WO2010071190A1

WO2010071190A1 - Heparin affinity erythropoietin

Info

Publication number: WO2010071190A1
Application number: PCT/JP2009/071095
Authority: WO
Inventors: 健鳥羽; 公則加藤; 晴雄塙; 義房相澤; 正人樋口
Original assignee: 国立大学法人新潟大学; 中外製薬株式会社
Priority date: 2008-12-19
Filing date: 2009-12-18
Publication date: 2010-06-24
Also published as: JP5799409B2; JPWO2010071190A1

Abstract

Disclosed is a chimeric protein containing a polypeptide having a heparin affinity motif and biological activity. Additionally disclosed are a controlled-release pharmaceutical composition and a prolonged-action pharmaceutical composition containing the protein.

Description

Heparin affinity erythropoietin

The present invention relates to a chimeric protein comprising a heparin affinity motif and a biologically active polypeptide.

Erythropoietin (hereinafter sometimes referred to as EPO) is an acidic glycoprotein hormone that promotes the differentiation and proliferation of erythroid progenitor cells, and is produced mainly from the kidney. The most abundant red blood cells in the blood are destroyed in the spleen after functioning for a certain period of time (in humans, the average life span is about 120 days). The red blood cell count is always kept constant. EPO plays a central role in maintaining homeostasis of erythrocytes in these organisms. Clinically, EPO is used for the treatment of anemia and pre- and postoperative management.

In addition to its function as a hematopoietic factor, EPO is known to suppress apoptosis and protect tissues in nervous system cells, cardiomyocytes, renal tubular epithelial cells, etc. (PNAS 100: 4802-4806, 2003, etc.) ). These two actions of EPO are thought to be due to EPO acting by two different signal transduction pathways. When EPO acts on homodimers of the EPO receptor, it exerts hematopoiesis through the intracellular JAK2 signaling pathway. On the other hand, when EPO acts on the heterodimer of EPO receptor and common β receptor (βcR), it exerts an anti-apoptotic effect through the intracellular ERK1 / 2 signaling pathway (PNAS 101: 14907-14912, 2004).

Based on the anti-apoptotic action of EPO, EPOE has angiogenesis-promoting activity and is also reported to be useful as a therapeutic agent for ischemic diseases (Christopher H et al., Blood 102 (4); 1340 -1346, 2003, Ferdinand H B et al., Blood 103 (3); 921-926, 2004, Kyle J S et al., Cardiovascular Research 59; 538-548, 2003).

When a cytokine having no heparin affinity, such as EPO, is administered into a mammalian tissue such as a human, it is likely to be reabsorbed from blood vessels present in the tissue, and the tissue concentration may decrease. For example, when EPO is used for the treatment of ischemic disease, it is necessary to maintain a sufficiently high drug concentration locally in a target organ where angiogenesis is desired for about one week until sufficient blood vessels are regenerated. If the drug can easily reach the local area from the body surface, such as treatment of limb ischemia, it can be administered daily, but difficult to administer frequently from the body surface, such as treatment of myocardial ischemia. If there is, there is a need to develop new formulations.

There are glycoproteins and proteoglycans (PG) as proteins containing sugar chains present in the living body. There are so-called heparin-like substances such as chondroitin sulfate, keratan sulfate, heparin, heparan sulfate, and dermatan sulfate in the sugar chain of PG, and the sulfo group (sulfate group) of the sugar chain is another substance, especially basic amino acid residues. Interact with the group. These heparin-like substances are abundant in connective tissues, and PG such as syndecan is expressed in various cell membranes, forming a scaffold for biological reactions on the extracellular matrix and cell surface. In particular, various PGs are expressed on the surface of vascular endothelium, providing a place for reaction to various blood substances.

A considerable number of cytokines, chemokines, and other biologically active substances have an affinity for heparin. Since these heparin-affinity substances secreted from the cells show affinity for the extracellular matrix existing around the cells, a concentration gradient with the secretory cells at the top of the mountain is formed, and the target cells of the bioactive substances are Provides information on polarity and direction of movement. In addition, these bioactive substances are strongly accumulated on the surface of cells expressing PG, and particularly on the surface of vascular endothelium.

A heparin affinity substance has a heparin affinity motif in its peptide sequence. Basic amino acids such as lysine and arginine have an excess amino group in the side chain, and have a strong affinity for the sulfo group present in the sugar chain of heparin-like substances. Multiple basic amino acids when multiple basic amino acids are present in the motif continuously or discontinuously, or when the protein forms a tertiary structure (three-dimensional structure) even if there is no accumulation of basic amino acids in the primary structure When they are close to each other, the structure functions as a heparin affinity motif.

To date, a method for purifying EPO using heparin-binding properties has been publicly known (WO97017366 (Special Table No. 11-511483)).

However, there is no known biologically active polypeptide such as EPO to which a heparin affinity motif is bound.

WO97017366 (Special table 11-511483)

An object of the present invention is to provide a chimeric protein containing a heparin affinity motif and a biologically active polypeptide, and a sustained-release pharmaceutical composition or sustained-release pharmaceutical composition containing the same.

The present inventors produced heparinophilic erythropoietin (HEPO), which is a chimeric protein linking EPO and a heparin affinity motif, which shows the affinity of tissue components for heparin-like substances, and EPO organisms. The present invention was completed by finding that it exhibited activity and having an in vivo hematopoietic action and angiogenesis inhibitory action.

That is, the present invention provides the following.
[1] A chimeric protein comprising a heparin affinity motif and a biologically active polypeptide.
[2] The chimeric protein according to [1], wherein the polypeptide having biological activity is a cytokine, hormone or chemokine.
[3] The chimeric protein according to [2], wherein the biologically active polypeptide is a hematopoietic factor.
[4] The chimeric protein according to [3], wherein the hematopoietic factor is human erythropoietin.
[5] The heparin affinity motif is composed of 3 to 100 amino acid residues including at least one basic amino acid sequence selected from the following (a) to (d) in the entire domain, and heparin or heparin-like substance The chimeric protein according to [1], which is a domain that binds to a sulfo group present in the sugar chain.
(a) BBB
(b) BXBB
(c) BBXB
(d) BXBXB
(Where B represents R or K; X represents an amino acid other than R or K)
[6] The chimeric protein according to [1], wherein the heparin affinity motif is a motif derived from heparin-binding growth factor or a part thereof.
[7] The chimeric protein according to [6], wherein the heparin-binding growth factor is PLGF.
[8] A sustained-release pharmaceutical composition comprising the chimeric protein according to [1] to [7].
[9] A sustained-release pharmaceutical composition comprising the chimeric protein according to [1] to [7].
[10] A method for sustained release of a pharmaceutically active compound by fusing a pharmaceutically active compound and a heparin affinity motif.
[11] A method for activating a pharmaceutically active compound by fusing a pharmaceutically active compound and a heparin affinity motif.
[12] A method for producing a pharmaceutically active compound for sustained release, comprising a step of fusing a heparin affinity motif to a pharmaceutically active compound.
[13] A method for producing a sustained-acting pharmaceutically active compound comprising a step of fusing a pharmaceutically active compound with a heparin affinity motif.

The present inventors produced HEPO, which is a chimeric protein in which EPO and a heparin affinity motif are connected, and confirmed that this acts as erythropoietin having heparin affinity in vitro and in vivo. According to the present invention, the following useful effects can be expected.
1. Long-acting erythrocytic agent: Erythropoietin is used to treat renal anemia, etc., but it can reduce the burden on patients by increasing the dose of HEPO and decreasing the number of doses it can.
2. EPO has a therapeutic effect on vascular endothelial injury, but in order to obtain this effect, a dosage sufficient to induce polycythemia and cause heart failure is necessary, which is not realistic. HEPO and its derivatives have a selective affinity for vascular endothelium, so it is expected to treat vascular endothelial injury in amounts that do not induce polycythemia, thrombotic thrombocytopenic purpura, post-transplantation / pharmacological properties and radiation It can be applied to the treatment of thrombotic microangiopathy due to injury, vasculitis associated with vascular endothelial injury such as nephritis and Kawasaki disease.
3. EPO has protective effects on the heart, central nervous system, and other organs, but HEPO and its derivatives can be used as alternative therapeutic agents.
4). By adding to a preservative for organs for transplantation, deterioration of the transplanted organ can be prevented and the survival rate can be increased.
5). Since it has an angiogenesis inhibitory effect, it inhibits the growth of cancerous blood vessels and can be applied as an anticancer agent.

Furthermore, according to the present invention, the following useful properties can be added by imparting heparin affinity to any peptide preparation or non-peptide preparation:
1. By generating tissue affinity, the drug concentration in the tissue can be maintained at a high level.
2. When administered into a tissue, it is slowly released into the blood from the tissue, so that it can be used as a sustained-release drug.
3. By adjusting the structure of the heparin affinity motif, affinity for any cell can be increased.
4). In particular, by increasing the affinity with the vascular endothelium, a drug that selectively acts on the vascular endothelium can be created.

FIG. 1 shows the structure of the pMIB vector used for rhHEPO cDNA expression. FIG. 2 shows the peptide sequence of rhHEPO. FIG. 3 is a phase contrast micrograph (Panel A) and a cell number graph (Panel B) showing the results of heparin affinity of each EPO in vitro. (In the figure, 1 is EPO; 2 is AEPO; 3 is CEPO; 4 is HEPO). FIG. 4 is a graph showing the erythropoietin activity of EPO and HEPO at various concentrations. FIG. 5 is a graph showing the hematopoietic effect of HEPO. FIG. 6 is a graph showing the angiogenesis inhibitory action of HEPO.

Polypeptide having biological activity The biologically active polypeptide used in the present invention is not particularly limited, but is preferably a polypeptide that preferably maintains the activity in the target tissue, or after binding to the tissue, it enters the blood from the tissue. A polypeptide that is preferably released gradually. Polypeptides having biological activity include, but are not limited to, antibodies, enzymes, cytokines, and hormones. Specifically, granulocyte colony stimulating factor (G-CSF), granulocyte macrophage colony stimulating factor (GM-CSF), erythropoietin (EPO), thrombopoietin and other hematopoietic factors, interferon, IL-1 and IL-6, etc. Includes cytokines, chemokines, immunoglobulins, monoclonal antibodies, humanized antibodies, tissue plasminogen activator (TPA), urokinase, serum albumin, blood coagulation factor VIII, leptin, insulin, stem cell growth factor (SCF), etc. However, it is not limited to these. In particular, hematopoietic factors such as G-CSF and EPO are preferred, and EPO is most preferred.

In the present invention, particularly by binding a heparin affinity motif to a polypeptide having low tissue affinity, it is possible to improve the sustained activity and sustained release of the biological activity.

Heparin affinity motif The heparin affinity motif in the present invention refers to a heparin affinity sequence motif contained in a heparin affinity substance, and has an excess amino group in a side chain such as a basic amino acid in the peptide sequence. The peptide is not particularly limited as long as it is a peptide having a strong affinity for a sulfo group present in the sugar chain of a heparin-like substance. For basic amino acids, multiple basic amino acids may exist continuously or discontinuously in the motif, and even if there is no accumulation of basic amino acids in the primary structure, the protein forms a tertiary structure (three-dimensional structure). In this case, a plurality of basic amino acids may be close to each other, and the structure may have heparin affinity. As such a heparin affinity motif, for example, at least one, preferably two or more basic amino acid sequences (heparin binding sequences) described in any of (a) to (d) below within the entire domain: In total, it consists of about 3 to 100 amino acid residues, preferably 10 to 40 amino acid residues.
(a) BBB
(b) BXBB
(c) BBXB
(d) BXBXB
(Where B represents R or K; X represents an amino acid other than R or K)
As the heparin affinity motif, a motif that binds to a sulfo group present in the sugar chain of a heparin-like substance, a motif derived from a heparin-binding growth factor such as vascular endothelial growth factor (VEGF), or a part thereof can be used. Examples of such a motif include the entire heparin affinity domain described below, or a heparin affinity motif (underlined part) in the domain or a part thereof.
hBMP-2:
QA K H K Q RKR L K SSCKRHP LYVDFSDVGW NDWIVAPPGY HAFYCHGECP FPLADHLNST NHAIVQTLVN SVNSKIPKAC CVPTELSAIS MLYLDENEKV VLKNYQDMVV EGCGCR (SEQ ID NO: 1)
hFGF1:
KK NG SC KR GP R THY GQ K (SEQ ID NO: 2)
hFGF2:
KR T GQY K LGS K TG PGQ K (SEQ ID NO: 3)
hPDGF-A:
R P R ESG KKRKRKR L K P T (SEQ ID NO: 4)
hVEGF:
E RRK HLFVQD PQTC K CSC K N TDS R C K A R QL ELNE R TC R CD K P RR (SEQ ID NO: 5)
hPLGF:
RRR P K G R G KR RR E K Q R PTDC HLCGDAVP RR (SEQ ID NO: 6)
Is mentioned.

Heparin-binding growth factor Examples of heparin-binding growth factors include PLGF (Placental growth factor), PDGF (Platelet derived growth factor), VEGF (Vascular endothelial growth factor: Vascular endothelial growth factor) ), IL-8 (Interleukin-8), HGF (Hepatocyto growth factor), SF (Scatter factor), FGF-1 (Fibroblast growth factor-1: fibroblast) Examples include growth factor-1), FGF-2, FGF-7, FGF-10, and the like. In particular, a tissue-selective drug can be obtained by using a tissue-specific heparin affinity motif or a part thereof.

Pharmaceutically active compound The pharmaceutical active compound used in the present invention is not particularly limited, and may be a peptide drug or a non-peptide drug, and the activity is not particularly limited. For example, when the present invention is applied to erythropoietin, it is possible to reduce the number of times erythropoietin is administered to a patient with renal anemia, and it is possible to cause the function of erythropoietin to act selectively in a tissue. An effect can be obtained. For example, it is possible to maintain the concentration within the administration site by binding a heparin-binding sequence to a non-peptide pharmaceutically active compound such as an anticancer drug using a linker or the like. Further, it can be applied as a DDS (Drug Delivery System) for targeting a target organ by binding a tissue-selective heparin-binding sequence.

Erythropoietin (EPO)
The erythropoietin used in the present invention can be any EPO, but is preferably a highly purified EPO, more specifically, a biological EPO that is substantially the same as mammalian EPO, particularly human EPO. It has activity.

The erythropoietin used in the present invention may be produced by any method, for example, natural human EPO (Japanese Patent Publication No. 1-38800) obtained by purification from a human-derived extract, or a gene Human EPO, etc. produced by various methods extracted into E. coli, yeast, Chinese hamster ovary cells (CHO cells), C127 cells, COS cells, myeloma cells, BHK cells, insect cells, etc. Can be used. The erythropoietin used in the present invention is preferably EPO produced by a genetic engineering technique, and preferably EPO produced using mammalian cells (particularly CHO cells) (for example, Japanese Patent Publication No. 1-444317, KennethacJacobs). et al., Nature, 313 806-810 (1985)).

EPO obtained by gene recombination method has the same amino acid sequence as naturally occurring EPO, or has one or more amino acids in the amino acid sequence deleted, substituted, added, etc. Those having the same biological activity as EPO may be used. Amino acid deletion, substitution, addition and the like can be performed by methods known to those skilled in the art. For example, those skilled in the art will recognize site-directed mutagenesis (Gotoh, T. et al. (1995) Gene 152, 271-275; Zoller, MJ and Smith, M. (1983) Methods Enzymol. 100, 468- 500; Kramer, W. et al. (1984) Nucleic Acids Res. 12, 9441-9456; Kramer, W. and Fritz, HJ (1987) Methods Enzymol. 154, 350-367; Kunkel, TA (1985) Proc. Natl. Acad. Sci. USA. 82, 488-492; Kunkel (1988) Methods Enzymol. 85, 2763-2766) etc. Polypeptide can be prepared. Amino acid mutations can also occur in nature. In general, the amino acid residue to be substituted is preferably substituted with another amino acid that preserves the properties of the amino acid side chain. For example, as the properties of amino acid side chains, hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T), amino acids having aliphatic side chains (G, A, V, L, I, P), amino acids having hydroxyl group-containing side chains (S, T, Y), sulfur atom-containing side chains Amino acids (C, M) having carboxylic acids and amide-containing side chains (D, N, E, Q), amino groups having base-containing side chains (R, K, H), aromatic-containing side chains (H, F, Y, W) can be mentioned (all parentheses represent single letter amino acids). It is already known that a polypeptide having an amino acid sequence modified by deletion, addition and / or substitution with other amino acids of one or more amino acid residues to a certain amino acid sequence maintains its biological activity. (Mark, DF et al., Proc. Natl. Acad. Sci. USA (1984) 81, 5662-5666; Zoller, MJ & Smith, M. Nucleic Acids Research (1982) 10, 6487-6500; Wang, A Et al., Science 224, 1431-1433; Dalbadie-McFarland, G. et al., Proc. Natl. Acad. Sci. USA (1982) 79,） 6409-6413).

Also, as the erythropoietin of the present invention, a fusion protein of EPO and another protein can be used. In order to produce a fusion polypeptide, for example, DNA encoding EPO and DNA encoding another protein are linked so that the frames coincide with each other, introduced into an expression vector, and expressed in a host. Other proteins that are subjected to fusion with the EPO of the present invention are not particularly limited.

Moreover, chemically modified EPO can also be used as the erythropoietin of the present invention. Examples of chemically modified EPO include, for example, EPO chemically modified with polyethylene glycol or the like (WO90 / 12874, etc.), EPO without a sugar chain chemically modified with polyethylene glycol or the like, other such as vitamin B12, inorganic or Examples thereof include EPO to which a compound such as an organic compound is bonded.

Furthermore, it is also possible to use an EPO derivative as the erythropoietin of the present invention. An EPO derivative refers to EPO modified with an amino acid in an EPO molecule or EPO modified with a sugar chain in an EPO molecule.

The modification of the sugar chain in the EPO molecule includes sugar chain addition, substitution, deletion and the like. Examples of preferred sugar chain modifications in the present invention include deletion of sialic acid in the EPO molecule.

Usually, both EPO produced by recombinant animal cells and EPO derived from urine are obtained as EPO compositions containing various EPOs having different sugar chain structures. The number of sialic acids added to EPO molecules in the EPO composition varies depending on individual EPO molecules, but usually 11 to 15 sialic acids are added to one EPO molecule. By removing these sialic acids, it is possible to produce asialized EPO (asialo EPO). The number of sialic acids removed during asialization is not particularly limited, and all sialic acids may be removed, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 sialic acids may be removed. The preferred asialo EPO in the present invention has 10 or less sialic acid added to the EPO molecule, more preferably 5 or less, and particularly preferably 2 or less. The number of sialic acids used in the present invention is the average number of EPO molecules contained in the EPO composition. The average of sialic acid per molecule can be measured by methods known to those skilled in the art (EP 0428267, etc.).

EPO from which sialic acid has been removed (Asialo EPO) can be prepared by a method known to those skilled in the art, for example, by treating EPO with an enzyme such as sialidase. A commercially available sialidase can be used. (Special Table 2005-507426, Nobuo Imai et al., Eur.J.Biochem, 194, 457-462 (1990), etc.)

Asialo EPO can be safely administered without side effects such as polycythemia and hypertension in angiogenesis treatment, and also when used alone or in combination with bone marrow mononuclear cell transplantation (BMI) Has also been reported to bring about a remarkable angiogenic effect (Japanese Patent Application No. 2007-519063 (Patent No. 4200509)). Asialo EPO is therefore a preferred EPO derivative.

Furthermore, the erythropoietin of the present invention may be a sugar chain-modified EPO, and this includes NESP (Novel Erythropoietin Stimulating Protein: WO85 / 02610, which is a sugar chain-modified EPO with sialic acid attached to the N-terminus of EPO. And EPO analogs with modified sugar chains such as WO91 / 05867 and WO95 / 05465).

Examples of amino acid modification in the EPO molecule include carbamylation, biotinylation, amidineation, acetylation, guanidination, and the like. A preferred amino acid modification in the present invention is carbamylation.

The amino acid residue to be modified is not particularly limited, and examples thereof include lysine, arginine, glutamic acid, tryptophan and the like, but a preferred amino acid modified in the present invention is lysine.

Accordingly, as a particularly preferred embodiment of EPO modified with amino acids in the present invention, EPO in which lysine is carbamylated can be mentioned (Marcel L et al. Derivatives of erythropoietin that are tissue protective but not erythropoietic. Science, 2004; 305: 239, Fiordaliso E et al. A nonerythropoietic derivative of erythropoietin protects the myocardium from ischemia-reperfusion injury. PNAS, 2005; 102: 2046, etc.). The carbamylation of EPO includes carbamylation by reaction with cyanate ion or the like, alkyl-carbamylation by reaction with alkyl-isocyanate or the like, aryl-carbamylation by reaction with aryl-isocyanate or the like.

Chimeric protein The present invention provides a chimeric protein comprising a heparin affinity motif and a biologically active polypeptide.

Preparation of a chimeric protein containing a heparin affinity motif and a biologically active polypeptide can be carried out by known methods in various modes described below.

When a heparin affinity motif is introduced into a polypeptide having biological activity, a heparin affinity motif sequence may be inserted into the N-terminus, C-terminus of the peptide, or in the middle of the peptide sequence. Or you may use so that a basic substance may adjoin with a tertiary structure instead of a primary structure.

In order to impart heparin affinity to a non-peptide preparation, a heparin affinity motif may be bound using a linker or the like. Alternatively, a basic side chain such as a free amino group may be directly introduced into the drug.

Specifically, there are the following methods for creating a heparin affinity motif.
1. A known heparin affinity substance, for example, a whole or part of a heparin affinity motif such as vascular endothelial growth factor (VEGF) is used as it is.
2. A small peptide is prepared so that lysine, arginine, other basic natural amino acids or synthetic amino acids have a certain sequence.
3. It is designed so that a plurality of basic amino acids are coordinated in the vicinity in a tertiary conformation.
4). Instead of basic amino acids, amino groups and other basic side chains are introduced directly or indirectly.

For example, as described in the Examples below, a chimeric protein can be obtained by linking a DNA encoding a biologically active polypeptide and a DNA encoding a heparin affinity motif and incorporating the DNA into an expression vector. A recombinant vector for expression can be produced. The chimeric protein produced during the culture can be obtained by culturing recombinant cells transformed with the vector and expressing the incorporated DNA.

Many combinations of hosts and expression vectors for producing chimeric proteins are known. Any of these expression systems can be applied to the present invention. When eukaryotic cells are used as hosts, animal cells, plant cells, or fungal cells can be used. Specifically, the following cells can be exemplified as animal cells that can be used in the present invention.
(1) Mammalian cells: CHO, COS, myeloma, BHK (baby hamster kidney), Hela, Vero, HEK293, Ba / F3, HL-60, Jurkat, SK-HEP1, etc.
(2) Amphibian cells: Xenopus oocytes and the like.
(3) Insect cells: sf9, sf21, Tn5, HiFive, etc.

Alternatively, as a plant cell, a protein gene expression system by cells derived from the genus Nicotiana such as Nicotiana tabacum is known. Callus cultured cells can be used for transformation of plant cells.

Furthermore, the following cells can be used as fungal cells. Yeast: genus Saccharomyces such as Saccharomyces serevisiae, Pichia genus filamentous fungi such as Pichia pastoris: Aspergillus genus such as Aspergillus niger.

Alternatively, protein gene expression systems using prokaryotic cells are also known. For example, when bacterial cells are used, bacterial cells such as E. coli and Bacillus subtilis can be used in the present invention.

When using mammalian cells, it can be expressed by functionally binding a useful promoter commonly used, a protein gene to be expressed, and a poly A signal downstream of the 3 'side. For example, the promoter / enhancer includes human cytomegalovirus early promoter / enhancer (human cytomegalovirus immediate-promoter / enhancer).

In addition, a promoter / enhancer derived from a mammalian cell such as a viral promoter / enhancer or human elongation factor 1α (HEF1α) can be used for protein expression. Specific examples of viruses that can utilize promoters / enhancers include retroviruses, polyomaviruses, adenoviruses, and simian virus 40 (SV40).

When using the SV40 promoter / enhancer, the method of Mulligan et al. (Nature (1979) 277, 108) can be used. Further, the HEF1α promoter / enhancer can be easily used for target gene expression by the method of Mizushima et al. (Nucleic Acids Res. (1990) 18, 5322).

In the case of Escherichia coli, the gene can be expressed by functionally combining a useful promoter commonly used, a signal sequence for protein secretion, and a protein gene to be expressed. Examples of the promoter include lacZ promoter and araB promoter. When using the lacZ promoter, the method of Ward et al. (Nature (1989) 341, 544-546; FASEBJ. (1992) 6, 2422-2427) can be used. Alternatively, the araB promoter can be used for the expression of the target gene by the method of Better et al. (Science (1988) 240, 1041-1043).

Pharmaceutical Composition The present invention further provides a pharmaceutical composition comprising a chimeric protein comprising a heparin affinity motif and a biologically active polypeptide.

The pharmaceutical composition of the present invention includes a suspending agent, a solubilizing agent, a stabilizer, an isotonic agent, a preservative, an adsorption inhibitor, a surfactant, a diluent, an excipient, pH, if necessary. A regulator, a soothing agent, a buffering agent, a sulfur-containing reducing agent, an antioxidant and the like can be appropriately added.

Examples of the suspending agent include methyl cellulose, polysorbate 80, hydroxyethyl cellulose, gum arabic, tragacanth powder, sodium carboxymethyl cellulose, polyoxyethylene sorbitan monolaurate and the like.

Examples of the solution auxiliary include polyoxyethylene hydrogenated castor oil, polysorbate 80, nicotinic acid amide, polyoxyethylene sorbitan monolaurate, Magrogol, castor oil fatty acid ethyl ester, and the like.

Examples of the stabilizer include dextran 40, methylcellulose, gelatin, sodium sulfite, and sodium metasulfite.

It is also possible to add a certain type of amino acid as a stabilizer (for example, JP-A-10-182481). Amino acids added as stabilizers include free amino acids, salts such as sodium salts, potassium salts and hydrochlorides thereof. Amino acids can be added alone or in combination of two or more. The amino acid added as a stabilizer is not particularly limited, but preferred amino acids include leucine, tryptophan, serine, glutamic acid, arginine, histidine, and lysine.

Examples of the isotonic agent include D-mannitol and sorbate.

Examples of the preservative include methyl paraoxybenzoate, ethyl paraoxybenzoate, sorbic acid, phenol, cresol, chlorocresol and the like.

Examples of the adsorption inhibitor include human serum albumin, lecithin, dextran, ethylene oxide / propylene oxide copolymer, hydroxypropyl cellulose, methyl cellulose, polyoxyethylene hydrogenated castor oil, polyethylene glycol and the like.

Surfactants include nonionic surfactants such as sorbitan fatty acid esters such as sorbitan monocaprylate, sorbitan monolaurate, and sorbitan monopalmitate; glycerin such as glycerin monocaprylate, glycerin monomylate, and glycerin monostearate. Fatty acid ester; polyglycerin fatty acid ester such as decaglyceryl monostearate, decaglyceryl distearate, decaglyceryl monolinoleate; polyoxyethylene sorbitan monolaurate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monostearate , Polyoxyethylene sorbitan monopalmitate, polyoxyethylene sorbitan trioleate, polyoxyethylene sorbitan tristearate, etc. Oxyethylene sorbitan fatty acid ester; polyoxyethylene sorbite fatty acid ester such as polyoxyethylene sorbite tetrastearate and polyoxyethylene sorbite tetraoleate; polyoxyethylene glycerin fatty acid ester such as polyoxyethylene glyceryl monostearate; polyethylene glycol distea Polyethylene glycol fatty acid esters such as rate; polyoxyethylene alkyl ethers such as polyoxyethylene lauryl ether; polyoxy such as polyoxyethylene polyoxypropylene glycol, polyoxyethylene polyoxypropylene propyl ether, polyoxyethylene polyoxypropylene cetyl ether Ethylene polyoxypropylene alkyl ether; polyoxyethylenno Polyoxyethylene alkyl phenyl ethers such as ruphenyl ether; Polyoxyethylene hydrogenated castor oil such as polyoxyethylene castor oil and polyoxyethylene hydrogenated castor oil (polyoxyethylene hydrogen castor oil); Polyoxy such as polyoxyethylene sorbite beeswax Ethylene beeswax derivatives; polyoxyethylene lanolin derivatives such as polyoxyethylene lanolin; polyoxyethylene fatty acid amides such as polyoxyethylene stearamide, etc. having HLB 6-18; anionic surfactants such as sodium cetyl sulfate, lauryl Alkyl sulfates having an alkyl group of 10 to 18 carbon atoms such as sodium sulfate and sodium oleyl sulfate; average addition moles of ethylene oxide such as sodium polyoxyethylene lauryl sulfate A polyoxyethylene alkyl ether sulfate having 2 to 4 and an alkyl group having 10 to 18 carbon atoms; an alkylsulfosuccinic acid ester salt having an alkyl group having 8 to 18 carbon atoms, such as sodium lauryl sulfosuccinate; Typical examples include natural surfactants such as lecithin, glycerophospholipids, fingophospholipids such as sphingomyelin, and sucrose fatty acid esters of fatty acids having 12 to 18 carbon atoms. One or a combination of two or more of these surfactants can be added to the pharmaceutical composition of the present invention. Preferred surfactants are polyoxyethylene sorbitan fatty acid esters such as polysorbate 20, 40, 60 or 80, with polysorbates 20 and 80 being particularly preferred. Polyoxyethylene polyoxypropylene glycol represented by poloxamer (such as Pluronic F-68 (registered trademark)) is also preferable.

Examples of the sulfur-containing reducing agent include N-acetylcysteine, N-acetylhomocysteine, thioctic acid, thiodiglycol, thioethanolamine, thioglycerol, thiosorbitol, thioglycolic acid and salts thereof, sodium thiosulfate, glutathione, carbon Examples thereof include those having a sulfhydryl group such as thioalkanoic acid having 1 to 7 atoms.

Examples of the antioxidant include erythorbic acid, dibutylhydroxytoluene, butylhydroxyanisole, α-tocopherol, tocopherol acetate, L-ascorbic acid and its salt, L-ascorbyl palmitate, L-ascorbic acid stearate, sodium bisulfite, Chelating agents such as sodium sulfite, triamyl gallate, propyl gallate or disodium ethylenediaminetetraacetate (EDTA), sodium pyrophosphate, sodium metaphosphate and the like can be mentioned.

Furthermore, normally added components such as inorganic salts such as sodium chloride, potassium chloride, calcium chloride, sodium phosphate, potassium phosphate and sodium bicarbonate; organic salts such as sodium citrate, potassium citrate and sodium acetate May be included.

When carrying out the present invention as a sustained-release preparation, the sustained-release preparation can be prepared by a known method, for example, a method using a polymer as a base. The polymer used as the base is preferably a polymer that is decomposed in vivo.

The pharmaceutical composition of the present invention varies depending on the type of biologically active polypeptide or pharmaceutically active compound and / or chimeric protein used and the disease to be treated. In the case of HEPO (Heparinophilic erythropoietin), which is a chimeric protein in which a heparin-binding domain of placental growth factor (PLGF) is bound to the C-terminus of EPO, which is an example of the present invention, usually 0.001 μg / kg / day to 1000 μg / It is administered at a dose of kg / day, preferably 0.01 μg / kg / day to 100 μg / kg / day, more preferably 0.1 μg / kg / day to 30 μg / kg / day. The dosage of the pharmaceutical composition of the present invention for each patient is determined by a doctor in consideration of the patient's age, weight, symptoms, route of administration and the like.

In the pharmaceutical composition of the present invention, when the chimeric protein can be directly administered on the body surface or via a catheter, a high tissue concentration can be maintained by local administration. The site to be locally administered is not particularly limited, and can be administered to, for example, a site (tissue, organ, etc.) where angiogenesis is promoted or blood flow is increased or a site ischemic. Specific examples of the local administration site include lower limb skeletal muscle, upper limb skeletal muscle, and heart (myocardium).

The local administration is not particularly limited as long as the chimeric protein can be efficiently administered locally to the affected area without having a significant effect on the whole body, and local administration using a normal syringe, needle, local needle, catheter, etc. Is possible.

Furthermore, the pharmaceutical composition of the present invention is not limited to local administration but can also be intravascular administration. When frequent administration from the body surface such as treatment of myocardial ischemia is difficult, by administering the chimeric protein of the present invention intravascularly, a part of the chimeric protein is expressed on the vascular endothelium. Since it binds to a substance for heparin such as proteoglycan sulfate, it is specifically adsorbed on the vascular endothelium and can maintain a high concentration in the tissue.

Therefore, the pharmaceutical composition of the present invention can be a sustained-release pharmaceutical composition or a sustained-release pharmaceutical composition.

The present invention will be described in more detail with reference to examples, but the present invention is not limited thereto. Various changes and modifications can be made by those skilled in the art, and these changes and modifications are also included in the present invention.

In the statistical analysis in the following examples, all data are expressed as an average value ± SD. Comparisons between groups were performed by ANOVA followed by Bonn-Feroni probability test. Significant differences were defined with p <0.05.

Example 1: Preparation of HEPO (1.1) Preparation of rhHEPO vector A rhHEPO cDNA was prepared from a human EPO cDNA containing no signal sequence by PCR using the following Primer. The construction of the generated cDNA is as follows:
5 '-(Sph-I cleavage sequence)-(full-length human EPO cDNA without signal sequence)-(human PLGF heparin affinity motif cDNA)-(stop codon)-(EcoRI cleavage sequence)-3'.

Primers used and the resulting polypeptide 1) Add Sph-I site to the 5 'end of hEPO-cDNA
5'primer: ttaatggcatgctagccccaccacgcctcatctgtgac (SEQ ID NO: 7)
2) Extension by adding PLGF cDNA heparin binding motif and EcoRI site to the 3 'end of hEPO
3'primer-1: ttctcttccccctgcccttgggtctcctccttctgtcccctgtcctgcaggcctc
(SEQ ID NO: 8)
3'primer-2: ggcagtctgtgggtctctgcttctctctcctcctcttccccctgcccttgggtc
(SEQ ID NO: 9)
3'primer-3: gagaattcctacctccggggaacagcatcgccgcacaggtggcagtctgtgggtctctgcttct
(SEQ ID NO: 10)
After cutting out the PCR band and confirming the nucleotide sequence, the cDNA of rhHEPO was inserted into pMIB Baculovirus Vector (Invitrigen) using restriction enzyme (5 ': SphI, 3': EcoRI) (Fig. 1), Was introduced into Escherichia coli JM109 strain (Takara Bio) to obtain a plurality of clones, and a clone inserted with the correct sequence in the correct orientation was obtained by confirming the nucleotide sequence. This Escherichia coli clone is grown by a known method, the vector is purified using Quantum Prep, Plasmid Maxiprep Kit (BIO-RAD), and miraculin treatment is performed using the kit (Mira CLEAN, Endotoxin Removal Kit, Mirus) The DNA concentration was measured with OD260 and stored at -80 ° C.

(1.2) rhHEPO expression system and purification An insect cell line HighFive (Invitrogen) is used as an expression cell, a serum-free culture medium ExpressFive (Invitrogen) is used as a culture medium, and BioCoat, Collagen-I bottle (BD) The cells were cultured in an adherent cell line with room air at 28 ° C. The thawed storage vector was introduced into insect cells using FuGENE HD (Invitrogen), and the culture supernatant was harvested. The particles were removed from the supernatant using MILLEX-HA, 0.45 μm (Millipore), and then concentrated to remove molecules of 10 kD or less using a concentration filter Amicon Ultra-15, Ultracel-10k (Millipore).

For purification of rhHEPO, a Heparin-Sepharose gel and a pre-packed column (HiTrap Heparin, GE Amersham) were used. After replacing the column with 1 M Tris buffer, 7.5pH7.5, inject the concentrated culture supernatant, wash the column with a sufficient amount of 1 M Tris buffer, and then wash with 1M NaCl + 0.3% BSA in 1M Tris buffer, pH 7.5 RhHEPO was recovered. The collected partially purified solution was concentrated using Ultracel- 10k, and the concentration was measured with hEPO ELISA kit (R & D) to obtain 10 μg / ml rhHEPO solution. A vector without rhHEPO cDNA incorporated was expressed in cells by the same method, and the collected culture supernatant was concentrated and purified by the same method as a control (Mock).

The structure of rhHEPO obtained is a chimeric protein consisting of 165 amino acids of human EPO and 30 amino acids of the heparin affinity motif of human PLGF, as shown in FIG. The sequence of the cDNA encoding the chimeric protein rhHEPO is (SEQ ID NO: 11), and the amino acid sequence is (SEQ ID NO: 12).

Example 2: Examination of the biological activity of HEPO The in vitro properties of HEPO were examined. For comparison, natural human recombinant erythropoietin (EPO), asialoerythropoietin (AEPO) and carbamyl erythropoietin (CEPO) were used. AEPO was prepared from EPO (manufactured by Chugai Pharmaceutical Co., Ltd.) produced by gene recombination using CHO cells, and literature (Imai N. Higuchi M. Kawamura A. Tomonoh K. Oh-Eda M. Fujiwara M. Shimonaka Y. Ochi N. Physicochemical and biological characterization of asialoerythropoietin. Suppressive effects of sialic acid in the expression of biological activity of human erythropoietin in vitro. European Journal of Biochemistry. 194 (2): 457-62, 1990 Dec 12.) CEPO was prepared by reacting EPO with cyanate ion and carbamylating lysine according to the method described in Jin Zeng (Methods in Enzymology 205: 433-437, 1991).

(2.1) Heparin affinity
Experimental Method A heparin agarose gel was added to 4 types of EPO solutions (80 ng / ml) and allowed to stand overnight. The next morning, the gel was washed several times with buffer. The gel was added to EPO-dependent leukemia cell line AS-E2 (1 × 10 ⁵ / ml), and the number of cells was measured after 5 days (n = 3).
The results of the resulting heparin affinity are shown in FIG. 3 (in the figure, 1 is EPO; 2 is AEPO; 3 is CEPO; 4 is HEPO). Panel A is a phase contrast photomicrograph, where the large particles in the photo are gels and the small particles are cells. Panel B shows the cell number (x 10 ⁶ / ml). From this result, it was revealed that only HEPO was adsorbed on the heparin agarose gel and not released by washing. It was also revealed that HEPO does not lose its biological activity as EPO even when adsorbed on heparin agarose gel.

(2.2) Erythropoietin activity
Experimental Method Each concentration of EPO and HEPO was added to AS-E2 cells (2 × 10 ⁴ / ml), and the number of cells was counted after 4 days of culture (n = 3).
Results The results of erythropoietin activity obtained are shown in FIG. 4 (in the figure, ◯ is EPO; ● is HEPO). EPO and HEPO showed maximum activity at 3 ■ 10 ng / ml. A decrease in activity is observed at a low concentration of HEPO. This is because the protein expressed in insect cells is easily adsorbed on the surface of the plastic container, and is not considered to be an original property of HEPO. From this result, it became clear that the titer of biological activity of HEPO is almost equal to EPO.

Example 3: HEPO hematopoietic action HEPO hematopoietic action was examined by the following method.
Experimental Method ICR mice were intramuscularly administered with 2 μg / kg body weight of EPO or HEPO or EPOs-free solution three times (

days

0, 2, 4). Blood was collected on

days

7 and 14, and the hemoglobin concentration (Hb) was measured.
Results The results of the resulting hemoglobin concentration (Hb) are shown in FIG. The administered EPO had a short half-life, so Hb already showed a tendency to decrease on the 14th day, but since HEPO was gradually released into the blood from the connective tissue, the Hb also showed an upward trend on the 14th day. (Day 0: n = 8, Day 7: null: n = 6, EPO: n = 6, HEPO: n = 6, Day 14: null: n = 6, EPO: n = 4, HEPO: n = 6 ).

Example 4: Angiogenesis inhibitory action of HEPO The angiogenesis inhibitory action of HEPO was examined by the following method.
Experimental Method Lower limb ischemia was created in C57BL mice by the following method. All experimental procedures were performed aseptically based on the Guide for the Care and Use of Laboratory Animals (NIH publication No. 86-23; National Institute of Health, Bethesda, MD). Mice were anesthetized by intraperitoneal administration of ketamine (60 mg / kg BW) and xylazine (6 mg / kg BW). A skin incision was made in the middle of the left lower limb according to the method of Isner, and blood vessels were exposed (Couffinhal T, Silver M, Zheng LP, Kearney M, Witzenbichler B, Isner JM: Mouse model of angiogenesis. Am J Pathol 152: 1667 -1679, 1998). After ligating the origin of the femoral artery, the saphenous artery at its periphery was ligated, and the other side branches were removed and resected together with the main tube. All mice were given normal food and drinking water.

2 μg / kg body weight of EPO or HEPO or EPOs-free solution is administered 2 times (days 0, 3) or 3 times (

days

0, 2, 4) into the ischemic muscle of the mouse that has created leg ischemia The blood flow recovery on the 7th day was measured by laser Doppler method (x2: null: n = 9, EPO: n = 9, HEPO: n = 6, x3: null: n = 6, EPO: 6, HEPO: n = 7). For comparison, the value one day after ischemia is also shown (n = 5). The C57BL mouse is a mouse that naturally recovers from ischemia.
Results The results of the angiogenesis inhibitory action obtained are shown in FIG. As is clear from the figure, HEPO was observed to inhibit the natural recovery of blood flow. The angiogenesis-promoting action is stronger in the 3rd intramuscular injection than in the 2nd intramuscular injection, but this is a so-called “needle treatment effect”, and there was no difference between the null group and the EPO group.

Claims

A chimeric protein comprising a heparin affinity motif and a polypeptide having biological activity.
The chimeric protein according to claim 1, wherein the polypeptide having biological activity is a cytokine, hormone or chemokine.
The chimeric protein according to claim 2, wherein the polypeptide having biological activity is a hematopoietic factor.
The chimeric protein according to claim 3, wherein the hematopoietic factor is human erythropoietin.
The heparin affinity motif is composed of 3 to 100 amino acid residues including at least one basic amino acid sequence selected from the following (a) to (d) in at least the entire domain, and the sugar chain of heparin or heparin-like substance The chimeric protein according to claim 1, wherein the chimeric protein is a domain that binds to a sulfo group present in.
(a) BBB
(b) BXBB
(c) BBXB
(d) BXBXB
(Where B represents R or K; X represents an amino acid other than R or K)
The chimeric protein according to claim 1, wherein the heparin affinity motif is a motif derived from heparin-binding growth factor or a part thereof.
The chimeric protein according to claim 6, wherein the heparin-binding growth factor is PLGF.
A sustained-release pharmaceutical composition comprising the chimeric protein according to any one of claims 1 to 7.
A sustained-release pharmaceutical composition comprising the chimeric protein according to any one of claims 1 to 7.
A method for sustained release of a pharmaceutically active compound by fusing a pharmaceutically active compound and a heparin affinity motif.
A method for retaining a pharmaceutically active compound by fusing a pharmaceutically active compound and a heparin affinity motif.
A method for producing a pharmaceutically active compound for sustained release, comprising a step of fusing a heparin affinity motif to a pharmaceutically active compound.
A method for producing a pharmaceutically active compound for sustained release, comprising a step of fusing a heparin affinity motif to a pharmaceutically active compound.