC

25 (18.9%) 6 (13%) 1.38)

HDAC5

rs850857 G / G 38 (28.6%) 14 (30.4%) one

A / G

63 (47.4%) 18 (39.1%) 0.78 (0.35 0.58 ns ns

fifteen

1.74)

A / C

32 (24.1%) 14 (30.4%) 1.19 (0.492.86)

rs368328

A / A A / G G / G 55 (45.8%) 51 (42.5%) 14 (11.7%) 18 (47.4%) 17 (44.7%) 3 (7.9%) 1 1.02 (0.472.19) 0.65 (0.172.54) 0.8 ns ns

HDAC6

rs2075840W A / C 2 (4.1%) 0 (%) NA

A / G G / G

16 (32.6%) 31 (63.3%) 3 (17.6%) 14 (82.4%) 1 0.48 (0,112.06) 0.326 ns ns

rs2075840M

A / A G / G 13 (14.9%) 74 (85.1%) 3 (11.5%) 23 (88.5%) 1 0.56 (0.122.73) 0.47 ns ns

HDAC7

rs2408874 G / G A / G A / A 64 (53.3%) 46 (38.3%) 10 (8.3%) 21 (50%) 17 (40.5%) 4 (9.5%) 1 1.13 (0.542.37) 1.22 (0.354.30) 0.9 ns ns

rs11831940

G / G A / G A / A 63 (46.7%) 59 (43.7%) 13 (9.6%) 17 (36.2%) 27 (57.5%) 3 (6.4%) 1 1.70 (0.843.43) 0.86 (0.223.35) 0.26 ns ns

rs13632

G / G A / G A / A 70 (52.6%) 52 (39.1%) 11 (8.3%) 23 (50%) 18 (39.1%) 5 (10.9%) 1 1.05 (0.522.15) 1.38 (0.434.40) 0.86 ns ns

HDAC8

rs1475091W A / A A / G 24 (49.0%) 21 (42.8%) 14 (73.7%) 5 (26.3%) 1 0.67 (0.321.41) 0.28 ns ns

G / G

4 (8.2%) 0 (0%) NA

rs1475091M

A / A G / G 64 (74.4%) 22 (25.6%) 19 (73.1%) 6 (26.9%) 1 1.11 (0.373.25) 0.87 ns ns

rs5912136W

C / G G / G 20 (42.5%) 27 (57.5%) 6 (33.3%) 12 (66.6%) 1 0.48 (0,112.06) 0.92 ns ns

rs5912136M

G / G 88 (100%) 26 (100%) NA NA NA NA

rs3012653W

A / A A / C C / C 12 (24.5%) 22 (44.9%) 15 (30.6%) 7 (36.8%) 7 (36.8%) 5 (26.4%) 1 0.86 (0.223.35) 0.74 (0.143.76) 0.71 ns ns

rs3012653M

A / A C / C 50 (56.8%) 38 (43.2%) 12 (46.1%) 14 (53.9%) 1 0.60 (0.231.56) 0.29 ns ns

HDAC9

rs801524 G / G A / G A / A 91 (66.9%) 39 (28.7%) 6 (4.4%) 28 (59.6%) 16 (34%) 3 (6.4%) 1 1.33 (0.652.74) 1.62 (0.386.92) 0.64 ns ns

HDAC10

rs4838866 G / G A / G A / A 99 (72.8%) 34 (25%) 3 (2.2%) 33 (75%) 10 (22.7%) 1 (2.3%) 1 0.88 (0.391.98) 1.00 (0.109.95) 0.95 ns ns

rs1555048

G / G A / G 70 (52.2%) 56 (41.8%) 19 (43.2%) 25 (56.8%) 1 1.64 (0.823.29)  0.09 ns ns

A / C

8 (6%) 0 (0%) NA

rs34402301

G / G A / G 114 (86.4%) 17 (12.9%) 37 (84.1%) 7 (15.9%) 1 1.27 (0.493.30)  0.67 ns ns

A / C

1 (0.8%) 0 (0%) NA

rs2341111

G / G G / C 69 (53.5%) 52 (40.3%) 18 (41.9%) 25 (58.1%) 1 1.84 (0.913.73)  0.055 ns ns

DC

8 (6.2%) 0 (0%) NA

HDAC11

rs2655217 G / G A / G A / A 46 (34.9%) 62 (47%) 24 (18.2%) 14 (34.1%) 17 (41.5%) 10 (24.4%) 1 0.90 (0.402.01) 1.37 (0.533.54) 0.67 ns ns

rs1116048

G / G A / G A / A 85 (62.5%) 45 (33.1%) 6 (4.4%) 31 (70.5%) 11 (25%) 2 (4.5%) 1 0.67 (0.311.46) 0.91 (0.184.77) 0.59 ns ns

rs2655218

G / G A / G A / A 43 (33.3%) 61 (47.3%) 25 (19.4%) 13 (29.6%) 20 (45.5%) 11 (25%) 1 1.08 (0.492.41) 1.46 (0.573.73) 0.72 ns ns

Table 4. Logistic regression analysis for clinical factors.

Clinical factors

FS2 F> 2 OR (95% CI) p OR (95% CI) p

GV1

1 No 1 103 (75.18%) 34 (24.82%) 40 (85.11%) 7 (14.89%) 1 0.53 (0.22-1.29) 0.16 ns ns

Age (years)

S40> 40 56 (40.88%) 81 (59.12%) 10 (21.28%) 37 (78.72%) 1 2.50 (1.17-5.56) 0.018 1 2.64 (1,126.20) 0.026

Basal viral load (IU / mL)

S600000> 600000 36 (26.28%) 101 (73.72%) 11 (23.40%) 36 (76.60%) 1 1.17 (0.54-2.53) 0.7 ns ns

Baseline ALT (U / L)

S40> 40 30 (21.74%) 108 (78.26%) 2 (4.25%) 45 (95.75%) 1 6.25 (1.43-27.26) 0.01 ns ns

Baseline AST (U / L)

S40 70 (50.72%) 4 (8.51%) one one

> 40

68 43 7.67 (3.43-17.17) 7.210-7 14.12 (4.09 2.710-5

(49.28%) (91.49%) 48.74)

52 7

S30 1

(38.24%) (14.89%) Baseline GGT (U / L) 84 40

> 30 3.54 (1.48-8.48) 0.005 ns ns

(61.76%) (85.11%)

Table 5. Areas under the curve of the different logistic regression models. Variables AUC 95% CI Sensitivity (%) Specificity (%)

AGE 0.600 0.507-0.693 77 43

AST 0.718 0.640-0.796 93 50

HDAC2 0.593 0.497-0.689 66 53

STAT1 0.643 0.542-0.745 67 62

ISGF3G 0.568 0.459-0.677 36 77

AGE + AST 0.771 0.695-0.848 75 72

HDAC2 + AGE 0.645 0.556-0.734 77 43

HDAC2 + AST 0.763 0.689-0.837 93 50

HDAC2 + STAT1 0.705 0.613-0.797 68 63

HDAC2 + ISGF3G 0.661 0.561-0.760 74 51

STAT1 + ISGF3G 0.699 0.605-0.793 86 48

HDAC2 + AGE + AST 0.795 0.722-0.868 90 62

HDAC2 + STAT1 + ISGF3G 0.727 0.639-0.814 80 54

HDAC2 + STAT1 + ISGF3G

0.759 0.680-0.838 94 46

+ AGE

STAT1 + ISGF3G + AST +

0.822 0.752-0.896 92 61

AGE

HDAC2 + STAT1 + AST +

0.820 0.746-0.894 78 76

AGE

HDAC2 + ISGF3G + AST +

0.823 0.753-0.892 83 70

AGE

HDAC2 + STAT1 + ISGF3G

0.844 0.776-0.912 89 73

+ AST + AGE

AUC, area under the curve (“Area Under the Curve”) calculated by the ROC analysis of the predicted probabilities of each of the logistic regression models.

Table 6. Factors significantly associated with high stages of fibrosis.

Variables

OR 95.0% CI p

rs2030171 genotype G / G

3.7 1.5-9.4 0.005

rs3778216 genotype G / G

2.6 1.1-6.8 0.051

rs12436555 allele A

3.1 1.1-8.3 0.028

AST> 40 U / L

11.5 3.1-42.4 2.4x10-4

Age> 40 years

3.0 1.1-8.1 0.032

The association with F> 2 is expressed as Odd ratio (OR), 95% confidence interval (95% CI) and p-value calculated by logistic regression.

Claims (20)

one.

In vitro method of obtaining useful data for the prognosis and / or diagnosis of severe hepatic fibrosis characterized by the detection of at least one genetic polymorphism of the HDAC2 gene selected from the list comprising: rs3778216, rs13209064, rs13213007, rs13201727, rs13216873, rs13194921 , rs13204434, rs12665655, rs13204445, rs12660414, rs2025191, rs1322453 and rs13212298 in the isolated biological sample of a subject suffering from chronic hepatitis C.

2.

Method according to claim 1 further comprising associating the G / G genotype of the rs3778216 genetic polymorphism, the A / A genotype of the rs13212298 genetic polymorphism, the C / C genotype of the rs12665655 genetic polymorphism, the A / A genotype of the rs13204445 genetic polymorphism, T / T genotype rs13204434 genetic polymorphism, A / A genotype of rs13194921 genetic polymorphism, T / T genotype of rs13209064 genetic polymorphism, C / C genotype of rs13213007 genetic polymorphism, T / T genotype of rs13132 genetic polymorphism G / G genotype of the rs12660414 genetic polymorphism, the T / T genotype of the rs2025191 genetic polymorphism, the A / A genotype of the rs13201727 genetic polymorphism, or the C / C genotype of the rs1322453 genetic polymorphism of the HDAC2 gene to a prognosis and / or diagnosis of severe liver fibrosis

3.

Method according to any one of claims 1 or 2 wherein the genetic polymorphism of the HDAC2 gene is rs3778216.

Four.

Method according to any one of claims 1 to 3 wherein the levels of aspartate aminotransferase (AST) are also detected.

5.

Method according to claim 4 wherein the association with a diagnosis of severe hepatic fibrosis is obtained if the AST values are greater than 40 U / L.

6.

Method according to any of claims 2 to 5 wherein the association with a prognosis and / or diagnosis of severe hepatic fibrosis is obtained if the patient's age is over 40 years.

7.

Method according to any one of claims 1 to 6 wherein at least one genetic polymorphism of the STAT1 gene selected from the list comprising: rs2030171, rs13029247, rs10173099, rs10199181, and rs6745710 is detected.

8.

Method according to claim 7 wherein the association with a prognosis and / or diagnosis of severe hepatic fibrosis is obtained when the subject is also a carrier of the genotype G / G of the genetic polymorphism rs2030171, of the T / T genotype of the genetic polymorphism rs13029247, of the genotype C / C of the rs10173099 genetic polymorphism, of the T / T genotype of the rs10199181 genetic polymorphism, or of the C / C genotype of the rs6745710 genetic polymorphism of the STAT1 gene.

9.

Method according to any of claims 7 or 8 wherein the genetic polymorphism of the STAT1 gene is rs2030171.

10.

Method according to any one of claims 1 to 9 wherein at least one genetic polymorphism of the ISGF3G gene or of the TM9SF1 gene selected from the list comprising: rs12436555, rs12432194 and rs10583 for the prognosis and / or diagnosis of fibrosis is detected.

eleven.

Method according to claim 10 wherein the association with a prognosis and / or diagnosis of severe hepatic fibrosis in step (b) is obtained when the subject also bears the A allele of the rs12436555 genetic polymorphism or the T allele of the rs12432194 genetic polymorphism of the gene ISGF3G, or allele A of the rs10583 genetic polymorphism of the TM9SF1 gene.

12.

Method according to any of claims 10 or 11 wherein the genetic polymorphism of the ISGF3G gene is rs12436555.

13.

Method according to any of claims 1 to 12 wherein the biological sample is selected from the list comprising tissue, oral mucosa, blood, plasma, serum and lymph.

14.

Method according to claim 13 wherein the biological sample is blood.

fifteen.

Method according to claims 1 to 14 wherein the detection of the polymorphism is carried out by hybridization probes labeled with fluorophores.

16.

Method according to any one of claims 1 to 15 wherein the subject is a human.

17.

Use of a kit comprising the probes SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 that detect the rs3778216 genetic polymorphism of the HDAC2 gene to obtain useful data for the prognosis and / or diagnosis of liver fibrosis severe in a subject suffering from chronic hepatitis C.

18.

Use of a kit according to claim 17 further comprising the probes SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9 that detect the rs2030171 genetic polymorphism of the STAT1 gene, and / or the probes SEQ ID NO: 10 , SEQ ID NO: 11 and SEQ ID NO: 12 that detect the rs12436555 genetic polymorphism of the ISGF3G gene.

19.

Use of a kit according to any of claims 17 or 18 wherein the subject is a human.

20 21 FIG. 1 FIG. 2 A FIG. 2 B FIG. 2 C SPANISH OFFICE OF THE PATENTS AND BRAND Application no .: 201230368 SPAIN Date of submission of the application: 12.03.2012 Priority Date: REPORT ON THE STATE OF THE TECHNIQUE 51 Int. Cl.: C12Q1 / 68 (2006.01) RELEVANT DOCUMENTS

Category

56 Documents cited Claims Affected

TO

WO 2007142763 A2 (AP-PLERA [US / US]) 13.12.2007, 1-19

summary; page 5, line 31 - page 8, line 33; claims 1-18.

TO

WO 2005111241 A2 (AP-PLERA CORPORATION [US / US]) 24.11.2005, 1-19

summary; page 6, line 29 - page 10, line 7; claims 1-18.

TO

WO 2010094740 A1 (UNIVERSITE DE LA MEDITERRANEE [FR / FR]) 26.08.2010, 1-19

summary; page 4, line 25 - page 6, line 11; claims 1-13.

TO

WO 0246462 A2 (ISIS INNOVATION LIMITED [GB / GB]) 13.06.2002, 1-19

pages 4-7; claims 1-5.

Category of the documents cited X: of particular relevance Y: of particular relevance combined with other / s of the same category A: reflects the state of the art O: refers to unwritten disclosure P: published between the priority date and the date of priority submission of the application E: previous document, but published after the date of submission of the application

This report has been prepared • for all claims • for claims no:

Date of realization of the report 27.06.2013

Examiner M. D. García Grávalos Page 1/4

REPORT OF THE STATE OF THE TECHNIQUE Application number: 201230368 Minimum documentation searched (classification system followed by classification symbols) C12Q Electronic databases consulted during the search (name of the database and, if possible, terms of search used) INVENES, EPODOC State of the Art Report Page 2/4  WRITTEN OPINION Application number: 201230368 Date of Completion of Written Opinion: 06.27.2013 Statement

Novelty (Art. 6.1 LP 11/1986)

Claims Claims 1-19 IF NOT

Inventive activity (Art. 8.1 LP11 / 1986)

Claims Claims 1-19 IF NOT

The application is considered to comply with the industrial application requirement. This requirement was evaluated during the formal and technical examination phase of the application (Article 31.2 Law 11/1986).  Opinion Base.- This opinion has been made on the basis of the patent application as published. State of the Art Report Page 3/4  WRITTEN OPINION Application number: 201230368  1. Documents considered.- The documents belonging to the state of the art taken into consideration for the realization of this opinion are listed below.

Document

Publication or Identification Number publication date

D01

WO 2007142763 A2 13.12.2007

D02

WO 2005111241 A2 11/24/2005

D03

WO 2010094740 A1 08/26/2010

D04

WO 0246462 A2 06.13.2002

2. Statement motivated according to articles 29.6 and 29.7 of the Regulation of execution of Law 11/1986, of March 20, on Patents on novelty and inventive activity; quotes and explanations in support of this statement The present invention discloses an in vitro method of prognosis and / or diagnosis of severe hepatic fibrosis by detecting the rs3778216 genetic polymorphism of the HDAC2 gene, or any of those found in linkage disequilibrium with it (claims 1-16). It also refers to a kit for detecting said polymorphism (claims 17-19). Document D01 discloses a series of genetic polymorphisms as genetic markers of diagnosis and / or prognosis of liver fibrosis and other related pathologies (see summary; page 5, line 31-page 8, line 33; claims 118). Document D02 discloses a series of genetic polymorphisms as genetic markers of diagnosis and / or prognosis of liver fibrosis (see summary; page 6, line 29-page 10, line 7; claims 1-18). Document D03 discloses a series of genetic polymorphisms as genetic markers of predisposition to suffer some type of fibrosis, preferably hepatic, as well as diagnosis and / or prognosis of the disease (see summary; page 4, line 25-page 6, line 11 ; claims 1-13). Document D04 discloses a series of genetic polymorphisms of matrix metalloproteinase-2 (MMP-2) as genetic markers of diseases, including liver fibrosis (see pages 4-7; claims 15).  1. NEW AND INVENTIVE ACTIVITY (Art. 6.1 and Art. 8.1 LP 11/1986) The technical object of the present invention is an in vitro method of prognosis and / or diagnosis of severe hepatic fibrosis by means of the detection of the genetic polymorphism rs3778216 of the HDAC2 gene, or any of those that are in linkage disequilibrium with it; as well as a kit for detecting said polymorphism. 1.1. CLAIMS 1-19 Documents D01 and D02 are considered the closest to the state of the art since they anticipate genetic polymorphisms as markers of liver fibrosis and their use in an in vitro method for diagnosis and / or prognosis of said disease. The difference between documents D01 and D02 and the technical object of the invention lies in the anticipated polymorphisms themselves as genetic markers of fibrosis that are different from those claimed in the present application, so they are considered as a different alternative to what is disclosed in The state of the art. Consequently, as disclosed in D01 D02, claims 1-19 meet the requirements of novelty and inventive activity (Art. 6.1 and Art. 8.1 LP11 / 1986). Documents D03 and D04 refer to the state of the art and are not relevant in relation to the object of the invention. State of the Art Report Page 4/4