WO2010084797A1 - Hetero atom-containing compound - Google Patents

Abstract

Disclosed is a hetero atom-containing compound which has an excellent activity as an α₂δ ligand. Specifically disclosed is a compound represented by general formula (I) or a pharmacologically acceptable salt thereof. (In the formula, R¹ represents a hydrogen atom or the like; R² represents a hydrogen atom or the like; R³ represents a hydrogen atom or the like; R⁴ represents a hydrogen atom or the like; R⁵ and R^5' each represents a hydrogen atom or the like; R⁶ represents a hydrogen atom or the like; R⁷ represents a hydrogen atom, a C₁-C₆ alkyl group or a protecting group of carboxy group; and X, Y and Z may be the same or different and each represents a methylene group, an oxygen atom or a sulfur atom.)

Description

Heteroatom-containing compounds

The present invention relates to a heteroatom-containing compound or a pharmacologically acceptable salt thereof, in particular, a compound having activity as an α ₂ δ ligand and having an affinity for the α ₂ δ subunit of a voltage-gated calcium channel or a compound thereof It relates to a pharmacologically acceptable salt. The present invention further relates to a pharmaceutical composition comprising such a compound or a pharmacologically acceptable salt thereof as an active ingredient.

Compounds that exhibit high affinity binding to the α ₂ δ subunit of the voltage-gated calcium channel have been shown to be effective, for example, in the treatment of neuropathic pain (eg, Non-Patent Document 1 and Non-Patent Document 1). Patent Document 2). Here, neuropathic pain is chronic pain caused by nerve tissue damage, etc., and is a disease that significantly impairs the quality of life, such as a patient becoming depressed when a painful attack is severe. .

Currently, several types of α ₂ δ ligands are known as therapeutic agents for such neuropathic pain, and examples of α ₂ δ ligands include gabapentin and pregabalin. Α ₂ δ ligands such as these compounds are useful for the treatment of epilepsy, neuropathic pain and the like (for example, Patent Document 1).

However, for example, in the case of gabapentin, the effective treatment rate by patient self-assessment in postherpetic neuralgia is about 60% (for example, see Non-Patent Document 3), and in the case of pregabalin, the patient's self in painful diabetic neuropathy It is reported that the therapeutic effective rate by evaluation is about 50% (for example, refer nonpatent literature 4).

As other compounds, for example, disclosed in Patent Document 2, Patent Document 3, Patent Document 4, and the like, but the main compounds disclosed in these Patent Documents are saturated hydrocarbon bicyclic compounds. This is clearly different from the compounds of the present invention.

WO04 / 006836 pamphlet WO99 / 21824 pamphlet International Publication No. 01/28978 Pamphlet International Publication No. 02/085839 Pamphlet

Providing a compound that further enhances the therapeutic effect over a compound having activity as an α ₂ δ ligand conventionally used in treatment is considered to have great significance in the treatment.

Therefore, the present invention provides an excellent therapeutic effect and / or preventive effect for disorders such as heteroatom compounds having excellent activity as α ₂ δ ligands or pharmacologically acceptable salts thereof, pain, central nervous system disorders and the like. It is an object of the present invention to provide a pharmaceutical composition having the formula, and a production intermediate.

The present invention is the invention described below.
(1)

[Wherein each substituent is defined as follows.
R ¹ represents a hydrogen atom or a C1-C6 alkyl group.
R ² represents a hydrogen atom, a halogen atom, a C1-C6 alkyl group, a halogeno C1-C6 alkyl group, a C1-C6 alkylthio group, a C1-C6 alkoxy group or a C3-C6 cycloalkyl group.
R ³ represents a hydrogen atom, a halogen atom, a C1-C6 alkyl group, a halogeno C1-C6 alkyl group, a C1-C6 alkylthio group, a C1-C6 alkoxy group or a C3-C6 cycloalkyl group.
R ⁴ represents a hydrogen atom, a C1-C6 alkyl group or a C3-C6 cycloalkyl group.
R ⁵ and R ^{5 ′} represent a hydrogen atom or a C1-C6 alkyl group.
R ⁶ represents a hydrogen atom, a C1-C6 alkyl group or an amino protecting group.
R ⁷ represents a hydrogen atom, a C1-C6 alkyl group or a protecting group for a carboxy group.
X, Y and Z are the same or different and each represents a methylene group, an oxygen atom or a sulfur atom.
However, all of X, Y and Z do not represent a methylene group at the same time. ]
(2)
The compound or pharmacologically acceptable salt thereof according to (1), wherein R ¹ is a hydrogen atom.
(3)
The compound or pharmacologically acceptable salt thereof according to (1) or (2), wherein R ² is a hydrogen atom, a methyl group, an ethyl group, a propyl group or a cyclopropyl group.
(4)
The compound or a pharmaceutically acceptable salt thereof according to any one of (1) to (3), wherein R ³ is a hydrogen atom.
(5)
The compound or a pharmacologically acceptable salt thereof according to any one of (1) to (4), wherein R ⁴ is a hydrogen atom.
(6)
The compound or a pharmaceutically acceptable salt thereof according to any one of (1) to (5), wherein R ⁵ and R ^{5 ′} are a hydrogen atom.
(7)
The compound or a pharmacologically acceptable salt thereof according to any one of (1) to (6), wherein X is an oxygen atom or a sulfur atom, and Y and Z are methylene groups.
(8)
The compound or a pharmaceutically acceptable salt thereof according to any one of (1) to (6), wherein Y is an oxygen atom or a sulfur atom, and X and Z are methylene groups.
(9)
The compound or a pharmacologically acceptable salt thereof according to any one of (1) to (6), wherein Z is an oxygen atom or a sulfur atom, and X and Y are methylene groups.
(10)
10. The compound or a pharmacologically acceptable salt thereof according to any one of (1) to (9), wherein R ⁶ is a hydrogen atom.
(11)
The compound or a pharmacologically acceptable salt thereof according to any one of (1) to (10), wherein R ⁷ is a hydrogen atom.
(12)
The compound according to (1) or a pharmacologically acceptable salt thereof, wherein the compound having the general formula (I) is a compound selected from the group consisting of:
[(1R ^* , 5S ^* , 6R ^* )-6- (aminomethyl) -2-thiabicyclo [3.2.0] hept-6-yl] acetic acid,
[(1R ^* , 5R ^* , 6S ^* )-6-aminomethyl-3-oxabicyclo [3.2.0] hept-6-yl] acetic acid,
[(1R ^* , 5R ^* , 6S ^* )-6-aminomethyl-3-thiabicyclo [3.2.0] hept-6-yl] acetic acid,
[(1R ^* , 5S ^* , 7R ^* )-7-aminomethyl-2-oxabicyclo [3.2.0] hept-7-yl] acetic acid,
[(1R ^* , 5S ^* , 7R ^* )-7-aminomethyl-2-thiabicyclo [3.2.0] hept-7-yl] acetic acid [(1R ^* , 5S ^* , 7R ^* )-7-amino Methyl-3-ethyl-2-thiabicyclo [3.2.0] hept-7-yl] acetic acid In the title of the compound name in the present specification, “ ^* ” indicates that the asymmetric carbon is a racemic mixture. It shows that there is. However, in the case of marking such as “(1S ^* , 5R ^* , 6R ^* ) −”, the relative arrangement indicates the relationship.
(13)
(1)-(12) A pharmaceutical composition comprising the compound according to any one of the above items or a pharmacologically acceptable salt thereof as an active ingredient.
(14)
The pharmaceutical composition according to (13), for treating and / or preventing pain.
(15)
Acute pain, chronic pain, pain arising from soft tissue or peripheral injury, postherpetic neuralgia, occipital neuralgia, trigeminal neuralgia, medullary or intercostal neuralgia, central pain, neuropathic pain, migraine, osteoarthritis or joint Pain associated with rheumatism, pain associated with contusion, sprains or trauma, spinal pain, pain due to spinal cord or brainstem injury, low back pain, sciatica, toothache, myofascial pain syndrome, perineal incision pain, gout pain, burn Related to pain, heart pain, muscle pain, eye pain, inflammatory pain, oral and facial pain, abdominal pain, dysmenorrhea, pain associated with labor pain or endometriosis, somatic pain, nerve or root injury Pain, amputation, painful tics, pain associated with neuroma or vasculitis, pain resulting from diabetic neuropathy (or diabetic peripheral neuropathic pain), pain resulting from chemotherapy-induced neuropathy, atypical facial pain , Neuropathy Lumbar pain, trigeminal neuralgia, occipital neuralgia, medullary or intercostal neuralgia, HIV-related neuralgia, AIDS-related neuralgia, hyperalgesia, burn pain, idiopathic pain, chemotherapy pain, occipital neuralgia, psychogenic pain, gallstones Pain, neuropathic or non-neuropathic pain associated with cancer, phantom limb pain, functional abdominal pain, headache, acute or chronic tension headache, sinus headache, cluster headache, temporal mandibular pain, maxillary sinus pain, Pain resulting from ankylosing spondyloarthritis, postoperative pain, scarring, chronic non-neuropathic pain, fibromyalgia, amyotrophic lateral sclerosis, epilepsy (partial epilepsy, partial seizures in adults, partial seizures in epileptic patients) ), A pharmaceutical composition according to (13) for treating and / or preventing a disease selected from the group consisting of generalized anxiety disorder and restless leg syndrome.
(16)
The pharmaceutical composition according to (13) for treating and / or preventing pain resulting from diabetic neuropathy.

Furthermore, the present invention includes the following inventions.
(17)
Use of the compound according to any one of (1) to (12) or a pharmacologically acceptable salt thereof for producing a pharmaceutical composition.
(18)
(1)-(12) A method for treating and / or preventing pain, comprising administering an effective amount of the compound or pharmacologically acceptable salt thereof according to any one of (1) to a mammal.
It is.

According to the present invention, a heteroatom-containing compound having an excellent activity as an α ₂ δ ligand or a pharmacologically acceptable salt thereof, an excellent therapeutic effect and / or preventive effect for disorders such as pain and central nervous system disorders Pharmaceutical compositions, as well as manufacturing intermediates can be provided.

The “halogen atom” is a fluorine atom, a chlorine atom, a bromine atom or an iodine atom, preferably a fluorine atom or a chlorine atom.

The “C1-C6 alkyl group” is a linear or branched alkyl group having 1 to 6 carbon atoms, such as a methyl group, ethyl group, propyl group, isopropyl group, butyl group, isobutyl group, sec -Butyl group, tert-butyl group, pentyl group, isopentyl group, 2-methylbutyl group, neopentyl group, 1-ethylpropyl group, hexyl group, isohexyl group, 4-methylpentyl group, 3-methylpentyl group, 2-methyl Pentyl group, 1-methylpentyl group, 3,3-dimethylbutyl group, 2,2-dimethylbutyl group, 1,1-dimethylbutyl group, 1,2-dimethylbutyl group, 1,3-dimethylbutyl group, 2 , 3-dimethylbutyl group, 2-ethylbutyl group, etc., preferably methyl group, ethyl group, propyl group, isopropyl group or butyl group.

The “C3-C6 cycloalkyl group” is a cyclic alkyl group having 3 to 6 carbon atoms, and examples thereof include a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, and preferably a cyclopropyl group or Cyclobutyl group.

The “halogeno C1-C6 alkyl group” is a group in which the “halogen atom” is substituted on the “C1-C6 alkyl group”. For example, a trifluoromethyl group, a trichloromethyl group, a difluoromethyl group, a dichloromethyl group , A dibromomethyl group, a fluoromethyl group, a 2,2,2-trifluoroethyl group, a 2,2,2-trichloroethyl group, and the like, and preferably a trifluoromethyl group.
The “C1-C6 alkylthio group” is a group in which a sulfur atom is substituted on the “C1-C6 alkyl group”, and examples thereof include a methylthio group, an ethylthio group, a propylthio group, and the like, and preferably a methylthio group .

The “C1-C6 alkoxy group” is a group in which an oxygen atom is substituted on the “C1-C6 alkyl group”, and examples thereof include a methoxy group, an ethoxy group, and a propoxy group, and a methoxy group is preferable. .

“Carboxy protecting group” means methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, hexyl, bromo-tert-butyl, trichloroethyl Group, benzyl group, p-nitrobenzyl group, o-nitrobenzyl group, p-methoxybenzyl group, p-tert-butylbenzyl group, acetoxymethyl group, propionyloxymethyl group, butyryloxymethyl group, isobutyryloxy Methyl group, valeryloxymethyl group, pivaloyloxymethyl group, acetoxyethyl group, acetoxypropyl group, acetoxybutyl group, propionyloxyethyl group, propionyloxypropyl group, butyryloxyethyl group, isobutyryloxyethyl group , Pivaloyloxyethyl group, hexanoyloxyethyl group, isobutyryloxy Cymethyl group, ethylbutyryloxymethyl group, dimethylbutyryloxymethyl group, pentanoyloxyethyl group, methoxycarbonyloxymethyl group, ethoxycarbonyloxymethyl group, propoxycarbonyloxymethyl group, tert-butoxycarbonyloxymethyl group, methoxy Carbonyloxyethyl group, ethoxycarbonyloxyethyl group, isopropoxycarbonyloxyethyl group, tert-butyldimethylsilyl group, trimethylsilyl group, methoxymethyl group, ethoxymethyl group, propoxymethyl group, isopropoxymethyl group, (2-methylthio) -Ethyl group, 3-methyl-2-butenyl group, 5-indanyl group, 3-phthalidyl group and the like.
“Amino group protecting group” means formyl group, phenylcarbonyl group, methoxycarbonyl group, ethoxycarbonyl group, phenyloxycarbonyl group, 9-fluorenylmethyloxycarbonyl group, adamantyloxycarbonyl group, benzyloxycarbonyl group, Benzylcarbonyl group, benzyl group, benzhydryl group, trityl group, phthaloyl group and the like.

“The pharmacologically acceptable salt” refers to a salt that can be used as a medicine. In the compound of this invention, when it has an acidic group or a basic group, since it can be made into a basic salt or an acidic salt by making it react with a base or an acid, the salt is shown.

The pharmacologically acceptable “basic salt” of the compound of the present invention is preferably an alkali metal salt such as sodium salt, potassium salt or lithium salt; an alkaline earth metal salt such as magnesium salt or calcium salt. Organic base salts such as N-methylmorpholine salt, triethylamine salt, tributylamine salt, diisopropylethylamine salt, dicyclohexylamine salt, N-methylpiperidine salt, pyridine salt, 4-pyrrolidinopyridine salt, picoline salt or glycine salt; Amino acid salts such as lysine salts, arginine salts, ornithine salts, glutamates, and aspartates, and alkali metal salts are preferred.
The pharmacologically acceptable “acid salt” of the compound of the present invention is preferably a hydrohalide salt such as hydrofluoride, hydrochloride, hydrobromide, hydroiodide, Inorganic acid salts such as nitrates, perchlorates, sulfates, phosphates; lower alkane sulfonates such as methanesulfonate, trifluoromethanesulfonate, ethanesulfonate, benzenesulfonate, p- Organics such as aryl sulfonates such as toluene sulfonate, acetate, malate, fumarate, succinate, citrate, ascorbate, tartrate, oxalate, maleate, etc. Acid salts; and amino acid salts such as glycine salt, lysine salt, arginine salt, ornithine salt, glutamate salt, aspartate, and most preferably hydrohalide salt.
The compound of the present invention or a pharmacologically acceptable salt thereof may absorb moisture, adhere to adsorbed water, or become a hydrate when left in the air or by recrystallization. The present invention also includes such various hydrates, solvates and polymorphic compounds.
The compound of the present invention, a salt thereof or a solvate thereof may be a geometric isomer such as cis isomer or trans isomer, tautomer or optical isomer such as d isomer, l isomer, etc., depending on the type or combination of substituents. The compounds of the present invention include all isomers, stereoisomers, and any ratios of these isomers and stereoisomer mixtures, unless otherwise specified. It is. A mixture of these isomers can be separated by a known resolution means.
The compound of the present invention also includes a label, that is, a compound in which one or more atoms of the compound of the present invention are substituted with a radioisotope (for example, ³ H, ¹⁴ C, ³⁵ S, etc.).
The present invention also includes pharmacologically acceptable prodrugs of the compounds of the present invention. A pharmacologically acceptable prodrug is a compound having a group that can be converted into an amino group, a hydroxyl group, a carboxyl group, or the like of the compound of the present invention by hydrolysis or under physiological conditions. Drug-forming groups are described in Prog. Med., Volume 5, pp. 2157-2161, 1985, “Development of Drugs” (Yodogawa Shoten, 1990), Volume 7, Molecular Design pages 163-198 It is the basis of. As the prodrug, more specifically, when an amino group is present in the compound of the present invention, a compound in which the amino group is acylated, alkylated or phosphorylated (for example, the amino group is eicosanoylated). Alanylation, pentylaminocarbonylation, (5-methyl-2-oxo-1,3-dioxolen-4-yl) methoxycarbonylation, tetrahydrofuranylation, pyrrolidylmethylation, pivaloyloxymethylation, tert- In the case where a hydroxyl group is present in the compound of the present invention, a compound in which the hydroxyl group is acylated, alkylated, phosphorylated or borated (for example, The hydroxyl group is acetylated, palmitoylated, propanoylated, pivaloylated, succinylated, fumarylated, alanylated, dimethylated. Le aminomethyl carbonylated compounds and the like.), And the like. In addition, when a carboxy group is present in the compound of the present invention, a compound in which the carboxy group is esterified or amidated (for example, the carboxy group is ethyl esterified, phenyl esterified, carboxymethyl esterified, dimethyl Aminomethyl esterification, pivaloyloxymethyl esterification, ethoxycarbonyloxyethyl esterification, amidation, methylamidated compounds, etc.).

The compound having the general formula (I) of the present invention is preferably a compound having a combination of the following substituents.
(1)
R ¹ is a hydrogen atom,
R ² is a hydrogen atom, a methyl group, an ethyl group, a propyl group or a cyclopropyl group,
R ³ , R ⁴ , R ⁵ and R ^{5 ′} are hydrogen atoms,
X is an oxygen atom or a sulfur atom, Y and Z are methylene groups,
R ⁶ is a hydrogen atom,
R ⁷ is a hydrogen atom.
(2)
R ¹ is a hydrogen atom,
R ² is a hydrogen atom, a methyl group, an ethyl group, a propyl group or a cyclopropyl group,
R ³ , R ⁴ , R ⁵ and R ^{5 ′} are hydrogen atoms,
Y is an oxygen atom or a sulfur atom, X and Z are methylene groups,
R ⁶ is a hydrogen atom,
R ⁷ is a hydrogen atom.
(3)
R ¹ is a hydrogen atom,
R ² is a hydrogen atom, a methyl group, an ethyl group, a propyl group or a cyclopropyl group,
R ³ , R ⁴ , R ⁵ and R ^{5 ′} are hydrogen atoms,
Z is an oxygen atom or a sulfur atom, X and Y are methylene groups,
R ⁶ is a hydrogen atom,
R ⁷ is a hydrogen atom.

The compounds having the general formula (I) of the present invention are more preferably the compounds described in the examples.
(Production method)
The compound of the present invention can be produced by applying various known synthesis methods using characteristics based on the basic skeleton or the type of substituent. Known methods include, for example, the methods described in “ORGANIC FUNCTIONAL GROUP PREPARATIONS”, 2nd edition, ACADEMIC PRESS, INC., 1989, “Comprehensive Organic Transformations”, VCH Publishers Inc., 1989, and the like.
In this case, depending on the type of functional group, it is effective in terms of production technology to protect the functional group with a suitable protecting group at the raw material or intermediate stage, or to replace it with a group that can be easily converted to the functional group. There are cases.
Examples of such a functional group include an amino group, a hydroxyl group, a carboxyl group, and the like, and examples of protective groups thereof include, for example, “Protective Groups in Organic Synthesis (3rd edition, 1999) by TW Greene and PG Wuts. ) ”, And may be appropriately selected and used depending on the reaction conditions. According to such a method, after carrying out the reaction by introducing the substituent, the desired compound can be obtained by removing the protective group or converting it to a desired group as necessary.
Further, a prodrug of the compound of the present invention is produced by introducing a specific group at the raw material or intermediate stage, or reacting with the obtained compound of the present invention, in the same manner as the above protecting group. it can. The reaction can be carried out by applying methods known to those skilled in the art, such as ordinary esterification, amidation, dehydration, hydrogenation and the like.
The production method of the compound of the present invention is described below. However, the manufacturing method is not limited to the following method.
[Method A]

[Wherein R ¹ , R ² , R ³ , R ⁴ , R ⁵ , R ^{5 ′} , X, Y and Z are as defined above, and P represents a protecting group for a carboxy group. ]
[Step A-1]
Step A-1 is a step for producing compound (2) by alkenylation of compound (1) (see J. Org. Chem. 1985, 50, 5167-5176).

Examples of the solvent used include aromatic, ether-based, ester-based, halogenated hydrocarbon-based, nitrile-based, amide-based and sulfoxide-based solvents, preferably ether-based solvents, and more preferably Tetrahydrofuran.

Examples of the auxiliary materials used include Horner Emmons reagent; Dialkylphosphonic acid alkyl ester such as diethylphosphonic acid ethyl ester; Phosphorus ylide reagent; Phosphonium ylide such as ethoxycarbonylmethylenetriphenylphosphorane.

The reagents used include inorganic bases, alkali metal alkoxides, organic bases, organic metal bases, etc., preferably inorganic bases, and more preferably sodium hydride.

The reaction temperature varies depending on the kind of the raw material compound, solvent, auxiliary material, reagent, etc., but is usually 0-100 ° C., preferably 0 ° C.-room temperature.

After completion of the reaction, the target compound of this reaction is collected from the reaction mixture according to a conventional method. For example, if necessary, the reaction is stopped by decomposing excess reagent, the reaction mixture is appropriately neutralized, and if insolubles are present, they are removed by filtration and then mixed with water and ethyl acetate. The organic layer containing the target compound is separated, washed with water and the like, dried over anhydrous magnesium sulfate, anhydrous sodium sulfate, anhydrous sodium hydrogencarbonate and the like, and then the solvent is distilled off. If necessary, the obtained target compound is appropriately combined with conventional methods such as recrystallization and reprecipitation, which are usually used for separation and purification of organic compounds, and applied to chromatography, using an appropriate eluent. To be separated and purified.

Thereafter, usually after completion of the reaction in each step, the target compound of each reaction is collected from the reaction mixture in the same manner as in the post-treatment in step A-1.
[Step A-2]
Step A-2 is a step for producing compound (3) from compound (2).

The solvent used is the same solvent as in step A-1, preferably an ether solvent or a nitrile solvent, and more preferably tetrahydrofuran or acetonitrile.

As an auxiliary material used, for example, there is nitromethane.

Examples of the reagent used include the same reagents as in step A-1, preferably organic bases or organometallic bases, more preferably diazabicycloundecene or tetraalkylammonium halide.

The reaction temperature varies depending on the kind of the raw material compound, solvent, auxiliary raw material, reagent and the like, but is usually 0-100 ° C., preferably 0-60 ° C.
[Step A-3]
Step A-3 is a step for producing compound (4) by reducing compound (3).

Examples of the solvent used include alcohol-based, ester-based, ether-based and aqueous solvents, preferably alcohol-based solvents or water-based solvents, and more preferably ethanol or water.

Examples of the reagent used include radium-carbon, palladium hydroxide-carbon, nickel chloride, tin chloride, sodium borohydride, iron powder, tin, zinc, hydrogen, etc., preferably iron powder or tin.

While the reaction temperature varies depending on the kind of raw material compound, solvent, reagent and the like, it is generally 0-100 ° C., preferably 60-80 ° C.
[Step A-4]
Step A-4 is a step for producing compound (5) from compound (4) by deprotection of the protecting group.

As the solvent to be used, there are the same solvents as in step A-3, preferably an ether solvent or an ester solvent, and more preferably dioxane or ethyl acetate.

The reagent used is an inorganic acid, an inorganic base or an organic acid, more preferably hydrochloric acid, acetic acid or trifluoroacetic acid.

The reaction temperature varies depending on the kind of the raw material compound, solvent, auxiliary raw material, reagent and the like, but is usually 0-100 ° C., preferably 0 ° C.-room temperature.
[Method B]
Method B is a production method in the compound (1) where Z is an oxygen atom or a sulfur atom, X and Y are methylene groups, and R ¹ , R ⁴ and R ⁵ are hydrogen atoms.

[Step B-1]
Step B-1 is a step of producing compound (7) by carrying out alkylation while deprotecting the protecting group (acetyl group) of compound (6) (see Org. Lett. 2003, 5, 901-904). It is.
In the deprotection of the acetyl group, examples of the solvent used include hydrocarbon-based, aromatic-based, ether-based, halogenated hydrocarbon-based, nitrile-based, amide-based, sulfoxide-based, alcohol-based, and water-based solvents. Yes, preferably an alcohol solvent, and more preferably methanol.
The reagent used is sodium hydroxide, lithium hydroxide, sodium methoxide or the like, and preferably sodium methoxide.
While the reaction temperature varies depending on the kind of the raw material compound, solvent, reagent and the like, it is generally 0-100 ° C, preferably 0 ° C-room temperature.
Examples of the solvent used in the alkylation reaction include hydrocarbon, aromatic, ether, halogenated hydrocarbon, nitrile, amide, sulfoxide, alcohol, and aqueous solvents. An alcohol solvent is preferable, and methanol is more preferable.
The reagent used is sodium hydroxide, lithium hydroxide, sodium methoxide or the like, and preferably sodium methoxide.
As an auxiliary material, N, N-dimethylbromoacetamide or the like is used.
While the reaction temperature varies depending on the kind of the raw material compound, solvent, reagent and the like, it is generally 0-100 ° C, preferably 0 ° C-room temperature.
[Step B-2]
Step B-2 is a step of producing compound (8) from compound (7) by cyclization reaction. The cyclization reaction in this step can be performed according to the cyclization reaction described in J. Org. Chem. 1985, 50, 5167-5176.
[Method C]
Method C is a production method in the compound (1) where Y is an oxygen atom or a sulfur atom, X and Z are methylene groups, and R ¹ , R ⁴ and R ⁵ are hydrogen atoms.

[Step C-1]
Step C-1 is a step for producing compound (14) from compound (13) by alkylation.
Examples of the solvent used include hydrocarbon-based, aromatic-based, ether-based, halogenated hydrocarbon-based, nitrile-based, amide-based, sulfoxide-based, alcohol-based, and water-based solvents, preferably amide-based solvents. More preferably, it is dimethylformamide.
Allyl bromide or the like is used as an auxiliary material.
Examples of the base used include inorganic bases, alkali metal alkoxides, organic bases, organic metal bases, etc., preferably inorganic bases, and more preferably potassium carbonate.
The reaction temperature varies depending on the kind of the raw material compound, solvent, reagent and the like, but is usually 0-100 ° C, preferably 0 ° C-room temperature.
[Step C-2]
Step C-2 is a step for producing compound (15) from compound (14) by hydrolysis.
Examples of the solvent used include hydrocarbon-based, aromatic-based, ether-based, halogenated hydrocarbon-based, nitrile-based, amide-based, sulfoxide-based, alcohol-based, and water-based solvents, preferably alcohol-based solvents. More preferably, it is ethanol.
The reagent used is sodium hydroxide, lithium hydroxide, sodium methoxide or the like, and preferably sodium hydroxide.
The reaction temperature varies depending on the kind of the raw material compound, solvent, reagent and the like, but is usually 0-100 ° C, preferably 0 ° C-room temperature.
[Step C-3]
Step C-3 is a step for producing compound (16) from compound (15) by amidation.
Examples of the solvent to be used include hydrocarbon, aromatic, ether, halogenated hydrocarbon, nitrile, amide, sulfoxide, alcohol, and aqueous solvents, preferably halogenated carbonization. A hydrogen-based solvent, and more preferably dichloromethane.
Dimethylamine or the like is used as an auxiliary material.
Moreover, oxalyl chloride, thionyl chloride, etc. are used for activation of carboxylic acid. At that time, it is known that the reaction is accelerated by using a catalytic amount of dimethylformamide or the like.
The reaction temperature varies depending on the kind of the raw material compound, solvent, reagent and the like, but is usually −78 to 100 ° C., preferably −10 ° C. to room temperature.
[Step C-4]
Step C-4 is a step for producing compound (17) from compound (16) by cyclization. This step is performed according to the cyclization reaction described in J. Org. Chem. 1985, 50, 5167-5176, as in the step B-2.
[Method D]
Method D is another method of Method C. In compound (1), Y is an oxygen atom or a sulfur atom, X and Z are methylene groups, and R ¹ , R ⁴ , and R ⁵ are hydrogen atoms. Manufacturing method.

[Step D-1]
Step D-1 is a step for producing compound (24) from compound (23) by amidation. This step is performed by the same method as in step C-3.
[Step D-2]
Step D-2 is a step of producing compound (25) from compound (24) by cyclization. This step is carried out in the same manner as in step B-2 (according to the cyclization reaction described in J. Org. Chem. 1985, 50, 5167-5176).
[E method]
Method E is a production method in the compound (1) where X is an oxygen atom or sulfur atom, Y and Z are methylene groups, and R ¹ , R ⁴ and R ⁵ are hydrogen atoms.

Compound (31) is a compound described in Tetrahedron Letters, 1985, 1791.
[Step E-1]
Step E-1 is a step of producing compound (32) from compound (31) by dechlorination.
The solvent to be used is not particularly limited as long as it does not inhibit the reaction and can dissolve the starting materials to some extent, for example, hydrocarbon, aromatic, ether, halogenated hydrocarbon, nitrile, There are amide-based and sulfoxide-based solvents, preferably hydrocarbon-based solvents, and more preferably cyclohexane.
As an auxiliary material, azobutyroisonitrile, tributyltin hydride, or the like is used.
The reaction temperature varies depending on the kind of the raw material compound, solvent, reagent and the like, but is usually 0-100 ° C., preferably 60-80 ° C.
[F method]
Method F shows another method of Method B and is a method for producing compound (42) from compound (38). L represents a leaving group.

[Step F-1]
Step F-1 is a step of producing compound (39) from compound (38) as a result of hydroxyl group activation reaction.
Examples of the solvent used include hydrocarbon, aromatic, ether, halogenated hydrocarbon, nitrile, amide, sulfoxide, and amine solvents, preferably amine solvents. Yes, more preferably pyridine.
As an auxiliary material, paratoluenesulfonyl chloride or the like is used.
The reaction temperature varies depending on the kind of the raw material compound, solvent, reagent and the like, but is usually −20 ° C.-room temperature, preferably 0 ° C.-room temperature.
[Step F-2]
Step F-2 is a step of producing compound (40) from compound (39) by nucleophilic substitution reaction.
Examples of the solvent used include hydrocarbon-based, aromatic-based, ether-based, halogenated hydrocarbon-based, nitrile-based, amide-based, sulfoxide-based, ketone-based solvents, preferably ketone-based solvents, More preferably, it is acetone.
As an auxiliary material, potassium thioacetate or the like is used.
The reaction temperature varies depending on the kind of the raw material compound, solvent, reagent and the like, but is usually −20 ° C.-room temperature, preferably 0 ° C.-room temperature.
[Step F-3]
Step F-3 is a step of producing compound (41) by hydrolysis of compound (40) and subsequent alkylation, and is performed in the same manner as step B-1.
[Step F-4]
Step F-4 is a step for producing compound (42) by cyclization of compound (41), as described in Step B-2 (described in J. Org. Chem. 1985, 50, 5167-5176). According to the cyclization reaction).

The compound having the general formula (I) obtained by the above method or a pharmacologically acceptable salt thereof shows activity as an α ₂ δ ligand and has an affinity for the α ₂ δ subunit of the voltage-dependent calcium channel. It is useful as an active ingredient in pharmaceutical compositions used for the treatment and / or prevention of pain, central nervous system disorders, and other disorders.

As pain, for example, acute pain, chronic pain, pain resulting from soft tissue or peripheral injury, postherpetic neuralgia, occipital neuralgia, trigeminal neuralgia, medullary or intercostal neuralgia, central nervous pain, neuropathic pain, migraine, Pain associated with osteoarthritis or rheumatoid arthritis, pain associated with contusion, sprain or trauma, spinal pain, pain due to spinal cord or brainstem injury, low back pain, sciatica, tooth pain, myofascial pain syndrome, perineal incision Pain, gout pain, pain resulting from burns, heart pain, muscle pain, eye pain, inflammatory pain, orofacial pain, abdominal pain, dysmenorrhea, labor pain or endometriosis related pain, somatic pain, nerve Or pain associated with radical injury, amputation, painful tics, pain associated with neuroma or vasculitis, pain resulting from diabetic neuropathy (or diabetic peripheral neuropathic pain), resulting from chemotherapy-induced neuropathy pain Atypical facial pain, neuropathic back pain, trigeminal neuralgia, occipital neuralgia, medullary or intercostal neuralgia, HIV-related neuralgia, AIDS-related neuralgia, hyperalgesia, burn pain, idiopathic pain, chemotherapy pain, occipital neuralgia, Psychogenic pain, pain associated with gallstones, neuropathic or non-neuropathic pain associated with cancer, phantom limb pain, functional abdominal pain, headache, acute or chronic tension headache, sinus headache, cluster headache, temporal Mandibular pain, maxillary sinus pain, pain resulting from ankylosing spondyloarthritis, postoperative pain, scar pain, chronic non-neuropathic pain, tendon pain associated with hyperlipidemia, fibromyalgia, fibromyalgia and the like.

Examples of central nervous system disorders include syncope, epilepsy (particularly partial epilepsy, partial seizures in adults, partial seizures in epileptic patients), asphyxia, general anoxia, hypoxia, spinal cord injury, traumatic brain Injury, head trauma, cerebral ischemia, stroke, cerebral vascular disorder, neurocardiac syncope, neurological syncope, irritable carotid sinus, neurovascular syndrome, arrhythmia, mood disorder (such as depression), treatment-resistant depression , Seasonal emotional disorder, childhood depression, premenstrual syndrome, premenstrual dysphoric disorder, hot flash, bipolar disorder, manic depression, behavioral disorder, disruptive behavior disorder, stress-related physical disorder, anxiety disorder, borderline Related to personality disorder, schizophrenia, schizophrenia disorder, paranoid disorder, simple psychotic disorder, shared psychotic disorder, substrate-induced psychotic disorder, anxiety related to psychosis, psychotic mood disorder, schizophrenia Mood disorder, behavioral disorder related to mental retardation, insomnia (primary insomnia, secondary insomnia, transient insomnia, etc.), sleepwalking, sleep deprivation, REM sleep disorder, sleep apnea, hypersomnia Symptom, parasomnia, sleep-wake cycle disorder, jet lag, narcolepsy, generalized anxiety disorder.

Other disorders include, for example, chronic obstructive airway disease, bronchial pneumonia, chronic bronchitis, cystic fibrosis, adult respiratory distress syndrome, bronchospasm, cough, whooping cough, allergy, contact dermatitis, atopic dermatitis , Hives, pruritus, pruritus related to hemodialysis, inflammatory bowel disease, psoriasis, osteoarthritis, cartilage damage, rheumatoid arthritis, psoriatic arthritis, asthma, sunburn, hypersensitivity disorder, Parkinson's disease, Huntington's disease, Alzheimer's disease , Delirium, dementia, amnesia disorder, autism, attention deficit hyperactivity disorder, Reiter syndrome, Down syndrome, Sjogren's syndrome, hypertension, hematopoiesis, postoperative neuroma, benign prostatic hypertrophy, periodontal disease, hemorrhoids, anus Fissure, infertility, reflex sympathetic dystrophy, hepatitis, vasodilation, fibrosis, collagen disease, angina, migraine, Raynaud's disease, dry eye syndrome, Meningitis, spring catarrh, proliferative vitreoretinopathy, multiple sclerosis, amyotrophic lateral sclerosis, pervasive developmental disorder, human immunodeficiency virus infection, HIV encephalopathy, dissociative disorder, eating disorder, ulcer Colitis, Crohn's disease, irritable bowel syndrome, chronic pancreatitis, chronic fatigue syndrome, sudden infant death syndrome, overactive bladder, chronic cystitis, chemotherapy-induced cystitis, primary movement disorder, ataxia, dyskinesia, Spasticity, Tourette syndrome, Scott syndrome, paralysis, extrapyramidal movement disorder, restless leg syndrome, breast pain syndrome, motion sickness, lupus erythematosus, immunodeficiency, inflammatory gastrointestinal disorders, gastritis, proctitis, gastroduodenum Examples include ulcers, peptic ulcers, dyspepsia, vomiting, breast cancer, gastric cancer, gastric lymphoma, ganglion cell blastoma, and small cell carcinoma.

When the pharmaceutical composition containing the compound having the general formula (I) or a pharmacologically acceptable salt thereof is administered to a mammal (eg, human, horse, cow, pig, etc., preferably human), It is administered systemically or locally, orally or parenterally.

The pharmaceutical composition of the present invention can be prepared by selecting an appropriate form according to the administration method and preparing various preparations usually used.

Oral pharmaceutical compositions include tablets, pills, powders, granules, capsules, liquids, suspensions, emulsions, syrups, elixirs and the like. The preparation of such a pharmaceutical composition includes excipients, binders, disintegrants, lubricants, swelling agents, swelling aids, coating agents, plasticizers, stabilizers, antiseptics, anti-fouling agents, ordinarily used as additives. An oxidizing agent, a coloring agent, a solubilizing agent, a suspending agent, an emulsifier, a sweetening agent, a preservative, a buffering agent, a diluent, a wetting agent and the like are appropriately selected as necessary, and are carried out according to a conventional method.

The forms of parenteral pharmaceutical compositions include injections, ointments, gels, creams, poultices, patches, sprays, inhalants, sprays, eye drops, nasal drops, suppositories, and inhalations. There are agents. Preparation of the pharmaceutical composition in such a form involves the use of stabilizers, preservatives, solubilizers, moisturizers, preservatives, antioxidants, flavoring agents, gelling agents, neutralizing agents, and dissolution agents that are commonly used as additives. Adjuvants, buffering agents, isotonic agents, surfactants, colorants, buffering agents, thickeners, wetting agents, fillers, absorption enhancers, suspending agents, binders, etc. are selected as necessary. And carried out in accordance with conventional methods.

The dose of the compound having the general formula (I) or a pharmacologically acceptable salt thereof varies depending on symptoms, age, body weight and the like, but in the case of oral administration, adults (body weight of about 60 kg) 1 to several times a day. As a compound, the compound equivalent is 1-2000 mg per person, preferably 10-600 mg. In the case of parenteral administration, the compound equivalent is 0.1-1000 mg per adult once a day or once per adult. The preferred amount is 1 to 300 mg.

Example 1 [(1R ^* , 5S ^* , 6R ^* )-6- (Aminomethyl) -2-thiabicyclo [3.2.0] hept-6-yl] acetic acid hydrochloride

(Structural formula indicates relative arrangement.)
(1-a) (1R ^* , 5S ^* )-2-thiabicyclo [3.2.0] hept-6-one trinormalbutyltin hydride (4.10 g, 14.1 mmol) heated to 80 ° C., and catalyst To a solution of N, N′-azobisisobutyronitrile (0.03 g) in cyclohexane (25 mL) was added (1R ^* , 5S ^* )-7,7-dichloro-2-thiabicyclo [3.2.0]. A solution of heptane-6-one (0.4 g, 2.0 mmol) in cyclohexane (10 mL) was added dropwise over 10 minutes. After stirring at 80 ° C. for 3 hours, the mixture was allowed to cool, the solvent was distilled off under reduced pressure, and silica gel column chromatography was performed to obtain the title compound as a colorless oil (0.18 g, 69%).
¹ H-NMR (400 MHz, CDCl ₃ ): δ ppm: 1.84-1.96 (1H, m), 2.52-2.57 (1H, m), 2.87-3.02 (3H, m), 3.54-3.63 (1H, m), 4.05-4.15 (2H, m).
(1-b) (1R ^* , 5S ^* )-2-thiabicyclo [3.2.0] hept-6-ylideneacetic acid sodium hydride (63%, 0.26 g, 6. 8 mmol) in tetrahydrofuran (6 mL) was prepared, and a solution of (dimethoxyphosphoryl) tert-butyl acetate (1.49 g, 6.7 mmol) in tetrahydrofuran (6 mL) was added dropwise over 15 minutes, followed by further stirring at 0 ° C. for 35 minutes. . To this solution, a tetrahydrofuran (6 mL) solution of (1R ^* , 5S ^* )-2-thiabicyclo [3.2.0] heptan-6-one (0.30 g, 2.3 mmol) was added dropwise over 10 minutes, Stir at room temperature for 2 hours. Water treatment was performed and extraction was performed using diethyl ether. The obtained organic layer was dried over anhydrous magnesium sulfate, the solvent was distilled off under reduced pressure, and then silica gel chromatography was performed to obtain the title compound as a white solid. (0.42 g, 80%).
¹ H-NMR (500 MHz, CDCl ₃ ): δ ppm: diastereomer mixture 1.48 (9H-a, s), 1.51 (9H-b, s), 1.93 (1H-a, ddt, J = 5.5, 6.5, 12.9 Hz ), 2.00-2.07 (1H-b, m), 2.27 (1H-a, dd, J = 5.1, 12.9Hz), 2.60 (1H-b, ddt, J = 1.6, 13.3, 3.2Hz), 2.68 (1H -b, ddt, J = 2.3, 18.7, 4.5Hz), 2.95-3.03 (1H-a, m), 2.97-3.17 (2H, m), 3.32 (1H-b, ddt, J = 8.3, 18.7, 2.2 Hz), 3.59 (1H-a, dddd, J = 1.5, 2.9, 7.8, 19.5Hz), 3.94-4.28 (2H, m), 5.53-5.56 (1H, m).
(1-c) [(1R ^* , 5S ^* , 6R ^* )-6- (nitromethyl) -2-thiabicyclo [3.2.0] hept-6-yl acetate tert-butyl acetate (1S ^* , 5S ^* )- To a solution of tert-butyl 2-thiabicyclo [3.2.0] hept-6-ylideneacetate (0.42 g, 1.9 mmol) in nitromethane (10 mL) was added 1,8-diazabicyclo [5.4.0] undeca- 7-ene (0.34 g, 2.2 mmol) was added, and the mixture was stirred at 60 ° C. for 4 hours, and further stirred at room temperature overnight. A saturated aqueous potassium dihydrogen phosphate solution was added, followed by extraction with ethyl acetate, and the organic layer was dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure, and the residue was purified by silica gel chromatography to obtain the title compound as a colorless liquid (0.40 g, 73%).
¹ H-NMR (400 MHz, CDCl ₃ ): δ ppm: 1.43 (9H, s), 1.82 (1H, dd, J = 7.0, 14.1 Hz), 1.87-1.98 (1H, m), 2.15 (1H, ddt, J = 5.0, 14.1, 2.2Hz), 2.43 (1H, d, J = 17.4Hz), 2.51 (1H, d, J = 17.4Hz), 2.61 (1H, ddd, J = 2.8, 8.3, 14.0Hz), 2.97-3.10 (2H, m), 3.16 (1H, t, J = 8.6Hz), 3.98 (1H, q, J = 7.7Hz), 4.75 (1H, d, J = 11.7Hz), 4.79 (1H, d , J = 11.7Hz).
(1-d) [(1R ^* , 5S ^* , 6R ^* )-6-{[(tert-butoxycarbonyl) amino] methyl} -2-thiabicyclo [3.2.0] hept-6-yl] acetic acid tert -Butyl [(1R ^* , 5S ^* , 6R ^* )-6- (nitromethyl) -2-thiabicyclo [3.2.0] hept-6-yl acetate tert-butyl acetate (0.40 g, 1.4 mmol) in ethanol (20 mL), iron powder (0.89 g, 15.9 mmol) was added, ammonium chloride (0.11 g, 2.1 mmol) aqueous solution (8 mL) was added, and the mixture was stirred with heating under reflux for 3.5 hours. . After standing to cool, insoluble material was removed by Celite filtration, di-tert-butyl dicarbonate (1.09 g, 5.0 mmol) was added, and the mixture was stirred at room temperature overnight. The solution was concentrated and the residue was diluted with ethyl acetate and water. The organic layer was dried over anhydrous magnesium sulfate, the solvent was distilled off under reduced pressure, and the residue was purified by silica gel column chromatography to obtain the title compound as a white powder (0.30 g, 60%).
¹ H-NMR (400 MHz, CDCl ₃ ): δ ppm: 1.41-1.52 (18H, m), 1.69 (1H, dd, J = 7.2, 13.5 Hz), 1.78-1.89 (1H, m), 2.12-2.18 ( 1H, m), 2.17 (1H, d, J = 14.7Hz), 2.24 (1H, d, J = 14.7Hz), 2.35 (1H, ddd, J = 2.8, 8.3, 13.0Hz), 2.89-3.03 (3H , m), 3.25-3.36 (2H, m), 3.95 (1H, q, J = 7.7Hz), 4.95 (1H, br).
(1-e) [(1R ^* , 5S ^* , 6R ^* )-6-{[(tert-butoxycarbonyl) amino] methyl} -2-thiabicyclo [3.2.0] hept-6-yl] acetic acid hydrochloric acid Salt [(1R ^* , 5S ^* , 6R ^* )-6-{[(tert-butoxycarbonyl) amino] methyl} -2-thiabicyclo [3.2.0] hept-6-yl] tert-butyl acetate (0 .30 g, 0.8 mmol) was dissolved in 4N hydrochloric acid-ethyl acetate solution (25 mL) and stirred at room temperature for 2 hours. The resulting solid was collected by filtration and dried under reduced pressure to give the title compound as a white powder. (0.17 g, 89%).
Mp 184-185 ° C;
¹ H-NMR (500 MHz, D ₂ O): δ ppm: 1.82 (1H, dd, J = 7.3, 13.7 Hz), 1.86-1.97 (1H, m), 2.21-2.27 (1H, m), 2.44-2.50 (1H, m), 2.52 (1H, d, J = 17.1Hz), 2.61 (1H, d, J = 17.1Hz), 3.06-3.17 (3H, m), 3.32 (1H, d, J = 13.2Hz) , 3.39 (1H, d, J = 13.2Hz), 4.09 (1H, q, J = 7.3Hz).
MS (EI ⁺ ): m / z: 201 (M ⁺ )
HRMS (EI ⁺ ) calcd for M ⁺ : 201.0823. Found 201.0826 (0.3 mmu).
Example 2 [(1R ^* , 5R ^* , 6S ^* )-6-aminomethyl-3-oxabicyclo [3.2.0] hept-6-yl] acetic acid

(Structural formula indicates relative arrangement.)
(2-a) 3-allyloxy-N, N-diethylpropionic acid amide of 3-allyloxypropionic acid ethyl (see J. Org. Chem., 30, 1965, p-3099. 4.50 g, 34.6 mmol) To the dichloromethane solution (100 mL) were added oxalyl chloride (4.5 mL, 51.9 mmol) and 2 drops of N, N-dimethylformamide, and the mixture was stirred at room temperature for 3 hours. The solvent was distilled off under reduced pressure, the residue was dissolved in dichloromethane (50 mL), and the mixture was added dropwise to a dichloromethane solution (10 mL) of diethylamine (10.8 mL, 104 mmol) under ice cooling. After returning to room temperature and stirring for 1 hour, the solvent was distilled off under reduced pressure. The residue was diluted with ethyl acetate and washed successively with water, 1N hydrochloric acid, water, saturated aqueous sodium hydrogen carbonate solution, water and brine. The organic layer was dried over anhydrous magnesium sulfate, and the solvent was distilled off under reduced pressure. The residue was purified by silica gel chromatography to give the title compound as a pale yellow oil (4.48 g, 70%).
¹ H-NMR (400 MHz, CDCl ₃ ): δ ppm: 1.12 (3H, t, J = 7.0 Hz), 1.18 (3H, t, J = 7.0 Hz), 2.62 (2H, t, J = 6.7 Hz), 3.33 (2H, q, J = 7.0Hz), 3.38 (2H, q, J = 7.0Hz), 3.78 (2H, t, J = 6.7Hz), 3.99-4.01 (2H, m), 5.15-5.19 (1H , m), 5.25-5.37 (1H, m), 5.86-5.96 (1H, m).
(2-b) (1R ^* , 5R ^* )-3-oxabicyclo [3.2.0] hept-6-ylideneacetic acid tert-butyl 3-allyloxy-N, N-diethylpropionic acid amide (4.48 g, 24.2 mmol) and collidine (3.36 mL, 25.4 mmol) in a benzene solution (100 mL) are heated and refluxed with a benzene solution (50 mL) of trifluoromethanesulfonic anhydride (4.48 mL, 26.6 mmol) for 40 minutes. It was dripped over. After stirring as it was for 2 hours, the solvent was distilled off under reduced pressure, and the residue was diluted with dichloromethane and water and stirred at room temperature for 1 hour. After separation of the reaction solution, the aqueous layer was extracted with dichloromethane, and the organic layer was washed successively with saturated aqueous sodium hydrogen carbonate solution and brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was added to a reaction solution prepared from a solution of tert-butyl dimethylphosphoryl acetate (1.96 mL, 12.1 mmol) in tetrahydrofuran (50 mL) and sodium hydride (> 65% oily, 461 mg, 12.1 mmol), and stirred for 30 minutes. did. Aqueous citric acid solution was sequentially added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with aqueous sodium hydrogen carbonate solution and brine, dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography to obtain the title compound as a pale yellow oily substance (680.0 mg, <26%, E, Z mixture).
¹ H-NMR (400 MHz, CDCl ₃ ): δ ppm: 1.45 (9H, s), 2.45-3.24 (2H, m), 3.51-3.66 (2H, m), 3.87-3.94 (1H, m), 3.94- 4.03 (2H, m), 4.20-4.24 (1H, m), 5.50-5.54 (1H, m).
(2-c) [(1R ^* , 5R ^* , 6S ^* )-6-nitromethyl-3-oxabicyclo [3.2.0] hept-6-yl] tert-butyl acetate (1R ^* , 5R ^* ) -3-Oxabicyclo [3.2.0] hept-6-ylideneacetic acid tert-butyl (680 mg, 3.23 mmol) was dissolved in nitromethane (7 mL) and 1,8-diazabicyclo [5.4.0] undeca −7-ene (0.72 mL, 4.85 mmol) was added, and the mixture was heated with stirring at 65-70 ° C. for 3 hours. After allowing to cool, the mixture was diluted with an aqueous potassium dihydrogen phosphate solution and extracted with ethyl acetate. The organic layer was washed successively with aqueous potassium dihydrogen phosphate solution and brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography to obtain the desired product as a colorless oil (720 mg, 82%).
¹ H-NMR (400 MHz, CDCl ₃ ): δ ppm: 1.44 (9H, s), 1.62 (1H, dd, J = 5.9, 13.3 Hz), 2.26 (1H, ddd, J = 2.0, 9.0, 13.3 Hz) , 2.56 (1H, d, J = 17.6Hz), 2.64 (1H, d, J = 17.6Hz), 2.86 (1H, dt, J = 2.0, 7.0Hz), 2.91-2.99 (1H, m), 3.41 ( 1H, dd, J = 3.0, 4.7Hz), 3.43 (1H, dd, J = 6.3, 11.0Hz), 3.79 (1H, d, J = 9.0Hz), 4.00 (1H, d, J = 11.0Hz), 4.76 (2H, s).
(2-d) [(1R ^* , 5R ^* , 6S ^* )-6- (tert-butoxycarbonylamino) methyl-3-oxabicyclo [3.2.0] hept-6-yl] tert-butyl acetate [(1R ^* , 5R ^* , 6S ^* )-6- (Nitromethyl) -3-oxabicyclo [3.2.0] hept-6-yl] tert-butyl acetate (715 mg, 2.64 mmol) in ethanol ( 10 mL) and water (2 mL), iron powder (1.47 mg, 26.4 mmol) and ammonium chloride (85 mg, 1.58 mmol) were added, and the mixture was stirred with heating under reflux for 5 hours. After allowing to cool, the mixture was diluted with tetrahydrofuran (10 mL), triethylamine (1.1 mL, 7.91 mmol) and di-tert-butyl dicarbonate (1.15 g, 5.27 mmol) were added, and the mixture was stirred at room temperature for 2 hr. After removing unnecessary substances, the filtrate was diluted with ethyl acetate and an aqueous citric acid solution. The organic layer was washed successively with aqueous citric acid solution, saturated aqueous sodium hydrogen carbonate solution and saturated brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel chromatography to give the title compound as a white solid (825 mg, 92%).
¹ H-NMR (400 MHz, CDCl ₃ ): δ ppm: 1.43 (9H, s), 1.44 (9H, s), 1.48-1.54 (2H, m), 1.97 (1H, ddd, J = 2.4, 8.6, 12.5 Hz), 2.32 (1H, d, J = 14.5Hz), 2.37 (1H, d, J = 14.5Hz), 2.62-2.67 (1H, m), 2.89-2.96 (2H, m), 3.27-3.43 (2H , m), 3.74 (1H, d, J = 9.0Hz), 4.08 (1H, d, J = 10.6Hz), 4.96 (1H, broad).
(2-e) [(1R ^* , 5R ^* , 6S ^* )-6-aminomethyl-3-oxabicyclo [3.2.0] hept-6-yl] acetic acid [(1R ^* , 5R ^* , 6S ^* ) -6- (tert-Butoxycarbonylamino) methyl-3-oxabicyclo [3.2.0] hept-6-yl] tert-butyl acetate (820 mg, 2.4 mmol) in 4N hydrochloric acid in ethyl acetate ( 10 mL) and stirred at room temperature for 2 hours, and then the solvent was distilled off under reduced pressure. The residue was dissolved in dichloromethane, triethylamine was added dropwise, and the resulting powder was collected by filtration, washed with dichloromethane and dried to give the title compound as a white solid (361 mg, 81%).
¹ H-NMR (400 MHz, CD ₃ OD): δ ppm: 1.49 (1H, dd, J = 6.3, 12.7 Hz), 1.95-1.98 (1H, m), 2.52 (1H, d, J = 16.4 Hz), 2.59 (1H, d, J = 16.4Hz), 2.72-2.76 (1H, m), 2.93-3.00 (1H, m), 3.11 (1H, d, J = 13.0Hz), 3.17 (1H, d, J = 13.0Hz), 3.31-3.44 (2H, m), 3.73 (1H, d, J = 9.1Hz), 4.14 (1H, d, J = 10.4Hz).
IR (KBr): cm ^-1 : 3148, 2961, 2928, 2853, 2703, 1625, 1572, 1521, 1394, 1381, 1083, 910.
MS (FAB): m / z: 186 (M + H) ⁺ .
Anal.calcd for C ₉ H ₁₅ NO ₃ : C, 58.36; H, 8.16; N, 7.56; Found C, 57.45; H, 7.92; N, 7.49.
Example 3 [(1R ^* , 5R ^* , 6S ^* )-6-aminomethyl-3-thiabicyclo [3.2.0] hept-6-yl] acetic acid

(Structural formula indicates relative arrangement.)
(3-a) 3- (allylthio) -N, N-diethylpropionic acid amide 3-mercaptopropionic acid ethyl (11.67 g, 87.0 mmol), allyl bromide (8.28 mL, 95.7 mmol), potassium carbonate (14.4 g, 104 mmol) was mixed in anhydrous N, N-dimethylformamide (100 mL) and stirred at room temperature for 3 hours. The reaction mixture was diluted with water and extracted with ethyl acetate. The organic layer was washed successively with dilute hydrochloric acid, water, saturated aqueous sodium hydrogen carbonate solution and brine, and dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was dissolved in ethanol (100 mL), 2N aqueous sodium hydroxide solution (100 mL) was added, and the mixture was stirred at room temperature for 2 hr. The reaction mixture was concentrated, the residue was washed with dichloromethane, and the aqueous layer was neutralized with hydrochloric acid. The mixture was extracted with ether, washed with water and brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was dissolved in anhydrous dichloromethane (200 mL), oxalyl chloride (13.9 mL, 160 mmol) was added, and the mixture was stirred at room temperature for 30 min. After adding 2 drops of N, N-dimethylformamide and further stirring for 1 hour, the solvent was distilled off under reduced pressure. The residue was dissolved in dichloromethane (50 mL) and added dropwise to a dichloromethane solution (200 mL) of diethylamine (33.1 mL, 320 mmol) under ice cooling. After returning to room temperature and stirring for 1 hour, the solvent was distilled off under reduced pressure. The residue was diluted with ethyl acetate and washed successively with water, 1N hydrochloric acid, water, saturated aqueous sodium hydrogen carbonate solution, water and brine. The organic layer was dried over anhydrous magnesium sulfate, and the solvent was distilled off under reduced pressure. The residue was purified by silica gel chromatography to give the title compound as a pale yellow oil (19.29 g, 90%).
¹ H-NMR (400 MHz, CDCl ₃ ): δ ppm: 1.12 (3H, t, J = 7.1 Hz), 1.18 (3H, t, J = 7.0 Hz), 2.57 (2H, t, J = 7.3 Hz), 2.80 (2H, t, J = 7.3Hz), 3.16 (2H, dt, J = 7.2, 1.4Hz), 3.31 (2H, q, J = 7.1Hz), 3.38 (2H, q, J = 7.0Hz), 5.08-5.16 (2H, m), 5.76-5.87 (1H, m).
(3-b) (1R ^* , 5R ^* )-3-thiabicyclo [3.2.0] hept-6-ylideneacetic acid tert-butyl 3- (allylthio) -N, N-diethylpropionic acid amide (19.29 g , 95.8 mmol) and collidine (13.3 mL, 101 mmol) in a benzene solution (500 mL), a benzene solution (100 mL) of trifluoromethanesulfonic anhydride (17.7 mL, 105 mmol) was added dropwise over 2 hours under heating and reflux. did. After stirring for 1 hour, the solvent was distilled off under reduced pressure, and the residue was diluted with dichloromethane and water and stirred at room temperature for 2 hours. After separation of the reaction solution, the aqueous layer was extracted with dichloromethane, and the organic layer was washed successively with saturated aqueous sodium hydrogen carbonate solution and brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was added to a reaction solution prepared from sodium hydride (> 65% oily, 0.70 g, 18 mmol) in a tetrahydrofuran solution (70 mL) of tert-butyl dimethylphosphoryl acetate (4.0 g, 18 mmol), and stirred for 2 hours. Aqueous citric acid solution was sequentially added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with aqueous sodium hydrogen carbonate solution and brine, dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography to obtain the title compound as a pale yellow oily substance (515 mg, <12%, E, Z mixture).
¹ H-NMR (400 MHz, CDCl ₃ ): δ ppm: major isomer: 1.48 (9H, s), 2.51-2.58 (1H, m), 2.72-2.75 (1H, m), 2.86-2.97 (2H, m) , 3.13-3.41 (3H, m), 4.11-4.12 (1H, m), 5.52-5.23 (1H, m); minor isomer: 1.49 (9H, s), 2.51-2.58 (1H, m), 2.72-2.97 (2H, m), 3.13-3.32 (2H, m), 3.57-3.59 (1H, m), 3.74-3.77 (1H, m), 4.11-4.12 (1H, m), 5.60-5.61 (1H, m) .
(3-c) [(1R ^* , 5R ^* , 6S ^* )-6-nitromethyl-3-thiabicyclo [3.2.0] hept-6-yl] tert-butyl acetate (1R ^* , 5R ^* )- 3-Thiabicyclo [3.2.0] hept-6-ylideneacetic acid tert-butyl (515 mg, 2.3 mmol) was dissolved in nitromethane (8 mL), and 1,8-diazabicyclo [5.4.0] undec-7 -Ene (0.39 mL, 2.6 mmol) was added, and the mixture was heated with stirring at 65-70 ° C. for 4 hours. After allowing to cool, the mixture was diluted with an aqueous potassium dihydrogen phosphate solution and extracted with ethyl acetate. The organic layer was washed successively with aqueous potassium dihydrogen phosphate solution and brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography to obtain the desired product as a colorless oil (200 mg, 30%).
¹ H-NMR (400 MHz, CDCl ₃ ): δ ppm: 1.45 (9H, s), 1.78 (1H, dd, 7.1, 12.7 Hz), 2.22 (1H, ddd, 2.3, 8.9, 13.7 Hz), 2.56-2.81 (4H, m), 3.01 (1H, t, J = 7.3Hz), 3.25 (1H, dt, 13.7, 7.3Hz), 4.76 (2H, s).
(3-d) [(1R ^* , 5R ^* , 6S ^* )-6- (tert-Butoxycarbonylamino) methyl-3-thiabicyclo [3.2.0] hept-6-yl] tert-butyl acetate [ (1R ^* , 5R ^* , 6S ^* )-6- (Nitromethyl) -3-thiabicyclo [3.2.0] hept-6-yl] tert-butyl acetate (220 mg, 0.77 mmol) in ethanol (50 mL) And dissolved in water (2 mL), iron powder (428 mg, 7.7 mmol) and ammonium chloride (25 mg, 0.46 mmol) were added, and the mixture was stirred with heating under reflux for 5 hours. The mixture was allowed to cool, diluted with tetrahydrofuran (5 mL), triethylamine (0.32 mL, 2.3 mmol) and di-tert-butyl dicarbonate (334 mg, 1.53 mmol) were added, and the mixture was stirred at room temperature for 1 hr. After removing unnecessary substances, the filtrate was diluted with ethyl acetate and an aqueous citric acid solution. The organic layer was washed successively with aqueous citric acid solution, saturated aqueous sodium hydrogen carbonate solution and saturated brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel chromatography to give the title compound as a white solid (225 mg, 82%).
¹ H-NMR (400 MHz, CDCl ₃ ): δ ppm: 1.41-1.45 (1H, m), 1.44 (18H, s), 1.65 (1H, dd, J = 6.8, 12.1 Hz), 1.95 (1H, dd, J = 1.6, 8.6Hz), 2.38 (1H, d, J = 13.6Hz), 2.46 (1H, d, J = 13.6Hz), 2.53 (1H, d, J = 12.5Hz), 2.72-2.81 (1H, m), 3.19-3.22 (1H, m), 3.31-3.33 (1H, m), 4.98 (1H, broad).
(3-e) [(1R ^* , 5R ^* , 6S ^* )-6-aminomethyl-3-thiabicyclo [3.2.0] hept-6-yl] acetic acid [(1R ^* , 5R ^* , 6S ^* ) -6- (tert-Butoxycarbonylamino) methyl-3-thiabicyclo [3.2.0] hept-6-yl] tert-butyl acetate (220 mg, 0.62 mmol) in 4N hydrochloric acid in ethyl acetate (10 mL) After stirring at room temperature for 2 hours, the solvent was distilled off under reduced pressure. The residue was dissolved in dichloromethane and triethylamine was added dropwise. The resulting powder was collected by filtration, washed with dichloromethane and dried to give the title compound as a white solid (115 mg, 93%).
¹ H-NMR (400 MHz, CD ₃ OD): δ ppm: 1.68 (1H, dd, J = 7.3, 12.4 Hz), 1.94 (1H, ddd, J = 2.2, 8.6, 12.3 Hz), 2.54 (1H, d , J = 11.6Hz), 2.57 (1H, d, J = 14.5Hz), 2.71-2.79 (3H, m), 2.83-2.88 (2H, m), 3.12 (1H, d, J = 13.2Hz), 3.16 (1H, d, J = 13.2Hz), 3.22-3.31 (1H, m).
IR (KBr): cm ^-1 : 2971, 2928, 2196, 1632, 1511, 1399, 1294, 1164.
MS (FAB): m / z: 202 (M + H) ⁺ .
Anal.calcd for C ₉ H ₁₅ NO ₂ S: C, 53.7; H, 7.51; N, 6.94; S, 15.93; Found C, 52.80; H, 7.44; N, 6.80; S, 15.64.
Example 4 [(1R ^* , 5S ^* , 7R ^* )-7-aminomethyl-2-oxabicyclo [3.2.0] hept-7-yl] acetic acid

(Structural formula indicates relative arrangement.)
(4-a) (1R ^* , 5S ^* )-2-oxabicyclo [3.2.0] hepta-7-ylideneacetic acid tert-butyl 2-allyloxy-N, N-dimethylacetamide (1.00 g, 6 .36 mmol) and collidine (0,95 mL, 6,36 mmol) in toluene solution (200 mL) and heated under reflux with trifluoromethanesulfonic anhydride (1.3 mL, 6.36 mmol) in toluene (50 mL) over 30 minutes The mixture was added dropwise and stirred for 3 hours. Water was added after standing_to_cool, and it stirred at room temperature for 10 minutes. After separating the reaction solution, the organic layer was washed with brine and dried over anhydrous magnesium sulfate. The insoluble material was filtered off and then prepared in advance from a dimethyl ether solution (10 mL) of tert-butyl dimethylphosphoryl acetate (1.52 g, 6.6 mmol) and sodium hydride (> 63% oily, 251.4 mg, 6.6 mmol). It added to the reaction liquid and stirred for 3 hours. A saturated aqueous ammonium chloride solution was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with aqueous sodium hydrogen carbonate solution and brine, dried over anhydrous magnesium sulfate and filtered, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography to obtain the title compound as a pale yellow oily substance (500.2 mg, 38%, E, Z mixture).
¹ H-NMR (400 MHz, CDCl ₃ ): δ ppm: major isomer: 1.48 (9H, s), 1.75 -1.94 (1H, m), 2.24-2.33 (1H, m), 2.55-2.62 (1H, m) , 2.76-3.10 (2H, m), 3.83-3.89 (1H, m), 4.11-4.17 (1H, m), 5.28-5.50 (1H, m), 5.60-5.62 (1H, m); minor isomer: 1.49 (9H, s), 1.75 -1.94 (1H, m), 2.24-2.33 (2H, m), 2.55-2.62 (1H, m), 3.00-3.09 (1H, m), 3.83-3.89 (1H, m) , 4.11-4.17 (1H, m), 4.95-4.97 (1H, m), 5.77-5.78 (1H, m).
(4-b) [(1R ^* , 5S ^* , 7R ^* )-7- (Nitromethyl) -2-oxabicyclo [3.2.0] hept-7-yl] tert-butyl acetate (1R ^* , 5S ^* ) 2-Oxabicyclo [3.2.0] hept-7-ylidene acetate tert-butyl (420.2 mg, 2.0 mol) was dissolved in nitromethane (5 mL) and 1,8-diazabicyclo [5. 4.0] Undec-7-ene (0.30 mL, 2.0 mmol) was added, and the mixture was heated with stirring at 55-60 ° C. for 4 hours. After allowing to cool, the mixture was diluted with an aqueous potassium dihydrogen phosphate solution and extracted with ethyl acetate. The organic layer was washed successively with aqueous potassium dihydrogen phosphate solution and brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography to obtain the title compound as a colorless oil (318.7 mg, 47%).
¹ H-NMR (400 MHz, CDCl ₃ ): δ ppm: 1.45 (9H, s), 1.55 (1H, dd, J = 7.2, 13.3 Hz), 1.74 (1H, dd, J = 5.9, 12.9 Hz), 1.80 -1.90 (1H, m), 2.22 (1H, ddd, J = 3.0, 9.0, 13.3Hz), 2.43 (1H, d, J = 17.2Hz), 2.56 (1H, d, J = 17.2Hz), 3.05- 3.12 (1H, m), 2.96-4.02 (1H, m), 4.21 (1H, dt, J = 1.6, 9.0Hz), 4.40 (1H, dd, J = 3.0, 5.9Hz), 4.68 (1H, d, J = 11.7Hz), 4.82 (1H, d, J = 11.7Hz).
(4-c) [(1R ^* , 5S ^* , 7R ^* )-7-aminomethyl-2-oxabicyclo [3.2.0] hept-7-yl] acetic acid [(1R ^* , 5S ^* , 7R ^* ) -7- (Nitromethyl) -2-oxabicyclo [3.2.0] hept-7-yl] tert-butyl acetate (315.9 mg, 1.16 mmol) in ethanol (10 mL) and water (5 mL) Then, iron powder (324, 8 mg, 5.8 mmol) and ammonium chloride (61.5 mg, 1.16 mmol) were added, and the mixture was stirred with heating under reflux for 4 hours. After allowing to cool, saturated aqueous sodium hydrogen carbonate solution was added to the reaction mixture, and the mixture was filtered through celite, and the residue was washed with ethyl acetate. The filtrate was separated, the organic layer was washed with saturated brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. 4N Hydrochloric acid ethyl acetate solution (10 mL) was added to the residue and the mixture was stirred at room temperature for 1 hr, and the solvent was evaporated under reduced pressure. The residue was dissolved in dichloromethane and triethylamine was added dropwise. The resulting powder was collected by filtration, washed with dichloromethane and dried to give the title compound as a white solid (41.2 mg, 19%).
¹ H-NMR (400 MHz, CD ₃ OD): δ ppm: 1.50 (1H, dd, J = 7.1, 13.0 Hz), 1.72-1.80 (2H, m), 2.05 (1H, ddd, J = 3.0, 8.8, 13.0Hz), 2.32 (1H, d, J = 16.0Hz), 2.66 (1H, J = 16.0Hz), 3.02 (1H, d, J = 13.0Hz), 3.08 (1H, d, J = 13.0Hz), 3.08-3.12 (1H, m), 4.02-4.08 (1H, m), 4.12-4.18 (2H, m).
MS (ESI): m / z: 186 (M + H) ⁺ , 208 (M + Na) ⁺ .
HRMS (ESI): m / z: anal.calcd for ¹² C ₉ ¹ H ₁₆ ¹⁴ N ¹⁶ O ₃ 186.11302; found 186.11113.
Example 5 [(1R ^* , 5S ^* , 7R ^* )-7-aminomethyl-2-thiabicyclo [3.2.0] hept-7-yl] acetic acid

(Structural formula indicates relative arrangement.)
(5-a) (1R ^* , 5S ^* )-3-thiabicyclo [3.2.0] hept-6-ylideneacetic acid tert-butyl 2- (but-3-ene-1-thio) -N, N- Dimethylacetamide (2.22 g, 12.8 mmol), trifluoromethanesulfonic anhydride (2.61 mL, 12.8 mmol, tert-butyl dimethylphosphorylacetate (2.87 g, 12.8 mmol), sodium hydride (> 63% Oily, 487.6 mg, 12.8 mmol) was used in the same manner as in Example (4-a) to obtain the title compound as a pale yellow oily substance (2.30 g, 79%, E, Z mixture) .
¹ H-NMR (400 MHz, CDCl ₃ ): δ ppm: major isomer: 1.45 (9H, s), 1.79 -1.92 (1H, m), 2.08-2.14 (1H, m), 2.26-2.36 (1H, m) , 2.48-2.56 (1H, m), 3.02-3.18 (2H, m), 3.28-3.41 (1H, m), 4.42-4.45 (1H, m), 5.62-5.64 (1H, m); minor isomer: 1.49 (9H, s), 1.79 -1.92 (1H, m), 2.08-2.14 (1H, m), 2.26-2.36 (1H, m), 2.48-2.56 (1H, m), 2.74-2.82 (1H, m) , 3.02-3.18 (1H, m), 3.28-3.41 (1H, m), 4.76-4.79 (1H, m), 5.44-5.46 (1H, m).
(5-b) [(1R ^* , 5S ^* , 7R ^* )-7- (Nitromethyl) -2-thiabicyclo [3.2.0] hept-7-yl] tert-butyl acetate (1R ^* , 5S ^* ) -2-thiabicyclo [3.2.0] hept-7-ylidene acetate tert-butyl (2.30 g, 10.2 mol), nitromethane (10 mL), 1,8-diazabicyclo [5.4.0] undeca Synthesis was performed in the same manner as in Example (4-b) using -7-ene (1.57 mL, 10.2 mmol) to obtain the title compound as a colorless oil (2.68 g, 92%).
¹ H-NMR (400 MHz, CDCl ₃ ): δ ppm: 1.36 (1H, dd, J = 7.6, 13.0 Hz), 1.45 (9H, s), 1.72-1.81 (1H, m), 1.96-2.00 (1H, m), 2.13 (1H, ddd, J = 3.1, 9.0, 13.3Hz), 2.57 (1H, d, J = 17.8Hz), 2.65 (1H, d, J = 17.8Hz), 2.97-3.01 (2H, m ), 3.40 (1H, quint, J = 7.6Hz), 3.93 (1H, dd, J = 2.7, 7.6Hz), 4.77 (1H, d, J = 11.7Hz), 4.93 (1H, d, J = 11.7Hz) ).
(5-c) [(1R ^* , 5S ^* , 7R ^* )-7-aminomethyl-2-thiabicyclo [3.2.0] hept-7-yl] acetic acid [(1R ^* , 5S ^* , 7R ^* ) -7- (Nitromethyl) -2-thiabicyclo [3.2.0] hept-7-yl] tert-butyl acetate (2.68 g, 9.3 mmol), iron powder (2.61 g, 46.7 mmol) , Ammonium chloride (492.9 mg, 9.3 mmol), and 4N hydrochloric acid in ethyl acetate (10 mL) were synthesized in the same manner as in Example (4-c) to obtain the title compound as a white solid (882. 8 mg, 47%).
¹ H-NMR (400 MHz, CD ₃ OD): δ ppm: 1.34 (1H, dd, J = 7.1, 13.0 Hz), 1.69 (1H, ddd, J = 6.7, 13.0, 18.5 Hz), 1.87 (1H, ddd , J = 3.2, 8.8, 13.0Hz), 1.96 (1H, dd, J = 5.0, 13.0Hz), 2.45 (1H, J = 16.7Hz), 2.75 (1H, d, J = 16.7Hz), 2.95 (1H , ddd, J = 0.8, 6.7, 13.0Hz), 3.07 (1H, dt, J = 5.0, 13.0Hz), 3.16 (1H, d, J = 13.2Hz), 3.24 (1H, d, J = 13.2Hz) , 3.40 (1H, quint.J = 6.7Hz), 3.79 (1H, dd, J = 3.0, 6.7Hz).
IR (KBr): cm ^-1 : 2935, 2910, 2842, 2198, 1631, 1564, 1509, 1413, 1390, 1307, 1290.
MS (FAB): m / z: 202 (M + H) ⁺ .
Anal.calcd for C ₉ H ₁₅ NO ₂ S: C, 53.70; H, 7.51; N, 6.96; S, 15.93; Found C, 53.21; H, 7.47; N, 6.87; S, 15.71.
Example 6 [(1R ^* , 5S ^* , 7R ^* )-7-Aminomethyl-3-ethyl-2-thiabicyclo [3.2.0] hept-7-yl] acetic acid

(Structural formula indicates relative arrangement.)
(6-a) (1S ^* , 5R ^* )-3-ethyl-2-thiabicyclo [3.2.0] hept-7-ylideneacetic acid tert-butyl 2- (but-3-ene-1-thio)- N, N-dimethylacetamide (2.46 g, 12.2 mmol), collidine (2.5 mL, 12.2 mmol), trifluoromethanesulfonic anhydride (2.5 mL, 12.2 mmol), tert-butyl dimethylphosphoryl acetate ( 2.74 g, 12.2 mmol), sodium hydride (> 63% oily, 464.8 mg, 12.2 mmol) and synthesized as in Example (4-a) to give the title compound as a pale yellow oil (1.82 g, 52%, E, Z mixture).
¹ H-NMR (400 MHz, CDCl ₃ ): δ ppm: major isomer: 1.05 (3H, t, J = 7.4 Hz), 1.45 (9H, s), 1.51 -1.59 (1H, m), 1.64-1.81 (2H , m), 2.13 (1H, dd, J = 4.3, 12.9Hz), 2.57-2.65 (1H, m), 3.11-3.19 (1H, m), 3.33-3.41 (1H, m), 3.57-3.68 (1H , m), 4.41-4.45 (1H, m), 5.63-5.65 (1H, m); minor isomer: 1.04 (3H, 5, J = 7.4Hz), 1.49 (9H, s), 1.51 -1.59 (1H, m), 1.64-1.81 (2H, m), 2.10-2.15 (1H, m), 2.40-2.46 (1H, m), 2.75-2.83 (1H, m), 3.28-3.37 (1H, m), 3.57- 3.68 (1H, m), 4.75-4.79 (1H, m), 5.44-5.46 (1H, m).
(6-b) [(1R ^* , 5S ^* , 7R ^* )-3-ethyl-7- (nitromethyl) -2-thiobicyclo [3.2.0] hept-7-yl] tert-butyl acetate (1R ^* , 5S ^* )-3-ethyl-2-thiobicyclo [3.2.0] hept-7-ylidene acetate tert-butyl acetate (1.61 g, 6.3 mol), nitromethane (10 mL), 1,8-diazabicyclo [5.4.0] Undec-7-ene (1.2 mL, 8.19 mmol) was used in the same manner as in Example (4-b) to give the title compound as an oil (2.02 g, 95%).
¹ H-NMR (400 MHz, CDCl ₃ ): δ ppm: 1.04 (3H t, J = 7.4 Hz), 1.41-1.50 (2H, m), 1.46 (9H, s), 1.64-1.77 (2H, m), 2.00 (1H, dd, J = 5.1, 13.3Hz), 2.13 (1H, ddd, J = 3.1, 8.6, 12.9Hz), 2.62 (1H, d, J = 17.8Hz), 2.69 (1H, d, J = 17.8Hz), 3.35-3.52 (2H, m), 3.94 (1H, dd, J = 3.5, 7.8Hz), 4.75 (1H, d, J = 11.3Hz), 4.91 (1H, d, J = 11.3Hz) .
(6-c) [(1R ^* , 5S ^* , 7R ^* )-7-aminomethyl-3-ethyl-2-thiobicyclo [3.2.0] hept-7-yl] acetic acid [(1R ^* , 5S ^* , 7R ^* )-3-ethyl-7- (nitromethyl) -2-thiobicyclo [3.2.0] hept-7-yl] tert-butyl acetate (1.89 g, 5.99 mmol), iron powder ( 1.80 g, 59.9 mmol), ammonium chloride (359.1 mg, 5.99 mmol), and 4N hydrochloric acid in ethyl acetate (10 mL) were synthesized in the same manner as in Example (4-c) to give the title compound as white Obtained as a solid (916.6 mg, 79%).
¹ H-NMR (400 MHz, CD ₃ OD): δ ppm: 1.04 (3H, t, J = 7.4 Hz), 1.38 (1H, ddd, J = 8.2, 11.2, 12.8 Hz), 1.47 (1H, dd, J = 8.2, 12.5Hz), 1.61 (1H, dquint, J = 14.8, 7.4Hz), 1.96 (1H, dquint, J = 14.8, 7.4Hz), 1.88 (1H, ddd, J = 3.0, 8.2, 12.5Hz) , 2.00 (1H, dd, J = 4.8, 12.8Hz), 3.38 (1H, quint, J = 8.2Hz), 3.59 (1H, dt, J = 11.2, 7.4Hz), 3.80 (1H, dd, J = 3.0 , 8.2Hz).
IR (KBr): cm ^-1 : 3035, 2961, 2925, 2631, 1640, 1517, 1413, 1389, 1261.
MS (FAB): m / z: 230 (M + H) ⁺ .
Anal.calcd for C ₁₁ H ₁₉ NO ₂ S: C, 57.61; H, 8.35; N, 6.11; S, 13.98; Found C, 56.981; H, 8.39; N, 6.08; S, 13.88.
Formulation Example 1 (Powder)
A powder is obtained by mixing 5 g of the compound of this invention, 895 g of lactose, and 100 g of corn starch with a blender.
Formulation Example 2 (granule)
After mixing 5 g of the compound of the present invention, 865 g of lactose and 100 g of low-substituted hydroxypropylcellulose, 300 g of 10% hydroxypropylcellulose aqueous solution is added and kneaded. This is granulated using an extrusion granulator and dried to obtain granules.
Formulation Example 3 (tablet)
5 g of the compound of the present invention, 90 g of lactose, 34 g of corn starch, 20 g of crystalline cellulose and 1 g of magnesium stearate are mixed with a blender, and then tableted by a tablet machine to obtain a tablet.
(Test Example 1) Construction of human calcium channel α ₂ δ ₁ subunit (hereinafter referred to as human Cacna2d1) gene expression plasmid and preparation of human Cacna2d1 expression cell membrane fraction a) Construction of human Cacna2d1 expression plasmid pRK / hCacna2d1 a-1 ) Preparation of DNA fragment The human Cacna2d1 gene was obtained by dividing it into a first half fragment and a second half fragment. PCR was carried out using the cDNA library (QUICK-Clone cDNA Human Brain (Clontech Laboratories, Inc)) as a template and the enzyme KOD polymerase (TOYOBO) according to the protocol attached to this enzyme. As a PCR primer, a primer having the following sequence in the first half fragment:
Primer 1: 5'-agctgcggcc gctagcgcca ccatggctgg ctgcctgctg gc-3 '(SEQ ID NO: 1)
Primer 2: 5'-attaggatcg attgcaaagt aataccc-3 '(SEQ ID NO: 2)
The latter fragment has primers with the following sequences:
Primer 3: 5'-aatgggtatt actttgcaat cgatcc-3 '(SEQ ID NO: 3)
Primer 4: 5'-agtcggatcc tcataacagc cggtgtgtgc tg-3 '(SEQ ID NO: 4)
Was purchased from Sigma Genesis and used. In the first and second half of the PCR reaction, a thermal cycler (GeneAmp PCR System 9700 (Applied Biosystems)) was used, and after heating at 94 ° C for 1 minute, temperature cycling (94 ° C for 15 seconds, 60 ° C for 30 seconds, 68 ° C) 2 minutes) was repeated 35 times, followed by 5 minutes at 68 ° C and cooling to 4 ° C.

The two reaction products were purified with a PCR product purification kit (MiniElute PCR Purification Kit (QIAGEN)) according to the protocol attached to the kit. The obtained first half fragment was digested with the restriction enzyme Not1 (TOYOBO). The latter half was digested with restriction enzymes Cla1 (TOYOBO) and BamH1 (TOYOBO). These were then purified with a reaction product purification kit (MiniElute Reaction Cleanup Kit (QIAGEN)) according to the protocol attached to this kit.
a-2) Preparation of vector A vector was prepared in which the multicloning site (hereinafter referred to as MCS) of the animal cell expression vector pRK5 (Pharmingen) was changed to MCS of the vector pBluescript 2 (STRATAGENE). That is, pRK5 was subjected to restriction enzyme treatment with Cla 1 (TOYOBO) and Hind 3 (TOYOBO), and then both ends of the DNA were smoothed using Klenow Fragment (TAKARA). Furthermore, after dephosphorylating both ends using bovine small intestine alkaline phosphatase (hereinafter referred to as CIAP: TAKARA), purification was performed using MiniElute Reaction Cleanup Kit (QIAGEN). Then, the enzyme-treated DNA was electrophoresed on a 1.0% agarose gel, the gel after electrophoresis was stained with ethidium bromide, and a band corresponding to about 4.7 kbp was irradiated with ultraviolet rays using a razor blade. After separation, DNA was extracted using a gel extraction purification kit (MiniElute Gel Extraction Kit (QIAGEN)) according to the protocol attached to this kit.

In order to obtain a DNA fragment corresponding to MCS of pBluescript 2, pBluescript 2 is subjected to restriction enzyme treatment with Sac 1 (TOYOBO) and Kpn 1 (TOYOBO), then both ends of DNA are smoothed using Klenow Fragment (TAKARA) Turned into. The enzyme-treated DNA was electrophoresed on a 2.0% agarose gel, the gel after electrophoresis was stained with ethidium bromide, and the band portion corresponding to about 100 bp was separated with a razor blade under ultraviolet irradiation. Then, using a gel extraction purification kit (MiniElute Gel Extraction Kit (QIAGEN)), DNA was extracted according to the protocol attached to this kit.

The obtained DNA fragment and cleaved pRK5 were ligated using a DNA ligation kit (TAKARA) according to the protocol attached to the kit. E. coli DH5α competent cells (TOYOBO) were transformed with this reaction product to obtain ampicillin resistant colonies. After collecting several colonies, a plasmid was extracted from the cells obtained by culturing the collected colonies, and the base sequence was analyzed using a DNA sequencer (Model 3700 (Applied Biosystems)). Has been confirmed to be introduced into pRK5. At this time, the orientation of the MCS sequence is upstream from the CMV promoter and the downstream direction is as follows: 5'-ccaccgcggtggcggccgctctagaactagtggatcccccgggctgcaggaattcgatatcaagcttatcgataccgtcgacctcgagggggggggcccg-3 '(SEQ ID NO: 5). Was named pRK-KS.
a-3) Plasmid construction pRK-SK obtained in a-2) was treated with the restriction enzyme Xba1 (TOYOBO), both ends of the DNA were blunted using Klenow Fragment (TAKARA), and the blunted DNA Was digested with restriction enzyme Not 1 (TOTOBO) and purified in the same manner as in a-2). The linearized pRK-SK and the first half of the human Cacna2d1 gene DNA fragment obtained in a-1) were electrophoresed on a 1.0% agarose gel, and about 4.7 kbp and about 1.5 kbp DNA was extracted from the gel and purified. The obtained two DNAs were ligated in the same manner as in a-2), and E. coli was transformed. A plasmid was extracted from the obtained Escherichia coli clone, and its base sequence was analyzed using a DNA sequencer (Model 3700 (Applied Biosystems)) to confirm that the sequence shown in SEQ ID NO: 6 was introduced. . Next, the obtained plasmid was treated with restriction enzymes Cla 1 (TOYOBO) and BamH 1 (TOYOBO), and CIAP treatment and purification were performed in the same manner as in a-2). The linearized plasmid DNA and the second half DNA fragment of the human Cacna2d1 gene obtained in a-1) were electrophoresed on a 1.0% agarose gel, and about 6.2 kbp and about 1.8 kbp as in a-2). kbp DNA was extracted from the gel and purified. The obtained two DNAs were ligated in the same manner as in a-2), and E. coli was transformed. A plasmid was extracted from the obtained Escherichia coli clone, the base sequence was analyzed using a DNA sequencer (Model 3700 (Applied Biosystems)), and the sequence shown in SEQ ID NO: 7 was introduced into the vector pRK-SK. I confirmed. The obtained plasmid was named pRK / hCacna2d1.
b) Acquisition of 293 cell line expressing human Cacna2d1 The human Cacna2d1 expression plasmid pRK / hCacna2d1 constructed in a) was introduced into 293 cells, and a human Cacna2d1 stable expression cell line was obtained using human Cacna2d1 protein expression as an index. Specifically, 2 × 10 ⁶ cells of 293 cells were seeded in a φ6 cm dish, and after culturing for 12 hours, using the gene transfer reagent LipofectaminePlus (Invitrogen), 5 μg of pRK / hCacna2d1 and 0.5 μg according to the protocol attached to the reagent The neomycin resistant gene expression plasmid pSV2neo (Clontech) was simultaneously introduced.

After gene transfer, cells were collected, diluted in a φ15 cm dish, seeded, and cultured for 2 weeks in DMEM (Invitrogen) supplemented with 10% fetal bovine serum (Cansera International Inc.) and 500 μg / ml G418 (Invitrogen). . The neomycin-resistant cells that formed colonies were isolated and the cells were expanded and recovered, and the cell lysate was evaluated by Western assay to obtain a 293 cell line expressing human Cacna2d1. In Western assay, anti-hCacna2d1 antibody (Chemicon Inc.) was used as the primary antibody.
c) Preparation of cell membrane fraction of human Cacna2d1-expressing 293 cells DMEM (Invitrogen) supplemented with 10% fetal calf serum (Cansera International Inc.) and 500 μg / ml G418 (Invitrogen) from human Cacna2d1-expressing 293 cells obtained in b) ) And cultured in large quantities. Add a recommended amount of protease inhibitor (Comlpete EDTA free (Roche)) to Binding Assay Buffer (10 mM MOPS (pH7.4), 10 mM HEPES (pH7.4), 100 mM NaCl) did. The collected cells were washed with a membrane fraction preparation buffer, and then disrupted using an ultrasonic disrupter. Thereafter, centrifugation was performed at 12,000 rpm, 4 ° C. for 1 hour using a centrifuge, and the supernatant was discarded and the precipitate was suspended in a membrane fraction preparation buffer. The process from sonication using an ultrasonic crusher to suspension of the precipitate after centrifugation was repeated three more times, and the resulting suspension was used as a human Cacna2d1-expressing cell membrane fraction. The total amount of protein contained in the membrane fraction was calculated from the absorbance of UV at a wavelength of 280 nm.
(Test Example 2) Construction of detection system for binding reaction between Cacna2d1 and Gabapentin (hereinafter referred to as GBP) and detection of Cacna2d1 / GBP binding reaction inhibitory activity by example compounds a) Construction of detection system for binding reaction between Cacna2d1 and GBP Human Cacna2d1 expression GBP labeled with cell membrane fraction and radioisotope ³ H (hereinafter referred to as ³ H-GBP: Tocris Cookson) Binding Assay Buffer (10 mM MOPS (pH 7.4), 10 mM HEPES (pH 7.4), 100 mM NaCl) The total amount of protein was diluted to a final concentration of 2.5 mg / ml and a final concentration of ³ H-GBP of 4.5 nM to prepare 120 μl of a reaction solution, which was allowed to stand at 4 ° C. for 3 hours. This reaction product was added to the well of a filter plate (UniFilter350 GF / B (Whatman)) and filtered. Thereafter, 350 μl of Binding Assay Buffer (10 mM MOPS (pH 7.4), 10 mM HEPES (pH 7.4), 100 mM NaCl) was added and the washing operation for filter filtration was repeated three times. The filter plate was thoroughly dried, the bottom was sealed, 50 μl of Microscint 20 (PerkinElmer) was added, the top was also sealed, and the radioisotope ³ H-derived radiation remaining on the filter was counted with TopCount (PerkinElmer). The value obtained when non-labeled GBP (SIGMA-ALDRICH) at a final concentration of 20 μM was added to this assay was subtracted from nonspecific adsorption, and the specific amount of ³ H-GBP bound to Cacna2d1 (units) "Count").
b) Detection of Cacna2d1 / GBP binding reaction inhibitory activity by the test compound The test compound was added at various concentrations to the detection assay for the Cacna2d1 / GBP binding reaction constructed in a), and the amount of binding was determined by the method described in a). It was measured. Thereafter, the amount of Cacna2d1 / GBP specific binding when the compound was added to x nM was defined as “binding amount [x]”, and the Cacna2d1 / GBP binding inhibition rate at that time was defined as “inhibition rate [x]”.
Inhibition rate [x] (%) = (1- (binding amount [x] / binding amount [0])) × 100
(In the formula, the binding amount [0] represents the binding amount of ³ H-GBP when no compound is added)
The inhibition rate (%) was obtained based on the above, and the inhibition rate was plotted against the concentration. From this result, the concentration of the test compound necessary to inhibit Cacna2d1 / GBP binding by 50%, “IC ₅₀ value” was calculated. Table 1 shows the test results of the test compounds.

Test Example 3 Mechanical Hyperalgesia Assay It has been reported that peripheral nerve injured animals and diabetes model animals exhibit hyperalgesia and allodynia symptoms to mechanical and thermal stimuli. In the present invention, mice that develop mechanical hyperalgesia are used for evaluation.
Mice are acclimated for 30 minutes in a plastic cage for measurement, and then the test compound is administered orally, and mechanical hyperalgesia is evaluated at the measurement time specified by the investigator. Mechanical hyperalgesia is evaluated by partially modifying the method of Takasaki et al. (Pain 86 95-101, 2000) to confirm the effect of the test compound on mechanical hyperalgesia. That is, mechanical hyperalgesia is evaluated by scoring the behavior induced by pressing 1.4 g of von Frey filament against the sole of the animal according to the criteria described below.
(0: no response, 1: escape from von Frey filament, 2: shake or lick the hind limb immediately after stimulation)
In one measurement, six stimulations are performed and the total score is taken as a pain score.
The test compound is evaluated by calculating a dose (ID ₅₀ ) that improves the pain score of the vehicle administration group by 50%.
Test Example 4 Thermal Hyperalgesia Assay In the present invention, mice and rats that develop thermal hyperalgesia are used for evaluation.
Test compounds are orally administered to animals and thermal hyperalgesia is assessed at the measurement time specified by the study director. In other words, a heat stimulus is applied to the sole of the hind limb of the animal, and the latency until escaping behavior such as licking the foot or swinging the foot is measured.
(Test Example 5) Cold plate test In the present invention, mice and rats that develop cold arodinia are used for evaluation.
Evaluation of cold arodinia is performed according to the method of Tanimoto-Mori et al. (Behabioural Pharmacology 19, 85-90, 2008). That is, the animal is placed on a low-temperature metal plate, and the latency until the hind limb lifting action is observed and the duration of the raising action are measured.
(Test Example 6) Mouse acetic acid writhing test The test compound was orally administered to the mouse, and 0.6% acetic acid was administered intraperitoneally at the measurement time determined by the person in charge of the test. The total number of writhing behaviors for 10 minutes from 5 minutes to 15 minutes later Count.
Test Example 7 Rat Adjuvant Arthritis Pain Test An adjuvant is prepared by pulverizing Mycobacterium butyricum dead cells in an agate mortar, suspending them in liquid paraffin sterilized by dry heat, and further sonicating.
This adjuvant (100 μg / 0.05 mL / paw as a heated dead cell) is injected into the right hind paw skin of a rat to induce arthritis. A pain test is performed 18 days after adjuvant treatment. That is, the test compound is orally administered to the animal, and the tarsal tibial joint is bent 5 times at the measurement time determined by the investigator, and the number of squeals (0-5) is recorded as a pain score.
(Test Example 8) Electric shock-induced convulsion test A test compound is orally administered to a mouse, and electric stimulation (60 Hz, 50 mA) is performed on the binocular cornea using an electric stimulator and a bipolar electrode at a measurement time determined by the person in charge of the test. 0.2 seconds), and observe and record the presence or absence of tonic extension of the hind limbs.
(Test Example 9) Pentylenetetrazole-induced convulsion test A test compound is orally administered to a mouse, and a pentyleneretrazole solution (85 mg / 10 ml / kg, dissolved in physiological saline) is subcutaneously administered at a measurement time determined by the person in charge of the test. And observe and record the presence or absence of clonic convulsions for 30 minutes.
(Test Example 10)
In addition, the effect of the present invention can be confirmed by performing an evaluation according to the method described in the homepage of the National Institutes of Health (NIH).
NIH HP: Antiepileptic Drug Development (ADD) Program

The compound of the present invention or a pharmacologically acceptable salt thereof can be used as an active ingredient in a pharmaceutical composition for treating and / or preventing disorders such as pain and central nervous system disorders.

SEQ ID NO: 1 is a PCR sense primer for the first half of human Cacna2d1.
SEQ ID NO: 2 is a PCR antisense primer in the first half of human Cacna2d1.
SEQ ID NO: 3 is a PCR sense primer in the latter half of human Cacna2d1.
SEQ ID NO: 4 is a PCR antisense primer in the latter half of human Cacna2d1.
SEQ ID NO: 5 is the multicloning site of vector pBluescript 2.

Claims (18)

1. A compound represented by formula (I) or a pharmacologically acceptable salt thereof.
   

   

   
   [Wherein each substituent is defined as follows.
   R ¹ represents a hydrogen atom or a C1-C6 alkyl group.
   R ² represents a hydrogen atom, a halogen atom, a C1-C6 alkyl group, a halogeno C1-C6 alkyl group, a C1-C6 alkylthio group, a C1-C6 alkoxy group or a C3-C6 cycloalkyl group.
   R ³ represents a hydrogen atom, a halogen atom, a C1-C6 alkyl group, a halogeno C1-C6 alkyl group, a C1-C6 alkylthio group, a C1-C6 alkoxy group or a C3-C6 cycloalkyl group.
   R ⁴ represents a hydrogen atom, a C1-C6 alkyl group or a C3-C6 cycloalkyl group.
   R ⁵ and R ^{5 ′} represent a hydrogen atom or a C1-C6 alkyl group.
   R ⁶ represents a hydrogen atom, a C1-C6 alkyl group or an amino protecting group.
   R ⁷ represents a hydrogen atom, a C1-C6 alkyl group or a protecting group for a carboxy group.
   X, Y and Z are the same or different and each represents a methylene group, an oxygen atom or a sulfur atom.
   However, all of X, Y and Z do not represent a methylene group at the same time. ]
2. The compound or pharmacologically acceptable salt thereof according to claim 1, wherein R ¹ is a hydrogen atom.
3. The compound or pharmacologically acceptable salt thereof according to claim 1 or 2, wherein R ² is a hydrogen atom, a methyl group, an ethyl group, a propyl group or a cyclopropyl group.
4. The compound or pharmacologically acceptable salt thereof according to any one of claims 1 to 3, wherein R ³ is a hydrogen atom.
5. The compound or pharmacologically acceptable salt thereof according to any one of claims 1 to 4, wherein R ⁴ is a hydrogen atom.
6. The compound or a pharmacologically acceptable salt thereof according to any one of claims 1 to 5, wherein R ⁵ and R ^{5 '} are hydrogen atoms.
7. The compound or a pharmacologically acceptable salt thereof according to any one of claims 1 to 6, wherein X is an oxygen atom or a sulfur atom, and Y and Z are methylene groups.
8. The compound or pharmacologically acceptable salt thereof according to any one of claims 1 to 6, wherein Y is an oxygen atom or a sulfur atom, and X and Z are methylene groups.
9. The compound or a pharmacologically acceptable salt thereof according to any one of claims 1 to 6, wherein Z is an oxygen atom or a sulfur atom, and X and Y are methylene groups.
10. The compound or a pharmacologically acceptable salt thereof according to any one of claims 1 to 9, wherein R ⁶ is a hydrogen atom.
11. The compound or pharmacologically acceptable salt thereof according to any one of claims 1 to 10, wherein R ⁷ is a hydrogen atom.
12. The compound according to claim 1 or a pharmacologically acceptable salt thereof, wherein the compound having the general formula (I) is a compound selected from the group consisting of:
    
13. A pharmaceutical composition comprising the compound according to any one of claims 1 to 12 or a pharmacologically acceptable salt thereof as an active ingredient.
14. 14. The pharmaceutical composition according to claim 13, for treating and / or preventing pain.
15. Acute pain, chronic pain, pain resulting from soft tissue or peripheral injury, postherpetic neuralgia, occipital neuralgia, trigeminal neuralgia, medulla or intercostal neuralgia, central nervous pain, neuropathic pain, migraine, osteoarthritis or joint Pain associated with rheumatism, pain associated with contusion, sprains or trauma, spinal pain, pain due to spinal cord or brainstem injury, low back pain, sciatica, toothache, myofascial pain syndrome, perineal incision pain, gout pain, burn Pain resulting from, heart pain, muscle pain, eye pain, inflammatory pain, orofacial pain, abdominal pain, dysmenorrhea, pain associated with labor pain or endometriosis, somatic pain, related to nerve or root injury Pain, amputation, painful tics, pain associated with neuroma or vasculitis, pain resulting from diabetic neuropathy (or diabetic peripheral neuropathic pain), pain resulting from chemotherapy-induced neuropathy, indefinite Facial pain, neuropathic back pain, trigeminal neuralgia, occipital neuralgia, medullary or intercostal neuralgia, HIV related neuralgia, AIDS related neuralgia, hyperalgesia, burn pain, idiopathic pain, chemotherapy pain, occipital neuralgia, psychogenic Pain, gallstone-related pain, cancer-related neuropathic or non-neuropathic pain, phantom limb pain, functional abdominal pain, headache, acute or chronic tension headache, sinus headache, cluster headache, temporal mandible Pain, maxillary sinus pain, pain resulting from ankylosing spondyloarthritis, postoperative pain, scar pain, chronic non-neuropathic pain, fibromyalgia, amyotrophic lateral sclerosis, epilepsy (partial epilepsy, partial seizure in adult epilepsy) 14. A pharmaceutical composition according to claim 13, for treating and / or preventing a disease selected from the group consisting of: partial seizures in epileptic patients), generalized anxiety disorder and restless leg syndrome.
16. 14. A pharmaceutical composition according to claim 13 for treating and / or preventing pain resulting from diabetic neuropathy.
17. Use of a compound according to any one of claims 1-12 or a pharmaceutically acceptable salt thereof for the manufacture of a pharmaceutical composition.
18. A method for treating and / or preventing pain, which comprises administering an effective amount of the compound or pharmacologically acceptable salt thereof according to any one of claims 1 to 12 to a mammal.