WO2010085966A2 - Method for quantification of small rna species - Google Patents
Method for quantification of small rna species Download PDFInfo
- Publication number
- WO2010085966A2 WO2010085966A2 PCT/DK2010/050029 DK2010050029W WO2010085966A2 WO 2010085966 A2 WO2010085966 A2 WO 2010085966A2 DK 2010050029 W DK2010050029 W DK 2010050029W WO 2010085966 A2 WO2010085966 A2 WO 2010085966A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- primer
- rna
- nucleotide sequence
- microrna
- specific
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Definitions
- the present invention relates to a method for amplification and quantification of small non- coding RNA molecules using quantitative reverse transcription polymerase chain reaction (qRT-PCR) technology.
- qRT-PCR quantitative reverse transcription polymerase chain reaction
- MicroRNAs are an abundant class of approximately 22-nucleotide-noncoding RNAs, which play important regulatory roles in animal, plant and virus development.
- the awareness of microRNAs was initiated almost 15 years ago by the discovery of lin-4, which encode a small RNA involved in the timing and progression of the nematode in C. elegans life cycle and larval development (Lee et al. 1993 Cell 75:843-854, Wightman et al.1993 Cell 75:855362), but it was only recently recognized that microRNAs form a major class of ribo-regulaters that have broad regulatory functions in animals (Lagos-Quintana et al. 2001 Science 294:853858, Lau et al.
- MicroRNAs are involved in the regulation of gene expression at the posttranscriptional level by degrading or blocking translation of messenger RNA targets, and it has been speculated that approximately 30 % of the human genome could be regulated by microRNAs.
- the importance of microRNAs is also obvious due to their involvement in various cellular processes including development, growth and proliferation, apoptosis, differentiation, and various human diseases (http://www.mir2disease.org/) such as cancer and diabetes.
- miRNAs are altered in every type of analyzed human cancer;
- miRNAs act as oncogenes and tumor suppressors;
- miRNAs alterations may cause cancer predisposition;
- miRNAs profiling is a new diagnostic tool for cancer patients and
- miRNA profiling represents prognostic tools for cancer patients. Accordingly, methods for expression profiling and quantification of microRNAs in cells and body-fluids from cancer patients are of great importance. To address this requirement, the present invention describes the development of a new robust and reliable q RT-PCR assay for microRNA measurements.
- ® involves a gene-specific reverse transcription step followed by a SYBR green qPCR step using a gene-specific forward primer containing locked nucleic acid (LNA) molecules and a universal reverse primer.
- Gilad et al. reports a qRT-PCR assay that involves a pol ⁇ adenylation step, an unspeciflc reverse transcription step, and a qPCR step involving a gene-specific forward primer, a gene-specific TaqMan primer and a universal reverse primer.
- Sharbati- Tehrani et al. developed a qRT-PCR assay that involves a gene-specific reverse transcription
- the present invention is characterised by only one reverse transcription reaction for all microRNAs in a sample and furthermore provides an extremely sensitive PCR method with an unmatched specificity that can be used for accurate quantification of small RNA molecules such as microRNAs.
- the present invention provides a procedure for amplifying and quantifying microRNA molecules in a sample: In the first step of the procedure complementary DNAs (cDNAs) of the microRNAs in a sample are produced by the concerted action of two enzymes in a single-tube reaction.
- cDNAs complementary DNAs
- poly-A tails are added to the J-terminus of the microRNAs using a pol ⁇ (A) polymerase, and secondly an extension primer is hybridized to the pol ⁇ -A tail and the cDNAs are produced by a reverse transcriptase using the microRNA as template.
- the first step is unspecific and produces cDNAs of all microRNAs present in a sample.
- specific cDNAs are amplified and quantified in a qPCR reaction using microRNA specific primer sets of forward and reverse primers containing LNA monomers.
- the invention provides oligo nucleotide primers listed in Table 18 (SEQ ID NO 1 to SEQ ID NO 128).
- the primers of the invention can be used for detecting mammalian microRNAs using the method of the invention.
- kits for detection of mammalian microRNAs comprising a universal extension primer and microRNA-specific forward and reverse primers sets for quantification of at least one microRNA, a subset of microRNAs or all known microRNAs.
- the present invention is useful for reliable and specific quantitative microRNA assays, including assays for diagnosing and prognosing diseases such as cancer using single assays or high through-put applications on robot platforms.
- RNA containing samples extracted from various cell types from living organisms, such as mammals and plants and including virus infected cells may be analysed using the method of the invention.
- the present invention mainly aims at providing a method for quantification of microRNAs the method can be used for detection and/or quantification of all types of RNA in particular all types of small noncoding RNAs.
- FIGURE 1 shows the steps involved in specific qRT-PCR of the present invention.
- the RNA to be analysed by the method may as well be any other small RNA molecule or even a mRNA.
- Step 1 is a one- tube-reaction for all microRNAs present in a sample.
- Step 2 is a microRNA specific qPCR using forward and reverse primer pairs for a specific microRNA.
- An oval indicate insertion of LNAs in forward and reverse primers.
- the miRNAs present in a sample are firstly poly-A-tailed using a poly(A) polymerase, which adds adenine residues to the J-end of RNA molecules.
- This primer may be referred to as the Universal RT primer.
- the extension primer is extended in a reverse transcription reaction using the miRNA as template. All of these reaction are performed in a one-tube reaction.
- the resulting primary extension product is composed of the extension primer and the newly synthesized DNA, which is cDNA complementary to all the miRNAs in the sample.
- a miRNA-specific PCR is carried out.
- a miRNA-specific forward primer is annealed to 3 1 - end of the newly synthesized cDNA and the upper-strand synthesis is carried out by extending the forward primer in a DNA-polymerization reaction using the primary extension product as template.
- a miRNA-specific reverse primer composed of a miRNA-specific y-end sequence, a poly-T-stretch and a 5'-end tail is then hybridized to the upper-strand and the lower-strand is synthesized by extension of the reverse primer.
- FIGURE 2 shows amplification of hsa-miR-197 (Example 1) with the forward primer 5' ttmCaccaccttctcca (SEQ ID NO 1 ⁇ and the reverse primer (SEQ ID NO 2).
- Synthetic template 10 7 copies of synthetic hsa-miR-197 were used for polyA tailing/RT. An amount corresponding to 10 5 copies was used for PCR.
- Total human RNA 100 ng of total human RNA was used for pol ⁇ A-tailing/RT (step 1). An amount corresponding to 1 ng was used for PCR.
- Negative controls water control and a total human RNA control without PolyA Polymerase in the RT react ion.
- the black line designates the result obtained with the synthetic template whereas the grey line show the result obtained with total human RNA as template.
- the melting curves of the result obtained with the synthetic template and the total human RNA are almost identical.
- FIGURE 3 shows the amplification curves and the first derivative of the melting curves of Example 2
- FIGURE 4 shows amplification plots of Example 4 wherein discrimination between hsa- ⁇ et-7a and the variants ⁇ sa-let-7f, ⁇ sa-let-7c and hsa- ⁇ et-7e are demonstrated. The amplification- signal from negative controls are also indicated.
- FIGURE 5A, 5B and 5C shows the method and processes that enables PCR amplification and discrimination between mature miRs, pre-miRs and pri-miRs. See example 6, 7 and 8.
- FIG. 5A illustrates the assa ⁇ used for assa ⁇ ing mature miRs.
- Fig 5B illustrates the assa ⁇ used for assa ⁇ ing pre-miRs and
- Fig 5C illustrate the assa ⁇ used for assa ⁇ ing pri-miRs.
- FIGURE 6 shows amplification curves of (A) the pre-mir-203 assa ⁇ on pre-miR-203, miR-203 and non-template controls (NTC).
- FIGURE 7 shows the different expression of a panel of selected miRNA genes in heart and liver.
- the data is presented as the difference in the crossing point (Cp) value (ACp) between heart and liver, see table 15.
- FIGURE 8 shows the detection of each of four listed miRs assa ⁇ ed b ⁇ the present method (black lines with diamonds) and compared with a commercial available method wherein the Reverse Transcription is performed as a one-tube-reaction for all microRNAs present in a sample (gra ⁇ lines with spheres).
- the figure presents the crossing point (Cp) values as a function of template concentration. Each value is in triplicate.
- RNA molecules ' ' refer to tin ⁇ RNA molecules in a living cell such as small "non-coding RNA molecules * i.e. molecules that are not translated into proteins.
- Non-coding RNA molecules include RNAs such as microRNAs (miRNAs), small interfering RNAs (siRNAs), small nuclear RNAs (snRNAs), small nucleolar RNAs (snoRNAs), small temporal RNAs (stRNAs), antigene RNAs (ag RNAs) and piwi-interacting RNAs (piRNAs).
- miRNAs microRNAs
- siRNAs small interfering RNAs
- snRNAs small nuclear RNAs
- snoRNAs small nucleolar RNAs
- stRNAs small temporal RNAs
- ag RNAs antigene RNAs
- piRNAs piwi-interacting RNAs
- pre-miRNAs non-coding RNAs derived from endogenous genes of living organisms such as animals and plants.
- mature miRNAs are biologically active and processed from longer hairpin-like precursors termed pre-miRNAs (pre-miRs) having a length of approximately 75 nucleotides.
- pre-miRs longer hairpin-like precursors
- the precursers of pre-miRNAs are pri-miRNAs (pri-miRs) with a length of 500 to 3000 nucleotides.
- MiRNAs assemble in complexes termed miRNPs and act as major regulators on important biological processes by binding to messenger RNA and interfering with translation efficiency.
- Target microRNAs of the present invention refer to all known microRNAs, such as microRNAs known from the scientific literature and public databases such as the miRBase database (http://microrna.sanger.ac.uk/) which is the home of microRNA data on the web administrated by the Sanger Institute, UK.
- the miRBase release 12 is hereby incorporated by reference, including all the mature mi RNA and pre-mature miRNA sequences disclosed therein.
- tnicroRNA profiling' describes a large-scale analysis in which the expression levels of all microRNAs in a sample such as a tumor sample are determined to build microRNA signatures for a particular disease such as a cancer disease.
- Adding poly-A tails', "PoIy-A tailing” and “polyadenylatiorf refers to the synthesis of a poly(A) tail, a stretch of RNA where all the bases are adenines, at the y-termini of an RNA molecule.
- Polyaden ⁇ lation is a natural biological process in living organisms, but it can also be carried out in vitro using various polymerases such as commercial available E. coli PoIy(A) Polymerase I (E-PAP).
- Extension primer and "RT-prime ⁇ ” refers to an oligonucleotide primer, comprising a recognition sequence, complementary to a sequence in the target deoxyribonucleic and/or ribonucleic acid sequence, e.g. to the 3'-end of the mature microRNA or small noncoding RNA in the target ribonucleic acid sequence, and an anchor sequence essential for subsequent amplification by PCR.
- the said extension primer is used as an anchored primer in a reverse transcription reaction to generate a primer extension product or cDNA.
- a "cDNA” refers to a complementary DNA produced by reverse transcription of an RNA template using a reverse transcriptase enzyme.
- Any reverse transcriptase can be used to synthesize the cDNA molecules, such as reverse transcriptases derived from moloney murine leukemia virus (M-MuLV) reverse transcriptase, avian myeloblastosis virus (AMV) reverse transcriptase, bovine leukemia virus (BLV) reverse transcriptase, Rous sarcoma virus (RSV) reverse transcriptase and human immunodeficiency virus (HIV) reverse transcriptase.
- M-MuLV moloney murine leukemia virus
- AMV avian myeloblastosis virus
- BLV bovine leukemia virus
- RSV Rous sarcoma virus
- HAV human immunodeficiency virus
- Primers refers to short, chemically synthesized oligonucleotides, usually with a length of about twenty to thrit ⁇ bases. They are hybridized to a target DNA, which is then copied by a DNA polymerase to produce a complementary DNA strand.
- a "forward primer” and a “reverse primer” constitute a "PCR primer set” used in PCR, where they hybridise to complementary DNA strands and direct replication towards each other producing the upper-strand and the lower- strand, respectively, leading to an exponential increase in the target DNA segment.
- the template derived extension of PCR primers can be carried out by any DNA polymerases, such as bacterial thermostable DNA polymerases, including Taq DNA polymerase from Thermus aquaticus, Pfu DNA polymerase from Pyrococcus furiosus, Vent DNA polymerase from Thermococcus litoralis or recombinant DNA polymerases such as Phusion DNA polymerase.
- DNA polymerases such as bacterial thermostable DNA polymerases, including Taq DNA polymerase from Thermus aquaticus, Pfu DNA polymerase from Pyrococcus furiosus, Vent DNA polymerase from Thermococcus litoralis or recombinant DNA polymerases such as Phusion DNA polymerase.
- PCR 1 PCR reaction
- PCR amplification PCR amplification
- qPCR and "real-time quantitative PCR” refers to the use of PCR to amplify and simultaneously quantify a targeted DNA molecule.
- qPCR enables both detection and quantification of the number of copies or relative amount of a specific sequence in a DNA sample, when normalized to DNA input.
- Amplified DNA is quantified as it accumulates in the reaction in real time after each amplification cycle. Quantification is accomplished using various assay chemistries including fluorescent dyes, such as SYBR® green, that intercalate with double-stranded DNA, and fluorescent reporter oligonucleotide probes such as Taqman probes, that release fluorescence signal during the amplification process.
- qRT-PCR refers to quantitative reverse transcription polymerase chain reaction in which a cDNA produced in a reverse transcription reaction serves as the initial DNA template for the amplification process, which is then combined with qPCR to quantify low abundance of RNA molecules such as microRNAs in a sample of a particular cell or tissue type. Methods for qPCR and qRT-PCR is described in "A-Z of Quantitative PCR.” (Bustin, SA (ed.) International
- Hybridisation refers to the bonding of two complementary single stranded nucleic acid polymers (such as oligonucleotides), such as RNA, DNA or polymers comprising or consisting of nucleotide analogues (such as LNA oligonucleotides).
- Hybridisation is highly specific, and may be controlled by regulation of the concentration of salts and temperature. Hybridisation occurs between complementary sequences, but may also occur between sequences which comprise some mismatches.
- the oligonucleotides used in the methods of the present invention may, therefore be 100% complementary to the target molecule. Alternatively, in one embodiment the oligonucleotides may comprise at least one or two mismatches.
- T m or "melting temperature" of an oligonucleotide is in the present context a measure of the stability of a duplex formed between the oligonucleotide and its perfect complement DNA strand determined at 115 mM Na + , no formamide.
- T m is defined as the temperature at which 50 % of the duplexes formed between the oligonucleotide and a complement nucleotide strand are dissociated into single strands.
- the length and nucleotide composition, such as the sequence of nucleotides and content of G and C nucleotides, of the oligonucleotide are important factors affecting T m .
- T m calculators are OligoCalc (W. A. Kibbe (2007) Nucleic Acids Res Volume 35, Web Server issue W43-W46) and LNA Probe T m Predictor at http://www.exiqon.com/oliao-tools .
- base covers the naturally occurring nucleobases adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U) as well as non-naturall ⁇ occurring nucleobases such as xanthine, diaminopurine, 8-oxo-N 6 -methyladenine, 7-deazaxanthine, 7- deazaguanine, N 4 ,N 4 -ethanocytosin, N 6 ,N 6 -ethano-2,6-diaminopurine, 5-methylc ⁇ tosine, 5- (C 3 -C 6 )-alkynyl-cytosine, 5-fluorouracil, 5-bromouracil, pseudoisocytosine, 2-hydroxy-5- methyl-4-triazolop ⁇ ridin, isocytosine, isoguanine, inosine and the "non-naturally occurring" nucleobases described in Benner e
- nucleobase thus includes not only the known purine and pyrimidine heterocycles, but also heterocyclic analogues and tautomers thereof. Further naturally and non naturally occurring nucleobases include those disclosed in U.S. Patent No. 3,687,808; in chapter 15 by Sanghvi, in Antisense Research and Application, Ed. S. T. Crooke and B.
- nucleotide residues Nucleotides incorporated into oligonucleotides are referred to as nucleotide residues.
- nucleoside base or “nucleobase analogue” is further intended to include heterocyclic compounds that can serve as like nucleosidic bases including certain "universal bases” that are not nucleosidic bases in the most classical sense but serve as nucleosidic bases.
- a universal base is 3-nitropyrrole or a 5-nitroindole.
- Other preferred compounds include pyrene and pyridyloxazole derivatives, pyrenyl, pyrenylmethylglycerol derivatives and the like.
- Other preferred universal bases include, pyrrole, diazole or triazole derivatives, including those universal bases known in the art.
- INA 1 INA monomei
- oriNA molecule e.g., an LNA nucleoside or LNA nucleotide
- LNA oligomer e.g., an oligonucleotide or nucleic acid
- nucleoside or nucleotide analogue that includes at least one LNA monomer.
- LNA LNA containing oligonucleotide sequences presented herein
- the LNAs are indicated by capital letters, whereas natural occurring nucleotide residues are indicated by lowercase letters: mC denotes LNA methyl cytosine.
- LNA monomers as disclosed in PCT Publication WO 99/14226 are in general particularly desirable modified nucleic acids for incorporation into an oligonucleotide of the invention. Additionally, the nucleic acids may be modified at either the 3 * and/or 5' end by any type of modification known in the art. For example, either or both ends may be capped with a protecting group, attached to a flexible linking group, attached to a reactive group to aid in attachment to the substrate surface, etc. Desirable LNA monomers and their method of synthesis also are disclosed in WO 98/39352.
- LNA monomers also referred to as "oxy-LNA' are LNA monomers which include bicydic compounds as disclosed in PCT Publication WO 03/020739 wherein the bridge between R 4 and R 2 as shown in formula (I) below together designate -CH 2 -O- or -CH 2 -CH 2 -O-.
- references herein to a nucleic acid unit, nucleic acid residue, LNA monomer, or similar term are inclusive of both individual nucleoside units and nucleotide units and nucleoside units and nucleotide units within an oligonucleotide.
- a “modified base” or other similar terms refer to a composition (e.g., a non-naturall ⁇ occurring nucleotide or nucleosidic base), which can pair with a natural base (e.g., adenine, guanine, cytosine, uracil, and/or thymine) and/or can pair with a non-naturall ⁇ occurring nucleotide or nucleosidic base.
- the modified base provides a T m differential of 15,
- chemical moiety refers to a part of a molecule.
- Modified by a chemical moiety thus refer to a modification of the standard molecular structure by inclusion of an unusual chemical structure. The attachment of said structure can be covalent or non-covalent.
- a chemical moiety in an oligonucleotide probe thus refers to attachment of a molecular structure.
- Such as chemical moiety include but are not limited to covalentl ⁇ and/or non-covalentl ⁇ bound minor groove binders (MGB) and/or intercalating nucleic acids
- INA selected from a group consisting of asymmetric cyanine dyes, DAPI, SYBR Green I,
- Oligonucleotide analogue refers to a nucleic acid binding molecule capable of recognizing a particular target nucleotide sequence.
- a particular oligonucleotide analogue is peptide nucleic acid (PNA) in which the sugar phosphate backbone of an oligonucleotide is replaced by a protein like backbone.
- PNA peptide nucleic acid
- nucleotides are attached to the uncharged pol ⁇ amide backbone yielding a chimeric pseudopeptide-nucleic acid structure, which is homomorphous to nucleic acid forms.
- T- ⁇ gh affinity nucleotide analogue or "affinity-enhancing nucleotide analogue” refers to a non- naturally occurring nucleotide analogue that increases the "binding affinity of an oligonucleotide probe to its complementary recognition sequence when substituted with at least one such high-affinity nucleotide analogue.
- a probe with an increased 'binding affinity for a recognition sequence compared to a probe which comprises the same sequence but does not comprise a stabilizing nucleotide refers to a probe for which the association constant (K a ) of the probe recognition segment is higher than the association constant of the complementary strands of a double- stranded molecule.
- the association constant of the probe recognition segment is higher than the dissociation constant (K d ) of the complementary strand of the recognition sequence in the target sequence in a double stranded molecule.
- Monomers are referred to as being "complementary" if they contain nucleotides that can form hydrogen bonds according to Watson-Crick base-pairing rules (e.g.
- G with C A with T or A with U
- other hydrogen bonding motifs such as for example diaminopurine with T, 5- methyl C with G, 2-thiothymidine with A, inosine with C, pseudoisocytosine with G, etc.
- oligonucleotide By “oligonucleotide,” “oligomer,” or “oligo” is meant a successive chain of monomers (e.g., glycosides of heterocyclic bases) connected via internucleoside linkages.
- the cycle at which the fluorescence from a sample crosses the threshold is called the 1 CyCIe threshold' or Q.
- Ct is used for quantification of a template.
- crossing poinf or Cp value is a slightly different, but related value that can be used for quantification of a template somewhat similar to the use of Q.
- the "targef or 'target nucleic acid * or target ribonucleic acid” refers to any relevant nucleic acid of a single specific sequence, e. g., a biological nucleic acid, e. g., derived from a subject or human being.
- the 'target' is a human miRNA or precursor thereof, or in one embodiment, a molecule which retains the genetic sequence information contained therein - such as all or (a sufficient) part of the seqeunce of nucleotides or reverse complement thereof.
- Target sequence refers to a specific nucleic acid sequence (or corresponding nuceltobase seqeunce) within any target nucleic acid.
- primer design refers to methods such as those provided below.
- the primer design is an systematic approach used for designing the sequence of nucleotides in forward and reverse primers thus ensuring probe specificity and binding efficiency to target microRNAs.
- the following rules have been used for design of primers for miR-specific qPCR:
- the forward primers are designed to be identical of from 12 to 18 bases of the 5' end of the miR sequence.
- the Tm of the forward primers should be in the range of between 55 0 C and 65 3 C, however, a Tm below 55 °C and above 65 “C may also be acceptable.
- one or more LNA monomers may be inserted into the sequence substituting the natural nucleotide.
- An artificial nucleotide sequence may also be added to the 5'-end of the forward primer to make certain that the Tm is in the range of between 55 °C and 65 °C.
- the reverse primer is according to formula II:
- R is a 5'-end nucleotide sequence
- T is a central part of x consecutive thymine
- x is an integer of from 1 to 100
- R is a 7-end nucleotide sequence that specifically hybridizes to a part of a microRNA molecule.
- R is preferably a nucleotide sequence of from 1 to 10 nucleotides designed from the J-end
- R is able to hybridize specifically to the DNA strand (i.e. the upper- strand) produced by extension of the corresponding miRNA specific forward primer.
- T m of the primer preferably is in the
- one or more LNA monomer may be inserted into the R sequence substituting the corresponding natural nucleotide.
- the (T) x central part is preferably a stretch of approximately 15 consecutive thymine nucleotide residues that hybridizes to the poly-A-tail part of the DNA strand produced from the corresponding miRNA specific forward primer.
- the R sequence of the reverse primer typically has a length of form 1 to 20 nucleotides.
- example R can be 17 nucleotides long, 8, 7 or 6 nucleotides long or even only one
- the R sequence is S-
- the length of the R sequence may be reduced from the 5'-end to adjust the T m of the reverse primer to the preferable range of between 55
- the R sequence is identical to or at least has overlap to part of the R sequence (formula (III)) of the extension primer.
- LNA should be in position four or higher from the J end of the primer.
- LNA should be in position four or higher from the J end of the primer.
- LNA-T LNA-th ⁇ mine
- R -OT Add a sequence of the formula R -OT) x to the 5'end of the reverse primer.
- the nucleotide sequence: (SEQ ID NO 4) is added at the 5' end of the reverse primer. If an LNA-T was added to the miR-specific part of the reverse primer (step C6) delete one thymine residue from the tail as there should never be more than 15 consecutive thymine residues.
- nucleotides are removed from the 5'-end of the reverse primer to fine-tune the T m of the primer.
- RNA refers to RNA comprising compositions obtained from cells, tissues or fluids from an organism according to conventional procedures described e.g. in RNA Isolation and Characterization Protocols (Rapley, Ralph; Manning, David L. (Eds. ⁇ 1998) known to the skilled artesian or by using commercial kits such as miRNeasy (QIAGEN GmbH, Hilden, Germany)) or miRVana (Ambion Inc., Austin, TX, US).
- Sources for isolation of RNA fractions are samples of cells, or tissue or fluid isolated from an organism or organisms, including but not limited to, for example, skin, plasma, serum, spinal fluid, lymph fluid, synovial fluid, urine, tears, blood cells, organs, tumours, and also to samples of in vitro cell culture constituents (including but not limited to conditioned medium resulting from the growth of cells in cell culture medium, recombinant cells and cell components).
- sample may also refer to cells or fluids that can be used directly in a q RT-PCR proces without previous enrichment of the RNA fraction or even RNA comprising compositions comprising artificially s ⁇ nthesised RNA.
- Cells or cell types also refer to any cells of Eukaryote, Prokar ⁇ ote and Archaea origin.
- a "living organism” refers to a living entity, including but not limited to, for example, human, mouse, rat, Drosophila, C. elegans, yeast, Arabidopsis thalia ⁇ a, maize, rice, zebra fish, primates, domestic animals, etc.
- the present invention provides methods for amplification of microRNA molecules in a sample, the method comprising the steps described schematically in Fig. 1, and comprise:
- step (a) and (b) When performing the method in practice step (a) and (b) is typically performed as one concerted reaction which is universal for all RNAs to be analysed - hence its nickname: 'Universal RT.
- the advantage of only one first-strand cDNA synthesis reaction (or RT reaction) to be used as template for multiple real-time PCR assays is that it saves precious sample, reduces technical variation and reduces time spent in the laboratory.
- RNAs are specifically PCR amplified using specific forward and reverse primers.
- the primers are optimised by introducing one or more LNA nucleotide analogues into the sequence of the primers, and typically the PCR is quantitative Real-Time PCR.
- the method result in 1) uniquely specific assays that enable discrimination between highly related RNA sequences and 2) an extremely low background which enables accurate quantitation of very low RNA levels.
- the method has been extensively used to quantify small RNAs.
- the small RNA comprises small non-coding RNAs such as short inferring RNAs (siRNAs), mature microRNAs and pre-microRNAs.
- small non-coding RNAs such as short inferring RNAs (siRNAs), mature microRNAs and pre-microRNAs.
- larger RNAs e.g. precursers of pre-microRNAs the pri-miRNAs (pri-miRs) and mRNAs may be assessed by method.
- the small RNA is a microRNA.
- the extension primer may be of a length in the range from 10 to 100 nucleotidbes, such as a length in the range from 15 to 45 nucleotides.
- the extension primer has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.
- the extension primer is of the formula III: wherein R is a 5'-end nucleotide sequence, (T)y is a central part of consecutive thymine
- the 5'-end part R is a nucleotide sequence with a length of from 1 to 30
- R sequence may be 6, 7, 8, 9, or 10 nucleotides long.
- sequence includes at least a hybridisation sequence for the R sequence in the reverse primer of the formula II (see below) to be used in the subsequent miRNA-specific qPCR.
- ⁇ in formula III is in the interval of from 5 to 50, more preferably y is in the interval of from 5 to 21.
- y is 12, 13, 14, 15, 16, 17 or 18.
- Most preferably y is 15.
- y of formula (III) equals x of formula (II).
- R is a degenerated anchor sequence motif VN, comprising the two 3-end terminal nucleotide residues, wherein V designate a selection of residues comprising bases which can base pair to all but one of the natural bases (e.g. base pair to guanine, cytosine, uracil and thymine but not to adenine), typically V designate that the base in any primer molecule is a base randomly selected between adenine, guanine and cytosine and wherein N designate a base which can base pair to any of the natural bases (e.g. adenine, guanine, cytosine, uracil and thymine), typically N may be a base randomly selected between adenine, guanine, cytosine or thymine residue.
- V designate a selection of residues comprising bases which can base pair to all but one of the natural bases (e.g. base pair to guanine, cytosine, uracil and thymine
- R is a degenerated sequence motif VNN, comprising the three 7-end terminal nucleotide residues, wherein V designate a selection of residues comprising bases which can base pair to all but one of the natural bases (e.g. base pair to guanine, cytosine, uracil and thymine but not to adenine), typically V designate that the base is a base randomly selected between adenine, guanine and cytosine and wherein N designate a base which can base pair to any of the natural bases (e.g.
- the extension primer comprises at least one LNA.
- the forward primer has a length in the range of from 10 to 100 nucleotides, such as 12 to 22 or 13 to 20 or 14,15, 16, 17, 18 or 19 nucleotides. See table 18 for specific embodiments.
- the forward primer may comprise one, two or even more LNAs.
- the nucleotide sequence of the forward primer is designed to specifically hybridize to the complement DNA molecule of a specific microRNA molecule using the primer design rules described in the definition of "primer design" (see DEFINITIONS section ⁇
- the reverse primer is of the formula II:
- R is a 5'-end nucleotide sequence (T) x is a central part of consecutive thymine
- x is an integer of from 1 to 100
- R is a ⁇ -end nucleotide sequence that specifically hybridizes to a nucleotide sequence of a target RNA molecule.
- the S-en ⁇ nucleotide sequence R of the reverse primer of formula II is a nucleotide sequence with a length of from 1 to 30 nucleotides.
- x in formula II is in the interval of from 5 to 50, more preferably x is in the interval of from 5 to 21.
- x is 12, 13, 14, 15, 16, 17 or 18.
- Most preferably x is 15.
- x of formula (II) equals y of formula (III). 4
- the J-end nucleotide sequence R of the reverse primer of formula II has a length in the range of from 1 to 10 nucleotides.
- LNA has a profound effect. Accordingly, in a preferred embodiment
- the 3"-end part, R , of the reverse primer of formula II comprises at least one
- the J-end part, R , of the reverse primer of formula II contains only one LNA.
- the LNA is situated in the 5' position or the
- nucleotide sequence of the reverse primer is designed to specifically hybridize to a specific microRNA molecule using the primer design rules described in the definition oPprimer design" (see DEFINITIONS section)
- the invention also provides methods for designing the nucleotide sequence of the forward primers and the reverse primers used in the invention. Systematic approaches and experimental evaluation of the primers are presented in the EXAMPLES 3 section.
- the present invention is useful for amplification and quantification of small RNA molecules such as microRNAs or siRNA's in various cells or tissues originating from humans or other organisms as described in EXAMPLES 5 and 9. As illustrated in example 10 the present method is superior with respect to sensitivity and specificity when compaired with a somewhat similar single tube cDNA synthesis approach which is commercially available.
- one aspect of the invention is a method for measuring the amount of a target microRNA in a sample from a living organism, the method comprising the steps of:
- the amount of the amplified DNA molecules is typically measured using fluorescence-based
- the present invention can be used as a tool for microRNA profiling of different cell and tissue types within a living organism.
- the number of specific microRNAs and the amounts of specific microRNAs present in different cell and tissue types can be determined using the present invention.
- the invention can be used to discriminate between the levels of mature microRNAs, pre-microRNAs and pri-microRNAs in different cell and tissue types by using appropiate primers targeting the mature microRNA or its precursors (see fig 5).
- the present invention can be used as a tool for microRNA profiling of patients suffering from various diseases such as cancer.
- the microRNAomes of various cancer tissues can be established using the invention.
- the present invention can be used for diagnosis of various diseases such as cancer by measuring microRNA expresssion in tissues and body fluids from normal individuals and from individuals having a disease, and subsequently analyse for differences in the microRNA profiles.
- the present invention may be used for measuring changes in the amount of specific microRNAs in response to treatment of a disease affected individual by means of pharmaceuticals, such as chemotherapeutical agents, and by means of surgery.
- the present invention may be used for measuring specific predictive microRNA biomarkers that correlate with re-currence free survival of patients having a disease, such as a cancer disease.
- the present invention is also suitable for high-throughput methods on robot platforms directed to the quantification of a single microRNA or a collection of microRNAs.
- the method is particularly suitable for multiple subsequent PCR reactions of individual microRNAs as described in EXAMPLE 5, 9 and 10.
- the method of the invention may be used to quantitatively determine the amount of mature microRNA in a sample without interference from the corresponding pre-miR, and vice versa the amount of a pre-miR can be determined without interference from the mature microRNA as described in EXAMPLES 6, 7 and 8.
- the method of the invention may be used for discrimination between targets with single nucleotide differences as described in EXAMPLE 4.
- kits for detecting at least one target microRNA comprising one or more primer sets specific for the detection of a target microRNA, each primer set comprising firstly, a universal extension primer for producing a cDNA molecule complementary to a target microRNA, and secondly, a PCR primer set comprising a forward primer specific for the .rend of the target miRNA and a reverse primer specific for the .Pend of the target miRNA for amplifying the cDNA molecule.
- a kit for detecting at least one target RNA comprises at least one primer set specific for the detection of a target RNA, said primer set comprises:
- R is a 5'-end nucleotide sequence
- T is a central part of consecutive thymine
- residues in the amount of y wherein y is an integer of from 1 to 100, and R is a ⁇ -end nucleotide sequence.
- R is a 5'-end nucleotide sequence
- T is a central part of consecutive thymine
- the kit is designed for detecting at least one mammalian target microRNA comprising at least one primer set specific for the detection of a target microRNA.
- the extension, the reverse and the forward primers are designed following the design rules given in the "primer design-part of the DEFINITIONS section and elsewhere and forward and reverse primers which includes at least one LNA molecule are especially preferred embodiments.
- a non-limiting example of an extension primer is shown as SEQ ID NO 5.
- Forward and reverse primers included in the kit may be designed to detect any mammalian target microRNA in accordance with the methods described herein.
- Non-limiting examples of forward and reverse primers are listed in TABLE 16.
- the kit includes multiple primer sets that may be used to detect various mammalian microRNA targets, such as two microRNA targets up to several hundred microRNA targets.
- a kit of the invention may also provide an array of primers delivered in microtiter qPCR plates such as 96, 768, 869, 1536 or even 3456-well microtiter qPCR plates suitable for robot handling as indicated in EXAMPLE 9.
- a kit of the invention may also include reagents required for the poly-A-tailing, primer extension and PCR reactions, such as buffers, salts, reducing agents, deoxy nucleoside triphosphates, nucleoside triphosphates, and enzymes.
- reagents required for the poly-A-tailing, primer extension and PCR reactions such as buffers, salts, reducing agents, deoxy nucleoside triphosphates, nucleoside triphosphates, and enzymes.
- a detection reagent for the qPCR such as 5YBR® green may also be included.
- a kit for RNA isolation may also be included.
- a further aspect of the invention is a high-throughput method for measuring the amount of specific target microRNAs in a sample from a living organism by using the method of the present invention and integrating an automated wherein the combined poly-A-tailing and reverse transcription reaction is aliquoted into individual wells of a microtiter plate containing microRNA specific primer sets of forward and reverse primers, resulting in the steps of:
- Such a set-up will typically comprise one or more pipetting robots.
- EXAMPLE 1 PRODUCTION OF SPECIFIC DNA MOLECULES USING MIR-SPECIFIC QPCR.
- hsa-miR-197 was amplified from a human RNA sample using the miR specific quantitative reverse transcription polymerase chain reaction (qRT-PCR) of this invention.
- RNA sample 100 ng of a mixture of 25 ng human heart RNA, 25 ng human brain RNA, 25 ng human liver RNA and 25 ng human lung RNA all from Ambion, Austin, TX, US.
- Synthetic templates were prepared in lOng/ ⁇ l phage MS2 RNA in TE, approximately 10 7 copies are added to the reaction. Synthetic template is obtained from Integrated DNA technologies Inc., Coralville, IA, US.) • Water to 10 ⁇ l
- Negative controls water control and a total human RNA control without PoIyA Polymerase in the RT reaction.
- the mixture was incubated at 42 0 C, 1 hour followed by 95 0 C, 5 minutes.
- step 1 on fig 1 For qPCR 1 ⁇ l or less of the polyA-tailing/RT reaction (step 1 on fig 1) was used for each PCR reaction with gene-specific forward and reverse primers for hsa-miR-197; forward primer 5' ttmCaccaccttctcca (SEQ ID NO 1) and the reverse primer (SEQ ID NO 2) (in the nucleotide sequences lower case designates a natural occurring nucleotide, upper case designates LNA, mC denotes LNA methyl cytosine).
- ® Real-time PCR was done on a ABI 7500 thermoc ⁇ cler (Applied Biosystems Inc, Foster City,
- a typical PCR reaction mixture contained :
- TE buffer 10 mM Tris/HCI (pH 8.0), ImM EDTA.
- the mixture was incubated at 95°C for 10 min followed 40 cycles of 95°C for 5 sec; 60 0 C for 60 sec with measurement of the fluorescence.
- Amplification of the correct product was measured by comparing the melting curve profile of the PCR product to the melting curve profile of a PCR product obtained by amplification of a synthetic template (Fig. 2). No signal was was obtained with the negative controls.
- the experiment shows that the same and correct hsa-miR-197 PCR product was obtained both using the total human RNA sample and a c hsa-miR-197 as template in step 1.
- EXAMPLE 2 EFFECT OF LNA IN THE REVERSE PRIMER.
- step 2 The effect of different designs of miR-specific PCR primers of step 2 can be tested on artificial DNA templates with the same sequence as the product of the reverse transcription reaction.
- An important advantage of using an artificial DNA template for PCR is that experimental variations in the efficiency of the reverse transcription step are eliminated.
- Hsa-let-7a DNA template Salmon DNA: 2 ng/ ⁇ l in TE buffer
- MiR-specific forward primer F7a: 5'-tGaGgtagtaggttg (SEQ ID NO 7) (lower case designates a natural occurring nucleotide, upper case designates LNA).
- a PCR mix was prepared:
- thermoc ⁇ der b ⁇ monitoring SYBR ® green fluorescence was carried out on a ABI 7500 " thermoc ⁇ der b ⁇ monitoring SYBR ® green fluorescence as a function of PCR cycle number.
- the mixture was incubated at 95°C for 10 min followed b ⁇ 40 cycles of 95°C for 5 sec; 60 0 C for 60 sec with measurement of the fluorescence.
- thermocycler Applied Biosystems, Foster City, CA, US. Briefly, the PCR reaction was incubated at 60 0 C for 1 minute and fluorescense was measured during a slow increase of the temperature to 95°C. The first derivative of the melting curves is shown in figure 3:
- EXAMPLE 3 MANUAL PRIMER DESIGN AND VALIDATION OF PRIMERS FOR MIRS.
- Primer validation By using the primer design rules it is possible to achieve PCR primers that have >70 % success rate in real-time PCR experiments according to the following validation criteria: Prepare Rtmix for four reverse transcription (RT) samples:
- RNA mix 1 ⁇ l 1 ⁇ g/ ⁇ l heart RNA, 1 ⁇ l 1 ⁇ g/ ⁇ l brain RNA, 1 ⁇ l 1 ⁇ g/ ⁇ l liver RNA, 1 ⁇ l 1 ⁇ g/ ⁇ l lung RNA, 36 ⁇ l TE.
- Sample 3 Ct above 40 compared to exponential area for #2 and 4. Melting peak derivative below 5000.
- Sample 4 One peak on bell shaped melting curve, unless otherwise justified the peak should be between 69 "C and 80 0 C. Peak at same temperature (+/- 0.5 0 C) as in sample 2.
- Lower case designates natural occuring nucleotides
- upper case designates LNA
- mC denotes LNA methyl cytosine.
- EXAMPLE 4 DISCRIMINATION BETWEEN TARGETS WITH A SINGLE NUCLEOTIDE DIFFERENCE.
- TlIe synthetic templates were prepared in lOng/ ⁇ l phage MS2 RNA in TE.
- the synthetic templates are obtained from Integrated DNA technologies Inc., Coralville, IA, US.
- PCR reaction mixture contained:
- the mixture was incubated at 95°C for 10 min followed 40 cycles of 95°C for 5 sec; 60 0 C for 60 sec with measurement of the fluorescence.
- Amplification of the correct product was measured by comparing the melting curve profile of the PCR product to the melting curve profile of a PCR product obtained by amplification of a synthetic template.
- EXAMPLE 5 QUANTIFICATION OF MIRS IN HUMAN BRAIN TOTAL RNA.
- v designates cytosine, guanine and adenine residues
- n designates cytosine, guanine, adenine and thymine residues
- Synthetic template Equal amounts (number of copies) of synthetic /?sa-let-7a, /?sa-miR-21, ⁇ sa-miR-27b and ⁇ sa-miR-195 in lOng/ ⁇ l phage MS2 RNA in TE (obtained from Integrated DNA technologies Inc).
- TE 1OmM Tris/HCI (pH 8.0), ImM EDTA.
- PCR reaction mixture contained:
- the mixture was incubated at 95°C for 10 min followed 40 cycles of 95°C for 5 sec; 60 0 C for 60 sec with measurement of the fluorescence.
- Amplification of the correct product was measured by comparing the melting curve profile of the PCR product to the melting curve profile of a PCR product obtained by amplification of a synthetic template.
- the Ct of the sample with human brain RNA was compared to the standard curve to determine the number of miRs in the sample (Bustin, SA (ed.) "A-Z of Quantitative PCR.” International University Line (La JoIIa, California, USA), 2004).
- v designates cytosine, guanine and adenine residues
- n designates cytosine, guanine, adenine and thymine residues
- PCR reaction mixture contained:
- the mixture was incubated at 95°C for 10 min followed 40 cycles of 95°C for 5 sec; 60 0 C for 60 sec with measurement of the fluorescence.
- ⁇ sa-miR-lOa and the corresponding pre-miR, ⁇ sa-pre-miR-lOa were detected in total human RNA.
- v designates cytosine, guanine and adenine residues
- n designates cytosine, guanine, adenine and thymine residues
- TE buffer 1OmM Tris/HCI (pH 8.0), ImM EDTA.
- PCR reaction mixture contained:
- the mixture was incubated at 95°C for 10 min followed 40 cycles of 95°C for 5 sec; 60 0 C for 60 sec with measurement of the fluorescence.
- the total RNA sample contains more than 10 6 copies of ⁇ sa-miR-lOa because the C ⁇ is below the C ⁇ of the sample with 10 6 copies of ⁇ sa-miR-10a whereas the total RNA sample contains less than 10 6 copies of ⁇ sa-premiR-lOa because the C ⁇ is below the C T of the sample with 10 6 copies of ⁇ sa-premiR-lOa.
- Synthetic miR 203 RNA (5'- gugaaauguuuaggaccacuag ⁇ (SEQ ID NO 103) and pre- miR 203 RNA (5'- agugguucuuaacaguucaacaguucugu-agcgcaauugugaaauguuuaggaccacuag) (SEQ ID NO 104) were selected as test subjects.
- the synthetic RNAs were synthesized by Integrated DNA technologies Inc., Coralville, IA, US. The RNAs were diluted to l*10 6 molecules/ ⁇ L in TEMS2 (TE buffer (10 mM Tris HCI pH 8, and 0.1 mM EDTA mixed with 10 ng/ ⁇ L MS2 viral RNA (Roche Applied Science Inc).
- q-RT-PCR reactions were performed in a 384 well plate in a LightCycler 480 (Roche Diagnostics) instrument using the following PCR protocol
- Aim of the experiment is to determine if well expressed mi RNAs that are differently expressed between heart and liver tissue can be discriminated using a qPCR array based on the SYBR green universal reverse transcriptase quantitative PCR (UniRT qPCR) method of the present invention.
- RNA from liver and whole-heart was obtained from Ambion Inc., and diluted in nuclease free water to a concentration of 10 ng/ ⁇ L and stored at -8O 0 C.
- the miR selected were hsa-miR-1, hsa-miR-126 and hsa-miR-133b (heart) and hsa-miR-192, hsa-miR-122*, hsa-miR-194 and hsa-miR-122 (liver).
- Quantitative polymerase chain reaction (q-PCR), step 2 of the protocol, was performed as follows:
- 5 ⁇ L diluted cDNA was mixed with 5 ⁇ L SYBR Green Master Mix, UniRT (Exiqon AS, Cat.No. 203400) into the 384 well plate with desiccated primer sets of the seven miR assays described below.
- the plate was sealed and directly put on to the LightCycler for amplification and anallysis.
- q-RT-PCR reactions were performed in a LightCycler 480 (Roche Diagnostics) using the following PCR protocol:
- Table 15 Ex ression values for the 7 miR selected and tested on the UniRT platform.
- EXAMPLE 10 COMPARISON OF miR SPECIFIC ASSAYS DESIGNED IN PRESENT INVENTION TO COMPETING METHOD USING PURE DNA PRIMERS
- the LNA based design described in the present invention was compared to a commercial DNA based product, the miScript Reverse Transcription Kit (Qiagen, Cat. no. 218060, QIAGEN GmbH, Hilden, Germany).
- This DNA based product also relies on a miRNA J- polyadenylation step followed by reverse transcription with a DNA based poly dT primer where both reactions occur in a one-tube reaction. Because both these methods use the same enzymatic steps a comparison very well illustrate the surprising advantages of the present LNA based method since the miScript does not include LNA in the primers.
- Another difference is that the miScript uses a reverse primer specific to the universal tag added with the RT primer whereas the LNA based reverse primer of the present method is specific to the miRNA being detected.
- Reverse transcription was performed on a dilution series of synthetic miRNA target (obtained from Integrated DNA technologies Inc., Coralville, IA, US.), with a background of 10 ng/ ⁇ l MS2 bacteriophage RNA (Roche Applied Science, Catalog Number 10165948001), using either Universal cDNA Synthesis Kit (Exiqon A/S, Vedbaek, Denmark., Prod. No. 203300) or miScript Reverse Transcription Kit (Qiagen, Cat. no. 218060, QIAGEN GmbH, Hilden, Germany) according to the manufacturer's instructions.
- Figure 8 shows the triplicate Cp values versus template concentration obtained in the experiment for each of the four tested miRNAs.
- the method of the present invention was more sensitive (black lines connecting diamonds) than the miScript assay (gray lines connecting sphaeres) as indicated by the lower Cp values consistently obtained with the assay of the present invention.
- ⁇ sa-let-7a there was a 10- fold improved sensitivity of the assay of the present invention, measured as the lowest copy- number detected quantitatively. For ftsa-miR-143 and ⁇ sa-miR-155 the difference in sensitivity was 100-fold better with the assay of the present invention.
- Lower case designates natural occuring nucleotides
- upper case designates LNA
- mC denotes LNA methyl cytosine.
- v is either an adenine residue, a guanine residue, or a c ⁇ tosine residue
- n is either an adenine residue, a guanine residue, a cytosine residue or a thymine residue.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (11)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP10706492.5A EP2391736B1 (en) | 2009-02-02 | 2010-02-02 | Method for quantification of small rna species |
| US13/147,562 US9096895B2 (en) | 2009-02-02 | 2010-02-02 | Method for quantification of small RNA species |
| DK10706492.5T DK2391736T3 (en) | 2009-02-02 | 2010-02-02 | A method for the quantitation of small RNA species |
| SG2011055654A SG173506A1 (en) | 2009-02-02 | 2010-02-02 | Method for quantification of small rna species |
| HK12102679.0A HK1162196B (en) | 2009-02-02 | 2010-02-02 | Method for quantification of small rna species |
| CN201080006461.XA CN102301011B (en) | 2009-02-02 | 2010-02-02 | Method for quantification of small RNA species |
| JP2011546595A JP5749656B2 (en) | 2009-02-02 | 2010-02-02 | Method for quantification of small RNA species |
| CA2750029A CA2750029C (en) | 2009-02-02 | 2010-02-02 | Method for quantification of small rna species |
| AU2010207826A AU2010207826B2 (en) | 2009-02-02 | 2010-02-02 | Method for quantification of small RNA species |
| ES10706492.5T ES2541356T3 (en) | 2009-02-02 | 2010-02-02 | Quantification procedure for small RNA species |
| IL214301A IL214301A (en) | 2009-02-02 | 2011-07-26 | Method for amplification of microrna, a method for measuring the amount of a target microrna and a kit for detecting at least one target microrna |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DKPA200900156 | 2009-02-02 | ||
| DKPA200900156 | 2009-02-02 | ||
| DKPA200901038 | 2009-09-17 | ||
| DKPA200901038 | 2009-09-17 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2010085966A2 true WO2010085966A2 (en) | 2010-08-05 |
| WO2010085966A3 WO2010085966A3 (en) | 2010-10-07 |
Family
ID=42232678
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/DK2010/050029 Ceased WO2010085966A2 (en) | 2009-02-02 | 2010-02-02 | Method for quantification of small rna species |
Country Status (11)
| Country | Link |
|---|---|
| US (1) | US9096895B2 (en) |
| EP (1) | EP2391736B1 (en) |
| JP (1) | JP5749656B2 (en) |
| CN (1) | CN102301011B (en) |
| AU (1) | AU2010207826B2 (en) |
| CA (1) | CA2750029C (en) |
| DK (1) | DK2391736T3 (en) |
| ES (1) | ES2541356T3 (en) |
| IL (1) | IL214301A (en) |
| SG (1) | SG173506A1 (en) |
| WO (1) | WO2010085966A2 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013011378A1 (en) | 2011-07-15 | 2013-01-24 | Leo Pharma A/S | Diagnostic microrna profiling in cutaneous t-cell lymphoma (ctcl) |
| WO2014052487A1 (en) | 2012-09-28 | 2014-04-03 | Cepheid | Two-primer pcr for microrna multiplex assay |
| CN106222244A (en) * | 2015-06-02 | 2016-12-14 | 奎克生技光电股份有限公司 | Nucleotide sequence, universal reverse primer, universal reverse transcription primer, primer design method and miRNA detection method |
| EP3181699A1 (en) | 2015-12-17 | 2017-06-21 | Oniris | Micrornas as predictive biomarkers of type 1 diabetes |
| WO2024003311A1 (en) * | 2022-06-30 | 2024-01-04 | Quantoom Biosciences France Sas | Method for adhering a poly(da/dt) tail to a dna backbone |
Families Citing this family (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2653559A1 (en) | 2012-04-20 | 2013-10-23 | Samsung Electronics Co., Ltd | Polynucleotide and use thereof |
| PL3260558T3 (en) | 2012-11-02 | 2020-08-10 | Life Technologies Corporation | NEW COMPOSITIONS AND WAYS TO IMPROVE PCR SPECIFICATIONS |
| KR101984700B1 (en) | 2012-11-19 | 2019-05-31 | 삼성전자주식회사 | Polynucleotide and use thereof |
| KR101922125B1 (en) | 2012-11-29 | 2018-11-26 | 삼성전자주식회사 | A method for labeling a target nucleic acid |
| WO2014089797A1 (en) * | 2012-12-13 | 2014-06-19 | 深圳华大基因科技服务有限公司 | Locked nucleic acid-modified dna fragment for high-throughput sequencing |
| CN103555848B (en) * | 2013-11-08 | 2015-02-11 | 复旦大学 | 3'-5'-qPCR (quantitative polymerase chain reaction) quantitative detection technology for small RNA (ribonucleic acid) |
| CN103740842B (en) * | 2014-01-26 | 2015-12-09 | 广州市锐博生物科技有限公司 | Highly sensitive tiny RNA quantitative detecting method and test kit |
| CA2977439C (en) | 2015-02-27 | 2025-05-20 | Aarhus Universitet | A microrna-based method for assessing the prognosis of a prostate cancer patient |
| CN107429296B (en) | 2015-03-13 | 2022-01-28 | 生命技术公司 | Methods, compositions and kits for capturing, detecting and quantifying small RNAs |
| CN106226273B (en) * | 2016-07-05 | 2018-09-25 | 无锡市第二人民医院 | A kind of rapid detection method of microRNA |
| CN108315824A (en) * | 2017-01-16 | 2018-07-24 | 刘月星 | A kind of construction method of RNA high-throughput sequencing libraries |
| CN108315320A (en) * | 2017-01-16 | 2018-07-24 | 李辉辉 | A kind of preparation method of RNA high-throughput sequencing libraries |
| CN111621566B (en) * | 2020-05-31 | 2022-04-01 | 浙江大学 | Serum miRNA marker for diagnosing liver cancer and predicting liver cancer metastasis and detection kit thereof |
| US20240425905A1 (en) * | 2021-08-25 | 2024-12-26 | Advanced Precision Medicine Limited | Method and kit for detecting microrna |
Family Cites Families (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3687808A (en) | 1969-08-14 | 1972-08-29 | Univ Leland Stanford Junior | Synthetic polynucleotides |
| US5432272A (en) | 1990-10-09 | 1995-07-11 | Benner; Steven A. | Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases |
| JP2843675B2 (en) * | 1992-03-11 | 1999-01-06 | ダナ−ファーバー・キャンサー・インスチチュート・インコーポレーテッド | Identification, isolation and cloning of messenger RNA |
| US5912340A (en) | 1995-10-04 | 1999-06-15 | Epoch Pharmaceuticals, Inc. | Selective binding complementary oligonucleotides |
| JP3756313B2 (en) | 1997-03-07 | 2006-03-15 | 武 今西 | Novel bicyclonucleosides and oligonucleotide analogues |
| CA2303299C (en) | 1997-09-12 | 2016-02-23 | Exiqon A/S | Oligonucleotide analogues |
| EP1072679A3 (en) | 1999-07-20 | 2002-07-31 | Agilent Technologies, Inc. (a Delaware corporation) | Method of producing nucleic acid molecules with reduced secondary structure |
| WO2003020739A2 (en) | 2001-09-04 | 2003-03-13 | Exiqon A/S | Novel lna compositions and uses thereof |
| DE50208869D1 (en) * | 2002-01-23 | 2007-01-11 | Heraeus Tenevo Gmbh | METHOD AND DEVICE FOR PREPARING A CYLINDER-FRAME GLASS BODY |
| US7232547B2 (en) * | 2002-03-22 | 2007-06-19 | Marshfield Clinic | Apparatus and method for testing and continuously reading low-volume samples |
| WO2005098029A2 (en) * | 2004-04-07 | 2005-10-20 | Exiqon A/S | Methods for quantification of micrornas and small interfering rnas |
| US8071306B2 (en) * | 2005-01-25 | 2011-12-06 | Merck Sharp & Dohme Corp. | Methods for quantitating small RNA molecules |
| JP2008528003A (en) | 2005-01-25 | 2008-07-31 | ロゼッタ インファーマティックス エルエルシー | Method for quantifying small RNA molecules |
| ATE532878T1 (en) | 2005-08-24 | 2011-11-15 | Life Technologies Corp | METHOD FOR QUANTIFYING SIRNAS, MIRNAS AND POLYMORPHOIC MIRNAS |
| DE102006038113A1 (en) * | 2006-08-14 | 2008-02-21 | Qiagen Gmbh | A method of synthesizing a cDNA in a sample in an enzymatic reaction and simultaneously providing a first enzyme having polyadenylation activity and a second enzyme having reverse transcriptase activity |
| WO2008040355A2 (en) | 2006-10-06 | 2008-04-10 | Exiqon A/S | Novel methods for quantification of micrornas and small interfering rnas |
-
2010
- 2010-02-02 JP JP2011546595A patent/JP5749656B2/en active Active
- 2010-02-02 AU AU2010207826A patent/AU2010207826B2/en active Active
- 2010-02-02 WO PCT/DK2010/050029 patent/WO2010085966A2/en not_active Ceased
- 2010-02-02 CA CA2750029A patent/CA2750029C/en active Active
- 2010-02-02 US US13/147,562 patent/US9096895B2/en active Active
- 2010-02-02 SG SG2011055654A patent/SG173506A1/en unknown
- 2010-02-02 EP EP10706492.5A patent/EP2391736B1/en active Active
- 2010-02-02 DK DK10706492.5T patent/DK2391736T3/en active
- 2010-02-02 ES ES10706492.5T patent/ES2541356T3/en active Active
- 2010-02-02 CN CN201080006461.XA patent/CN102301011B/en active Active
-
2011
- 2011-07-26 IL IL214301A patent/IL214301A/en active IP Right Grant
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013011378A1 (en) | 2011-07-15 | 2013-01-24 | Leo Pharma A/S | Diagnostic microrna profiling in cutaneous t-cell lymphoma (ctcl) |
| WO2014052487A1 (en) | 2012-09-28 | 2014-04-03 | Cepheid | Two-primer pcr for microrna multiplex assay |
| CN106222244A (en) * | 2015-06-02 | 2016-12-14 | 奎克生技光电股份有限公司 | Nucleotide sequence, universal reverse primer, universal reverse transcription primer, primer design method and miRNA detection method |
| CN110804656A (en) * | 2015-06-02 | 2020-02-18 | 奎克生技光电股份有限公司 | Nucleotide sequence, universal reverse primer, universal reverse transcription primer and miRNA detection method |
| CN110804656B (en) * | 2015-06-02 | 2024-01-19 | 奎克生技光电股份有限公司 | Nucleotide sequence, universal reverse primer, universal reverse transcription primer and miRNA detection method |
| EP3181699A1 (en) | 2015-12-17 | 2017-06-21 | Oniris | Micrornas as predictive biomarkers of type 1 diabetes |
| WO2017102902A1 (en) | 2015-12-17 | 2017-06-22 | Ecole Nationale Veterinaire | Micrornas as predictive biomarkers of type 1 diabetes |
| WO2024003311A1 (en) * | 2022-06-30 | 2024-01-04 | Quantoom Biosciences France Sas | Method for adhering a poly(da/dt) tail to a dna backbone |
Also Published As
| Publication number | Publication date |
|---|---|
| IL214301A (en) | 2015-04-30 |
| EP2391736B1 (en) | 2015-04-08 |
| CA2750029C (en) | 2019-05-21 |
| IL214301A0 (en) | 2011-09-27 |
| US9096895B2 (en) | 2015-08-04 |
| AU2010207826B2 (en) | 2013-10-03 |
| HK1162196A1 (en) | 2012-08-24 |
| AU2010207826A1 (en) | 2011-08-04 |
| EP2391736A2 (en) | 2011-12-07 |
| DK2391736T3 (en) | 2015-05-11 |
| CN102301011A (en) | 2011-12-28 |
| WO2010085966A3 (en) | 2010-10-07 |
| SG173506A1 (en) | 2011-09-29 |
| ES2541356T3 (en) | 2015-07-17 |
| JP2012516678A (en) | 2012-07-26 |
| CN102301011B (en) | 2014-05-07 |
| JP5749656B2 (en) | 2015-07-15 |
| CA2750029A1 (en) | 2010-08-05 |
| US20120071332A1 (en) | 2012-03-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2391736B1 (en) | Method for quantification of small rna species | |
| US8383344B2 (en) | Methods for quantification of microRNAs and small interfering RNAs | |
| EP1735459B1 (en) | Methods for quantification of micrornas and small interfering rnas | |
| US8314220B2 (en) | Methods compositions, and kits for detection of microRNA | |
| EP2419537B1 (en) | Methods and compositions for detection of small rnas | |
| CN101528763B (en) | Methods and substances for isolation and detection of small polynucleotides | |
| CN102102130A (en) | Method for the detection of a RNA molecule, kit and use related thereof | |
| EP2900836B1 (en) | Two-primer pcr for microrna multiplex assay | |
| JP2008543288A (en) | Improved primer-based amplification method | |
| WO2008040355A2 (en) | Novel methods for quantification of micrornas and small interfering rnas | |
| JP2021514651A (en) | Preparation of single-stranded circular DNA template for single molecule sequencing | |
| US12421542B2 (en) | Advanced Dumbell PCR for isomiR detection | |
| CN102676637B (en) | A highly specific method for the determination of small RNA | |
| Kumar et al. | miR-ID: a novel, circularization-based platform for detection of microRNAs | |
| CN103797132A (en) | Use of G-Clamps for Improved Allele-Specific PCR | |
| KR101874089B1 (en) | A kit and method for detecting RNA molecules | |
| HK1162196B (en) | Method for quantification of small rna species | |
| EP4655417A1 (en) | Dumbbell pcr for methylated small non-coding rna detection | |
| Andersen et al. | 15 New Applications for Microarrays |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201080006461.X Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10706492 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010207826 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2750029 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2011546595 Country of ref document: JP |
|
| ENP | Entry into the national phase |
Ref document number: 2010207826 Country of ref document: AU Date of ref document: 20100202 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010706492 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 6201/CHENP/2011 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13147562 Country of ref document: US |






























