WO2010094036A1 - Methods of creating and screening dna-encoded libraries - Google Patents

Methods of creating and screening dna-encoded libraries Download PDF

Info

Publication number
WO2010094036A1
WO2010094036A1 PCT/US2010/024314 US2010024314W WO2010094036A1 WO 2010094036 A1 WO2010094036 A1 WO 2010094036A1 US 2010024314 W US2010024314 W US 2010024314W WO 2010094036 A1 WO2010094036 A1 WO 2010094036A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
library
oligonucleotide
building blocks
diversity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2010/024314
Other languages
French (fr)
Inventor
Richard W. Wagner
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
X Chem Inc
Original Assignee
X Chem Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=42562099&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2010094036(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to DK10741877.4T priority Critical patent/DK2396459T3/en
Priority to SG2011057619A priority patent/SG173627A1/en
Priority to EP10741877.4A priority patent/EP2396459B1/en
Priority to CN201080007813.3A priority patent/CN102317513B/en
Priority to ES10741877.4T priority patent/ES2638324T3/en
Priority to JP2011550313A priority patent/JP5770641B2/en
Priority to EP19208965.4A priority patent/EP3653763A1/en
Priority to BRPI1008429-0A priority patent/BRPI1008429A2/en
Priority to NZ594420A priority patent/NZ594420A/en
Priority to MX2011008563A priority patent/MX2011008563A/en
Priority to KR1020207007550A priority patent/KR102231531B1/en
Application filed by X Chem Inc filed Critical X Chem Inc
Priority to KR1020117021196A priority patent/KR101789216B1/en
Priority to CA2752543A priority patent/CA2752543A1/en
Priority to EP17163865.3A priority patent/EP3211126B1/en
Priority to KR1020177029869A priority patent/KR20170119729A/en
Priority to KR1020197018343A priority patent/KR102091207B1/en
Priority to AP2011005847A priority patent/AP3396A/en
Priority to US13/147,910 priority patent/US9359601B2/en
Priority to EA201101205A priority patent/EA021797B1/en
Publication of WO2010094036A1 publication Critical patent/WO2010094036A1/en
Priority to IL214399A priority patent/IL214399B/en
Anticipated expiration legal-status Critical
Priority to US15/147,600 priority patent/US11168321B2/en
Priority to IL263625A priority patent/IL263625B/en
Priority to US16/906,626 priority patent/US12606817B2/en
Priority to IL283572A priority patent/IL283572A/en
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1065—Preparation or screening of tagged libraries, e.g. tagged microorganisms by STM-mutagenesis, tagged polynucleotides, gene tags
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1068—Template (nucleic acid) mediated chemical library synthesis, e.g. chemical and enzymatical DNA-templated organic molecule synthesis, libraries prepared by non ribosomal polypeptide synthesis [NRPS], DNA/RNA-polymerase mediated polypeptide synthesis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/04—Libraries containing only organic compounds
    • C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • C40B40/08—Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B70/00—Tags or labels specially adapted for combinatorial chemistry or libraries, e.g. fluorescent tags or bar codes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B20/00—Methods specially adapted for identifying library members
    • C40B20/04—Identifying library members by means of a tag, label, or other readable or detectable entity associated with the library members, e.g. decoding processes
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/04—Libraries containing only organic compounds
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/04—Libraries containing only organic compounds
    • C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof

Definitions

  • Morgan et al. (U.S. Patent Application Publication No. 2007/0224607, hereby incorporated by reference) identifies the major challenges in the use of DNA- displayed combinatorial approaches in drug discovery: (1) the synthesis of libraries of sufficient complexity and (2) the identification of molecules that are active in the screens used.
  • Morgan et al. states that the greater the degree of complexity of a library, i.e., the number of distinct structures present in the library, the greater the probability that the library contains molecules with the activity of interest.
  • the chemistry employed in library synthesis must be capable of producing vast numbers of compounds within a reasonable time frame. This approach has been generally successful at identifying molecules with diverse chemotypes and high affinity.
  • DNA display of combinatorial small molecule libraries relies on multistep, split-and-pool synthesis of the library, coupled to enzymatic addition of DNA tags that encode both the synthetic step and building block used.
  • Several (e.g., 3 or 4) synthetic steps are typically carried out and encoded, and these include diversity positions (described herein as A. B, and C (Fig. I)), such as those formed by coupling building blocks with, e.g., amine or carboxylate functional groups onto a chemical scaffold that displays the attached building blocks in defined orientations.
  • A. B, and C Fig. I
  • One example of a scaffold (S) that is often used in combinatorial libraries is a triazine moiety, which can be orthogonally derivatized in three positions about its ring structure.
  • the process of library formation can be time consuming, products are often inefficiently purified, and the result is that unknown reactions may occur that create unwanted and/or unknown molecules attached to the DNA. Furthermore, incomplete purification of the library can result in tags cross-contaminating during the ligation steps, resulting in mis-tagging.
  • the end result for screening and sequencing hits from the library is that massively parallel sequencing has to be employed due the inherent "noise" of both DNAs that are attached to molecules that are unintended (e.g., unreacted or side products) or that are mis-tagged. Thus, the efficiency of sequencing is lost.
  • an initiator oligonucleotide from which the small molecule library is built, contains a primer-binding region for polymerase amplification (e.g., PCR) in the form of a covalently-closed, double-stranded oligonucleotide.
  • PCR polymerase amplification
  • the present invention features a method for creating and screening simplified DNA-encoded libraries, owing to fewer synthetic steps (e.g., no enzymatic ligation or no covalently closed initiator double-stranded oligonucleotides) and, therefore, substantially less "noise” during the analysis of the encoded oligomers (herein termed "identifier regions").
  • synthetic steps e.g., no enzymatic ligation or no covalently closed initiator double-stranded oligonucleotides
  • identifier regions substantially less “noise” during the analysis of the encoded oligomers
  • the present invention features a method of tagging DNA- encoded chemical libraries by binding a first functional group of a bifunctional linker to an initiator oligonucleotide at the 5' end of the initiator oligonucleotide, wherein the initiator oligonucleotide forms a hairpin structure, and binding a second functional group of the bifunctional linker to a component of the chemical library.
  • the initiator oligonucleotide may include a first identifier region and a second identifier region, such that the second identifier region hybridizes to the first identifier region of the initiator oligonucleotide.
  • the second identifier region may include a fluorescent tag (e.g., a fluorophore or GFP) or biotin label.
  • the second identifier region is not amplified prior to analysis following a selection step.
  • the invention features a method of creating DN ⁇ - encoded libraries by (a) creating a first diversity node, (b) encoding the first diversity node in separate vessels, (c) pooling the first diversity node, and (d) splitting the pooled first diversity node into a second set of separate vessels, wherein the first diversity node reacts to form a second diversity node.
  • the second diversity node is not encoded and pooled.
  • the present invention features a method for creating libraries using semi- or non-aqueous (e.g., organic) chemical reactions with higher yield, a greater diversity of building blocks, and a greater number of chemical reactions that can be used to create more DNA-tagged combinatorial libraries than previously achieved.
  • semi- or non-aqueous (e.g., organic) chemical reactions with higher yield, a greater diversity of building blocks, and a greater number of chemical reactions that can be used to create more DNA-tagged combinatorial libraries than previously achieved.
  • the methods of the present invention provide a set of libraries containing, e.g., one or two diversity positions on a chemical scaffold that can be efficiently generated at high yield, screened to identify preferred individual building blocks or combinations of building blocks that reside at the, e.g., one or two diversity positions, and iteratively diversified at, e.g., a second, third, and/or fourth diversity position to create molecules with improved properties.
  • the methods described herein allow for an expansive and extensive analysis of the selected compounds having a desired biological property, which, in turn, allows for related compounds with familial structural relationships to be identified (e.g., structure- activity relationships).
  • scaffold is meant a chemical moiety which displays diversity node(s) in a particular special geometry.
  • Diversity node(s) are typically attached to the scaffold during library synthesis, but in some cases one diversity node can be attached to the scaffold prior to library synthesis (e.g., addition of identifier regions).
  • the scaffold is derivatized such that it can be orthogonally deprotected during library synthesis and subsequently reacted with different diversity nodes (e.g., using identifier tagging at each step).
  • identifier region is meant the DNA tag portion of the library that encodes the building block addition to the library.
  • initiiator oligonucleotide is meant the starting oligonucleotide for library synthesis which also contains a covalently attached linker and functional moiety for addition of a diversity node or scaffold.
  • the oligonucleotide can be single- or double- stranded.
  • the oligonucleotide can consist of natural or modified bases.
  • “functional moiety” is meant a chemical moiety comprising one or more building blocks that can be selected from any small molecule or designed and built based on desired characteristics of, for example, solubility, availability of hydrogen bond donors and acceptors, rotational degrees of freedom of the bonds, positive charge, negative charge, and the like.
  • the functional moiety must be compatible with chemical modification such that it reacts with the headpiece.
  • the functional moiety can be reacted further as a bifunctional or trifunctional (or greater) entity.
  • Functional moieties can also include building blocks that are used at any of the diversity nodes or positions. Examples of building blocks and encoding DNA tags are found in Tables 1 and 2. See, e.g., U.S. Patent Application Publication No. 2007/0224607, hereby incorporated by reference.
  • building block is meant a chemical structural unit which is linked to other chemical structural units or can be linked to other such units.
  • the building blocks are the monomelic units of the polymer or oligomer.
  • Building blocks can also include a scaffold structure (e.g., a scaffold building block) to which is, or can be, attached one or more additional structures (e.g., peripheral building blocks).
  • the building blocks can be any chemical compounds which are complementary (i.e., the building blocks must be able to react together to form a structure comprising two or more building blocks).
  • all of the building blocks used will have at least two reactive groups, although some of the building blocks used will have only one reactive group each. Reactive groups on two different building blocks should be complementary, i.e., capable of reacting together to form a covalent bond.
  • linker is meant a molecule that links the nucleic acid portion of the library to the functional displayed species.
  • linkers are known in the art, and those that can be used during library synthesis include, but are not limited to, 5'-O- Dimethoxytrityl-r,2'-Dideoxyribose-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite; 9-O-Dimethoxytrityl-triethylene glycol, l-[(2-cyanoethyl)-(N,N- diisopropyl)]-phosphoramidite; 3-(4,4'-Dimethoxytrityloxy)propyl- 1 -[(2-cyanoethyl)- (N,N-diisopropyl)]-phosphoramidite; and 18-O-Dirnethoxytritylhexaethyleneglycol, 1 - [(2-cyanoethyl
  • branched linker is meant a molecule that links the nucleic acid position of the library to 2 or more identical, functional species of the library.
  • Branched linkers are well known in the art and examples can consist of symmetric or asymmetric doublers (1) and (2) or a symmetric trebler (3). See, for example, Newcome et al., Dendritic Molecules: Concepts, Synthesis, Perspectives, VCH Publishers (1996); Boussif et al., Proc. Natl. Acad. ScL USA 92: 7297-7301 (1995); and Jansen et al., Science 266: 1226 (1994).
  • oligonucleotide refers to a polymer of nucleotides.
  • the oligonucleotide may include DNA or any derivative thereof known in the art that can be synthesized and used for base-pair recognition.
  • the oligonucleotide does not have to have contiguous bases, but can be interspersed with linker moieties.
  • the oligonucleotide polymer may include natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine), nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, C5-propynylcytidine, C5-propynyluridine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-methylcytidine, 7- deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine), chemically
  • operatively linked is meant that two chemical structures are linked together in such a way as to remain linked through the various manipulations they are expected to undergo.
  • the functional moiety and the encoding oligonucleotide are linked covalently via an appropriate linking group.
  • the linking group may be a bifunctional moiety with a site of attachment for the encoding oligonucleotide and a site of attachment for the functional moiety.
  • small molecule is meant a molecule that has a molecular weight below about 1000 Daltons. Small molecules may be organic or inorganic, and may be isolated from, e.g., compound libraries or natural sources, or may be obtained by derivatization of known compounds.
  • Fig. 1 is a schematic illustrating the diversity positions A, B, and C.
  • Fig. 2 is a schematic of a DNA-encoded chemical library member of Mode 1, showing, in part, the initiator oligonucleotide, which includes a hairpin structure complementary at the identifier region, which has been reacted with A and B diversity nodes. The identifier region for B is being added.
  • the "C" diversity node is the potential position for an additional diversity position to be added following the addition of B identifier region.
  • FIG. 3 is a schematic of a DNA-encoded chemical library member of Mode 1, showing, in part, the initiator oligonucleotide, which includes a sequence in the loop region of the hairpin structure that can serve as a primer binding region for amplification.
  • Fig. 4 is a schematic of a DNA-encoded chemical library member of Mode 1, showing, in part, the initiator oligonucleotide, which includes a non-complementary sequence on the 3' end of the molecule that can serve to bind a second identifier region for either polymerization or for enzymatic ligation.
  • Fig. 5 is a schematic of a DNA-encoded chemical library member of Mode 1, showing, in part, the initiator oligonucleotide, wherein the loop region of the initiator oligonucleotide and at least the identifier region on the 3' side of the loop region can serve to hybridize to a complementary oligonucleotide that also contains a second identifier region.
  • Fig. 6 is a schematic of PCR amplification of the hairpin model, as presented in Figure 5.
  • Fig. 7 is a schematic of a DNA-encoded chemical library member of Mode 2, showing a hairpin oligonucleotide that is covalently closed (e.g., via a hairpin or chemically) on the distal end to the linker.
  • Fig. 8 is a schematic of a DNA-encoded chemical library member of Mode 2, showing the inclusion of additional diversity nodes.
  • Fig. 9 is a schematic of a DNA-encoded chemical library member of Mode 2, showing the steps for screening of libraries and methods for deconvoluting the identifier regions.
  • Fig. 10 is a schematic showing oligonucleotides used in library synthesis.
  • Headpiece (HP) was synthesized by IDT DNA and HPLC purified. Arrows indicate the site for BbvCI restriction (underlined) or Nb.BbvCI or Nt.BbvCI nicking digest. Sequences of the DNA tags Al, Bl, and Cl (top and bottom strands), the 5' and 3 * PCR primers, and the 3' end of the HP are also shown.
  • Fig. 11 is an electrophoretic gel (TBE-urea (15%) gel electrophoresis; UV shadowing on a TLC plate) of the headpiece at different steps of its synthesis.
  • Headpiece HP (IDT DNA) was acylated by Fmoc-amino-PEG2000-NHS (JenKem Technology USA).
  • Lane 1 is the HP (IDT DNA) oligonucleotide (42 nts).
  • Lane 2 is HP acylated with Fmoc-amino-PEG2000-NHS. Following Tris-HCl addition, some deprotection of Fmoc is observed.
  • Lane 3 is the crude reaction with piperidine, showing complete deprotection of Fmoc.
  • Lane 4 is the same as Lane 3 after desalting on a NAP-5 column and lyophilization.
  • Fig. 12 is a schematic showing the steps in model library synthesis. DTAF was conjugated to amino-PEG modified headpiece (HP-I) in the first step. Following this step, a portion of HP-I-DTAF was further acylated with pentylamino-biotin.
  • HP-I amino-PEG modified headpiece
  • Fig. 13A is a scheme of the ligation of the DNA tags.
  • Fig 13B illustrates a 4% agarose gel of HP-I -DTAF -biotin library at different steps of the DNA tag ligation.
  • M marker; Lane 1: HP-1-DTAF-biotin; Lane 2: 1 I Tag A only; Lane 3: 1 + Tags A, B, and C, as well as 3'-end oligo ligated. Arrow indicates bright green fluorescence (DTAF). No substantial separation is observed on the gel.
  • Fig. 13C illustrates PCR amplification (24 cycles) of the ligation reactions.
  • M marker (lowest band is 100); Lane 1 : PCR amplification of the green fluorescent band from Lane 1 of Fig.
  • Fig. 14 is a set of electrophoretic gels showing the purification of the XChem model compound and model selection (via a binding interaction between the biotin moiety of the XChem model compound and streptavidin).
  • the gels are 4-12% SDS NuPage gels with MES running buffer. Gels were scanned for green fluorescence using a 450-nm laser.
  • Fig. 14A is a gel showing synthesis and purification steps. Samples were mixed with loading buffer and boiled.
  • Lanes 3-6 steps of purification/model selection using streptavidin Dynal beads: Lane 3: flow- through; Lane 4: last wash (washed with water at 80 0 C for 10 minutes); Lanes 5 and 5': elution with 25 mM EDTA at 9O 0 C (1 st and 2 nd ); Lanes 6 and 6': elution with 25 mM EDTA and 5 mM NaOH at 90 0 C (1 st and 2 nd ).
  • 14B is a gel showing binding of HP-1-DTAF-biotin ("library of 1") to streptavidin. Samples were mixed with gel loading buffer and directly loaded onto the gel without boiling. Samples, as in the gel of Fig. 14A, were incubated with an excess of streptavidin in 50 mM NaCl/10 mM Tris HCl, pH 7.0, for 10 minutes. "S” indicates the addition of streptavidin. Samples 5 and 6 were pooled together.
  • Lane 1 HP-I-DTAF; Lane IS: HP-I-DTAF + streptavidin; Lane 2: HP-1-DTAF-biotin (desalted); Lane 2S: HP-1-DTAF-biotin + streptavidin; Lane 4: last wash (washed with water at 8O 0 C for 10 minutes); Lane 4S: last wash sample + streptavidin; Lane 5+6: pooled samples 5, 5', 6 and 6' (elution fractions from streptavidin beads, purified and selected HP-1-DTAF-biotin; Lane 5+6S': purified and selected HP-1-DTAF-biotin + streptavidin. Note that there is no noticeable difference in migration between different the steps of "library of 1" synthesis. Fig.
  • Fig 14C is a 4% agarose gel of headpiece (Trilink) HP-T, reacted with DTAF. Lane 1: Marker; Lane 2: DTAF; Lane 3 HP-T-DTAF. Left panel: UV visualization of the gel (ethidium bromide staining); Right panel: same gel scanned for fluorescence at excitation wavelength 450 nm (green, fluorescein).
  • Fig 14D is a 4- 12% SDS NuPage gel with MES running buffer, showing binding of HP-T-DTAF- biotin to streptavidin. Samples were mixed with gel loading buffer and directly loaded onto the gel without boiling. Samples, as in the gel of Fig.
  • Fig. 15 ⁇ is a scheme of the synthesis of the construct for the T7 RNAP intracellular delivery experiment.
  • the V H dsDNA clone was PCR amplified to append a Bsml site at the 5' end upstream of the T7 promoter.
  • the construct was ligated to HP-1-DTAF-R7 (headpiece modified with DTAF and (-Arg- ⁇ Ahx) ⁇ -Arg peptide).
  • Fig. 15B is an electrophoretic gel of the ligation reaction. Lanes 1 and 2 show different HP-I samples ligated to V H ; Lane 3 shows unligated V H PCR product; and M is the marker.
  • Fig. 15 ⁇ is a scheme of the synthesis of the construct for the T7 RNAP intracellular delivery experiment.
  • the V H dsDNA clone was PCR amplified to append a Bsml site at the 5' end upstream of the T7 promoter.
  • the construct was ligated to
  • FIG. 15C is an electrophoretic gel showing validation for T7 promoter activity.
  • the gel shows a T7 Megascript (Ambion, Inc.) reaction using samples from Lanes 1-3 of Fig. 15B.
  • Fig. 16 is an agarose gel electrophoresis of the steps in library 10x10 synthesis
  • Fig. 16A is a 4% agarose gel of headpiece (Trilink) HP-T ligated with tag A.
  • Lane 1 Marker; Lane 2: HP-T; Lane 3: Tag A annealed; Lane 4: HP-T ligated with tag A; Lane 5: HP-T ligated with tag A and desalted on Zeba column.
  • Fig. 16B is a 2% agarose gel of HP-T-A ligation with 12 different tags B.
  • Lane M Marker, Lanes 1 and 9: HP-T-A; Lanes 3, 4, 5, 6, 7, 8, 11, 12, 13, 14, 15 and 16: HP-T-A ligation with tags Bl- B 12.
  • Fig 16C is a 4% agarose gel of the pooled library (library B), with tags A and Bl -B 12 ligated, after reaction with cyanouric chloride and amines Bl -B 12.
  • Lane 1 Marker
  • Lane 2 HP-T-A
  • Lane 3 Library-B pooled and desalted on Zeba columns.
  • the present invention features a number of methods for identifying one or more compounds that bind to a biological target.
  • the methods include synthesizing a library of compounds, wherein the compounds contain a functional moiety having one or more diversity positions.
  • the functional moiety of the compounds is operatively linked to an initiator oligonucleotide that identifies the structure of the functional moiety.
  • Mode 1 provides a number of methods to preserve the double- stranded character of the dsDNA during library synthesis, which is important during the chemical reaction step, and can be used (as shown in Figs. 2-6) for generating up to two diversity nodes.
  • Mode 2 (Figs.
  • Mode 3 provides methods to create libraries with one, two, three, or more nodes of diversity. Modes 1, 2, and 3 are described in detail below.
  • the present invention features a method for identifying one or more compounds that bind to a biological target.
  • the method includes synthesizing a library of compounds, wherein the compounds contain a functional moiety having no greater than two diversity positions.
  • the functional moiety of the compounds is operatively linked to an initiator oligonucleotide that identifies the structure of the functional moiety by providing a solution containing A initiator compounds.
  • the initiator oligonucleotide includes a linker L (e.g., polyethylene glycol) with an integer of one or greater, wherein the initiator oligonucleotides contain a functional moiety that includes A building blocks attached to L and separated into A reaction vessels, wherein A is an integer of two or greater, which is operatively linked to an initiator oligonucleotide that identifies the A building blocks.
  • L e.g., polyethylene glycol
  • the A building blocks can be further derivatized through a common node S.
  • A is subsequently transformed with S, S being a scaffold molecule that allows further nodes of diversity introduction.
  • A-S can be screened directly, representing a single node of diversity.
  • the A-S reaction vessels e.g., which may first include a purification of A-S from starting materials
  • B is an integer of one or greater, and reacted with one of B building blocks.
  • A-S-B still in B reaction vessels, is in some cases reacted with a C building block, where C is an integer of one, is purified, and subjected to a polymerization or ligation reaction using B primers, in which the B primers differ in sequence and identify the B building blocks.
  • A-S can be an integer of one.
  • A- S can be linked directly to B initiator oligonucleotides, and following reaction of B building blocks, the B reactions are mixed.
  • the A-S-B mixture, where B represents the only diversity node is screened directly, representing a single node of diversity.
  • the A-S-B mixture, where B represents the only diversity node is subsequently aliquoted into C reaction vessels, reacted with C building blocks, and subjected to second strand polymerization or ligation reaction using C primers, in which the C primers differ in sequence and identify the C building blocks.
  • B can be an integer of one and A-S is greater than one, in which case A-S, now derivatized with B, is aliquoted into C reaction vessels, reacted with C building blocks, and subjected to second strand polymerization reaction using C primers, in which the C primers differ in sequence and identify the C building blocks.
  • This general strategy can be expanded to include additional diversity nodes (e.g., D, E, F, etc.) so that the first diversity node is reacted with building blocks and/or S and encoded by an initial oligonucleotide, mixed, re-aliquoted into vessels and then the subsequent diversity node is derivatized by building blocks, which is encoded by the primer used for the polymerization or ligation reaction.
  • additional diversity nodes e.g., D, E, F, etc.
  • A can be an integer of one
  • B can be an integer of one
  • C initiator oligonucleotides are used.
  • A-S-B, attached to C initiator oligonucleotides, is formed in C reaction vessels, reacted with C building blocks, and screened directly.
  • S is reacted first with the initiator oligonucleotide, and A, B and/or C (e.g., or D, E, F, and so on) are subsequently reacted.
  • A, B, or C e.g., or D, E, F, and so on
  • the initiator oligonucleotide includes a hairpin structure complementary at the identifier region (Fig. T).
  • the identifier region can be, e.g., 2 to 100 base pairs in length, preferably 5 to 20 base pairs in length, and most preferably 6 to 12 base pairs in length.
  • the initiator oligonucleotide further includes a sequence in the loop region of the hairpin structure that can serve as a primer binding region for amplification (Fig. 3), such that the primer binding region has a higher melting temperature for its complementary primer (e.g., which can include flanking identifier regions) than the identifier region alone.
  • the loop region may include modified bases that can form higher affinity duplex formations than unmodified bases, such modified bases being known in the art (Fig. 3).
  • the initiator oligonucleotide can further include a non- complementary sequence on the 3' end of the molecule that can serve to bind a second identifier region for either polymerization or for enzymatic ligation (Fig. 4).
  • the strands can be subsequently crosslinked, e.g., using psoralen.
  • the loop region and at least the identifier region on the 3' side of the loop region can serve to hybridize to a complementary oligonucleotide that also contains a second identifier region (Fig. 5).
  • a mix-and-split strategy may be employed during the oligonucleotide synthesis step to create the necessary number of tags.
  • mix-and-split strategies for DNA synthesis are known in the art.
  • the strands can be subsequently crosslinked, e.g., using psoralen.
  • the resultant library members can be amplified by PCR following selection for binding entities versus a target(s) of interest (Fig. 6).
  • a headpiece which includes an initiator oligonucleotide
  • a linker and A which includes, for example, 1000 different variants.
  • a DNA tag A may be ligated or primer extended to the headpiece. These reactions may be performed in, e.g., a 1000-well plate or 10 x 100 well plates. All reactions may be pooled, optionally purified, and split into a second set of plates. Next, the same procedure may be performed with B building blocks, which also include, for example, 1000 different variants.
  • a DNA tag B may be ligated to the headpiece, and all reactions may be pooled.
  • the same approach may be extended to add variants C, D, E, etc.
  • the generated library may then be used to identify compounds that bind to the target.
  • the composition of the compounds that bind to the library can be assessed by PCR and sequencing of the DNA tags to identify the compounds that were enriched.
  • the method includes synthesizing a library of compounds, wherein the compounds contain a functional moiety having no greater than two diversity positions.
  • the functional moiety of the compounds is operatively linked to an initiator oligonucleotide, which contains a unique genetic sequence that identifies the structure of the functional moiety by providing a solution comprising A initiator compounds, wherein L is an integer of one or greater, where the initiator compounds include a functional moiety having A building blocks separated into A reaction vessels, where, e.g., A is an integer of two or greater, which is operatively linked to an initial oligonucleotide which identifies the A building blocks.
  • the A building blocks are pre-derivatized with a common S.
  • A is subsequently transformed with S, S being a scaffold molecule that allows further nodes of diversity introduction.
  • the A-S reaction vessels (which may first include a purification of A-S from starting materials) are mixed together and aliquoted into B reaction vessels, wherein B is an integer of one or greater, and reacted with one of B building blocks.
  • B is an integer of one or greater
  • A-S-B still in B reaction vessels is, in some embodiments, reacted with a C building block, where C is an integer of one, are purified, and kept separate in B vessels for screening.
  • A-S is an integer of one.
  • A-S can be linked directly to B initiator oligonucleotides and, following the reaction of B building blocks, the B reactions are mixed and aliquoted into C reaction vessels, reacted with C building blocks, and kept separate in C vessels for screening.
  • B can be an integer of one and A-S is greater than one, in which case A-S, now derivatized with B, is aliquoted into C reaction vessels reacted with C building blocks, and kept separate in C vessels for screening.
  • This general strategy can be expanded to include additional diversity nodes (e.g., D, E, F, etc.) so that the first diversity node is reacted with building blocks and/or S and encoded by an initiator oligonucleotide, mixed, re-aliquoted into vessels, and then the subsequent diversity node is derivatized by building blocks and kept in their respective vessels for screening (Fig. 8).
  • additional diversity nodes e.g., D, E, F, etc.
  • a headpiece which includes an initiator oligonucleotide
  • a building blocks which include, for example, 1000 different variants.
  • a DNA tag A may be ligated or primer extended to the headpiece.
  • the reactions may be pooled.
  • B the same procedure may be performed with B building blocks, but a DNA tag is not added for B. Because B is not coded for, all "B" reactions may be pooled (e.g., 1000 reactions) and a selection step may be performed to identify all A building blocks that produce the desired binding effect with unknown B building blocks.
  • a library of A building blocks identified in the selection step may then be reacted with the same 1000 B building blocks, resulting in a screen of 10,000 compounds or less.
  • DNA tags for B may be added and B building blocks that produce the desired binding effect in combination with the, e.g., 10 A building blocks can be identified, resulting in a step-wise convolution of an initial library of, for example, 1,000,000 compounds.
  • a set of these final compounds may be individually tested to identify the best, e.g., binders, activators, or inhibitors.
  • a BIND Reader (SRU Biosystems), for example, may be used to monitor binding on a sensor surface in high throughput format (e.g., 384 well plates and 1536 well plates).
  • the A building blocks may be encoded with DNA tags and the B building blocks may be position encoded.
  • Binders can then be identified using a BIND sensor, sequencing, and microarray analysis or restriction digest analysis of the A tags. This analysis allows for the identification of combinations of A and B building blocks that produce the desired molecules.
  • Other methods for monitoring binding known to those of skill in the art may be used including, e.g., ELISA. Modes 1 and 2
  • the initiator oligonucleotide of Modes 1 and 2 may contain a hairpin structure, complementary at the identifier region.
  • the initiator oligonucleotide further contains a sequence in the loop region of the hairpin structure that can serve as a primer-binding region for amplification, such that the primer binding region has a higher melting temperature for its complementary primer (which can include flanking identifier regions) than the identifier region alone.
  • the initiator oligonucleotide includes a linker molecule capable of being functionally reacted with building blocks.
  • the linker molecule can be attached directly to the 5' end of the oligonucleotide through methods known in the art or can be embedded within the molecule, e.g., off of a derivatized base (e.g., the C5 position of uridine), or the linker can be placed in the middle of the oligonucleotide using standard techniques known in the art.
  • the initiator oligonucleotide may be single-stranded or double-stranded.
  • the formation of a double-stranded oligonucleotide may be achieved through hairpin formation of the oligonucleotide or through cross-linking using, e.g., a psoralen moiety, as known in the art.
  • the initiator oligonucleotide may contain two primer-binding regions (e.g., to enable a PCR reaction) on either side of the identifier region that encodes the building block.
  • the initiator oligonucleotide may contain one primer-binding site on the 5' end.
  • the initiator oligonucleotide is a hairpin, and the loop region forms a primer-binding site or the primer-binding site is introduced through hybridization of an oligonucleotide to the identifier region on the 3' side of the loop.
  • a primer oligonucleotide containing a region homologous to the 3' end of the initiator oligonucleotide and carrying a primer binding region on its 5' end (e.g., to enable a PCR reaction) may be hybridized to the initiator oligonucleotide, and may contain an identifier region that encodes the building blocks used at one of the diversity positions.
  • the primer oligonucleotide may contain additional information, such as a region of randomized nucleotides, e.g., 2 to 16 nucleotides in length, which is included for bioinformatic analysis.
  • the initiator oligonucleotide does not contain a PCR primer-binding site.
  • the library of compounds, or a portion thereof is contacted with a biological target under conditions suitable for at least one member of the library of compounds to bind to the target, followed by removal of library members that do not bind to the target, and analyzing the identifier region or regions.
  • Exemplary biological targets include, e.g., enzymes (e.g., kinases, phosphatases, methylases, demethylases, proteases, and DNA repair enzymes), proteins involved in protein :protein interactions (e.g., ligands for receptors), receptor targets (e.g., GPCRs and RTKs), ion channels, bacteria, viruses, parasites, DNA, RNA, prions, or carbohydrates).
  • enzymes e.g., kinases, phosphatases, methylases, demethylases, proteases, and DNA repair enzymes
  • proteins involved in protein :protein interactions e.g., ligands for receptors
  • receptor targets e.g., GPCRs and RTKs
  • ion channels e.g., bacteria, viruses, parasites, DNA, RNA, prions, or carbohydrates.
  • the library of compounds, or a portion thereof is contacted with a biological target under conditions suitable for at least one member of the library of compounds to bind to the target, followed by removal of library members that do not bind to the target, followed by amplification of the identifier region by methods known in the art, and subsequently analyzing the identifier region or regions by methods known in the art.
  • the method of amplification of the identifier region can include, e.g., polymerase chain reaction (PCR), linear chain amplification (LCR), rolling circle amplification (RC ⁇ ), or any other method known in the art to amplify nucleic acid sequences.
  • PCR polymerase chain reaction
  • LCR linear chain amplification
  • RC ⁇ rolling circle amplification
  • the library of compounds is not pooled following the final step of building block addition and the pools are screened individually to identify compound(s) that bind to a target.
  • the molecules that bind to a target are not subjected to amplification, but are analyzed directly.
  • Methods of analysis include, e.g., microarray analysis or bead-based methods for deconvoluting the identifier regions (Fig. 9). Molecules that bind during the screening step may also be detected by a label-free photonic crystal biosensor.
  • the initiator oligonucleotide and/or the primer oligonucleotide contain a functional moiety that allows for its detection by, e.g., fluorescent tags, Q dots, or biotin.
  • the microarray analysis uses advanced detection capability, such as, e.g., evanescent resonance photonic crystals.
  • the method of amplifying includes forming a water-in-oil emulsion to create a plurality of aqueous microreactors, wherein at least one of the microreactors has at least one member of a library of compounds that binds to the target, a single bead capable of binding to the encoding oligonucleotide of the at least one member of the library of compounds that binds to the target, and amplification reaction solution containing reagents necessary to perform nucleic acid amplification, amplifying the encoding oligonucleotide in the microreactors to form amplified copies of the encoding oligonucleotide, and binding the amplified copies of the encoding oligonucleotide to the beads in the microreactors.
  • a second library may be prepared in an iterative fashion, in which one or two additional nodes of diversity are added, and the library is created and diversity sampled as described herein. This process can be repeated as many times as necessary to create molecules with desired molecular and pharmaceutical properties.
  • Exemplary A building blocks include, e.g., amino acids (not limited to alpha- amino acids), click-chemistry reactants (e.g., azide or alkine chains) with an amine, or a thiol reactant.
  • the choice of A building block depends on, for example, the nature of the reactive group used in the linker, the nature of a scaffold moiety, and the solvent used for the chemical synthesis. See, e.g., Table 1.
  • Exemplary B and C building blocks are described in Tables 2 and 3, respectively.
  • a restriction site may be introduced, for example, in the B or C position for analysis of the final product and selection by performing PCR and restriction digest with one of the corresponding restriction enzymes.
  • the headpiece oligonucleotide may be modified to support solubility in semi- or non-aqueous (e.g., organic) conditions.
  • the headpiece in certain embodiments, includes the identifier region.
  • the headpiece with linker can first be derivatized with a building block (e.g., a functional moiety) or scaffold, and the identifier sequence is then added.
  • Nucleotide bases of the headpiece can be rendered more hydrophobic by modifying, for example, the C5 positions of T or C bases with aliphatic chains without significantly disrupting their ability to hydrogen bond to their complementary bases. See, e.g., Table 4 for examples of modified bases.
  • the headpiece oligonucleotide can be interspersed with modifications that promote solubility in organic solvents.
  • azobenzene phosphoramidite can introduce a hydrophobic moiety into the headpiece design. Such insertions of hydrophobic amidites into the headpiece can occur anywhere in the molecule.
  • the insertion cannot interfere with subsequent tagging using additional DNA tags during the library synthesis or ensuing PCR reactions once a selection is complete or microarray analysis, if used for tag deconvolution.
  • Such additions to the headpiece design described herein would render the headpiece soluble in, for example, 15%, 25%, 30%, 50%, 75%, 90 %, 95%, 98%, 99%, or 100% organic solvent.
  • addition of hydrophobic residues into the headpiece design allows for improved solubility in semi- or non-aqueous (e.g., organic) conditions, while rendering the headpiece competent for nucleic acid tagging.
  • DNA tags that are subsequently introduced into the library can also be modified at the C5 position of T or C bases such that they also render the library more hydrophobic and soluble in organic solvents for subsequent steps of library synthesis.
  • linker molecule between the headpiece and small molecule library can be varied to increase the solubility of the headpiece in organic solvent.
  • a wide variety of linkers are commercially available that can couple the headpiece with the small molecule library.
  • Linkers are empirically selected for a given small molecule library design (scaffolds and building blocks) such that the library can be synthesized in organic solvent, for example, 15%, 25%, 30%, 50%, 75%, 90 %, 95%, 98%, 99%, or 100% organic solvent.
  • linker can be varied using model reactions prior to library synthesis to select the appropriate chain length that solubilizes the headpiece in organic solvent.
  • linkers may include linkers with, e.g., increased alkyl chain length, increased polyethylene glycol units, branched species with positive charges (to neutralize the negative phosphate charges on the headpiece), or increased amounts of hydrophobicity (for example, addition of benzene ring structures).
  • the linker molecule may provide an appropriate spacer between the headpiece DN ⁇ and member of a chemical library.
  • bifunctional linkers may be used.
  • bifunctional linkers may include, for example, three parts.
  • Part 1 may be a reactive group, which forms a covalent bond with DNA, such as, e.g., a carboxylic acid, preferably activated by a N-hydroxy succinimide (NHS) ester to react with an amino group on the DNA (e.g., amino-modified dT), an amidite to modify the 5' or 3' end of a single-stranded DNA headpiece (achieved by means of standard oligonucleotide chemistry), click chemistry pairs (azide alkyne cycloaddition in the presence of Cu(I) catalyst), or thiol reactive groups.
  • DNA such as, e.g., a carboxylic acid, preferably activated by a N-hydroxy succinimide (NHS) ester to react with an
  • Part 2 may also be a reactive group, which forms a covalent bond with the chemical library, either a building block in the position A or scaffold moiety.
  • a reactive group could be, e.g., an amine, a thiol, an azide, or an alkyne for water based reactions or multiple other reactive groups for the organic-based reactions.
  • Part 3 may be a chemically inert spacer of variable length, introduced between Part 1 and 2.
  • Such a spacer can be a chain of ethylene glycol units (e.g., PEGs of different lengths), an alkane, an alkene, polyene chain, or peptide chain.
  • the linker can contain branches or inserts with hydrophobic moieties (such as, e.g., benzene rings) to improve solubility of the headpiece in organic solvents, as well as fluorescent moieties (e.g. fluorescein or Cy- 3) used for library detection purposes.
  • hydrophobic moieties such as, e.g., benzene rings
  • fluorescent moieties e.g. fluorescein or Cy- 3
  • linkers examples include, e.g., amino-carboxylic linkers (e.g., peptides (e.g., Z-Gly-Gly-Gly-Osu or Z-Gly-Gly-Gly-Gly-Gly-Gly-Osu), PEG (e.g., Fmoc-aminoPEG2000-NHS or amino-PEG (12-24)-NHS), or alkane acid chains (e.g., Boc- ⁇ -aminocaproic acid-Osu)), click chemistry linkers (e.g., peptides (e.g., azidohomalanine-Gly-Gly-Gly-OSu or propargylglycine-Gly-Gly-Gly- OSu), PEG (e.g., azido-PEG-NHS), or alkane acid chains (e.g., 5-azidopentanoic acid, (S)-2-(azidomethyl)-
  • Hydrophobic residues in the headpiece design may be varied with the linker design to facilitate library synthesis in organic solvents.
  • the headpiece and linker combination is designed to have appropriate residues wherein the octanohwater coefficient (Poet) is from, e.g., 1.0 to 2.5.
  • oligo HP phosphorylated oligonucleotide headpiece having the following sequence was synthesized and HPLC purified by IDT DNA.
  • oligonucleotide folds into a hairpin (Fig. 10) with an overhang and contains a cleavage site (CCTCAGC) for restriction enzyme BbvCI or nicking versions of this enzyme Nb.BbvCI or Nt.BbvCI, which can cleave either the top or bottom strand (New England BioLabs).
  • CCTCAGC cleavage site
  • Nb.BbvCI or Nt.BbvCI Nt.BbvCI
  • the top and bottom strands of the DNA tags A, B, and C were synthesized and purified by IDT DNA and purified by standard desalting. Longer oligonucleotides, such as the 3' end and PCR primers, were synthesized by IDT DNA and HPLC purified.
  • the resulting material was lyophilized and dissolved in 100 ⁇ l water. 20 ⁇ l of piperidine (to a final concentration of 20%) was added and incubated for 2 hours at room temperature. A cloudy precipitate was formed due to deprotection of the amine and release of the water insoluble Fmoc group.
  • the reaction was then filtered through 0.2- ⁇ m spin-filters (Millipore) and precipitated using 300 mM sodium acetate by the addition of 3 volumes of ethanol.
  • the Fmoc-protected form of the modified oligonucleotide was found to be soluble in ethanol and isopropanol. Due to high coupling efficiency, the resulting headpiece (HP-I) was used without further purification (Fig. 11).
  • a complete headpiece (HP-I) having the following sequence was prepared by Trilink, Inc., following a similar procedure as described above, and RP-HPLC purified. 5'-(phosphatc)TCCTGGCTGAGGCGAGAGTT(dT-C6-NH)(X)
  • Step 1 Coupling of DTAF
  • DTAF 5 -(4,6- dichlorotriazinyl-aminofluorescein)
  • Fig. 12 a model compound, 5 -(4,6- dichlorotriazinyl-aminofluorescein) (DTAF; Anaspec) (Fig. 12) was coupled to the amino group of HP-I.
  • DTAF structurally represents a trichlorotriazine scaffold with one amino compound coupled.
  • trichlorotriazine scaffolds can be derivatized with a diversity of building blocks at each of the three chlorine positions.
  • DTAF also provides a fluorescent label to the model library.
  • the reaction (10 ⁇ l) was set up as follows.
  • Step 2 Coupling of amino-biotin After DTAF was coupled to HP-I, one more reactive group on the scaffold molecule is still available for modification.
  • the reaction was set up as follows. 20 ⁇ l of the reaction mixture contained around 200 pmol of HP-I-DTAF (Step 1) dissolved in 150 mM borate buffer, pH 9.5, and 10 nmol of pentylamine-biotin. The reaction was allowed to proceed for 4-12 hours at 75°C. The reaction was then purified by desalting on a Zeba spin column, as described above.
  • Step 3 Ligation of the DNA tags to HP-1-DTAF-biotin Phosphorylated DNA tags (3' end primer region and 5' and 3' PCR primers) were synthesized by IDT DNA. Oligonucleotide sequences (Fig. 13) are as follows.
  • DNA Tag Al (top): 5'-phos-GGAGGACTGT (SEQ ID NO: 53) DNA Tag Al (bottom): 5'-phos-AGTCCTCCGG (SEQ ID NO: 54) DNA Tag Bl (top): 5 '-phos-C AGACGACGA (SEQ ID NO: 55) DNA Tag Bl (bottom): 5'-phos-GTCGTCTGAC (SEQ ID NO: 56) DNA Tag Cl (top): 5'-phos-CGATGCTCTT (SEQ ID NO: 57) DNA Tag Cl (bottom): 5 '-phos-GAGC ATCGTC (SEQ ID NO: 58)
  • the double-stranded Al tag was ligated to the headpiece.
  • the ligation reaction (20 ⁇ l) contained 2.5 ⁇ M of HP-1-DTAF-biotin and 2.5 ⁇ M of double- stranded Al tag in Ix T4 DNA ligase buffer and 60 Weiss units of T4 DNA ligase (New England BioLabs). The reaction was incubated at 16 0 C for 16 hours. The resulting product did not resolve on any of the tested gels, including different percentages of TBE-urea, NativePage, SDS-PAGE, or 2% and 4% agarose E-gel (Invitrogen, Inc.).
  • the ligation reaction (70 ⁇ l) contained: 2.5 ⁇ M of HP-1-DTAF-biotin; 2.5 ⁇ M of each of the annealed double-stranded DNA tags (Al, B 1 , and C 1 ), as well as the 3 ' end tag; 1 x T4 DNA ligase buffer; and 210 Weiss units of T4 DNA ligase.
  • the reaction was incubated at 16 0 C for 20 hours.
  • Step 4 Purification of HP-I -DTAF-biotin on streptavidin beads and reaction with streptavidin
  • the beads were eluted with 30 ⁇ l of 25 mM EDTA and 5 mM NaOH for 10 minutes at 90 0 C, and the eluent was immediately neutralized by adding 3 ⁇ l of 1 M Tris HCl, pH 7.0.
  • DNA construct for intracellular T7 RNAP delivery detection experiment The DNA construct used for the chemical "library of 1" intracellular delivery experiment was prepared from a PCR product of a V H DNA single clone of -400 bp featuring a T7 promoter region at the 5' end and a short antibody constant Cmu region close to the 3' end of the molecule.
  • a Bsml restriction site was appended upstream of the T7 promoter region by PCR amplification of the clone.
  • Bsml restriction digest produced a 3' GG overhang, which allowed ligation to the headpiece (3' CC overhang).
  • the 5' primer with Bsml site was synthesized by IDT DNA, Inc. 5'-GGATGCCGAATGCCTAATACGACTCACTATAGGG-
  • ACAATTACTATTTACAATTACA (SEQ ID NO: 63)
  • the DNA construct was purified using a PCR purification kit (Invitrogen), and the resulting DNA was digested with 250 U Bsml (New England BioLabs) at 65 0 C in NEB buffer 4 for 2 hours. The DNA was purified on a 2% agarose gel.
  • the ligation reaction (30 ⁇ l) contained 2 pmol of each V H DNA construct, digested with Bsml, as well as HP-I -DTAF -R7 (arginine-aminohexanoic acid peptide) in Ix T4 DNA ligase buffer and 60 Weiss units of T4 DNA ligase (New England BioLabs). The reaction was incubated at 16 0 C for 20 hours. Due to high efficiency of the ligation, the material was further used for the intracellular delivery/T7 RNAP experiment without further purification. The results are summarized in Fig. 15.
  • Step 1 Ligation of the tag A to the headpiece HP-T
  • positions B and C are used.
  • One tag A is ligated to HP-T.
  • the tag has the following sequence:
  • 30 nmol of HP-T were mixed with 45 nmol of each Tag Al top and Tag Al bottom oligos in Ix T4 DNA ligase buffer and were annealed by heating to 95°C for 1 minute, followed by cooling to 4°C at 0.2°C/second. The sample was then brought to 16 0 C. 300 Weiss Units of T4 DNA ligase was added and the samples were allowed to incubate for 16-20 hours at 16 0 C. Following the ligation, HP-T-A was desalted using a Zeba column (Pierce). See, e.g., Fig. 16A.
  • Step 2 Ligation of tags Bl -B 12 and C tags Twelve ligation reactions were set up similar to the ligation reactions described above. In each of 12 tubes, 5 nmol pairs of Bl -B 12 top and bottom oligos were added to Ix T4 DNA ligase buffer and annealed as described above. HP-T-A was dissolved in Ix T4 DNA ligase buffer. 2.5 nmol of HP-T-A were aliquoted in these 12 tubes. 30 Weiss units of T4 DNA ligase were added to each tube and reactions were allowed to proceed for 20 hours at 16°C.
  • each reaction mixture was individually desalted on a 0.5 ml Zeba spin column, equilibrated with 150 mM borate buffer, pH 9.0.
  • a 2Ox excess of cyanouric chloride 50 nmol
  • a 10Ox excess 250 nmol, i.e., 5x excess relative to cyanouric chloride
  • amines B 1 -B 12 dissolved in acetonitrile or DMF
  • the library was pooled, desalted twice on 2-ml Zeba columns and lyophilized. See, e.g., Figs. 16B and 16C.
  • the C tags and amines are added using similar reaction conditions to those described above.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention features a number of methods for identifying one or more compounds that bind to a biological target. The methods include synthesizing a library of compounds, wherein the compounds contain a functional moiety having one or more diversity positions. The functional moiety of the compounds is operatively linked to an initiator oligonucleotide that identifies the structure of the functional moiety.

Description

METHODS OF CREATING AND SCREENING DNA-ENCODED LIBRARIES
BACKGROUND OF THE INVENTION
The burgeoning cost of drug discovery has led to the ongoing search for new methods of screening greater chemical space as inexpensively as possible to find molecules with greater potency and little to no toxicity. Combinatorial chemistry approaches in the 1980s were originally heralded as being methods to transcend the drug discovery paradigm, but largely failed due to insufficient library sizes and inadequate methods of deconvolution. Recently, the use of DNA-displayed combinatorial libraries of small molecules has created a new paradigm shift for the screening of therapeutic lead compounds.
Morgan et al. (U.S. Patent Application Publication No. 2007/0224607, hereby incorporated by reference) identifies the major challenges in the use of DNA- displayed combinatorial approaches in drug discovery: (1) the synthesis of libraries of sufficient complexity and (2) the identification of molecules that are active in the screens used. In addition, Morgan et al. states that the greater the degree of complexity of a library, i.e., the number of distinct structures present in the library, the greater the probability that the library contains molecules with the activity of interest. Thus, the chemistry employed in library synthesis must be capable of producing vast numbers of compounds within a reasonable time frame. This approach has been generally successful at identifying molecules with diverse chemotypes and high affinity. However, a number of issues have surfaced with respect to generating libraries of enormous complexity and evaluating the sequencing output on the scale that has been described. For example, purification of a library following multiple chemical transformations (e.g.. usually 3 or 4 steps) and biological transformations (e.g., enzymatic ligation of DNA tags) is cumbersome and results in a significant amount of "noise" in the library due either to incomplete synthesis of molecules or to mis-tagging during the ligation step. Furthermore, the amount of sequencing that is required to interrogate selected populations is striking, usually requiring "nextgeneration" sequencing methods. The latter is due to the fact that sophisticated genetic tagging schemes embedded in the DNA portion of the library, together with bioinformatics algorithms for analyzing the "nextgeneration" sequencing output, are required to sift through the noise and identify hits in the library. As a result, even with these methodologies, the sequencing is still not advanced enough to fully capture the diversity of sequences (representing both real hits and "noise") from a given screen.
DNA display of combinatorial small molecule libraries relies on multistep, split-and-pool synthesis of the library, coupled to enzymatic addition of DNA tags that encode both the synthetic step and building block used. Several (e.g., 3 or 4) synthetic steps are typically carried out and encoded, and these include diversity positions (described herein as A. B, and C (Fig. I)), such as those formed by coupling building blocks with, e.g., amine or carboxylate functional groups onto a chemical scaffold that displays the attached building blocks in defined orientations. One example of a scaffold (S) that is often used in combinatorial libraries is a triazine moiety, which can be orthogonally derivatized in three positions about its ring structure.
The process of library formation can be time consuming, products are often inefficiently purified, and the result is that unknown reactions may occur that create unwanted and/or unknown molecules attached to the DNA. Furthermore, incomplete purification of the library can result in tags cross-contaminating during the ligation steps, resulting in mis-tagging. The end result for screening and sequencing hits from the library is that massively parallel sequencing has to be employed due the inherent "noise" of both DNAs that are attached to molecules that are unintended (e.g., unreacted or side products) or that are mis-tagged. Thus, the efficiency of sequencing is lost.
In some instances, an initiator oligonucleotide, from which the small molecule library is built, contains a primer-binding region for polymerase amplification (e.g., PCR) in the form of a covalently-closed, double-stranded oligonucleotide. This construct is very problematic for performing polymerase reactions, owing to the difficulty of melting the duplex and allowing a primer oligonucleotide to bind and initiate polymerization, which results in an inefficient reaction, reducing yield by 10- to 1000-fold or more. There exists a need for a more step-wise approach to screening and identifying small molecules that have greater potency and little to no toxicity. SUMMARY OF THE INVENTION
The present invention features a method for creating and screening simplified DNA-encoded libraries, owing to fewer synthetic steps (e.g., no enzymatic ligation or no covalently closed initiator double-stranded oligonucleotides) and, therefore, substantially less "noise" during the analysis of the encoded oligomers (herein termed "identifier regions"). Thus, sequencing becomes much more efficient, or alternatively, microarray analysis becomes possible, taking into account the inherent biases that can confound interpretation of the data that can be introduced by amplification of the encoding region. We also have identified methods for creating a greater diversity of chemical reactions rather than those simply limited to aqueous conditions to render the DNA-encoded library more hydrophobic and soluble in organic solvents for subsequent steps of library synthesis. In this manner, chemical reactions can be carried out with potentially higher yield, a greater diversity of building blocks, and improved fidelity of the chemical reactions. Accordingly, the present invention features a method of tagging DNA- encoded chemical libraries by binding a first functional group of a bifunctional linker to an initiator oligonucleotide at the 5' end of the initiator oligonucleotide, wherein the initiator oligonucleotide forms a hairpin structure, and binding a second functional group of the bifunctional linker to a component of the chemical library. The initiator oligonucleotide may include a first identifier region and a second identifier region, such that the second identifier region hybridizes to the first identifier region of the initiator oligonucleotide. The second identifier region may include a fluorescent tag (e.g., a fluorophore or GFP) or biotin label. In addition, the second identifier region is not amplified prior to analysis following a selection step. In another embodiment, the invention features a method of creating DNΛ- encoded libraries by (a) creating a first diversity node, (b) encoding the first diversity node in separate vessels, (c) pooling the first diversity node, and (d) splitting the pooled first diversity node into a second set of separate vessels, wherein the first diversity node reacts to form a second diversity node. In certain embodiments, the second diversity node is not encoded and pooled.
In another embodiment, the present invention features a method for creating libraries using semi- or non-aqueous (e.g., organic) chemical reactions with higher yield, a greater diversity of building blocks, and a greater number of chemical reactions that can be used to create more DNA-tagged combinatorial libraries than previously achieved.
In general, the methods of the present invention provide a set of libraries containing, e.g., one or two diversity positions on a chemical scaffold that can be efficiently generated at high yield, screened to identify preferred individual building blocks or combinations of building blocks that reside at the, e.g., one or two diversity positions, and iteratively diversified at, e.g., a second, third, and/or fourth diversity position to create molecules with improved properties. In addition, the methods described herein allow for an expansive and extensive analysis of the selected compounds having a desired biological property, which, in turn, allows for related compounds with familial structural relationships to be identified (e.g., structure- activity relationships).
By "scaffold" is meant a chemical moiety which displays diversity node(s) in a particular special geometry. Diversity node(s) are typically attached to the scaffold during library synthesis, but in some cases one diversity node can be attached to the scaffold prior to library synthesis (e.g., addition of identifier regions). In some embodiments, the scaffold is derivatized such that it can be orthogonally deprotected during library synthesis and subsequently reacted with different diversity nodes (e.g., using identifier tagging at each step). By "identifier region" is meant the DNA tag portion of the library that encodes the building block addition to the library.
By "initiator oligonucleotide" is meant the starting oligonucleotide for library synthesis which also contains a covalently attached linker and functional moiety for addition of a diversity node or scaffold. The oligonucleotide can be single- or double- stranded. The oligonucleotide can consist of natural or modified bases.
By "functional moiety" is meant a chemical moiety comprising one or more building blocks that can be selected from any small molecule or designed and built based on desired characteristics of, for example, solubility, availability of hydrogen bond donors and acceptors, rotational degrees of freedom of the bonds, positive charge, negative charge, and the like. The functional moiety must be compatible with chemical modification such that it reacts with the headpiece. In certain embodiments, the functional moiety can be reacted further as a bifunctional or trifunctional (or greater) entity. Functional moieties can also include building blocks that are used at any of the diversity nodes or positions. Examples of building blocks and encoding DNA tags are found in Tables 1 and 2. See, e.g., U.S. Patent Application Publication No. 2007/0224607, hereby incorporated by reference.
By "building block" is meant a chemical structural unit which is linked to other chemical structural units or can be linked to other such units. When the functional moiety is polymeric or oligomeric, the building blocks are the monomelic units of the polymer or oligomer. Building blocks can also include a scaffold structure (e.g., a scaffold building block) to which is, or can be, attached one or more additional structures (e.g., peripheral building blocks). The building blocks can be any chemical compounds which are complementary (i.e., the building blocks must be able to react together to form a structure comprising two or more building blocks). Typically, all of the building blocks used will have at least two reactive groups, although some of the building blocks used will have only one reactive group each. Reactive groups on two different building blocks should be complementary, i.e., capable of reacting together to form a covalent bond.
By "linker" is meant a molecule that links the nucleic acid portion of the library to the functional displayed species. Such linkers are known in the art, and those that can be used during library synthesis include, but are not limited to, 5'-O- Dimethoxytrityl-r,2'-Dideoxyribose-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite; 9-O-Dimethoxytrityl-triethylene glycol, l-[(2-cyanoethyl)-(N,N- diisopropyl)]-phosphoramidite; 3-(4,4'-Dimethoxytrityloxy)propyl- 1 -[(2-cyanoethyl)- (N,N-diisopropyl)]-phosphoramidite; and 18-O-Dirnethoxytritylhexaethyleneglycol, 1 - [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite. Such linkers can be added in tandem to one another in different combinations to generate linkers of different desired lengths. By "branched linker" is meant a molecule that links the nucleic acid position of the library to 2 or more identical, functional species of the library. Branched linkers are well known in the art and examples can consist of symmetric or asymmetric doublers (1) and (2) or a symmetric trebler (3). See, for example, Newcome et al., Dendritic Molecules: Concepts, Synthesis, Perspectives, VCH Publishers (1996); Boussif et al., Proc. Natl. Acad. ScL USA 92: 7297-7301 (1995); and Jansen et al., Science 266: 1226 (1994).
As used herein, the term "oligonucleotide" refers to a polymer of nucleotides. The oligonucleotide may include DNA or any derivative thereof known in the art that can be synthesized and used for base-pair recognition. The oligonucleotide does not have to have contiguous bases, but can be interspersed with linker moieties. The oligonucleotide polymer may include natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine), nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, C5-propynylcytidine, C5-propynyluridine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-methylcytidine, 7- deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine), chemically modified bases, biologically modified bases (e.g., methylated bases), intercalated bases, modified sugars (e.g., T- fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose), and/or modified phosphate groups (e.g., phosphorothioates and 5'-N-phosphoramidite linkages). By "operatively linked" is meant that two chemical structures are linked together in such a way as to remain linked through the various manipulations they are expected to undergo. Typically, the functional moiety and the encoding oligonucleotide are linked covalently via an appropriate linking group. For example, the linking group may be a bifunctional moiety with a site of attachment for the encoding oligonucleotide and a site of attachment for the functional moiety.
By "small molecule" is meant a molecule that has a molecular weight below about 1000 Daltons. Small molecules may be organic or inorganic, and may be isolated from, e.g., compound libraries or natural sources, or may be obtained by derivatization of known compounds.
Other features and advantages of the invention will be apparent from the following detailed description, the drawings, the examples, and the claims.
BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a schematic illustrating the diversity positions A, B, and C. Fig. 2 is a schematic of a DNA-encoded chemical library member of Mode 1, showing, in part, the initiator oligonucleotide, which includes a hairpin structure complementary at the identifier region, which has been reacted with A and B diversity nodes. The identifier region for B is being added. In this figure, the "C" diversity node is the potential position for an additional diversity position to be added following the addition of B identifier region. Fig. 3 is a schematic of a DNA-encoded chemical library member of Mode 1, showing, in part, the initiator oligonucleotide, which includes a sequence in the loop region of the hairpin structure that can serve as a primer binding region for amplification. Fig. 4 is a schematic of a DNA-encoded chemical library member of Mode 1, showing, in part, the initiator oligonucleotide, which includes a non-complementary sequence on the 3' end of the molecule that can serve to bind a second identifier region for either polymerization or for enzymatic ligation.
Fig. 5 is a schematic of a DNA-encoded chemical library member of Mode 1, showing, in part, the initiator oligonucleotide, wherein the loop region of the initiator oligonucleotide and at least the identifier region on the 3' side of the loop region can serve to hybridize to a complementary oligonucleotide that also contains a second identifier region.
Fig. 6 is a schematic of PCR amplification of the hairpin model, as presented in Figure 5.
Fig. 7 is a schematic of a DNA-encoded chemical library member of Mode 2, showing a hairpin oligonucleotide that is covalently closed (e.g., via a hairpin or chemically) on the distal end to the linker.
Fig. 8 is a schematic of a DNA-encoded chemical library member of Mode 2, showing the inclusion of additional diversity nodes.
Fig. 9 is a schematic of a DNA-encoded chemical library member of Mode 2, showing the steps for screening of libraries and methods for deconvoluting the identifier regions.
Fig. 10 is a schematic showing oligonucleotides used in library synthesis. Headpiece (HP) was synthesized by IDT DNA and HPLC purified. Arrows indicate the site for BbvCI restriction (underlined) or Nb.BbvCI or Nt.BbvCI nicking digest. Sequences of the DNA tags Al, Bl, and Cl (top and bottom strands), the 5' and 3* PCR primers, and the 3' end of the HP are also shown.
Fig. 11 is an electrophoretic gel (TBE-urea (15%) gel electrophoresis; UV shadowing on a TLC plate) of the headpiece at different steps of its synthesis.
Headpiece HP (IDT DNA) was acylated by Fmoc-amino-PEG2000-NHS (JenKem Technology USA). Lane 1 is the HP (IDT DNA) oligonucleotide (42 nts). Lane 2 is HP acylated with Fmoc-amino-PEG2000-NHS. Following Tris-HCl addition, some deprotection of Fmoc is observed. Lane 3 is the crude reaction with piperidine, showing complete deprotection of Fmoc. Lane 4 is the same as Lane 3 after desalting on a NAP-5 column and lyophilization. (XC: xylene cyanol (migrates as 60 nt DNA); BPB: bromophenol blue (migrates as 15 nt DNA) Fig. 12 is a schematic showing the steps in model library synthesis. DTAF was conjugated to amino-PEG modified headpiece (HP-I) in the first step. Following this step, a portion of HP-I-DTAF was further acylated with pentylamino-biotin.
Fig. 13A is a scheme of the ligation of the DNA tags. Fig 13B illustrates a 4% agarose gel of HP-I -DTAF -biotin library at different steps of the DNA tag ligation. M: marker; Lane 1: HP-1-DTAF-biotin; Lane 2: 1 I Tag A only; Lane 3: 1 + Tags A, B, and C, as well as 3'-end oligo ligated. Arrow indicates bright green fluorescence (DTAF). No substantial separation is observed on the gel. Fig. 13C illustrates PCR amplification (24 cycles) of the ligation reactions. M: marker (lowest band is 100); Lane 1 : PCR amplification of the green fluorescent band from Lane 1 of Fig. 14B (HP-1-DTAF-biotin + Tag A); Lane 2: PCR amplification of the green fluorescent band from Lane 2 of Fig. 13B (HP-1-DTAF-biotin + all 3 tags and 3'-end oligo); Lane 3: PCR amplification of the crude ligation reaction HP-1-DTAF-biotin + all 3 tags; Lane 4: no template control.
Fig. 14 is a set of electrophoretic gels showing the purification of the XChem model compound and model selection (via a binding interaction between the biotin moiety of the XChem model compound and streptavidin). The gels are 4-12% SDS NuPage gels with MES running buffer. Gels were scanned for green fluorescence using a 450-nm laser. Fig. 14A is a gel showing synthesis and purification steps. Samples were mixed with loading buffer and boiled. M: marker; Lane 1 : HP-I + DTAF; Lanes 2 and 2a: HP-I-DTAF + biotin (two independent reactions); Lanes 3-6 (steps of purification/model selection using streptavidin Dynal beads): Lane 3: flow- through; Lane 4: last wash (washed with water at 800C for 10 minutes); Lanes 5 and 5': elution with 25 mM EDTA at 9O0C (1st and 2nd); Lanes 6 and 6': elution with 25 mM EDTA and 5 mM NaOH at 900C (1st and 2nd). Fig. 14B is a gel showing binding of HP-1-DTAF-biotin ("library of 1") to streptavidin. Samples were mixed with gel loading buffer and directly loaded onto the gel without boiling. Samples, as in the gel of Fig. 14A, were incubated with an excess of streptavidin in 50 mM NaCl/10 mM Tris HCl, pH 7.0, for 10 minutes. "S" indicates the addition of streptavidin. Samples 5 and 6 were pooled together. Lane 1 : HP-I-DTAF; Lane IS: HP-I-DTAF + streptavidin; Lane 2: HP-1-DTAF-biotin (desalted); Lane 2S: HP-1-DTAF-biotin + streptavidin; Lane 4: last wash (washed with water at 8O0C for 10 minutes); Lane 4S: last wash sample + streptavidin; Lane 5+6: pooled samples 5, 5', 6 and 6' (elution fractions from streptavidin beads, purified and selected HP-1-DTAF-biotin; Lane 5+6S': purified and selected HP-1-DTAF-biotin + streptavidin. Note that there is no noticeable difference in migration between different the steps of "library of 1" synthesis. Fig. 14C is a 4% agarose gel of headpiece (Trilink) HP-T, reacted with DTAF. Lane 1: Marker; Lane 2: DTAF; Lane 3 HP-T-DTAF. Left panel: UV visualization of the gel (ethidium bromide staining); Right panel: same gel scanned for fluorescence at excitation wavelength 450 nm (green, fluorescein). Fig 14D is a 4- 12% SDS NuPage gel with MES running buffer, showing binding of HP-T-DTAF- biotin to streptavidin. Samples were mixed with gel loading buffer and directly loaded onto the gel without boiling. Samples, as in the gel of Fig. 14A, were incubated with an excess of streptavidin in 50 mM NaCl/10 raM Tris HCl, pH 7.0, for 10 minutes. Lane 1 : DTAF; Lane 2: HP-T-DTAF; Lane 3: HP-T-DTAF + streptavidin; Lane 4: HP-T-DTAF-biotin (desalted); Lane 5: HP-T-DTAF-biotin + streptavidin; Lane 6: pooled samples 5, 5', 6 and 6' (elution fractions from streptavidin beads, purified and selected HP-1-DTAF-biotin; Lane 7: purified and selected HP- 1 -DTAF-biotin + streptavidin.
Fig. 15Λ is a scheme of the synthesis of the construct for the T7 RNAP intracellular delivery experiment. The VH dsDNA clone was PCR amplified to append a Bsml site at the 5' end upstream of the T7 promoter. Following restriction digestion and purification, the construct was ligated to HP-1-DTAF-R7 (headpiece modified with DTAF and (-Arg-εAhx)δ-Arg peptide). Fig. 15B is an electrophoretic gel of the ligation reaction. Lanes 1 and 2 show different HP-I samples ligated to VH; Lane 3 shows unligated VH PCR product; and M is the marker. Fig. 15C is an electrophoretic gel showing validation for T7 promoter activity. The gel shows a T7 Megascript (Ambion, Inc.) reaction using samples from Lanes 1-3 of Fig. 15B. Fig. 16 is an agarose gel electrophoresis of the steps in library 10x10 synthesis
Fig. 16A is a 4% agarose gel of headpiece (Trilink) HP-T ligated with tag A. Lane 1 : Marker; Lane 2: HP-T; Lane 3: Tag A annealed; Lane 4: HP-T ligated with tag A; Lane 5: HP-T ligated with tag A and desalted on Zeba column. Fig. 16B is a 2% agarose gel of HP-T-A ligation with 12 different tags B. Lane M: Marker, Lanes 1 and 9: HP-T-A; Lanes 3, 4, 5, 6, 7, 8, 11, 12, 13, 14, 15 and 16: HP-T-A ligation with tags Bl- B 12. Fig 16C is a 4% agarose gel of the pooled library (library B), with tags A and Bl -B 12 ligated, after reaction with cyanouric chloride and amines Bl -B 12. Lane 1 : Marker; Lane 2: HP-T-A; Lane 3: Library-B pooled and desalted on Zeba columns.
DETAILED DESCRIPTION OF THE INVENTION
The present invention features a number of methods for identifying one or more compounds that bind to a biological target. The methods include synthesizing a library of compounds, wherein the compounds contain a functional moiety having one or more diversity positions. The functional moiety of the compounds is operatively linked to an initiator oligonucleotide that identifies the structure of the functional moiety. In summary, Mode 1 provides a number of methods to preserve the double- stranded character of the dsDNA during library synthesis, which is important during the chemical reaction step, and can be used (as shown in Figs. 2-6) for generating up to two diversity nodes. Mode 2 (Figs. 7-9) anticipates one node of diversity and uses a hairpin oligonucleotide that is covalently closed (e.g., via a hairpin or chemically) on the distal end to the linker. Mode 3 provides methods to create libraries with one, two, three, or more nodes of diversity. Modes 1, 2, and 3 are described in detail below.
Mode l
The present invention features a method for identifying one or more compounds that bind to a biological target. The method includes synthesizing a library of compounds, wherein the compounds contain a functional moiety having no greater than two diversity positions. The functional moiety of the compounds is operatively linked to an initiator oligonucleotide that identifies the structure of the functional moiety by providing a solution containing A initiator compounds. The initiator oligonucleotide includes a linker L (e.g., polyethylene glycol) with an integer of one or greater, wherein the initiator oligonucleotides contain a functional moiety that includes A building blocks attached to L and separated into A reaction vessels, wherein A is an integer of two or greater, which is operatively linked to an initiator oligonucleotide that identifies the A building blocks.
In some embodiments, the A building blocks can be further derivatized through a common node S. In other embodiments, A is subsequently transformed with S, S being a scaffold molecule that allows further nodes of diversity introduction. In some embodiments, A-S can be screened directly, representing a single node of diversity. In other embodiments, the A-S reaction vessels (e.g., which may first include a purification of A-S from starting materials) are mixed together and aliquoted into B reaction vessels, wherein B is an integer of one or greater, and reacted with one of B building blocks. A-S-B, still in B reaction vessels, is in some cases reacted with a C building block, where C is an integer of one, is purified, and subjected to a polymerization or ligation reaction using B primers, in which the B primers differ in sequence and identify the B building blocks.
In certain embodiments, A-S can be an integer of one. In one embodiment, A- S can be linked directly to B initiator oligonucleotides, and following reaction of B building blocks, the B reactions are mixed. In certain embodiments, the A-S-B mixture, where B represents the only diversity node, is screened directly, representing a single node of diversity. In other embodiments, the A-S-B mixture, where B represents the only diversity node, is subsequently aliquoted into C reaction vessels, reacted with C building blocks, and subjected to second strand polymerization or ligation reaction using C primers, in which the C primers differ in sequence and identify the C building blocks.
In certain embodiments, B can be an integer of one and A-S is greater than one, in which case A-S, now derivatized with B, is aliquoted into C reaction vessels, reacted with C building blocks, and subjected to second strand polymerization reaction using C primers, in which the C primers differ in sequence and identify the C building blocks. This general strategy can be expanded to include additional diversity nodes (e.g., D, E, F, etc.) so that the first diversity node is reacted with building blocks and/or S and encoded by an initial oligonucleotide, mixed, re-aliquoted into vessels and then the subsequent diversity node is derivatized by building blocks, which is encoded by the primer used for the polymerization or ligation reaction.
In certain embodiments, A can be an integer of one, B can be an integer of one, and C initiator oligonucleotides are used. A-S-B, attached to C initiator oligonucleotides, is formed in C reaction vessels, reacted with C building blocks, and screened directly.
In certain embodiments, S is reacted first with the initiator oligonucleotide, and A, B and/or C (e.g., or D, E, F, and so on) are subsequently reacted. In certain embodiments, A, B, or C (e.g., or D, E, F, and so on) can contain sites for additional diversity nodes. If this is the case, then S may or may not be used or needed to introduce additional diversity nodes.
In one embodiment, the initiator oligonucleotide includes a hairpin structure complementary at the identifier region (Fig. T). The identifier region can be, e.g., 2 to 100 base pairs in length, preferably 5 to 20 base pairs in length, and most preferably 6 to 12 base pairs in length. The initiator oligonucleotide further includes a sequence in the loop region of the hairpin structure that can serve as a primer binding region for amplification (Fig. 3), such that the primer binding region has a higher melting temperature for its complementary primer (e.g., which can include flanking identifier regions) than the identifier region alone.
In one embodiment, the loop region may include modified bases that can form higher affinity duplex formations than unmodified bases, such modified bases being known in the art (Fig. 3). The initiator oligonucleotide can further include a non- complementary sequence on the 3' end of the molecule that can serve to bind a second identifier region for either polymerization or for enzymatic ligation (Fig. 4). In one embodiment, the strands can be subsequently crosslinked, e.g., using psoralen. In another embodiment, the loop region and at least the identifier region on the 3' side of the loop region can serve to hybridize to a complementary oligonucleotide that also contains a second identifier region (Fig. 5). In cases where many building blocks and corresponding tags are used (e.g., 100 tags), a mix-and-split strategy may be employed during the oligonucleotide synthesis step to create the necessary number of tags. Such mix-and-split strategies for DNA synthesis are known in the art. In one embodiment, the strands can be subsequently crosslinked, e.g., using psoralen. The resultant library members can be amplified by PCR following selection for binding entities versus a target(s) of interest (Fig. 6).
For example, a headpiece, which includes an initiator oligonucleotide, may be reacted with a linker and A, which includes, for example, 1000 different variants. For each A building block, a DNA tag A may be ligated or primer extended to the headpiece. These reactions may be performed in, e.g., a 1000-well plate or 10 x 100 well plates. All reactions may be pooled, optionally purified, and split into a second set of plates. Next, the same procedure may be performed with B building blocks, which also include, for example, 1000 different variants. A DNA tag B may be ligated to the headpiece, and all reactions may be pooled. A library of 1000 x 1000 combinations of A to B (i.e., 1,000,000 compounds), tagged by 1,000,000 different combinations of tags. The same approach may be extended to add variants C, D, E, etc. The generated library may then be used to identify compounds that bind to the target. The composition of the compounds that bind to the library can be assessed by PCR and sequencing of the DNA tags to identify the compounds that were enriched.
Mode 2
In another embodiment (Fig. 7), the method includes synthesizing a library of compounds, wherein the compounds contain a functional moiety having no greater than two diversity positions. The functional moiety of the compounds is operatively linked to an initiator oligonucleotide, which contains a unique genetic sequence that identifies the structure of the functional moiety by providing a solution comprising A initiator compounds, wherein L is an integer of one or greater, where the initiator compounds include a functional moiety having A building blocks separated into A reaction vessels, where, e.g., A is an integer of two or greater, which is operatively linked to an initial oligonucleotide which identifies the A building blocks. In some embodiments, the A building blocks are pre-derivatized with a common S. In other embodiments, A is subsequently transformed with S, S being a scaffold molecule that allows further nodes of diversity introduction. Next, the A-S reaction vessels (which may first include a purification of A-S from starting materials) are mixed together and aliquoted into B reaction vessels, wherein B is an integer of one or greater, and reacted with one of B building blocks. A-S-B, still in B reaction vessels is, in some embodiments, reacted with a C building block, where C is an integer of one, are purified, and kept separate in B vessels for screening. In some embodiments, A-S is an integer of one. In one embodiment, A-S can be linked directly to B initiator oligonucleotides and, following the reaction of B building blocks, the B reactions are mixed and aliquoted into C reaction vessels, reacted with C building blocks, and kept separate in C vessels for screening. In other embodiments, B can be an integer of one and A-S is greater than one, in which case A-S, now derivatized with B, is aliquoted into C reaction vessels reacted with C building blocks, and kept separate in C vessels for screening. This general strategy can be expanded to include additional diversity nodes (e.g., D, E, F, etc.) so that the first diversity node is reacted with building blocks and/or S and encoded by an initiator oligonucleotide, mixed, re-aliquoted into vessels, and then the subsequent diversity node is derivatized by building blocks and kept in their respective vessels for screening (Fig. 8).
For example, as described in Mode 1 , a headpiece, which includes an initiator oligonucleotide, may be reacted with a linker and A building blocks, which include, for example, 1000 different variants. For each A building block, a DNA tag A may be ligated or primer extended to the headpiece. The reactions may be pooled. Next, the same procedure may be performed with B building blocks, but a DNA tag is not added for B. Because B is not coded for, all "B" reactions may be pooled (e.g., 1000 reactions) and a selection step may be performed to identify all A building blocks that produce the desired binding effect with unknown B building blocks. A library of A building blocks identified in the selection step (e.g., 10 A building blocks) may then be reacted with the same 1000 B building blocks, resulting in a screen of 10,000 compounds or less. In this round, DNA tags for B may be added and B building blocks that produce the desired binding effect in combination with the, e.g., 10 A building blocks can be identified, resulting in a step-wise convolution of an initial library of, for example, 1,000,000 compounds. A set of these final compounds may be individually tested to identify the best, e.g., binders, activators, or inhibitors.
To avoid pooling all of the reactions after B synthesis, a BIND Reader (SRU Biosystems), for example, may be used to monitor binding on a sensor surface in high throughput format (e.g., 384 well plates and 1536 well plates). For example, the A building blocks may be encoded with DNA tags and the B building blocks may be position encoded. Binders can then be identified using a BIND sensor, sequencing, and microarray analysis or restriction digest analysis of the A tags. This analysis allows for the identification of combinations of A and B building blocks that produce the desired molecules. Other methods for monitoring binding known to those of skill in the art may be used including, e.g., ELISA. Modes 1 and 2
The initiator oligonucleotide of Modes 1 and 2 may contain a hairpin structure, complementary at the identifier region. The initiator oligonucleotide further contains a sequence in the loop region of the hairpin structure that can serve as a primer-binding region for amplification, such that the primer binding region has a higher melting temperature for its complementary primer (which can include flanking identifier regions) than the identifier region alone.
In one embodiment, the initiator oligonucleotide includes a linker molecule capable of being functionally reacted with building blocks. The linker molecule can be attached directly to the 5' end of the oligonucleotide through methods known in the art or can be embedded within the molecule, e.g., off of a derivatized base (e.g., the C5 position of uridine), or the linker can be placed in the middle of the oligonucleotide using standard techniques known in the art.
The initiator oligonucleotide may be single-stranded or double-stranded. The formation of a double-stranded oligonucleotide may be achieved through hairpin formation of the oligonucleotide or through cross-linking using, e.g., a psoralen moiety, as known in the art.
The initiator oligonucleotide may contain two primer-binding regions (e.g., to enable a PCR reaction) on either side of the identifier region that encodes the building block. Alternatively, the initiator oligonucleotide may contain one primer-binding site on the 5' end. In other embodiments, the initiator oligonucleotide is a hairpin, and the loop region forms a primer-binding site or the primer-binding site is introduced through hybridization of an oligonucleotide to the identifier region on the 3' side of the loop. A primer oligonucleotide, containing a region homologous to the 3' end of the initiator oligonucleotide and carrying a primer binding region on its 5' end (e.g., to enable a PCR reaction) may be hybridized to the initiator oligonucleotide, and may contain an identifier region that encodes the building blocks used at one of the diversity positions. The primer oligonucleotide may contain additional information, such as a region of randomized nucleotides, e.g., 2 to 16 nucleotides in length, which is included for bioinformatic analysis.
In one embodiment, the initiator oligonucleotide does not contain a PCR primer-binding site. In another embodiment, the library of compounds, or a portion thereof, is contacted with a biological target under conditions suitable for at least one member of the library of compounds to bind to the target, followed by removal of library members that do not bind to the target, and analyzing the identifier region or regions. Exemplary biological targets include, e.g., enzymes (e.g., kinases, phosphatases, methylases, demethylases, proteases, and DNA repair enzymes), proteins involved in protein :protein interactions (e.g., ligands for receptors), receptor targets (e.g., GPCRs and RTKs), ion channels, bacteria, viruses, parasites, DNA, RNA, prions, or carbohydrates). In one embodiment, the library of compounds, or a portion thereof, is contacted with a biological target under conditions suitable for at least one member of the library of compounds to bind to the target, followed by removal of library members that do not bind to the target, followed by amplification of the identifier region by methods known in the art, and subsequently analyzing the identifier region or regions by methods known in the art.
In one embodiment the method of amplification of the identifier region can include, e.g., polymerase chain reaction (PCR), linear chain amplification (LCR), rolling circle amplification (RCΛ), or any other method known in the art to amplify nucleic acid sequences. In a further embodiment, the library of compounds is not pooled following the final step of building block addition and the pools are screened individually to identify compound(s) that bind to a target.
In another embodiment, the molecules that bind to a target are not subjected to amplification, but are analyzed directly. Methods of analysis include, e.g., microarray analysis or bead-based methods for deconvoluting the identifier regions (Fig. 9). Molecules that bind during the screening step may also be detected by a label-free photonic crystal biosensor.
In one embodiment, the initiator oligonucleotide and/or the primer oligonucleotide contain a functional moiety that allows for its detection by, e.g., fluorescent tags, Q dots, or biotin.
In one embodiment, the microarray analysis uses advanced detection capability, such as, e.g., evanescent resonance photonic crystals. In one embodiment, the method of amplifying includes forming a water-in-oil emulsion to create a plurality of aqueous microreactors, wherein at least one of the microreactors has at least one member of a library of compounds that binds to the target, a single bead capable of binding to the encoding oligonucleotide of the at least one member of the library of compounds that binds to the target, and amplification reaction solution containing reagents necessary to perform nucleic acid amplification, amplifying the encoding oligonucleotide in the microreactors to form amplified copies of the encoding oligonucleotide, and binding the amplified copies of the encoding oligonucleotide to the beads in the microreactors. Once the building blocks from the first library that bind to the target of interest have been identified, a second library may be prepared in an iterative fashion, in which one or two additional nodes of diversity are added, and the library is created and diversity sampled as described herein. This process can be repeated as many times as necessary to create molecules with desired molecular and pharmaceutical properties.
Exemplary A building blocks include, e.g., amino acids (not limited to alpha- amino acids), click-chemistry reactants (e.g., azide or alkine chains) with an amine, or a thiol reactant. The choice of A building block depends on, for example, the nature of the reactive group used in the linker, the nature of a scaffold moiety, and the solvent used for the chemical synthesis. See, e.g., Table 1.
Table 1. Exemplary Position A Building Blocks
Figure imgf000018_0001
Figure imgf000019_0001
Exemplary B and C building blocks are described in Tables 2 and 3, respectively. A restriction site may be introduced, for example, in the B or C position for analysis of the final product and selection by performing PCR and restriction digest with one of the corresponding restriction enzymes.
Table 2. Examples of Position B Building Blocks and Encoding DNA Tags
Figure imgf000020_0001
Figure imgf000021_0001
Table 3. Examples of Position C Building Blocks and Encoding DNA Tags
Figure imgf000021_0002
Figure imgf000022_0001
Figure imgf000023_0001
Mode 3
In either of the modes described herein (e.g., Modes 1 and X), the headpiece oligonucleotide may be modified to support solubility in semi- or non-aqueous (e.g., organic) conditions. The headpiece, in certain embodiments, includes the identifier region. In other embodiments, the headpiece with linker can first be derivatized with a building block (e.g., a functional moiety) or scaffold, and the identifier sequence is then added.
Nucleotide bases of the headpiece can be rendered more hydrophobic by modifying, for example, the C5 positions of T or C bases with aliphatic chains without significantly disrupting their ability to hydrogen bond to their complementary bases. See, e.g., Table 4 for examples of modified bases. In addition, the headpiece oligonucleotide can be interspersed with modifications that promote solubility in organic solvents. For example, azobenzene phosphoramidite can introduce a hydrophobic moiety into the headpiece design. Such insertions of hydrophobic amidites into the headpiece can occur anywhere in the molecule. However, the insertion cannot interfere with subsequent tagging using additional DNA tags during the library synthesis or ensuing PCR reactions once a selection is complete or microarray analysis, if used for tag deconvolution. Such additions to the headpiece design described herein would render the headpiece soluble in, for example, 15%, 25%, 30%, 50%, 75%, 90 %, 95%, 98%, 99%, or 100% organic solvent. Thus, addition of hydrophobic residues into the headpiece design allows for improved solubility in semi- or non-aqueous (e.g., organic) conditions, while rendering the headpiece competent for nucleic acid tagging. Furthermore, DNA tags that are subsequently introduced into the library can also be modified at the C5 position of T or C bases such that they also render the library more hydrophobic and soluble in organic solvents for subsequent steps of library synthesis.
Table 4. Exemplary modified nucleotide bases
Figure imgf000024_0001
5'-Dimethoxytrityl-5-(l-Propynyl)-2'-
5 '-Dimethoxytrityl-N4- deoxyUridine,3'-[(2-cyanoethyl)- diisobutylaminomethylidene-5-(l - (N,N-diisopropyl)]-phosphoramidite
Propynyl)-
2'-deoxyCytidine,3'-[(2-cyanoethyl)- (N,N-diisopropyl)]-phosphoramidite
Figure imgf000024_0002
5'-Dimethoxytrityl-5-fluoro-2'- dcoxyUridinc,3'-[(2-cyanoethyl)- 5'-Dimethoxytrity]-5-(pyren-l-yl-
(N,N-diisopropyl)]-phosphoramidite ethynyl)-2 '-deoxyUridine,
3 '- [(2-cyanoethyl)-(N,N-diisopropyl)] - phosphoramidite The linker molecule between the headpiece and small molecule library can be varied to increase the solubility of the headpiece in organic solvent. A wide variety of linkers are commercially available that can couple the headpiece with the small molecule library. Linkers are empirically selected for a given small molecule library design (scaffolds and building blocks) such that the library can be synthesized in organic solvent, for example, 15%, 25%, 30%, 50%, 75%, 90 %, 95%, 98%, 99%, or 100% organic solvent. The linker can be varied using model reactions prior to library synthesis to select the appropriate chain length that solubilizes the headpiece in organic solvent. Such linkers may include linkers with, e.g., increased alkyl chain length, increased polyethylene glycol units, branched species with positive charges (to neutralize the negative phosphate charges on the headpiece), or increased amounts of hydrophobicity (for example, addition of benzene ring structures).
The linker molecule may provide an appropriate spacer between the headpiece DNΛ and member of a chemical library. For example, bifunctional linkers may be used. In certain embodiments, bifunctional linkers may include, for example, three parts. Part 1 may be a reactive group, which forms a covalent bond with DNA, such as, e.g., a carboxylic acid, preferably activated by a N-hydroxy succinimide (NHS) ester to react with an amino group on the DNA (e.g., amino-modified dT), an amidite to modify the 5' or 3' end of a single-stranded DNA headpiece (achieved by means of standard oligonucleotide chemistry), click chemistry pairs (azide alkyne cycloaddition in the presence of Cu(I) catalyst), or thiol reactive groups. Part 2 may also be a reactive group, which forms a covalent bond with the chemical library, either a building block in the position A or scaffold moiety. Such a reactive group could be, e.g., an amine, a thiol, an azide, or an alkyne for water based reactions or multiple other reactive groups for the organic-based reactions. Part 3 may be a chemically inert spacer of variable length, introduced between Part 1 and 2. Such a spacer can be a chain of ethylene glycol units (e.g., PEGs of different lengths), an alkane, an alkene, polyene chain, or peptide chain. The linker can contain branches or inserts with hydrophobic moieties (such as, e.g., benzene rings) to improve solubility of the headpiece in organic solvents, as well as fluorescent moieties (e.g. fluorescein or Cy- 3) used for library detection purposes.
Examples of commercially available linkers include, e.g., amino-carboxylic linkers (e.g., peptides (e.g., Z-Gly-Gly-Gly-Osu or Z-Gly-Gly-Gly-Gly-Gly-Gly- Osu), PEG (e.g., Fmoc-aminoPEG2000-NHS or amino-PEG (12-24)-NHS), or alkane acid chains (e.g., Boc-ε-aminocaproic acid-Osu)), click chemistry linkers (e.g., peptides (e.g., azidohomalanine-Gly-Gly-Gly-OSu or propargylglycine-Gly-Gly-Gly- OSu), PEG (e.g., azido-PEG-NHS), or alkane acid chains (e.g., 5-azidopentanoic acid, (S)-2-(azidomethyl)- 1 -Boc-pyrrolidine, or 4-azido-butan- 1 -oic acid N- hydroxysuccinimide ester)), thiol-reactive linkers (e.g., PEG (e.g., SM(PEG)n NHS- PEG-maleimide), alkane chains (e.g., 3-(pyridin-2-yldisulfanyl)-propionic acid-Osu or sulfosuccinimidyl 6-(3'-[2-pyridyldithio]-propionamido)hexanoate))), amidites for oligonucleotide synthesis (e.g., amino modifiers (e.g., 6-(trifluoroacetylamino)-hexyl- (2-cyanocthyl)-(N,N-diisopropyl)-phosphoramiditc), thiol modifiers (e.g., S-trityl-6- mercaptohexyl-1 -[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, or chick chemistry modifiers (e.g., 6-hexyn-l-yl-(2-cyanoethyl)-(N,N-diisopropyl)- phosphoramidite, 3-dimethoxytrityloxy-2-(3-(3- propargyloxypropanamido)propanamido)propyl-l -O-succinoyl, long chain alkylamino CPG, or 4-azido-butan- 1 -oic acid N-hydroxy succinimide ester)).
Hydrophobic residues in the headpiece design may be varied with the linker design to facilitate library synthesis in organic solvents. For example, the headpiece and linker combination is designed to have appropriate residues wherein the octanohwater coefficient (Poet) is from, e.g., 1.0 to 2.5.
EXAMPLES
The following examples are intended to illustrate the invention. They are not meant to limit the invention in any way.
Example 1. Preparation of the headpiece (Variant 1)
A phosphorylated oligonucleotide headpiece (oligo HP) having the following sequence was synthesized and HPLC purified by IDT DNA.
5 ' -(phosphate)TCCTGGCTGAGGCGAGAGTT(dT-C6-NH)
TTCTCTCGCCTCAGCC AGGACC-3' (SEQ ID NO: 51) The oligonucleotide folds into a hairpin (Fig. 10) with an overhang and contains a cleavage site (CCTCAGC) for restriction enzyme BbvCI or nicking versions of this enzyme Nb.BbvCI or Nt.BbvCI, which can cleave either the top or bottom strand (New England BioLabs). In the middle of the hairpin loop, the side chain C5-amino-modified dT is inserted (dT-C6-NH; "C6" refers to a carbon 6 linker), which was used for the coupling of the amino-PEG linker (PEG2000, approximately 45 ethylene glycol units). The top and bottom strands of the DNA tags A, B, and C were synthesized and purified by IDT DNA and purified by standard desalting. Longer oligonucleotides, such as the 3' end and PCR primers, were synthesized by IDT DNA and HPLC purified.
Ten nanomoles of the oligo HP were dissolved in 50 μl water. A 20-fold molar excess of Fmoc-amino-PEG2000-carboxyl-NHS ester (JenKem Technology USA) was dissolved in 50 μl dimethylformamide (DMF) and was added to the oligonucleotide solution in 2 portions over the course of 2 hours at room temperature (final solvent composition of 50% DMF/50% water). Subsequently, 60 μl of 1 M Tris HCl, pH 7.0 (final concentration of 200 mM), was added to quench the excess of NHS esters, and the solution was incubated for an additional 30 minutes at room temperature. The resulting reaction mixture was diluted to 500 μl with water and was desalted by passing through a NAP-5 column (Sephadex-25, GE Healthcare).
The resulting material was lyophilized and dissolved in 100 μl water. 20 μl of piperidine (to a final concentration of 20%) was added and incubated for 2 hours at room temperature. A cloudy precipitate was formed due to deprotection of the amine and release of the water insoluble Fmoc group. The reaction was then filtered through 0.2-μm spin-filters (Millipore) and precipitated using 300 mM sodium acetate by the addition of 3 volumes of ethanol. The Fmoc-protected form of the modified oligonucleotide was found to be soluble in ethanol and isopropanol. Due to high coupling efficiency, the resulting headpiece (HP-I) was used without further purification (Fig. 11).
Example 2. Preparation of the headpiece (Variant 2)
A complete headpiece (HP-I) having the following sequence was prepared by Trilink, Inc., following a similar procedure as described above, and RP-HPLC purified. 5'-(phosphatc)TCCTGGCTGAGGCGAGAGTT(dT-C6-NH)(X)
TTCTCTCGCCTCAGCCAGGACC-3' (SEQ ID NO: 52) where X stands for amino-PEG2000. Example 3. Synthesis of a model library member
Step 1: Coupling of DTAF
In order to prepare a "library of 1 ," a model compound, 5 -(4,6- dichlorotriazinyl-aminofluorescein) (DTAF; Anaspec) (Fig. 12), was coupled to the amino group of HP-I. DTAF structurally represents a trichlorotriazine scaffold with one amino compound coupled. To form a library, trichlorotriazine scaffolds can be derivatized with a diversity of building blocks at each of the three chlorine positions. DTAF also provides a fluorescent label to the model library. The reaction (10 μl) was set up as follows. To 5 μl of 400 μM HP-I dissolved in water, 2 μl of 750 mM borate buffer, pH 9.5, and 1 μl of DMF were added. DTAF was dissolved in DMF to 50 mM and 2 μl was added to the reaction. Final concentrations of the HP-I and DTAF were 200 μM and 10 mM, respectively, thus generating a 50-fold excess of DTAF. The final DMF concentration was 30%. It was noticed that HP-I stayed soluble in up to 90% DMF, demonstrating that it was soluble in an organic solvent, e.g., DMF. The reaction was allowed to proceed at 40C for 16-20 hours. The reaction mixture was then diluted with water to 30-50 μl and desalted on a Zeba spin column (Pierce). No further purification was completed at this point.
Step 2: Coupling of amino-biotin After DTAF was coupled to HP-I, one more reactive group on the scaffold molecule is still available for modification. We chose an amino-biotin analog, EZ- Link Pentylamine-Biotin (Pierce), to couple at this position in order to generate a model binding compound (Fig. 12). The reaction was set up as follows. 20 μl of the reaction mixture contained around 200 pmol of HP-I-DTAF (Step 1) dissolved in 150 mM borate buffer, pH 9.5, and 10 nmol of pentylamine-biotin. The reaction was allowed to proceed for 4-12 hours at 75°C. The reaction was then purified by desalting on a Zeba spin column, as described above.
Step 3: Ligation of the DNA tags to HP-1-DTAF-biotin Phosphorylated DNA tags (3' end primer region and 5' and 3' PCR primers) were synthesized by IDT DNA. Oligonucleotide sequences (Fig. 13) are as follows.
DNA Tag Al (top): 5'-phos-GGAGGACTGT (SEQ ID NO: 53) DNA Tag Al (bottom): 5'-phos-AGTCCTCCGG (SEQ ID NO: 54) DNA Tag Bl (top): 5 '-phos-C AGACGACGA (SEQ ID NO: 55) DNA Tag Bl (bottom): 5'-phos-GTCGTCTGAC (SEQ ID NO: 56) DNA Tag Cl (top): 5'-phos-CGATGCTCTT (SEQ ID NO: 57) DNA Tag Cl (bottom): 5 '-phos-GAGC ATCGTC (SEQ ID NO: 58)
3' end (top): S'-phos-GCTGTGCAGGTAGAGTGC^' (SEQ ID NO: 59) 3' end (bottom): 5'-AACGACACGTCCATCTCACG (SEQ ID NO: 60) 5' PCR primer: 5'-CTCTCGCCTCAGCCAGGA (SEQ ID NO: 61) 3' PCR primer: 5'-GCACTCTACCTGCACAGC (SEQ ID NO: 62) Equivalent amounts of top and bottom pairs of tags and 3' end oligonucleotides were dissolved in water and annealed by heating to 85°C and ramping down to 40C in 200 mM NaCl, 50 mM Tris HCl, pH 7.0, buffer.
First, the double-stranded Al tag was ligated to the headpiece. The ligation reaction (20 μl) contained 2.5 μM of HP-1-DTAF-biotin and 2.5 μM of double- stranded Al tag in Ix T4 DNA ligase buffer and 60 Weiss units of T4 DNA ligase (New England BioLabs). The reaction was incubated at 160C for 16 hours. The resulting product did not resolve on any of the tested gels, including different percentages of TBE-urea, NativePage, SDS-PAGE, or 2% and 4% agarose E-gel (Invitrogen, Inc.). Mobility of the oligonucleotide, modified with PEG linker and DTAF-biotin, was mostly determined by the presence of these groups rather than by the DNA itself (data not shown). To test the efficiency of the ligation, we ligated all tags and 3' end oligonucleotides and performed PCR assays of the resulting construct to confirm the ligation efficiency. The ligation reaction (70 μl) contained: 2.5 μM of HP-1-DTAF-biotin; 2.5 μM of each of the annealed double-stranded DNA tags (Al, B 1 , and C 1 ), as well as the 3 ' end tag; 1 x T4 DNA ligase buffer; and 210 Weiss units of T4 DNA ligase. The reaction was incubated at 160C for 20 hours.
The reaction mixture was loaded on a 4% agarose gel and the fluorescent band was extracted from the gel. This material was used for the test 24 cycle PCR amplification using primers 5' and 3' as described above. The results are summarized in Fig. 13. Step 4: Purification of HP-I -DTAF-biotin on streptavidin beads and reaction with streptavidin
Purification of HP-I -DTAF-biotin on streptavidin (SA) Dynal magnetic beads M-280 (Invitrogen) serves as a model for affinity selection for the chemical DNA- tagged library. SA beads were pre-equilibrated in 2x PBS buffer containing 0.05% Triton X-100. 50 pmol of HP-I -DTAF-biotin were loaded on 25 μl of the pre-washed SA beads for 15 minutes at room temperature with tumbling. The flow-through was collected and the beads were washed 3 times for 30 minutes with 1 ml of the same buffer. A final wash was performed at 8O0C for 10 minutes with 30 μl water (collected). The beads were eluted with 30 μl of 25 mM EDTA and 5 mM NaOH for 10 minutes at 900C, and the eluent was immediately neutralized by adding 3 μl of 1 M Tris HCl, pH 7.0.
For the streptavidin binding experiment, 5 μl of the elution samples were incubated with an excess of streptavidin in 50 mM NaCl/10 mM Tris HCl, pH 7.0, for 10 minutes. The samples were mixed with gel-loading buffer without boiling and resolved on a 4-12% SDS NuPage gel (Invitrogen) using MES running buffer. The results are summarized in Fig. 14.
Example 4. Coupling of H(-Arg-εAhx)6-Arg-OH peptide to HP-I-DTAF We have chosen an arginine-rich peptide R7, H(-Arg-sAhx)6-Arg-OH
(Bachem), to use as another modification for the last reactive group on the triazine scaffold. This is an arginine-aminohexanoic acid cell membrane permeable peptide used for intracellular compound delivery. The reaction was set up similar to the reaction conditions described above: 20 μl reaction contained around 200 pmol of HP- 1 -DTAF (Step 1 ) dissolved in 150 mM borate buffer, pH 9.5, and 10 nmol of R7 peptide. Under these conditions, the side chains of the arginines do not react, and the only reactive amine in the peptide is the N-terminus. The reaction was allowed to proceed for 12 hours at 750C and was then purified by desalting on a Zeba spin column.
Example 5. DNA construct for intracellular T7 RNAP delivery detection experiment The DNA construct used for the chemical "library of 1" intracellular delivery experiment was prepared from a PCR product of a VH DNA single clone of -400 bp featuring a T7 promoter region at the 5' end and a short antibody constant Cmu region close to the 3' end of the molecule. In order to link the DNA construct to the modified headpiece of the model chemical library, a Bsml restriction site was appended upstream of the T7 promoter region by PCR amplification of the clone. Bsml restriction digest produced a 3' GG overhang, which allowed ligation to the headpiece (3' CC overhang). The 5' primer with Bsml site (underlined) was synthesized by IDT DNA, Inc. 5'-GGATGCCGAATGCCTAATACGACTCACTATAGGG-
ACAATTACTATTTACAATTACA (SEQ ID NO: 63) Following PCR amplification, the DNA construct was purified using a PCR purification kit (Invitrogen), and the resulting DNA was digested with 250 U Bsml (New England BioLabs) at 650C in NEB buffer 4 for 2 hours. The DNA was purified on a 2% agarose gel. The ligation reaction (30 μl) contained 2 pmol of each VH DNA construct, digested with Bsml, as well as HP-I -DTAF -R7 (arginine-aminohexanoic acid peptide) in Ix T4 DNA ligase buffer and 60 Weiss units of T4 DNA ligase (New England BioLabs). The reaction was incubated at 160C for 20 hours. Due to high efficiency of the ligation, the material was further used for the intracellular delivery/T7 RNAP experiment without further purification. The results are summarized in Fig. 15.
Example 6. Synthesis of 10x10 Library
Step 1. Ligation of the tag A to the headpiece HP-T In this exemplary library, only positions B and C are used. One tag A is ligated to HP-T. The tag has the following sequence:
DNA Tag Al (top): 5'-phos-GGAGGACTGT (SEQ ID NO: 64) DNA Tag Al (bottom): 5'-phos-AGTCCTCCGG (SEQ ID NO: 65) 30 nmol of HP-T were mixed with 45 nmol of each Tag Al top and Tag Al bottom oligos in Ix T4 DNA ligase buffer and were annealed by heating to 95°C for 1 minute, followed by cooling to 4°C at 0.2°C/second. The sample was then brought to 160C. 300 Weiss Units of T4 DNA ligase was added and the samples were allowed to incubate for 16-20 hours at 160C. Following the ligation, HP-T-A was desalted using a Zeba column (Pierce). See, e.g., Fig. 16A.
Step 2. Ligation of tags Bl -B 12 and C tags Twelve ligation reactions were set up similar to the ligation reactions described above. In each of 12 tubes, 5 nmol pairs of Bl -B 12 top and bottom oligos were added to Ix T4 DNA ligase buffer and annealed as described above. HP-T-A was dissolved in Ix T4 DNA ligase buffer. 2.5 nmol of HP-T-A were aliquoted in these 12 tubes. 30 Weiss units of T4 DNA ligase were added to each tube and reactions were allowed to proceed for 20 hours at 16°C. Following the incubation, each reaction mixture was individually desalted on a 0.5 ml Zeba spin column, equilibrated with 150 mM borate buffer, pH 9.0. To each tube, a 2Ox excess of cyanouric chloride (50 nmol), dissolved in acetonitrile, was added and incubated for 1.5 hours at 40C. Following this incubation, a 10Ox excess (250 nmol, i.e., 5x excess relative to cyanouric chloride) of amines B 1 -B 12, dissolved in acetonitrile or DMF, was added in correspondence with the ligated Bl -B 12 tags. The reaction with amines was allowed to proceed for 20 hours at 4°C. Following this reaction the library was pooled, desalted twice on 2-ml Zeba columns and lyophilized. See, e.g., Figs. 16B and 16C. Like the reactions above, the C tags and amines are added using similar reaction conditions to those described above.
Other Embodiments
All publications, patents, and patent applications mentioned in the above specification are hereby incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the invention. Other embodiments are in the claims. What is claimed is:

Claims

Claims
1. A method of tagging DNA-encoded chemical libraries, said method comprising binding a first functional group of a bifunctional linker to an initiator oligonucleotide at the 5' end of said initiator oligonucleotide, wherein said initiator oligonucleotide bound to said bifunctional linker forms a hairpin structure, and binding a second functional group of said bifunctional linker to a component of said chemical library.
2. The method of claim 1, wherein said initiator oligonucleotide comprises a first identifier region.
3. The method of claim 2, wherein said initiator oligonucleotide comprises a second identifier region hybridizes to said first identifier region of the initiator oligonucleotide.
4. The method of claim 3, wherein the second identifier region comprises a fluorescent tag or biotin label.
5. The method of claim 4, wherein said second identifier region is not amplified prior to analysis following a selection step.
6. The method of any one of claims 1-5, wherein said bifunctional linker, initiator oligonucleotide, first identifier region, or second identifier region is modified to increase solubility of a member of said DNA-encoded chemical library in organic conditions.
7. A method of creating DNA-encoded libraries, said method comprising: (a) creating a first diversity node; (b) encoding said first diversity node in separate vessels;
(c) pooling said first diversity node; and (d) splitting said pooled first diversity node into a second set of separate vessels, wherein said first diversity node reacts to form a second diversity node.
8. The method of claim 7, wherein the second diversity node is not encoded and pooled.
PCT/US2010/024314 2009-02-13 2010-02-16 Methods of creating and screening dna-encoded libraries Ceased WO2010094036A1 (en)

Priority Applications (24)

Application Number Priority Date Filing Date Title
CA2752543A CA2752543A1 (en) 2009-02-13 2010-02-16 Methods of creating and screening dna-encoded libraries, and associated complexes and dna-encoded chemical libraries
KR1020117021196A KR101789216B1 (en) 2009-02-13 2010-02-16 Methods of creating and screening dna-encoded libraries
EP10741877.4A EP2396459B1 (en) 2009-02-13 2010-02-16 Methods of creating and screening dna-encoded libraries
CN201080007813.3A CN102317513B (en) 2009-02-13 2010-02-16 Methods of generating and screening DNA-encoded libraries
EP17163865.3A EP3211126B1 (en) 2009-02-13 2010-02-16 Methods of creating and screening dna-encoded libraries
JP2011550313A JP5770641B2 (en) 2009-02-13 2010-02-16 Methods for making and screening DNA-encoded libraries
EP19208965.4A EP3653763A1 (en) 2009-02-13 2010-02-16 Methods of creating and screening dna-encoded libraries
BRPI1008429-0A BRPI1008429A2 (en) 2009-02-13 2010-02-16 methods of creating and screening encoded DNA libraries.
NZ594420A NZ594420A (en) 2009-02-13 2010-02-16 Methods of creating and screening dna-encoded libraries
MX2011008563A MX2011008563A (en) 2009-02-13 2010-02-16 METHODS OF CREATING AND ANALYZING / SELECTING DNA CODIFIED LIBRARIES.
KR1020207007550A KR102231531B1 (en) 2009-02-13 2010-02-16 Methods of creating and screening dna-encoded libraries
SG2011057619A SG173627A1 (en) 2009-02-13 2010-02-16 Methods of creating and screening dna-encoded libraries
EA201101205A EA021797B1 (en) 2009-02-13 2010-02-16 METHODS OF CREATING AND SCREENING LIBRARIES CODED BY DNA
DK10741877.4T DK2396459T3 (en) 2009-02-13 2010-02-16 Method for preparing and screening DNA-encoded libraries
ES10741877.4T ES2638324T3 (en) 2009-02-13 2010-02-16 Methods of creating and examining DNA-encoded libraries
KR1020177029869A KR20170119729A (en) 2009-02-13 2010-02-16 Methods of creating and screening dna-encoded libraries
KR1020197018343A KR102091207B1 (en) 2009-02-13 2010-02-16 Methods of creating and screening dna-encoded libraries
AP2011005847A AP3396A (en) 2009-02-13 2010-02-16 Methods of creating and screening DNA-encoded libraries
US13/147,910 US9359601B2 (en) 2009-02-13 2010-02-16 Methods of creating and screening DNA-encoded libraries
IL214399A IL214399B (en) 2009-02-13 2011-08-02 Methods for creating and sifting coded libraries - DNA
US15/147,600 US11168321B2 (en) 2009-02-13 2016-05-05 Methods of creating and screening DNA-encoded libraries
IL263625A IL263625B (en) 2009-02-13 2018-12-10 Methods for creating and sifting coded libraries - DNA
US16/906,626 US12606817B2 (en) 2009-02-13 2020-06-19 Methods of creating and screening DNA-encoded libraries
IL283572A IL283572A (en) 2009-02-13 2021-05-30 Methods for creating and sifting coded libraries - DNA

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US15250809P 2009-02-13 2009-02-13
US61/152,508 2009-02-13

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/147,910 A-371-Of-International US9359601B2 (en) 2009-02-13 2010-02-16 Methods of creating and screening DNA-encoded libraries
US15/147,600 Continuation US11168321B2 (en) 2009-02-13 2016-05-05 Methods of creating and screening DNA-encoded libraries

Publications (1)

Publication Number Publication Date
WO2010094036A1 true WO2010094036A1 (en) 2010-08-19

Family

ID=42562099

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/024314 Ceased WO2010094036A1 (en) 2009-02-13 2010-02-16 Methods of creating and screening dna-encoded libraries

Country Status (16)

Country Link
US (3) US9359601B2 (en)
EP (3) EP3653763A1 (en)
JP (6) JP5770641B2 (en)
KR (4) KR102231531B1 (en)
CN (2) CN107916456B (en)
AP (1) AP3396A (en)
BR (1) BRPI1008429A2 (en)
CA (2) CA3015312C (en)
DK (2) DK2396459T3 (en)
EA (4) EA202090636A3 (en)
ES (2) ES2842527T3 (en)
IL (3) IL214399B (en)
MX (1) MX2011008563A (en)
NZ (2) NZ611886A (en)
SG (3) SG173627A1 (en)
WO (1) WO2010094036A1 (en)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011127933A1 (en) 2010-04-16 2011-10-20 Nuevolution A/S Bi-functional complexes and methods for making and using such complexes
EP2396459A1 (en) 2009-02-13 2011-12-21 X-Chem, Inc. Methods of creating and screening dna-encoded libraries
WO2013036810A1 (en) 2011-09-07 2013-03-14 X-Chem, Inc. Methods for tagging dna-encoded libraries
KR20150030260A (en) * 2012-07-13 2015-03-19 엑스-켐, 인크. Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
WO2015091207A1 (en) * 2013-12-20 2015-06-25 Philochem Ag Production of encoded chemical libraries
WO2015135856A1 (en) * 2014-03-14 2015-09-17 Philochem Ag Purification of dna-conjugate products
WO2016074683A1 (en) 2014-11-11 2016-05-19 Lundorf Pedersen Materials Aps Method for identification of molecules with desired characteristics
WO2020212439A1 (en) 2019-04-16 2020-10-22 F. Hoffmann-La Roche Ag Small molecule screening cellular assay using modified beads
EP3000898B1 (en) 2013-05-21 2020-11-18 Hitgen Inc. Drug target capturing method
WO2021241528A1 (en) 2020-05-25 2021-12-02 日産化学株式会社 Cleavable dna-encoded library
EP3515880B1 (en) 2017-03-17 2023-05-10 Hitgen Inc. Methods and compositions for synthesis of encoded libraries
EP3914704B1 (en) 2019-01-22 2023-06-07 Vipergen APS A method for screening of an in vitro display library within a cell
US11795580B2 (en) 2017-05-02 2023-10-24 Haystack Sciences Corporation Molecules for verifying oligonucleotide directed combinatorial synthesis and methods of making and using the same
US12180536B2 (en) 2014-11-14 2024-12-31 University Of Washington Methods and kits for labeling cellular molecules
WO2025217391A1 (en) * 2024-04-12 2025-10-16 Insitro, Inc. Methods of preparing oligonucleotide-directed combinatorial libraries

Families Citing this family (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NL2013857B1 (en) 2014-11-21 2016-10-11 Piculet Biosciences Tech B V Self-assembled bivalent ligand complex (SABLC) libraries and methods for screening such libraries.
WO2016165621A1 (en) * 2015-04-14 2016-10-20 成都先导药物开发有限公司 Method for solid-phase synthesis of dna-encoded chemical library
US11186836B2 (en) 2016-06-16 2021-11-30 Haystack Sciences Corporation Oligonucleotide directed and recorded combinatorial synthesis of encoded probe molecules
CN107130300A (en) * 2016-10-08 2017-09-05 深圳劲宇生物科技有限公司 The synthetic method and DNA profiling of a kind of DNA encoding library of molecules
JP6941680B2 (en) 2016-10-24 2021-09-29 ジェネインフォセック、インコーポレイテッド Concealment of information existing in nucleic acids
US20190264199A1 (en) * 2016-11-08 2019-08-29 Nanna Therapeutics Limited Tagless encoded chemical library
CN108149325A (en) * 2016-12-02 2018-06-12 杭州阿诺生物医药科技股份有限公司 The synthesis of DNA encoding dynamic library of molecules and screening technique
US12527788B2 (en) 2017-02-17 2026-01-20 University Of Florida Research Foundation, Incorporated Defining RNA-small molecule affinity landscapes enables design of a small molecule inhibitor of an oncogenic non-coding RNA
CN108070009B (en) * 2017-12-12 2021-04-13 上海药明康德新药开发有限公司 Method for preparing DNA coding compound library and initial fragment compound and prepared DNA coding compound
CN110658163A (en) * 2018-06-29 2020-01-07 成都先导药物开发股份有限公司 Method for monitoring reaction in synthesis of DNA coding compound
CN112739856B (en) * 2018-07-18 2024-10-15 上海科技大学 Functionality-independent labeling of organic compounds
CN109338477A (en) * 2018-10-25 2019-02-15 深圳劲宇生物科技有限公司 Based on the DNA encoding library of molecules and its synthetic method of annular template and application
CN111675744B (en) * 2019-03-11 2022-01-04 成都先导药物开发股份有限公司 A kind of DNA coding compound soluble in organic solvent and its intermediate compound
CN112143783B (en) * 2019-06-27 2024-09-24 成都先导药物开发股份有限公司 A method for identifying mixtures of complex biological systems
CA3156387A1 (en) 2019-10-29 2021-05-06 Matthew D. Disney Compounds and modules for inhibition of pre-mir-21 and their use in treatment of certain cancers
KR102376443B1 (en) 2020-02-26 2022-03-17 포항공과대학교 산학협력단 A nanostructure, a biosensor including the nanostructure, and a screening method
US20250215615A1 (en) * 2021-11-24 2025-07-03 Nissan Chemical Corporation Method for evaluating dna-encoded library
WO2023108090A2 (en) * 2021-12-09 2023-06-15 University Of Florida Research Foundation, Incorporated Platform using dna-encoded small molecule libraries and rna selection to design small molecules that target rna
CN114989229B (en) * 2022-03-25 2025-02-11 康龙化成(宁波)科技发展有限公司 A kind of oligonucleic acid-pyrazole compound and its synthesis method
JP7204026B1 (en) 2022-03-31 2023-01-13 大阪ガスケミカル株式会社 NONWOVEN FABRIC AND METHOD FOR MANUFACTURING SAME, METHOD FOR COLLECTING ORGANIC SOLVENT USING SAME, AND ORGANIC SOLVENT COLLECTION APPARATUS
CN114920791B (en) * 2022-04-28 2024-06-18 康龙化成(宁波)科技发展有限公司 A method for synthesizing oligonucleic acid-succinimide compound
WO2024069235A2 (en) 2022-09-30 2024-04-04 Sixfold Bioscience Ltd. Compositions containing oligonucleotides with theranostic applications
CN116590798A (en) * 2023-05-10 2023-08-15 中科苏州药物研究院 DNA-encoded compound containing triazine skeleton and its synthesis method, DNA-encoded compound library

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6607878B2 (en) * 1997-10-06 2003-08-19 Stratagene Collections of uniquely tagged molecules
US20050227281A1 (en) * 2001-03-19 2005-10-13 Liu David R Evolving new molecular function
US20070224607A1 (en) * 2005-10-28 2007-09-27 Praecis Pharmaceuticals Incorporated Methods for identifying compounds of interest using encoded libraries
US20080220982A1 (en) * 2005-07-26 2008-09-11 Vu Tania Q Nanoparticle Probes for Capture, Sorting and Placement of Targets

Family Cites Families (163)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS5292967A (en) 1976-01-30 1977-08-04 Hanshin Diesel Works Separated matter accummulation takeout device for centrifugal separators
DE3788914T2 (en) 1986-09-08 1994-08-25 Ajinomoto Kk Compounds for cleaving RNA at a specific position, oligomers used in the preparation of these compounds and starting materials for the synthesis of these oligomers.
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
US5025388A (en) 1988-08-26 1991-06-18 Cramer Richard D Iii Comparative molecular field analysis (CoMFA)
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US6005087A (en) 1995-06-06 1999-12-21 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
US5660985A (en) 1990-06-11 1997-08-26 Nexstar Pharmaceuticals, Inc. High affinity nucleic acid ligands containing modified nucleotides
US5723289A (en) 1990-06-11 1998-03-03 Nexstar Pharmaceuticals, Inc. Parallel selex
JP2780572B2 (en) 1991-09-13 1998-07-30 株式会社島津製作所 Enzymatic synthesis of oligonucleotides and use of oligonucleotides as primers
US5639603A (en) 1991-09-18 1997-06-17 Affymax Technologies N.V. Synthesizing and screening molecular diversity
DK0604552T3 (en) 1991-09-18 1997-08-04 Affymax Tech Nv Process for the synthesis of different assemblies of oligomers
US5573905A (en) 1992-03-30 1996-11-12 The Scripps Research Institute Encoded combinatorial chemical libraries
US5633360A (en) * 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
EP0665897B1 (en) 1992-10-01 2003-07-09 The Trustees Of Columbia University In The City Of New York Complex combinatorial chemical libraries encoded with tags
US6503759B1 (en) 1992-10-01 2003-01-07 The Trustees Of Columbia University In The City Of New York Complex combinatorial chemical libraries encoded with tags
US5807683A (en) 1992-11-19 1998-09-15 Combichem, Inc. Combinatorial libraries and methods for their use
WO1994024143A1 (en) 1993-04-12 1994-10-27 Northwestern University Method of forming oligonucleotides
US5681943A (en) 1993-04-12 1997-10-28 Northwestern University Method for covalently linking adjacent oligonucleotides
US5840485A (en) 1993-05-27 1998-11-24 Selectide Corporation Topologically segregated, encoded solid phase libraries
WO1994028028A1 (en) 1993-05-27 1994-12-08 Selectide Corporation Topologically segregated, encoded solid phase libraries
JPH09500378A (en) 1993-07-02 1997-01-14 リンクス セラピューティクス,インコーポレイティド Focused synthesis of branched and intricately linked polymeric structures
US5571903A (en) 1993-07-09 1996-11-05 Lynx Therapeutics, Inc. Auto-ligating oligonucleotide compounds
US6087186A (en) 1993-07-16 2000-07-11 Irori Methods and apparatus for synthesizing labeled combinatorial chemistry libraries
GB9315847D0 (en) 1993-07-30 1993-09-15 Isis Innovation Tag reagent and assay method
DK96093D0 (en) 1993-08-25 1993-08-25 Symbicom Ab IMPROVEMENTS IN MOLECULAR MODELING AND DRUG DESIGN
US5658782A (en) 1993-10-20 1997-08-19 State Of Oregon, Acting By And Through The Oregon State Board Of Higher Education On Behalf Of The Oregon Health Sciences University A Non-Profit Organization Amino acid transporters and uses
BR9407947A (en) 1993-11-02 1996-11-26 Affymax Tech Nv Process for synthesizing diverse molecules on a plurality of substrates and a labeled molecular collection to perform copulation reactions on beads in parallel to screen a labeled molecular collection to detect the presence of one or more different labels and to determine the sequence of synthesis apparatus for reactions parallel copulation devices on solid supports optical alignment block for use with an optical detector delivery systems for dispensing device reagents
US6117976A (en) 1993-11-04 2000-09-12 Medical Research Council Manufacture and use of polypeptides tagged using binding molecules
WO1995016788A1 (en) 1993-12-17 1995-06-22 Cubicciotti Roger S Nucleotide-directed assembly of bimolecular and multimolecular drugs and devices
US6936477B2 (en) 1994-04-13 2005-08-30 The Trustees Of Columbia University In The City Of New York Complex combinatorial chemical libraries encoded with tags
JPH08268A (en) 1994-06-16 1996-01-09 Koichi Nishigaki Method of producing ligated double-stranded dna
US5525735A (en) 1994-06-22 1996-06-11 Affymax Technologies Nv Methods for synthesizing diverse collections of pyrrolidine compounds
US5525734A (en) 1994-06-22 1996-06-11 Affymax Technologies N.V. Methods for synthesizing diverse collections of pyrrolidine compounds
MX9700725A (en) 1994-07-26 1997-05-31 Scripps Research Inst Soluble combinatorial libraries.
US6013445A (en) 1996-06-06 2000-01-11 Lynx Therapeutics, Inc. Massively parallel signature sequencing by ligation of encoded adaptors
US6654505B2 (en) 1994-10-13 2003-11-25 Lynx Therapeutics, Inc. System and apparatus for sequential processing of analytes
US5846719A (en) 1994-10-13 1998-12-08 Lynx Therapeutics, Inc. Oligonucleotide tags for sorting and identification
US5695934A (en) 1994-10-13 1997-12-09 Lynx Therapeutics, Inc. Massively parallel sequencing of sorted polynucleotides
USRE43097E1 (en) 1994-10-13 2012-01-10 Illumina, Inc. Massively parallel signature sequencing by ligation of encoded adaptors
US5604097A (en) 1994-10-13 1997-02-18 Spectragen, Inc. Methods for sorting polynucleotides using oligonucleotide tags
WO1996038726A1 (en) 1995-05-30 1996-12-05 Ecole Polytechnique Federale De Lausanne (Epfl) Covalently immobilized phospholipid bilayers on solid surfaces
US5780613A (en) 1995-08-01 1998-07-14 Northwestern University Covalent lock for self-assembled oligonucleotide constructs
DE19646372C1 (en) 1995-11-11 1997-06-19 Evotec Biosystems Gmbh Conjugates of polypeptide and encoding nucleic acid
US5763175A (en) 1995-11-17 1998-06-09 Lynx Therapeutics, Inc. Simultaneous sequencing of tagged polynucleotides
US5780231A (en) 1995-11-17 1998-07-14 Lynx Therapeutics, Inc. DNA extension and analysis with rolling primers
US5962228A (en) 1995-11-17 1999-10-05 Lynx Therapeutics, Inc. DNA extension and analysis with rolling primers
US6537776B1 (en) 1999-06-14 2003-03-25 Diversa Corporation Synthetic ligation reassembly in directed evolution
US5846839A (en) 1995-12-22 1998-12-08 Glaxo Group Limited Methods for hard-tagging an encoded synthetic library
US6027890A (en) 1996-01-23 2000-02-22 Rapigene, Inc. Methods and compositions for enhancing sensitivity in the analysis of biological-based assays
US5898031A (en) 1996-06-06 1999-04-27 Isis Pharmaceuticals, Inc. Oligoribonucleotides for cleaving RNA
CA2261704A1 (en) 1996-07-31 1998-02-05 Norbert W. Bischofberger Lipophilic oligonucleotide analogs
DE19642751A1 (en) 1996-10-16 1998-04-23 Deutsches Krebsforsch Saccharide library
DK0971946T3 (en) 1997-01-21 2006-10-30 Gen Hospital Corp Selection of proteins using RNA-protein fusions
US5888737A (en) 1997-04-15 1999-03-30 Lynx Therapeutics, Inc. Adaptor-based sequence analysis
EP0985142A4 (en) 1997-05-23 2006-09-13 Lynx Therapeutics Inc System and apparaus for sequential processing of analytes
US6969488B2 (en) 1998-05-22 2005-11-29 Solexa, Inc. System and apparatus for sequential processing of analytes
US20020034732A1 (en) 1997-07-30 2002-03-21 Daniel J. Capon Compositions and methods for determining anti-viral drug susceptibility and resistance and anti-viral drug screening
CA2302292A1 (en) 1997-08-29 1999-03-04 Selective Genetics, Inc. Methods using phage display for selecting internalizing ligands for gene delivery
DE19928591A1 (en) 1998-06-22 1999-12-23 Roxana Havlina Production of polymers from nucleotide and/or non-nucleotide units using RNA ligase, useful for
US6846655B1 (en) 1998-06-29 2005-01-25 Phylos, Inc. Methods for generating highly diverse libraries
AU6502599A (en) 1998-10-05 2000-04-26 Lynx Therapeutics, Inc. Enzymatic synthesis of oligonucleotide tags
AU1318400A (en) 1998-10-19 2000-05-08 Board Of Trustees Of The Leland Stanford Junior University Dna-templated combinatorial library chemistry
US5942609A (en) 1998-11-12 1999-08-24 The Porkin-Elmer Corporation Ligation assembly and detection of polynucleotides on solid-support
PT1137812E (en) 1998-12-02 2007-05-31 Adnexus Therapeutics Inc Dna-protein fusions and uses thereof
US6087112A (en) 1998-12-30 2000-07-11 Oligos Etc. Inc. Arrays with modified oligonucleotide and polynucleotide compositions
US7033753B1 (en) 1999-01-15 2006-04-25 University Of Rochester Compositions and methods for nonenzymatic ligation of oligonucleotides and detection of genetic polymorphisms
AU2951599A (en) 1999-04-08 2000-11-14 Pavel Sergeev Synthesis of biologically active compounds in cells
ATE347616T1 (en) 1999-04-30 2006-12-15 Cyclops Genome Sciences Ltd RIBONUCLIC ACID DERIVATIVES
US7270969B2 (en) 1999-05-05 2007-09-18 Phylogica Limited Methods of constructing and screening diverse expression libraries
JP4803933B2 (en) 1999-08-27 2011-10-26 ブリストル−マイヤーズ スクウィブ カンパニー Encoding method and selection method of in vitro translated protein
WO2001020331A1 (en) 1999-09-14 2001-03-22 Xenoport, Inc. Substrates and screening methods for transport proteins
WO2001025188A1 (en) 1999-10-04 2001-04-12 University Of Medicine And Dentistry Of New Jersey Novel carbamates and ureas
US6844324B1 (en) 1999-11-12 2005-01-18 Massachusetts Institute Of Technology Modular peptide mediated intracellular delivery system and uses therefore
WO2001062772A2 (en) 2000-02-23 2001-08-30 Xenoport, Inc. Self-encoded combinatorial synthesis of compound multiplets
US6936467B2 (en) 2000-03-27 2005-08-30 University Of Delaware Targeted chromosomal genomic alterations with modified single stranded oligonucleotides
US7998673B2 (en) 2000-03-29 2011-08-16 Lgc Limited Hybridisation beacon and method of rapid sequence detection and discrimination
US6479262B1 (en) 2000-05-16 2002-11-12 Hercules, Incorporated Solid phase enzymatic assembly of polynucleotides
US6994963B1 (en) 2000-07-10 2006-02-07 Ambion, Inc. Methods for recombinatorial nucleic acid synthesis
US20020072887A1 (en) 2000-08-18 2002-06-13 Sandor Szalma Interaction fingerprint annotations from protein structure models
US6627748B1 (en) 2000-09-11 2003-09-30 The Trustees Of Columbia University In The City Of New York Combinatorial fluorescence energy transfer tags and their applications for multiplex genetic analyses
EP2187317B1 (en) 2000-09-20 2012-12-05 ARKRAY, Inc. Client support system requesting a page of the manual in accordance with the status of a client
US6706481B2 (en) 2000-10-27 2004-03-16 Research Development Foundation In vitro selection of signaling aptamers
JP2002315577A (en) 2000-11-14 2002-10-29 Gencom Co Method for constructing nucleic acid library
US20030049616A1 (en) 2001-01-08 2003-03-13 Sydney Brenner Enzymatic synthesis of oligonucleotide tags
EP1401850A1 (en) 2001-06-20 2004-03-31 Nuevolution A/S Nucleoside derivatives for library preparation
US20060234231A1 (en) 2001-06-20 2006-10-19 Nuevolution A/S Microarrays displaying encoded molecules
US20030143561A1 (en) 2001-06-20 2003-07-31 Nuevolution A/S Nucleoside derivatives for library preparation
CN1539014A (en) 2001-06-20 2004-10-20 ŦΤ¬ɭ��˾ Modulated molecules and methods of using such molecules
WO2003078445A2 (en) 2002-03-15 2003-09-25 Nuevolution A/S A building block forming a c=c double bond upon reaction
DK1483585T3 (en) 2002-03-08 2009-06-22 Eidgenoess Tech Hochschule Encoded, self-assembling chemical libraries (ESACHEL)
AU2003218630A1 (en) 2002-03-15 2003-09-29 Nuevolution A/S A building block capable of functional entity transfer to nucleophil
US20050247001A1 (en) 2002-03-15 2005-11-10 Nuevolution A/S Building block forming a c-c or a c-hetero atom bond uponreaction
US20050221318A1 (en) 2002-03-15 2005-10-06 Gouliaev Alex H Building block forming a c-c bond upon reaction
DE60324778D1 (en) 2002-03-15 2009-01-02 Nuevolution As AN IMPROVED METHOD FOR SYNTHESIS OF MATTRESS-RELATED MOLECULES
EP1520040A2 (en) 2002-06-20 2005-04-06 Nuevolution A/S Microarrays displaying encoded molecules
EP1543156A4 (en) 2002-07-18 2005-12-21 Univ Leland Stanford Junior DETECTION OF CHEMICAL LIGATURES USING FLUORESCENCE EXTINGUISHING GROUPS
WO2004009814A1 (en) 2002-07-23 2004-01-29 Nuevolution A/S Gene shuffling by template switching
WO2004013070A2 (en) * 2002-08-01 2004-02-12 Nuevolution A/S Multi-step synthesis of templated molecules
WO2004016767A2 (en) 2002-08-19 2004-02-26 The President And Fellows Of Harvard College Evolving new molecular function
EP1539953A2 (en) 2002-09-12 2005-06-15 Nuevolution A/S Proximity-aided synthesis of templated molecules
DK3299463T3 (en) 2002-10-30 2020-12-07 Nuevolution As ENZYMATIC CODING
ATE450609T1 (en) 2002-12-19 2009-12-15 Nuevolution As SYNTHESIS METHOD GUIDED BY QUASI-RANDOM STRUCTURES AND FUNCTIONS
EP1597394A2 (en) 2003-02-21 2005-11-23 Nuevolution A/S A method for obtaining structural information about an encoded molecule
US20070026397A1 (en) 2003-02-21 2007-02-01 Nuevolution A/S Method for producing second-generation library
US7915201B2 (en) 2003-03-20 2011-03-29 Nuevolution A/S Ligational encoding of small molecules
EP1652123A2 (en) 2003-07-03 2006-05-03 Biogen Idec MA Inc. STRUCTURAL INTERACTION FINGERPRINT (SIFt)
WO2005007815A2 (en) 2003-07-07 2005-01-27 One Cell Systems, Inc. Hairpin-labeled probes and methods of use
EP1533385A1 (en) 2003-09-05 2005-05-25 Nuevolution A/S Templated compounds for generation of encoded molecules and directional methods using such compounds
US7365179B2 (en) 2003-09-09 2008-04-29 Compass Genetics, Llc Multiplexed analytical platform
WO2005026387A1 (en) 2003-09-18 2005-03-24 Nuevolution A/S A method for obtaining structural information concerning an encoded molecule and method for selecting compounds
WO2005050224A2 (en) 2003-11-13 2005-06-02 Epitome Biosystems Inc. Small molecule and peptide arrays and uses thereof
RU2470077C2 (en) 2003-12-17 2012-12-20 ГЛЭКСОСМИТКЛАЙН ЭлЭлСи Biologically active compound containing coding oligonucleotide (versions), method for synthesis thereof, library of compounds (versions), method for synthesis thereof, and method of searching for compound bound with biological target (versions)
US7972994B2 (en) 2003-12-17 2011-07-05 Glaxosmithkline Llc Methods for synthesis of encoded libraries
US20050153321A1 (en) 2003-12-30 2005-07-14 Saba James A. Libraries of multiple-ligand-conjugated nucleic acids
AU2005214329A1 (en) 2004-02-12 2005-09-01 Population Genetics Technologies Ltd Genetic analysis by sequence-specific sorting
EP1723255B1 (en) 2004-02-17 2010-12-29 Nuevolution A/S Method for enrichment involving elimination by mismatch hybridisation
WO2005090566A2 (en) 2004-03-22 2005-09-29 Nuevolution A/S Ligational encoding using building block oligonucleotides
US7618778B2 (en) 2004-06-02 2009-11-17 Kaufman Joseph C Producing, cataloging and classifying sequence tags
US7405287B2 (en) 2004-08-03 2008-07-29 Board Of Regents, The University Of Texas System Method of treating a cancer
US7745614B2 (en) 2004-09-03 2010-06-29 The Board Of Trustees Of The Leland Stanford Junior University Universal linker compositions for the release or transfer of chemical agents from a polynucleotide
US20060099626A1 (en) 2004-10-27 2006-05-11 Harbury Pehr B DNA-templated combinatorial library device and method for use
CA2587010C (en) 2004-11-08 2017-08-15 Vipergen Aps Structural nucleic acid guided chemical synthesis
EP1828381B1 (en) 2004-11-22 2009-01-07 Peter Birk Rasmussen Template directed split and mix systhesis of small molecule libraries
AU2005316503A1 (en) 2004-12-17 2006-06-22 Dynavax Technologies Corporation Methods and compositions for induction or promotion of immune tolerance
JP4969459B2 (en) 2005-01-21 2012-07-04 プレジデント アンド フェロウズ オブ ハーバード カレッジ Free reactants used in nucleic acid template synthesis
US7407757B2 (en) 2005-02-10 2008-08-05 Population Genetics Technologies Genetic analysis by sequence-specific sorting
US7393665B2 (en) 2005-02-10 2008-07-01 Population Genetics Technologies Ltd Methods and compositions for tagging and identifying polynucleotides
WO2006099604A2 (en) 2005-03-16 2006-09-21 Compass Genetics, Llc Methods and compositions for assay readouts on multiple analytical platforms
NZ564545A (en) 2005-06-09 2011-03-31 Praecis Pharm Inc Methods for synthesis of encoded libraries
US20090035824A1 (en) 2005-06-17 2009-02-05 Liu David R Nucleic acid-templated chemistry in organic solvents
US7630694B2 (en) 2005-07-19 2009-12-08 Samsung Electronics Co., Ltd. Remote access unit and optical network for bidirectional wireless communication using the same
WO2007016488A2 (en) 2005-07-29 2007-02-08 Ensemble Discovery Corporation Analysis of encoded chemical libraries
WO2007041201A2 (en) 2005-10-03 2007-04-12 Applera Corporation Compositions, methods, and kits for amplifying nucleic acids
LT2336315T (en) 2005-12-01 2017-11-10 Nuevolution A/S Enzymatic encoding methods for efficient synthesis of large libraries
WO2007087312A2 (en) 2006-01-23 2007-08-02 Population Genetics Technologies Ltd. Molecular counting
US8114636B2 (en) 2006-02-10 2012-02-14 Life Technologies Corporation Labeling and detection of nucleic acids
WO2007124758A1 (en) 2006-05-03 2007-11-08 Vipergen Aps A method for preparing compounds by nucleic acid directed synthesis
US8153830B2 (en) 2006-10-26 2012-04-10 Sumitomo Chemical Company, Limited Production method of asymmetric copper complex crystal
CN101219219B (en) 2007-01-10 2013-02-13 北京普罗吉生物科技发展有限公司 Complex containing vascellum chalone or fragment, preparation method and application thereof
CN101896623B (en) 2007-10-22 2013-12-18 Lgc有限公司 Oligonucleotides and uses thereof
WO2009066447A1 (en) 2007-11-19 2009-05-28 Japan Advanced Institute Of Science And Technology Light-responsive artificial nucleotide having photo-crosslinking ability
WO2009077173A2 (en) 2007-12-19 2009-06-25 Philochem Ag Dna-encoded chemical libraries
US20120107840A1 (en) 2008-04-09 2012-05-03 Sru Biosystems, Inc Methods for Label Free Testing of Cells
JP4814904B2 (en) 2008-04-16 2011-11-16 国立大学法人北陸先端科学技術大学院大学 Method for sequence-selective purification of nucleic acids
CA2723265C (en) 2008-05-02 2015-11-24 Epicentre Technologies Corporation Selective 5' ligation tagging of rna
TW201011006A (en) 2008-06-16 2010-03-16 Nuevolution As IAP binding compounds
WO2010011944A2 (en) 2008-07-25 2010-01-28 Wagner Richard W Protein screeing methods
US20120100530A1 (en) 2009-01-30 2012-04-26 Oxford Nanopore Technologies Limited Enzyme mutant
US20120004137A1 (en) 2009-02-13 2012-01-05 X-Body, Inc. Identification of nucleic acid delivery vehicles using dna display
KR102231531B1 (en) 2009-02-13 2021-03-23 엑스-켐, 인크. Methods of creating and screening dna-encoded libraries
EP2610352B1 (en) 2009-02-16 2014-10-08 Epicentre Technologies Corporation Template-independent ligation of single-stranded DNA
US8728725B2 (en) 2009-07-06 2014-05-20 Trilink Biotechnologies Chemically modified ligase cofactors, donors and acceptors
US8574864B2 (en) 2009-11-05 2013-11-05 Epicentre Technologies Corporation Methods and kits for 3'-end-tagging of RNA
DE102009058769A1 (en) 2009-12-16 2011-06-22 MagForce Nanotechnologies AG, 10589 Temperature-dependent activation of catalytic nucleic acids for controlled drug release
JP2013518602A (en) 2010-02-09 2013-05-23 サンガモ バイオサイエンシーズ, インコーポレイテッド Targeted genome modification by partially single-stranded donor molecules
US8716467B2 (en) 2010-03-03 2014-05-06 Gen9, Inc. Methods and devices for nucleic acid synthesis
US20110237535A1 (en) 2010-03-26 2011-09-29 Sru Biosystems, Inc. Use of Induced Pluripotent Cells and other Cells for Screening Compound Libraries
CA2832672A1 (en) 2010-04-16 2011-10-20 Nuevolution A/S Bi-functional complexes and methods for making and using such complexes
US9880160B2 (en) 2011-03-15 2018-01-30 X-Body, Inc. Antibody screening methods
US8846883B2 (en) 2011-08-16 2014-09-30 University Of Southhampton Oligonucleotide ligation
ES2675111T3 (en) 2011-09-07 2018-07-06 X-Chem, Inc. Methods for tagging libraries with DNA coding
CN104685115A (en) 2012-07-13 2015-06-03 X-化学有限公司 DNA-encoded library with polymerase-unreadable coding oligonucleotide ligation
GB201322692D0 (en) 2013-12-20 2014-02-05 Philochem Ag Production of encoded chemical libraries

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6607878B2 (en) * 1997-10-06 2003-08-19 Stratagene Collections of uniquely tagged molecules
US20050227281A1 (en) * 2001-03-19 2005-10-13 Liu David R Evolving new molecular function
US20080220982A1 (en) * 2005-07-26 2008-09-11 Vu Tania Q Nanoparticle Probes for Capture, Sorting and Placement of Targets
US20070224607A1 (en) * 2005-10-28 2007-09-27 Praecis Pharmaceuticals Incorporated Methods for identifying compounds of interest using encoded libraries

Cited By (66)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12606817B2 (en) 2009-02-13 2026-04-21 X-Chem, Inc. Methods of creating and screening DNA-encoded libraries
EP2396459A1 (en) 2009-02-13 2011-12-21 X-Chem, Inc. Methods of creating and screening dna-encoded libraries
EP3211126B1 (en) 2009-02-13 2020-10-21 X-Chem, Inc. Methods of creating and screening dna-encoded libraries
US9359601B2 (en) 2009-02-13 2016-06-07 X-Chem, Inc. Methods of creating and screening DNA-encoded libraries
US11168321B2 (en) 2009-02-13 2021-11-09 X-Chem, Inc. Methods of creating and screening DNA-encoded libraries
EP3540059A1 (en) 2010-04-16 2019-09-18 Nuevolution A/S Bi-functional complexes and methods for making and using such complexes
WO2011127933A1 (en) 2010-04-16 2011-10-20 Nuevolution A/S Bi-functional complexes and methods for making and using such complexes
AU2019200965B2 (en) * 2011-09-07 2021-01-28 X-Chem, Inc. Methods for tagging DNA-encoded libraries
JP2014528713A (en) * 2011-09-07 2014-10-30 エックス−ケム インコーポレイテッド Method for tagging a DNA code library
EP3828271A1 (en) * 2011-09-07 2021-06-02 X-Chem, Inc. Methods for tagging dna-encoded libraries
JP2018138590A (en) * 2011-09-07 2018-09-06 エックス−ケム インコーポレイテッド Methods for tagging dna-encoded libraries
US10865409B2 (en) 2011-09-07 2020-12-15 X-Chem, Inc. Methods for tagging DNA-encoded libraries
US20140315762A1 (en) * 2011-09-07 2014-10-23 X-Chem, Inc. Methods for tagging dna-encoded libraries
EP3351631B1 (en) 2011-09-07 2020-11-04 X-Chem, Inc. Methods for tagging dna-encoded libraries
CN103998658A (en) * 2011-09-07 2014-08-20 X-化学有限公司 Methods for labeling DNA-encoding libraries
EP2748357B1 (en) 2011-09-07 2018-04-04 X-Chem, Inc. Methods for tagging dna-encoded libraries
EP2748357A1 (en) 2011-09-07 2014-07-02 X-Chem, Inc. Methods for tagging dna-encoded libraries
WO2013036810A1 (en) 2011-09-07 2013-03-14 X-Chem, Inc. Methods for tagging dna-encoded libraries
EA032438B1 (en) * 2011-09-07 2019-05-31 Икс-Чем, Инк. Methods for tagging dna-encoded libraries
EP3351631A3 (en) * 2011-09-07 2018-08-29 X-Chem, Inc. Methods for tagging dna-encoded libraries
EP3392338B1 (en) 2012-07-13 2020-12-09 X-Chem, Inc. Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
US20150211002A1 (en) * 2012-07-13 2015-07-30 X-Chem, Inc. Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
JP2019030324A (en) * 2012-07-13 2019-02-28 エックス−ケム インコーポレイテッド Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
EP3392338A1 (en) * 2012-07-13 2018-10-24 X-Chem, Inc. Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
JP2021167326A (en) * 2012-07-13 2021-10-21 エックス−ケム インコーポレイテッド DNA encoding library with coding oligonucleotide linkage that cannot be read by polymerase
AU2013289993B2 (en) * 2012-07-13 2018-05-10 X-Chem, Inc. DNA-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
AU2018202665B2 (en) * 2012-07-13 2020-06-25 X-Chem, Inc. DNA-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
KR102146721B1 (en) * 2012-07-13 2020-08-21 엑스-켐, 인크. Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
KR20200100206A (en) * 2012-07-13 2020-08-25 엑스-켐, 인크. Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
EP2872680B1 (en) 2012-07-13 2018-04-04 X-Chem, Inc. Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
KR20150030260A (en) * 2012-07-13 2015-03-19 엑스-켐, 인크. Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
EP3851529A1 (en) * 2012-07-13 2021-07-21 X-Chem, Inc. Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
KR102270554B1 (en) 2012-07-13 2021-06-28 엑스-켐, 인크. Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
EP2872680A4 (en) * 2012-07-13 2016-01-27 Chem Inc X Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
JP2015529449A (en) * 2012-07-13 2015-10-08 エックス−ケム インコーポレイテッド DNA-encoded library with coding oligonucleotide linkage that cannot be read by polymerase
US11674135B2 (en) 2012-07-13 2023-06-13 X-Chem, Inc. DNA-encoded libraries having encoding oligonucleotide linkages not readable by polymerases
EP3000898B1 (en) 2013-05-21 2020-11-18 Hitgen Inc. Drug target capturing method
EP3083957B1 (en) 2013-12-20 2018-05-23 Philochem AG Production of encoded chemical libraries
WO2015091207A1 (en) * 2013-12-20 2015-06-25 Philochem Ag Production of encoded chemical libraries
US10240147B2 (en) 2013-12-20 2019-03-26 Philochem Ag Production of encoded chemical libraries
WO2015135856A1 (en) * 2014-03-14 2015-09-17 Philochem Ag Purification of dna-conjugate products
WO2016074683A1 (en) 2014-11-11 2016-05-19 Lundorf Pedersen Materials Aps Method for identification of molecules with desired characteristics
US12252733B2 (en) 2014-11-14 2025-03-18 University Of Washington Methods and kits for labeling cellular molecules
US12252737B2 (en) 2014-11-14 2025-03-18 University Of Washington Methods and kits for labeling cellular molecules
US12467076B2 (en) 2014-11-14 2025-11-11 University Of Washington Methods and kits for labeling cellular molecules
US12428671B2 (en) 2014-11-14 2025-09-30 University Of Washington Methods and kits for labeling cellular molecules
US12371733B2 (en) 2014-11-14 2025-07-29 University Of Washington Methods and kits for labeling cellular molecules
US12180536B2 (en) 2014-11-14 2024-12-31 University Of Washington Methods and kits for labeling cellular molecules
US12195786B2 (en) 2014-11-14 2025-01-14 University Of Washington Methods and kits for labeling cellular molecules
US12227793B2 (en) 2014-11-14 2025-02-18 University Of Washington Methods and kits for labeling cellular molecules
US12247248B2 (en) 2014-11-14 2025-03-11 University Of Washington Methods and kits for labeling cellular molecules
US12247247B2 (en) 2014-11-14 2025-03-11 University Of Washington Methods and kits for labeling cellular molecules
US12252736B2 (en) 2014-11-14 2025-03-18 University Of Washington Methods and kits for labeling cellular molecules
US12371734B2 (en) 2014-11-14 2025-07-29 University Of Washington Methods and kits for labeling cellular molecules
US12305219B2 (en) 2014-11-14 2025-05-20 University Of Washington Methods and kits for labeling cellular molecules
US12252734B2 (en) 2014-11-14 2025-03-18 University Of Washington Methods and kits for labeling cellular molecules
US12252735B2 (en) 2014-11-14 2025-03-18 University Of Washington Methods and kits for labeling cellular molecules
US12305220B2 (en) 2014-11-14 2025-05-20 University Of Washington Methods and kits for labeling cellular molecules
US12305221B2 (en) 2014-11-14 2025-05-20 University Of Washington Methods and kits for labeling cellular molecules
EP3515880B1 (en) 2017-03-17 2023-05-10 Hitgen Inc. Methods and compositions for synthesis of encoded libraries
US11795580B2 (en) 2017-05-02 2023-10-24 Haystack Sciences Corporation Molecules for verifying oligonucleotide directed combinatorial synthesis and methods of making and using the same
EP3914704B1 (en) 2019-01-22 2023-06-07 Vipergen APS A method for screening of an in vitro display library within a cell
WO2020212439A1 (en) 2019-04-16 2020-10-22 F. Hoffmann-La Roche Ag Small molecule screening cellular assay using modified beads
WO2021241528A1 (en) 2020-05-25 2021-12-02 日産化学株式会社 Cleavable dna-encoded library
KR20230015347A (en) 2020-05-25 2023-01-31 닛산 가가쿠 가부시키가이샤 cleavable DNA-encoded library
WO2025217391A1 (en) * 2024-04-12 2025-10-16 Insitro, Inc. Methods of preparing oligonucleotide-directed combinatorial libraries

Also Published As

Publication number Publication date
NZ611886A (en) 2014-10-31
EA035311B1 (en) 2020-05-27
US20120053091A1 (en) 2012-03-01
KR102231531B1 (en) 2021-03-23
EA201791990A2 (en) 2018-05-31
DK3211126T3 (en) 2020-12-21
IL283572A (en) 2021-07-29
EP2396459A4 (en) 2012-07-25
DK2396459T3 (en) 2017-08-28
CN107916456A (en) 2018-04-17
KR20170119729A (en) 2017-10-27
CA2752543A1 (en) 2010-08-19
EP2396459B1 (en) 2017-05-03
EP3211126B1 (en) 2020-10-21
IL214399B (en) 2019-01-31
EA202090636A3 (en) 2021-04-30
EA028985B1 (en) 2018-01-31
JP2017201991A (en) 2017-11-16
JP5770641B2 (en) 2015-08-26
EP3653763A1 (en) 2020-05-20
EA201791990A3 (en) 2018-09-28
JP2012517812A (en) 2012-08-09
KR20200031707A (en) 2020-03-24
SG2014011381A (en) 2014-06-27
EA201492135A1 (en) 2015-06-30
CN102317513B (en) 2018-01-02
AP3396A (en) 2015-08-31
US20200385709A1 (en) 2020-12-10
SG173627A1 (en) 2011-09-29
JP2016182148A (en) 2016-10-20
KR101789216B1 (en) 2017-10-23
JP7010875B2 (en) 2022-01-26
KR20190077614A (en) 2019-07-03
CN107916456B (en) 2021-08-10
EA021797B1 (en) 2015-09-30
JP6200560B2 (en) 2017-09-20
EP2396459A1 (en) 2011-12-21
KR20110126678A (en) 2011-11-23
EA202090636A2 (en) 2020-12-30
ES2638324T3 (en) 2017-10-19
BRPI1008429A2 (en) 2020-08-25
ES2842527T3 (en) 2021-07-14
CA3015312A1 (en) 2010-08-19
EA201101205A1 (en) 2012-02-28
SG10202007808YA (en) 2020-09-29
HK1243467A1 (en) 2018-07-13
IL263625A (en) 2019-01-31
KR102091207B1 (en) 2020-03-20
CA3015312C (en) 2022-02-08
NZ594420A (en) 2013-06-28
AP2011005847A0 (en) 2011-08-31
EP3211126A1 (en) 2017-08-30
US12606817B2 (en) 2026-04-21
JP2019176856A (en) 2019-10-17
US11168321B2 (en) 2021-11-09
JP2015213509A (en) 2015-12-03
CN102317513A (en) 2012-01-11
IL214399A0 (en) 2011-09-27
JP2022058604A (en) 2022-04-12
MX2011008563A (en) 2012-06-19
IL263625B (en) 2021-06-30
HK1253711A1 (en) 2019-06-28
US9359601B2 (en) 2016-06-07
US20160369267A1 (en) 2016-12-22
JP5980995B2 (en) 2016-08-31

Similar Documents

Publication Publication Date Title
US12606817B2 (en) Methods of creating and screening DNA-encoded libraries
HK1164264A (en) Methods of creating and screening dna-encoded libraries
HK1164264B (en) Methods of creating and screening dna-encoded libraries
HK40029383A (en) Methods of creating and screening dna-encoded libraries
HK1243467B (en) Methods of creating and screening dna-encoded libraries
HK1253711B (en) Methods of creating and screening dna-encoded libraries

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080007813.3

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10741877

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 214399

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 594420

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2752543

Country of ref document: CA

Ref document number: 2011550313

Country of ref document: JP

Ref document number: MX/A/2011/008563

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2010741877

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2010741877

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 6461/CHENP/2011

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 20117021196

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 201101205

Country of ref document: EA

WWE Wipo information: entry into national phase

Ref document number: 13147910

Country of ref document: US

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: PI1008429

Country of ref document: BR

ENP Entry into the national phase

Ref document number: PI1008429

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20110815