WO2010084668A1 - Diagnostic method for nephrotic syndrome, prophylactic or therapeutic agent for nephrotic syndrome, and method for screening the prophylactic or therapeutic agent - Google Patents

Abstract

A single nucleotide polymorphism of a nucleotide located on Glypican-5 gene or a single nucleotide polymorphism of a nucleotide that is in linkage disequilibrium with the aforementioned nucleotide is analyzed, and nephrotic syndrome is diagnosed based on the results of the analysis.  The screening for a prophylactic or therapeutic agent for nephrotic syndrome is achieved by selecting a substance that can alter the expression level of Glypican-5.  A pharmaceutical preparation for preventing or treating nephrotic syndrome is provided, which comprises a fibroblast growth factor (FGF) signaling inhibitor as an active ingredient.

Description

Nephrotic syndrome test method, nephrotic syndrome preventive or therapeutic agent and screening method thereof

The present invention relates to a nephrotic syndrome test method, probes and primers used therefor, a drug for preventing or treating nephrotic syndrome, and a screening method thereof.

Nephrotic syndrome is known to exhibit large amounts of proteinuria and hypoproteinemia. Nephrotic syndrome has minimal change type (minimal change nephritic syndrome: MC), focal glomerulosclerosis (FSGS), membranous nephropathy (MN), membranous proliferative glomerulonephritis (MPGN) Etc. are included.

In nephrotic syndrome, there is an abnormality in the glomerular filtration function, but unlike other nephropathy, there are almost no histological changes in the tubules. And remission by administration of immunosuppressants. It tends to recur and has characteristics such as poor prognosis depending on the tissue type.

In nephrotic syndrome, it is known that serum protein with a relatively low molecular weight leaks in urine in large amounts, so that the total protein mass and albumin / globulin ratio in serum are decreased. Therefore, to determine the pathological condition of nephrotic syndrome, it has been conventionally performed to measure urinary protein / serum total protein mass and albumin / globulin ratio. However, even if steroid administration or resting diet therapy improves the filtration function of the kidney glomeruli and the protein leakage into the urine stops, the serum total protein mass and albumin / globulin ratio are immediately Will not recover. Therefore, these measured values do not reflect the pathological condition such as the therapeutic effect of nephrotic syndrome so quickly, and there is a problem in quantitativeness. Therefore, there has been a demand for development of a method for more accurately and accurately determining nephrotic syndrome.
In the past, causative genes such as NPHS1, NPHS2, and ACTN4 have been identified in congenital nephrotic syndrome, but multifactorial genetic factors are considered to be involved in acquired nephrotic syndrome, which accounts for the majority of clinical practice, and most of them still remain. The disease susceptibility gene has not been clarified.

Non-Patent Document 1 describes that Glypican5 (GPC5) is a cell surface proteoglycan that enhances fibroblast growth factor (FGF) -2 signal and participates in the growth of mesoderm cells, and GPC5 It is described that it can be expected as a target molecule for tumors such as rhabdomyosarcoma. However, the relationship between FGF and nephrotic syndrome is not known, and the involvement of GPC5 in nephrotic syndrome is not known at all.

An object of the present invention is to provide an inspection method for accurately predicting the onset and progression of nephrotic syndrome. Another object of the present invention is to provide a preventive or therapeutic agent for nephrotic syndrome and a screening method thereof.

The present inventors analyzed to identify a single nucleotide polymorphism (SNP) associated with nephrotic syndrome. As a result, it was found that the SNP of the base present on the GPC5 gene or the SNP in linkage disequilibrium with the base is related to nephrotic syndrome. Furthermore, we found that double-stranded RNA that suppresses GPC5 gene expression suppresses the onset of nephrotic syndrome and reduces symptoms after onset, and substances that suppress GPC5 gene expression or GPC5 function prevent nephrotic syndrome It was found to be useful as a medicine or therapeutic agent. Furthermore, the inventors have found that FGF signal inhibitors such as FGF receptor (FGFR) tyrosine kinase activity inhibitors are also useful as preventive and therapeutic agents for nephrotic syndrome, and have completed the present invention.

That is, the present invention is as follows.
(1) A method for analyzing nephrotic syndrome based on the analysis result of a base SNP present on the GPC5 gene or a base SNP in linkage disequilibrium with the base.
(2) The method according to (1), wherein the SNP is a polymorphism in a base corresponding to the base of the base number 101 in the base sequence of SEQ ID NO: 1.
(3) A probe for testing nephrotic syndrome having a sequence of 10 bases or more including the base of the base number 101 in the base sequence of SEQ ID NO: 1, or a complementary sequence thereof.
(4) A primer for nephrotic syndrome test that can amplify a region containing the base at the 101st base number in any base sequence of SEQ ID NO: 1.
(5) a step of adding a drug candidate substance to a cell expressing a GPC5 gene or a reporter gene linked to a promoter of the GPC5 gene, a step of measuring the expression level of the GPC5 gene or the reporter gene, and a substance that decreases the expression level A method for screening a preventive or therapeutic agent for nephrotic syndrome, comprising a step of selecting
(6) A method for examining nephrotic syndrome, comprising a step of measuring the expression level of a GPC5 gene or GPC5 gene product.
(7) A medicament for preventing or treating nephrotic syndrome, comprising an FGF signal inhibitor as an active ingredient.
(8) The medicament according to (7), wherein the FGF signal inhibitor is a substance that inhibits the binding of FGF to the FGF receptor.
(9) The medicament according to (8), wherein the substance that inhibits the binding of FGF to the FGF receptor is a GPC5 gene expression suppressing substance or a GPC5 function suppressing substance.
(10) The medicament according to (9), wherein the substance that suppresses GPC5 gene expression is a double-stranded RNA against the GPC5 gene.
(11) The medicament according to (7), wherein the FGF signal inhibitor is an FGF receptor tyrosine kinase activity inhibitor.
(12) The medicament according to (8), wherein the substance that inhibits the binding of FGF to the FGF receptor is Sulfatase 2.
(13) A method for screening a preventive or therapeutic agent for nephrotic syndrome, comprising screening a substance that inhibits the binding of FGF to an FGF receptor or a substance that inhibits FGF receptor tyrosine kinase activity.

According to the test method of the present invention, since the onset risk and progression of nephrotic syndrome can be accurately predicted, proteinuria can be controlled, and progression of renal damage can be suppressed. This makes it possible to reduce the number of patients who need artificial kidney treatment, which is synonymous with expensive medical care, due to the elimination of renal function. In addition, substances that inhibit GPC5 gene expression, such as double-stranded RNA, and FGF signal inhibitors, such as FGF receptor tyrosine kinase activity inhibitors, have the effect of reducing protein permeability in glomeruli. It is useful as a novel preventive or therapeutic agent for syndrome.

The figure which shows the expression level of GPC5 gene in each genotype. The vertical axis is an arbitrary unit. (A) Confirmation of siRNA suppression of GPC5 gene expression by RT-PCR (electrophoresis photograph). (B) Schematic diagram of a protein permeability evaluation system using GEC-T cells. (C) Evaluation of the effect of siRNA on protein permeability. The control indicates no addition of siRNA, the negative control indicates the addition of negative control siRNA, and siRNA indicates the addition of GPC5-specific siRNA. The vertical axis represents the protein transmission concentration. The figure which shows the effect of siRNA with respect to the effect | action which promotes the coupling | bonding of FGF-2 and FGFR of GPC5. (A) is a result of a rat glomerular epithelial cell line, and (B) is a result of a human colon cancer cell line. Photograph of mouse kidney immune tissue staining using anti-GPC5 antibody. (A) Wild type mouse, (B) GPC5 glomerular-specific knockdown mouse. (C) shows the BAC construct used for knockdown mouse production. Changes in albumin creatinine ratio (ACR) and total urine protein (uTP) after nephritis-induced stimulation (PAN + bFGF) in wild-type mice (GPC5-specific siRNA administration, non-administration) and GPC5 glomerular-specific knockdown mice FIG. The figure which shows the albumin (ALB) density | concentration in the albumin blood after nephritis induction stimulation (puromycin + bFGF) in a wild type mouse | mouth and a GPC5 glomerulus specific knockdown mouse | mouth. In wild-type mice, GPC5-specific siRNA was administered after measurement on the 10th day. The figure which shows the ratio of nest | segmentation segmental hardening in a wild-type mouse (GPC5-specific siRNA administration, non-administration) and a GPC5 glomerulus-specific knockdown mouse | mouth. The figure which shows the fluctuation | variation of the albumin creatinine ratio (ACR) after nephritis induction stimulation (puromycin + bFGF) in a wild type mouse (PD173074 administration or non-administration). The figure which shows the fluctuation | variation of the albumin creatinine ratio (ACR) after nephritis induction stimulation (adriamycin) in a wild-type mouse (PD173074 administration or non-administration). The schematic diagram which shows the role of GPC5 and Sulfatase 2 with respect to FGF signal. The figure which shows the effect of Sulfatase 2 siRNA on cell proliferation in GEC-T cells.

<1> Test Method Based on SNP The test method of the present invention analyzes a base SNP present on the GPC5 gene or a base SNP in linkage disequilibrium with the base, and tests nephrotic syndrome based on the analysis. This is a method (a method for obtaining inspection data). Nephrotic syndrome is characterized by proteinuria (continuous daily protein content of 3.5 g or more) and hypoproteinemia (serum total protein content of 6.0 g / 100 ml or less). MC, FSGS, MN, MPGN, diabetic Although nephropathy (DMN) and the like are included, according to the test method of the present invention, MCNS, FSGS, MN, and MPGN that are particularly four major tissue lesions can be accurately detected. In the present invention, “test” includes a test for predicting whether nephrotic syndrome will occur in the future and a test for predicting whether the degree of nephrotic syndrome will become severe.

The GPC5 gene is preferably a human GPC5 gene, and examples thereof include a gene having a sequence registered in 90848929 .. 92317490 of GenBank Accession No. NC — 000013.9. However, the gene is not limited to the gene of the above sequence because substitution or deletion may exist in one or a plurality of bases due to differences in race.
The SNP of the GPC5 gene associated with nephrotic syndrome is not particularly limited, and examples thereof include rs16946160 present in intron 2. rs16946160 indicates the registration number of the dbSNP database (//www.ncbi.nlm.nih.gov/projects/SNP/) of National Center for Biotechnology Information.

rs16946160 is a polymorphism of guanine (G) / adenine (A) at the 5393489th base of GenBank Accession No. NT_009952.14 (91001814 of NC_000013.9). When this allele is A, nephrotic syndrome occurs. Probability is high. Moreover, when the genotype is taken into consideration, the probability that rs16946160 becomes nephrotic syndrome in the order of AA>AG> GG is high.
Regarding rs16946160, a sequence having a total length of 201 bp including the SNP base and the region of 100 bp before and after that is shown in SEQ ID NO: 1 (the 101st base has a polymorphism).
The polymorphism corresponding to this base is analyzed by the method of the present invention. Here, “corresponding” means a corresponding base in the region having the above sequence on the human GPC5 gene. Even if the above sequence is slightly changed at a position other than the SNP due to a difference in race, It also includes analyzing the corresponding base in it.

Nephrotic syndrome can be examined by examining the type of the SNP base. Note that the GPC5 gene sequence may be analyzed for the sense strand or the antisense strand. For example, in the case of rs16946160, the polymorphism when analyzing the sense strand is A / G, but the polymorphism when analyzing the antisense strand is T / C.
In addition, the base to be analyzed in the present invention is not limited to the above SNP, and a polymorphism that is in linkage disequilibrium with the above base may be analyzed. Here, “polymorphism in linkage disequilibrium with the above-mentioned base” refers to a base that satisfies the relationship of r ² > 0.5 with the above-described polymorphism.

The sample used for the analysis of the SNP of the GPC5 gene is not particularly limited as long as it contains a chromosomal DNA, and examples thereof include body fluid samples such as blood and urine, cells, body hair such as hair, and nails. Although these samples can be used directly for the analysis of SNP, it is preferable to isolate chromosomal DNA from these samples by a conventional method and analyze them.

The analysis of SNP of GPC5 gene can be performed by the usual SNP analysis method. Examples include, but are not limited to, sequence analysis, PCR, hybridization, and the like.

The sequence can be performed by a normal method. Specifically, a sequence reaction is performed using a primer set at a position of several tens of bases on the 5 ′ side of the base showing the polymorphism, and the type of base at the corresponding position is determined from the analysis result. can do. When sequencing is performed, it is preferable to amplify a fragment containing a polymorphism in advance by PCR or the like.

It can also be analyzed by examining the presence or absence of amplification by PCR. For example, a primer having a sequence corresponding to a region containing a base showing a polymorphism and corresponding to each polymorphism is prepared. PCR can be performed using each primer, and the type of polymorphism can be determined depending on the presence or absence of the amplification product.

It is also possible to amplify a DNA fragment containing a polymorphism and determine which type of polymorphism is based on the difference in mobility of the amplified product in electrophoresis. Examples of such a method include a PCR-SSCP (single-strand conformation polymorphism) method (Genomics. 1992 Jan 1; 12 (1): 139-146.). Specifically, first, DNA containing a polymorphic site of the GPC5 gene is amplified, and the amplified DNA is dissociated into single-stranded DNA. Next, the dissociated single-stranded DNA is separated on a non-denaturing gel, and the type of polymorphism can be determined by the difference in mobility of the separated single-stranded DNA on the gel.

Furthermore, when a base showing polymorphism is included in the restriction enzyme recognition sequence, it can be analyzed by the presence or absence of cleavage by a restriction enzyme (RFLP method). In this case, first, a DNA sample is amplified by PCR and cut with a restriction enzyme. The DNA fragments can then be separated and the type of polymorphism determined by the size of the detected DNA fragment.

It is also possible to analyze the type of polymorphism by examining the presence or absence of hybridization. That is, it is possible to determine which base an SNP is by preparing probes corresponding to each base and examining which probe hybridizes.

<2> Reagent for Nephrotic Syndrome The present invention also provides a test reagent such as a primer or a probe for examining nephrotic syndrome. Examples of such a probe include a probe that includes the polymorphic site in the GPC5 gene and can determine the type of base at the polymorphic site based on the presence or absence of hybridization. Specifically, a probe having a length of 10 bases or more having a sequence containing the 101st base of the base sequence in SEQ ID NO: 1 or a complementary sequence thereof can be mentioned. The length of the probe is more preferably 15 to 35 bases, and further preferably 20 to 35 bases. An example of such a probe is a probe containing SEQ ID NO: 10 or a complementary sequence thereof.

Examples of the primer include a primer that can be used for PCR for amplifying the polymorphic site in the GPC5 gene, or a primer that can be used for sequence analysis (sequencing) of the polymorphic site. Specifically, a primer that can amplify or sequence a region containing the 101st base of the base sequence of SEQ ID NO: 1 is exemplified. The length of such a primer is preferably 10 to 50 bases, more preferably 15 to 35 bases, and further preferably 20 to 35 bases.
As a primer for sequencing the polymorphic site, a primer having a sequence 5 ′ side of the base, preferably 30 to 100 bases upstream, or a 3 ′ side region of the base, preferably 30 to 100 bases. A primer having a sequence complementary to the downstream region is exemplified. As a primer used to determine polymorphism by the presence or absence of amplification by PCR, it has a sequence containing the base, a primer containing the base on the 3 ′ side, a complementary sequence of the sequence containing the base, Examples include a primer containing a base complementary to the above base on the 3 ′ side.
An example of such a primer is a primer comprising the nucleotide sequence of SEQ ID NO: 11.
In addition to these primers and probes, the test reagent of the present invention may contain a polymerase for PCR, a buffer, a hybridization reagent, and the like.

<3> Method of screening for preventive or therapeutic agent for nephrotic syndrome According to the present inventors' research, rs16946160 is present in an intron and affects the expression level of GPC5, and the expression level of GPC5 gene is increased in a nephrotic syndrome model. It was suggested that From the above, a candidate substance that can be a prophylactic or therapeutic drug for nephrotic syndrome can be obtained by screening a substance that decreases the expression of the GPC5 gene or inhibits the function of GPC5.
That is, the screening method of the present invention includes a step of adding a drug candidate substance to a cell that expresses a reporter gene linked to a GPC5 gene or a GPC5 gene promoter, a step of measuring the expression level of the GPC5 gene or reporter gene, and The screening method of the preventive or therapeutic agent of nephrotic syndrome including the process of selecting the substance which reduces the said expression level is mentioned.

As the cells that express the GPC5 gene, glomerular epithelial cells are preferable, and GEC-T cells (J Am Soc Nephrol 13: 2027-36, 2002) can be used.

When a reporter gene linked to the promoter of the GPC5 gene is used, the GPC5 gene promoter is preferably a region containing about 2 kbp upstream of the transcription start point of the gene, and more preferably a region containing about 5 kbp upstream. The sequence information of the promoter can be obtained from the genome sequence of the GPC5 gene (NC_000013.9).
Examples of reporter genes include luciferase gene, GFP gene, chloramphenicol acetyltransferase gene and the like. These reporter genes are linked to the GPC5 gene promoter, incorporated into a plasmid used to introduce the gene into mammalian cells, and transfected into cells by a conventional method such as lipofection.
A drug candidate substance is added to a cell expressing the GPC5 gene as described above or a cell into which the reporter gene has been introduced, and the expression level of the GPC5 gene or reporter gene is measured.

The drug candidate substance is not particularly limited, and may be, for example, a low molecular synthetic compound or a compound contained in a natural product. Further, it may be a peptide or a nucleic acid. Although individual test substances may be used for screening, a compound library containing these substances may be used. A candidate substance for a nephrotic syndrome drug can be obtained by selecting a candidate substance that reduces the expression level of the GPC5 gene or reporter gene (compared to the case where no addition is made).

The expression level of the GPC5 gene can be measured by methods such as RT-PCR, quantitative PCR, Northern blot, ELISA, Western blotting, In situ hybridization, and immunohistochemical staining.
Although the expression level of the reporter gene depends on the type of reporter gene, it can be measured by fluorescence intensity, luminescence intensity, radioactivity intensity, and the like.
A substance in which the expression level of the GPC5 gene or reporter gene is changed can be selected as a candidate substance for a nephrotic syndrome therapeutic drug.

It is also possible to screen for preventive or therapeutic agents for nephrotic syndrome using FGF or FGFR using FGF signal inhibitory activity as an index. For example, using FGF and FGFR, screening for substances that inhibit the binding of FGF to FGFR, or screening for substances that inhibit the tyrosine kinase activity of FGFR activated by the binding of FGF to FGFR In addition, a prophylactic or therapeutic agent for nephrotic syndrome can be screened.

FGF-2 is preferred as the FGF used here. The sequence of FGF-2 is known in humans, mice, rats and the like, and those cloned based on the sequence and those commercially available can be used. For example, as human FGF-2, a protein having the sequence of Database Swiss Prot Accession No. P09038 (UniProtKB FGF2_HUMAN) or a fragment thereof can be used.
On the other hand, various types of FGFR are expressed in the kidney and all react with FGF2. Therefore, any FGFR may be used. For example, a protein having a sequence of Database Swiss Prot Accession No. P11362 (FGFR1_HUMAN of UniProtKB) or a fragment thereof can be used as human FGFR.

As a method of screening for substances that inhibit the binding of FGF to FGFR, for example, an in vitro pull-down assay using both FGF and FGFR proteins and an interaction detection system using surface plasmon resonance phenomenon are prepared. Examples thereof include a method for selecting a compound that inhibits the interaction.

As a method of screening for substances that inhibit the tyrosine kinase activity of FGFR, at least a FGFR containing a tyrosine kinase domain and its substrate (full length of FGF receptor substrate or a part containing a phosphorylation site) are prepared, and the compound is a substrate by FGFR. And a method of screening using as an index whether or not phosphorylation is inhibited. An assay kit for FGFR tyrosine kinase activity is commercially available from Cyclex.
Examples of the inhibitor thus obtained include PD173074 (Sigma-Aldrich Japan), SU5402 (Calbiochem), AZD2171 (Astrazeneca), Ki23057 (Kyowa Hakko Kirin) and the like.

<4> Nephrotic Syndrome Therapeutic Agent or Preventive Agent The present invention provides a medicament for treating or preventing nephrotic syndrome containing an FGF signal inhibitor. An FGF signal inhibitor is a substance that blocks a signal at any stage in a series of reactions in which FGF binds to FGFR and FGFR is activated and downstream genes are activated or attenuated. Say.
One embodiment of the FGF signal inhibitory substance is a substance that inhibits the binding of FGF to the FGF receptor.
Since GPC5 works to strengthen the binding of FGF and FGFR via its heparan sulfate (HS) side chain, GPC5 gene expression inhibitor or GPC5 function inhibitor inhibits the binding of FGF to the FGF receptor. Can be used as a substance.

That is, the present invention provides a medicament for the treatment or prevention of nephrotic syndrome containing a GPC5 gene expression inhibitor or a GPC5 function inhibitor.
Here, examples of the GPC5 gene expression inhibitory substance include double-stranded RNA, antisense nucleic acid, and low molecular weight compounds that have GPC5 gene expression inhibitory action.
The double-stranded RNA having the GPC5 gene expression inhibitory action is a double-stranded RNA for the GPC5 gene that suppresses the expression of the GPC5 gene by RNA interference (a double strand consisting of a partial sequence of the GPC5 gene and its complementary strand). RNA). Specifically, when such double-stranded RNA for the GPC5 gene is introduced into a cell, mRNA transcribed from the endogenous GPC5 gene is degraded, resulting in specific suppression of GPC5 gene expression in the cell. Is done. This technique has also been confirmed in mammalian cells and the like (Hannon, GJ., Nature (2002) 418,244-251 (review); Japanese translations of PCT publication No. 2002-516062; Japanese translations of PCT publication No. 8-506734).
The double-stranded RNA (short-interfering RNA: siRNA) that can be used in the present invention is a sequence of 10 to 50 contiguous nucleotides in the nucleotide sequence (eg, SEQ ID NO: 8) of the GPC5 gene coding region, preferably It consists of 15 to 35 contiguous base sequences, more preferably 19 to 27 contiguous base sequences, still more preferably 21 to 23 contiguous base sequences and their complementary strands. Examples of siRNA that can be used as a GPC5 gene expression inhibitor include siRNA consisting of SEQ ID NOs: 4 and 5, but are not limited thereto, and other regions of the GPC5 gene are also identified and used using a search algorithm be able to.
The double-stranded RNA may be a single double-stranded RNA molecule composed of two separate strands, but a double-stranded RNA formed by a single strand having a stem-loop structure. It may be a molecule. In addition, by providing a 2 base overhang on the 3 ′ side of each strand, the gene expression inhibitory action can also be enhanced (WO01 / 75164 pamphlet).

Examples of the antisense nucleic acid having a GPC5 gene expression inhibitory action include antisense oligonucleotides having a base sequence complementary to a part of the base sequence of the GPC5 gene (eg, SEQ ID NO: 8). The antisense oligonucleotide may be modified with phosphorothioate or the like. The length of the antisense oligonucleotide is not particularly limited, but is preferably 15 to 40 mer, more preferably 20 to 30 mer.

A low molecular weight compound having a GPC5 gene expression inhibitory action can be obtained by a screening method using a cell expressing a GPC5 gene or a reporter gene linked to a GPC5 gene promoter.
Examples of the GPC5 function inhibitor include antibodies to GPC5 and partial proteins of GPC5. Whether to suppress the function of GPC5 can be confirmed by suppressing the function of GPC5 that promotes the interaction between FGF-2 and FGF receptor (FGFR).

As another embodiment of the FGF signal inhibitory substance, an FGF receptor tyrosine kinase activity inhibitor can also be used. Specific examples of the inhibitor include PD173074, SU5402, AZD2171, Ki23057 described above.

Sulfatase 2 (SULF2), an enzyme that binds to FGF and degrades heparan sulfate (HS), which is involved in promoting the binding between FGF and FGFR, is also used as a substance that inhibits the binding of FGF to the FGF receptor. be able to. Examples of SULF2 include human SULF2 having the amino acid sequence set forth in SEQ ID NO: 17 or a homologue thereof. The homologue is not limited as long as it has HS degradation activity, but preferably includes an amino acid sequence having 95% or more identity with the amino acid sequence shown in SEQ ID NO: 17.
SULF2 may be administered to the affected area (kidney) or may be locally administered to the affected area in the state of the gene encoding SULF2 to express the SULF2 protein.

Furthermore, as other embodiments of the FGF signal inhibitor, FGF2 mutants, FGF2 siRNA, FGF2 antisense nucleic acid, and the like can also be used. FGF2 mutants include mutants that bind to FGFR but cannot activate FGFR. The FGF2 siRNA or FGF2 antisense nucleic acid may be any nucleic acid that can suppress the expression of the FGF2 gene, and the preferred length is the same as that of GPC.

In the nephrotic syndrome treatment or prevention drug of the present invention, FGF signal inhibitory substances such as GPC5 gene expression inhibitory substances and FGF receptor tyrosine kinase activity inhibitors may be used as they are, but preferably GPC5 gene expression inhibitory substances and An FGF signal inhibitor such as an FGF receptor tyrosine kinase activity inhibitor is used in a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include liquid carriers (eg, water, oil, saline, aqueous dextrose, ethanol, etc.), solid carriers (eg, gelatin, starch, glucose, lactose, sucrose, sodium stearate, monostearate). Acid glycerol, keratin, colloidal silica, dried skim milk, glycerol, water-soluble fullerene, etc.). In addition, it contains suitable additives such as adjuvants, preservatives, stabilizers, thickeners, lubricants, colorants, wetting agents, emulsifiers, pH buffering agents, etc., which are blended in ordinary pharmaceutical compositions. Also good.

When the nephrotic syndrome therapeutic or preventive agent of the present invention contains the above double-stranded RNA or antisense nucleic acid as an active ingredient, nanocapsules, microspheres, beads, Oil-in-water emulsions, micelles, mixed micelles, liposomes and the like are preferably used as delivery systems.

The administration method of the nephrotic syndrome therapeutic or prophylactic agent of the present invention is not particularly limited, but particularly when double-stranded RNA or antisense nucleic acid is used as the active ingredient, it is administered to the kidney by injection or local administration using a liquid feeding tube. It is preferable. Alternatively, when a double-stranded RNA or antisense nucleic acid is used as an active ingredient, the double-stranded RNA or antisense nucleic acid is introduced into a cell obtained from a patient, and then delivered by administering the cell to the patient. be able to. Introduction of double-stranded RNA or antisense nucleic acid into cells can be performed by the calcium phosphate method, DEAE-dextran method, electroporation, lipofection, or the like.

The dose of the therapeutic or preventive agent for nephrotic syndrome of the present invention is appropriately set according to the age, sex, symptoms, administration route, administration frequency, dosage form, etc. of the patient. A suitable dose can be set by conducting a test using a disease model. For example, the active ingredient can be administered at 0.1 mg / kg body weight / day to 50 mg / kg / day.

<5> Test Method Based on Expression Level The present invention also provides a test method for nephrotic syndrome (a method for obtaining test data) including a step of measuring the expression level of a GPC5 gene or GPC5 gene product. If the expression level of the GPC5 gene or GPC5 gene product (GPC5 protein) is increased compared to controls such as healthy individuals, it can be determined that the patient is suffering from nephrotic syndrome or is at high risk for nephrotic syndrome .
The expression level of GPC5 gene can be examined by RT-PCR, Northern blot, microarray method and the like. The expression level of the GPC5 gene product can be examined by ELISA, Western blot, or the like. As the antibody, a commercially available antibody can be used, or an antibody prepared by using a part of the amino acid sequence of GPC5 protein (for example, SEQ ID NO: 9) as an antigen can also be used. GenBank Accession No. NM — 004466 (SEQ ID NO: 8) is exemplified as the base sequence of the coding region of GPC5, and primers or probes for expression analysis can be designed or obtained using this sequence. Examples of RT-PCR primers include the primer sets of SEQ ID NOs: 2 and 3.
The sample used for the test includes a blood sample or a urine sample.

Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these examples.

1. Identification of SNPs correlated with nephrotic syndrome Nephrotic syndrome patients and control patients Three independent populations of patients with nephrotic syndrome (case 1 (N = 195), case 2 (N = 231), case 3 (N = 201)), nephrotic We searched for SNPs associated with nephrotic syndrome using three independent populations of controls that were not syndrome patients (control 1 (N = 1546), control 2 (N = 1548), control 3 (N = 300)) . Case 1, case 2, control 1 and control 2 used samples registered with RIKEN Biobank, and case 3 used nephrotic syndrome patient samples collected at Fukushima Medical University. Control 3 was a healthy person sample owned by the University of Tokyo Hospital.
In addition, informed consent was obtained for the collection of these samples.
Cases 1 to 3 were selected according to the following criteria.
(1) Proteinuria: Maintains a daily protein content of 3.5 g or more (2) Hypoproteinemia: Serum total protein is 6.0 g / 100 ml or less (when hypoalbuminemia is established, serum albumin is 3.0 g / 100 ml) Less than)
Controls 1 and 2 are diseases other than nephrotic syndrome, specifically type 2 diabetes, bronchial asthma, myocardial infarction, breast cancer, Basedow's disease, cerebral infarction, cerebral aneurysm, osteoporosis, heart disease, unstable angina If you are a patient with symptom, pollinosis, obstructive arteriosclerosis, emphysema, atopic dermatitis, gastric cancer or cirrhosis.
The breakdown of cases 1 to 3 and control 1 to 3 is shown in Table 1.

Age is shown as mean ± standard deviation. NA indicates that it cannot be identified. etc indicates primary nephrotic syndrome other than the four major tissue diagnoses, and secondary indicates secondary nephrotic syndrome. MC: minimal change type; FSGS, focal segmental glomerulosclerosis; MN, membranous nephropathy; MPGN; membranous proliferative glomerulonephritis

SNP analysis was performed by direct sequencing, TaqMan ™ SNP genotyping assay or DigitagIItm assay (Analytical Biochemistry 346 (2): 281-288).
First, an attempt was made to search for SNPs that correlate with nephrotic syndrome using case 1 and control 1, and case 2 and control 2, and both were significant between case 1 and control 1 and between case 2 and control 2. We obtained 90 SNPs without any reversal of disease-sensitive alleles.
Since nephrotic syndrome includes many pathological conditions, it was thought that the target pathological condition would become ambiguous if simply put together as nephrotic syndrome, so primary nephrotic syndrome and four major tissue lesions (from all nephrotic syndromes ( Minor change group, focal glomerulosclerosis, membranous nephropathy, membranoproliferative glomerulonephritis), Minor change group, focal glomerulosclerosis, membranous nephropathy, membranoproliferative glomeruli We tried to obtain a more purely pathological SNP among nephrosis by comparing the P value and odds ratio (OR) in each group of nephritis.
Of these subgroups, 48 were SNPs with a P value of less than 0.01 in one or more groups. Since 4 of them were typing errors, 44 were considered significant SNPs.

From the SNPs derived in this way, the top 10 SNPs of primary nephrotic syndrome and four major tissue lesions (15 in total because of 5 duplications) were selected.
When these were examined between case 3 and control 3, reproducibility was confirmed with 3 SNPs.
One of these was SNP (rs16946160) present in intron 2 of the GPC5 gene. Table 2 shows the results of comparison between case 1 and control 1 (1 ^st panel), case 2 and control 2 (2 ^nd panel), and case 3 and control 3 (3 ^rd panel). The upper row used all nephrotic syndrome as the case, and the lower row used only the four major tissue lesions as the case.
From these results, for rs16946160, all nephrotic syndrome: control has an odds ratio of 1.273, four major tissue lesions: control has an odds ratio of 1.376, and the rs16946160 A allele is a significant risk allele of nephrotic syndrome. It turned out to be.

MAF: minor allele frequency, OR: odds ratio

Since rs16946160 is in the intron region, cDNA synthesized using total RNA from the peripheral blood of healthy individuals with each genotype was screened for splicing RNA by PCR with intron 2 between exons 2 and 3. However, no difference in splicing was observed in each genotype (data not shown).

Analysis of GPC5 mRNA expression level Real-time PCR of GPC5 was performed on cDNA synthesized from the peripheral RNA of healthy humans with each genotype, and the transcription level of GPC5 gene was compared with that of β-actin. It was shown that the mRNA level of GPC5 is high in healthy individuals with / A (FIG. 1). In other words, it was suggested that increased expression of the GPC5 gene may promote the onset of nephrotic syndrome. In realtime PCR, SEQ ID NOs: 2 and 3 were used as primers for human GPC5 amplification, and ABI Prism 3700 Real Time PCR System (Applied BioSystems) was used as a detection device.

When the expression level of GPC5 gene in cultured glomerular epithelial cells (GEC-T) and cultured proximal tubular epithelial cells (mProx) was compared, it was found that GPC5 was highly expressed in the former (data Is not shown). Furthermore, when immunohistochemical staining was performed using an anti-GPC5 antibody (R & D systems, MAB2607), accumulation of GPC5 in the glomeruli was observed (FIG. 4A).

Functional analysis of GPC5 in the cell line Cultured rat glomerular epithelial cells (GEC-T) were added with siRNA against the GPC5 gene or negative control siRNA (40 pmol / ml), cultured until 100% confluent, and diluted 2-fold with PBS After plating on collagen type I-coated filter (Japan BD: BioCoat Collagen I culture insert, pore size 0.4μm, 1,600,000 / cm ² ) and culturing at 37 ° C for 18 hours, 0.6g / dl above and below the cell layer An experimental system was established in which a liquid phase with a difference in albumin concentration was arranged and a protein permeability study could be evaluated with a difference in concentration gradient after 8 hours (FIG. 2B).
GEC-T has already been reported in JAm Soc Nephrol 13: 2027-36,2002, has C-arboration, C-3 and 5-specific arborization, Nephrin and VEGF121 expression, and specific for glomerular epithelial cells. 1-2 Immunization of monoclonal antibodies has been confirmed.
As a result, protein permeability decreased when siRNA against the GPC5 gene was added to suppress the expression of the GPC5 gene compared to when no siRNA was added (control) and when a negative control siRNA was added (FIG. 2C).
Here, double-stranded RNA (GPC5-specific siRNA) consisting of SEQ ID NO: 4 (sense strand) and SEQ ID NO: 5 (antisense strand) was used as siRNA against the GPC5 gene. It has been confirmed that it can be suppressed to a certain extent (FIG. 2A).
As the negative control siRNA, Stealth RNAi Negative Control Medium GC Duplex # 2 (Invitrogen, Carlsbad, CA) was used. Lipofectamine 2000 (Invitrogen, Carlsbad, CA) was used to add GPC5-specific siRNA and negative control siRNA.

Functional analysis of GPC5 by in vivo experiments A glomerular-specific knockdown mouse of GPC5 gene was prepared. Specifically, as shown in FIG. 4C, thymidine kinase polyA sequence (TKpA) and mouse GPC5 mRNA sequence (NM — 175500.) downstream of the podocin promoter, which is a glomerular-specific gene of the E. coli artificial chromosome (BAC clone). 3) This is a double-stranded RNA expression sequence for expressing microRNA (miR RNA) having RNAi effect on three places (1-1) TGCTGTTCAGGAGGGCCCTACTGCACGTTTTGGCCACTGACTGACGTGCAGTAGCCCTCCTGAA (SEQ ID NO: 6)
(1-2) CCTGTTCAGGAGGGCTACTGCACGTCAGTCAGTGGCCAAAACGTGCAGTAGGGCCCTCCTGAAC (SEQ ID NO: 7)
(2-1) TGCTGCAAACCTGAAGATCAGGTCCTGTTTTGGCCACTGACTGACAGGACCTGCTTCAGGTTTG (SEQ ID NO: 12)
(2-2) CCTGCAAACCTGAAGCAGGTCCTGTCAGTCAGTGGCCAAAACAGGACCTGATCTTCAGGTTTGC (SEQ ID NO: 13)
(3-1) TGCTGAATTTCTGCCCATTGAGGTGAGTTTTGGCCACTGACTGACTCACCTCAGGGCAGAAATT (SEQ ID NO: 14)
(3-2) Three sets of CCTGAATTTCTGCCCTGAGGTGAGTCAGTCAGTGGCCAAAACTCACCTCAATGGGCAGAAATTC (SEQ ID NO: 15) self-annealed were cloned. BAC construct (Tg-podocin-GPC5iR RecBAC) obtained by a conventional method was introduced into mouse ES cells to produce a mouse (GPC5 glomerular-specific knockdown mouse) in which GPC5 gene expression was specifically suppressed. did.
When the obtained GPC5 glomerulus-specific knockdown mouse was stained for kidney tissue using an anti-GPC5 antibody, it was confirmed that the expression of GPC5 in the glomerulus was significantly reduced (FIG. 4B).

In wild-type mice (BDF1 mice) and the GPC5 glomerular-specific knockdown mice, puromycin (PAN) (300 mg / kg sc) and basic fibroblast growth factor (bFGF: FGF2 alias) (250 μg) Nephritis was induced by administering (/ kg vaginal intravenous administration). As a result, as shown in FIG. 5, urinary albumin creatinine ratio (ACR) and total urine protein (uTP) increased in wild type mice, whereas these values in GPC5 glomerular-specific knockdown mice. The rise of was not seen.

The GPC5-specific siRNA (400μg / PBS マ ウ ス 0.8μml IV) was administered to wild-type mice, and urinary albumin creatinine ratio (ACR) and urinary protein (uTP) were examined over time. No significant increase in ACR and uTP was observed in about 10-12 days after nephritis induction in wild type mice, and it was found that administration of GPC5-specific siRNA can suppress nephritis symptoms.

Furthermore, blood was collected from wild-type mice and GPC5 glomerular-specific knockdown mice, and the amount of albumin in the blood was measured. As a result, as shown in FIG. 6, in the wild-type mouse, the amount of albumin (ALB) in the blood decreased due to nephritis induction (10 days after nephritis induction), whereas in the GPC5 glomerular-specific knockdown mouse, The amount of ALB did not decrease. In the wild-type mouse, when the GPC5-specific siRNA was administered 10 days after nephritis induction, the amount of ALB in the blood recovered 11 days after administration (21 days after nephritis induction).

In wild-type mice (GPC5-specific siRNA administration (siRNA administration on day 9 after nephritis induction) and non-administration) and GPC5 glomerular-specific knockdown mice, kidneys were removed 28 days after nephritis induction and kidneys were removed. Tissue staining (PAS staining and MT staining) was performed. The degree of focal segmental hardening of the glomeruli was calculated from the results of PAS staining and MT staining. The results are shown in FIG. According to it, glomerular nest-like segmental sclerosis was hardly seen in GPC5 glomerulus-specific knockdown mice. In addition, the proportion of severe segmental sclerosis (75 to 100%) in GPC5-specific siRNA-treated mice was also reduced compared to non-treated mice.

From the above results, it was found that the possibility of developing nephrotic syndrome can be predicted by typing SNP of GPC5 gene, and that nephrotic syndrome can be treated and prevented by using a GPC5 expression inhibitor such as siRNA.

In addition, the present inventor has shown that the GPC5 gene product promotes the binding of FGF-2 and FGFR, and the suppression of the GPC5 gene increases the expression of the p21 gene and increases the ratio of G0 / G1 stage, It is confirmed that the period ratio is significantly suppressed. From these facts, the increase in GPC5 expression causes glomerular epithelial cells to enter the proliferative phase through activation of FGF signal transduction and suppression of p21 downstream thereof, which forms a barrier function in the glomerulus. It was thought that glomerular epithelial cell construction led to collapse, and tight junction 障害 was impaired, leading to proteinuria.

In addition, the effect of GPC5-specific siRNA on the binding of FGF-2 and FGFR was examined in a cell line. Specifically, biotin-labeled bFGF is added to the cultured cell medium and bound to FGFR, and the remaining bFGF is detected with picoerythrin (PE) -labeled streptavidin, and the binding ability of FGF is determined by negative control siRNA (Stealth RNAi Negative Comparison was made in the presence of Control Medium GC Duplex # 2) or GPC5-specific siRNA. The results are shown in FIG. (A) is a result of a rat glomerular epithelial cell line, and (B) is a result of a human colon cancer cell line. It can be seen that the addition of GPC5-specific siRNA decreases the binding of FGF-2 and FGFR.
As the GPC5-specific siRNA, siRNA consisting of SEQ ID NOs: 4 and 5 was used. This sequence is an siRNA against a sequence common to humans and mice, and it is preferable to use the same sequence in humans as well, but the same effect can be expected with miRNA and siRNA that can suppress GPC5 expression as well.
As a result, it was found that nephrotic syndrome can be treated and prevented by using a GPC5 expression inhibitor such as siRNA in humans.

From the above results, it is possible to treat and prevent nephrotic syndrome by decreasing the binding of FGF-2 and FGFR, or by blocking the signal pathway activated by FGF-2 binding to FGFR Was considered.
Therefore, first, an FGF receptor tyrosine kinase activity inhibitor was administered to a nephritis model, and the therapeutic effect was examined.

By administering puromycin (PAN) (500 mg / kg subcutaneous administration) and basic fibroblast growth factor (bFGF) (5 mg / kg intravenous administration) in wild type mice (BDF1 mice), nephritis Induced. On the 4th, 5th, 6th, 7th, 8th, and 9th days after nephritis induction, 40 μg / day 受 容 of FGF receptor tyrosine kinase activity inhibitor (PD173074: Sigma-Aldrich Japan) was intraperitoneally administered, and after inducing nephritis On the 7th, 10th, and 14th days, ACR was measured and compared with the group not administered with the FGF receptor inhibitor. The results are shown in FIG.

In addition, nephritis was induced in wild-type mice (BDF1 mice) by administering adriamycin (AD: Hydroxydaunorubicin hydrochloride: Sigma-Aldrich Japan) (10 mg / kg intravenous injection). PD173074 125 μg / day was administered intraperitoneally on days 1, 2 and 3 after nephritis induction, and ACR was measured on days 1, 3, 5, 7 and 10 after nephritis induction and FGF receptor inhibitor non-administration group Compared with. The results are shown in FIG.

As shown in FIGS. 8 and 9, in all nephritis models, PD173074 administration reduced ACR, indicating that PD173074 is effective in the treatment and prevention of nephrotic syndrome.

Regarding the binding of FGF to FGFR on the cell membrane, heparan sulfate (HS) modified with a side chain on the membrane protein GPC5 interacts with FGF, which stabilizes the binding of FGF to FGFR. It is known that the sulfate group of HS is degraded by the action of SULF2, thereby reducing the binding of FGF to FGFR (Chemistry and Biology of Heparin and Heparan Sulfate (p245): FIG. 10). Therefore, it is considered that nephrotic syndrome can be treated and prevented if FGF signal is attenuated by introducing SULF2 protein or expressing SULF2 gene.

In order to examine the effect of SULF2 on the FGF signal, SULF2-specific siRNA was added to GEC-T cells and cultured, and the degree of cell proliferation was examined. As a result, it was found that the cell growth rate was higher when SULF2-specific siRNA was added than when siRNA was not added and when non-specific siRNA was added (FIG. 11). This result suggests that SULF2-specific siRNA suppresses the degradation of HS sulfate group and promotes FGF signal, thus promoting p21 suppression reaction downstream of FGF signal and promoting cell proliferation. It was.

The following SULF2-specific siRNA and non-specific siRNA were used.
Rat Sulf2 siRNA:
Sense CCCAUCGGUGCUACAUCCUUGAGAA (SEQ ID NO: 18)
Antisense UUCUCAAGGAUGUAGCACCGAUGGG (SEQ ID NO: 19)
Rat Sulf2 negative control siRNA
Sense CCCGCUGCGAUACCUUCGUAUAGAA (SEQ ID NO: 20)
Antisense UUCUAUACGAAGGUAUCGCAGCGGG (SEQ ID NO: 21)

The present invention is useful in the fields of diagnosis and medicine. Since the onset risk and progression of nephrotic syndrome can be accurately predicted according to the test method of the present invention, it is possible to control proteinuria and reduce the number of patients requiring artificial dialysis, which contributes to the medical economy. . Moreover, the nephrotic syndrome therapeutic agent of the present invention provides a new and efficient treatment method based on a novel mechanism.

Claims (13)

1. A method of analyzing a single nucleotide polymorphism of a base present on a Glypican5 (GPC5) gene or a single nucleotide polymorphism of a base in linkage disequilibrium with the base and examining nephrotic syndrome based on the analysis result.
2. The method according to claim 1, wherein the single nucleotide polymorphism is a polymorphism in a base corresponding to the 101st base of the nucleotide sequence of SEQ ID NO: 1.
3. A probe for testing nephrotic syndrome, which has a sequence of 10 bases or more including the base of the base number 101 in the base sequence of SEQ ID NO: 1, or a complementary sequence thereof.
4. A primer for nephrotic syndrome test, which can amplify a region containing the base at the 101st base in any base sequence of SEQ ID NO: 1.
5. A step of adding a drug candidate substance to a cell that expresses a GPC5 gene or a reporter gene linked to a promoter of the GPC5 gene, a step of measuring the expression level of the GPC5 gene or the reporter gene, and a substance that reduces the expression level are selected. A method for screening a preventive or therapeutic agent for nephrotic syndrome, comprising a step.
6. A test method for nephrotic syndrome, comprising a step of measuring the expression level of a GPC5 gene or GPC5 gene product.
7. A medicament for preventing or treating nephrotic syndrome, comprising a fibroblast growth factor (FGF) signal inhibitor as an active ingredient.
8. The medicament according to claim 7, wherein the FGF signal inhibitor is a substance that inhibits the binding of FGF to the FGF receptor.
9. The medicament according to claim 8, wherein the substance that inhibits the binding of FGF to the FGF receptor is a substance that suppresses GPC5 gene expression or a substance that suppresses GPC5 function.
10. The medicament according to claim 9, wherein the GPC5 gene expression inhibitor is a double-stranded RNA against the GPC5 gene.
11. The medicament according to claim 7, wherein the FGF signal inhibitor is an FGF receptor tyrosine kinase inhibitor.
12. The medicament according to claim 9, wherein the substance that inhibits the binding of FGF to the FGF receptor is Sulfatase-2.
13. A method for screening a preventive or therapeutic agent for nephrotic syndrome, comprising screening a substance that inhibits the binding of FGF to an FGF receptor or a substance that inhibits FGF receptor tyrosine kinase activity.

Images