WO2010085101A9 - Novel lipases induced by fasting - Google Patents

Novel lipases induced by fasting Download PDF

Info

Publication number
WO2010085101A9
WO2010085101A9 PCT/KR2010/000396 KR2010000396W WO2010085101A9 WO 2010085101 A9 WO2010085101 A9 WO 2010085101A9 KR 2010000396 W KR2010000396 W KR 2010000396W WO 2010085101 A9 WO2010085101 A9 WO 2010085101A9
Authority
WO
WIPO (PCT)
Prior art keywords
fasting
fil
ire
fat
hsp
Prior art date
Application number
PCT/KR2010/000396
Other languages
French (fr)
Korean (ko)
Other versions
WO2010085101A2 (en
WO2010085101A3 (en
Inventor
조현선
심지원
김재범
이준호
Original Assignee
서울대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교 산학협력단 filed Critical 서울대학교 산학협력단
Publication of WO2010085101A2 publication Critical patent/WO2010085101A2/en
Publication of WO2010085101A3 publication Critical patent/WO2010085101A3/en
Publication of WO2010085101A9 publication Critical patent/WO2010085101A9/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/18—Carboxylic ester hydrolases (3.1.1)
    • C12N9/20—Triglyceride splitting, e.g. by means of lipase
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L29/00—Foods or foodstuffs containing additives; Preparation or treatment thereof
    • A23L29/06—Enzymes
    • C—CHEMISTRY; METALLURGY
    • C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/16—Organic compounds
    • C11D3/38—Products with no well-defined composition, e.g. natural products
    • C11D3/386—Preparations containing enzymes, e.g. protease or amylase
    • C11D3/38627—Preparations containing enzymes, e.g. protease or amylase containing lipase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression

Definitions

  • the present invention relates to a novel lipase induced by fasting, a gene encoding the same, and a preparation vector containing the novel lipase.
  • ER is a specialized organelle that is involved in the processing and processing of proteins, as well as the production and storage of glycogen, fat, and other macromolecules.
  • Unfolded protein response (UPR) is a well known response in ER that results from various changes in cells. Accumulation of misfolded or unfolded proteins due to impaired cellular capacity or a stress environment that causes the proteins to fold properly causes an UPR reaction to minimize the burden of ER (Ron and Walter, 2007).
  • IRE1 also referred to as 'inositol-requiring transmembrane kinase and endonuclease 1'
  • PERK elastonuclease 1'
  • ATF6 elastonuclease 1'
  • IRE1 also referred to as 'inositol-requiring transmembrane kinase and endonuclease 1'
  • PERK transmembrane kinase and endonuclease 1'
  • ATF6 ATF6
  • These regulators bind BiP, one of the chaperones present on the ER membrane in the absence of ER stress, accelerate the activation process by dissociating BiP and preferentially bind to misfolded proteins under ER stress (Calfon et.
  • IRE1 one of the UPR modulators, IRE1
  • IRE1 has a wide range of degradation target mRNAs, including those encoding membrane and secretory proteins (Hollien and Weissman, 2006).
  • IRE1 is activated at high glucose concentrations to regulate its target genes and to participate in insulin biosynthesis without separating from BiP in pancreatic beta cells (Lipson et al., 2006).
  • ER is important for lipid metabolism continues to accumulate (Gregor and Hotamisligil, 2007; Ron and Walter, 2007). For example, high fat nutrient mice showed increased ER stress in liver and adipose tissue (Ozcan et al., 2004). This indicates that ER is a key organelle for mediating metabolic changes caused by such diets. In addition, cellular lipid droplets kinetically move through the cytoplasm and interact with ER (Miyanari et al., 2007). Most recently, XBP1, a key transcriptional regulator of IRE1-mediated UPR, has been reported to play an important role in hepatic lipogenesis (Lee et al., 2008). These results suggest that ER proteins are involved in lipid metabolism. However, how ER is involved in lipid homeostasis in response to nutritional changes is largely unknown.
  • Caenorhabditis elegans ( C. elegans ) has been known as an excellent genetic model for studying the energy homeostasis throughout the body, including lipid metabolism (McKay et al., 2003). Mammals have adipoocytes as fat stores, but C. elegans do not have proprietary tissues or cells. Instead, C. elegans stores fat in the form of fat droplets in intestinal cells. C. elegans has a transparent body, so droplets can be seen directly by dyeing with Sudan black or Nile red dyes (McKay et al., 2003; Van Gilst et al., 2005b). These dyes greatly facilitate the genetic analysis of lipid regulation by making fat droplets visible in live worms.
  • the inventors of the present invention using C. elegans as a model system, examined whether ER and related proteins regulate lipid metabolism according to nutritional changes. Because the major UPR pathway genes and fat metabolism genes are conserved in C. elegans (Harding et al., 1999; Liu et al., 2000; Sood et al., 2000; Van Gilst et al., 2005b) The evolution of ER's ability to regulate basic aspects of cell physiology, such as fat metabolism, is preserved. Accordingly, the present inventors have found that IRE-1 and HSP-4, which are homologous to nematode IRE1 and BiP, recognize the change in nutritional status and satisfy the energy requirements for motility in C. elegans . The present invention was completed by stimulating the expression of 1 and FIL-2.
  • the present invention aims to provide novel lipases induced by fasting.
  • the present invention aims to provide a gene sequence encoding a novel lipase induced by fasting.
  • An object of the present invention is to provide a recombinant vector containing the gene encoding the novel lipase.
  • novel lipases according to the invention are novel lipases having the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
  • the novel lipase gene according to the present invention is a gene sequence encoding the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, more specifically, a gene having a nucleic acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4.
  • the recombinant vector according to the present invention is a recombinant vector comprising a gene sequence encoding the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, more specifically a recombinant vector having a nucleic acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4.
  • the lipase according to the present invention is a novel lipase, and is associated with the decomposition of fat granulocytes, and thus may be usefully used for developing obesity treatments. It can also be used throughout the industry, including food, detergents, fine chemicals, cosmetics and environmental materials.
  • FIG. 1 shows that C. elegans ire-1 mediates fat granule degradation by short - term fasting.
  • A Short-term fasting leads to lipolysis. The left panel is Fed or 24 h Fasted worms, respectively. The right panel is a quantification of Nile red fluorescence. Scale bar represents 50 ⁇ m.
  • B Time-phased characterization of fasting-induced lipolytic degradation after knockdown of UPR genes. The top panel visualizes the intestinal fat content in Nile Red for 12 hours without food. Images were taken with the same exposure time. Scale bar represents 50 ⁇ m. The bottom shows the relative intensities of the Nile Red stains measured with OpenLab (Improvision Inc.) software. Asterisk indicates statistical significance (p ⁇ 0.01).
  • FIG. 3 shows that fil-1 and fil-2 encode fast-induced lipases whose expression is dependent on ire-1 and hsp-4 .
  • A Phylogenetic analysis of FIL-1 and FIL-2. FIL-1 and FIL-2 are most similar to each other. C05D11.7 is another potential ATGL homolog in C. elegans , but was not induced by fasting in the experiments of the present invention ( Table 2 ).
  • B Relative amounts of fil-1 and fil-2 mRNA after 6 hours of fasting in ire-1 and hsp-4 RNA i worms. Quantitative real time PCR was performed three times independently.
  • C Fasting-induced fil-1 and fil-2 expression is independent of xbp-1 .
  • fil-1 and fil-2 were upregulated by fasting even in the presence of xbp-1 (RNA i ) background.
  • D Expression patterns of FIL-1 and FIL-2 before and after fasting. FIL-1 and FIL-2 were induced by fasting only in the intestines. The inlet of the lower right panel shows the localization of FIL-2 in the droplets. Scale bar represents 25 ⁇ m.
  • A Confocal image of fat granules in fil-1 and / or fil-2 RNA i worms after 6 hours of fasting. The left panels are fed; The right panels are fasted.
  • B FIL-1 and FIL-2 expression under the control of the act-5 promoter is sufficient to induce lipogranuclease degradation in WT, hsp-4 (gk514) mutants , and ire-1 (RNA i ) animals. The left panel shows WT animals. The middle and right panels represent hsp-4 (gk514) and ire-1 ( RNA i) animals, respectively. The bottom panels of A and B are the quantification of the results. The numbers represent the percentage of Nile red fluorescence after fasting. Scale bar represents 25 ⁇ m.
  • FIG. 7 shows Nile red staining of ire-1 (v33) mutants before fasting and after 8 hours of fasting. Although nile red staining occurs in the intestinal lumen of ire-1 (v33) mutant animals before fasting, intestinal fat granules remain unchanged after fasting. Scale bar represents 50 ⁇ m.
  • FIG. 12 Is WT, ire-1 , And hsp-4 Show overall differences in mutant animals. WT animals are “transparent” due to the consumption of fat granules due to fasting, ire-1 And hsp-4 Mutations remain 'dark' due to the lack of droplet hydrolysis.
  • FIG. 13 shows recovery of bend rate by 5 mM glucose, 5 mM deoxy-glucose, and 5 mM sorbitol in ire-1 and hsp-4 mutant animals. WT animals were used as negative controls. Asterisks indicate statistical significance (p ⁇ 0.05).
  • a first embodiment of the invention is the lipase of SEQ ID NO: 1 or SEQ ID NO: 2.
  • Lipases lipases, glycerol ester hydrolases
  • lipase has been studied as an additive for detergents and bleaching agents because it has a function of hydrolyzing fatty components with fatty acids or glycerol, which are soluble in water, to facilitate the action of surfactants. This is because of the disadvantage of poor activity of lipase at low cleaning temperatures, poor or incomplete removal of fats or fats and oils.
  • Lipases according to the invention can be used in various fields of industry as lipases with novel sequences. Lipases provided according to the present invention are currently capable of modification to amino acid sequences by genetic manipulation techniques of those skilled in the art. Therefore, based on the lipase according to SEQ ID NO: 1 or SEQ ID NO: 2 it is possible to change the sequence while having substantially the activity of the lipase.
  • a lipase comprising a sequence at least 85% similar to SEQ ID NO: 1 and SEQ ID NO: 2, more specifically at least 90% similar lipase, more particularly at least 95% similar lipase, even more specifically 99% Similar lipases are included within the scope of the present invention as long as they have substantially the same effect as the lipase of the present invention. This is referred to as the "functional equivalent" of the lipase of the present invention.
  • Functional equivalents include all in which some or all of the enzymes are substituted, or amino acid sequence variants in which some or all of the amino acids are deleted or added to maintain the enzyme function.
  • Substitutions of amino acids are preferably conservative substitutions. Examples of conservative substitutions of amino acids present in nature are as follows; Aliphatic amino acids (Gly, Ala, Pro), hydrophobic amino acids (Ile, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp, Glu), basic amino acids (His, Lys, Arg, Gln, Asn ) And sulfur-containing amino acids (Cys, Met). Deletion of amino acids is preferably located in portions not directly involved in the activity of lipase and esterase enzymes. However, conventionally known lipases are not intended to be included in the scope of the present invention.
  • a second embodiment of the present invention is a gene sequence encoding the lipase of SEQ ID NO: 1 or SEQ ID NO: 2. More specifically, it is a gene sequence having a nucleic acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4.
  • Lipase nucleic acid sequences provided according to the invention may have various forms of gene sequences due to the degeneracy of the codons.
  • codon degenerate is meant any nucleic acid sequence that encodes a polypeptide that differs from the naturally occurring sequence but is identical to the naturally occurring lipase disclosed herein. Therefore, the gene sequence encoding the lipase of SEQ ID NO: 1 or SEQ ID NO: 2 or a functional equivalent thereof is within the scope of the present invention.
  • a third embodiment of the present invention is a recombinant vector comprising a gene encoding the lipase of SEQ ID NO: 1 or SEQ ID NO: 2.
  • the term vector refers to a nucleic acid molecule capable of binding and transferring another nucleic acid thereto.
  • the recombinant vector of the present invention may be an expression vector, which includes a plasmid, cosmid or phage capable of synthesizing the protein encoded by each recombinant gene carried by the vector.
  • Preferred vectors may be vectors that can self replicate and express the nucleic acid to which they are bound.
  • Wild type C. elegans used in the present invention is Bristol strain N2 (Brenner, 1974). N2 and mutations were raised to 20 ° C. in NGM plates. ire-1 (v33) and hsp-4 (gk514 ) mutant strains were obtained from CGC (Minneapolis, MN).
  • fil-1 and fil-2 cDNA were fused with the upstream 2 kb promoter of the act-5 gene and subcloned into the pPD95.77 vector.
  • the fil-1 cDNA, fil-2 cDNA, and act-5 promoter fragments were fil-1 cDNA-1 (SEQ ID NO: 5), fil-1 cDNA-2 primer (SEQ ID NO: 6), and fil-2 cDNA-1 (SEQ ID NO: 6).
  • Number 7 fil-2 cDNA-2 primer (SEQ ID NO: 8), and act-5 pro-1 (SEQ ID NO: 9), act-5 pro-2 primer (SEQ ID NO: 10) (SEQ ID NO: 11 to 14 are sequences for amplifying fil-1 and fil-2 on vectors).
  • the promoters and ORFs of fil-1 and fil-2 were fil-1 geno-1 (SEQ ID NO: 15), fil-1 geno-2 (SEQ ID NO: 16), and fil-2 geno-1 (SEQ ID NO: 17) and cloned into GFP reporter plasmid with fil-2 geno-2 primer (SEQ ID NO: 18).
  • cDNAs encoding fil-1 and fil-2 were fil-1 RNAi-1 (SEQ ID NO: 19), fil-1 RNAi-2 primer (SEQ ID NO: 20) and fil-2 RNAi-1 (SEQ ID NO: 21), PCR was amplified from the cDNA library using fil-2 RNAi-2 primer (SEQ ID NO: 22). The amplified cDNA was cloned into bacterial expression vector L4440 (pPD129.36; SEQ ID NO: 25) ( FIG. 15 ). To make a dual RNA i construct, fil-2 cDNA was fused to vector L4440 (pPD129.36), which already had fil-1 cDNA.
  • RNA i library purchased from MRC (Cambridge, UK) was used. The worms were bleached to obtain the larvae. Synchronized worms were cultured in RNA i plates until the L4 phase. The efficiency of RNA i was confirmed by real time Q-PCR using appropriate PCR primers.
  • Nile red powder (N3013, Sigma) was dissolved in acetone at 500 ⁇ g / ml. Nile red stock solutions were diluted to a final concentration of 0.05 ⁇ g / ml in 1 ⁇ PBS as described (Ashrafi et al., 2003). Before fixing the worms, diluted Nile Red solution was added to the top of the NGM plate which had already introduced OP50 or RNA i bacteria. Synchronous larvae differentiated and their staining phenotype was examined at L4 phase. Nile red fluorescence was observed using an AxioPlan II (Zeiss) microscope and Confocal LSM510 system (Zeiss).
  • Bleached worms were prepared by known methods (Van Gilst et al., 2005a). Synchronous worms were grown to L4 phase either in NGM plates containing OP50 bacteria or RNA i plates containing HT115 bacteria. After worms were obtained, they were strongly washed with M9 buffer and placed in RNA i plates without NGM or HT115 without OP50 for 12 hours (Van Gilst et al., 2005a). Insects were collected every 4 hours for nile red staining and RNA sample preparation.
  • synchronous N2, ire-1 (v33) and hsp-4 (gk514) worms were incubated up to L4 phase in NGM Lite medium. Half of the worms were obtained and incubated for 8 hours in empty NGM Lite medium to make fasting samples. The worms were obtained immediately before the measurement, incubated in oxygen-saturated M9 buffer, and oxygen levels were measured at least five times for each sample by a known method (Braeckman et al., 2002). Oxygen consumption rate was monitored by Clark type electrode sensor, YSI 5300A oxygen monitor (YSI Corporation). Protein content was measured by the BCA method and used to average oxygen consumption, which was calculated as the relative O 2 ⁇ mol per mg protein per hour.
  • worms were synchronized as previously reported (Van Gilst et al., 2005a) and propagated on NGM Lite plates. After reaching the L4 phase, worms were obtained S-basal and washed strongly to remove OP50 bacteria. Each strain was transferred to a 50 ml flask with 20 ml S-basal buffer and incubated at 20 ° C. in a shaking incubator. To measure the bending rate, 1 ml of worm-containing culture was pipetted into wells of a 24-well tissue culture dish every 2 hours.
  • Fat content was measured with a commercially available triglyceride assay kit (Biovision Inc.) as reported previously (Ristow et al., 2000) and averaged in gram weights of animals. At each treatment condition and at defined times, at least three independently generated biological samples were obtained, and duplicate lysates were prepared for each sample and duplicate measurements were made for each prepared lysate.
  • cDNA was synthesized with RevertAid M-MuLV reverse transcriptase (Fermentas, Canada) using random hexamer, SYBR Green by gene specific primers and MyIQ real-time PCR detection system (Bio-Rad Laboratories) PCR amplification using I (BioWhittaker Molecular Applications). Relative mRNA amounts were calculated after normalization to C. elegans act-1 / 3 mRNA.
  • Free fatty acid (Roche) and glycerol (Sigma) contents were measured by commercialized measurement kit (Biovision Inc.) as reported previously (Ristow et al., 2000) and averaged against protein content measured by the BCA method. .
  • Biovision Inc. Commercialized measurement kit
  • F primers GCCTTTGAATCAGCAGTGGGAACAG (SEQ ID NO: 23) and
  • R primer TTCACGCGTTTCTGAAGATG (SEQ ID NO: 24)
  • fasting worms treated with ire-1 RNA i did not reduce the level of fat granules ( FIG. 1B ).
  • the level of total triglycerides (TG) was reduced by about 50% in wild-type animals, while in ire-1 knockdown animals by about 10% under the same conditions ( FIG. 1C ).
  • the total amounts of free fatty acids and glycerol increased by fasting in wild-type animals, whereas not in ire-1 RNA i animals ( FIG. 6 ).
  • IRE-1 is regulated by BiP, one of the ER-present molecule chaperones (Bertolotti et al., 2000; Kimata et al., 2004).
  • the present inventors evaluated the effect of HSP-4, one of the homologous genes of BiP in C. elegans , on fasting ire-1 -mediated lipophilic hydrolysis according to fasting. Similar to ire-1 knockdown worms, both hsp-4 RNA i animals and hsp-4 (gk514) mutant animals prevented fasting-induced lipolysis ( FIG. 2A and 2B ), which indicated that fat metabolism following fasting This suggests that hsp-4 has a similar function to ire-1 .
  • FIL-1 and FIL-2 proteins are mammalian ATGL (Zimmermann et al., 2004), Drosophila Brummer (Gronke et al., 2005), and yeast TGL3 (Athenstaedt and Daum, 2003), TGL4 (Kurat et al., 2006), and belongs to lipase categories such as TGL5 (Athenstaedt and Daum, 2005) ( Fig 3A ). Biochemical assays using recombinant FIL-1 proteins expressed in bacteria clearly showed that FIL-1 exhibited lipase activity ( 10 ).
  • FIL-1 and FIL-2 are necessary and sufficient for fasting-induced fat granulation hydrolysis.
  • fil-1 and fil-2 are functional fast-inducing lipases
  • fil-1 and fil-2 were overexpressed in the gut under the control of the act-5 promoter (MacQueen et al., 2005).
  • Intestinal-specific overexpression of fil-1 or fil-2 lipase stimulated constant granule hydrolysis in WT worms even in the presence of food ( FIG. 4B ).
  • overexpression of fil-1 and fil-2 clearly reduced the amount of lipogranules in the gut of hsp-4 (gk514) mutations and ire-1 (RNA i) animals ( FIG. 4B ). .
  • ire-1 And hsp-4 In order to determine if lipogranate hydrolysis regulated by is associated with whole body energy homeostasis in fasting worms, ire-1 (v33), And hsp-4 (gk514) In animals, the effects of fasting on their form and motility were carefully examined. When you fed the bacteria to the bugs, ire-1 ( v33 ) And hsp-4 (gk514) The pumping rate in animals was slightly reduced compared to WT, but not statistically significant.
  • oxygen is an indicator of mitochondrial activity for energy production in feeding and fasting conditions.
  • the consumption rate was measured. Consistent with previous reports (Bishop and Guarente, 2007), oxygen consumption rate was increased by fasting in WT animals ( FIG. 5B ).
  • FIG. 5B there was a significant decrease in ire-1 and hsp-4 mutant animals ( FIG. 5B ). This suggests that energy production for exercise during fasting is dependent on ire-1 and hsp-4 .
  • WT, ire-1, and hsp-4 mutant animals in the fed state showed similar oxygen consumption rates ( FIG. 5B ) and were much lower than in the fasted state. This shows that ire-1 and hsp-4 mutant animals can produce energy to a similar extent as WT animals, perhaps by using other energy sources, such as carbohydrates, in the fed state.
  • Lipases according to the present invention can be used in various fields of the industry as lipases with novel sequences.
  • Lipases lipases (lipases, glycerol ester hydrolases) are hydrolysis, alcohololysis, acidolysis. It is involved in various biocatalytic reactions, such as esterification, aminolysis, etc., maintains activity in organic solvents as well as in aqueous solution, and does not require a separate cofactor in the catalysis process.
  • it is one of enzymes having high industrial applicability because it exhibits substrate specificity for various substrates and has isomer selectivity showing activity for only one of the optical isomers.
  • lipases are used throughout the food, detergent, fine chemicals, cosmetics, and environmental materials industries.
  • YMR313c / TGL3 encodes a novel triacylglycerol lipase located in lipid particles of Saccharomyces cerevisiae. J Biol Chem 278, 23317-23323.
  • Tgl4p and Tgl5p two triacylglycerol lipases of the yeast Saccharomyces cerevisiae are localized to lipid particles. J Biol Chem 280, 37301-37309.
  • IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature 415, 92-96.
  • Adipocyte Biology Adipocyte stress: the endoplasmic reticulum and metabolic disease. J Lipid Res 48, 1905-1914.
  • Brummer lipase is an evolutionary conserved fat storage regulator in Drosophila. Cell Metab 1, 323-330.
  • Obese yeast triglyceride lipolysis is functionally conserved from mammals to yeast. J Biol Chem 281, 491-500.
  • Ligand-independent dimerization activates the stress response kinases IRE1 and PERK in the lumen of the endoplasmic reticulum. J Biol Chem 275, 24881-24885.
  • ACT-5 is an essential Caenorhabditis elegans actin required for intestinal microvilli formation. Mol Biol Cell 16, 3247-3259.
  • lipid droplet is an important organelle for hepatitis C virus production. Nat Cell Biol 9, 1089-1097.
  • Glucose restriction extends Caenorhabditis elegans life span by inducing mitochondrial respiration and increasing oxidative stress. Cell Metab 6, 280-293.
  • Nuclear hormone receptor NHR-49 controls fat consumption and fatty acid composition in C. elegans. PLoS Biol 3, e53.
  • Frataxin activates mitochondrial energy conversion and oxidative phosphorylation. Proceedings of the National Academy of Sciences of the United States of America 97, 12239-12243.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Detergent Compositions (AREA)

Abstract

The present invention relates to novel lipases induced by fasting, genes encoding the same, and recombinant vectors comprising the novel lipases. The lipase according to the present invention can be useful in all industrial fields such as foods, detergents, precision chemistry, cosmetics, and environmental materials.

Description

금식에 의해 유도되는 신규한 리파아제Novel Lipase Induced by Fasting
본 발명은 금식(fasting)에 의해 유도되는 신규한 리파아제 및 이를 암호화하는 유전자, 그리고 상기 신규한 리파아제를 포함하고 있는 제조합벡터에 관한 것이다.The present invention relates to a novel lipase induced by fasting, a gene encoding the same, and a preparation vector containing the novel lipase.
ER은 단백질의 프로세싱 뿐 아니라, 글리코겐, 지방, 및 다른 거대분자들의 생산 및 저장과 관련된 특수화된 세포소기관이다. 접히지 않은 단백질 반응(unfolded protein response, UPR)은 세포의 다양한 변화로부터 기인하는 잘 알려진 ER 내 반응이다. 단백질을 적절히 접히게 하는 세포 능력의 손상 또는 스트레스 환경으로 인해 잘못 접히거나 접히지 않은 단백질들이 축적되면 ER의 부담을 최소화하기 위해 UPR 반응이 일어난다(Ron and Walter, 2007). UPR 과정 동안, IRE1 ('이노시톨-요구 막관통 키나아제 및 엔도뉴클리에이즈 1(inositol-requiring transmembrane kinase and endonuclease 1)’이라고도 함.), PERK, 및 ATF6 의 3개의 주된 조절인자(regulator)들이 ER 샤페론, ERAD 구성물 및 번역감쇄(translational attenuation) 유도를 조절하기 위하여 활성화된다(Kaufman, 1999; Mori et al., 2000; Patil and Walter, 2001). 이들 조절인자들은 ER 스트레스가 없을 때 ER막 상에 존재하는 샤페론의 하나인 BiP와 결합하고, BiP와 해리함으로써 활성화 과정을 빠르게 진행하며, ER 스트레스 하에서 잘못 접힌 단백질들과 우선적으로 결합한다(Calfon et al., 2002; Tirasophon et al., 1998; Wang et al., 1998). 흥미롭게도, 최근의 연구들은 UPR 조절인자의 하나인 IRE1이 UPR 외에 다른 기능에도 관련이 있음을 시사한다. IRE1은, 막 및 분비 단백질들을 암호화하는 것들을 포함하여, 광범위한 분해 표적 mRNA들을 갖고 있다(Hollien and Weissman, 2006). IRE1은 그것의 표적유전자들을 조절하고, 췌장 베타 세포들에서 BiP로부터 분리되지 않고 인슐린 생합성에 관여하기 위해 높은 글루코스 농도에서 활성화된다(Lipson et al., 2006). ER is a specialized organelle that is involved in the processing and processing of proteins, as well as the production and storage of glycogen, fat, and other macromolecules. Unfolded protein response (UPR) is a well known response in ER that results from various changes in cells. Accumulation of misfolded or unfolded proteins due to impaired cellular capacity or a stress environment that causes the proteins to fold properly causes an UPR reaction to minimize the burden of ER (Ron and Walter, 2007). During the UPR process, three major regulators of IRE1 (also referred to as 'inositol-requiring transmembrane kinase and endonuclease 1'), PERK, and ATF6 are Activated to regulate induction of chaperone, ERAD constructs and translational attenuation (Kaufman, 1999; Mori et al., 2000; Patil and Walter, 2001). These regulators bind BiP, one of the chaperones present on the ER membrane in the absence of ER stress, accelerate the activation process by dissociating BiP and preferentially bind to misfolded proteins under ER stress (Calfon et. al., 2002; Tirasophon et al., 1998; Wang et al., 1998). Interestingly, recent studies suggest that one of the UPR modulators, IRE1, is involved in other functions besides UPR. IRE1 has a wide range of degradation target mRNAs, including those encoding membrane and secretory proteins (Hollien and Weissman, 2006). IRE1 is activated at high glucose concentrations to regulate its target genes and to participate in insulin biosynthesis without separating from BiP in pancreatic beta cells (Lipson et al., 2006).
ER이 지질대사에 중요하다는 증거들 역시 계속해서 축적되고 있다(Gregor and Hotamisligil, 2007; Ron and Walter, 2007). 예를 들면, 고지방의 영양을 섭취한 마우스는 간 및 지방 조직에서 증가된 ER 스트레스를 보였다(Ozcan et al., 2004). 이는 ER이 그러한 식이요법에 의해 유발된 대사변화들을 매개하는데 있어 핵심적인 세포소기관임을 나타낸다. 추가로, 세포지질방울(cellular lipid droplet)들은 동력학적으로 세포질을 통해 이동하고, ER과 상호작용한다(Miyanari et al., 2007). 가장 최근에, IRE1-매개 UPR의 핵심적인 전사 조절인자인 XBP1은 간의 지방생성에 중요한 역할을 한다는 것이 보고되었다(Lee et al., 2008). 이러한 결과들은 ER 단백질들이 지질 대사와 관련있다는 사실을 시사한다. 하지만, 어떻게 ER이 영양변화에 대응해서 지질 항상성에 관여하는지는 대체로 알려진 바가 없다. Evidence that ER is important for lipid metabolism continues to accumulate (Gregor and Hotamisligil, 2007; Ron and Walter, 2007). For example, high fat nutrient mice showed increased ER stress in liver and adipose tissue (Ozcan et al., 2004). This indicates that ER is a key organelle for mediating metabolic changes caused by such diets. In addition, cellular lipid droplets kinetically move through the cytoplasm and interact with ER (Miyanari et al., 2007). Most recently, XBP1, a key transcriptional regulator of IRE1-mediated UPR, has been reported to play an important role in hepatic lipogenesis (Lee et al., 2008). These results suggest that ER proteins are involved in lipid metabolism. However, how ER is involved in lipid homeostasis in response to nutritional changes is largely unknown.
Caenorhabditis elegans (C. elegans) 는 지질대사를 포함한 몸 전체의 에너지 항상성을 연구하는데 훌륭한 유전적 모델로 알려져 왔다(McKay et al., 2003). 포유동물들은 지방 저장고로 아디포사이트(adipocytes)가 있지만, C. elegans 는 독점적인 조직이나 세포를 갖고 있지 않다. 대신에, C. elegans 는 지방을 장 세포에서 지방방울의 형태로 저장한다. C. elegans 는 투명한 몸체를 갖고 있으므로, 지방방울들은 수단 블랙(Sudan black) 또는 나일 레드(Nile red) 염료들로 염색함으로써 직접적으로 볼 수 있다(McKay et al., 2003; Van Gilst et al., 2005b). 이들 염료들은 살아있는 벌레들에서 지방방울들을 쉽게 볼 수 있게 함으로써, 지질 조절의 유전적 분석을 매우 용이하게 한다. 이러한 장점들을 이용하여, 유전체 수준의 접근법은 C. elegans에서 지질의 흡수, 운반, 보관 및 이용을 위한 핵심적인 조절네트워크를 성공적으로 밝혔다(Ashrafi et al., 2003). 하지만, C. elegans 또는 다른 모델생물을 사용한 연구들은 ER 및 영양상태 의존적 지질대사 간의 뚜렷한 상관관계를 보이지는 못하였다. Caenorhabditis elegans ( C. elegans ) has been known as an excellent genetic model for studying the energy homeostasis throughout the body, including lipid metabolism (McKay et al., 2003). Mammals have adipoocytes as fat stores, but C. elegans do not have proprietary tissues or cells. Instead, C. elegans stores fat in the form of fat droplets in intestinal cells. C. elegans has a transparent body, so droplets can be seen directly by dyeing with Sudan black or Nile red dyes (McKay et al., 2003; Van Gilst et al., 2005b). These dyes greatly facilitate the genetic analysis of lipid regulation by making fat droplets visible in live worms. Using these advantages, the genome-level approach has successfully identified key regulatory networks for the uptake, transport, storage and use of lipids in C. elegans (Ashrafi et al., 2003). But C. Studies using elegans or other model organisms did not show a clear correlation between ER and nutrition-dependent lipid metabolism.
이에 본 발명자들은 C. elegans 를 모델시스템으로 하여, ER 및 그것과 관련된 단백질들이 영양의 변화에 따라 지질대사를 조절하는지 알아보았다. 주요한 UPR 경로의 유전자들과 지방대사 유전자들은 C. elegans에서 보존되어 있기 때문에(Harding et al., 1999; Liu et al., 2000; Sood et al., 2000; Van Gilst et al., 2005b), 지방대사와 같은 세포생리학의 기본적인 측면들을 조절하는 ER의 기능이 진화적으로 보존되어 있음을 알 수 있다. 이에 본 발명자들은 선충의 IRE1 및 BiP와 각각 상동성이 있는 IRE-1 및 HSP-4가 영양상태의 변화를 인식하고, C. elegans에서 운동성에 필요한 에너지 요구를 충족시키기 위하여, 유도성 리파아제 FIL-1 및 FIL-2의 발현을 자극한다는 것을 발견하고 본 발명을 완성하였다.Therefore, the inventors of the present invention, using C. elegans as a model system, examined whether ER and related proteins regulate lipid metabolism according to nutritional changes. Because the major UPR pathway genes and fat metabolism genes are conserved in C. elegans (Harding et al., 1999; Liu et al., 2000; Sood et al., 2000; Van Gilst et al., 2005b) The evolution of ER's ability to regulate basic aspects of cell physiology, such as fat metabolism, is preserved. Accordingly, the present inventors have found that IRE-1 and HSP-4, which are homologous to nematode IRE1 and BiP, recognize the change in nutritional status and satisfy the energy requirements for motility in C. elegans . The present invention was completed by stimulating the expression of 1 and FIL-2.
본 발명은 금식(fasting)에 의해 유도되는 신규한 리파아제를 제공하는 것을 목적으로 한다.The present invention aims to provide novel lipases induced by fasting.
본 발명은 금식에 의해 유도되는 신규한 리파아제를 암호화하는 유전자 서열을 제공하는 것을 목적으로 한다.The present invention aims to provide a gene sequence encoding a novel lipase induced by fasting.
본 발명은 상기 신규한 리파아제를 암호화하는 유전자가 포함된 재조합벡터를 제공하는 것을 목적으로 한다.An object of the present invention is to provide a recombinant vector containing the gene encoding the novel lipase.
본 발명에 따른 신규한 리파아제는 서열번호 1 또는 서열번호 2의 아미노산 서열을 가진 신규한 리파아제이다. The novel lipases according to the invention are novel lipases having the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
본 발명에 따른 신규한 리파아제 유전자는 서열번호 1 또는 서열번호 2의 아미노산 서열을 암호화하는 유전자 서열이고, 보다 구체적으로 서열번호 3 또는 서열번호 4의 핵산 서열을 가지는 유전자이다.The novel lipase gene according to the present invention is a gene sequence encoding the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, more specifically, a gene having a nucleic acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4.
본 발명에 따른 재조합 벡터는 상기 서열번호 1 또는 서열번호 2의 아미노산 서열을 암호화하는 유전자 서열을 포함하는 재조합벡터이고, 보다 구체적으로 서열번호 3 또는 서열번호 4의 핵산 서열을 가지는 재조합벡터이다. The recombinant vector according to the present invention is a recombinant vector comprising a gene sequence encoding the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, more specifically a recombinant vector having a nucleic acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4.
본 발명에 따른 리파아제는 신규한 리파아제이고, 지방 과립구의 분해와 관련이 있어 비만 치료제 개발에 유용하게 사용될 수 있다. 또한 식품, 세제, 정밀화학, 화장품 및 환경소재공업등 산업 전반에 걸쳐서 이용될 수 있다.The lipase according to the present invention is a novel lipase, and is associated with the decomposition of fat granulocytes, and thus may be usefully used for developing obesity treatments. It can also be used throughout the industry, including food, detergents, fine chemicals, cosmetics and environmental materials.
도 1은 C. elegans ire-1 이 단기간의 금식에 의한 지방과립 분해를 매개한다는 것을 보여준다. (A) 단기간의 금식은 지방과립 분해를 유도한다. 왼쪽 패널은 각각 섭식(Fed)하거나 24시간 동안 금식한(24 h Fasted) 벌레들이다. 오른쪽 패널은 나일 레드 형광을 정량화한 것이다. 스케일바는 50 μm를 나타낸다. (B) UPR 유전자들의 넉다운 후 금식-유도 지방과립 분해의 시간대별 형질 분석. 상단 패널은 먹이가 없는 12시간 동안의 장내 지방 함량을 나일 레드로 가시화하여 보여준다. 이미지들은 동일한 노출시간으로 찍었다. 스케일바는 50μm를 나타낸다. 하단은 OpenLab (Improvision Inc.) 소프트웨어로 측정한 나일 레드 염색의 상대적인 강도를 보여준다. 별표시(Asterisk)는 통계적 유의성(p< 0.01)을 나타낸다. (C) 섭식 또는 8시간 금식한 WT 및 ire-1 RNAi 동물들 각각에서 트라이글리세라이드 양의 비교. 별표시(Asterisk)는 통계적 유의성(p< 0.01)을 나타낸다. (D) 금식 8시간 후의 지방과립의 공초점 이미지(confocal image). 금식 8시간 후에 지방과립의 수 및 크기는 대조구 RNAi (상단 패널)에서는 급격히 감소하였으나, ire-1 RNAi (하단 패널)에서는 큰 변화가 관찰되지 않는다. 스케일바는 15 μm를 나타낸다. Figure 1 shows that C. elegans ire-1 mediates fat granule degradation by short - term fasting. (A) Short-term fasting leads to lipolysis. The left panel is Fed or 24 h Fasted worms, respectively. The right panel is a quantification of Nile red fluorescence. Scale bar represents 50 μm. (B) Time-phased characterization of fasting-induced lipolytic degradation after knockdown of UPR genes. The top panel visualizes the intestinal fat content in Nile Red for 12 hours without food. Images were taken with the same exposure time. Scale bar represents 50 μm. The bottom shows the relative intensities of the Nile Red stains measured with OpenLab (Improvision Inc.) software. Asterisk indicates statistical significance (p <0.01). (C) Comparison of triglyceride amounts in each of WT and ire-1 RNA i animals fed or fasted for 8 hours. Asterisk indicates statistical significance (p <0.01). (D) Confocal image of local granules after 8 hours of fasting. After 8 hours of fasting, the number and size of fat granules decreased drastically in control RNA i (top panel), but no significant change was observed in ire-1 RNA i (bottom panel). Scale bar represents 15 μm.
도 2는 xbp-1이 아니라 hsp-4가 금식-유도 지방과립 분해에 필수적임을 보여준다. (A) hsp-4 의 넉다운 후 금식 12시간 동안의 금식-유도 지방과립 분해의 시간대별 형질 분석. 모든 이미지들은 동일한 노출조건으로 찍었다. 하단 패널은 상대적인 나일 레드 강도를 보여준다. 별표시는 p< 0.01 를 나타낸다. (B) 금식 8시간 후의 hsp-4 (gk514) 돌연변이 동물의 나일 레드 염색. 좌측 패널은 나일 레드 형광의 현미경 사진이고, 우측 패널은 OpenLab 소프트웨어로 측정한 정량적 데이터이다. (C) xbp-1 넉다운 후, 금식 12시간 동안의 금식-유도 지방과립 분해의 시간대별 형질분석. (D) 금식은 xbp-1 mRNA의 스플라이싱을 유도하지 않았다. 금식이 아니라 튜니카마이신(tunicamycin)에 의해 유발된 전형적인 ER 스트레스가 xbp-1 의 스플라이싱을 유도한다. 2Isxbp-1Nothsp-4Is essential for fasting-induced lipolysis.                 (A)                 hsp-4Time-phased characterization of fasting-induced lipolysis during 12 hours of fasting after knocking down. All images were taken under the same exposure conditions. The bottom panel shows the relative Nile Red intensity. Stars indicate p <0.01.(B) 8 hours after fasting                 hsp-4 (gk514)Nile red staining of mutant animals. The left panel is a micrograph of Nile red fluorescence and the right panel is quantitative data measured by OpenLab software.(C)                 xbp-1After knockdown, time-phased characterization of fasting-induced lipolysis over 12 hours of fasting.(D) Fastingxbp-1It did not induce splicing of mRNA. The typical ER stress caused by tunicamycin, not fasting,xbp-1Induces splicing of
도 3은 fil-1 및 fil-2 가 그 발현이 ire-1 및 hsp-4에 의존적인 금식-유도 리파아제를 암호한다는 것을 보여준다. (A) FIL-1 및 FIL-2의 계통분석. FIL-1 및 FIL-2 는 서로간에 가장 유사성이 높다. C05D11.7 는 C. elegans 에서 또다른 잠정적 ATGL 호모로그(homolog)이나, 본 발명의 실험에서 금식에 의해 유도되지 않았다(표 2). (B) ire-1 및 hsp-4 RNAi 벌레들에서 금식 6시간 후의 fil-1 및 fil-2 mRNA의 상대적 양. 정량적 실시간 PCR을 독립적으로 3번 실시하였다. (C) 금식-유도 fil-1 및 fil-2 발현은 xbp-1과는 독립적이다. fil-1 및 fil-2는 xbp-1 (RNAi) 배경(background)의 존재하에서도 금식에 의해 상향조절(upregulation)되었다. (D) 금식 전후에 있어 FIL-1 및 FIL-2의 발현 양상. FIL-1 및 FIL-2는 장에서만 금식에 의해 유도되었다. 하단 우측 패널의 입구는 지방방울에서 FIL-2의 위치(localization)를 보여준다. 스케일바는 25μm를 나타낸다. 3 shows that fil-1 and fil-2 encode fast-induced lipases whose expression is dependent on ire-1 and hsp-4 . (A) Phylogenetic analysis of FIL-1 and FIL-2. FIL-1 and FIL-2 are most similar to each other. C05D11.7 is another potential ATGL homolog in C. elegans , but was not induced by fasting in the experiments of the present invention ( Table 2 ). (B) Relative amounts of fil-1 and fil-2 mRNA after 6 hours of fasting in ire-1 and hsp-4 RNA i worms. Quantitative real time PCR was performed three times independently. ( C ) Fasting-induced fil-1 and fil-2 expression is independent of xbp-1 . fil-1 and fil-2 were upregulated by fasting even in the presence of xbp-1 (RNA i ) background. (D) Expression patterns of FIL-1 and FIL-2 before and after fasting. FIL-1 and FIL-2 were induced by fasting only in the intestines. The inlet of the lower right panel shows the localization of FIL-2 in the droplets. Scale bar represents 25 μm.
도 4는 fil-1 및 fil-2 가 지방과립 분해에 필요충분하다는 것을 보여준다. (A) 금식 6시간 후 fil-1 및/또는 fil-2 RNAi 벌레들에서 지방과립의 공초점 이미지. 좌측 패널들은 섭식상태(Fed)이고; 우측 패널들은 금식상태(Fasted)이다. (B) act-5 프로모터의 조절 하에 FIL-1 및 FIL-2 발현은 WT, hsp-4(gk514) 돌연변이, 및 ire-1(RNAi) 동물들에서 지방과립 분해를 유도하기에 충분하다. 좌측패널은 WT 동물을 보여준다. 가운데 및 우측패널은 각각 hsp-4 (gk514) 및 ire-1(RNAi)동물들을 나타낸다. A 및 B 의 하단 패널은 결과들의 정량화이다. 숫자들은 금식 후 나일 레드 형광의 감소 퍼센트(percentage)를 나타낸다. 스케일바는 25 μm를 나타낸다. 4 shows that fil-1 and fil-2 are necessary for lipogranude degradation. (A) Confocal image of fat granules in fil-1 and / or fil-2 RNA i worms after 6 hours of fasting. The left panels are fed; The right panels are fasted. (B) FIL-1 and FIL-2 expression under the control of the act-5 promoter is sufficient to induce lipogranuclease degradation in WT, hsp-4 (gk514) mutants , and ire-1 (RNA i ) animals. The left panel shows WT animals. The middle and right panels represent hsp-4 (gk514) and ire-1 ( RNA i) animals, respectively. The bottom panels of A and B are the quantification of the results. The numbers represent the percentage of Nile red fluorescence after fasting. Scale bar represents 25 μm.
도 5는 금식환경에서 IRE-1/ HSP-4-의존적 지방과립 가수분해가 운동성에 미치는 영향을 보여준다. (A) 액체배지에서 굽힘 비율(bending rates)에 의해 측정한 벌레들의 운동성 측정. (B) 먹이 고갈 후의 산소소비율 측정. 그래프는 금식 전 및 금식 후 8시간 동안의 WT, ire-1 (v33) 및 hsp-4 (gk514) 동물들의 계산된 몸 전체의 산소 소비율을 나타낸다. 별표시는 p<0.01을 나타낸다. (C) ire-1 및 hsp-4 돌연변이 동물들에서 5 mM 글루코스에 의한 굽힘 비율 회복의 정량화. 별표시는 p<0.05 의 통계적 유의성을, 이중 별표시는, p<0.1을 나타낸다. (D) 5 mM 글루코스의 배지내 첨가에 의한 ire-1 (v33) 및 hsp-4 (gk514) 돌연변이들의 금식-유발 운동성 결함의 회복. 패널들은 다음 조건에서 30초간 이동한 WT, ire-1 및 hsp-4 벌레들의 스냅샷을 보여준다: 섭식(fed), 8시간 금식(fasted), 및 8시간 금식 후의 글루코스 보충(glucose). 별표시는 측정을 위해 벌레들을 처음 위치시켰던 곳을 나타낸다. hsp-4 (gk514) 동물들에 대한 하단 패널의 화살표는 처음 위치가 화면범위에서 벗어났음을 나타낸다. 5In a fasting environment The effect of IRE-1 / HSP-4-dependent fat granule hydrolysis on motility is shown.(A) Measurement of motility of worms as measured by bending rates in liquid media.(B) Oxygen consumption rate after food depletion. The graph shows WT before fasting and for 8 hours after fasting,ire-1 (v33)Andhsp-4 (gk514)The calculated total oxygen consumption of the animals. Asterisks indicate p <0.01.(C)                 ire-1Andhsp-4Quantification of bending rate recovery by 5 mM glucose in mutant animals. Asterisks indicate statistical significance of p <0.05, and double asterisks indicate p <0.1.(D)By addition of 5 mM glucose in the mediumire-1 (v33)Andhsp-4 (gk514)Recovery of fasting-induced motility defects of mutations. The panels moved for 30 seconds under the following conditions:ire-1Andhsp-4Snapshots of worms are shown: fed, 8 hours fasted, and glucose after 8 hours fasted. Stars indicate where bugs were first placed for measurement.hsp-4 (gk514)The arrow on the bottom panel for the animals indicates that the initial position is out of view.
도 6은 섭식 또는 8시간 금식한 WT 및 ire-1 RNAi 동물에서 자유 지방산들(A) 및 글리세롤(B)의 상대적인 양을 나타낸다. 별표시는 통계적 유의성(p < 0.05)을 나타낸다. 6 shows the relative amounts of free fatty acids ( A ) and glycerol ( B ) in WT and ire-1 RNA i animals fed or fasted for 8 hours. Asterisks indicate statistical significance (p <0.05).
도 7은 금식 전 및 금식 8시간 후의 ire-1 (v33) 돌연변이들의 나일 레드 염색을 나타낸다. 금식 전에 알 수 없는 이유로 ire-1 (v33) 돌연변이 동물들의 장내 루멘(lumen)에서 나일 레드 염색이 나타나기는 하지만, 금식 후에 장내 지방과립들은 실제로 변하지 않은 채로 남아 있다. 스케일바는 50 μm를 나타낸다. 7 shows Nile red staining of ire-1 (v33) mutants before fasting and after 8 hours of fasting. Although nile red staining occurs in the intestinal lumen of ire-1 (v33) mutant animals before fasting, intestinal fat granules remain unchanged after fasting. Scale bar represents 50 μm.
도 8은 지방 생합성과 관련 있는 유전자들의 실시간 PCR 분석이다. 대부분의 유전자들의 발현수준은 금식에 의해 많이 영향받지 않는 반면에, fat-7의 발현은 금식에 의해 억제되었다. 하지만, fat-7 은 fat-5 및 fat-6와 중복적이므로, 이러한 억제는 전체적인 지방 함량에 영향을 미칠 것 같지 않다. 8 is a real-time PCR analysis of genes involved in fat biosynthesis. While expression levels of most genes were not significantly affected by fasting, the expression of fat-7 was inhibited by fasting. However, fat-7 is redundant with fat-5 and fat-6 , so this inhibition is unlikely to affect the overall fat content.
도 9는 마이크로어레이 실험에서 금식 동안 적어도 두배의 상향조절(upregulation)을 나타낸 지방대사와 관련된 유전자들의 실시간 PCR 분석이다. fil-1 및 fil-2 의 결과들이 주요 도면에 나와 있다. acs-2, cpt-3, 및 gei-7은 금식에 의해 유도되나,그들의 유도는 ire-1와는 독립적이다. 9 is a real-time PCR analysis of genes associated with fat metabolism that exhibited at least double upregulation during fasting in a microarray experiment. The results of fil-1 and fil-2 are shown in the main figures. acs-2 , cpt-3 , and gei-7 are induced by fasting, but their induction is independent of ire-1 .
도 10은 FIL-1에 대한 시험관내(in vitro)리파아제 측정결과이다. While GST 단백질 단독으로는 어떠한 리파아제 활성도 보이지 않았으나, GST-융합 FIL-1은 박테리아에서 상당한 리파아제 활성을 보였다. 10 isResults of in vitro lipase assay for FIL-1.  While GST protein alone did not show any lipase activity, GST-fusion FIL-1 showed significant lipase activity in bacteria.
도 11은 섭식 또는 8시간 금식한 L4440, fil-1 및 fil-2 RNAi 동물들 각각에서 트라이글리세라이드(triglyceride)의 양을 나타낸다. 별표시는 통계적 유의성 (p< 0.05)을 나타낸다. 11Silver eating or 8 hours fasting L4440,fil-1 Andfil-2RNAiIn each of the animals The amount of triglyceride is shown. Asterisks indicate statistical significance (p <0.05).
도 12는 WT, ire-1, 및 hsp-4 돌연변이 동물들간에 전체적인 외양의 차이를 보여준다. WT 동물들은 금식에 따른 지방과립의 소모로 인해 ‘투명한’ 반면, ire-1 및 hsp-4 돌연변이는 지방방울 가수분해의 결핍으로 인해 ‘어둡게' 남아 있다. Figure 12Is WT,ire-1, Andhsp-4Show overall differences in mutant animals. WT animals are “transparent” due to the consumption of fat granules due to fasting,ire-1Andhsp-4Mutations remain 'dark' due to the lack of droplet hydrolysis.
도 13은 ire-1 및 hsp-4 돌연변이 동물들에서, 5 mM 글루코스, 5 mM 디옥시-글루코스, 및 5mM 소비톨(sorbitol)에 의한 굽힘 비율의 회복을 보여준다. WT 동물들을 음성 대조구로 사용하였다. 별표시는 통계적 유의성(p < 0.05)을 나타낸다. FIG. 13 shows recovery of bend rate by 5 mM glucose, 5 mM deoxy-glucose, and 5 mM sorbitol in ire-1 and hsp-4 mutant animals. WT animals were used as negative controls. Asterisks indicate statistical significance (p <0.05).
도 14는 nhr-49, sbp-1, daf-16, cbp-1, crh-1, skn-1, 및 lpd-2 RNAi 동물들에서 8시간 금식 후에 fil-1 (A) 및 fil-2 (B) mRNA 의 상대적인 양을 나타낸다. 실시간 Q-PCR 을 독립적으로 3번 수행하였다. (C) 8시간 금식 후 cbp-1 RNAi 동물의 나일 레드 염색. 금식한 cbp-1 RNAi 동물은 장내에서 지방과립의 감소를 보이지 않았다. 14Isnhr-49, sbp-1, daf-16, cbp-1, crh-1, skn-1,Andlpd-2 RNAiAfter 8 hours fast in animals                 fil-1                 (A)Andfil-2                 (B)Relative amount of mRNA is shown. Real time Q-PCR was performed three times independently.(C)8 hours after fasting                 cbp-1 RNAiNile red staining of animals. Fastedcbp-1RNAiThe animal did not show a decrease in fat granules in the intestine.
도 15는 발현벡터 L4440의 개열지도를 보인다. 15 shows a cleavage map of the expression vector L4440.
본 발명의 제 1 의 실현 형태는 서열번호 1 또는 서열번호 2의 리파아제이다. 리파아제(lipase, glycerol ester hydrolases)란 다양한 범위의 수용성 혹은 비수용성 카르복실산 에스테르(carboxylic acid ester)나 아마이드(amide)의 가수분해 혹은 합성을 촉매하는 효소를 말하며 가수분해 (hydrolysis), 알콜분해(alcoholysis), 산 분해 (acidolysis), 에스테르화(esterification), 아미노분해(aminolysis) 등과 같이 다양한 생물 촉매 반응에 관여하고, 수용액 상태에서 뿐 아니라 유기 용매에서도 활성을 유지하고, 촉매반응 과정에 별도의 보조인자(cofactor)를 필요로 하지 않고, 다양한 기질에 대해 기질 특이성을 나타내고, 광학이성질체중 어느 한쪽에 대해서만 활성을 나타내는 이성질체 선택성을 가지고 있어 산업적 응용성이 높은 효소 중의 하나이다. 현재까지 많은 종류의 동물, 식물, 미생물이 리파아제를 생산하는 것으로 알려졌으며, 리파아제의 생화학적 특성에 대한 연구, 리파아제 유전자를 확보하기 위한 연구가 진행되고 있으며, 특히 식품, 세제, 정밀화학, 화장품 및 환경소재공업등 산업 전반에 걸쳐서 리파아제를 이용하기 위한 연구가 활발히 진행되고 있다.A first embodiment of the invention is the lipase of SEQ ID NO: 1 or SEQ ID NO: 2. Lipases (lipases, glycerol ester hydrolases) are enzymes that catalyze the hydrolysis or synthesis of a wide range of water-soluble or non-aqueous carboxylic acid esters or amides. Participates in various biocatalytic reactions such as alcoholysis, acidolysis, esterification, aminolysis, etc., maintains activity in organic solvents as well as aqueous solutions, and assists catalysis It is one of enzymes with high industrial applicability because it does not require a cofactor, exhibits substrate specificity with respect to various substrates, and has isomer selectivity which shows activity with only one of the optical isomers. To date, many kinds of animals, plants and microorganisms have been known to produce lipases, and researches on the biochemical properties of lipases and the acquisition of lipase genes have been carried out, especially foods, detergents, fine chemicals, cosmetics, Researches to use lipases are being actively conducted in various industries such as environmental materials industry.
의약품을 비롯한 부가가치가 높은 선도물질을 합성하는 정밀화학분야에서,  In the field of fine chemicals that synthesize high value-added leading substances including pharmaceuticals,
기존의 화학적인 방법으로 에스테르화합물을 합성하는 경우, 고온과 고압에서 합성Synthesis of ester compound by high temperature and high pressure
되기 때문에 에너지가 많이 소모되며 품질에 나쁜 영향을 주는 여러 가지 부반응이 Energy consumption and many side reactions that adversely affect quality.
일어날 뿐 아니라, 전환율 및 특정 광학이성체의 순도가 낮아서 고순도의 정밀화학In addition, high purity fine chemistry due to low conversion and purity of certain optical isomers
제품 생산에 어려움이 있어 왔다. 최근에는 이러한 문제점을 보완하기 위해서, 위There has been difficulty in producing the product. In recent years, to solve this problem,
치특이성과 광학활성 특이성을 나타내는 리파아제를 생촉매로 사용하는 반응이 활발히 연구되고 있다.Reactions using lipases as biocatalysts, which have specificity and optical activity specificity, have been actively studied.
또한, 리파아제는 지방 성분의 때를 물에 잘 녹는 지방산 또는 글리세롤로 가수분해시켜 계면활성제의 작용을 용이하게 해주는 기능이 있어 세제, 표백제의 첨가제로 연구되어져 왔지만, 현재까지 사용실적이 미미한 상태이다. 이는 낮은 세정 온도에서 리파아제의 활성이 떨어지는 단점으로 인해, 지방이나 유지성분이 불량하게 혹은 불완전하게 제거되기 때문이다. 본 발명에 따른 리파아제는 신규한 서열을 가진 리파아제로서 산업의 여러 분야에서 사용이 될 수 있다. 본 발명에 따라 제공되는 리파아제는 현재 당업자의 유전자 조작 기술에 의하여 아미노산 서열에 변형이 가능하다. 따라서 상기 서열번호 1 또는 서열번호 2에 따른 리파아제를 기초로 하여서 실질적으로 리파아제의 활성을 가지면서 서열의 변화가 가능하다. 리파아제에 대한 연구를 통하여 리파아제의 활성에 직접인 영향을 주지 않는 부분에 대한 결실, 치환, 부가, 전좌 등이 가능하며 이와 같이 변형된 리파아제도 본 발명의 범주에 들어가는 것이다. 보다 구체적으로 서열번호 1 및 서열번호 2와 85% 이상 유사한 서열을 포함하는 리파아제, 보다 상세하게는 90% 이상 유사한 리파아제, 보다 더 상세하게는 95% 이상 유사한 리파아제, 보다 더욱 더 상세하게는 99% 이상 유사한 리파아제가 본 발명의 리파아제와 실질적으로 동일한 작용효과를 가지는 한 본 발명의 범주안에 포함된다. 이를 본 발명의 리파아제와 "기능적 동등물"이라고 부른다. 기능적 동등물은 효소 중 일부 또는 전부가 치환되거나, 아미노산의 일부가 결실 또는 부가된 아미노산 서열 변형체가 상기 효소 기능을 유지하는 것 모두를 포함된다. 아미노산의 치환은 바람직하게는 보존적 치환이다. 천연에 존재하는 아미노산의 보존적 치환의 예는 다음과 같다; 지방족 아미노산(Gly, Ala, Pro), 소수성 아미노산(Ile, Leu, Val), 방향족 아미노산(Phe, Tyr, Trp), 산성 아미노산(Asp, Glu), 염기성 아미노산(His, Lys, Arg, Gln, Asn) 및 황함유 아미노산(Cys, Met). 아미노산의 결실은 바람직하게는 리파아제 및 에스터라제 효소의 활성에 직접 관여하지 않는 부분에 위치한다. 다만 종래의 공지된 리파아제를 본 발명의 범주에 포함하려는 것은 아니다.  In addition, lipase has been studied as an additive for detergents and bleaching agents because it has a function of hydrolyzing fatty components with fatty acids or glycerol, which are soluble in water, to facilitate the action of surfactants. This is because of the disadvantage of poor activity of lipase at low cleaning temperatures, poor or incomplete removal of fats or fats and oils. Lipases according to the invention can be used in various fields of industry as lipases with novel sequences. Lipases provided according to the present invention are currently capable of modification to amino acid sequences by genetic manipulation techniques of those skilled in the art. Therefore, based on the lipase according to SEQ ID NO: 1 or SEQ ID NO: 2 it is possible to change the sequence while having substantially the activity of the lipase. Through the study of lipases, deletions, substitutions, additions, translocations, and the like that do not directly affect the activity of lipases are possible, and thus modified lipases fall within the scope of the present invention. More specifically, a lipase comprising a sequence at least 85% similar to SEQ ID NO: 1 and SEQ ID NO: 2, more specifically at least 90% similar lipase, more particularly at least 95% similar lipase, even more specifically 99% Similar lipases are included within the scope of the present invention as long as they have substantially the same effect as the lipase of the present invention. This is referred to as the "functional equivalent" of the lipase of the present invention. Functional equivalents include all in which some or all of the enzymes are substituted, or amino acid sequence variants in which some or all of the amino acids are deleted or added to maintain the enzyme function. Substitutions of amino acids are preferably conservative substitutions. Examples of conservative substitutions of amino acids present in nature are as follows; Aliphatic amino acids (Gly, Ala, Pro), hydrophobic amino acids (Ile, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp, Glu), basic amino acids (His, Lys, Arg, Gln, Asn ) And sulfur-containing amino acids (Cys, Met). Deletion of amino acids is preferably located in portions not directly involved in the activity of lipase and esterase enzymes. However, conventionally known lipases are not intended to be included in the scope of the present invention.
본 발명의 제 2 의 실현 형태는 상기 서열번호 1 또는 서열번호 2의 리파아제를 암호화하는 유전자 서열이다. 보다 구체적으로 서열번호 3 또는 서열번호 4의 핵산서열을 가지는 유전자 서열이다. 본 발명에 따라 제공되는 리파아제 핵산 서열은 코돈의 축퇴성에 의해 다양한 형태의 유전자 서열이 있을 수 있다. "코돈 축퇴성"이란 상기 자연 발생의 서열과는 상이하나 본 발명에 개시된 자연 발생의 리파아제와 동일한 서열의 폴리펩타이드를 암호화하는 모든 핵산서열을 의미한다. 따라서 상기 서열번호 1 또는 서열번호 2의 리파아제 또는 이의 기능적 동등물을 암호화 하는 유전자 서열은 본 발명의 범주에 속한다. A second embodiment of the present invention is a gene sequence encoding the lipase of SEQ ID NO: 1 or SEQ ID NO: 2. More specifically, it is a gene sequence having a nucleic acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4. Lipase nucleic acid sequences provided according to the invention may have various forms of gene sequences due to the degeneracy of the codons. By "codon degenerate" is meant any nucleic acid sequence that encodes a polypeptide that differs from the naturally occurring sequence but is identical to the naturally occurring lipase disclosed herein. Therefore, the gene sequence encoding the lipase of SEQ ID NO: 1 or SEQ ID NO: 2 or a functional equivalent thereof is within the scope of the present invention.
본 발명의 제 3 의 실현 형태는 상기 서열번호 1 또는 서열번호 2의 리파아제를 암호화하는 유전자를 포함하는 재조합 벡터이다. 본 발명에서 사용되는 벡터라는 용어는 또다른 핵산을 그것에 결합시켜 이송시킬 수 있는 핵산 분자를 의미한다. 본 발명의 재조합 벡터는 발현 벡터일 수 있으며, 발현벡터란 상기 벡터에 의해 운반되는 각 재조합형 유전자에 의해 암호화되는 단백질을 합성시킬 수 있는 플라스미드, 코스미드 또는 파아지를 포함한다. 바람직한 벡터는 그것이 결합된 핵산을 자기 복제 및 발현시킬 수 있는 벡터일 수 있다. A third embodiment of the present invention is a recombinant vector comprising a gene encoding the lipase of SEQ ID NO: 1 or SEQ ID NO: 2. The term vector, as used herein, refers to a nucleic acid molecule capable of binding and transferring another nucleic acid thereto. The recombinant vector of the present invention may be an expression vector, which includes a plasmid, cosmid or phage capable of synthesizing the protein encoded by each recombinant gene carried by the vector. Preferred vectors may be vectors that can self replicate and express the nucleic acid to which they are bound.
이하 본 발명을 실시예를 통하여 자세히 설명한다. 그러나 본 발명의 실시예는 본 발명의 권리범위를 한정하는 것이 아니며, 본 발명의 권리범위는 청구범위에 의하여 정하여진다.Hereinafter, the present invention will be described in detail through examples. However, embodiments of the present invention do not limit the scope of the present invention, the scope of the present invention is defined by the claims.
(실시예 1)(Example 1)
벌레 균주 및 배양Worm Strains and Cultures
본 발명에 사용된 야생형 C. elegans 는 Bristol strain N2 (Brenner, 1974)이다. N2 및 돌연변이들은 NGM 플레이트에서 20℃ 로 키웠다. ire-1(v33) 및 hsp-4(gk514) 돌연변이 균주들은 CGC (Minneapolis, MN)로부터 얻었다.Wild type C. elegans used in the present invention is Bristol strain N2 (Brenner, 1974). N2 and mutations were raised to 20 ° C. in NGM plates. ire-1 (v33) and hsp-4 (gk514 ) mutant strains were obtained from CGC (Minneapolis, MN).
형질전환 균주의 제조Preparation of Transgenic Strains
fil-1 및 fil-2 를 장내에서 일정하게 발현시키기 위하여, fil-1 및 fil-2 cDNA를 act-5 유전자의 상위(upstream) 2kb 프로모터와 융합시키고, pPD95.77 벡터에 서브클론하였다. fil-1 cDNA, fil-2 cDNA 및 act-5 프로모터 단편들은 각각 fil-1 cDNA-1(서열번호 5), fil-1 cDNA-2 프라이머(서열번호 6), fil-2 cDNA-1(서열번호 7), fil-2 cDNA-2 프라이머(서열번호 8), 및 act-5 pro-1(서열번호 9), act-5 pro-2 프라이머(서열번호 10)를 사용하여 증폭시켰다(서열번호 11 내지 14는 벡터상에서 fil-1 및 fil-2를 증폭시키기 위한 서열이다). 발현 연구를 위해 fil-1 및 fil-2의 프로모터 및 ORF를 각각 fil-1 geno-1(서열번호 15), fil-1 geno-2(서열번호 16) 및 fil-2 geno-1(서열번호 17), fil-2 geno-2 프라이머(서열번호 18)로 GFP리포터 플라스미드에 클로닝하였다. To consistently express fil-1 and fil-2 in the gut , fil-1 and fil-2 cDNA were fused with the upstream 2 kb promoter of the act-5 gene and subcloned into the pPD95.77 vector. The fil-1 cDNA, fil-2 cDNA, and act-5 promoter fragments were fil-1 cDNA-1 (SEQ ID NO: 5), fil-1 cDNA-2 primer (SEQ ID NO: 6), and fil-2 cDNA-1 (SEQ ID NO: 6). Number 7), fil-2 cDNA-2 primer (SEQ ID NO: 8), and act-5 pro-1 (SEQ ID NO: 9), act-5 pro-2 primer (SEQ ID NO: 10) (SEQ ID NO: 11 to 14 are sequences for amplifying fil-1 and fil-2 on vectors). For expression studies, the promoters and ORFs of fil-1 and fil-2 were fil-1 geno-1 (SEQ ID NO: 15), fil-1 geno-2 (SEQ ID NO: 16), and fil-2 geno-1 (SEQ ID NO: 17) and cloned into GFP reporter plasmid with fil-2 geno-2 primer (SEQ ID NO: 18).
RNARNA i i 섭취 실험 방법Intake experiment method
fil-1 및 fil-2 를 암호화하는 cDNA를 각각 fil-1 RNAi-1(서열번호 19), fil-1 RNAi-2 프라이머(서열번호 20) 및 fil-2 RNAi-1(서열번호 21), fil-2 RNAi-2 프라이머(서열번호 22)를 사용하여 cDNA 라이브러리로부터 PCR로 증폭하였다. 증폭된 cDNA를 박테리아 발현벡터 L4440(pPD129.36; 서열번호 25)에 클로닝하였다(도 15). 이중 RNAi 구축물을 만들기 위해, fil-2 cDNA를 이미 fil-1 cDNA를 갖고 있는 벡터 L4440(pPD129.36)에 융합시켰다. ire-1, atf-6, xbp-1, hsp-4 및 pek-1 RNAi 를 위해, MRC (Cambridge, UK)로부터 구입한 RNAi 라이브러리를 사용하였다. 애벌레를 얻기 위해 벌레들을 표백하였다. L4 기에 이를 때까지 동기의(synchronized) 벌레들을 RNAi 플레이트에서 배양하였다. RNAi 의 효율은 적절한 PCR 프라이머들을 사용하여 실시간 Q-PCR 로 확인하였다. cDNAs encoding fil-1 and fil-2 were fil-1 RNAi-1 (SEQ ID NO: 19), fil-1 RNAi-2 primer (SEQ ID NO: 20) and fil-2 RNAi-1 (SEQ ID NO: 21), PCR was amplified from the cDNA library using fil-2 RNAi-2 primer (SEQ ID NO: 22). The amplified cDNA was cloned into bacterial expression vector L4440 (pPD129.36; SEQ ID NO: 25) ( FIG. 15 ). To make a dual RNA i construct, fil-2 cDNA was fused to vector L4440 (pPD129.36), which already had fil-1 cDNA. For ire-1 , atf-6, xbp-1, hsp-4 and pek-1 RNA i , RNA i library purchased from MRC (Cambridge, UK) was used. The worms were bleached to obtain the larvae. Synchronized worms were cultured in RNA i plates until the L4 phase. The efficiency of RNA i was confirmed by real time Q-PCR using appropriate PCR primers.
나일 레드 염색 및 형광 밀도 정량Nile Red Staining and Fluorescence Density Quantitation
나일 레드 파우더(Nile red powder) (N3013, Sigma) 를 아세톤에 500 μg/ml 로 녹였다. 나일 레드 스톡(stock) 용액을 기술된 바와 같이 1X PBS에서 최종농도 0.05 μg/ml 로 희석시켰다(Ashrafi et al., 2003). 벌레들을 고정시키기 전에, 희석한 나일 레드 용액을 이미 OP50 또는 RNAi 박테리아를 도입한 NGM 플레이트의 상부에 첨가하였다. 동기의 애벌레들이 분화하였고, 그들의 염색 표현형질을 L4 기에서 조사하였다. 나일 레드 형광은 AxioPlan II (Zeiss) 현미경 및 Confocal LSM510 system (Zeiss) 을 사용하여 관찰하였다. 이미지들은 로다민(rhodamine) 필터(emission 560 ~ 590 nm)가 있는 AxioCam 카메라를 사용하여 얻었다. 모든 이미지들은 동일한 세팅 및 노출시간을 사용하여 얻었다. 나일 레드의 형광 강도를 정량화하기 위해 Open lab software (Improvision Inc.) 를 이용하였다. 벌레 몸체의 동일한 부분들을 선별하고, 그 부분에서 염색방울들의 강도를 벌레마다 3번씩 측정하였다. 10개 이상의 벌레들의 형광 강도의 평균을 계산하였다.Nile red powder (N3013, Sigma) was dissolved in acetone at 500 μg / ml. Nile red stock solutions were diluted to a final concentration of 0.05 μg / ml in 1 × PBS as described (Ashrafi et al., 2003). Before fixing the worms, diluted Nile Red solution was added to the top of the NGM plate which had already introduced OP50 or RNA i bacteria. Synchronous larvae differentiated and their staining phenotype was examined at L4 phase. Nile red fluorescence was observed using an AxioPlan II (Zeiss) microscope and Confocal LSM510 system (Zeiss). Images were obtained using an AxioCam camera with a rhodamine filter (emission 560-590 nm). All images were obtained using the same settings and exposure times. Open lab software (Improvision Inc.) was used to quantify the fluorescence intensity of Nile Red. Identical parts of the worm body were selected, and the intensity of the stains in the area was measured three times per worm. The average of the fluorescence intensities of 10 or more worms was calculated.
금식(Fasting) 분석Fasting Analysis
종래 알려진 방법으로 표백된 벌레들을 준비하였다(Van Gilst et al., 2005a). OP50 박테리아(bacteria)를 포함한 NGM 플레이트 또는 HT115 박테리아를 포함하는 RNAi 플레이트의 어느 하나에서 동기의 벌레들을 L4 기까지 키웠다. 벌레들을 얻은 후, M9 버퍼로 강하게 씻고 OP50이 없는 NGM 또는 HT115가 없는 RNAi 플레이트에 12시간 동안 두었다(Van Gilst et al., 2005a). 나일 레드 염색 및 RNA 시료의 준비를 위해 4시간마다 벌레들을 수집하였다. Bleached worms were prepared by known methods (Van Gilst et al., 2005a). Synchronous worms were grown to L4 phase either in NGM plates containing OP50 bacteria or RNA i plates containing HT115 bacteria. After worms were obtained, they were strongly washed with M9 buffer and placed in RNA i plates without NGM or HT115 without OP50 for 12 hours (Van Gilst et al., 2005a). Insects were collected every 4 hours for nile red staining and RNA sample preparation.
산소 소비율 분석Oxygen Consumption Rate Analysis
분당 산소소비량을 측정하기 위해, 동기의 N2, ire-1 (v33) 및 hsp-4(gk514) 벌레들을 NGM Lite 배지에서 L4 기까지 배양하였다. 금식 샘플을 만들기 위해 절반의 벌레들을 빈 NGM Lite 배지에서 8시간 동안 획득 및 배양시켰다. 벌레들을 측정 직전에 획득하고, 산소-포화 M9 버퍼에서 배양시킨 후, 산소 수준을 종래 알려진 방법으로 각 샘플마다 5회 이상 측정하였다(Braeckman et al., 2002). 산소소비율을 Clark 타입 전극센서, YSI 5300A oxygen monitor (YSI Corporation)로 모니터하였다. 단백질 함량은 BCA 방법으로 측정하고, 산소소비율을 평균화하는데 이용하였으며, 이것은 단백질 mg당 시간당 상대적인 O2 μmol 로 계산되었다.To measure oxygen consumption per minute, synchronous N2, ire-1 (v33) and hsp-4 (gk514) worms were incubated up to L4 phase in NGM Lite medium. Half of the worms were obtained and incubated for 8 hours in empty NGM Lite medium to make fasting samples. The worms were obtained immediately before the measurement, incubated in oxygen-saturated M9 buffer, and oxygen levels were measured at least five times for each sample by a known method (Braeckman et al., 2002). Oxygen consumption rate was monitored by Clark type electrode sensor, YSI 5300A oxygen monitor (YSI Corporation). Protein content was measured by the BCA method and used to average oxygen consumption, which was calculated as the relative O 2 μmol per mg protein per hour.
금식 동안의 이동성 시험 및 글루코스 회복 분석Mobility Test and Glucose Recovery Analysis During Fasting
Bristol N2, ire-1(v33) 및 hsp-4(gk514)벌레들은 종래 보고된 바와 같이 싱크로나이즈시켰고(Van Gilst et al., 2005a) NGM Lite 플레이트에서 번식했다. L4 기에 이른 후, 벌레들을 S-basal 로 획득하고 OP50 박테리아를 제거하기 위해 강하게 씻었다. 각각의 균주는 20 ml S-basal 버퍼와 함께 50 ml 플라스크에 옮기고, 쉐이킹 인큐베이터에서 20℃로 배양하였다. 굽힘정도(bending rate)를 측정하기 위해 매 2시간마다 벌레가 있는 1 ml 의 배양액을 24-웰 조직배양디시(tissue culture dish)의 웰에 피펫팅하였다. 금식 동물의 운동성을 측정하기 위해, 액체 배지에서 벌레들의 분당 몸 굽힘을 세었다(Janiesch et al., 2007). 금식 벌레들의 에너지 수준을 회복하기 위하여, D-글루코스 파우더(G7021, Sigma)를 S-basal 에 100 mM로 녹였다. 글루코스를 8시간 금식한 벌레들을 포함한 S-basal 에 최종농도 5 mM로 녹였다(Schulz et al., 2007). 8시간 금식 벌레들에 대해 5mM 글루코스를 2 ~ 3 시간 동안 다시 섭식시켰다. 사진은 동일한 세팅의 Sony 디지털카메라로 찍었으며 동작파일들은 Dimis-M optical system (Siwon Optical technology, Korea)을 이용하여 캡쳐하였다.Bristol N2, ire-1 (v33) and hsp-4 (gk514) worms were synchronized as previously reported (Van Gilst et al., 2005a) and propagated on NGM Lite plates. After reaching the L4 phase, worms were obtained S-basal and washed strongly to remove OP50 bacteria. Each strain was transferred to a 50 ml flask with 20 ml S-basal buffer and incubated at 20 ° C. in a shaking incubator. To measure the bending rate, 1 ml of worm-containing culture was pipetted into wells of a 24-well tissue culture dish every 2 hours. To measure the motility of fasted animals, the body bows per minute of the worms were counted in liquid medium (Janiesch et al., 2007). To restore the energy levels of fasting worms, D-glucose powder (G7021, Sigma) was dissolved in S-basal at 100 mM. Glucose was dissolved in the final concentration of 5 mM in S-basal containing worms fasting for 8 hours (Schulz et al., 2007). 5 mM glucose was ingested again for 2-3 hours for 8 hour fasting worms. Photos were taken with Sony digital cameras with the same settings, and motion files were captured using a Dimis-M optical system (Siwon Optical technology, Korea).
전체 트리아실글리세롤 정량 분석Total Triacylglycerol Quantitation
L1-기 동물들의 동기(synchronous) 개체군을 얻기 위하여, 알(Egg)들을 상술한대로 준비하고 M9 버퍼에서 밤새 부화하도록 하였다. 그 후 선충들을 E. coli OP50으로 덮힌 NGM 플레이트에 옮겨 L4기까지 키웠고, 금식검정(starvation assay)을 수행하였다. 선충을 액체 질소에서 신선하게 얼리고, 더 처리될 때까지 -80℃에서 보관하였다. 약 30 mg 선충들의 무게를 재고, 질소-냉각 막자사발에서 250 μl 의 냉각 포스페이트 버퍼와 함께 갈았다. 용해물을 깨끗하게 하기 위해 추출물들을 12,000 x g 로 7분간 원심분리하였다. 지방 함량은 종래 보고된 바와 같이 상용화된 트라이글리세라이드(triglyceride) 측정키트(Biovision Inc.)로 측정하였고(Ristow et al., 2000), 동물들의 그람 무게단위로 평균화하였다. 각각의 처리조건 및 정해진 시간마다, 적어도 3개의 독립적으로 생성된 생물학적 시료들을 얻었고, 각각의 시료마다 중복된 용해물들을 준비하고 준비된 각 용해물마다 중복측정을 하였다.To obtain a synchronous population of L1-phase animals, eggs were prepared as described above and allowed to incubate overnight in M9 buffer. Nematodes were then transferred to NGM plates covered with E. coli OP50 and grown up to L4 phase, and starvation assays were performed. Nematodes were freshly frozen in liquid nitrogen and stored at −80 ° C. until further treatment. Approximately 30 mg nematodes were weighed and ground with 250 μl of cold phosphate buffer in a nitrogen-cooled mortar. Extracts were centrifuged at 12,000 x g for 7 minutes to clear the lysate. Fat content was measured with a commercially available triglyceride assay kit (Biovision Inc.) as reported previously (Ristow et al., 2000) and averaged in gram weights of animals. At each treatment condition and at defined times, at least three independently generated biological samples were obtained, and duplicate lysates were prepared for each sample and duplicate measurements were made for each prepared lysate.
마이크로 어레이 및 정량적 실시간 PCR 분석 Microarray and Quantitative Real-Time PCR Analysis
동기의(synchronized) L4 벌레들은 상술한 금식검정 프로토콜을 사용하여 잘 섭식한 것과 6 시간 금식 시료로 나누어진다. RNA는 Trizol 시약(Invitrogen) 을 이용한 냉동법(freeze-thaw method)으로 추출하고 RNeasy 미니 키트 (Qiagen)를 사용하여 정제하였다. 모든 마이크로어레이 실험에 C. elegans Affymetrix 칩을 사용하였다(www.affymetrix.com). 마이크로어레이 데이터를 확인하기 위하여, 정량적 실시간 PCR 실험을 수행하였다. 생산자의 프로토콜에 따라 트리졸 시약 (Invitrogen)으로 총 RNA를 추출하였다. cDNA는 랜덤 헥사머(random hexamer)를 사용하여 RevertAid M-MuLV 역전사효소(Fermentas, Canada)로 합성하였고, 유전자 특이적 프라이머들 및 MyIQ real-time PCR detection system (Bio-Rad Laboratories)에 의한 SYBR Green I (BioWhittaker Molecular Applications) 을 사용하여 PCR 증폭시켰다. 상대적인 mRNA 양을 C. elegans act-1/3 mRNA에 대해 표준화시킨 후 계산하였다. Synchronized L4 worms are divided into well fed and 6 hour fast samples using the fasting protocol described above. RNA was extracted by freeze-thaw method using Trizol reagent (Invitrogen) and purified using RNeasy mini kit (Qiagen). C. elegans Affymetrix chips were used for all microarray experiments (www.affymetrix.com). To confirm microarray data, quantitative real-time PCR experiments were performed. Total RNA was extracted with Trizol Reagent (Invitrogen) according to the producer's protocol. cDNA was synthesized with RevertAid M-MuLV reverse transcriptase (Fermentas, Canada) using random hexamer, SYBR Green by gene specific primers and MyIQ real-time PCR detection system (Bio-Rad Laboratories) PCR amplification using I (BioWhittaker Molecular Applications). Relative mRNA amounts were calculated after normalization to C. elegans act-1 / 3 mRNA.
전체 자유 지방산 및 글리세롤 정량 분석 Quantitative analysis of total free fatty acids and glycerol
L1-기의 동기 개체군 동물들을 얻기 위해 알들을 준비하고 M9 버퍼에서 밤새 부화시켰다. 그 후 선충을 E. coli OP50으로 덮힌 NGM 플레이트에 옮긴 후, L4 기까지 키우고, 금식검정을 하였다. 선충들은 액체 질소에서 신선하게 얼리고 더 처리할 때까지 -80°C에 저장하였다. 약 30 mg 의 선충의 무게를 재고 , 질소-냉각 막자사발에서 250 μl 의 냉각 포스페이트 버퍼와 함께 갈았다. 용해물을 깨끗하게 하기 위해 추출물들을 12,000 x g 로 7분간 원심분리하였다. 자유지방산(Roche), 및 글리세롤(Sigma) 함량은 종래 보고된 바와 같이 상용화된 측정키트(Biovision Inc.)로 측정하였고(Ristow et al., 2000), BCA법으로 측정한 단백질 함량에 대해 평균화하였다. 각각의 처리조건 및 정해진 시간마다, 적어도 2개의 독립적으로 생성된 생물학적 시료들을 얻었고, 각각의 시료마다 중복된 용해물들을 준비하고 준비된 각 용해물마다 중복측정을 하였다.Eggs were prepared and incubated overnight in M9 buffer to obtain L1-phase synchronous population animals. Nematodes were then transferred to NGM plates covered with E. coli OP50, grown to L4 phase, and fasted. Nematodes were stored at -80 ° C until freshly frozen in liquid nitrogen and further processed. Approximately 30 mg of nematode was weighed and ground with 250 μl of cold phosphate buffer in a nitrogen-cooled mortar. Extracts were centrifuged at 12,000 x g for 7 minutes to clear the lysate. Free fatty acid (Roche) and glycerol (Sigma) contents were measured by commercialized measurement kit (Biovision Inc.) as reported previously (Ristow et al., 2000) and averaged against protein content measured by the BCA method. . At each treatment condition and at a defined time, at least two independently generated biological samples were obtained, and duplicate lysates were prepared for each sample and duplicate measurements were made for each prepared lysate.
FIL-1 리파아제 활성 분석 FIL-1 Lipase Activity Assay
Furukawa et al. (Furukawa et al., 1982) 에 기술된 방법에 기초하여 실험하였다. 반응들은 사용자 매뉴얼을 따랐다. 반응들은 다양한 양의 E.coli 재조합 단백질의 첨가에 따라 37 °C에서 수행되었다. 20분의 배양 후에, 반응은 2 ml 아세톤의 첨가로 중지시켰고, 흡광도를 412 nm에서 Tecan 분광광도계 (USA)를 이용하여 측정하였다. 지방분해 활성을 계산하기 위하여 반응 부피의 차이를 고려하였다. 지방분해 활성을 나타내는 1 단위(unit)는 실험조건 하에서 분당가수분해된 1 mmol 의 기질을 의미한다.Furukawa et al. Experiments were based on the method described in (Furukawa et al., 1982). The reactions followed the user manual. The reactions were carried out at 37 ° C following the addition of various amounts of E. coli recombinant protein. After 20 minutes of incubation, the reaction was stopped by the addition of 2 ml acetone and the absorbance was measured using a Tecan spectrophotometer (USA) at 412 nm. The difference in reaction volume was taken into account to calculate the lipolytic activity. One unit showing lipolytic activity means 1 mmol of substrate hydrolyzed per minute under experimental conditions.
C. elegans xbp-1 C. elegans xbp-1 전사체의 스플라이스된 형태의 측정 Measurement of Spliced Forms of Transcripts
생산자의 프로토콜에 따라 트리졸 시약 (Invitrogen)으로 총 RNA를 추출하였다. cDNA는 랜덤 헥사머(random hexamer)를 사용하여 RevertAid M-MuLV 역전사효소(Fermentas, Canada)로 합성하였고, 유전자 특이적 프라이머들 및 MyIQ real-time PCR detection system (Bio-Rad Laboratories)에 의한 SYBR Green I (BioWhittaker Molecular Applications) 을 사용하여 PCR 증폭시켰다. 상대적인 mRNA 양을 C. elegans act-1/3 mRNA에 대해 표준화시킨 후 계산하였다. Total RNA was extracted with Trizol Reagent (Invitrogen) according to the producer's protocol. cDNA was synthesized with RevertAid M-MuLV reverse transcriptase (Fermentas, Canada) using a random hexamer, SYBR Green by gene-specific primers and MyIQ real-time PCR detection system (Bio-Rad Laboratories) PCR amplification using I (BioWhittaker Molecular Applications). Relative mRNA amounts were calculated after normalization to C. elegans act-1 / 3 mRNA.
xbp-1 스플라이싱에 대한 프라이머는 다음과 같다; Primers for xbp-1 splicing are as follows;
F 프라이머: GCCTTTGAATCAGCAGTGGGAACAG (서열번호 23) 및F primers: GCCTTTGAATCAGCAGTGGGAACAG (SEQ ID NO: 23) and
R 프라이머: TTCACGCGTTTCTGAAGATG (서열번호 24)R primer: TTCACGCGTTTCTGAAGATG (SEQ ID NO: 24)
결과 result
단기간 금식 동안에During a fast C. elegans ire-1  C. elegans ire-1 에 의한 지방 과립 분해 중재Mediated fat granulation by
포유동물과 마찬가지로, C. elegans 도 금식동안에 활발하게 저장된 지방과립을 소비한다(McKay et al., 2003; Van Gilst et al., 2005b). 본 발명자들은 동기의(synchronized) L4 동물들에서 (24시간 내의) 단기의 금식은 저장된 장내 지방방울들의 양을 매우 감소시킨다는 사실을 일관되게 관찰하였다(도 1A). 이에 나아가 특히 UPR과 관련된 ER 단백질들이 지방과립 이동과 관련된 것인지 알아보기 위하여, 본 발명자들은 3개의 핵심적인 UPR 인식(sensing) 구성성분인 ire-1, atf-6 및 pek-1의 넉다운이 금식의존적 지방과립 분해에 미치는 영향을 조사하였다(Shen et al., 2001, Harding et al., 1999). 본 발명자들은, 대조구 RNAi 박테리아를 공급한, 금식한 야생형(WT) 벌레들은 금식동안 그것들의 저장된 지방과립을 이용한다는 것을 발견하였다. 하지만, ire-1 RNAi 를 처리한 금식 벌레들에서는 지방과립의 수준이 감소되지 않았다(도 1B). 전체 트라이글리세라이드(TG)의 수준은 야생형 동물들에서 약 50% 감소한 반면에, ire-1 넉다운 동물들에서는 같은 조건하에서 약 10% 감소하였다(도 1C). 추가로, 야생형 동물들에서는 금식에 의해 자유 지방산(free fatty acid) 및 글리세롤의 총 양이 증가한 반면, ire-1 RNAi 동물들에서는 그렇지 않았다(도 6). WT 동물들과는 달리, ire-1 넉다운 동물들에서는 금식동안에 지방과립의 수 및 크기 모두 대체로 변하지 않았다(도 1D). 게다가, 유전자 내 약 0.9kb의 결실부위를 갖는 ire-1 (v33) 돌연변이(Shen et al., 2001)를 포함하는 동물들은 금식 12시간 후에도 비슷한 수준의 저장된 지방과립을 유지하기도 하였다(도 7). 반면에, pek-1 또는 atf-6 넉다운 동물들에서는 금식동안에 지방과립 수준이 근소하게 감소하였으며(도 1B), 이는 금식에 의한 지방과립의 분해가 atf-6 또는 pek-1 이 아닌 ire-1 에 의존적임을 시사한다.Like mammals, C. elegans consumes fat granules actively stored during fasting (McKay et al., 2003; Van Gilst et al., 2005b). We consistently observed that short-term fasting (within 24 hours) in synchronized L4 animals greatly reduced the amount of stored intestinal fat droplets ( FIG. 1A ). Furthermore, in order to determine whether the ER proteins associated with UPR are particularly involved in lipo- granular migration, we found that the knockdown of three key UPR-sensing components, ire-1 , atf-6 and pek-1 , was fast-dependent. The effects on lipogranude degradation were investigated (Shen et al., 2001, Harding et al., 1999). The inventors found that fasting wild type (WT) worms, which fed control RNA i bacteria, used their stored fat granules during fasting. However, fasting worms treated with ire-1 RNA i did not reduce the level of fat granules ( FIG. 1B ). The level of total triglycerides (TG) was reduced by about 50% in wild-type animals, while in ire-1 knockdown animals by about 10% under the same conditions ( FIG. 1C ). In addition, the total amounts of free fatty acids and glycerol increased by fasting in wild-type animals, whereas not in ire-1 RNA i animals ( FIG. 6 ). Unlike WT animals, in ire-1 knockdown animals both the number and size of fat granules did not change substantially during fasting ( FIG. 1D ). In addition, animals containing an ire-1 (v33) mutation (Shen et al., 2001) with a deletion of about 0.9 kb in the gene maintained similar levels of stored fat granules after 12 hours of fasting ( FIG. 7 ). . On the other hand, in the pek-1 or atf-6 knockdown animals, the level of fat granules was slightly decreased during fasting ( FIG. 1B ), indicating that the breakdown of fat granules by fasting was not atf-6 or pek-1 but ire-1. Implies dependence on
금식 동안에 금식-유도 지방 과립구의 분해에 On fasting-induced breakdown of fat granulocytes during fasting xbp-1 xbp-1 이 아닌 is not hsp-4hsp-4 가 필수적이다Is essential . .
ER에서, IRE-1 은 ER-존재 분자 샤페론의 하나인, BiP에 의해 조절된다(Bertolotti et al., 2000; Kimata et al., 2004). 본 발명자들은 C. elegans에서 BiP의 상동유전자의 하나인 HSP-4가 금식에 따른 ire-1-매개 조절 지방과립 가수분해에 미치는 영향을 평가하였다. ire-1 넉다운 벌레들과 유사하게, hsp-4 RNAi 동물들 및 hsp-4(gk514) 돌연변이 동물들 모두 금식-유도 지방과립 분해를 막았으며(도 2A 및 2B), 이는 금식에 따른 지방대사의 조절에 있어 hsp-4 가 ire-1 과 유사한 기능이 있음을 암시한다. XBP-1 은 UPR에 있어 잘 알려진 IRE-1의 하위 (downstream) 전사인자(transcription factor)이므로, 본 발명자들은 금식-의존적 지방방울 가수분해에 xbp-1 이 필요한지 시험하였다. 도 2C에 도시된 바와 같이, ire-1 및 hsp-4 RNAi 와 달리, xbp-1 RNAi 는 지방방울의 감소를 방해하지 않았다. 추가로, UPR의 전형적 산물인, xbp-1 mRNA의 스플라이싱(splicing)은 금식 조건에서 일어나지 않았다(도 2D). 이들을 고려하면, PEK-1 또는 ATF-6가 아니라, IRE-1 및 HSP-4가 C.elegans에서 금식-유도 지방과립 가수분해에 결정적인 ER 단백질들이며, 이 역할은 XBP-1과는 무관하다는 것을 알 수 있다.In ER, IRE-1 is regulated by BiP, one of the ER-present molecule chaperones (Bertolotti et al., 2000; Kimata et al., 2004). The present inventors evaluated the effect of HSP-4, one of the homologous genes of BiP in C. elegans , on fasting ire-1 -mediated lipophilic hydrolysis according to fasting. Similar to ire-1 knockdown worms, both hsp-4 RNA i animals and hsp-4 (gk514) mutant animals prevented fasting-induced lipolysis ( FIG. 2A and 2B ), which indicated that fat metabolism following fasting This suggests that hsp-4 has a similar function to ire-1 . Since XBP-1 is a well-known downstream transcription factor of IRE-1 for UPR, we tested whether xbp-1 is required for fast-dependent fat droplet hydrolysis. As shown in Figure 2C, unlike ire-1 and hsp-4 RNA i , xbp-1 RNA i did not interfere with the reduction of fat droplets. In addition, splicing of xbp-1 mRNA, a typical product of UPR, did not occur in fasting conditions ( FIG. 2D ). Considering these, PEK-1 or ATF-6 as well, IRE-1 and HSP-4 fasting in C.elegans - deulyimyeo crucial proteins in the ER induced hydrolysis of fat granules, that this role is independent of XBP-1 Able to know.
ire-1 ire-1 및 And hsp-4hsp-4 의 발현에 의존적인 금식-유도 Fasting-dependent, depending on the expression of fil-1 fil-1 및 And fil-2 fil-2 리파아제의 동정Identification of lipases
xbp-1 은 ire-1 및 hsp-4-의존적 금식-유도 지방과립 이동과 관련이 없으므로, ire-1 은 전형적인 UPR 경로와는 다르게 작용할 수 있다. C. elegans ire-1 및 hsp-4 가 어떻게 지방과립 가수분해를 조절하는지 알아보기 위하여, 본 발명자들은 WT 금식 동물들에 대해 유전체 수준에서 마이크로어레이(microarray) 분석을 수행하였다. 마이크로어레이 및 Q-PCR 로 측정한 결과, 본 발명자들은, fat-7 을 제외하고(Van Gilst et al., 2005b), 지방생성과 관련된 대부분의 유전자들이 금식으로 인해 mRNA 수준에서 상당한 감소(>2배)를 보이지 않는다는 것을 관찰하였다(표 1, 도 8). fat-7 은 지방 합성에 대해 fat-5 및 fat-6 와 중복적이다; 따라서, fat-7 의 단독적인 감소는 전체적인 지질 구성에 영향을 미치지 않을 것으로 보인다(Brock et al., 2006, 2007). 이러한 결과들은 C. elegans에서 지방생성 유전자들의 전체적인 발현이 단기의 금식으로 상당히 영향받지는 않음을 시사한다. 그 후 본 발명자들은 정량적 실시간 PCR(quantitative real-time PCR)로 더 검증하기 위해 금식동안에 적어도 2배의 변화를 보인, 다른 유형의 지질대사(Ashrafi et al., 2003; Van Gilst et al., 2005b)에 관련되어 있는 것으로 추정되는 유전자들을 선별하였다(표 2, 도 9). 흥미롭게도, 본 발명자들은 트라이글리세라이드 가수분해효소(triglyceride hydrolases)로 추정되는, T01C3.4 및 K12B6.3 ("금식-유도 리파아제-1 및 -2" 각각에 대해 fil-1 및 fil-2로 명명)를 암호화하는 2개의 유전자들이 금식에 대해 ire-1-의존적 방식으로 그들의 mRNA 발현수준을 증가시킨다는 것을 발견했다(도 3). FIL-1 및 FIL-2 단백질들 모두 포유동물의 ATGL(Zimmermann et al., 2004), 초파리의 Brummer (Gronke et al., 2005), 및 효모 TGL3 (Athenstaedt and Daum, 2003), TGL4 (Kurat et al., 2006), TGL5 (Athenstaedt and Daum, 2005)와 같은 리파아제 카테고리에 속한다(도 3A). 박테리아에서 발현된 재조합 FIL-1 단백질들을 이용한 생화학적 검정(assay)은 FIL-1이 리파아제 활성을 보인다는 것을 명확히 보여주었다(도 10). 금식-유도 fil-1 및 fil-2 상향조절(upregulation)이 ire-1 또는 hsp-4 의 넉다운에 의해 상당히 저해된다는 것은(도 3B) ire-1 및 hsp-4 모두 금식-유도 fil-1 및 fil-2 유전자 발현에 필요한 상위 요소(upstream factor)들이라는 것을 나타낸다. 반대로, xbp-1 RNAi 는 금식-유도 fil-1 및 fil-2 유전자 발현에 영향을 미치지 않았으며(도 3C), 이는 다시 XBP-1이 금식 조건에서 fil1 및 fil-2를 통한 지방과립 조절에 관련되어 있지 않다는 것을 나타낸다. 추가로, 본 발명자들은 FIL-1 및 FIL-2 단백질들이 금식에 의해 주로 장내에서 유도된다는 것을 관찰하였다(도 3D). xbp-1silverire-1 Andhsp-4Dependent fasting-induced fat granule migrationire-1May work differently than typical UPR pathways.C. elegans ire-1Andhsp-4In order to find out how regulating lipogranules hydrolysis, we performed microarray analysis at the genome level for WT fasted animals. As a result of measurement by microarray and Q-PCR, the inventorsfat-7Except for (Van Gilst et al., 2005b), we observed that most genes associated with adiogenesis do not show a significant decrease (> 2 fold) in mRNA levels due to fasting (Table 1,8).fat-7About fat synthesisfat-5Andfat-6 Is redundant with; therefore,fat-7Is not likely to affect the overall lipid composition (Brock et al., 2006, 2007). These resultsC. elegansSuggests that the overall expression of adipogenic genes is not significantly affected by short-term fasting. We then found other types of lipid metabolism (Ashrafi et al., 2003; Van Gilst et al., 2005b) that showed at least a twofold change during fasting for further verification by quantitative real-time PCR. Genes presumed to be related to the virus were selected (Table 2,9). Interestingly, for the T01C3.4 and K12B6.3 ("fasting-induced lipase-1 and -2", respectively), which are assumed to be triglyceride hydrolases,fil-1Andfil-2Two genes that encode for fastingire-1Have been found to increase their mRNA expression levels in a dependent manner.3). Both FIL-1 and FIL-2 proteins are mammalian ATGL (Zimmermann et al., 2004), Drosophila Brummer (Gronke et al., 2005), and yeast TGL3 (Athenstaedt and Daum, 2003), TGL4 (Kurat et al., 2006), and belongs to lipase categories such as TGL5 (Athenstaedt and Daum, 2005) (Fig 3A). Biochemical assays using recombinant FIL-1 proteins expressed in bacteria clearly showed that FIL-1 exhibited lipase activity (10). Fasting-Inductionfil-1Andfil-2Upregulationire-1orhsp-4Significantly hindered by knockdown ofFig 3B)ire-1Andhsp-4All fasted-inducedfil-1Andfil-2 Upstream factors required for gene expression. Contrary,xbp-1RNAiFasting-inductionfil-1Andfil-2Did not affect gene expression (Fig 3C, Which again means that XBP-1fil1Andfil-2It is not related to the regulation of fat granules through. In addition, we observed that FIL-1 and FIL-2 proteins are mainly induced in the gut by fasting (3D).
FIL-1 및 FIL-2가 금식-유도 지방과립 가수분해에 필요적이고 충분적이다. FIL-1 and FIL-2 are necessary and sufficient for fasting-induced fat granulation hydrolysis.
fil-1 및 fil-2 가 실제로 금식-의존적 지방방울 가수분해에 작용하는지 알아보기 위하여, 본 발명자들은 fil-1 또는 fil-2 의 어느 하나 또는 두 개 모두를 RNAi 넉다운 처리한 금식동물에서 저장된 지방과립 수준을 조사하였다. 도 4A 및 도 11에 도시된 바와 같이, 금식-유도 지방방울 가수분해는 전체적이진 않았지만 부분적으로 fil-1 또는 fil-2 를 억제함으로써 저해되었다. 또한, fil-1 및 fil-2 유전자 모두 억제함으로써 지방과립의 이용이 거의 완전히 저해되었다. 이것은 fil-1 및 fil-2 가 금식동안에 지방과립 가수분해에 필요하다는 것을 암시한다. 추가로 fil-1 및 fil-2 가 기능적인 금식-유도 리파아제임을 확인하기 위하여, fil-1 및 fil-2 를 act-5 프로모터의 조절 하에 장내에서 과발현시켰다(MacQueen et al., 2005). fil-1 또는 fil-2 리파아제의 장-특이적 과발현은 심지어 먹이의 존재하에서도 WT 벌레들에서 일정한 지방과립 가수분해를 자극하였다(도 4B). 추가로, 본 발명자들은 fil-1 및 fil-2 의 과발현이 hsp-4 (gk514) 돌연변이 및 ire-1(RNAi) 동물들의 장내에서 지방과립의 양을 명백히 감소시킴을 관찰하였다(도 4B). 이는 fil-1 및 fil-2 유전자들이 금식-유도 지방과립 가수분해에 있어서 ire-1 및 hsp-4 의 하위(downstream)에서 작용함을 암시한다. 따라서, 이러한 결과들은 fil-1 및 fil-2 가 실제로 그것의 발현이 금식조건 하에서 ire-1 및 hsp-4 를 통해 자극받는 기능적인 리파아제를 암호화한다는 것을 나타낸다. In order to determine if fil-1 and fil-2 actually act on fast-dependent lipolytic hydrolysis, we have stored either or both of fil-1 or fil-2 in fasted animals treated with RNA i knockdown. Lipid granule levels were investigated. As shown in FIGS. 4A and 11, fasting-induced fat hydrolysis was inhibited by partially but not inhibiting fil-1 or fil-2 . In addition, by inhibiting both fil-1 and fil-2 genes, the use of fat granules was almost completely inhibited. This suggests that fil-1 and fil-2 are required for lipogranate hydrolysis during fasting. To further confirm that fil-1 and fil-2 are functional fast-inducing lipases, fil-1 and fil-2 were overexpressed in the gut under the control of the act-5 promoter (MacQueen et al., 2005). Intestinal-specific overexpression of fil-1 or fil-2 lipase stimulated constant granule hydrolysis in WT worms even in the presence of food ( FIG. 4B ). In addition, we observed that overexpression of fil-1 and fil-2 clearly reduced the amount of lipogranules in the gut of hsp-4 (gk514) mutations and ire-1 (RNA i) animals ( FIG. 4B ). . This suggests that the fil- 1 and fil-2 genes act downstream of ire-1 and hsp-4 in fasting-induced lipophilic hydrolysis. Thus, these results indicate that fil-1 and fil-2 actually encode functional lipases whose expression is stimulated via ire-1 and hsp-4 under fasting conditions.
IRE-1/HSP-4-의존 지방 과립구의 가수분해는 금식동안에 에너지원을 제공한다.Hydrolysis of IRE-1 / HSP-4-dependent fat granulocytes provides an energy source during fasting.
ire-1 및 hsp-4 에 의해 조절되는 지방과립 가수분해가 금식중인 벌레에서 몸 전체의 에너지 항상성과 관련이 있는지 알아보기 위하여, 본 발명자들은 WT, ire-1(v33), 및 hsp-4 (gk514) 동물들에서 금식이 그들의 형태와 운동성에 미치는 영향을 주의깊게 조사하였다. 벌레들에게 박테리아를 먹였을때, ire-1(v33) 및 hsp-4 (gk514) 동물들에서 펌핑(pumping) 비율이 WT에 비하여 약간 감소하였지만 통계적으로 유의적인 수준은 아니었다. 금식 동안에, WT 동물들은 거대한 지방과립의 분해로 투명하고 깨끗한 장을 보였으나, ire-1(v33) 및 hsp-4 (gk514) 동물들은 여전히 많은 양의 지방과립을 장내에 갖고 있었다(도 12). 게다가, ire-1(v33) 및 hsp-4(gk514) 돌연변이 동물들은 금식에 대해 사실상 무기력한 모습을 보였으며, 이것은 ire-1 (v33) 돌연변이에서 더 심각하였다. 운동성 측면에서, WT 동물들은 금식 동안에 다른 흠을 보이지 않았으나, ire-1 및 hsp-4 돌연변이 동물들은 운동성이 상당히 감소하였다(도 5A). 이러한 결과들은 저장된 지방과립으로부터의 금식-유도 지방연소 및 이용이 WT 동물들의 운동성을 위한 충분한 에너지원이 될 수 있음을 암시한다. 반면에, ire-1(v33) 및 hsp-4(gk514) 돌연변이 동물들은 fil-1 및 fil-2 와 같은 금식-유도 장내 리파아제의 불완전한 자극 때문에, 그들의 저장된 지방과립으로부터 에너지를 추출 및/또는 이용하지 못하였다. ire-1Andhsp-4 In order to determine if lipogranate hydrolysis regulated by is associated with whole body energy homeostasis in fasting worms,ire-1 (v33),Andhsp-4 (gk514)In animals, the effects of fasting on their form and motility were carefully examined. When you fed the bacteria to the bugs,ire-1(v33) Andhsp-4 (gk514)The pumping rate in animals was slightly reduced compared to WT, but not statistically significant. During the fasting, WT animals showed a clear and clear intestine due to the breakdown of huge fat granules,ire-1 (v33)Andhsp-4 (gk514)Animals still had large amounts of fat granules in their intestines (Figure 12). Besides,ire-1(v33) Andhsp-4(gk514) Mutant animals were virtually lethargic about fasting,ire-1 (v33)It was more severe in the mutation. In terms of motility, WT animals did not show other flaws during fasting,ire-1Andhsp-4Mutant animals had significantly reduced motility (Figure 5A). These results suggest that fasting-induced fat burning and use from stored fat granules can be a sufficient energy source for the mobility of WT animals. On the other hand,ire-1 (v33)Andhsp-4 (gk514)Mutant animalsfil-1Andfil-2Due to the incomplete stimulation of fasting-induced intestinal lipases, such as, they were unable to extract and / or use energy from their stored fat granules.
금식한 WT 과 ire-1 또는 hsp-4 돌연변이 동물들간에 저장 지방과립으로부터 운동성을 위한 에너지를 생성하는 능력에 차이가 있는지 알아보기 위하여, 섭식 및 금식 조건에서 에너지 생성을 위한 미토콘드리아 활성의 지표인 산소소비율을 측정하였다. 이전의 보고(Bishop and Guarente, 2007)와 일치하여, 산소소비율은 WT 동물들에서 금식에 의해 증가하였다(도 5B). 반면에, ire-1 및 hsp-4 돌연변이 동물들에서는 상당히 감소하였다(도 5B). 이것은 금식 동안에 운동을 위한 에너지 생성은 ire-1 및 hsp-4 에 의존적임을 암시한다. 반대로, 섭식상태에서 WT, ire-1, 및 hsp-4 돌연변이 동물들은 유사한 산소소비율을 보였으며(도 5B), 금식 상태에서보다 훨씬 낮았다. 이것은 ire-1 및 hsp-4 돌연변이 동물들이 섭식상태에서는, 아마도 탄수화물과 같은 다른 에너지원을 이용함으로써, WT 동물들과 유사한 정도로 에너지를 생성할 수 있음을 보여준다.To determine if there is a difference in the ability to generate energy for motility from stored fat granules between fasted WT and ire-1 or hsp-4 mutant animals, oxygen is an indicator of mitochondrial activity for energy production in feeding and fasting conditions. The consumption rate was measured. Consistent with previous reports (Bishop and Guarente, 2007), oxygen consumption rate was increased by fasting in WT animals ( FIG. 5B ). On the other hand, there was a significant decrease in ire-1 and hsp-4 mutant animals ( FIG. 5B ). This suggests that energy production for exercise during fasting is dependent on ire-1 and hsp-4 . In contrast, WT, ire-1, and hsp-4 mutant animals in the fed state showed similar oxygen consumption rates ( FIG. 5B ) and were much lower than in the fasted state. This shows that ire-1 and hsp-4 mutant animals can produce energy to a similar extent as WT animals, perhaps by using other energy sources, such as carbohydrates, in the fed state.
보충적인 글루코스는 Supplementary glucose ire-1 ire-1 및And Hsp-4  Hsp-4 돌연변이에 의한 지방 과립구 가수분해의 에너지 결핍을 회복시킨다.It restores the energy deficiency of fat granulocyte hydrolysis by mutation.
ire-1 및 hsp-4 돌연변이 동물들이 저장된 지방과립으로부터 에너지를 이용하지 못하는지를 명확히 알아보기 위하여, 다른 에너지원인 글루코스를 보충함으로써 금식한 ire-1 및 hsp-4 동물들의 운동성이 감소되는 것을 막을 수 있는지 조사하였다. WT 동물들에서, 글루코스의 보충은 섭식 또는 금식 조건 모두에서 운동성을 많이 변화시키지 않았다(도 5C 및 5D). 하지만, 글루코스를 ire-1(v33) 및 hsp-4 (gk514) 돌연변이 모두에 처리한 경우 운동성의 마비 및 감소를 상당히 완화시켰다(도 5C 및 5D; Supplementary video clips 1-9). 삼투변화에 대한 대조구로서 디옥시-글루코스(deoxy-glucose), 사용할 수 없는 글루코스 유사체(non-usable glucose analog), 및 소비톨(sorbitol) 의 존재 하에 시험해 본 결과, 글루코스 존재하에서와 달리 ire-1 및 hsp-4 돌연변이들 모두 운동성을 회복하지 못했다(도 13). 따라서, 이러한 결과들은 돌연변이들 모두 저장된 지방과립들이 아니라 글루코스로부터 운동을 위한 에너지를 효과적으로 얻을 수 있다는 강력한 증거가 되며, 이것은 아마도 fil-1 및 fil-2와 같은 금식-유도 리파아제를 자극하지 못하기 때문일 것이다. ire-1Andhsp-4To clarify whether mutant animals are unable to use energy from stored fat granules, fasting by supplementing glucose, another energy source,ire-1Andhsp-4We investigated whether the animal's motility could be prevented from decreasing. In WT animals, supplementation of glucose did not significantly change motility in both feeding or fasting conditions (Figure 5C And5D). But glucoseire-1 (v33)Andhsp-4 (gk514) Treatment with both mutations significantly alleviated paralysis and reduction of motility (Figure 5C And5D; Supplementary video clips 1-9). Tests in the presence of deoxy-glucose, non-usable glucose analogs, and sorbitol as controls for osmotic changes, unlike in the presence of glucoseire-1Andhsp-4None of the mutations restored motility (13). Thus, these results provide strong evidence that all of the mutations can effectively obtain energy for exercise from glucose rather than stored fat granules, which is probablyfil-1Andfil-2This may be because they do not stimulate fasting-induced lipases.
본 발명에 따른 리파아제는 신규한 서열을 가진 리파아제로서 산업의 여러 분야에서 사용이 될 수 있다.리파아제(lipase, glycerol ester hydrolases)는 가수분해 (hydrolysis), 알콜분해(alcoholysis), 산 분해 (acidolysis), 에스테르화 (esterification), 아미노분해(aminolysis) 등과 같이 다양한 생물 촉매 반응에 관여하고, 수용액 상태에서 뿐만 아니라 유기 용매에서도 활성을 유지하고, 촉매반응 과정에 별도의 보조인자(cofactor)를 필요로 하지 않고, 다양한 기질에 대해 기질 특이성을 나타내고, 광학이성질체중 어느 한쪽에 대해서만 활성을 나타내는 이성질체 선택성을 가지고 있어 산업적 응용성이 높은 효소 중의 하나이다. 특히 식품, 세제, 정밀화학, 화장품 및 환경소재공업등 산업 전반에 걸쳐서 리파아제가 이용되고 있다.Lipases according to the present invention can be used in various fields of the industry as lipases with novel sequences. Lipases (lipases, glycerol ester hydrolases) are hydrolysis, alcohololysis, acidolysis. It is involved in various biocatalytic reactions, such as esterification, aminolysis, etc., maintains activity in organic solvents as well as in aqueous solution, and does not require a separate cofactor in the catalysis process. In addition, it is one of enzymes having high industrial applicability because it exhibits substrate specificity for various substrates and has isomer selectivity showing activity for only one of the optical isomers. In particular, lipases are used throughout the food, detergent, fine chemicals, cosmetics, and environmental materials industries.
참고문헌references
Anderson, R.G. (2003). Joe Goldstein and Mike Brown: from cholesterol homeostasis to new paradigms in membrane biology. Trends in cell biology 13, 534-539.Anderson, R.G. (2003). Joe Goldstein and Mike Brown: from cholesterol homeostasis to new paradigms in membrane biology. Trends in cell biology 13, 534-539.
Ashrafi, K., Chang, F.Y., Watts, J.L., Fraser, A.G., Kamath, R.S., Ahringer, J., and Ruvkun, G. (2003). Genome-wide RNAi analysis of Caenorhabditis elegans fat regulatory genes. Nature 421, 268-272.Ashrafi, K., Chang, F.Y., Watts, J.L., Fraser, A.G., Kamath, R.S., Ahringer, J., and Ruvkun, G. (2003). Genome-wide RNAi analysis of Caenorhabditis elegans fat regulatory genes. Nature 421, 268-272.
Athenstaedt, K., and Daum, G. (2003). YMR313c/TGL3 encodes a novel triacylglycerol lipase located in lipid particles of Saccharomyces cerevisiae. J Biol Chem 278, 23317-23323.Athenstaedt, K., and Daum, G. (2003). YMR313c / TGL3 encodes a novel triacylglycerol lipase located in lipid particles of Saccharomyces cerevisiae. J Biol Chem 278, 23317-23323.
Athenstaedt, K., and Daum, G. (2005). Tgl4p and Tgl5p, two triacylglycerol lipases of the yeast Saccharomyces cerevisiae are localized to lipid particles. J Biol Chem 280, 37301-37309.Athenstaedt, K., and Daum, G. (2005). Tgl4p and Tgl5p, two triacylglycerol lipases of the yeast Saccharomyces cerevisiae are localized to lipid particles. J Biol Chem 280, 37301-37309.
Bertolotti, A., Zhang, Y., Hendershot, L.M., Harding, H.P., and Ron, D. (2000). Dynamic interaction of BiP and ER stress transducers in the unfolded-protein response. Nat Cell Biol 2, 326-332.Bertolotti, A., Zhang, Y., Hendershot, L.M., Harding, H.P., and Ron, D. (2000). Dynamic interaction of BiP and ER stress transducers in the unfolded-protein response. Nat Cell Biol 2, 326-332.
Bishop, N.A., and Guarente, L. (2007). Two neurons mediate diet-restriction-induced longevity in C. elegans. Nature 447, 545-549.Bishop, N.A., and Guarente, L. (2007). Two neurons mediate diet-restriction-induced longevity in C. elegans. Nature 447, 545-549.
Braeckman, B.P., Houthoofd, K., De Vreese, A., and Vanfleteren, J.R. (2002). Assaying metabolic activity in ageing Caenorhabditis elegans. Mech Ageing Dev 123, 105-119.Braeckman, B.P., Houthoofd, K., De Vreese, A., and Vanfleteren, J.R. (2002). Assaying metabolic activity in ageing Caenorhabditis elegans. Mech Ageing Dev 123, 105-119.
Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 71-94.Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 71-94.
Brock, T.J., Browse, J., and Watts, J.L. (2006). Genetic regulation of unsaturated fatty acid composition in C. elegans. PLoS genetics 2, e108.Brock, T.J., Browse, J., and Watts, J.L. (2006). Genetic regulation of unsaturated fatty acid composition in C. elegans. PLoS genetics 2, e108.
Brock, T.J., Browse, J., and Watts, J.L. (2007). Fatty acid desaturation and the regulation of adiposity in Caenorhabditis elegans. Genetics 176, 865-875.Brock, T.J., Browse, J., and Watts, J.L. (2007). Fatty acid desaturation and the regulation of adiposity in Caenorhabditis elegans. Genetics 176, 865-875.
Calfon, M., Zeng, H., Urano, F., Till, J.H., Hubbard, S.R., Harding, H.P., Clark, S.G., and Ron, D. (2002). IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature 415, 92-96.Calfon, M., Zeng, H., Urano, F., Till, J. H., Hubbard, S. R., Harding, H. P., Clark, S. G., and Ron, D. (2002). IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature 415, 92-96.
Eizirik, D.L., Cardozo, A.K., and Cnop, M. (2008). The Role for Endoplasmic Reticulum Stress in Diabetes Mellitus. Endocr Rev.Eizirik, D.L., Cardozo, A.K., and Cnop, M. (2008). The Role for Endoplasmic Reticulum Stress in Diabetes Mellitus. Endocr Rev.
Gregor, M.F., and Hotamisligil, G.S. (2007). Thematic review series: Adipocyte Biology. Adipocyte stress: the endoplasmic reticulum and metabolic disease. J Lipid Res 48, 1905-1914.Gregor, M.F., and Hotamisligil, G.S. (2007). Thematic review series: Adipocyte Biology. Adipocyte stress: the endoplasmic reticulum and metabolic disease. J Lipid Res 48, 1905-1914.
Gronke, S., Mildner, A., Fellert, S., Tennagels, N., Petry, S., Muller, G., Jackle, H., and Kuhnlein, R.P. (2005). Brummer lipase is an evolutionary conserved fat storage regulator in Drosophila. Cell Metab 1, 323-330.Gronke, S., Mildner, A., Fellert, S., Tennagels, N., Petry, S., Muller, G., Jackle, H., and Kuhnlein, R.P. (2005). Brummer lipase is an evolutionary conserved fat storage regulator in Drosophila. Cell Metab 1, 323-330.
Gruninger, T.R., Gualberto, D.G., and Garcia, L.R. (2008). Sensory perception of food and insulin-like signals influence seizure susceptibility. PLoS genetics 4, e1000117.Gruninger, T.R., Gualberto, D.G., and Garcia, L.R. (2008). Sensory perception of food and insulin-like signals influence seizure susceptibility. PLoS genetics 4, e1000117.
Harding, H.P., Zhang, Y., and Ron, D. (1999). Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 397, 271-274.Harding, H. P., Zhang, Y., and Ron, D. (1999). Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 397, 271-274.
Hollien, J., and Weissman, J.S. (2006). Decay of endoplasmic reticulum-localized mRNAs during the unfolded protein response. Science 313, 104-107.Hollien, J., and Weissman, J.S. (2006). Decay of endoplasmic reticulum-localized mRNAs during the unfolded protein response. Science 313, 104-107.
Janiesch, P.C., Kim, J., Mouysset, J., Barikbin, R., Lochmuller, H., Cassata, G., Krause, S., and Hoppe, T. (2007). The ubiquitin-selective chaperone CDC-48/p97 links myosin assembly to human myopathy. Nat Cell Biol 9, 379-390.Janiesch, P.C., Kim, J., Mouysset, J., Barikbin, R., Lochmuller, H., Cassata, G., Krause, S., and Hoppe, T. (2007). The ubiquitin-selective chaperone CDC-48 / p97 links myosin assembly to human myopathy. Nat Cell Biol 9, 379-390.
Kaufman, R.J. (1999). Stress signaling from the lumen of the endoplasmic reticulum: coordination of gene transcriptional and translational controls. Genes Dev 13, 1211-1233.Kaufman, R. J. (1999). Stress signaling from the lumen of the endoplasmic reticulum: coordination of gene transcriptional and translational controls. Genes Dev 13, 1211-1233.
Kimata, Y., Oikawa, D., Shimizu, Y., Ishiwata-Kimata, Y., and Kohno, K. (2004). A role for BiP as an adjustor for the endoplasmic reticulum stress-sensing protein Ire1. J Cell Biol 167, 445-456.Kimata, Y., Oikawa, D., Shimizu, Y., Ishiwata-Kimata, Y., and Kohno, K. (2004). A role for BiP as an adjustor for the endoplasmic reticulum stress-sensing protein Ire1. J Cell Biol 167, 445-456.
Kurat, C.F., Natter, K., Petschnigg, J., Wolinski, H., Scheuringer, K., Scholz, H., Zimmermann, R., Leber, R., Zechner, R., and Kohlwein, S.D. (2006). Obese yeast: triglyceride lipolysis is functionally conserved from mammals to yeast. J Biol Chem 281, 491-500.Kurat, C.F., Natter, K., Petschnigg, J., Wolinski, H., Scheuringer, K., Scholz, H., Zimmermann, R., Leber, R., Zechner, R., and Kohlwein, S.D. (2006). Obese yeast: triglyceride lipolysis is functionally conserved from mammals to yeast. J Biol Chem 281, 491-500.
Lee, A.H., Scapa, E.F., Cohen, D.E., and Glimcher, L.H. (2008). Regulation of hepatic lipogenesis by the transcription factor XBP1. Science 320, 1492-1496.Lee, A. H., Scapa, E. F., Cohen, D. E., and Glimcher, L. H. (2008). Regulation of hepatic lipogenesis by the transcription factor XBP1. Science 320, 1492-1496.
Lipson, K.L., Fonseca, S.G., Ishigaki, S., Nguyen, L.X., Foss, E., Bortell, R., Rossini, A.A., and Urano, F. (2006). Regulation of insulin biosynthesis in pancreatic beta cells by an endoplasmic reticulum-resident protein kinase IRE1. Cell Metab 4, 245-254.Lipson, K.L., Fonseca, S.G., Ishigaki, S., Nguyen, L.X., Foss, E., Bortell, R., Rossini, A.A., and Urano, F. (2006). Regulation of insulin biosynthesis in pancreatic beta cells by an endoplasmic reticulum-resident protein kinase IRE1. Cell Metab 4, 245-254.
Liu, C.Y., Schroder, M., and Kaufman, R.J. (2000). Ligand-independent dimerization activates the stress response kinases IRE1 and PERK in the lumen of the endoplasmic reticulum. J Biol Chem 275, 24881-24885.Liu, C.Y., Schroder, M., and Kaufman, R.J. (2000). Ligand-independent dimerization activates the stress response kinases IRE1 and PERK in the lumen of the endoplasmic reticulum. J Biol Chem 275, 24881-24885.
MacQueen, A.J., Baggett, J.J., Perumov, N., Bauer, R.A., Januszewski, T., Schriefer, L., and Waddle, J.A. (2005). ACT-5 is an essential Caenorhabditis elegans actin required for intestinal microvilli formation. Mol Biol Cell 16, 3247-3259.MacQueen, A.J., Baggett, J.J., Perumov, N., Bauer, R.A., Januszewski, T., Schriefer, L., and Waddle, J.A. (2005). ACT-5 is an essential Caenorhabditis elegans actin required for intestinal microvilli formation. Mol Biol Cell 16, 3247-3259.
McKay, R.M., McKay, J.P., Avery, L., and Graff, J.M. (2003). C elegans: a model for exploring the genetics of fat storage. Dev Cell 4, 131-142.McKay, R. M., McKay, J. P., Avery, L., and Graff, J. M. (2003). C elegans: a model for exploring the genetics of fat storage. Dev Cell 4, 131-142.
Miyanari, Y., Atsuzawa, K., Usuda, N., Watashi, K., Hishiki, T., Zayas, M., Bartenschlager, R., Wakita, T., Hijikata, M., and Shimotohno, K. (2007). The lipid droplet is an important organelle for hepatitis C virus production. Nat Cell Biol 9, 1089-1097.Miyanari, Y., Atsuzawa, K., Usuda, N., Watashi, K., Hishiki, T., Zayas, M., Bartenschlager, R., Wakita, T., Hijikata, M., and Shimotohno, K. (2007). The lipid droplet is an important organelle for hepatitis C virus production. Nat Cell Biol 9, 1089-1097.
Mori, K., Ogawa, N., Kawahara, T., Yanagi, H., and Yura, T. (2000). mRNA splicingmediated C-terminal replacement of transcription factor Hac1p is required for efficient activation of the unfolded protein response. Proc Natl Acad Sci U S A 97, 4660-4665.Mori, K., Ogawa, N., Kawahara, T., Yanagi, H., and Yura, T. (2000). mRNA splicingmediated C-terminal replacement of transcription factor Hac1p is required for efficient activation of the unfolded protein response. Proc Natl Acad Sci U S A 97, 4660-4665.
Okamura, K., Kimata, Y., Higashio, H., Tsuru, A., and Kohno, K. (2000). Dissociation of Kar2p/BiP from an ER sensory molecule, Ire1p, triggers the unfolded protein response in yeast. Biochem Biophys Res Commun 279, 445-450.Okamura, K., Kimata, Y., Higashio, H., Tsuru, A., and Kohno, K. (2000). Dissociation of Kar2p / BiP from an ER sensory molecule, Ire1p, triggers the unfolded protein response in yeast. Biochem Biophys Res Commun 279, 445-450.
Ozcan, U., Cao, Q., Yilmaz, E., Lee, A.H., Iwakoshi, N.N., Ozdelen, E., Tuncman, G., Gorgun, C., Glimcher, L.H., and Hotamisligil, G.S. (2004). Endoplasmic reticulum stress links obesity, insulin action, and type 2 diabetes. Science 306, 457-461.Ozcan, U., Cao, Q., Yilmaz, E., Lee, A.H., Iwakoshi, N.N., Ozdelen, E., Tuncman, G., Gorgun, C., Glimcher, L.H., and Hotamisligil, G.S. (2004). Endoplasmic reticulum stress links obesity, insulin action, and type 2 diabetes. Science 306, 457-461.
Ozcan, U., Yilmaz, E., Ozcan, L., Furuhashi, M., Vaillancourt, E., Smith, R.O., Gorgun, C.Z., and Hotamisligil, G.S. (2006). Chemical chaperones reduce ER stress and restore glucose homeostasis in a mouse model of type 2 diabetes. Science 313, 1137-1140.Ozcan, U., Yilmaz, E., Ozcan, L., Furuhashi, M., Vaillancourt, E., Smith, R. O., Gorgun, C.Z., and Hotamisligil, G.S. (2006). Chemical chaperones reduce ER stress and restore glucose homeostasis in a mouse model of type 2 diabetes. Science 313, 1137-1140.
Patil, C., and Walter, P. (2001). Intracellular signaling from the endoplasmic reticulum to the nucleus: the unfolded protein response in yeast and mammals. Curr Opin Cell Biol 13, 349-355.Patil, C., and Walter, P. (2001). Intracellular signaling from the endoplasmic reticulum to the nucleus: the unfolded protein response in yeast and mammals. Curr Opin Cell Biol 13, 349-355.
Ristow, M., Pfister, M.F., Yee, A.J., Schubert, M., Michael, L., Zhang, C.Y., Ueki, K., Michael, M.D., 2nd, Lowell, B.B., and Kahn, C.R. (2000). Frataxin activates mitochondrial energy conversion and oxidative phosphorylation. Proc Natl Acad Sci USA 97, 12239-12243.Ristow, M., Pfister, M.F., Yee, A.J., Schubert, M., Michael, L., Zhang, C.Y., Ueki, K., Michael, M.D., 2nd, Lowell, B.B., and Kahn, C.R. (2000). Frataxin activates mitochondrial energy conversion and oxidative phosphorylation. Proc Natl Acad Sci USA 97, 12239-12243.
Ron, D., and Walter, P. (2007). Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev Mol Cell Biol 8, 519-529.Ron, D., and Walter, P. (2007). Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev Mol Cell Biol 8, 519-529.
Schulz, T.J., Zarse, K., Voigt, A., Urban, N., Birringer, M., and Ristow, M. (2007). Glucose restriction extends Caenorhabditis elegans life span by inducing mitochondrial respiration and increasing oxidative stress. Cell Metab 6, 280-293.Schulz, T. J., Zarse, K., Voigt, A., Urban, N., Birringer, M., and Ristow, M. (2007). Glucose restriction extends Caenorhabditis elegans life span by inducing mitochondrial respiration and increasing oxidative stress. Cell Metab 6, 280-293.
Shen, X., Ellis, R.E., Lee, K., Liu, C.Y., Yang, K., Solomon, A., Yoshida, H., Morimoto, R., Kurnit, D.M., Mori, K., and Kaufman, R.J. (2001). Complementary signaling pathways regulate the unfolded protein response and are required for C. elegans development. Cell 107, 893-903.Shen, X., Ellis, RE, Lee, K., Liu, CY, Yang, K., Solomon, A., Yoshida, H., Morimoto, R., Kurnit, DM, Mori, K., and Kaufman, RJ (2001). Complementary signaling pathways regulate the unfolded protein response and are required for C. elegans development. Cell 107, 893-903.
Sood, R., Porter, A.C., Ma, K., Quilliam, L.A., and Wek, R.C. (2000). Pancreatic eukaryotic initiation factor-2alpha kinase (PEK) homologues in humans, Drosophila melanogaster and Caenorhabditis elegans that mediate translational control in response to endoplasmic reticulum stress. Biochem J 346 Pt 2, 281-293.Sood, R., Porter, A. C., Ma, K., Quilliam, L. A., and Wek, R. C. (2000). Pancreatic eukaryotic initiation factor-2alpha kinase (PEK) homologues in humans, Drosophila melanogaster and Caenorhabditis elegans that mediate translational control in response to endoplasmic reticulum stress. Biochem J 346 Pt 2, 281-293.
Tirasophon, W., Welihinda, A.A., and Kaufman, R.J. (1998). A stress response pathway from the endoplasmic reticulum to the nucleus requires a novel bifunctional protein kinase/endoribonuclease (Ire1p) in mammalian cells. Genes Dev 12, 1812-1824.Tirasophon, W., Welihinda, A.A., and Kaufman, R.J. (1998). A stress response pathway from the endoplasmic reticulum to the nucleus requires a novel bifunctional protein kinase / endoribonuclease (Ire1p) in mammalian cells. Genes Dev 12, 1812-1824.
Van Gilst, M.R., Hadjivassiliou, H., Jolly, A., and Yamamoto, K.R. (2005a). Nuclear hormone receptor NHR-49 controls fat consumption and fatty acid composition in C. elegans. PLoS Biol 3, e53.Van Gilst, M.R., Hadjivassiliou, H., Jolly, A., and Yamamoto, K.R. (2005a). Nuclear hormone receptor NHR-49 controls fat consumption and fatty acid composition in C. elegans. PLoS Biol 3, e53.
Van Gilst, M.R., Hadjivassiliou, H., and Yamamoto, K.R. (2005b). A Caenorhabditis elegans nutrient response system partially dependent on nuclear receptor NHR-49. Proc Natl Acad Sci U S A 102, 13496-13501.Van Gilst, M.R., Hadjivassiliou, H., and Yamamoto, K.R. (2005b). A Caenorhabditis elegans nutrient response system partially dependent on nuclear receptor NHR-49. Proc Natl Acad Sci U S A 102, 13496-13501.
Wang, X.Z., Harding, H.P., Zhang, Y., Jolicoeur, E.M., Kuroda, M., and Ron, D. (1998). Cloning of mammalian Ire1 reveals diversity in the ER stress responses. EMBO J 17, 5708-5717.Wang, X. Z., Harding, H. P., Zhang, Y., Jolicoeur, E. M., Kuroda, M., and Ron, D. (1998). Cloning of mammalian Ire1 reveals diversity in the ER stress responses. EMBO J 17, 5708-5717.
Zimmermann, R., Strauss, J.G., Haemmerle, G., Schoiswohl, G., Birner-Gruenberger, R., Riederer, M., Lass, A., Neuberger, G., Eisenhaber, F., Hermetter, A., and Zechner, R. (2004). Fat mobilization in adipose tissue is promoted by adipose triglyceride lipase. Science 306, 1383-1386.Zimmermann, R., Strauss, JG, Haemmerle, G., Schoiswohl, G., Birner-Gruenberger, R., Riederer, M., Lass, A., Neuberger, G., Eisenhaber, F., Hermetter, A. , and Zechner, R. (2004). Fat mobilization in adipose tissue is promoted by adipose triglyceride lipase. Science 306, 1383-1386.
Furukawa, I., Kurooka, S., Arisue, K., Kohda, K., and Hayashi, C. (1982). Assays of serum lipase by the "BALB-DTNB method" mechanized for use with discrete and continuous-flow analyzers. Clin Chem 28, 110-113.Furukawa, I., Kurooka, S., Arisue, K., Kohda, K., and Hayashi, C. (1982). Assays of serum lipase by the "BALB-DTNB method" mechanized for use with discrete and continuous-flow analyzers. Clin Chem 28, 110-113.
Ristow, M., Pfister, M.F., Yee, A.J., Schubert, M., Michael, L., Zhang, C.Y., Ueki, K., Michael, M.D., 2nd, Lowell, B.B., and Kahn, C.R. (2000).Ristow, M., Pfister, M.F., Yee, A.J., Schubert, M., Michael, L., Zhang, C.Y., Ueki, K., Michael, M.D., 2nd, Lowell, B.B., and Kahn, C.R. (2000).
Frataxin activates mitochondrial energy conversion and oxidative phosphorylation. Proceedings of the National Academy of Sciences of the United States of America 97, 12239-12243.Frataxin activates mitochondrial energy conversion and oxidative phosphorylation. Proceedings of the National Academy of Sciences of the United States of America 97, 12239-12243.
금식에 의해 유도되는 신규한 리파아제에 대한 서열을 포함하고 있다.It contains sequences for novel lipases induced by fasting.

Claims (8)

  1. 서열번호 1의 리파아제.Lipase of SEQ ID NO: 1.
  2. 서열번호 2의 리파아제.Lipase of SEQ ID NO: 2.
  3. 제 1 항의 리파아제를 암호화하는 리파아제 유전자.Lipase gene encoding the lipase of claim 1.
  4. 제 3 항에 있어서 상기 유전자는 서열번호 3인 것을 특징으로 하는 리파아제 유전자.The lipase gene according to claim 3, wherein the gene is SEQ ID NO.
  5. 제 2 항의 리파아제를 암호화하는 리파아제 유전자.Lipase gene encoding the lipase of claim 2.
  6. 제 5 항에 있어서 상기 유전자는 서열번호 4인 것을 특징으로 하는 리파아제 유전자.The lipase gene according to claim 5, wherein the gene is SEQ ID NO.
  7. 제 3 항 또는 제 4 항중 어느 한 항에 따른 리파아제 유전자를 포함하는 재조합 벡터.Recombinant vector comprising a lipase gene according to claim 3.
  8. 제 5 항 또는 제 6 항중 어느 한 항에 따른 리파아제 유전자를 포함하는 재조합 벡터.Recombinant vector comprising a lipase gene according to any one of claims 5 and 6.
PCT/KR2010/000396 2009-01-22 2010-01-21 Novel lipases induced by fasting WO2010085101A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2009-0005749 2009-01-22
KR1020090005749A KR20100086390A (en) 2009-01-22 2009-01-22 New lipase induced by fasting

Publications (3)

Publication Number Publication Date
WO2010085101A2 WO2010085101A2 (en) 2010-07-29
WO2010085101A3 WO2010085101A3 (en) 2010-11-18
WO2010085101A9 true WO2010085101A9 (en) 2013-03-14

Family

ID=42356332

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2010/000396 WO2010085101A2 (en) 2009-01-22 2010-01-21 Novel lipases induced by fasting

Country Status (2)

Country Link
KR (1) KR20100086390A (en)
WO (1) WO2010085101A2 (en)

Also Published As

Publication number Publication date
WO2010085101A2 (en) 2010-07-29
WO2010085101A3 (en) 2010-11-18
KR20100086390A (en) 2010-07-30

Similar Documents

Publication Publication Date Title
Radyuk et al. The peroxiredoxin gene family in Drosophila melanogaster
Sanders et al. Blood meal induces global changes in midgut gene expression in the disease vector, Aedes aegypti
Zito et al. Oxidative protein folding by an endoplasmic reticulum-localized peroxiredoxin
Bota et al. Protein degradation in mitochondria: implications for oxidative stress, aging and disease:: a novel etiological classification of mitochondrial proteolytic disorders
Aoyama et al. Structure and function of choline kinase isoforms in mammalian cells
Choi et al. The Saccharomyces cerevisiae FAT1 gene encodes an acyl-CoA synthetase that is required for maintenance of very long chain fatty acid levels
Gelmedin et al. Molecular characterisation of MEK1/2-and MKK3/6-like mitogen-activated protein kinase kinases (MAPKK) from the fox tapeworm Echinococcus multilocularis
Arai Platelet-activating factor acetylhydrolase
Akimoto et al. O-GlcNAc modification of nucleocytoplasmic proteins and diabetes
Rivera-Pérez et al. Purification and characterization of an intracellular lipase from pleopods of whiteleg shrimp (Litopenaeus vannamei)
Saitoh et al. Spatiotemporal localization of D-amino acid oxidase and D-aspartate oxidases during development in Caenorhabditis elegans
US20180105860A1 (en) Muteins of the pyrroline-5-carboxylate reductase 1
Alves-Bezerra et al. Long-chain acyl-CoA synthetase 2 knockdown leads to decreased fatty acid oxidation in fat body and reduced reproductive capacity in the insect Rhodnius prolixus
Derewenda et al. PAF-acetylhydrolases
Kawabe et al. Molecular cloning of calnexin and calreticulin in the Pacific oyster Crassostrea gigas and its expression in response to air exposure
Chen et al. The E3 ubiquitin ligase gp78 protects against ER stress in zebrafish liver
Luz et al. Protein disulfide isomerase: a multifunctional protein of the endoplasmic reticulum
Hu et al. Molecular characterization of a novel Clonorchis sinensis secretory phospholipase A2 and investigation of its potential contribution to hepatic fibrosis
Smith et al. Specificity and localization of lipolytic activity in adult Drosophila melanogaster
WO2010085101A9 (en) Novel lipases induced by fasting
Cai et al. Vitellocyte-specific expression of phospholipid hydroperoxide glutathione peroxidases in Clonorchis sinensis
Kumar et al. The peroxisome: an update on mysteries 3.0
Wang et al. Characterization of a phosphotyrosyl phosphatase activator homologue of the parasitic nematode Haemonchus contortus and its immunomodulatory effect on goat peripheral blood mononuclear cells in vitro
Belardinelli et al. Lipase and antibacterial activities of a recombinant protein from the accessory glands of female Phlebotomus papatasi (Diptera: Psychodidae)
Mohammad et al. Functional interaction of bacterial virulence factors of Xenorhabdus nematophila with a calcium-independent cytosolic PLA2 of Spodoptera exigua

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10733654

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10733654

Country of ref document: EP

Kind code of ref document: A2