WO2010085966A2 - Method for quantification of small rna species - Google Patents

Method for quantification of small rna species Download PDF

Info

Publication number
WO2010085966A2
WO2010085966A2 PCT/DK2010/050029 DK2010050029W WO2010085966A2 WO 2010085966 A2 WO2010085966 A2 WO 2010085966A2 DK 2010050029 W DK2010050029 W DK 2010050029W WO 2010085966 A2 WO2010085966 A2 WO 2010085966A2
Authority
WO
WIPO (PCT)
Prior art keywords
primer
rna
nucleotide sequence
microrna
specific
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/DK2010/050029
Other languages
French (fr)
Other versions
WO2010085966A3 (en
Inventor
Peter Kamp Busk
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Exiqon AS
Original Assignee
Exiqon AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA2750029A priority Critical patent/CA2750029C/en
Priority to AU2010207826A priority patent/AU2010207826B2/en
Priority to US13/147,562 priority patent/US9096895B2/en
Priority to DK10706492.5T priority patent/DK2391736T3/en
Priority to SG2011055654A priority patent/SG173506A1/en
Priority to HK12102679.0A priority patent/HK1162196B/en
Priority to EP10706492.5A priority patent/EP2391736B1/en
Priority to CN201080006461.XA priority patent/CN102301011B/en
Application filed by Exiqon AS filed Critical Exiqon AS
Priority to JP2011546595A priority patent/JP5749656B2/en
Priority to ES10706492.5T priority patent/ES2541356T3/en
Publication of WO2010085966A2 publication Critical patent/WO2010085966A2/en
Publication of WO2010085966A3 publication Critical patent/WO2010085966A3/en
Priority to IL214301A priority patent/IL214301A/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification

Definitions

  • the present invention relates to a method for amplification and quantification of small non- coding RNA molecules using quantitative reverse transcription polymerase chain reaction (qRT-PCR) technology.
  • qRT-PCR quantitative reverse transcription polymerase chain reaction
  • MicroRNAs are an abundant class of approximately 22-nucleotide-noncoding RNAs, which play important regulatory roles in animal, plant and virus development.
  • the awareness of microRNAs was initiated almost 15 years ago by the discovery of lin-4, which encode a small RNA involved in the timing and progression of the nematode in C. elegans life cycle and larval development (Lee et al. 1993 Cell 75:843-854, Wightman et al.1993 Cell 75:855362), but it was only recently recognized that microRNAs form a major class of ribo-regulaters that have broad regulatory functions in animals (Lagos-Quintana et al. 2001 Science 294:853858, Lau et al.
  • MicroRNAs are involved in the regulation of gene expression at the posttranscriptional level by degrading or blocking translation of messenger RNA targets, and it has been speculated that approximately 30 % of the human genome could be regulated by microRNAs.
  • the importance of microRNAs is also obvious due to their involvement in various cellular processes including development, growth and proliferation, apoptosis, differentiation, and various human diseases (http://www.mir2disease.org/) such as cancer and diabetes.
  • miRNAs are altered in every type of analyzed human cancer;
  • miRNAs act as oncogenes and tumor suppressors;
  • miRNAs alterations may cause cancer predisposition;
  • miRNAs profiling is a new diagnostic tool for cancer patients and
  • miRNA profiling represents prognostic tools for cancer patients. Accordingly, methods for expression profiling and quantification of microRNAs in cells and body-fluids from cancer patients are of great importance. To address this requirement, the present invention describes the development of a new robust and reliable q RT-PCR assay for microRNA measurements.
  • ® involves a gene-specific reverse transcription step followed by a SYBR green qPCR step using a gene-specific forward primer containing locked nucleic acid (LNA) molecules and a universal reverse primer.
  • Gilad et al. reports a qRT-PCR assay that involves a pol ⁇ adenylation step, an unspeciflc reverse transcription step, and a qPCR step involving a gene-specific forward primer, a gene-specific TaqMan primer and a universal reverse primer.
  • Sharbati- Tehrani et al. developed a qRT-PCR assay that involves a gene-specific reverse transcription
  • the present invention is characterised by only one reverse transcription reaction for all microRNAs in a sample and furthermore provides an extremely sensitive PCR method with an unmatched specificity that can be used for accurate quantification of small RNA molecules such as microRNAs.
  • the present invention provides a procedure for amplifying and quantifying microRNA molecules in a sample: In the first step of the procedure complementary DNAs (cDNAs) of the microRNAs in a sample are produced by the concerted action of two enzymes in a single-tube reaction.
  • cDNAs complementary DNAs
  • poly-A tails are added to the J-terminus of the microRNAs using a pol ⁇ (A) polymerase, and secondly an extension primer is hybridized to the pol ⁇ -A tail and the cDNAs are produced by a reverse transcriptase using the microRNA as template.
  • the first step is unspecific and produces cDNAs of all microRNAs present in a sample.
  • specific cDNAs are amplified and quantified in a qPCR reaction using microRNA specific primer sets of forward and reverse primers containing LNA monomers.
  • the invention provides oligo nucleotide primers listed in Table 18 (SEQ ID NO 1 to SEQ ID NO 128).
  • the primers of the invention can be used for detecting mammalian microRNAs using the method of the invention.
  • kits for detection of mammalian microRNAs comprising a universal extension primer and microRNA-specific forward and reverse primers sets for quantification of at least one microRNA, a subset of microRNAs or all known microRNAs.
  • the present invention is useful for reliable and specific quantitative microRNA assays, including assays for diagnosing and prognosing diseases such as cancer using single assays or high through-put applications on robot platforms.
  • RNA containing samples extracted from various cell types from living organisms, such as mammals and plants and including virus infected cells may be analysed using the method of the invention.
  • the present invention mainly aims at providing a method for quantification of microRNAs the method can be used for detection and/or quantification of all types of RNA in particular all types of small noncoding RNAs.
  • FIGURE 1 shows the steps involved in specific qRT-PCR of the present invention.
  • the RNA to be analysed by the method may as well be any other small RNA molecule or even a mRNA.
  • Step 1 is a one- tube-reaction for all microRNAs present in a sample.
  • Step 2 is a microRNA specific qPCR using forward and reverse primer pairs for a specific microRNA.
  • An oval indicate insertion of LNAs in forward and reverse primers.
  • the miRNAs present in a sample are firstly poly-A-tailed using a poly(A) polymerase, which adds adenine residues to the J-end of RNA molecules.
  • This primer may be referred to as the Universal RT primer.
  • the extension primer is extended in a reverse transcription reaction using the miRNA as template. All of these reaction are performed in a one-tube reaction.
  • the resulting primary extension product is composed of the extension primer and the newly synthesized DNA, which is cDNA complementary to all the miRNAs in the sample.
  • a miRNA-specific PCR is carried out.
  • a miRNA-specific forward primer is annealed to 3 1 - end of the newly synthesized cDNA and the upper-strand synthesis is carried out by extending the forward primer in a DNA-polymerization reaction using the primary extension product as template.
  • a miRNA-specific reverse primer composed of a miRNA-specific y-end sequence, a poly-T-stretch and a 5'-end tail is then hybridized to the upper-strand and the lower-strand is synthesized by extension of the reverse primer.
  • FIGURE 2 shows amplification of hsa-miR-197 (Example 1) with the forward primer 5' ttmCaccaccttctcca (SEQ ID NO 1 ⁇ and the reverse primer (SEQ ID NO 2).
  • Synthetic template 10 7 copies of synthetic hsa-miR-197 were used for polyA tailing/RT. An amount corresponding to 10 5 copies was used for PCR.
  • Total human RNA 100 ng of total human RNA was used for pol ⁇ A-tailing/RT (step 1). An amount corresponding to 1 ng was used for PCR.
  • Negative controls water control and a total human RNA control without PolyA Polymerase in the RT react ion.
  • the black line designates the result obtained with the synthetic template whereas the grey line show the result obtained with total human RNA as template.
  • the melting curves of the result obtained with the synthetic template and the total human RNA are almost identical.
  • FIGURE 3 shows the amplification curves and the first derivative of the melting curves of Example 2
  • FIGURE 4 shows amplification plots of Example 4 wherein discrimination between hsa- ⁇ et-7a and the variants ⁇ sa-let-7f, ⁇ sa-let-7c and hsa- ⁇ et-7e are demonstrated. The amplification- signal from negative controls are also indicated.
  • FIGURE 5A, 5B and 5C shows the method and processes that enables PCR amplification and discrimination between mature miRs, pre-miRs and pri-miRs. See example 6, 7 and 8.
  • FIG. 5A illustrates the assa ⁇ used for assa ⁇ ing mature miRs.
  • Fig 5B illustrates the assa ⁇ used for assa ⁇ ing pre-miRs and
  • Fig 5C illustrate the assa ⁇ used for assa ⁇ ing pri-miRs.
  • FIGURE 6 shows amplification curves of (A) the pre-mir-203 assa ⁇ on pre-miR-203, miR-203 and non-template controls (NTC).
  • FIGURE 7 shows the different expression of a panel of selected miRNA genes in heart and liver.
  • the data is presented as the difference in the crossing point (Cp) value (ACp) between heart and liver, see table 15.
  • FIGURE 8 shows the detection of each of four listed miRs assa ⁇ ed b ⁇ the present method (black lines with diamonds) and compared with a commercial available method wherein the Reverse Transcription is performed as a one-tube-reaction for all microRNAs present in a sample (gra ⁇ lines with spheres).
  • the figure presents the crossing point (Cp) values as a function of template concentration. Each value is in triplicate.
  • RNA molecules ' ' refer to tin ⁇ RNA molecules in a living cell such as small "non-coding RNA molecules * i.e. molecules that are not translated into proteins.
  • Non-coding RNA molecules include RNAs such as microRNAs (miRNAs), small interfering RNAs (siRNAs), small nuclear RNAs (snRNAs), small nucleolar RNAs (snoRNAs), small temporal RNAs (stRNAs), antigene RNAs (ag RNAs) and piwi-interacting RNAs (piRNAs).
  • miRNAs microRNAs
  • siRNAs small interfering RNAs
  • snRNAs small nuclear RNAs
  • snoRNAs small nucleolar RNAs
  • stRNAs small temporal RNAs
  • ag RNAs antigene RNAs
  • piRNAs piwi-interacting RNAs
  • pre-miRNAs non-coding RNAs derived from endogenous genes of living organisms such as animals and plants.
  • mature miRNAs are biologically active and processed from longer hairpin-like precursors termed pre-miRNAs (pre-miRs) having a length of approximately 75 nucleotides.
  • pre-miRs longer hairpin-like precursors
  • the precursers of pre-miRNAs are pri-miRNAs (pri-miRs) with a length of 500 to 3000 nucleotides.
  • MiRNAs assemble in complexes termed miRNPs and act as major regulators on important biological processes by binding to messenger RNA and interfering with translation efficiency.
  • Target microRNAs of the present invention refer to all known microRNAs, such as microRNAs known from the scientific literature and public databases such as the miRBase database (http://microrna.sanger.ac.uk/) which is the home of microRNA data on the web administrated by the Sanger Institute, UK.
  • the miRBase release 12 is hereby incorporated by reference, including all the mature mi RNA and pre-mature miRNA sequences disclosed therein.
  • tnicroRNA profiling' describes a large-scale analysis in which the expression levels of all microRNAs in a sample such as a tumor sample are determined to build microRNA signatures for a particular disease such as a cancer disease.
  • Adding poly-A tails', "PoIy-A tailing” and “polyadenylatiorf refers to the synthesis of a poly(A) tail, a stretch of RNA where all the bases are adenines, at the y-termini of an RNA molecule.
  • Polyaden ⁇ lation is a natural biological process in living organisms, but it can also be carried out in vitro using various polymerases such as commercial available E. coli PoIy(A) Polymerase I (E-PAP).
  • Extension primer and "RT-prime ⁇ ” refers to an oligonucleotide primer, comprising a recognition sequence, complementary to a sequence in the target deoxyribonucleic and/or ribonucleic acid sequence, e.g. to the 3'-end of the mature microRNA or small noncoding RNA in the target ribonucleic acid sequence, and an anchor sequence essential for subsequent amplification by PCR.
  • the said extension primer is used as an anchored primer in a reverse transcription reaction to generate a primer extension product or cDNA.
  • a "cDNA” refers to a complementary DNA produced by reverse transcription of an RNA template using a reverse transcriptase enzyme.
  • Any reverse transcriptase can be used to synthesize the cDNA molecules, such as reverse transcriptases derived from moloney murine leukemia virus (M-MuLV) reverse transcriptase, avian myeloblastosis virus (AMV) reverse transcriptase, bovine leukemia virus (BLV) reverse transcriptase, Rous sarcoma virus (RSV) reverse transcriptase and human immunodeficiency virus (HIV) reverse transcriptase.
  • M-MuLV moloney murine leukemia virus
  • AMV avian myeloblastosis virus
  • BLV bovine leukemia virus
  • RSV Rous sarcoma virus
  • HAV human immunodeficiency virus
  • Primers refers to short, chemically synthesized oligonucleotides, usually with a length of about twenty to thrit ⁇ bases. They are hybridized to a target DNA, which is then copied by a DNA polymerase to produce a complementary DNA strand.
  • a "forward primer” and a “reverse primer” constitute a "PCR primer set” used in PCR, where they hybridise to complementary DNA strands and direct replication towards each other producing the upper-strand and the lower- strand, respectively, leading to an exponential increase in the target DNA segment.
  • the template derived extension of PCR primers can be carried out by any DNA polymerases, such as bacterial thermostable DNA polymerases, including Taq DNA polymerase from Thermus aquaticus, Pfu DNA polymerase from Pyrococcus furiosus, Vent DNA polymerase from Thermococcus litoralis or recombinant DNA polymerases such as Phusion DNA polymerase.
  • DNA polymerases such as bacterial thermostable DNA polymerases, including Taq DNA polymerase from Thermus aquaticus, Pfu DNA polymerase from Pyrococcus furiosus, Vent DNA polymerase from Thermococcus litoralis or recombinant DNA polymerases such as Phusion DNA polymerase.
  • PCR 1 PCR reaction
  • PCR amplification PCR amplification
  • qPCR and "real-time quantitative PCR” refers to the use of PCR to amplify and simultaneously quantify a targeted DNA molecule.
  • qPCR enables both detection and quantification of the number of copies or relative amount of a specific sequence in a DNA sample, when normalized to DNA input.
  • Amplified DNA is quantified as it accumulates in the reaction in real time after each amplification cycle. Quantification is accomplished using various assay chemistries including fluorescent dyes, such as SYBR® green, that intercalate with double-stranded DNA, and fluorescent reporter oligonucleotide probes such as Taqman probes, that release fluorescence signal during the amplification process.
  • qRT-PCR refers to quantitative reverse transcription polymerase chain reaction in which a cDNA produced in a reverse transcription reaction serves as the initial DNA template for the amplification process, which is then combined with qPCR to quantify low abundance of RNA molecules such as microRNAs in a sample of a particular cell or tissue type. Methods for qPCR and qRT-PCR is described in "A-Z of Quantitative PCR.” (Bustin, SA (ed.) International
  • Hybridisation refers to the bonding of two complementary single stranded nucleic acid polymers (such as oligonucleotides), such as RNA, DNA or polymers comprising or consisting of nucleotide analogues (such as LNA oligonucleotides).
  • Hybridisation is highly specific, and may be controlled by regulation of the concentration of salts and temperature. Hybridisation occurs between complementary sequences, but may also occur between sequences which comprise some mismatches.
  • the oligonucleotides used in the methods of the present invention may, therefore be 100% complementary to the target molecule. Alternatively, in one embodiment the oligonucleotides may comprise at least one or two mismatches.
  • T m or "melting temperature" of an oligonucleotide is in the present context a measure of the stability of a duplex formed between the oligonucleotide and its perfect complement DNA strand determined at 115 mM Na + , no formamide.
  • T m is defined as the temperature at which 50 % of the duplexes formed between the oligonucleotide and a complement nucleotide strand are dissociated into single strands.
  • the length and nucleotide composition, such as the sequence of nucleotides and content of G and C nucleotides, of the oligonucleotide are important factors affecting T m .
  • T m calculators are OligoCalc (W. A. Kibbe (2007) Nucleic Acids Res Volume 35, Web Server issue W43-W46) and LNA Probe T m Predictor at http://www.exiqon.com/oliao-tools .
  • base covers the naturally occurring nucleobases adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U) as well as non-naturall ⁇ occurring nucleobases such as xanthine, diaminopurine, 8-oxo-N 6 -methyladenine, 7-deazaxanthine, 7- deazaguanine, N 4 ,N 4 -ethanocytosin, N 6 ,N 6 -ethano-2,6-diaminopurine, 5-methylc ⁇ tosine, 5- (C 3 -C 6 )-alkynyl-cytosine, 5-fluorouracil, 5-bromouracil, pseudoisocytosine, 2-hydroxy-5- methyl-4-triazolop ⁇ ridin, isocytosine, isoguanine, inosine and the "non-naturally occurring" nucleobases described in Benner e
  • nucleobase thus includes not only the known purine and pyrimidine heterocycles, but also heterocyclic analogues and tautomers thereof. Further naturally and non naturally occurring nucleobases include those disclosed in U.S. Patent No. 3,687,808; in chapter 15 by Sanghvi, in Antisense Research and Application, Ed. S. T. Crooke and B.
  • nucleotide residues Nucleotides incorporated into oligonucleotides are referred to as nucleotide residues.
  • nucleoside base or “nucleobase analogue” is further intended to include heterocyclic compounds that can serve as like nucleosidic bases including certain "universal bases” that are not nucleosidic bases in the most classical sense but serve as nucleosidic bases.
  • a universal base is 3-nitropyrrole or a 5-nitroindole.
  • Other preferred compounds include pyrene and pyridyloxazole derivatives, pyrenyl, pyrenylmethylglycerol derivatives and the like.
  • Other preferred universal bases include, pyrrole, diazole or triazole derivatives, including those universal bases known in the art.
  • INA 1 INA monomei
  • oriNA molecule e.g., an LNA nucleoside or LNA nucleotide
  • LNA oligomer e.g., an oligonucleotide or nucleic acid
  • nucleoside or nucleotide analogue that includes at least one LNA monomer.
  • LNA LNA containing oligonucleotide sequences presented herein
  • the LNAs are indicated by capital letters, whereas natural occurring nucleotide residues are indicated by lowercase letters: mC denotes LNA methyl cytosine.
  • LNA monomers as disclosed in PCT Publication WO 99/14226 are in general particularly desirable modified nucleic acids for incorporation into an oligonucleotide of the invention. Additionally, the nucleic acids may be modified at either the 3 * and/or 5' end by any type of modification known in the art. For example, either or both ends may be capped with a protecting group, attached to a flexible linking group, attached to a reactive group to aid in attachment to the substrate surface, etc. Desirable LNA monomers and their method of synthesis also are disclosed in WO 98/39352.
  • LNA monomers also referred to as "oxy-LNA' are LNA monomers which include bicydic compounds as disclosed in PCT Publication WO 03/020739 wherein the bridge between R 4 and R 2 as shown in formula (I) below together designate -CH 2 -O- or -CH 2 -CH 2 -O-.
  • references herein to a nucleic acid unit, nucleic acid residue, LNA monomer, or similar term are inclusive of both individual nucleoside units and nucleotide units and nucleoside units and nucleotide units within an oligonucleotide.
  • a “modified base” or other similar terms refer to a composition (e.g., a non-naturall ⁇ occurring nucleotide or nucleosidic base), which can pair with a natural base (e.g., adenine, guanine, cytosine, uracil, and/or thymine) and/or can pair with a non-naturall ⁇ occurring nucleotide or nucleosidic base.
  • the modified base provides a T m differential of 15,
  • chemical moiety refers to a part of a molecule.
  • Modified by a chemical moiety thus refer to a modification of the standard molecular structure by inclusion of an unusual chemical structure. The attachment of said structure can be covalent or non-covalent.
  • a chemical moiety in an oligonucleotide probe thus refers to attachment of a molecular structure.
  • Such as chemical moiety include but are not limited to covalentl ⁇ and/or non-covalentl ⁇ bound minor groove binders (MGB) and/or intercalating nucleic acids
  • INA selected from a group consisting of asymmetric cyanine dyes, DAPI, SYBR Green I,
  • Oligonucleotide analogue refers to a nucleic acid binding molecule capable of recognizing a particular target nucleotide sequence.
  • a particular oligonucleotide analogue is peptide nucleic acid (PNA) in which the sugar phosphate backbone of an oligonucleotide is replaced by a protein like backbone.
  • PNA peptide nucleic acid
  • nucleotides are attached to the uncharged pol ⁇ amide backbone yielding a chimeric pseudopeptide-nucleic acid structure, which is homomorphous to nucleic acid forms.
  • T- ⁇ gh affinity nucleotide analogue or "affinity-enhancing nucleotide analogue” refers to a non- naturally occurring nucleotide analogue that increases the "binding affinity of an oligonucleotide probe to its complementary recognition sequence when substituted with at least one such high-affinity nucleotide analogue.
  • a probe with an increased 'binding affinity for a recognition sequence compared to a probe which comprises the same sequence but does not comprise a stabilizing nucleotide refers to a probe for which the association constant (K a ) of the probe recognition segment is higher than the association constant of the complementary strands of a double- stranded molecule.
  • the association constant of the probe recognition segment is higher than the dissociation constant (K d ) of the complementary strand of the recognition sequence in the target sequence in a double stranded molecule.
  • Monomers are referred to as being "complementary" if they contain nucleotides that can form hydrogen bonds according to Watson-Crick base-pairing rules (e.g.
  • G with C A with T or A with U
  • other hydrogen bonding motifs such as for example diaminopurine with T, 5- methyl C with G, 2-thiothymidine with A, inosine with C, pseudoisocytosine with G, etc.
  • oligonucleotide By “oligonucleotide,” “oligomer,” or “oligo” is meant a successive chain of monomers (e.g., glycosides of heterocyclic bases) connected via internucleoside linkages.
  • the cycle at which the fluorescence from a sample crosses the threshold is called the 1 CyCIe threshold' or Q.
  • Ct is used for quantification of a template.
  • crossing poinf or Cp value is a slightly different, but related value that can be used for quantification of a template somewhat similar to the use of Q.
  • the "targef or 'target nucleic acid * or target ribonucleic acid” refers to any relevant nucleic acid of a single specific sequence, e. g., a biological nucleic acid, e. g., derived from a subject or human being.
  • the 'target' is a human miRNA or precursor thereof, or in one embodiment, a molecule which retains the genetic sequence information contained therein - such as all or (a sufficient) part of the seqeunce of nucleotides or reverse complement thereof.
  • Target sequence refers to a specific nucleic acid sequence (or corresponding nuceltobase seqeunce) within any target nucleic acid.
  • primer design refers to methods such as those provided below.
  • the primer design is an systematic approach used for designing the sequence of nucleotides in forward and reverse primers thus ensuring probe specificity and binding efficiency to target microRNAs.
  • the following rules have been used for design of primers for miR-specific qPCR:
  • the forward primers are designed to be identical of from 12 to 18 bases of the 5' end of the miR sequence.
  • the Tm of the forward primers should be in the range of between 55 0 C and 65 3 C, however, a Tm below 55 °C and above 65 “C may also be acceptable.
  • one or more LNA monomers may be inserted into the sequence substituting the natural nucleotide.
  • An artificial nucleotide sequence may also be added to the 5'-end of the forward primer to make certain that the Tm is in the range of between 55 °C and 65 °C.
  • the reverse primer is according to formula II:
  • R is a 5'-end nucleotide sequence
  • T is a central part of x consecutive thymine
  • x is an integer of from 1 to 100
  • R is a 7-end nucleotide sequence that specifically hybridizes to a part of a microRNA molecule.
  • R is preferably a nucleotide sequence of from 1 to 10 nucleotides designed from the J-end
  • R is able to hybridize specifically to the DNA strand (i.e. the upper- strand) produced by extension of the corresponding miRNA specific forward primer.
  • T m of the primer preferably is in the
  • one or more LNA monomer may be inserted into the R sequence substituting the corresponding natural nucleotide.
  • the (T) x central part is preferably a stretch of approximately 15 consecutive thymine nucleotide residues that hybridizes to the poly-A-tail part of the DNA strand produced from the corresponding miRNA specific forward primer.
  • the R sequence of the reverse primer typically has a length of form 1 to 20 nucleotides.
  • example R can be 17 nucleotides long, 8, 7 or 6 nucleotides long or even only one
  • the R sequence is S-
  • the length of the R sequence may be reduced from the 5'-end to adjust the T m of the reverse primer to the preferable range of between 55
  • the R sequence is identical to or at least has overlap to part of the R sequence (formula (III)) of the extension primer.
  • LNA should be in position four or higher from the J end of the primer.
  • LNA should be in position four or higher from the J end of the primer.
  • LNA-T LNA-th ⁇ mine
  • R -OT Add a sequence of the formula R -OT) x to the 5'end of the reverse primer.
  • the nucleotide sequence: (SEQ ID NO 4) is added at the 5' end of the reverse primer. If an LNA-T was added to the miR-specific part of the reverse primer (step C6) delete one thymine residue from the tail as there should never be more than 15 consecutive thymine residues.
  • nucleotides are removed from the 5'-end of the reverse primer to fine-tune the T m of the primer.
  • RNA refers to RNA comprising compositions obtained from cells, tissues or fluids from an organism according to conventional procedures described e.g. in RNA Isolation and Characterization Protocols (Rapley, Ralph; Manning, David L. (Eds. ⁇ 1998) known to the skilled artesian or by using commercial kits such as miRNeasy (QIAGEN GmbH, Hilden, Germany)) or miRVana (Ambion Inc., Austin, TX, US).
  • Sources for isolation of RNA fractions are samples of cells, or tissue or fluid isolated from an organism or organisms, including but not limited to, for example, skin, plasma, serum, spinal fluid, lymph fluid, synovial fluid, urine, tears, blood cells, organs, tumours, and also to samples of in vitro cell culture constituents (including but not limited to conditioned medium resulting from the growth of cells in cell culture medium, recombinant cells and cell components).
  • sample may also refer to cells or fluids that can be used directly in a q RT-PCR proces without previous enrichment of the RNA fraction or even RNA comprising compositions comprising artificially s ⁇ nthesised RNA.
  • Cells or cell types also refer to any cells of Eukaryote, Prokar ⁇ ote and Archaea origin.
  • a "living organism” refers to a living entity, including but not limited to, for example, human, mouse, rat, Drosophila, C. elegans, yeast, Arabidopsis thalia ⁇ a, maize, rice, zebra fish, primates, domestic animals, etc.
  • the present invention provides methods for amplification of microRNA molecules in a sample, the method comprising the steps described schematically in Fig. 1, and comprise:
  • step (a) and (b) When performing the method in practice step (a) and (b) is typically performed as one concerted reaction which is universal for all RNAs to be analysed - hence its nickname: 'Universal RT.
  • the advantage of only one first-strand cDNA synthesis reaction (or RT reaction) to be used as template for multiple real-time PCR assays is that it saves precious sample, reduces technical variation and reduces time spent in the laboratory.
  • RNAs are specifically PCR amplified using specific forward and reverse primers.
  • the primers are optimised by introducing one or more LNA nucleotide analogues into the sequence of the primers, and typically the PCR is quantitative Real-Time PCR.
  • the method result in 1) uniquely specific assays that enable discrimination between highly related RNA sequences and 2) an extremely low background which enables accurate quantitation of very low RNA levels.
  • the method has been extensively used to quantify small RNAs.
  • the small RNA comprises small non-coding RNAs such as short inferring RNAs (siRNAs), mature microRNAs and pre-microRNAs.
  • small non-coding RNAs such as short inferring RNAs (siRNAs), mature microRNAs and pre-microRNAs.
  • larger RNAs e.g. precursers of pre-microRNAs the pri-miRNAs (pri-miRs) and mRNAs may be assessed by method.
  • the small RNA is a microRNA.
  • the extension primer may be of a length in the range from 10 to 100 nucleotidbes, such as a length in the range from 15 to 45 nucleotides.
  • the extension primer has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.
  • the extension primer is of the formula III: wherein R is a 5'-end nucleotide sequence, (T)y is a central part of consecutive thymine
  • the 5'-end part R is a nucleotide sequence with a length of from 1 to 30
  • R sequence may be 6, 7, 8, 9, or 10 nucleotides long.
  • sequence includes at least a hybridisation sequence for the R sequence in the reverse primer of the formula II (see below) to be used in the subsequent miRNA-specific qPCR.
  • ⁇ in formula III is in the interval of from 5 to 50, more preferably y is in the interval of from 5 to 21.
  • y is 12, 13, 14, 15, 16, 17 or 18.
  • Most preferably y is 15.
  • y of formula (III) equals x of formula (II).
  • R is a degenerated anchor sequence motif VN, comprising the two 3-end terminal nucleotide residues, wherein V designate a selection of residues comprising bases which can base pair to all but one of the natural bases (e.g. base pair to guanine, cytosine, uracil and thymine but not to adenine), typically V designate that the base in any primer molecule is a base randomly selected between adenine, guanine and cytosine and wherein N designate a base which can base pair to any of the natural bases (e.g. adenine, guanine, cytosine, uracil and thymine), typically N may be a base randomly selected between adenine, guanine, cytosine or thymine residue.
  • V designate a selection of residues comprising bases which can base pair to all but one of the natural bases (e.g. base pair to guanine, cytosine, uracil and thymine
  • R is a degenerated sequence motif VNN, comprising the three 7-end terminal nucleotide residues, wherein V designate a selection of residues comprising bases which can base pair to all but one of the natural bases (e.g. base pair to guanine, cytosine, uracil and thymine but not to adenine), typically V designate that the base is a base randomly selected between adenine, guanine and cytosine and wherein N designate a base which can base pair to any of the natural bases (e.g.
  • the extension primer comprises at least one LNA.
  • the forward primer has a length in the range of from 10 to 100 nucleotides, such as 12 to 22 or 13 to 20 or 14,15, 16, 17, 18 or 19 nucleotides. See table 18 for specific embodiments.
  • the forward primer may comprise one, two or even more LNAs.
  • the nucleotide sequence of the forward primer is designed to specifically hybridize to the complement DNA molecule of a specific microRNA molecule using the primer design rules described in the definition of "primer design" (see DEFINITIONS section ⁇
  • the reverse primer is of the formula II:
  • R is a 5'-end nucleotide sequence (T) x is a central part of consecutive thymine
  • x is an integer of from 1 to 100
  • R is a ⁇ -end nucleotide sequence that specifically hybridizes to a nucleotide sequence of a target RNA molecule.
  • the S-en ⁇ nucleotide sequence R of the reverse primer of formula II is a nucleotide sequence with a length of from 1 to 30 nucleotides.
  • x in formula II is in the interval of from 5 to 50, more preferably x is in the interval of from 5 to 21.
  • x is 12, 13, 14, 15, 16, 17 or 18.
  • Most preferably x is 15.
  • x of formula (II) equals y of formula (III). 4
  • the J-end nucleotide sequence R of the reverse primer of formula II has a length in the range of from 1 to 10 nucleotides.
  • LNA has a profound effect. Accordingly, in a preferred embodiment
  • the 3"-end part, R , of the reverse primer of formula II comprises at least one
  • the J-end part, R , of the reverse primer of formula II contains only one LNA.
  • the LNA is situated in the 5' position or the
  • nucleotide sequence of the reverse primer is designed to specifically hybridize to a specific microRNA molecule using the primer design rules described in the definition oPprimer design" (see DEFINITIONS section)
  • the invention also provides methods for designing the nucleotide sequence of the forward primers and the reverse primers used in the invention. Systematic approaches and experimental evaluation of the primers are presented in the EXAMPLES 3 section.
  • the present invention is useful for amplification and quantification of small RNA molecules such as microRNAs or siRNA's in various cells or tissues originating from humans or other organisms as described in EXAMPLES 5 and 9. As illustrated in example 10 the present method is superior with respect to sensitivity and specificity when compaired with a somewhat similar single tube cDNA synthesis approach which is commercially available.
  • one aspect of the invention is a method for measuring the amount of a target microRNA in a sample from a living organism, the method comprising the steps of:
  • the amount of the amplified DNA molecules is typically measured using fluorescence-based
  • the present invention can be used as a tool for microRNA profiling of different cell and tissue types within a living organism.
  • the number of specific microRNAs and the amounts of specific microRNAs present in different cell and tissue types can be determined using the present invention.
  • the invention can be used to discriminate between the levels of mature microRNAs, pre-microRNAs and pri-microRNAs in different cell and tissue types by using appropiate primers targeting the mature microRNA or its precursors (see fig 5).
  • the present invention can be used as a tool for microRNA profiling of patients suffering from various diseases such as cancer.
  • the microRNAomes of various cancer tissues can be established using the invention.
  • the present invention can be used for diagnosis of various diseases such as cancer by measuring microRNA expresssion in tissues and body fluids from normal individuals and from individuals having a disease, and subsequently analyse for differences in the microRNA profiles.
  • the present invention may be used for measuring changes in the amount of specific microRNAs in response to treatment of a disease affected individual by means of pharmaceuticals, such as chemotherapeutical agents, and by means of surgery.
  • the present invention may be used for measuring specific predictive microRNA biomarkers that correlate with re-currence free survival of patients having a disease, such as a cancer disease.
  • the present invention is also suitable for high-throughput methods on robot platforms directed to the quantification of a single microRNA or a collection of microRNAs.
  • the method is particularly suitable for multiple subsequent PCR reactions of individual microRNAs as described in EXAMPLE 5, 9 and 10.
  • the method of the invention may be used to quantitatively determine the amount of mature microRNA in a sample without interference from the corresponding pre-miR, and vice versa the amount of a pre-miR can be determined without interference from the mature microRNA as described in EXAMPLES 6, 7 and 8.
  • the method of the invention may be used for discrimination between targets with single nucleotide differences as described in EXAMPLE 4.
  • kits for detecting at least one target microRNA comprising one or more primer sets specific for the detection of a target microRNA, each primer set comprising firstly, a universal extension primer for producing a cDNA molecule complementary to a target microRNA, and secondly, a PCR primer set comprising a forward primer specific for the .rend of the target miRNA and a reverse primer specific for the .Pend of the target miRNA for amplifying the cDNA molecule.
  • a kit for detecting at least one target RNA comprises at least one primer set specific for the detection of a target RNA, said primer set comprises:
  • R is a 5'-end nucleotide sequence
  • T is a central part of consecutive thymine
  • residues in the amount of y wherein y is an integer of from 1 to 100, and R is a ⁇ -end nucleotide sequence.
  • R is a 5'-end nucleotide sequence
  • T is a central part of consecutive thymine
  • the kit is designed for detecting at least one mammalian target microRNA comprising at least one primer set specific for the detection of a target microRNA.
  • the extension, the reverse and the forward primers are designed following the design rules given in the "primer design-part of the DEFINITIONS section and elsewhere and forward and reverse primers which includes at least one LNA molecule are especially preferred embodiments.
  • a non-limiting example of an extension primer is shown as SEQ ID NO 5.
  • Forward and reverse primers included in the kit may be designed to detect any mammalian target microRNA in accordance with the methods described herein.
  • Non-limiting examples of forward and reverse primers are listed in TABLE 16.
  • the kit includes multiple primer sets that may be used to detect various mammalian microRNA targets, such as two microRNA targets up to several hundred microRNA targets.
  • a kit of the invention may also provide an array of primers delivered in microtiter qPCR plates such as 96, 768, 869, 1536 or even 3456-well microtiter qPCR plates suitable for robot handling as indicated in EXAMPLE 9.
  • a kit of the invention may also include reagents required for the poly-A-tailing, primer extension and PCR reactions, such as buffers, salts, reducing agents, deoxy nucleoside triphosphates, nucleoside triphosphates, and enzymes.
  • reagents required for the poly-A-tailing, primer extension and PCR reactions such as buffers, salts, reducing agents, deoxy nucleoside triphosphates, nucleoside triphosphates, and enzymes.
  • a detection reagent for the qPCR such as 5YBR® green may also be included.
  • a kit for RNA isolation may also be included.
  • a further aspect of the invention is a high-throughput method for measuring the amount of specific target microRNAs in a sample from a living organism by using the method of the present invention and integrating an automated wherein the combined poly-A-tailing and reverse transcription reaction is aliquoted into individual wells of a microtiter plate containing microRNA specific primer sets of forward and reverse primers, resulting in the steps of:
  • Such a set-up will typically comprise one or more pipetting robots.
  • EXAMPLE 1 PRODUCTION OF SPECIFIC DNA MOLECULES USING MIR-SPECIFIC QPCR.
  • hsa-miR-197 was amplified from a human RNA sample using the miR specific quantitative reverse transcription polymerase chain reaction (qRT-PCR) of this invention.
  • RNA sample 100 ng of a mixture of 25 ng human heart RNA, 25 ng human brain RNA, 25 ng human liver RNA and 25 ng human lung RNA all from Ambion, Austin, TX, US.
  • Synthetic templates were prepared in lOng/ ⁇ l phage MS2 RNA in TE, approximately 10 7 copies are added to the reaction. Synthetic template is obtained from Integrated DNA technologies Inc., Coralville, IA, US.) • Water to 10 ⁇ l
  • Negative controls water control and a total human RNA control without PoIyA Polymerase in the RT reaction.
  • the mixture was incubated at 42 0 C, 1 hour followed by 95 0 C, 5 minutes.
  • step 1 on fig 1 For qPCR 1 ⁇ l or less of the polyA-tailing/RT reaction (step 1 on fig 1) was used for each PCR reaction with gene-specific forward and reverse primers for hsa-miR-197; forward primer 5' ttmCaccaccttctcca (SEQ ID NO 1) and the reverse primer (SEQ ID NO 2) (in the nucleotide sequences lower case designates a natural occurring nucleotide, upper case designates LNA, mC denotes LNA methyl cytosine).
  • ® Real-time PCR was done on a ABI 7500 thermoc ⁇ cler (Applied Biosystems Inc, Foster City,
  • a typical PCR reaction mixture contained :
  • TE buffer 10 mM Tris/HCI (pH 8.0), ImM EDTA.
  • the mixture was incubated at 95°C for 10 min followed 40 cycles of 95°C for 5 sec; 60 0 C for 60 sec with measurement of the fluorescence.
  • Amplification of the correct product was measured by comparing the melting curve profile of the PCR product to the melting curve profile of a PCR product obtained by amplification of a synthetic template (Fig. 2). No signal was was obtained with the negative controls.
  • the experiment shows that the same and correct hsa-miR-197 PCR product was obtained both using the total human RNA sample and a c hsa-miR-197 as template in step 1.
  • EXAMPLE 2 EFFECT OF LNA IN THE REVERSE PRIMER.
  • step 2 The effect of different designs of miR-specific PCR primers of step 2 can be tested on artificial DNA templates with the same sequence as the product of the reverse transcription reaction.
  • An important advantage of using an artificial DNA template for PCR is that experimental variations in the efficiency of the reverse transcription step are eliminated.
  • Hsa-let-7a DNA template Salmon DNA: 2 ng/ ⁇ l in TE buffer
  • MiR-specific forward primer F7a: 5'-tGaGgtagtaggttg (SEQ ID NO 7) (lower case designates a natural occurring nucleotide, upper case designates LNA).
  • a PCR mix was prepared:
  • thermoc ⁇ der b ⁇ monitoring SYBR ® green fluorescence was carried out on a ABI 7500 " thermoc ⁇ der b ⁇ monitoring SYBR ® green fluorescence as a function of PCR cycle number.
  • the mixture was incubated at 95°C for 10 min followed b ⁇ 40 cycles of 95°C for 5 sec; 60 0 C for 60 sec with measurement of the fluorescence.
  • thermocycler Applied Biosystems, Foster City, CA, US. Briefly, the PCR reaction was incubated at 60 0 C for 1 minute and fluorescense was measured during a slow increase of the temperature to 95°C. The first derivative of the melting curves is shown in figure 3:
  • EXAMPLE 3 MANUAL PRIMER DESIGN AND VALIDATION OF PRIMERS FOR MIRS.
  • Primer validation By using the primer design rules it is possible to achieve PCR primers that have >70 % success rate in real-time PCR experiments according to the following validation criteria: Prepare Rtmix for four reverse transcription (RT) samples:
  • RNA mix 1 ⁇ l 1 ⁇ g/ ⁇ l heart RNA, 1 ⁇ l 1 ⁇ g/ ⁇ l brain RNA, 1 ⁇ l 1 ⁇ g/ ⁇ l liver RNA, 1 ⁇ l 1 ⁇ g/ ⁇ l lung RNA, 36 ⁇ l TE.
  • Sample 3 Ct above 40 compared to exponential area for #2 and 4. Melting peak derivative below 5000.
  • Sample 4 One peak on bell shaped melting curve, unless otherwise justified the peak should be between 69 "C and 80 0 C. Peak at same temperature (+/- 0.5 0 C) as in sample 2.
  • Lower case designates natural occuring nucleotides
  • upper case designates LNA
  • mC denotes LNA methyl cytosine.
  • EXAMPLE 4 DISCRIMINATION BETWEEN TARGETS WITH A SINGLE NUCLEOTIDE DIFFERENCE.
  • TlIe synthetic templates were prepared in lOng/ ⁇ l phage MS2 RNA in TE.
  • the synthetic templates are obtained from Integrated DNA technologies Inc., Coralville, IA, US.
  • PCR reaction mixture contained:
  • the mixture was incubated at 95°C for 10 min followed 40 cycles of 95°C for 5 sec; 60 0 C for 60 sec with measurement of the fluorescence.
  • Amplification of the correct product was measured by comparing the melting curve profile of the PCR product to the melting curve profile of a PCR product obtained by amplification of a synthetic template.
  • EXAMPLE 5 QUANTIFICATION OF MIRS IN HUMAN BRAIN TOTAL RNA.
  • v designates cytosine, guanine and adenine residues
  • n designates cytosine, guanine, adenine and thymine residues
  • Synthetic template Equal amounts (number of copies) of synthetic /?sa-let-7a, /?sa-miR-21, ⁇ sa-miR-27b and ⁇ sa-miR-195 in lOng/ ⁇ l phage MS2 RNA in TE (obtained from Integrated DNA technologies Inc).
  • TE 1OmM Tris/HCI (pH 8.0), ImM EDTA.
  • PCR reaction mixture contained:
  • the mixture was incubated at 95°C for 10 min followed 40 cycles of 95°C for 5 sec; 60 0 C for 60 sec with measurement of the fluorescence.
  • Amplification of the correct product was measured by comparing the melting curve profile of the PCR product to the melting curve profile of a PCR product obtained by amplification of a synthetic template.
  • the Ct of the sample with human brain RNA was compared to the standard curve to determine the number of miRs in the sample (Bustin, SA (ed.) "A-Z of Quantitative PCR.” International University Line (La JoIIa, California, USA), 2004).
  • v designates cytosine, guanine and adenine residues
  • n designates cytosine, guanine, adenine and thymine residues
  • PCR reaction mixture contained:
  • the mixture was incubated at 95°C for 10 min followed 40 cycles of 95°C for 5 sec; 60 0 C for 60 sec with measurement of the fluorescence.
  • ⁇ sa-miR-lOa and the corresponding pre-miR, ⁇ sa-pre-miR-lOa were detected in total human RNA.
  • v designates cytosine, guanine and adenine residues
  • n designates cytosine, guanine, adenine and thymine residues
  • TE buffer 1OmM Tris/HCI (pH 8.0), ImM EDTA.
  • PCR reaction mixture contained:
  • the mixture was incubated at 95°C for 10 min followed 40 cycles of 95°C for 5 sec; 60 0 C for 60 sec with measurement of the fluorescence.
  • the total RNA sample contains more than 10 6 copies of ⁇ sa-miR-lOa because the C ⁇ is below the C ⁇ of the sample with 10 6 copies of ⁇ sa-miR-10a whereas the total RNA sample contains less than 10 6 copies of ⁇ sa-premiR-lOa because the C ⁇ is below the C T of the sample with 10 6 copies of ⁇ sa-premiR-lOa.
  • Synthetic miR 203 RNA (5'- gugaaauguuuaggaccacuag ⁇ (SEQ ID NO 103) and pre- miR 203 RNA (5'- agugguucuuaacaguucaacaguucugu-agcgcaauugugaaauguuuaggaccacuag) (SEQ ID NO 104) were selected as test subjects.
  • the synthetic RNAs were synthesized by Integrated DNA technologies Inc., Coralville, IA, US. The RNAs were diluted to l*10 6 molecules/ ⁇ L in TEMS2 (TE buffer (10 mM Tris HCI pH 8, and 0.1 mM EDTA mixed with 10 ng/ ⁇ L MS2 viral RNA (Roche Applied Science Inc).
  • q-RT-PCR reactions were performed in a 384 well plate in a LightCycler 480 (Roche Diagnostics) instrument using the following PCR protocol
  • Aim of the experiment is to determine if well expressed mi RNAs that are differently expressed between heart and liver tissue can be discriminated using a qPCR array based on the SYBR green universal reverse transcriptase quantitative PCR (UniRT qPCR) method of the present invention.
  • RNA from liver and whole-heart was obtained from Ambion Inc., and diluted in nuclease free water to a concentration of 10 ng/ ⁇ L and stored at -8O 0 C.
  • the miR selected were hsa-miR-1, hsa-miR-126 and hsa-miR-133b (heart) and hsa-miR-192, hsa-miR-122*, hsa-miR-194 and hsa-miR-122 (liver).
  • Quantitative polymerase chain reaction (q-PCR), step 2 of the protocol, was performed as follows:
  • 5 ⁇ L diluted cDNA was mixed with 5 ⁇ L SYBR Green Master Mix, UniRT (Exiqon AS, Cat.No. 203400) into the 384 well plate with desiccated primer sets of the seven miR assays described below.
  • the plate was sealed and directly put on to the LightCycler for amplification and anallysis.
  • q-RT-PCR reactions were performed in a LightCycler 480 (Roche Diagnostics) using the following PCR protocol:
  • Table 15 Ex ression values for the 7 miR selected and tested on the UniRT platform.
  • EXAMPLE 10 COMPARISON OF miR SPECIFIC ASSAYS DESIGNED IN PRESENT INVENTION TO COMPETING METHOD USING PURE DNA PRIMERS
  • the LNA based design described in the present invention was compared to a commercial DNA based product, the miScript Reverse Transcription Kit (Qiagen, Cat. no. 218060, QIAGEN GmbH, Hilden, Germany).
  • This DNA based product also relies on a miRNA J- polyadenylation step followed by reverse transcription with a DNA based poly dT primer where both reactions occur in a one-tube reaction. Because both these methods use the same enzymatic steps a comparison very well illustrate the surprising advantages of the present LNA based method since the miScript does not include LNA in the primers.
  • Another difference is that the miScript uses a reverse primer specific to the universal tag added with the RT primer whereas the LNA based reverse primer of the present method is specific to the miRNA being detected.
  • Reverse transcription was performed on a dilution series of synthetic miRNA target (obtained from Integrated DNA technologies Inc., Coralville, IA, US.), with a background of 10 ng/ ⁇ l MS2 bacteriophage RNA (Roche Applied Science, Catalog Number 10165948001), using either Universal cDNA Synthesis Kit (Exiqon A/S, Vedbaek, Denmark., Prod. No. 203300) or miScript Reverse Transcription Kit (Qiagen, Cat. no. 218060, QIAGEN GmbH, Hilden, Germany) according to the manufacturer's instructions.
  • Figure 8 shows the triplicate Cp values versus template concentration obtained in the experiment for each of the four tested miRNAs.
  • the method of the present invention was more sensitive (black lines connecting diamonds) than the miScript assay (gray lines connecting sphaeres) as indicated by the lower Cp values consistently obtained with the assay of the present invention.
  • ⁇ sa-let-7a there was a 10- fold improved sensitivity of the assay of the present invention, measured as the lowest copy- number detected quantitatively. For ftsa-miR-143 and ⁇ sa-miR-155 the difference in sensitivity was 100-fold better with the assay of the present invention.
  • Lower case designates natural occuring nucleotides
  • upper case designates LNA
  • mC denotes LNA methyl cytosine.
  • v is either an adenine residue, a guanine residue, or a c ⁇ tosine residue
  • n is either an adenine residue, a guanine residue, a cytosine residue or a thymine residue.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a method for amplification and quantification of mscroRNA molecules using quantitative reverse transcription polymerase chain reaction (q RT- PC R) technology. The method comprise the steps of (a) producing cDNA molecules complementary' to microRNAs in a sample using polyadenylation and primer extension by reverse transcription, and (b) amplification and quantification of the cDNAs by qPCR using microRNA specific primer sets of forward and reverse primers containing LNA monomers.

Description

METHOD FOR QUANTIFICATION OF SMALL RNA SPECIES
FIELD OF THE INVENTION
The present invention relates to a method for amplification and quantification of small non- coding RNA molecules using quantitative reverse transcription polymerase chain reaction (qRT-PCR) technology.
BACKGROUND OF THE INVENTION
MicroRNAs are an abundant class of approximately 22-nucleotide-noncoding RNAs, which play important regulatory roles in animal, plant and virus development. The awareness of microRNAs was initiated almost 15 years ago by the discovery of lin-4, which encode a small RNA involved in the timing and progression of the nematode in C. elegans life cycle and larval development (Lee et al. 1993 Cell 75:843-854, Wightman et al.1993 Cell 75:855362), but it was only recently recognized that microRNAs form a major class of ribo-regulaters that have broad regulatory functions in animals (Lagos-Quintana et al. 2001 Science 294:853858, Lau et al. 2001 Science 294:858-862, Lee and Ambros. 2001 Science 294:862-864). Since then, a revolution in the study of microRNAs have taken place, and today the miRBase database version 12.0 (http://microrna.sanqer.ac.uk/) include 866 human microRNAs and the PubMed database fhttD://www.ncbi.nlm.nih.αov/Dubmed/') encompass 3900 microRNA related articles, reflecting the interest and importance of microRNAs.
MicroRNAs are involved in the regulation of gene expression at the posttranscriptional level by degrading or blocking translation of messenger RNA targets, and it has been speculated that approximately 30 % of the human genome could be regulated by microRNAs. The importance of microRNAs is also obvious due to their involvement in various cellular processes including development, growth and proliferation, apoptosis, differentiation, and various human diseases (http://www.mir2disease.org/) such as cancer and diabetes.
The importance of microRNAs in cancer is highlighted in a recent article (Barbarotto et al 2008 Int. J. Cancer. 122:969-977), which summarizes the main paradigms for the miRNA involvement in human cancers: Thus, 1Xi) miRNAs are altered in every type of analyzed human cancer; (ii) miRNAs act as oncogenes and tumor suppressors; (iii) miRNAs alterations may cause cancer predisposition; (iv) miRNAs profiling is a new diagnostic tool for cancer patients and (v) miRNA profiling represents prognostic tools for cancer patients". Accordingly, methods for expression profiling and quantification of microRNAs in cells and body-fluids from cancer patients are of great importance. To address this requirement, the present invention describes the development of a new robust and reliable q RT-PCR assay for microRNA measurements.
Quantification of microRNAs by qRT-PCR procedures is very challenging due to the small size of microRNAs of only 21 to 25 nucleotides, which is the size of primers normally used for PCR. Solutions to this problem have been published in Raymond et al. RNA. 2005 Nov;ll(ll):1737-44, Gilad et al. PLoS ONE. 2008 Sep 5;3(9):e3148 and Sharbati-Tehrani et al. BMC Molecular Biology. 2008, 9:34. Raymond et al. describes a qRT-PCR assay that
® involves a gene-specific reverse transcription step followed by a SYBR green qPCR step using a gene-specific forward primer containing locked nucleic acid (LNA) molecules and a universal reverse primer. Gilad et al. reports a qRT-PCR assay that involves a polγadenylation step, an unspeciflc reverse transcription step, and a qPCR step involving a gene-specific forward primer, a gene-specific TaqMan primer and a universal reverse primer. Sharbati- Tehrani et al. developed a qRT-PCR assay that involves a gene-specific reverse transcription
® step followed by a SYBR green qPCR step using a gene-specific forward primer and 2 universal primers.
However, the existing techniques for quantification of microRNAs by qRT-PCR do not fulfil the present need for microRNA assays, which requires high specificity that allows discrimination between closely related microRNAs, high sensitivity, low background an a relatively simple procedure.
The present invention is characterised by only one reverse transcription reaction for all microRNAs in a sample and furthermore provides an extremely sensitive PCR method with an unmatched specificity that can be used for accurate quantification of small RNA molecules such as microRNAs.
SUMMARY OF THE INVENTION
Establishing and understanding the microRNA dysregulation patterns associated with various human diseases such as cancers, call for novel, improved technologies for detection and quantification of microRNAs in human cells and body fluids. The present invention introduces a new highly sensitive and specific assay for this purpose. In one aspect, the present invention provides a procedure for amplifying and quantifying microRNA molecules in a sample: In the first step of the procedure complementary DNAs (cDNAs) of the microRNAs in a sample are produced by the concerted action of two enzymes in a single-tube reaction. Firstly, poly-A tails are added to the J-terminus of the microRNAs using a polγ(A) polymerase, and secondly an extension primer is hybridized to the polγ-A tail and the cDNAs are produced by a reverse transcriptase using the microRNA as template. The first step is unspecific and produces cDNAs of all microRNAs present in a sample. In the second step of the procedure specific cDNAs are amplified and quantified in a qPCR reaction using microRNA specific primer sets of forward and reverse primers containing LNA monomers.
In another aspect, the invention provides oligo nucleotide primers listed in Table 18 (SEQ ID NO 1 to SEQ ID NO 128).
The primers of the invention can be used for detecting mammalian microRNAs using the method of the invention.
In another aspect, the invention provides kits for detection of mammalian microRNAs, the kits comprising a universal extension primer and microRNA-specific forward and reverse primers sets for quantification of at least one microRNA, a subset of microRNAs or all known microRNAs.
The present invention is useful for reliable and specific quantitative microRNA assays, including assays for diagnosing and prognosing diseases such as cancer using single assays or high through-put applications on robot platforms. RNA containing samples extracted from various cell types from living organisms, such as mammals and plants and including virus infected cells may be analysed using the method of the invention.
Although the present invention mainly aims at providing a method for quantification of microRNAs the method can be used for detection and/or quantification of all types of RNA in particular all types of small noncoding RNAs.
FIGURES
FIGURE 1 shows the steps involved in specific qRT-PCR of the present invention. To illustrate the principle the qRT-PCR of a microRNA serves as an example, the RNA to be analysed by the method may as well be any other small RNA molecule or even a mRNA. Step 1 is a one- tube-reaction for all microRNAs present in a sample. Step 2 is a microRNA specific qPCR using forward and reverse primer pairs for a specific microRNA. An oval indicate insertion of LNAs in forward and reverse primers. When the method is carried out in practice the miRNAs present in a sample are firstly poly-A-tailed using a poly(A) polymerase, which adds adenine residues to the J-end of RNA molecules. Secondly, an extension primer, which has a poly-T- core nucleotide sequence, a J-end VN-degenerate motif and a ET-end tail, is annealed to the poly-A-tailed miRNA through hybridisation with the VN-poly-T-sequence of the extension primer, (N=C, G, A and T; V= C, G, and A). This primer may be referred to as the Universal RT primer. Subsequently, the extension primer is extended in a reverse transcription reaction using the miRNA as template. All of these reaction are performed in a one-tube reaction. The resulting primary extension product is composed of the extension primer and the newly synthesized DNA, which is cDNA complementary to all the miRNAs in the sample. In the next step a miRNA-specific PCR is carried out. A miRNA-specific forward primer is annealed to 31- end of the newly synthesized cDNA and the upper-strand synthesis is carried out by extending the forward primer in a DNA-polymerization reaction using the primary extension product as template. A miRNA-specific reverse primer composed of a miRNA-specific y-end sequence, a poly-T-stretch and a 5'-end tail is then hybridized to the upper-strand and the lower-strand is synthesized by extension of the reverse primer. Various demonstrations of the method of the invention are described in the EXAMPLES section.
FIGURE 2 shows amplification of hsa-miR-197 (Example 1) with the forward primer 5' ttmCaccaccttctcca (SEQ ID NO 1} and the reverse primer
Figure imgf000005_0001
(SEQ ID NO 2). Synthetic template: 107 copies of synthetic hsa-miR-197 were used for polyA tailing/RT. An amount corresponding to 105 copies was used for PCR. Total human RNA: 100 ng of total human RNA was used for polγA-tailing/RT (step 1). An amount corresponding to 1 ng was used for PCR. Negative controls: water control and a total human RNA control without PolyA Polymerase in the RT react ion. The black line designates the result obtained with the synthetic template whereas the grey line show the result obtained with total human RNA as template. The melting curves of the result obtained with the synthetic template and the total human RNA are almost identical.
FIGURE 3 shows the amplification curves and the first derivative of the melting curves of Example 2
FIGURE 4 shows amplification plots of Example 4 wherein discrimination between hsa-\et-7a and the variants ήsa-let-7f, ήsa-let-7c and hsa-\et-7e are demonstrated. The amplification- signal from negative controls are also indicated. FIGURE 5A, 5B and 5C shows the method and processes that enables PCR amplification and discrimination between mature miRs, pre-miRs and pri-miRs. See example 6, 7 and 8. A) Polγadenγlation of all RNA J-ends. B) Reverse transcription of polyadenylated RNA to cDNA using the Universal RT primer (N=C, G, A and T; V= C, G, and A). C) MicroRNA specific PCR amplification using gene specfic primers. Note that the site of polγadenγlation in combination with the gene specific reverse primers ensures specific detection of each of the individual molecules mature miRs, pre-miRs and pri-miRs. Fig 5A illustrate the assaγ used for assaγing mature miRs. Fig 5B illustrate the assaγ used for assaγing pre-miRs and Fig 5C illustrate the assaγ used for assaγing pri-miRs.
FIGURE 6 shows amplification curves of (A) the pre-mir-203 assaγ on pre-miR-203, miR-203 and non-template controls (NTC). (B) Amplification curves of (A) the miR-203 assaγ on pre- miR-203, miR-203 and non-template controls (NTC).
FIGURE 7 shows the different expression of a panel of selected miRNA genes in heart and liver. The data is presented as the difference in the crossing point (Cp) value (ACp) between heart and liver, see table 15.
FIGURE 8 shows the detection of each of four listed miRs assaγed bγ the present method (black lines with diamonds) and compared with a commercial available method wherein the Reverse Transcription is performed as a one-tube-reaction for all microRNAs present in a sample (graγ lines with spheres). The figure presents the crossing point (Cp) values as a function of template concentration. Each value is in triplicate.
DEFINITIONS
"small RNA molecules'' refer to tinγ RNA molecules in a living cell such as small "non-coding RNA molecules* i.e. molecules that are not translated into proteins. Non-coding RNA molecules include RNAs such as microRNAs (miRNAs), small interfering RNAs (siRNAs), small nuclear RNAs (snRNAs), small nucleolar RNAs (snoRNAs), small temporal RNAs (stRNAs), antigene RNAs (ag RNAs) and piwi-interacting RNAs (piRNAs).
The terms ΥnicroRNA", 'miRNA" and"miR' are used sγnonγmouslγ and refer to 21-25 nucleotides non-coding RNAs derived from endogenous genes of living organisms such as animals and plants. These socalled mature miRNAs are biologically active and processed from longer hairpin-like precursors termed pre-miRNAs (pre-miRs) having a length of approximately 75 nucleotides. The precursers of pre-miRNAs are pri-miRNAs (pri-miRs) with a length of 500 to 3000 nucleotides. MiRNAs assemble in complexes termed miRNPs and act as major regulators on important biological processes by binding to messenger RNA and interfering with translation efficiency. Target microRNAs of the present invention refer to all known microRNAs, such as microRNAs known from the scientific literature and public databases such as the miRBase database (http://microrna.sanger.ac.uk/) which is the home of microRNA data on the web administrated by the Sanger Institute, UK. The miRBase release 12 is hereby incorporated by reference, including all the mature mi RNA and pre-mature miRNA sequences disclosed therein. tnicroRNA profiling' describes a large-scale analysis in which the expression levels of all microRNAs in a sample such as a tumor sample are determined to build microRNA signatures for a particular disease such as a cancer disease.
"Adding poly-A tails', "PoIy-A tailing" and "polyadenylatiorf refers to the synthesis of a poly(A) tail, a stretch of RNA where all the bases are adenines, at the y-termini of an RNA molecule. Polyadenγlation is a natural biological process in living organisms, but it can also be carried out in vitro using various polymerases such as commercial available E. coli PoIy(A) Polymerase I (E-PAP).
'Extension primer" and "RT-primeι" refers to an oligonucleotide primer, comprising a recognition sequence, complementary to a sequence in the target deoxyribonucleic and/or ribonucleic acid sequence, e.g. to the 3'-end of the mature microRNA or small noncoding RNA in the target ribonucleic acid sequence, and an anchor sequence essential for subsequent amplification by PCR. The said extension primer is used as an anchored primer in a reverse transcription reaction to generate a primer extension product or cDNA.
A "cDNA" refers to a complementary DNA produced by reverse transcription of an RNA template using a reverse transcriptase enzyme. Any reverse transcriptase can be used to synthesize the cDNA molecules, such as reverse transcriptases derived from moloney murine leukemia virus (M-MuLV) reverse transcriptase, avian myeloblastosis virus (AMV) reverse transcriptase, bovine leukemia virus (BLV) reverse transcriptase, Rous sarcoma virus (RSV) reverse transcriptase and human immunodeficiency virus (HIV) reverse transcriptase.
"Primers' refers to short, chemically synthesized oligonucleotides, usually with a length of about twenty to thritγ bases. They are hybridized to a target DNA, which is then copied by a DNA polymerase to produce a complementary DNA strand. A "forward primer" and a "reverse primer" constitute a "PCR primer set" used in PCR, where they hybridise to complementary DNA strands and direct replication towards each other producing the upper-strand and the lower- strand, respectively, leading to an exponential increase in the target DNA segment. The template derived extension of PCR primers can be carried out by any DNA polymerases, such as bacterial thermostable DNA polymerases, including Taq DNA polymerase from Thermus aquaticus, Pfu DNA polymerase from Pyrococcus furiosus, Vent DNA polymerase from Thermococcus litoralis or recombinant DNA polymerases such as Phusion DNA polymerase.
The terms 'amplification", "PCR1, "PCR reaction" and "PCR amplification", are interchangeable terms used to signify use of a nucleic acid amplification system, which multiplies the target nucleic acids using the polymerase chain reaction (PCR).
"qPCR" and "real-time quantitative PCR" refers to the use of PCR to amplify and simultaneously quantify a targeted DNA molecule. qPCR enables both detection and quantification of the number of copies or relative amount of a specific sequence in a DNA sample, when normalized to DNA input. Amplified DNA is quantified as it accumulates in the reaction in real time after each amplification cycle. Quantification is accomplished using various assay chemistries including fluorescent dyes, such as SYBR® green, that intercalate with double-stranded DNA, and fluorescent reporter oligonucleotide probes such as Taqman probes, that release fluorescence signal during the amplification process.
"qRT-PCR" refers to quantitative reverse transcription polymerase chain reaction in which a cDNA produced in a reverse transcription reaction serves as the initial DNA template for the amplification process, which is then combined with qPCR to quantify low abundance of RNA molecules such as microRNAs in a sample of a particular cell or tissue type. Methods for qPCR and qRT-PCR is described in "A-Z of Quantitative PCR." (Bustin, SA (ed.) International
University Line (La JoIIa, CA, USA), 2004) which is hereby incorporated by reference in its entirety.
'Hybridisation" refers to the bonding of two complementary single stranded nucleic acid polymers (such as oligonucleotides), such as RNA, DNA or polymers comprising or consisting of nucleotide analogues (such as LNA oligonucleotides). Hybridisation is highly specific, and may be controlled by regulation of the concentration of salts and temperature. Hybridisation occurs between complementary sequences, but may also occur between sequences which comprise some mismatches. The oligonucleotides used in the methods of the present invention may, therefore be 100% complementary to the target molecule. Alternatively, in one embodiment the oligonucleotides may comprise at least one or two mismatches.
The term "Tm" or "melting temperature" of an oligonucleotide is in the present context a measure of the stability of a duplex formed between the oligonucleotide and its perfect complement DNA strand determined at 115 mM Na+, no formamide. In general Tm is defined as the temperature at which 50 % of the duplexes formed between the oligonucleotide and a complement nucleotide strand are dissociated into single strands. The length and nucleotide composition, such as the sequence of nucleotides and content of G and C nucleotides, of the oligonucleotide are important factors affecting Tm. Substituiton of the normal A, G, C and T nucleotides with the corresponding LNA molecules in an oligonucleotide increases Tm. Similary, hybridisation conditions defined by salt concentration, oligonucleotide concentration, and the presence of denaturants (such as formamide or DMSO) affects Tm. Those skilled in the art of molecular biology know that several useful formulas for calculation of theoretical Tm's have been developed to evaluate the Tm of an oligonucleotide for PCR,
Southern and Northern blots, and in situ hybridization. Examples of Tm calculators are OligoCalc (W. A. Kibbe (2007) Nucleic Acids Res Volume 35, Web Server issue W43-W46) and LNA Probe Tm Predictor at http://www.exiqon.com/oliao-tools .
The term "base", as used herein covers the naturally occurring nucleobases adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U) as well as non-naturallγ occurring nucleobases such as xanthine, diaminopurine, 8-oxo-N6-methyladenine, 7-deazaxanthine, 7- deazaguanine, N4,N4-ethanocytosin, N6,N6-ethano-2,6-diaminopurine, 5-methylcγtosine, 5- (C3-C6)-alkynyl-cytosine, 5-fluorouracil, 5-bromouracil, pseudoisocytosine, 2-hydroxy-5- methyl-4-triazolopγridin, isocytosine, isoguanine, inosine and the "non-naturally occurring" nucleobases described in Benner et al., U.S. Patent No. 5,432,272 and Susan M. Freier and Karl-Heinz Altmann, Nucleic Acid Research,25\ 4429-4443, 1997. The term "nucleobase" thus includes not only the known purine and pyrimidine heterocycles, but also heterocyclic analogues and tautomers thereof. Further naturally and non naturally occurring nucleobases include those disclosed in U.S. Patent No. 3,687,808; in chapter 15 by Sanghvi, in Antisense Research and Application, Ed. S. T. Crooke and B. Lebleu, CRC Press, 1993; in Englisch, et al., Angewandte Chemie, International Edition, 30: 613-722, 1991 (see, especially pages 622 and 623, and in the Concise Encyclopedia of Polymer Science and Engineering, J. I. Kroschwitz Ed., John Wiley & Sons, pages 858-859, 1990, Cook, Anti-Cancer DrugDesign 6: 585-607, 1991, each of which are hereby incorporated by reference in their entirety).
Nucleotides incorporated into oligonucleotides are referred to as nucleotide residues.
The term "nucleoside base" or "nucleobase analogue" is further intended to include heterocyclic compounds that can serve as like nucleosidic bases including certain "universal bases" that are not nucleosidic bases in the most classical sense but serve as nucleosidic bases. Especially mentioned as a universal base is 3-nitropyrrole or a 5-nitroindole. Other preferred compounds include pyrene and pyridyloxazole derivatives, pyrenyl, pyrenylmethylglycerol derivatives and the like. Other preferred universal bases include, pyrrole, diazole or triazole derivatives, including those universal bases known in the art.
By "locked nucleic acid", INA1, INA monomei" oriNA molecule" (e.g., an LNA nucleoside or LNA nucleotide) or an LNA oligomer (e.g., an oligonucleotide or nucleic acid) is meant a nucleoside or nucleotide analogue that includes at least one LNA monomer.
To distinguish between LNA and natural occurring nucleotide residues in LNA containing oligonucleotide sequences presented herein, the LNAs are indicated by capital letters, whereas natural occurring nucleotide residues are indicated by lowercase letters: mC denotes LNA methyl cytosine.
LNA monomers as disclosed in PCT Publication WO 99/14226 are in general particularly desirable modified nucleic acids for incorporation into an oligonucleotide of the invention. Additionally, the nucleic acids may be modified at either the 3* and/or 5' end by any type of modification known in the art. For example, either or both ends may be capped with a protecting group, attached to a flexible linking group, attached to a reactive group to aid in attachment to the substrate surface, etc. Desirable LNA monomers and their method of synthesis also are disclosed in WO 98/39352.
Preferred LNA monomers, also referred to as "oxy-LNA' are LNA monomers which include bicydic compounds as disclosed in PCT Publication WO 03/020739 wherein the bridge between R4 and R2 as shown in formula (I) below together designate -CH2-O- or -CH2-CH2-O-.
Figure imgf000010_0001
It is understood that references herein to a nucleic acid unit, nucleic acid residue, LNA monomer, or similar term are inclusive of both individual nucleoside units and nucleotide units and nucleoside units and nucleotide units within an oligonucleotide.
A "modified base" or other similar terms refer to a composition (e.g., a non-naturallγ occurring nucleotide or nucleosidic base), which can pair with a natural base (e.g., adenine, guanine, cytosine, uracil, and/or thymine) and/or can pair with a non-naturallγ occurring nucleotide or nucleosidic base. Desirably, the modified base provides a Tm differential of 15,
12, 10, 8, 6, 4, or 20C or less as described herein. Exemplary modified bases are described in EP 1 072 679 and WO 97/12896.
The term "chemical moiety refers to a part of a molecule. "Modified by a chemical moiety thus refer to a modification of the standard molecular structure by inclusion of an unusual chemical structure. The attachment of said structure can be covalent or non-covalent.
The term Inclusion of a chemical moiety in an oligonucleotide probe thus refers to attachment of a molecular structure. Such as chemical moiety include but are not limited to covalentlγ and/or non-covalentlγ bound minor groove binders (MGB) and/or intercalating nucleic acids
® (INA) selected from a group consisting of asymmetric cyanine dyes, DAPI, SYBR Green I,
SYBR Green II, SYBR Gold, PicoGreen , thiazole orange, Hoechst 33342, Ethidium
Bromide, l-O-(l-pyrenylmethyl)glycerol and Hoechst 33258. Other chemical moieties include the modified nucleotides, nucleosidic bases or LNA modified oligonucleotides.
Oligonucleotide analogue" refers to a nucleic acid binding molecule capable of recognizing a particular target nucleotide sequence. A particular oligonucleotide analogue is peptide nucleic acid (PNA) in which the sugar phosphate backbone of an oligonucleotide is replaced by a protein like backbone. In PNA, nucleotides are attached to the uncharged polγamide backbone yielding a chimeric pseudopeptide-nucleic acid structure, which is homomorphous to nucleic acid forms.
T-ϊgh affinity nucleotide analogue" or "affinity-enhancing nucleotide analogue" refers to a non- naturally occurring nucleotide analogue that increases the "binding affinity of an oligonucleotide probe to its complementary recognition sequence when substituted with at least one such high-affinity nucleotide analogue.
As used herein, a probe with an increased 'binding affinity for a recognition sequence compared to a probe which comprises the same sequence but does not comprise a stabilizing nucleotide, refers to a probe for which the association constant (Ka) of the probe recognition segment is higher than the association constant of the complementary strands of a double- stranded molecule. In another preferred embodiment, the association constant of the probe recognition segment is higher than the dissociation constant (Kd) of the complementary strand of the recognition sequence in the target sequence in a double stranded molecule. Monomers are referred to as being "complementary" if they contain nucleotides that can form hydrogen bonds according to Watson-Crick base-pairing rules (e.g. G with C, A with T or A with U) or other hydrogen bonding motifs such as for example diaminopurine with T, 5- methyl C with G, 2-thiothymidine with A, inosine with C, pseudoisocytosine with G, etc.
By "oligonucleotide," "oligomer," or "oligo" is meant a successive chain of monomers (e.g., glycosides of heterocyclic bases) connected via internucleoside linkages. The linkage between two successive monomers in the oligo consist of 2 to 4, desirably 3, groups/atoms selected from -CH2-, -O-, -S-, -NRH-, >C=O, >C=NRH, >C=S, -Si(R11J2-, -SO-, -S(O)2-, -P(O)2-, -PO(BH3)-, -P(O1S)-, -P(S)2-, -PO(R")-, -PO(OCH3)-, and -PO(NHRH)-, where RH is selected from hydrogen and C^-alkyl, and R" is selected from C1-6-alkyl and phenyl. Illustrative examples of such linkages are -CH2-CH2-CH2-, -CH2-CO-CH2-, -CH2-CHOH-CH2-, -0-CH2-O-, -0-CH2-CH2-, -0-CH2-CH= (including R5 (see formula I) when used as a linkage to a succeeding monomer), -CH2-CH2-O-, -NRH-CH2-CH2-, -CH2-CH2-NR"-, -CH2-NRH-CH2-, -0-CH2-CH2-NR"-, -NRH-CO-O-, -NRH-CO-NRH-, -NRH-CS-NRH-, -NRH-C(=NRH)-NRH-, -NRH- CO-CH2-NR"-, -0-C0-0-, -0-CO-CH2-O-, -0-CH2-CO-O-, -CH2-CO-NRH-, -O-CO-NRH-, -NRH- CO-CH2-, -0-CH2-CO-NR"-, -O-CH2-CH2-NRH-, -CH=N-O-, -CH2-NRH-O-, -CH2-O-N= (including R5 when used as a linkage to a succeeding monomer), -CH2-O-NRH-, -CO-NRH-CH2-, -CH2- NRH-O-, -CH2-NRH-CO-, -O-NRH-CH2-, -O-NRH-, -0-CH2-S-, -S-CH2-O-, -CH2-CH2-S-, -0-CH2- CH2-S-, -S-CH2-CH= (including R5 when used as a linkage to a succeeding monomer), -S- CH2-CH2-, -S-CH2-CH2-O-, -S-CH2-CH2-S-, -CH2-S-CH2-, -CH2-SO-CH2-, -CH2-SO2-CH2-, -0-S0-0-, -0-S(O)2-O-, -0-S(O)2-CH2-, -O-S(O)2-NRH-, -NRH-S(O)2-CH2-, -0-S(O)2-CH2-, -O- P(O)2-O-, -O-P(O,S)-O-, -0-P(S)2-O-, -S-P(O)2-O-, -S-P(O,S)-O-, -S-P(S)2-O-, -0-P(O)2-S-, -O-P(O,S)-S-, -0-P(S)2-S-, -S-P(O)2-S-, -S-P(O,S)-S-, -S-P(S)2-S-, -O-PO(R")-O-, -O- PO(OCH3J-O-, -O-PO(OCH2CH3)-O-, -0-PO(OCH2CH2S-R)-O-, -0-PO(BH3)O-, -O-PO(NHRN)- 0-, -O-P(O)2-NRH-, -NRH-P(O)2-O-, -O-P(O,NRH)-O-, -CH2-P(O)2-O-, -0-P(O)2-CH2-, and -O- Si(R11J2-O-; among which -CH2-CO-NRH-, -CH2-NRH-O-, -S-CH2-O-, -0-P(O)2-O-, -0-P(O1S)-O- , -0-P(S)2-O-, -NRH-P(O)2-O-, -O-P(O,NRH)-O-, -O-PO(R")-O-, -0-PO(CH3)O-, and -O-PO(NHRN)-O-, where RH is selected form hydrogen and C1-4-alkyl, and R" is selected from Ci-6-alkyl and phenyl, are especially desirable. Further illustrative examples are given in Mesmaeker et. al., Current Opinion in Structural Biology 1995, 5, 343-355 and Susan M. Freier and Karl-Heinz Altmann, Nucleic Acids Research, 1997, vol 25, pp 4429-4443. The left-hand side of the internucleoside linkage is bound to the 5-membered ring as substituent P* at the 3'-position, whereas the right-hand side is bound to the 5'-position of a preceding monomer. The term "succeeding monomer" relates to the neighbouring monomer in the 5'-terminal direction and the "preceding monomer" relates to the neighbouring monomer in the 3'- terminal direction. It should be noted that whereas the natural synthesis of DNA and RNA proceed in the direction 5' to J, many chemical synthesis-schemes proceed in the direction of JtO -T.
When performing quantitative PCR, the cycle at which the fluorescence from a sample crosses the threshold is called the 1CyCIe threshold' or Q. Ct is used for quantification of a template.
The "crossing poinf or Cp value is a slightly different, but related value that can be used for quantification of a template somewhat similar to the use of Q. The LightCycler® 480
Software calculates the second derivatives of entire amplification curves and determines where this value is at its maximum. This value (crossing point, Cp) represents the cycle at which the increase of fluorescence is highest and where the logarithmic phase of a PCR begins. Both terms Q and Cp are further explained in Bustin, SA (ed.) "A-Z of Quantitative PCR." International University Line (La JoIIa, California, USA), 2004, which is included herein by reference.
Suitably, the "targef or 'target nucleic acid* or target ribonucleic acid" refers to any relevant nucleic acid of a single specific sequence, e. g., a biological nucleic acid, e. g., derived from a subject or human being. Within the context of the oligonucleotides and detection probes used in the invention to detect miRNAs, the 'target' is a human miRNA or precursor thereof, or in one embodiment, a molecule which retains the genetic sequence information contained therein - such as all or (a sufficient) part of the seqeunce of nucleotides or reverse complement thereof.
Target sequence" refers to a specific nucleic acid sequence (or corresponding nuceltobase seqeunce) within any target nucleic acid.
The term "primer design" refers to methods such as those provided below. The primer design is an systematic approach used for designing the sequence of nucleotides in forward and reverse primers thus ensuring probe specificity and binding efficiency to target microRNAs. The following rules have been used for design of primers for miR-specific qPCR:
Forward primer design:
Preferably, the forward primers are designed to be identical of from 12 to 18 bases of the 5' end of the miR sequence. Preferably, the Tm of the forward primers should be in the range of between 55 0C and 65 3C, however, a Tm below 55 °C and above 65 "C may also be acceptable. To ensure that the Tm of the primers preferably is in the range of between 55 DC and 65 °C, one or more LNA monomers may be inserted into the sequence substituting the natural nucleotide. An artificial nucleotide sequence may also be added to the 5'-end of the forward primer to make certain that the Tm is in the range of between 55 °C and 65 °C.
Reverse primer design:
The reverse primer is according to formula II:
Figure imgf000014_0001
wherein R is a 5'-end nucleotide sequence, (T)x is a central part of x consecutive thymine
4 residues in the amount of x, wherein x is an integer of from 1 to 100, and R is a 7-end nucleotide sequence that specifically hybridizes to a part of a microRNA molecule.
4 R is preferably a nucleotide sequence of from 1 to 10 nucleotides designed from the J-end
4 of a specific miRNA. R is able to hybridize specifically to the DNA strand (i.e. the upper- strand) produced by extension of the corresponding miRNA specific forward primer. To ensure miRNA specificity and make certain that the Tm of the primer preferably is in the
4 range of between 55 °C and 65 °C, one or more LNA monomer may be inserted into the R sequence substituting the corresponding natural nucleotide.
The (T)x central part is preferably a stretch of approximately 15 consecutive thymine nucleotide residues that hybridizes to the poly-A-tail part of the DNA strand produced from the corresponding miRNA specific forward primer.
The R sequence of the reverse primer typically has a length of form 1 to 20 nucleotides. For
example R can be 17 nucleotides long, 8, 7 or 6 nucleotides long or even only one
nucleotide long. In certain embodiments of the present invention, the R sequence is S-
TGACACGGAGGTACrAG-? (SEQ ID NO 3). The length of the R sequence may be reduced from the 5'-end to adjust the Tm of the reverse primer to the preferable range of between 55
DC and 65 °C. The R sequence is identical to or at least has overlap to part of the R sequence (formula (III)) of the extension primer.
The procedure for designing the reverse primer is described below.
A. Design a number of primers that fulfil the following conditions:
1) Delete all adenine residues from J-end of miR nucleotide sequence. They will form part of the polγ-A tail.
2) After deleting adenine residues start with reverse complement to 7 end base of the miR and continue until one base overlap with forward primer.
3) Delete one base from the 3 'end of the reverse primer if the sequence is a cytosine residue and the J end of the forward primer is a guanine residue.
4) Delete one base from the 3 'end of the primer if the sequence is a guanine residue and the J end of the forward primer is a cytosine residue.
5) Delete one base from the 3 'end of the primer if the last two bases are overlapping with the last two bases of the forward primer (from the J end).
6) Repeat this process until the conditions are fulfilled.
7) If no primer fulfils the conditions disregard rules #2 and 3 and allow two bases overlap (but not more) for sequences ending with AA, AT, TA or TT.
8) If no primer fulfils the conditions try another forward primer design.
B. Choose the longest reverse primer that fulfils the following conditions:
1) At least four bases long.
2) Less than five cytosine residues and guanine residues in the last six bases at the J end of the primer. 3) Less than four cytosine residues and guanine residues in the last five bases at the J end of the primer except if the last or second last base is an adenine residue or thymine residue .
4} If possible not more than two adenine residues or thymine residues in the 3" end.
5) If no primer fulfils the conditions try another forward primer design.
C. Optionally insert one LNA monomer according to the following rules:
4
1) Insert LNA at first cytosine residue or guanine residue from 5' end of the R part of the reverse primer.
2) No LNA in sequences with three or more consecutive cytosine residues or guanine residues.
3) LNA should be in position four or higher from the J end of the primer.
4) If the conditions cannot be fulfilled insert LNA at first adenine residue or thymine
4 residue from 5' end of the R part of the reverse primer.
5) LNA should be in position four or higher from the J end of the primer.
4 6) If the conditions cannot be fulfilled insert LNA-thγmine (LNA-T) at S end of the R part of the primer.
D. Tailing:
Add a sequence of the formula R -OT)x to the 5'end of the reverse primer. I certain embodiments of the present invention the nucleotide sequence:
Figure imgf000016_0001
(SEQ ID NO 4) is added at the 5' end of the reverse primer. If an LNA-T was added to the miR-specific part of the reverse primer (step C6) delete one thymine residue from the tail as there should never be more than 15 consecutive thymine residues.
Eventually, nucleotides are removed from the 5'-end of the reverse primer to fine-tune the Tm of the primer.
"Sample" of RNA refers to RNA comprising compositions obtained from cells, tissues or fluids from an organism according to conventional procedures described e.g. in RNA Isolation and Characterization Protocols (Rapley, Ralph; Manning, David L. (Eds.} 1998) known to the skilled artesian or by using commercial kits such as miRNeasy (QIAGEN GmbH, Hilden, Germany)) or miRVana (Ambion Inc., Austin, TX, US). Sources for isolation of RNA fractions are samples of cells, or tissue or fluid isolated from an organism or organisms, including but not limited to, for example, skin, plasma, serum, spinal fluid, lymph fluid, synovial fluid, urine, tears, blood cells, organs, tumours, and also to samples of in vitro cell culture constituents (including but not limited to conditioned medium resulting from the growth of cells in cell culture medium, recombinant cells and cell components). 'Sample" may also refer to cells or fluids that can be used directly in a q RT-PCR proces without previous enrichment of the RNA fraction or even RNA comprising compositions comprising artificially sγnthesised RNA.
Cells or cell types also refer to any cells of Eukaryote, Prokarγote and Archaea origin.
A " living organism" refers to a living entity, including but not limited to, for example, human, mouse, rat, Drosophila, C. elegans, yeast, Arabidopsis thaliaπa, maize, rice, zebra fish, primates, domestic animals, etc.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
Detailed outline of the αRT-PCR reaction and the primers involved:
The present invention provides methods for amplification of microRNA molecules in a sample, the method comprising the steps described schematically in Fig. 1, and comprise:
(a) adding poly-A tails to a population of RNA molecules in a sample; (b) producing cDNA molecules of the polγ-A-tailed RNA molecules using an extension primer in a reverse transcription reaction; and
(c) amplifying the cDNA molecules bγ PCR using a forward primer and a reverse primer both of which are specific for said RNA molecule.
When performing the method in practice step (a) and (b) is typically performed as one concerted reaction which is universal for all RNAs to be analysed - hence its nickname: 'Universal RT. The advantage of only one first-strand cDNA synthesis reaction (or RT reaction) to be used as template for multiple real-time PCR assays is that it saves precious sample, reduces technical variation and reduces time spent in the laboratory.
During step (c) of the method individual (or groups of individual) RNAs are specifically PCR amplified using specific forward and reverse primers. Typically the primers are optimised by introducing one or more LNA nucleotide analogues into the sequence of the primers, and typically the PCR is quantitative Real-Time PCR. As can be seen from the examples the method result in 1) uniquely specific assays that enable discrimination between highly related RNA sequences and 2) an extremely low background which enables accurate quantitation of very low RNA levels.
The method has been extensively used to quantify small RNAs. In a preferred embodiment the small RNA, comprises small non-coding RNAs such as short inferring RNAs (siRNAs), mature microRNAs and pre-microRNAs. Also larger RNAs, e.g. precursers of pre-microRNAs the pri-miRNAs (pri-miRs) and mRNAs may be assessed by method.
Most preferably the small RNA is a microRNA.
The extension primer may be of a length in the range from 10 to 100 nucleotidbes, such as a length in the range from 15 to 45 nucleotides. Preferably, the extension primer has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.
In a preferred embodiment, the extension primer is of the formula III:
Figure imgf000018_0001
wherein R is a 5'-end nucleotide sequence, (T)y is a central part of consecutive thymine
residues in the amount of y, wherein γ is an integer of from 1 to 100, and R is a ϊ-end nucleotide sequence.
Typically, the 5'-end part R is a nucleotide sequence with a length of from 1 to 30
nucleotides. For example the R sequence may be 6, 7, 8, 9, or 10 nucleotides long. The R
sequence includes at least a hybridisation sequence for the R sequence in the reverse primer of the formula II (see below) to be used in the subsequent miRNA-specific qPCR.
Preferably, γ in formula III is in the interval of from 5 to 50, more preferably y is in the interval of from 5 to 21. For example y is 12, 13, 14, 15, 16, 17 or 18. Most preferably y is 15.
In one especially preferred embodiment y of formula (III) equals x of formula (II).
In a preferred embodiment, R is a degenerated anchor sequence motif VN, comprising the two 3-end terminal nucleotide residues, wherein V designate a selection of residues comprising bases which can base pair to all but one of the natural bases (e.g. base pair to guanine, cytosine, uracil and thymine but not to adenine), typically V designate that the base in any primer molecule is a base randomly selected between adenine, guanine and cytosine and wherein N designate a base which can base pair to any of the natural bases (e.g. adenine, guanine, cytosine, uracil and thymine), typically N may be a base randomly selected between adenine, guanine, cytosine or thymine residue.
In another preferred embodiment R is a degenerated sequence motif VNN, comprising the three 7-end terminal nucleotide residues, wherein V designate a selection of residues comprising bases which can base pair to all but one of the natural bases (e.g. base pair to guanine, cytosine, uracil and thymine but not to adenine), typically V designate that the base is a base randomly selected between adenine, guanine and cytosine and wherein N designate a base which can base pair to any of the natural bases (e.g. adenine, guanine, cytosine, uracil and thymine), typically N may be a base randomly selected between adenine, guanine, cytosine or thymine residue. In a preferable embodiment, the extension primer comprises at least one LNA.
In a certain embodiment of the present invention the extension primer has the sequence S-
Figure imgf000020_0002
Preferably, the forward primer has a length in the range of from 10 to 100 nucleotides, such as 12 to 22 or 13 to 20 or 14,15, 16, 17, 18 or 19 nucleotides. See table 18 for specific embodiments.
The forward primer may comprise one, two or even more LNAs.
In a preferred embodiment, the nucleotide sequence of the forward primer is designed to specifically hybridize to the complement DNA molecule of a specific microRNA molecule using the primer design rules described in the definition of "primer design" (see DEFINITIONS section}
Preferably, the reverse primer is of the formula II:
Figure imgf000020_0001
wherein R is a 5'-end nucleotide sequence (T)x is a central part of consecutive thymine
4 nucleotides in the amount of x, wherein x is an integer of from 1 to 100, and R is a ϊ-end nucleotide sequence that specifically hybridizes to a nucleotide sequence of a target RNA molecule.
Preferably, the S-enά nucleotide sequence R of the reverse primer of formula II is a nucleotide sequence with a length of from 1 to 30 nucleotides.
Preferably, x in formula II is in the interval of from 5 to 50, more preferably x is in the interval of from 5 to 21. For example x is 12, 13, 14, 15, 16, 17 or 18. Most preferably x is 15.
In one especially preferred embodiment x of formula (II) equals y of formula (III). 4 In a preferred embodiment, the J-end nucleotide sequence R of the reverse primer of formula II has a length in the range of from 1 to 10 nucleotides.
As illustrated in example 2 LNA has a profound effect. Accordingly, in a preferred
4 embodiment, the 3"-end part, R , of the reverse primer of formula II comprises at least one
4 LNA. More preferably, the J-end part, R , of the reverse primer of formula II contains only one LNA. In a particularly preferred embodiment the LNA is situated in the 5' position or the
4 position adjacent to the 5* position of the R part of the reverse primer.
In a preferred embodiment the nucleotide sequence of the reverse primer is designed to specifically hybridize to a specific microRNA molecule using the primer design rules described in the definition oPprimer design" (see DEFINITIONS section)
Design of primers
The invention also provides methods for designing the nucleotide sequence of the forward primers and the reverse primers used in the invention. Systematic approaches and experimental evaluation of the primers are presented in the EXAMPLES 3 section.
Examples of applications of the present invention
The present invention is useful for amplification and quantification of small RNA molecules such as microRNAs or siRNA's in various cells or tissues originating from humans or other organisms as described in EXAMPLES 5 and 9. As illustrated in example 10 the present method is superior with respect to sensitivity and specificity when compaired with a somewhat similar single tube cDNA synthesis approach which is commercially available.
Thus one aspect of the invention is a method for measuring the amount of a target microRNA in a sample from a living organism, the method comprising the steps of:
a) amplifying the target microRNA according to the method of any one of claims 1 to 28
b) measuring the amount of the amplified DNA molecules. The amount of the amplified DNA molecules is typically measured using fluorescence-based
® quantitative real-time PCR by e.g. monitoring SYBR green fluorescence as a function of PCR cycle number.
Accordingly, the present invention can be used as a tool for microRNA profiling of different cell and tissue types within a living organism. Thus, the number of specific microRNAs and the amounts of specific microRNAs present in different cell and tissue types can be determined using the present invention. Similarly, the invention can be used to discriminate between the levels of mature microRNAs, pre-microRNAs and pri-microRNAs in different cell and tissue types by using appropiate primers targeting the mature microRNA or its precursors (see fig 5).
In another aspect, the present invention can be used as a tool for microRNA profiling of patients suffering from various diseases such as cancer. By way of example, the microRNAomes of various cancer tissues can be established using the invention.
In yet another aspect the present invention can be used for diagnosis of various diseases such as cancer by measuring microRNA expresssion in tissues and body fluids from normal individuals and from individuals having a disease, and subsequently analyse for differences in the microRNA profiles.
In another embodiment the present invention may be used for measuring changes in the amount of specific microRNAs in response to treatment of a disease affected individual by means of pharmaceuticals, such as chemotherapeutical agents, and by means of surgery.
In another embodiment the present invention may be used for measuring specific predictive microRNA biomarkers that correlate with re-currence free survival of patients having a disease, such as a cancer disease.
Due to its simplicity: one "universal-RT" step and one discriminatory PCR step, the present invention is also suitable for high-throughput methods on robot platforms directed to the quantification of a single microRNA or a collection of microRNAs. Thus, the method is particularly suitable for multiple subsequent PCR reactions of individual microRNAs as described in EXAMPLE 5, 9 and 10.
In a certain embodiment the method of the invention may be used to quantitatively determine the amount of mature microRNA in a sample without interference from the corresponding pre-miR, and vice versa the amount of a pre-miR can be determined without interference from the mature microRNA as described in EXAMPLES 6, 7 and 8.
In another embodiment the method of the invention may be used for discrimination between targets with single nucleotide differences as described in EXAMPLE 4.
In another aspect, the present invention provides kits for detecting at least one target microRNA, the kits comprising one or more primer sets specific for the detection of a target microRNA, each primer set comprising firstly, a universal extension primer for producing a cDNA molecule complementary to a target microRNA, and secondly, a PCR primer set comprising a forward primer specific for the .rend of the target miRNA and a reverse primer specific for the .Pend of the target miRNA for amplifying the cDNA molecule.
Accordingly in one aspect the invention a kit for detecting at least one target RNA is provided. The kit comprises at least one primer set specific for the detection of a target RNA, said primer set comprises:
1 2 a) an extension primer of formula I: R -(T)v -R (III)
wherein R is a 5'-end nucleotide sequence, (T)y is a central part of consecutive thymine
residues in the amount of y, wherein y is an integer of from 1 to 100, and R is a ϊ-end nucleotide sequence.
3 4 b) a reverse primer of formula II: R -(T)x -R (II)
3 wherein R is a 5'-end nucleotide sequence, (T)x is a central part of consecutive thymine
4 residues in the amount of x, wherein x is an integer of from 1 to 100, and R is a 3*-end nucleotide sequence that specifically hybridizes to a nucleotide sequence of a target RNA molecule, and
c) a forward primer
In one embodiment the kit is designed for detecting at least one mammalian target microRNA comprising at least one primer set specific for the detection of a target microRNA. Preferably, the extension, the reverse and the forward primers are designed following the design rules given in the "primer design-part of the DEFINITIONS section and elsewhere and forward and reverse primers which includes at least one LNA molecule are especially preferred embodiments.
A non-limiting example of an extension primer is shown as SEQ ID NO 5.
Forward and reverse primers included in the kit may be designed to detect any mammalian target microRNA in accordance with the methods described herein. Non-limiting examples of forward and reverse primers are listed in TABLE 16.
In certain embodiments, the kit includes multiple primer sets that may be used to detect various mammalian microRNA targets, such as two microRNA targets up to several hundred microRNA targets.
A kit of the invention may also provide an array of primers delivered in microtiter qPCR plates such as 96, 768, 869, 1536 or even 3456-well microtiter qPCR plates suitable for robot handling as indicated in EXAMPLE 9.
A kit of the invention may also include reagents required for the poly-A-tailing, primer extension and PCR reactions, such as buffers, salts, reducing agents, deoxy nucleoside triphosphates, nucleoside triphosphates, and enzymes. A detection reagent for the qPCR such as 5YBR® green may also be included. Similarly a kit for RNA isolation may also be included.
A further aspect of the invention is a high-throughput method for measuring the amount of specific target microRNAs in a sample from a living organism by using the method of the present invention and integrating an automated wherein the combined poly-A-tailing and reverse transcription reaction is aliquoted into individual wells of a microtiter plate containing microRNA specific primer sets of forward and reverse primers, resulting in the steps of:
a) adding poly-A tails to a population of small RNA molecules in a sample and producing cDNA molecules of the polγ-A-tailed small RNA molecules using an extension primer in a reverse transcription reaction; and
b) pipetting aliquots of the combined poly-A-tailing and reverse transcription reaction into individual wells of a microtiter plate c) amplifying specific target microRNAs in individual wells of a microtiter plate containing microRNA specific primer sets
d) measuring the amount of specific microRNA molecules in individual wells.
being performed in a fashion compatible with a high-throughput experimental set-up. Such a set-up will typically comprise one or more pipetting robots.
EXAMPLES
EXAMPLE 1: PRODUCTION OF SPECIFIC DNA MOLECULES USING MIR-SPECIFIC QPCR.
In this example hsa-miR-197 was amplified from a human RNA sample using the miR specific quantitative reverse transcription polymerase chain reaction (qRT-PCR) of this invention.
Mixed on ice:
• 1 μl 1Ox PoIy(A) polymerase buffer (New England Biolabs)
• 1 μl 1 mM ATP
• 1 μl 10 μM RT-primer (=extension primer)
Figure imgf000026_0002
(SEQ ID NO 5), v designates cytosine, guanine and adenine residues, n designates cytosine, guanine, adenine and thymine residues)).
• 1 μl mix of 1 mM dATP, 1 mM dCTP, 1 mM dGTP, 1 mM dTTP
• 0,5 μl (200U/μl) MuLV reverse transcriptase (New England Biolabs Inc., Ipswich, MA, US)
• 0,2 μl (5U/μl) PoIy(A) polymerase (New England Biolabs) • 1 μl RNA sample (total human RNA sample =100 ng of a mixture of 25 ng human heart RNA, 25 ng human brain RNA, 25 ng human liver RNA and 25 ng human lung RNA all from Ambion, Austin, TX, US. Synthetic templates were prepared in lOng/μl phage MS2 RNA in TE, approximately 107 copies are added to the reaction. Synthetic template is obtained from Integrated DNA technologies Inc., Coralville, IA, US.) • Water to 10 μl
Negative controls: water control and a total human RNA control without PoIyA Polymerase in the RT reaction.
The mixture was incubated at 42 0C, 1 hour followed by 95 0C, 5 minutes.
For qPCR 1 μl or less of the polyA-tailing/RT reaction (step 1 on fig 1) was used for each PCR reaction with gene-specific forward and reverse primers for hsa-miR-197; forward primer 5' ttmCaccaccttctcca (SEQ ID NO 1) and the reverse primer
Figure imgf000026_0001
(SEQ ID NO 2) (in the nucleotide sequences lower case designates a natural occurring nucleotide, upper case designates LNA, mC denotes LNA methyl cytosine). ® Real-time PCR was done on a ABI 7500 thermocγcler (Applied Biosystems Inc, Foster City,
CA, US) by monitoring SYBR green fluorescence as a function of PCR cycle number. A typical PCR reaction mixture contained :
• 10 μl 2x PCR mastermix (Roche cat#04 673 484 001, Roche Diagnostics A/S, Hvidovre, Denmark)
• 1 μl or less of the RT reaction
• 1 μl TE buffer with 2.5 μM miR-specific forward primer and 2.5 μM miR-specific reverse primer (TE buffer: 10 mM Tris/HCI (pH 8.0), ImM EDTA).
• Water to 20 μl.
The mixture was incubated at 95°C for 10 min followed 40 cycles of 95°C for 5 sec; 600C for 60 sec with measurement of the fluorescence.
Amplification of the correct product was measured by comparing the melting curve profile of the PCR product to the melting curve profile of a PCR product obtained by amplification of a synthetic template (Fig. 2). No signal was was obtained with the negative controls. The experiment shows that the same and correct hsa-miR-197 PCR product was obtained both using the total human RNA sample and a c hsa-miR-197 as template in step 1.
EXAMPLE 2: EFFECT OF LNA IN THE REVERSE PRIMER.
The effect of different designs of miR-specific PCR primers of step 2 can be tested on artificial DNA templates with the same sequence as the product of the reverse transcription reaction. An important advantage of using an artificial DNA template for PCR is that experimental variations in the efficiency of the reverse transcription step are eliminated.
Hsa-let-7a DNA template:
Figure imgf000027_0001
Salmon DNA: 2 ng/μl in TE buffer
MiR-specific forward primer: F7a: 5'-tGaGgtagtaggttg (SEQ ID NO 7) (lower case designates a natural occurring nucleotide, upper case designates LNA).
MiR-specific reverse primers:
Figure imgf000028_0001
A PCR mix was prepared:
• 550 μl 2x PCR mastermix (Roche cat#04 673 484 001)
• 440 μl water, and as described i tab 1.
TABLE l:Four PCR reactions were prepared:
Figure imgf000028_0002
Real-time PCR was carried out on a ABI 7500" thermocγder bγ monitoring SYBR ® green fluorescence as a function of PCR cycle number.
The mixture was incubated at 95°C for 10 min followed bγ 40 cycles of 95°C for 5 sec; 600C for 60 sec with measurement of the fluorescence.
Amplification of the correct product was measured according to the recommendations from the manufacturer of the thermocycler (Applied Biosystems, Foster City, CA, US). Briefly, the PCR reaction was incubated at 600C for 1 minute and fluorescense was measured during a slow increase of the temperature to 95°C. The first derivative of the melting curves is shown in figure 3:
The results show (Figure 3) that the reverse primer without LNA (r7a.2) gives a positive signal in the negative control whereas the reverse primer with LNA (r7a.7) does not. Thus the LNA base in r7a.7 is necessary in order to avoid an unspecific PCR product developed in the negative control reaction. Both primers amplify the positive control template.
As can be seen from table 2, it was found that the inclusion of one LNA in the miR-specific sequence of the reverse primer reduced background signal in PCR.
Figure imgf000030_0001
EXAMPLE 3: MANUAL PRIMER DESIGN AND VALIDATION OF PRIMERS FOR MIRS.
Primers were manually designed following the design-rules presented in the "primer desigrf- part of the DEFINITIONS section.
Primer validation: By using the primer design rules it is possible to achieve PCR primers that have >70 % success rate in real-time PCR experiments according to the following validation criteria: Prepare Rtmix for four reverse transcription (RT) samples:
1. Water
2. 100 ng total human RNA mix* (as default we use a mix of 25 ng of each heart, brain, liver and lung total RNA from Ambion).
*RNA mix: 1 μl 1 μg/μl heart RNA, 1 μl 1μg/μl brain RNA, 1 μl 1μg/μl liver RNA, 1 μl 1μg/μl lung RNA, 36μl TE. Store in 1 μl aliquots at -8O0C
3. 100 ng total human RNA mix without PoIyA tailing.
4. 107 copies of the synthetic miR in 10 ng phage MS2 RNA in TE (synthetic miRs were obtained from Integrated DNA technologies Inc., Coralville, IA, US.). The miR can be added as a pool comprising up to at least 20 miRs.
Figure imgf000031_0001
Reverse transcription reactions:
Figure imgf000032_0001
Incubate 42°C,1 h>95°C,51
Add 90μl TE to each sample and store at -2O0C a) Remember to dilute the poly(A) polymerase (PAP) 1:10 before use!
miR-specϊfic qPCR:
Run PCR with the forward and reverse primers on 1 μl of each reverse transcription (RT) reaction:
Sample 1μl RT reaction 5μM forward primer 5μM reverse primer 2xfaststart Water
#1 #1 0,5μl 0,5μl 10μl 8μl
#2 #2 0,5μl 0,5μl 10μl 8μl
#3 #3 0,5μl 0,5μl 10μl 8μl
#4 #4 0,5μl 0,5μl 10μl 8μl
Figure imgf000032_0002
Real-time PCR on the ABI 7500: 95°C, 10 min
95°C, 15 sec; 600C, 60 sec; 40 cycles Run melting curve analysis
Acceptance criteria:
Sample 1: Cycle threshold (Ct) above 40 compared to exponential area for #2 and 4. Melting peak derivative below 5000.
Sample 2: Ct below 35
One peak on bell shaped melting curve, unless otherwise justified the peak should be between 69 °C and 80 0C. Peak at same temperature (+/- 0.5 0C) as in sample 4. In the exponential area the crossing point at 10 times delta Rn minus the crossing point at delta Rn should be between 3.2 and 4.4: 3.2 < (ClOT-CT) < 4.4
Sample 3: Ct above 40 compared to exponential area for #2 and 4. Melting peak derivative below 5000.
Sample 4: One peak on bell shaped melting curve, unless otherwise justified the peak should be between 69 "C and 80 0C. Peak at same temperature (+/- 0.5 0C) as in sample 2.
Figure imgf000034_0001
Table 4: Design and validation of 15 primer pairs. The theoretical Tm of the reverse primer was optimised to 59 °C:
Figure imgf000035_0001
Lower case designates natural occuring nucleotides, upper case designates LNA, mC denotes LNA methyl cytosine.
Result (see tab 4): 15 primers pairs were designed according to the design rules. 12 of the 15 assays were successfully validated according to the validation protocol corresponding to a success rate of 80%.
EXAMPLE 4: DISCRIMINATION BETWEEN TARGETS WITH A SINGLE NUCLEOTIDE DIFFERENCE.
There are three miRs that only differ by one nucleotide from the sequence of /?sa-let-7a (table below).
Figure imgf000036_0001
To test if the qPCR primers for ήsa-let-7a detect the miRs with a single nucleotide difference the following miR-specific qPCR experiment was performed:
Mixed on ice:
RT mix:
1 μl 1Ox PAP buffer (Epicentre Biotechnologies, Madison, WI, US.)
1 μl 1 mM ATP
1 μl 10 μM RT-primer (L2TA: 5r-ggtactagtttttttttttttttvn (SEQ ID NO 5), v designates c, g and a, n designates c, g, a and t))
1 μl mix of 1 mM dATP, 1 mM dCTP, 1 mM dGTP, 1 mM dTTP
0,5 μl 2 units/μl Transcriptor (Roche Diagnostics A/S, Hvidovre, Denmark, cat# 03
531 295 001).
0,2 μl (5U/μl) PoIy(A) polymerase (Epicentre)
4.5 μl water
The following samples were prepared and incubated at 42 3C, 1 hour followed by 95 °C, 5 minutes:
Figure imgf000037_0001
TlIe synthetic templates were prepared in lOng/μl phage MS2 RNA in TE. The synthetic templates are obtained from Integrated DNA technologies Inc., Coralville, IA, US.
For qPCR 1 μl of the polyA tailing/RT reaction was used for each PCR reaction with the hsa- let-7a forward primer 5'-tGaGgtagtaggttg (SEQ ID NO 7) and reverse primer ?- cggaggtactagtttttttttttttttAactat (SEQ ID NO 94)
Real-time PCR was done on a ABI 7500 thermocyder by monitoring SYBR® green fluorescence as a function of PCR cycle number. The PCR reaction mixture contained:
10 μl 2x PCR mastermix (Roche cat#04 673 484 001)
1 μl or less of the RT reaction
1 μl TE with 2.5 μM miR-specific forward primer and 2.5 μM miR-specific reverse primer water to 20 μl.
The mixture was incubated at 95°C for 10 min followed 40 cycles of 95°C for 5 sec; 600C for 60 sec with measurement of the fluorescence.
Amplification of the correct product was measured by comparing the melting curve profile of the PCR product to the melting curve profile of a PCR product obtained by amplification of a synthetic template.
The result of the real-time PCR experiment was analysed according to standard methods (Bustin, SA (ed.) "A-Z of Quantitative PCR." International University Line (La JoIIa, California, USA), 2004).
The result is shown in table 6 and as amplification plots in Figure 4.
Figure imgf000038_0001
EXAMPLE 5: QUANTIFICATION OF MIRS IN HUMAN BRAIN TOTAL RNA.
In this example the copy number of miRs /?sa-let-7a, ήsa-miR-21, /jsa-miR-27b and ήsa-miR- 195 in total human brain RNA (Ambion) was determined.
Mixed on ice:
RT mix:
1 μl 10x PAP buffer (New England Biolabs)
1 μl 1 mM ATP
1 μl 10 μM RT-primer (L2TA: 5'-ggtactagtttttttttttttttvn (SEQ ID NO 5), v designates cytosine, guanine and adenine residues, n designates cytosine, guanine, adenine and thymine residues)).
1 μl mix of 1 mM dATP, 1 mM dCTP, 1 mM dGTP, 1 mM dTTP
0,5 μl 2 units/μl Transcriptor (Roche cat# 03 531 295 001, Roche Diagnostics A/S,
Hvidovre, Denmark).
0,5 μl (5U/μl) PoIy(A) polymerase (New England Biolabs Inc., Ipswich, MA, US)
3 μl water
The following samples were prepared and incubated at 42 °C, 1 hour followed by 95 °C, 5 minutes:
Figure imgf000039_0001
Synthetic template: Equal amounts (number of copies) of synthetic /?sa-let-7a, /?sa-miR-21, ήsa-miR-27b and Λsa-miR-195 in lOng/μl phage MS2 RNA in TE (obtained from Integrated DNA technologies Inc).
TE: 1OmM Tris/HCI (pH 8.0), ImM EDTA.
For qPCR 1 μl of the polyA tailing/RT reaction was used for each PCR reaction with the gene- specific primers:
Table 7:
Figure imgf000039_0002
Real-time PCR was done on a ABI 7500® thermocγder by monitoring SYBR® green fluorescence as a function of PCR cycle number. The PCR reaction mixture contained:
• 10 μl 2x PCR mastermix (Roche cat#04 673 484 001)
• 1 μl or less of the RT reaction • 1 μl TE with 2.5 μM miR-specific forward primer and 2.5 μM miR-specific reverse primer
• water to 20 μl.
The mixture was incubated at 95°C for 10 min followed 40 cycles of 95°C for 5 sec; 600C for 60 sec with measurement of the fluorescence.
Amplification of the correct product was measured by comparing the melting curve profile of the PCR product to the melting curve profile of a PCR product obtained by amplification of a synthetic template.
For each miR, the result of the real-time PCR experiment was analysed according to standard methods (Bustin, SA (ed.) nA-Z of Quantitative PCR." International University Line (La JoIIa, California, USA),, 2004) and the Q values from the samples without human brain RNA was used to construct standard curves.
The Ct of the sample with human brain RNA was compared to the standard curve to determine the number of miRs in the sample (Bustin, SA (ed.) "A-Z of Quantitative PCR." International University Line (La JoIIa, California, USA), 2004).
Results:
Table 8:
Figure imgf000040_0001
EXAMPLE 6: DESIGN OF PREMIR QPCR ASSAYS
This example shows that the Λsa-miR-lOa assay does not detect the corresponding premiR, Λsa-premiR-lOa. Similarly, it is possible to use the primer design to make an assay that detects Λsa-premiR-lOa but not Λsa-miR-lOa.
Mixed on ice:
RT mix:
1 μl 1Ox PAP buffer (New England Biolabs)
1 μl 1 mM ATP
1 μl 10 μM RT-primer (L2TA: 5'-ggtactagtttttttttttttttvn (SEQ ID NO 5), v designates cytosine, guanine and adenine residues, n designates cytosine, guanine, adenine and thymine residues)).
1 μl mix of 1 mM dATP, 1 mM dCTP, 1 mM dGTP, 1 mM dTTP
0,5 μl 2 units/μl Transcriptor (Roche cat# 03 531 295 001).
0,5 μl (5U/μl) PoIy(A) polymerase (New England Biolabs)
3 μl water
The following samples were prepared and incubated at 42 °C, 1 hour followed by 95 3C, 5 minutes:
Figure imgf000041_0001
For qPCR 1 μl of the polyA tailing/RT reaction was used for each PCR reaction with the specific primers in Table 9. Table 9:
Figure imgf000042_0001
Real-time PCR was done on a ABI 7500 theπmocyder by monitoring SYBR® green fluorescence as a function of PCR cycle number. The PCR reaction mixture contained:
• 10 μl 2x PCR mastermix (Roche cat#04 673 484 001)
• 1 μl or less of the RT reaction
• 1 μl TE with 2.5 μM miR-specific forward primer and 2.5 μM miR-specific reverse primer
• water to 20 μl.
The mixture was incubated at 95°C for 10 min followed 40 cycles of 95°C for 5 sec; 600C for 60 sec with measurement of the fluorescence.
For each miR, the result of the real-time PCR experiment was analysed according to standard methods (Bustin, SA (ed.)"A-Z of Quantitative PCR." International University Line, 2004).
Table 10:
Figure imgf000042_0002
The result shows that both the Λsa-miR-lOa and the ftsa-premiR-lOa assays detect the correct target and that there is no cross reaction to premiR-lOa or miR -10a, respectively. EXAMPLE 7: DETECTION OF PRE-MIR BY QPCR
In this example Λsa-miR-lOa and the corresponding pre-miR, Λsa-pre-miR-lOa were detected in total human RNA.
Mixed on ice:
RT mix:
1 μl 1Ox PAP buffer (New England Biolabs Inc., Ipswich, MA, US)
1 μl 1 mM ATP
1 μl 10 μM RT-primer (L2TA: 5'-ggtactagtttttttttttttttvn (SEQ ID NO 5), v designates cytosine, guanine and adenine residues, n designates cytosine, guanine, adenine and thymine residues)).
1 μl mix of 1 mM dATP, 1 mM dCTP, 1 mM dGTP, 1 mM dTTP
0,5 μl 2 units/μl Transcriptor (Roche cat# 03 531 295 001).
0,5 μl (5U/μl) PoIy(A) polymerase (New England Biolabs)
3 μl water
The following samples were prepared and incubated at 42 °C, 1 hour followed by 95 DC, 5 minutes:
Figure imgf000043_0001
aMixture of 1 μl of 1 μg/μl heart RNA, 1 μl of 1 μg/μl brain RNA, 1 μl of 1 μg/μl liver RNA, 1 μl of 1 μg/μl lung RNA, 1 μl of 1 μg/μl kidney RNA, 1 μl of 1 μg/μl lymph RNA, 1 μl of 1 μg/μl jejunum RNA, 1 μl of 1 μg/μl colon RNA, 1 μl of 1 μg/μl breast RNA and 1 μl of 1 μg/μl leukemia RNA in TE.
TE buffer: 1OmM Tris/HCI (pH 8.0), ImM EDTA. For qPCR 1 μl of the polγA tailing/RT reaction was used for each PCR reaction with the specific primers in Table 11.
Table 11:
Figure imgf000044_0001
Real-time PCR was done on a ABI 7500 thermocycler by monitoring SYBR® green fluorescence as a function of PCR cycle number. The PCR reaction mixture contained:
10 μl 2x PCR mastermix (Roche cat#04 673 484 001)
1 μl or less of the RT reaction
1 μl TE with 2.5 μM miR-specific forward primer and 2.5 μM miR-specific reverse primer water to 20 μl.
The mixture was incubated at 95°C for 10 min followed 40 cycles of 95°C for 5 sec; 600C for 60 sec with measurement of the fluorescence.
For each miR, the result of the real-time PCR experiment was analysed according to standard methods (Bustin, SA (ed.)uA-Z of Quantitative PCR." International University Line, 2004). The result is shown in tab 12.
Table 12:
Figure imgf000044_0002
The result shows that the total RNA sample contains more than 106 copies of Λsa-miR-lOa because the Cτ is below the Cτ of the sample with 106 copies of Λsa-miR-10a whereas the total RNA sample contains less than 106 copies of Λsa-premiR-lOa because the Cτ is below the CT of the sample with 106 copies of Λsa-premiR-lOa.
EXAMPLE 8: SPECIFIC DETECTION OF PRE-MIRNAS
Aim of the experiment: To determine if the universal reverse transcriptase quantitative PCR methodology (UniRT qPCR) described in this application could be used to detect pre-miR specifically without co-detection of the corresponding mature miR.
Materials: Synthetic miR 203 RNA (5'- gugaaauguuuaggaccacuag} (SEQ ID NO 103) and pre- miR 203 RNA (5'- agugguucuuaacaguucaacaguucugu-agcgcaauugugaaauguuuaggaccacuag) (SEQ ID NO 104) were selected as test subjects. The synthetic RNAs were synthesized by Integrated DNA technologies Inc., Coralville, IA, US. The RNAs were diluted to l*106 molecules/μL in TEMS2 (TE buffer (10 mM Tris HCI pH 8, and 0.1 mM EDTA mixed with 10 ng/μL MS2 viral RNA (Roche Applied Science Inc). Primers used were miR-203.Rev (5-
Figure imgf000045_0001
(SEQ ID NO 105), miR-203.Fwd (5'- gtGaaatGtttaggacca) (SEQ ID NO 106) and pre-miR- 203. Fwd (S'-cagttcaacagttctgtagc) (SEQ ID NO 107). The pre- miR-203 Fwd primer was designed in the loop structure of the pre-miR-203 molecule. Mature miR-203 template and pre-miR-203 were subject to reverse transcription using Universal cDNA synthesis kit (Exiqon AS, Cat.no #203300).
Mix:
• Synthetic RNA I311IO6 molecules • 5 x UniRT reaction buffer 2 μL
• 1Ox Enzyme mixture 1 μL
• Water up to 10 μL
Incubate at 42°C for 60 minutes and heat denature at 85°C for 5 minutes. Dilute 10 x in water.
qPCR with SYBR Green Master Mix, UniRT (Exiqon AS, Cat.No. 203400)
Mix:
Primer mix (3uM each) l μL
SYBR green master mix 5 μL cDNA template l μL
Water 3 μL Two primer mixes were used: 1) miR-203 ((miR-203.Fwd and miR-203.Rev primer) and 2) pre-miR-203 (pre-miR- 203. Fwd and miR-203. Rev primer). Templates used were mir-203 and pre-mir-203. Non template control (NTC) qPCR was also run for each PCR assay. All qPCR were done in duplicates.
q-RT-PCR reactions were performed in a 384 well plate in a LightCycler 480 (Roche Diagnostics) instrument using the following PCR protocol
1. 95°C for 10 minutes 2. 95°C for 10 seconds 3. 600C for 1 minute
Signal detection with SYBR green (HRM dye) setup. Steps 2-3 repeated for 45 times followed by melting curve analysis.
Results and discussion
Standard miR-203 primers detect the miR-203 template well with a Cp value of 28,86. Also the miR-203 assay, partially detects the pre-miR-203(Cp of 30,125) since the miR is located on the 3' end of the pre-mir-203. Pre-miR-203 assay design detects the pre-miR with the Cp values of 25,7 however the mature miR-203 is not detected with the pre-miR-203 specific assay (Cp=40). This data clearly shows that pre-mir specific assays can be designed to specifically target the pre-miR molecules.
Figure imgf000046_0001
EXAMPLE 9: MICRO-RNAS DIFFERENTIALLYLY EXPRESSED IN HEART AND LIVER TISSUES
Aim of the experiment is to determine if well expressed mi RNAs that are differently expressed between heart and liver tissue can be discriminated using a qPCR array based on the SYBR green universal reverse transcriptase quantitative PCR (UniRT qPCR) method of the present invention.
Materials and methods
Total RNA from liver and whole-heart was obtained from Ambion Inc., and diluted in nuclease free water to a concentration of 10 ng/μL and stored at -8O0C. We selected a few miRNA that are known to be differentially expressed in heart and liver tissue samples from the literature (see for example: Liang, Y., et al. (2007) BMC Genomics. 8: ppl66 and Landgraf P., et al.(2007) Nature Biotechnol. (9): pp 996-7). The miR selected were hsa-miR-1, hsa-miR-126 and hsa-miR-133b (heart) and hsa-miR-192, hsa-miR-122*, hsa-miR-194 and hsa-miR-122 (liver).
Figure imgf000047_0001
RT reactions were performed in triplicate for each tissue and non enzyme control (NEC)) with Universal cDNA synthesis kit (Exiqon AS, Cat.no #203300)
total RNA 20 ng
5 x UniRT reaction buffer 4 μL
Enzyme mixture 2 μL
Water up to 20 μL Incubate at 42°C for 60 minutes and heat denature at 85°C for 5 minutes. Dilute the cDNA 1/100 in nuclease free water.
Quantitative polymerase chain reaction (q-PCR), step 2 of the protocol, was performed as follows:
5 μL diluted cDNA was mixed with 5 μL SYBR Green Master Mix, UniRT (Exiqon AS, Cat.No. 203400) into the 384 well plate with desiccated primer sets of the seven miR assays described below. The plate was sealed and directly put on to the LightCycler for amplification and anallysis.
q-RT-PCR reactions were performed in a LightCycler 480 (Roche Diagnostics) using the following PCR protocol:
1. 95°C for 10 minutes
2. 95°C for 10 seconds
3. 60°C for 1 minute
Signal detection with SYBR green (HRM dye) setup. Steps 2-3 repeated for 45 times followed by melting curve analysis.
Standard data analysis was performed on the LC480 raw data using the supplied data analysis software (Roche Diagnostics). Cp values were collected as Abs Quant/second derivatives max.
For this experiment of looking at examples of well expressed mi RNA genes from both liver and heart, we used mean of raw data Cp values without normalization or calibration. This is done since normalization between tissues is not very accurate way of estimating miRs from different sources. Then we compare the difference between the two tissues in terms of Δ Cp values. Note that a difference of 1 in Cp value represents approximately a two fold difference in expression.
Results and discussion
We selected total of 7 miRNAs that are known previously from the literature, to be differentially expressed between heart and liver tissue. The results are shown in table 15 and fig. 7. The data obtained showed that the three genes miR-1, miR-133b and 126 are all showing much higher expression in heart samples than liver samples. Similarly the miR-192, miR-194 and miR-122 and 122* are showing much higher expression in liver than heart. The difference is ranging from 2.6 to 12.9 Cp which corresponds to a range of from 5 fold to over 1000 fold difference in expression. In general the differentially expressed miRs described from the literature are easily distinguished by the UniRT expression platform using the assays described here.
Table 15: Ex ression values for the 7 miR selected and tested on the UniRT platform.
Figure imgf000049_0001
Positive ΔCp values represent excess expression in heart and negative Cps represents excess expression in liver.
EXAMPLE 10: COMPARISON OF miR SPECIFIC ASSAYS DESIGNED IN PRESENT INVENTION TO COMPETING METHOD USING PURE DNA PRIMERS
The LNA based design described in the present invention was compared to a commercial DNA based product, the miScript Reverse Transcription Kit (Qiagen, Cat. no. 218060, QIAGEN GmbH, Hilden, Germany). This DNA based product also relies on a miRNA J- polyadenylation step followed by reverse transcription with a DNA based poly dT primer where both reactions occur in a one-tube reaction. Because both these methods use the same enzymatic steps a comparison very well illustrate the surprising advantages of the present LNA based method since the miScript does not include LNA in the primers. Another difference is that the miScript uses a reverse primer specific to the universal tag added with the RT primer whereas the LNA based reverse primer of the present method is specific to the miRNA being detected.
Table 16: Nucleotide sequences of compared miRNAs
Figure imgf000049_0002
Figure imgf000050_0001
FIRST STEP
Reverse transcription was performed on a dilution series of synthetic miRNA target (obtained from Integrated DNA technologies Inc., Coralville, IA, US.), with a background of 10 ng/μl MS2 bacteriophage RNA (Roche Applied Science, Catalog Number 10165948001), using either Universal cDNA Synthesis Kit (Exiqon A/S, Vedbaek, Denmark., Prod. No. 203300) or miScript Reverse Transcription Kit (Qiagen, Cat. no. 218060, QIAGEN GmbH, Hilden, Germany) according to the manufacturer's instructions.
SECOND STEP
On the cDNA obtained using the Universal cDNA Synthesis Kit (Exiqon, Prod. No. 203300), qPCR was performed using SYBR Green master mix, Universal RT (Exiqon, Prod. No. 203400) and the primer sets described in Table 17. On the cDNA obtained using miScript Reverse Transcription Kit (Qiagen, Cat. no. 218060), qPCR was performed using miScript SYBR Green PCR Kit (Qiagen, Cat. no. 218073). In both cases the amplification and detection was performed on a Roche LC480 LightCycler (Roche Diagnostics A/S, Hvidovre, Denmark), using the cycling conditions instructed by the manufacturer. Each cDNA/assaγ combination was run in triplicate.
RESULTS
Figure 8 shows the triplicate Cp values versus template concentration obtained in the experiment for each of the four tested miRNAs. In all four compared assays, the method of the present invention was more sensitive (black lines connecting diamonds) than the miScript assay (gray lines connecting sphaeres) as indicated by the lower Cp values consistently obtained with the assay of the present invention. In the case of ήsa-let-7a, there was a 10- fold improved sensitivity of the assay of the present invention, measured as the lowest copy- number detected quantitatively. For ftsa-miR-143 and Λsa-miR-155 the difference in sensitivity was 100-fold better with the assay of the present invention. For Λsa-miR-1 with a very low gc-content (see table 16) and thus low melting temperature, the alternative assay was unable to detect the template even at highest concentration of RNA. The assay designed in the present invention quantitatively detected an equivalent of as little as 10 miRNA copies in the PCR reaction. This data clearly shows that the assay of the present invention is surprisingly more sensitive. We ascribe the improvement in sensitivity partly to the design of the extension primer which comprise both a 5™tag-sequence" (R ) as well as a 3™anchor
sequence" (R ) and partly to the design of template-specific (e.g. miR-specific) forward and reverse primers of the qPCR reaction which includes LNA. Our results indicate that the gene specific design of the forward and reverse primers allow more sensitive detection than with pure DNA primers using a universal reverse primer.
TABLE 18: Nucleotide sequences
Lower case designates natural occuring nucleotides, upper case designates LNA, mC denotes LNA methyl cytosine. v is either an adenine residue, a guanine residue, or a cγtosine residue and n is either an adenine residue, a guanine residue, a cytosine residue or a thymine residue.
Figure imgf000052_0001
Figure imgf000054_0001
Figure imgf000055_0001
Figure imgf000056_0001
Figure imgf000057_0001

Claims

1. A method for amplification of a specific RNA molecule in a sample, the method comprising the steps of:
a) adding poly-A tails to a population of RNA molecules in a sample;
b) producing cDNA molecules of the polγ-A-tailed RNA molecules using an primer in a reverse transcription reaction; and
c) amplifying the cDNA molecules by PCR using a forward primer and a reverse primer both of which are specific for said specific RNA molecule.
2. The method of claim 1, wherein the specific RNA molecule is a small, non-coding RNA.
3. The method of claims 1 or 2, wherein the specific small RNA molecule is a microRNA.
4. The method according to of any of claims 1, 2 or 3, wherein the extension primer has a length in the range from 10 to 100 nucleotides.
5. The method according claim 4, wherein the extension primer has a length in the range from 15 to 45 nucleotides.
6. The method according to any one of claims 1-5, wherein said extension primer is a nucleotide sequence according to formula III:
R1-(T)y -R2 (III)
wherein R is a 5'-end nucleotide sequence, (T)y is a central part of y consecutive thymine
2 residues, wherein y is an integer of from 1 to 100, and R is a 7-end nucleotide sequence.
7. The method according to claim 6, wherein R is a nucleotide sequence with a length of from 1 to 30 nucleotides.
8. The method according to claim 7, wherein R is a nucleotide sequence with a length of from 6 to 10 nucleotides.
9. The method according to claim 8, wherein R is a nucleotide sequence with a length of 8 nucleotides.
10. The method according to any of claims 6 to 9, wherein y is an integer from 5 to 50.
11. The method according to claim 10, wherein y is an integer from 5 to 21.
12. The method according to claim 11, wherein y is 12, 13, 14, 15, 16, 17 or 18.
13. The method according to claim 12, wherein γ is 15.
14 A method according to any one of claims 6-13, wherein R is a sequence motif VN, consisting of two J-end terminal nucleotide residues, wherein V is either an adenine residue, a guanine residue, or a cytosine residue and N is either an adenine residue, a guanine residue, a cytosine residue or a thymine residue.
15. The method according to any one of claims 6-13, wherein R is a sequence motif VNN, consisting of the three 7-end terminal nucleotides, wherein V is either an adenine residue, a guanine residue, or a cytosine residue and N is either an adenine residue, a guanine residue, a cytosine residue or a thymine residue.
16. The method according to any one of claims 1-15, wherein the extension primer comprises at least one LNA.
17. The method according to any one of claims 1-16, wherein the forward primer has a length in the range of from 10 to 100 nucleotides.
18. The method according to any one of claims 1-17, wherein the forward primer comprises at least one LNA.
19. The method according to any one of claims 1-18, wherein the forward primer is designed to specifically hybridize to the complement DNA molecule of a target RNA molecule.
20. The method according to any one of claims 1-19, wherein the reverse primer is a nucleotide sequence according to formula II:
Figure imgf000060_0001
3 wherein R is a 5'-end nucleotide sequence, (T)x is a central part of x consecutive thymine
4 residues, wherein x is an integer of from 1 to 100, and R is a 7-end nucleotide sequence that specifically hybridizes to a nucleotide sequence of a target RNA molecule.
21. The method according to claim 20, wherein R is a nucleotide sequence with a length of from 1 to 30 nucleotides.
22. The method according to any of claims 20 or 21, wherein x is 5 to 50.
23. The method according to claim 22, wherein x is 5 to 21.
24. The method according to claim 23, wherein x is 15.
25. The method according to any of the preceding claims wherein x of formula (II) equals γ of formula (III).
4
26. The method according to any one of claims 20-25, wherein R has a length in the range of from 1 to 10 nucleotides.
4
27. The method according to any one of claims 20-26, wherein R comprises at least one
LNA.
4
28. The method according to claim 27, wherein R contains only one LNA.
4 29. The method according to any one of claims 20-28, wherein R is designed to specifically hybridize to the J-end of a target RNA.
30. The method according to any one of claims 27-29, wherein the LNA is situated in the 5' position or the position adjacent to the S position of the R4 part of the reverse primer.
31. A method for measuring the amount of a target microRNA in a sample from a living organism, the method comprising the steps of:
a) amplifying the target microRNA according to the method of any one of claims 1 to 30. b) measuring the amount of the amplified DNA molecules.
32. The method according to claim 31, wherein the amount of the amplified DNA molecules is measured using a fluorescence-based quantitative real-time PCR method.
33. The method according to any of claims 31 or 32, wherein the amount of the amplified DNA molecules is measured using SYBR ® green dye.
34. A kit for detecting at least one target RNA comprising at least one primer set specific for the detection of a the target RNA, the primer set comprising:
1 2 a) an extension primer of formula III: R -(T)y -R (III}
wherein R is a 5'-end nucleotide sequence, (T)v is a central part of γ consecutive thymine
residues, wherein γ is an integer of from 1 to 100, and R is a J-end nucleotide sequence.
3 4 b) a reverse primer of formula II: R -(T)x -R (II)
wherein R is a 5'-end nucleotide sequence, (T)x is a central part of x consecutive thymine
4 residues, wherein x is an integer of from 1 to 100, and R is a 7-end nucleotide sequence that specifically hybridizes to a nucleotide sequence of a target RNA molecule.
c) a forward primer
35. The kit according to claim 34 for detecting at least one mammalian target microRNA comprising at least one primer set specific for the detection of a target microRNA.
36. The kit according to claim 34 or 35, wherein the forward primer has a length in the range from 10 to 100 nucleotides.
37. The kit according to any one of claim 34 to 36, wherein the forward primer comprises at least one LNA.
38. The kit according to any one of claim 34 to 37, wherein the reverse primer comprises at least one LNA.
39. The kit according to any one of claims 34 to 38, wherein the forward primer is designed to specifically hybridize to the complement DNA molecule of a target microRNA molecule.
40. The kit according to any of claims 34 to 39, wherein the reverse primer is a reverse primer according to any of claims 27 to 30.
41. The kit according any of claims 34 to 40, wherein the at least one mammalian target microRNA is a human microRNA.
42. The kit according to any one of claims 34 to 41, wherein the at least one mammalian target microRNA is selected from the group consisting of all known human microRNAs available from the miRBase (http://mictOrna.sanger.ac.uk/).
43. The kit according to any one of claims 34 to 41, wherein the at least one mammalian target microRNA is a murine microRNA.
44. A high-throughput method for detecting or measuring the amount of specific target microRNAs in a sample from a living organism, according to any one of claims 1 to 33, the method further comprising a distribution step in which the combined poly-A-tailing and reverse transcription reaction is aliquoted into individual wells of a microtiter plate containing microRNA specific primer sets of forward and reverse primers, resulting in the steps of:
c) adding poly-A tails to a population of small RNA molecules in a sample and producing cDNA molecules of the poly-A-tailed small RNA molecules using an extension primer in a reverse transcription reaction; and
d) pipetting aliquots of the combined poly-A-tailing and reverse transcription reaction into individual wells of a microtiter plate e) amplifying specific target microRNAs in individual wells of a microtiter plate containing microRNA specific primer sets f) measuring the amount of specific microRNA molecules in individual wells, being performed in a fashion compatible with a high-throughput experimental set-up.
45. An oligonucleotide selected from the group of oligonucleotides disclosed in table 18.
PCT/DK2010/050029 2009-02-02 2010-02-02 Method for quantification of small rna species Ceased WO2010085966A2 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
EP10706492.5A EP2391736B1 (en) 2009-02-02 2010-02-02 Method for quantification of small rna species
US13/147,562 US9096895B2 (en) 2009-02-02 2010-02-02 Method for quantification of small RNA species
DK10706492.5T DK2391736T3 (en) 2009-02-02 2010-02-02 A method for the quantitation of small RNA species
SG2011055654A SG173506A1 (en) 2009-02-02 2010-02-02 Method for quantification of small rna species
HK12102679.0A HK1162196B (en) 2009-02-02 2010-02-02 Method for quantification of small rna species
CN201080006461.XA CN102301011B (en) 2009-02-02 2010-02-02 Method for quantification of small RNA species
JP2011546595A JP5749656B2 (en) 2009-02-02 2010-02-02 Method for quantification of small RNA species
CA2750029A CA2750029C (en) 2009-02-02 2010-02-02 Method for quantification of small rna species
AU2010207826A AU2010207826B2 (en) 2009-02-02 2010-02-02 Method for quantification of small RNA species
ES10706492.5T ES2541356T3 (en) 2009-02-02 2010-02-02 Quantification procedure for small RNA species
IL214301A IL214301A (en) 2009-02-02 2011-07-26 Method for amplification of microrna, a method for measuring the amount of a target microrna and a kit for detecting at least one target microrna

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DKPA200900156 2009-02-02
DKPA200900156 2009-02-02
DKPA200901038 2009-09-17
DKPA200901038 2009-09-17

Publications (2)

Publication Number Publication Date
WO2010085966A2 true WO2010085966A2 (en) 2010-08-05
WO2010085966A3 WO2010085966A3 (en) 2010-10-07

Family

ID=42232678

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK2010/050029 Ceased WO2010085966A2 (en) 2009-02-02 2010-02-02 Method for quantification of small rna species

Country Status (11)

Country Link
US (1) US9096895B2 (en)
EP (1) EP2391736B1 (en)
JP (1) JP5749656B2 (en)
CN (1) CN102301011B (en)
AU (1) AU2010207826B2 (en)
CA (1) CA2750029C (en)
DK (1) DK2391736T3 (en)
ES (1) ES2541356T3 (en)
IL (1) IL214301A (en)
SG (1) SG173506A1 (en)
WO (1) WO2010085966A2 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013011378A1 (en) 2011-07-15 2013-01-24 Leo Pharma A/S Diagnostic microrna profiling in cutaneous t-cell lymphoma (ctcl)
WO2014052487A1 (en) 2012-09-28 2014-04-03 Cepheid Two-primer pcr for microrna multiplex assay
CN106222244A (en) * 2015-06-02 2016-12-14 奎克生技光电股份有限公司 Nucleotide sequence, universal reverse primer, universal reverse transcription primer, primer design method and miRNA detection method
EP3181699A1 (en) 2015-12-17 2017-06-21 Oniris Micrornas as predictive biomarkers of type 1 diabetes
WO2024003311A1 (en) * 2022-06-30 2024-01-04 Quantoom Biosciences France Sas Method for adhering a poly(da/dt) tail to a dna backbone

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2653559A1 (en) 2012-04-20 2013-10-23 Samsung Electronics Co., Ltd Polynucleotide and use thereof
PL3260558T3 (en) 2012-11-02 2020-08-10 Life Technologies Corporation NEW COMPOSITIONS AND WAYS TO IMPROVE PCR SPECIFICATIONS
KR101984700B1 (en) 2012-11-19 2019-05-31 삼성전자주식회사 Polynucleotide and use thereof
KR101922125B1 (en) 2012-11-29 2018-11-26 삼성전자주식회사 A method for labeling a target nucleic acid
WO2014089797A1 (en) * 2012-12-13 2014-06-19 深圳华大基因科技服务有限公司 Locked nucleic acid-modified dna fragment for high-throughput sequencing
CN103555848B (en) * 2013-11-08 2015-02-11 复旦大学 3'-5'-qPCR (quantitative polymerase chain reaction) quantitative detection technology for small RNA (ribonucleic acid)
CN103740842B (en) * 2014-01-26 2015-12-09 广州市锐博生物科技有限公司 Highly sensitive tiny RNA quantitative detecting method and test kit
CA2977439C (en) 2015-02-27 2025-05-20 Aarhus Universitet A microrna-based method for assessing the prognosis of a prostate cancer patient
CN107429296B (en) 2015-03-13 2022-01-28 生命技术公司 Methods, compositions and kits for capturing, detecting and quantifying small RNAs
CN106226273B (en) * 2016-07-05 2018-09-25 无锡市第二人民医院 A kind of rapid detection method of microRNA
CN108315824A (en) * 2017-01-16 2018-07-24 刘月星 A kind of construction method of RNA high-throughput sequencing libraries
CN108315320A (en) * 2017-01-16 2018-07-24 李辉辉 A kind of preparation method of RNA high-throughput sequencing libraries
CN111621566B (en) * 2020-05-31 2022-04-01 浙江大学 Serum miRNA marker for diagnosing liver cancer and predicting liver cancer metastasis and detection kit thereof
US20240425905A1 (en) * 2021-08-25 2024-12-26 Advanced Precision Medicine Limited Method and kit for detecting microrna

Family Cites Families (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
JP2843675B2 (en) * 1992-03-11 1999-01-06 ダナ−ファーバー・キャンサー・インスチチュート・インコーポレーテッド Identification, isolation and cloning of messenger RNA
US5912340A (en) 1995-10-04 1999-06-15 Epoch Pharmaceuticals, Inc. Selective binding complementary oligonucleotides
JP3756313B2 (en) 1997-03-07 2006-03-15 武 今西 Novel bicyclonucleosides and oligonucleotide analogues
CA2303299C (en) 1997-09-12 2016-02-23 Exiqon A/S Oligonucleotide analogues
EP1072679A3 (en) 1999-07-20 2002-07-31 Agilent Technologies, Inc. (a Delaware corporation) Method of producing nucleic acid molecules with reduced secondary structure
WO2003020739A2 (en) 2001-09-04 2003-03-13 Exiqon A/S Novel lna compositions and uses thereof
DE50208869D1 (en) * 2002-01-23 2007-01-11 Heraeus Tenevo Gmbh METHOD AND DEVICE FOR PREPARING A CYLINDER-FRAME GLASS BODY
US7232547B2 (en) * 2002-03-22 2007-06-19 Marshfield Clinic Apparatus and method for testing and continuously reading low-volume samples
WO2005098029A2 (en) * 2004-04-07 2005-10-20 Exiqon A/S Methods for quantification of micrornas and small interfering rnas
US8071306B2 (en) * 2005-01-25 2011-12-06 Merck Sharp & Dohme Corp. Methods for quantitating small RNA molecules
JP2008528003A (en) 2005-01-25 2008-07-31 ロゼッタ インファーマティックス エルエルシー Method for quantifying small RNA molecules
ATE532878T1 (en) 2005-08-24 2011-11-15 Life Technologies Corp METHOD FOR QUANTIFYING SIRNAS, MIRNAS AND POLYMORPHOIC MIRNAS
DE102006038113A1 (en) * 2006-08-14 2008-02-21 Qiagen Gmbh A method of synthesizing a cDNA in a sample in an enzymatic reaction and simultaneously providing a first enzyme having polyadenylation activity and a second enzyme having reverse transcriptase activity
WO2008040355A2 (en) 2006-10-06 2008-04-10 Exiqon A/S Novel methods for quantification of micrornas and small interfering rnas

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013011378A1 (en) 2011-07-15 2013-01-24 Leo Pharma A/S Diagnostic microrna profiling in cutaneous t-cell lymphoma (ctcl)
WO2014052487A1 (en) 2012-09-28 2014-04-03 Cepheid Two-primer pcr for microrna multiplex assay
CN106222244A (en) * 2015-06-02 2016-12-14 奎克生技光电股份有限公司 Nucleotide sequence, universal reverse primer, universal reverse transcription primer, primer design method and miRNA detection method
CN110804656A (en) * 2015-06-02 2020-02-18 奎克生技光电股份有限公司 Nucleotide sequence, universal reverse primer, universal reverse transcription primer and miRNA detection method
CN110804656B (en) * 2015-06-02 2024-01-19 奎克生技光电股份有限公司 Nucleotide sequence, universal reverse primer, universal reverse transcription primer and miRNA detection method
EP3181699A1 (en) 2015-12-17 2017-06-21 Oniris Micrornas as predictive biomarkers of type 1 diabetes
WO2017102902A1 (en) 2015-12-17 2017-06-22 Ecole Nationale Veterinaire Micrornas as predictive biomarkers of type 1 diabetes
WO2024003311A1 (en) * 2022-06-30 2024-01-04 Quantoom Biosciences France Sas Method for adhering a poly(da/dt) tail to a dna backbone

Also Published As

Publication number Publication date
IL214301A (en) 2015-04-30
EP2391736B1 (en) 2015-04-08
CA2750029C (en) 2019-05-21
IL214301A0 (en) 2011-09-27
US9096895B2 (en) 2015-08-04
AU2010207826B2 (en) 2013-10-03
HK1162196A1 (en) 2012-08-24
AU2010207826A1 (en) 2011-08-04
EP2391736A2 (en) 2011-12-07
DK2391736T3 (en) 2015-05-11
CN102301011A (en) 2011-12-28
WO2010085966A3 (en) 2010-10-07
SG173506A1 (en) 2011-09-29
ES2541356T3 (en) 2015-07-17
JP2012516678A (en) 2012-07-26
CN102301011B (en) 2014-05-07
JP5749656B2 (en) 2015-07-15
CA2750029A1 (en) 2010-08-05
US20120071332A1 (en) 2012-03-22

Similar Documents

Publication Publication Date Title
EP2391736B1 (en) Method for quantification of small rna species
US8383344B2 (en) Methods for quantification of microRNAs and small interfering RNAs
EP1735459B1 (en) Methods for quantification of micrornas and small interfering rnas
US8314220B2 (en) Methods compositions, and kits for detection of microRNA
EP2419537B1 (en) Methods and compositions for detection of small rnas
CN101528763B (en) Methods and substances for isolation and detection of small polynucleotides
CN102102130A (en) Method for the detection of a RNA molecule, kit and use related thereof
EP2900836B1 (en) Two-primer pcr for microrna multiplex assay
JP2008543288A (en) Improved primer-based amplification method
WO2008040355A2 (en) Novel methods for quantification of micrornas and small interfering rnas
JP2021514651A (en) Preparation of single-stranded circular DNA template for single molecule sequencing
US12421542B2 (en) Advanced Dumbell PCR for isomiR detection
CN102676637B (en) A highly specific method for the determination of small RNA
Kumar et al. miR-ID: a novel, circularization-based platform for detection of microRNAs
CN103797132A (en) Use of G-Clamps for Improved Allele-Specific PCR
KR101874089B1 (en) A kit and method for detecting RNA molecules
HK1162196B (en) Method for quantification of small rna species
EP4655417A1 (en) Dumbbell pcr for methylated small non-coding rna detection
Andersen et al. 15 New Applications for Microarrays

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080006461.X

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10706492

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2010207826

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2750029

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2011546595

Country of ref document: JP

ENP Entry into the national phase

Ref document number: 2010207826

Country of ref document: AU

Date of ref document: 20100202

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2010706492

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 6201/CHENP/2011

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 13147562

Country of ref document: US