CN103555848B

CN103555848B - 3'-5'-qPCR (quantitative polymerase chain reaction) quantitative detection technology for small RNA (ribonucleic acid)

Info

Publication number: CN103555848B
Application number: CN201310553552.0A
Authority: CN
Inventors: 于文强; 肖敏; 赵丽萍
Original assignee: Fudan University
Current assignee: Fudan University
Priority date: 2013-11-08
Filing date: 2013-11-08
Publication date: 2015-02-11
Anticipated expiration: 2033-11-08
Also published as: CN103555848A

Abstract

The invention relates to a 3'-5'-qPCR (quantitative polymerase chain reaction) quantitative detection technology for small RNA (ribonucleic acid) and discloses a method for performing high-specificity, high-sensitivity and low-cost detection and quantification on small RNA from inside to outside, namely 3' to 5' PCR, based on a fluorescent quantitative PCR technology.

Description

3 '-5 of tiny RNA '-qPCR quantitative measurement technology

Technical field

The invention belongs to biological technical field; More specifically, the present invention relates to 3 '-5 of a kind of new tiny RNA '-qPCR quantitative measurement technology.

Background technology

Tiny RNA comprises the siRNA and endogenous microRNA, piRNA etc. that endogenous or external source imports, and they are coded protein and high conservative be extensively present in each species not.MicroRNA is extensively present in each species and has tissue specific expression, be about 21-25 Nucleotide, processed by Dicer, major function is Seed Sequences by 2-8 nucleotide position and the incomplete complementary pairing of target, in translation skill inhibition of gene expression, a multiple target gene of microRNA controllable, visible microRNA participates in the regulation and control of multiple signal path, plays a role in physiology and various pathological process.Now, the about 50% people microRNA encoding gene identified is found to be positioned at the karyomit(e) easy fracture region relevant to tumour, is all found microRNA unconventionality expression or undergos mutation in nearly all malignant tumour.

In July, 2006, the magazines such as Nature, Science almost report new non-coding tiny RNA---the piRNA of a class simultaneously.The about 24-30 of a piRNA Nucleotide is long, and it and Argonaute family member piwi protein binding form mixture.Different from microRNA, the formation of piRNA does not need the participation of RNA enzyme Dicer.They are present in the gamogenesis cell of the many animals from fruit bat to people.PiRNA is greatly relevant with the sequence of retrotransposon, and this illustrates that piRNA may participate in the silence of these displaceable elements, thus maintains the complete of germ cells gene group.

SiRNA is also a kind of microRNA, length and microRNA similar, also processed by Dicer, unlike siRNA mainly through matching to degrade mRNA thus suppress to translate with target mRNA complete complementary.People utilize the physiological function of siRNA, make it to become experimental tool powerful in laboratory, utilize the silence with the special target gene of the double-stranded RNA induced sequence of homology, and rapid blocking gene is active.The blocking effect of double-stranded RNA to genetic expression is called as RNA and intervenes (RNA interference, RNAi), double-stranded RNA can form a lot of small segment after enzyme is cut, be siRNA, these small segments are once combine with the homologous sequence complementation in messenger RNA(mRNA) (mRNA), mRNA can be caused to lose function, namely can not translate generation protein, namely make gene " silence ".Still continuing to bring out new tiny RNA now.

Because tiny RNA is different from the gene of other proteins encoded, so its detection and quantivative approach are difficult to the detecting pattern applying mechanically common gene.First, because tiny RNA is very short and do not have poly (A) to modify, so cannot go to select the primer of the suitable suitable Tm value of Position Design to carry out amplified reaction according to the design requirements of general primer; Secondly, some family members of tiny RNA such as microRNA are closely similar, often only have the difference of one or two base, so the detection of tiny RNA is also very high to specific requirement; In addition, tiny RNA length is too short, is not enough to mix enough SYBR Green and carries out fluorescent quantitation detection; The each side feature that comprehensive tiny RNA detects, its effective detection and quantivative approach roughly require below demand fulfillment: (1) high specific, can distinguish the tiny RNA of single base difference; (2) hypersensitivity, can carry out fluorescence quantitative PCR detection; (3) can be used for the expression level of quantitative analysis all kinds tiny RNA; (4) than being easier to operation, the reagent not needing some common laboratory to be difficult to possess and instrument; (5) low cost.

Up to the present, existing tiny RNA detection method can be sorted out roughly as follows, divides based on the tiny RNA means of catching, and the detection technique based on hybridization, the detection technique based on amplification and clone can be divided into detect.Hybridization mainly refers to Northern blots, in situ hybridization, gene chip, and amplification aspect mainly refers to real-time quantitative PCR and gold nanoparticle-initiated silver enhancement, and clone aspect is mainly similar to the method for miRAGE.In these methods, Northern blots and in situ hybridization belong to small throughput detection method, real-time quantitative PCR and miRAGE flux medium, chip technology is high throughput testing; And quantitative fluorescent PCR and chip technology belong to quantivative approach, Northern blots and in situ hybridization belong to sxemiquantitative or main only for method with presence or absence of detecting.In fact, these methods imperfections, respectively have intrinsic relative merits, some method sensitivity and specificity inadequate, some method high costs.

A large amount of tiny RNA detection techniques is constantly developed, the chip that such as various change is various, round pcr, lasso trick (padlock) and rolling circle replication methods, based on the analytical technology of ELISA, molecule detection, based on the miRAGE technology of SAGE, the Klenow enzyme (RAKE) based on RNA primer is analyzed.The discovery of first microRNA is exactly by Northern blots, and up to the present Northern blots remains the golden standard that tiny RNA detects.But Northern blots still has inferior position, such as Northern blots uses isotopic labeling to make detection very responsive, but whole experiment is very time-consuming.And Northern blots be unfavorable for carrying out sample in enormous quantities and multiple tiny RNA while detect.If do not use expensive lock nucleotide probe, Northern blots tests initial total serum IgE amount about needs 5-25 μ g.Up to the present, from using method statistics of publishing an article, the most widely used tiny RNA detects and quantivative approach is exactly mainly chip technology and Real-time quantitative PCR.In numerous tiny RNA detection methods, chip technology can be described as the method for obtaining tiny RNA express spectra of almost Perfect, because other method has a common defect cannot carry out high-throughput Whole genome analysis exactly.But chip technology also has its intrinsic defect, first chip technology is difficult to the amplification tiny RNA expression amount signal having no bias, and that is its sensitivity is not high; Secondly, chip is based on the research and development of company, and whole process needs the time, and the cost of custom chip is very high, so the method for chip can not be used for the discovery of new tiny RNA and its mutant and the detection of these tiny RNA and quantitatively.

So, though real-time quantitative PCR does not have chip so high-throughput, but be really general, the most practical detection in laboratory and quantivative approach.Manyly carry out increasing and qRT-PCR (the quantitative real-time PCR) method of quantitative tiny RNA is pushed out, using more is three kinds of methods simultaneously:

1.Invitrogen company Poly (A) tailing method: first add ploy (A) at microRNA 3 ' end, obtain first strand cDNA with adapter poly (T) primer as reverse transcriptase primer again, the general forward primer then using corresponding adapter to design and microRNA specific reverse primer carry out PCR reaction.This method cost is lower, uses SYBR Green dyestuff, but is only determined the specificity of whole detection method by the wall scroll microRNA special primer in PCR step, is not obviously suitable for the high tiny RNA of similarity and detects.

2.ABI company stem is around-France: adopt the microRNA special primer with loop-stem structure to carry out reverse transcription reaction and obtain first strand cDNA, simultaneously introduce adapter by loop-stem structure, then utilize the general forward primer of corresponding adapter, the specific reverse primer of microRNA carry out PCR in conjunction with taqman probe and react fluorescent quantitation and detect.This method comparatively Poly (A) tailing method detection specificity increases, but stem ring primer design method is complicated, and Taqman probe cost is quite high.

3.Exiqon company lock Nucleotide system: obtain first strand cDNA with the microRNA specific reverse transcriptase primer with adapter, then with the general forward primer of corresponding adapter and carry out PCR reaction with the microRNA specific reverse primer of lock nucleotide modification.Wherein lock the stability that nucleotide modification can increase the combination of special primer masterplate, improve primer Tm.This method improves to some extent in specificity, and the difficulty also not having loop-stem structure to design is large, but lock nucleotide modification cost is high, and the primer storehouse that detectable tiny RNA limit can provide in company, this is also the problem that two methods are common above.

Generally speaking, the basic ideas the first step of aforesaid method is all generally extend to make tiny RNA be extended to be applicable to carrying out fluorescent quantitation reaction, main extension method has the primer of primer or the band Oligo dT using neck ring structure, these methods or insufficient sensitivity, need to use taqman probe or lock nucleotide modification, and primer needs repeatedly to attempt and check just to find best primer and reaction conditions, expensive probe or to modify and time-consuming primer condition gropes to make these methods majority commercializations, and the finite rate of company's research and development, the tiny RNA detection kit being difficult to allow everybody buy in time and recently finding, more impossible by buy product remove the tiny RNA that rapid detection oneself finds.

Summary of the invention

The object of the present invention is to provide 3 '-5 of a kind of new tiny RNA '-qPCR quantitative measurement technology.

In a first aspect of the present invention, provide a kind of method of the specific tiny RNA detected in testing sample, described method comprises:

(1) from testing sample, extract total serum IgE (containing tiny RNA);

(2) with the total serum IgE of (1) for template, carry out reverse transcription reaction with the special reverse transcriptase primer of tiny RNA, obtain and comprise the reverse transcription product of cDNA; Wherein, 5 ' end band of the special reverse transcriptase primer of described tiny RNA has unrelated sequences, and 3 ' end holds complementation with 3 ' of tiny RNA; In described unrelated sequences and testing sample genome there is not complementation in any nucleotide sequence;

(3) with the reverse transcription product comprising cDNA of (2) for template, carry out 3 ' → 5 ' PCR reaction with tiny RNA specific forward primer (corresponding to 5 ' end of tiny RNA or the 3 ' end of cDNA) and specific reverse primer (3 ' end corresponding to tiny RNA), obtain PCR primer; 5 ' end band of described tiny RNA specific forward primer has unrelated sequences, and 3 ' of the cDNA that 3 ' end obtains with tiny RNA reverse transcription holds complementation; Described tiny RNA specific reverse primer its can be the special reverse transcriptase primer of tiny RNA, or for the primer of tiny RNA specific designs to be measured;

(4) analyzing the PCR primer of (3), there is situation and amount in what obtain tiny RNA.

In a preference, described tiny RNA specific reverse primer can be the special reverse transcriptase primer of tiny RNA.

In another preference, described unrelated sequences length 10-60bp; Preferably 15-50bp; More preferably 18-30bp; Preferably, the nucleotide sequence of 5 ' end unrelated sequences of the special reverse transcriptase primer of described tiny RNA is as shown in SEQ ID NO:1; The nucleotide sequence of the 5 ' unrelated sequences held of described tiny RNA specific forward primer is as shown in SEQ ID NO:2.

In another preference, the GC content of the unrelated sequences described in adjustment, makes the Tm value of the special reverse transcriptase primer of tiny RNA or tiny RNA specific forward primer remain on 60 ± 3 DEG C (preferably 60 ± 2 DEG C) left and right, makes primer be applicable to quantitative fluorescent PCR.

In another preference, 5-9,3 ' end (the preferably 6-8) base of the special reverse transcriptase primer of described tiny RNA and 3 ' of tiny RNA holds 5-9 (preferably 6-8) base complementrity.

In another preference, 3 ' of the cDNA that 3 ' end 5-18 base (preferably 6-16) of described tiny RNA specific forward primer and tiny RNA reverse transcription obtain holds 5-18 base (preferably 6-16) complementary.

In another preference, described testing sample can be any biologies that there is tiny RNA such as animal, plant, virus; From sample type, described testing sample can be whole blood, serum, blood plasma, saliva, urine, tissue juice stoste, cell culture medium etc.

In another preference, described tiny RNA comprises the tiny RNA of 10-50bp (or nt).

In another preference, described testing sample also can comprise the short DNA (the little DNA as 10-50bp or nt) of purification.

In another preference, described unrelated sequences plays the effect that signal amplifies.

In another preference, when there is the difference of more than two bases between multiple specific tiny RNA, detect multiple specific tiny RNA in a system simultaneously.

In another preference, the special reverse transcriptase primer of tiny RNA is identical with tiny RNA specific reverse primer sequence.

In another preference, the feature that can not correctly extend when utilizing 3 ' end to there is mispairing is to distinguish single base difference of tiny RNA.

In another preference, described 3 ' → 5 ' PCR reaction is 3 ' → 5 ' quantitative fluorescent PCR reaction; Preferably, SYBR fluorescence dye is adopted to carry out quantitative fluorescent PCR.

In another aspect of this invention, a kind of detection kit of the specific tiny RNA detected in testing sample is provided, comprises following component:

The special reverse transcriptase primer of (a) tiny RNA, its 5 ' end band has unrelated sequences, and 3 ' end holds complementation with 3 ' of tiny RNA;

(b) tiny RNA specific forward primer, its 5 ' end band has unrelated sequences, and 3 ' of the cDNA that 3 ' end obtains with tiny RNA reverse transcription holds complementation;

(c) tiny RNA specific reverse primer.

In another preference, also comprise in described test kit: reverse transcription reaction reagent or fluorescence quantitative PCR detection reagent.

Other side of the present invention, due to disclosure herein, is apparent to those skilled in the art.

Accompanying drawing explanation

Fig. 1, principle of the invention schematic diagram.

Fig. 2, Microarray detect the expression of results figure of microRNA in the different cell of three kinds of metastatic potentials.

The microarray result figure of Fig. 3, qPCR proof diagram 2.

Fig. 4, compare the expression of results figure of rat fetus cerebral tissue and renal tissue let-7 family.

Fig. 5, by detect only have the microRNA mimics of the synthesis of single base difference to carry out the specificity of verification method.

Embodiment

The present inventor is through deep research, based on fluorescent quantitative PCR technique, provide one to carry out being from inside to outside that 3 ' → 5 ' PCR carries out the detection of high specific, highly sensitive and low cost and quantitative method to tiny RNA, and the test kit researched and developed on this basis.The present invention can be used for expression analysis and the clinical detection of various tiny RNA in multiple sample type.

Principle schematic is shown in Figure of description---Fig. 1.Tiny RNA detection method involved in the present invention, comprising: extract total serum IgE (containing tiny RNA), synthesize cDNA with the special reverse transcriptase primer of tiny RNA with unrelated sequences under the katalysis of reversed transcriptive enzyme; Then, to carry out from inside to outside with the tiny RNA specific forward primer of unrelated sequences and specific reverse primer, from 3 ' → 5 ' quantitative fluorescent PCR reaction, thus detect the expression amount of tiny RNA.Of the present invention 3 '-5 '-qPCR quantitative measurement technology, the reaction of every One_step PCR, primer is all cost in the centre of template, and from 3 ' to 5 ' increases, and what so just make to react very is special.

Apply method of the present invention, detect and quantitative result specificity and accuracy high, this is because every One_step PCR reacts, and primer all will carry out specific recognition.Meanwhile, unrelated sequences is not only to balance GC, and is the fluorescence intensity in order to increase when quantitative fluorescent PCR, thus use low cost, simple SYBR Green just can realize.

As optimal way of the present invention, described detection method is achieved through the following technical solutions:

1. the extraction of total serum IgE

The method that this area can be adopted to commonly use and test kit are to carry out the extraction of total serum IgE.Preferably, described Total RNAs extraction comprises: A, sample preparation; B, RNA are separated; C, RNA precipitate; D, RNA wash; E, RNA dissolve; F, RNA concentration determination; G, RNA electrophoresis detection.

The reverse transcription of 2.RNA

Reverse transcription is carried out with the special reverse transcriptase primer of the tiny RNA comprising unrelated sequences, as need be detected multiple tiny RNA simultaneously, can add several species specific reverse transcriptase primer, thus amplification is from the first chain cDNA of corresponding tiny RNA, this step can make tiny RNA extend sequence simultaneously.The sequence length extended depending on the length of unrelated sequences, as optimal way of the present invention, described unrelated sequences length 10-60bp; Preferably 15-50bp; More preferably 18-30bp.Described unrelated sequences plays the effect that signal amplifies.As more preferably mode of the present invention, also by the GC content of the unrelated sequences described in adjustment, make the Tm value of the special reverse transcriptase primer of tiny RNA or tiny RNA specific forward primer remain on 60 ± 3 DEG C (preferably 60 ± 2 DEG C) left and right, make primer be applicable to quantitative fluorescent PCR.

3. fluorescence quantitative PCR detection

Carry out real-time fluorescence quantitative PCR with the specific forward primer and reverse primer that include the tiny RNA of unrelated sequences, detect the content of various tiny RNA in sample.This step can make tiny RNA extend further, thus is conducive to implementing tiny RNA fluorescence quantitative PCR detection.This quantivative approach can the expression amount level of identical tiny RNA in more different sample; As needed more different tiny RNA at the expression level of same sample, then can obtain the amplification efficiency of different tiny RNA primer by production standard curve by experiment, thus the expression amount carrying out different tiny RNA compares.

Reverse transcription step and PCR stage carry out twice application unrelated sequences to extend the length of microRNA amplified production, are conducive to PCR qualification and the fluorescent quantitation detection of carrying out tiny RNA.Two stages can apply identical unrelated sequences or different unrelated sequences; Preferably apply different unrelated sequences.Namely improved the specificity of detection at reverse transcription step by special reverse transcriptase primer.By specific forward primer and specific reverse primer, each step in PCR step improves the specificity detected.

Outside in (3 ' → 5 ') mode of extending that what described PCR adopted is is higher from inner extension mode specificity outwards than tradition.

As optimal way of the present invention, quantitative fluorescent PCR adopts SYBR fluorescence dye, mixes DNA double chain emitting fluorescence signal specifically, can not need to use expensive TaqMan fluorescent probe or lock nucleic acid technique, greatly reduces experimental cost.

Based on novel method of the present invention, the invention still further relates to a kind of detection kit of the specific tiny RNA detected in testing sample, comprise following component: the special reverse transcriptase primer of (a) tiny RNA, its 5 ' end band has unrelated sequences, and 3 ' end holds complementation with 3 ' of tiny RNA; (b) tiny RNA specific forward primer, its 5 ' end band has unrelated sequences, and 3 ' of the cDNA that 3 ' end obtains with tiny RNA reverse transcription holds complementation; (c) tiny RNA specific reverse primer, it can be the special reverse transcriptase primer of tiny RNA, or for the primer of tiny RNA specific designs to be measured.Preferably, also comprise in described test kit: also comprise in described test kit: reverse transcription reaction reagent or fluorescence quantitative PCR detection reagent; More preferably also comprise the working instructions that application mentioned reagent carries out tiny RNA detection.

Described test kit is applied to and carries out tiny RNA detection and expression level analysis for fundamental research and/or clinical application.

Major advantage of the present invention is:

1. method of the present invention has high degree of specificity, from inside to outside PCR reaction is carried out by special reverse transcriptase primer, forward primer and reverse primer, two the even tiny RNA of the very high homology of a family can be distinguished, even can be as accurate as the tiny RNA distinguishing single base difference;

2. method of the present invention has the quantitative linearity scope of superelevation and the detection sensitivity of height, and the scope of detection can copy several ten thousand copies to from several;

3. sample consumption is few, and the total serum IgE of 10pg-5 μ g is all applicable to the carrying out of experiment, if the tiny RNA extracted, then the RNA needed measures then less;

4. use range is wide, and the RNA in the total serum IgE extracted in various biology, cell lysate, cells and supernatant can be used as the detection by quantitative of sample for tiny RNA;

5. platform is simple, price material benefit, and the reagent involved by whole testing process, consumptive material and instrument all belong to laboratory routine configuration, and the price such as reagent, primer is all not expensive.

Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, conveniently condition such as J. Pehanorm Brooker etc. is write usually, Molecular Cloning: A Laboratory guide, the third edition, Science Press, the condition described in 2002, or according to the condition that manufacturer advises.Unless otherwise indicated, otherwise per-cent and number calculate by weight.

The extraction of embodiment 1, RNA

1, RNA extracting

(1) mirVana is used ^tMmiRNA Isolation Kit extracting

Utilize this test kit can extracted total RNA (comprising complete tiny RNA), also the tiny RNA being less than 200nt can be extracted separately.The supporting protocol of total process reference reagent box.

(2) Trizol extracting RNA is used

Conventional RNA method for extracting extracts.

3, RNA detects

(1) nanodrop is first taken to detect RNA purity after exhausting RNA.A260/A280, A260/A230 ratio of DNA, RNA need be all best about 2.0, has recorded concentration simultaneously.

(2) glue qualification RNA quality is run.Use the special sample-loading buffer of RNA to run glue, the good RNA of extracting can see obvious two rrna bands.

(3) packing is frozen in-80 DEG C to need the RNA of Reusability to advise.

4, RNA is except DNA

For avoiding the impact of DNA, DNase I need be used to remove DNA.The present invention uses the test kit of Premega, and carries Protocol, and roughly process of testing is as follows:

(1) the RNA 1 – 8 μ l of water-soluble or TE

RQ1 RNase-Free DNase 10X Reaction Buffer 1μl

RQ1 RNase-Free DNase 1u/μg RNA

Nuclease-free water adds to 10 μ l

(2) 30min is placed at 37 DEG C after preparing;

(3) 1 μ l RQ1 DNase Stop Solution termination reaction is above added;

(4) 65 DEG C, 10min makes DNase inactivation.

For the tiny RNA that content in total serum IgE is less, this step 3,4 replaces to phenol chloroform, dilute with the water of the RNase free of about 10ul, comparatively concentrated RNA can be obtained, then in a rear step process of reverse-transcription, if use the reversed transcriptive enzyme of invitrogen, the reverse transcription of the RNA of maximum 5ug can be carried out.

Embodiment 2, reverse transcription

The volume of RNA and the various primer that oneself will add is calculated according to test kit (Invitrogen) supporting protocol.Generalized case is enumerated as follows:

(1) micro RNA Auele Specific Primer (GSP (special reverse transcription primer)) 0.2 μ l/ tiny RNA

Total serum IgE 10pg – 5 μ g (general about 200ng)

RNAase Free Water moisturizing to 13 μ l

(2) 65 DEG C are carried out 5min, are placed on 1min on ice immediately

(3)5X First-Strand Buffer 4μl

0.1M DTT 1μl

RNaseOUT 1μl

SuperScript ^TMIII RT 1μl

(4) adopt 55 DEG C and carry out reverse transcription 70 DEG C;

(5) 15min fermentoid;

(6) cDNA preferably dilutes 10 times and carries out follow-up PCR reaction more later.

For micro RNA Auele Specific Primer, invention has been particular design, if gene expression detection and specific tiny RNA when a reverse transcription is identical, can while adding microRNA reverse transcription primer, add conventional random and oligod (T) primer and carry out reverse transcription, such cDNA in Q-PCR step below, then can detect the expression of tiny RNA in sample, can detect the expression of other common genes simultaneously.

If need detection 2 kinds or more tiny RNA in a pipe reverse transcription product simultaneously, and the similarity of these tiny RNA is not high, then in this step reverse transcription, can add the Auele Specific Primer for multiple tiny RNA.

Embodiment 3, PCR react

PCR reaction is carried out with forward primer corresponding to tiny RNA, reverse primer.Wherein reverse primer can be identical with micro RNA Auele Specific Primer.If but that for distinguishing similar let-7 family, only have the tiny RNA of minority base difference, then reverse transcriptase primer is also different from the reverse primer of PCR.The tiny RNA distinguishing a small amount of base difference is reached by reverse transcriptase primers different separately, forward primer, reverse primer.

Mainly be operating as example with sybrgreen qPCR, regular-PCR class of operation is like qRNA.

(1) mix in PCR pipe below reagent.For multiple reaction, strong suggestion minimizing moves liquid error.

(2) centrifugally guarantee that all the components is at tube bottom.

(3) react on the real-time PCR of preheating, step is as follows:

PCR program:

(4) solubility curve analysis: reference instrument explanation.

(5) data are collected, analytical results.

Embodiment 4, application example 1---analyze microRNA in osteosarcoma cell and express

Osteosarcoma is the modal Primary Malignant Bone Tumor of teenager, and osteosarcoma easily Lung metastases occurs, in recent years to osteosarcoma with lung transfer treatment never had effective means, even in conjunction with chemotherapeutics to the elimination of Pulmonary metastasis focuses or control action kou not remarkable yet.Therefore the problem solving osteosarcoma with lung transfer is the key point of clinical treatment of osteosarcoma, significant to the raising of Patients with Osteosarcoma survival rate.

143B-GFP, MNNG-RFP and HOS TE85 are conventional humanized's osteosarcoma transplanted cells strains that three kinds of genetic background is identical, and the ATCC title of their correspondences is 143B (ATCC with numbering respectively cRL-8303 ^tM), MNNG/HOS Cl#5 [R-1059-D] (ATCC cRL-1547 ^tM) and HOS (ATCC cRL-1543 ^tM).

HOS TE85 is a kind of osteosarcoma cell that grade malignancy is lower, derives from human osteosarcoma, and being built by JS Rhim is generation; MNNG-RFP is the osteosarcoma cell that the grade malignancy of inducing HOS TE85 to obtain with N-methyl-N '-nitro-N nitrosoguanidine (0.01mcg/ml MNNG) is higher, and pack imported RFP (red fluorescent protein) by virus, this cell can stably express red fluorescent protein; 144B-GFP has imported ki-ras gene in HOS TE85 cell, is a kind of osteosarcoma cell that grade malignancy is very high, and virus packaging has imported GFP (green fluorescent protein), and this cell can stably express green fluorescent protein.

After the training of 143B-GFP, MNNG-RFP cell is supported by the present inventor respectively, respectively with Trizol cracking about 106 cell, and extract RNA, then giving Exiqon company adopts the miRCURYTMLNA Array (v.16.0) described as Fig. 2 to carry out microRNA chip detection, on the left of Fig. 2, little figure illustrates the whole result of differential expression microRNA between two kinds of cells, illustrate on the right side of Fig. 2 some by analysis after, believable, the microRNA drawn is at 143B-GFP, MNNG-RFP two kinds of cell expressing difference microRNA more than 2 times.

Then, select the microRNA of differential expression in chip and interested microRNA, carry out Real-time PCR checking.

Reverse transcription method and reagent are substantially the same, verify Microarray result with Q-PCR, see the expression of microRNA in the cell that three kinds of metastatic potentials are different.

(1) design of primers of hsa-miR-708-3p (miRBase:MIMAT0004927)

The sequence of hsa-miR-708-3p is: (SEQ ID NO:3).

Based on above-mentioned sequence, carry out design of primers.

As reverse transcription primer, first its reverse transcription efficiency should be considered, Gu when designing reverse transcription primer, the sequence of matching is held not need oversize with microRNA 3 ', general 6-8bp is best, for hsa-miR-708-3p sequence, 6 bases " UUCUAG " next, the content of U is slightly high, so the number of reverse transcription primer pairing, the present inventor have chosen 7, namely with hsa-miR-708-3p after 7 bit bases " CUUCUAG " complementary pairing, add for extending and the unrelated sequences of leveling " TGTCAGGCAACCGTATTCACC " (SEQ ID NO:1), design reverse transcriptase primer be " cTAGAAG" (SEQ ID NO:4).In view of hsa-miR-708-3p does not have the microRNA of its high similarity, in reverse primer, its reverse transcription primer can be continued to use as reverse primer.It is slightly long that forward primer designs the distinguished sequence corresponding with microRNA, adopt the part " CAACUAGACUGUGAG " (SEQ ID NO:5) of front 15 bases of microRNA, add for extending and the unrelated sequences of leveling " CGTCAGCTGTCCGAGTAGAGG " (SEQ ID NO:2), the sequence of forward primer is (SEQ ID NO:6).Thus carry out real-time PCR reaction.

To sum up, designed primer following (RP is forward primer, and RTP is reverse transcription primer):

Hsa-miR-708 3p RP: (SEQ ID NO:7) (wherein the corresponding hsa-miR-708-3p sequence 5 ' of dotted line underscore part holds 15 bases, and italicized item is for extending sequence);

Hsa-miR-708 3p RTP: cTAGAAG(SEQ ID NO:8) (wherein underscore part and hsa-miR-708-3p sequence 3 ' hold 7 base pairings, and italicized item is for extending sequence).

Reverse transcription primer is simultaneously as reverse primer.

(2) design of primers of hsa-miR-1275 (miRBase:MIMAT0005929)

The sequence of hsa-miR-708-3p is: (SEQ ID NO:9).

This microRNA only has 17 bases, but method of the present invention is not by the restriction of its length.Carry out design of primers, the similar hsa-miR-708-3p of method of design.Final primer is:

Hsa-mir-1275RP: (SEQ ID NO:10) (wherein the corresponding hsa-miR-708-3p sequence 5 ' of dotted line underscore part holds 10 bases, and italicized item is for extending sequence);

Hsa-mir-1275RTP: gACAGCC(SEQ ID NO:11) (wherein underscore part and hsa-miR-708-3p sequence 3 ' hold 7 base pairings, and italicized item is for extending sequence).

Reverse transcription primer is equally as reverse primer.

(3) other microRNA design of primers

According to similar primer design method, the present inventor has also carried out design of primers for other microRNA, and concrete list of primers, in table 1.

Table 1

In table, italicized item is for extending sequence (unrelated sequences), and the corresponding microRNA sequence 5 ' of dotted line underscore part is held, and solid line underscore part and sequence microRNA sequence 3 ' hold base pairing; RTP represents reverse transcriptase primer (reverse primer), and RP is forward primer.

Because hsa-let-7b, hsa-let-7g are two kinds of similar microRNA, therefore during reverse transcription, 143B-GFP, MNNG-RFP and HOS TE85 tri-samples, all carry out 2 pipe reverse transcriptions.Be about to the 16 kinds of microRNA needing to detect, be divided into 2 pipes to carry out reverse transcription, often pipe turns 8 kinds of microRNA.Concrete point-score, first hsa-let-7b, the microRNA that hsa-let-7g two kinds of similarities are high must separate reverse transcription, other 14 kinds of microRNA separate in order, front 7 kinds in a system: hsa-miR-708 3pRTP, hsa-mir-1275RTP, hsa-miR-320a RTP, hsa-miR-378RTP, hsa-miR-29a 5pRTP, hsa-miR-20a 5p RTP, hsa-miR-193a-3p RTP, carry out reverse transcription together with hsa-let-7b.Rear 7 kinds in another system: hsa-miR-101 3p RTP, hsa-miR-720RTP, hsa-miR-15a5p RTP, hsa-miR-3679-3p RTP, hsa-miR-3676RTP, hsa-miR-146b-5p RTP, hsa-mir-30c-2RTP, carry out reverse transcription together with hsa-let-7g.

Result such as the microRNA expression of results detected in 143B-GFP, MNNG-RFP in Fig. 3, Fig. 3 conforms to the Microarray result (Fig. 2) of cell.

Embodiment 5, application example 1---the MicroRNA comparing rat fetus cerebral tissue and renal tissue let-7 family expresses

In let-7 family, two microRNAs (miRNAs) that people find at first are that lin-4 and let-7, lin-4 are found at first in nematode, and control the time of stem cell division and differentiation.As the mankind miRNA that first is found, let-7 follows lin-4 closely and is found, and his family member is in sequence with functionally across species high conservative, the mistake regulation and control of let-7 can cause the generation of some PD cell states and the disease based on cell, such as cancer.There are 13 members in people let-7 family, and be positioned at 9 different chromosomal focis, many malignant tumours lose the expression regulation effect of let-7 family often, and therefore, let-7 family is regarded as cancer suppressor gene.Because of whole terminal differentiation and the apoptosis of energy regulating cell, the expression recovering let-7 family is significant in the treatment of cancer.

Let-7 family regulates propagation and the atomization of the various types of biology from nematode to people.Ripe body (being called as let7a to let7i) is had any different in a few locations with let7a sequence.The expression level of autoploid is different, and they are also different on allelotaxis and disease origin.Differentiate that these autoploids will contribute to illustrating the function of let7.

In the present embodiment, carry out the differentiation of let-7a, let-7c, let-7d, let-7e, let-7f and let-7i.They are comparatively close in sequence, and figure below is that the difference of let-7c, let-7d, let-7e, let-7f and let-7i and let-7a base identifies.

When needs carry out this single base difference differentiation, need to utilize only base difference as far as possible, use different reverse transcriptase primers, forward primer and reverse primer to react.

As figure below, for rno-let-7a, by reverse transcription primer design at underline position UGAGGUAGUAGGUUG (SEQ ID NO:56), can distinguish with rno-let-7d, rno-let-7c, forward primer is designed into uGAGGUAGUaGGUUGUAUAGUU (SEQ ID NO:56) position can be distinguished with rno-let-7e, and reverse primer is designed into UGAGGUAGUAG gUUGUAUAGUU(SEQ ID NO:56) position, can distinguish with rno-let-7f, rno-let-7i.

The design of rno-let-7c reverse transcription primer is at UGAGGUAGUAGGUUGU (SEQ ID NO:57) position can be distinguished with rno-let-7i, also can with rno-let-7a, rno-let-7d, rno-let-7e, rno-let-7f as differentiation; Forward primer design exists uGAGGUAGUAGGUUGUaUGGUU (SEQ ID NO:57) can with rno-let-7d as obvious differentiation, and reverse primer design is at UGAGGUAGUAGGUUGUAU gGUU(SEQ ID NO:57), can do obvious differentiation with rno-let-7a.Other several principle of design are similar.The unrelated sequences added, for extending and leveling GC content, consistent with above-mentioned sequence.

Distinguish the microRNA of this few base difference several, reverse transcription needs to be in charge of to carry out.

The present inventor extracts kidney and the cerebral tissue of rat fetus, uses trizol cracking, extracts total serum IgE, and then carries out reverse transcription.The reverse transcription of let-7 family is all in charge of and is carried out, thus distinguishes each member of this family.

Table 2

In table 2, secondary series indicates the design attitude of reverse primer with underscore, and the 3rd row arrange with the 4th the design attitude indicating forward primer and reverse primer respectively with underscore.Primer is designed as front method indicates site according to table 2.

In order to verify the specificity of system of the present invention, the present inventor has synthesized the RNA sequence of Rno-let-7c and Rno-let-7f miRNA respectively, and both only differ from 2 bases.Application Rno-let-7c primer carries out Realtime PCR detection respectively, found that amplification difference 150-15000 doubly, illustrates the specificity of Real-Time PCR system of the present invention under the template of different concns.Table 3 illustrates the result of carrying out primer amplification acquisition with two kinds of microRNA of the synthesis of different concns gradient.With 1pM let-7c for template, use let-7c primer amplification, real-time PCR CT value is 23.4; And be template with 1pM let-7f, use let-7c primer amplification, real-time PCR CT value is 30.7, differs 7.3 CT values, is equivalent to differ from 154.3 times.When being template with 10pM let-7c, use let-7c primer amplification, real-time PCR CT value is 19.4; And be template with 10pM let-7f, use let-7c primer amplification, real-time PCR CT value is 30.3, differs 10.9 CT values, is equivalent to differ from 1893.3 times.Situation is below similar.Fig. 5 is the histogram that this result is formed.

Table 3

The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.

Claims

1. detect a method for the specific tiny RNA in testing sample, it is characterized in that: described method comprises:

(1) from testing sample, total serum IgE is extracted;

(3) with the reverse transcription product comprising cDNA of (2) for template, with tiny RNA specific forward primer and specific reverse primer carry out 3 ' → 5 ' PCR reaction, obtain PCR primer; 5 ' end band of described tiny RNA specific forward primer has unrelated sequences, and 3 ' of the cDNA that 3 ' end obtains with tiny RNA reverse transcription holds complementation; 3 ' of the cDNA that 3 ' end 5-18 base of described tiny RNA specific forward primer and tiny RNA reverse transcription obtain holds 5-18 base complementrity; The feature that can not correctly extend when utilizing 3 ' end to there is mispairing is to distinguish single base difference of tiny RNA;

Further, tiny RNA specific reverse primer is identical with tiny RNA special reverse transcriptase primer sequence;

Further, described 3 ' → 5 ' PCR reaction is 3 ' → 5 ' quantitative fluorescent PCR reaction, adopts SYBR fluorescence dye to carry out quantitative fluorescent PCR;

2. the method for claim 1, is characterized in that, described unrelated sequences length 10-60bp.

3. method as claimed in claim 2, is characterized in that, described unrelated sequences length 15-50bp.

4. method as claimed in claim 3, is characterized in that, described unrelated sequences length 18-30bp.

5. method as claimed in claim 4, is characterized in that, the nucleotide sequence of 5 ' end unrelated sequences of the special reverse transcriptase primer of described tiny RNA is as shown in SEQ ID NO:1; The nucleotide sequence of the 5 ' unrelated sequences held of described tiny RNA specific forward primer is as shown in SEQ ID NO:2.

6. method as claimed in claim 1 or 2, is characterized in that, the GC content of the unrelated sequences described in adjustment, makes the Tm value of the special reverse transcriptase primer of tiny RNA or tiny RNA specific forward primer remain on about 60 ± 3 DEG C, make primer be applicable to quantitative fluorescent PCR.

7. the method for claim 1, is characterized in that, 3 ' end 5-9 base of the special reverse transcriptase primer of described tiny RNA and 3 ' of tiny RNA holds 5-9 base complementrity.

8. the method for claim 1, is characterized in that, when there is the difference of more than two bases between multiple specific tiny RNA, detects multiple specific tiny RNA in a system simultaneously.