WO2010070104A1 - Synthesis of fucosylated compounds - Google Patents

Synthesis of fucosylated compounds Download PDF

Info

Publication number
WO2010070104A1
WO2010070104A1 PCT/EP2009/067531 EP2009067531W WO2010070104A1 WO 2010070104 A1 WO2010070104 A1 WO 2010070104A1 EP 2009067531 W EP2009067531 W EP 2009067531W WO 2010070104 A1 WO2010070104 A1 WO 2010070104A1
Authority
WO
WIPO (PCT)
Prior art keywords
fucose
fucosyllactose
cell
coli
fkp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2009/067531
Other languages
French (fr)
Inventor
Eric HÜFNER
Julia Parkot
Stefan Jennewein
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chr Hansen HMO GmbH
Original Assignee
Jennewein Biotechnologie GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=40550215&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2010070104(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to HK11113658.3A priority Critical patent/HK1159173B/en
Priority to BRPI0923433-0A priority patent/BRPI0923433B1/en
Priority to NZ593448A priority patent/NZ593448A/en
Priority to EP09797036.2A priority patent/EP2379708B1/en
Priority to SG2011037785A priority patent/SG171814A1/en
Priority to JP2011541476A priority patent/JP5726751B2/en
Priority to CN200980151270XA priority patent/CN102257128A/en
Application filed by Jennewein Biotechnologie GmbH filed Critical Jennewein Biotechnologie GmbH
Priority to MX2011006371A priority patent/MX2011006371A/en
Priority to US13/140,548 priority patent/US20110300584A1/en
Priority to RU2011129780/10A priority patent/RU2584599C2/en
Priority to AU2009329543A priority patent/AU2009329543B2/en
Priority to MYPI2011002757A priority patent/MY183602A/en
Publication of WO2010070104A1 publication Critical patent/WO2010070104A1/en
Anticipated expiration legal-status Critical
Priority to US16/440,777 priority patent/US11390855B2/en
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs

Definitions

  • the present invention is related to methods of making fucosylated compounds and cells related thereto.
  • Human milk consists of a complex mixture of carbohydrates, proteins, lipids, hormones, and micronutrients, providing all necessary nutrients for infant development.
  • human milk contains several protective agents.
  • human milk contains an array of complex oligosaccharides with protective properties.
  • Human milk oligosaccharide (HMO) fraction comprise beside the principal carbohydrate component lactose, more than 130 different complex oligosaccharides. This structural diversity of complex oligosaccharides and their occurrence at high amounts is unique to humans. In contrast, only trace amounts of much less complex oligosaccharides are found in bovine milk, and consequently commonly used infant formula lacks these oligosaccharides.
  • HMOs can drastically reduce the virulence of pathogenic Escherichia coli (Cravioto et al., 1991), Vibrio cholerae (Coppa et al., 2006), Streptococcus pneumoniae (Andersson et al., 1986) or Campylobacter jejuni (Ruiz-Palacios et al., 2003) and are also able to neutralize toxins, like the heat-stable enterotoxin of E. coli (Crane et al., 1994). Besides the mentioned local effects in the intestinal tract, HMOs are also capable of eliciting systemic effects in infants by entering the systemic circulation (Gnoth et al., 2001).
  • HMOs e.g., selectin- leukocyte binding
  • oligosaccharides represent the third largest component of human milk, after lactose and fat. They almost all have in common lactose at the reducing end, and are decorated with fucose and/or sialic acid at the non- reducing end. They are build from 3 to up to 32 monosaccharides and most of them contain fucose, with 1 to 15 fucose units. Thus, fucosylated oligosaccharides show great potential as bioactive food ingredients with anti- infective and prebiotic attributes.
  • Fucosyltransferases which catalyze the transfer of fucose residues from the donor guanosine-diphosphate activated L-fucose (GDP-L-fucose) to several acceptor molecules, are expressed in animals, plants, fungi and bacteria (Ma et al., 2006). They are categorized according to the site of fucose addition, therefore ⁇ l,2, ⁇ l,3/4, and ⁇ l,6 FucTs are distinguished. Besides human FucTs, which are originally responsible for the biosynthesis of HMOs and blood group antigens, several bacterial FucTs have been described.
  • FucT activity has been best documented for the human gastric pathogen Helicobacter pylori, which decorates its lipopolysaccharide (LPS) with fucose- containing Lewis antigens (Wang et al., 2000).
  • LPS lipopolysaccharide
  • FucT activity has been best documented for the human gastric pathogen Helicobacter pylori, which decorates its lipopolysaccharide (LPS) with fucose- containing Lewis antigens (Wang et al., 2000).
  • LPS lipopolysaccharide
  • FucT activity has been best documented for the human gastric pathogen Helicobacter pylori, which decorates its lipopolysaccharide (LPS) with fucose- containing Lewis antigens (Wang et al., 2000).
  • LPS lipopolysaccharide
  • FucT activity has been best documented for the human gastric pathogen Helicobacter pylori
  • GDP- ⁇ -L-fucose is prepared by conversion of GDP-D- mannose to GDP-4-keto-6-deoxy-D-mannose. This is treated with a GDP-4- keto-6-deoxy-D-mannose 3,5 epimerase-4-reductase to produce GDP- ⁇ -L- fucose, which is purified by preparative HPLC.
  • a genetically modified cell is produced. It has been transformed to express a fucosekinase, a fucose-1- phosphate guanylyltransferase and a fucosyltransferase.
  • the genetically modified cell is a microorganism selected from the group consisting of the genera Escherichia, Klebsiella, Helicobacter, Bacillus, Lactobacillus, Streptococcus, Lactococcus, Pichia, Saccharomyces and Kluyveromyces.
  • the fucose kinase and the fucose- 1-phosphate guanylyltransferase activity are combined in a bifunctional enzyme.
  • Suitable genes for transformation, coding for a fucose kinase, a fucose-1-phosphate guanylyltransferase and/or a bifunctional fucose kinase/fucose-1-phosphate guanylyltransferase can be obtained from the genera Bacteroides, Lentisphaera, Ruminococcus, Solibacter, Arabidopsis, Oryza, Physcomitrella, Vitis, Danio, Bos, Equus, Macaca, Pan, Homo, Rattus, Mus and Xenopus.
  • Suitable fucosyltransferase genes can be derived from organisms selected from the group of the genera Helicobacter, Escherichia , Yersinia, Enterococcus , Shigella, Klebsiella, Salmonella, Bacteroides, Dictyostelium , Arabidopsis, Drosophila, Homo, Bos, Mus, Rattus, Gall us, Canis and Sus.
  • a codon optimization may be helpful to increase the expression.
  • Some cells have a catabolic pathway for fucose. In this case, it is recommendable to inactivate this catabolic pathway.
  • Suitable methods comprise inactivating one or several genes selected from the group consisting of a fucose-1-phosphate aldolase gene, a fucose isomerase gene and a fuculose kinase gene.
  • Suitable fucose derived compounds which can be prepared by the genetically modified cells of the present invention are fucosyllactoses, preferably T- fucosyllactose, 3-fucosyllactose or lactodifucotetraose.
  • the present invention is a synthesis in a cell starting from fucose instead of a preparative synthesis with recombinant enzymes starting from GDP-D- mannose as described by Albermann et al. (2001).
  • a further embodiment of the invention is the genetically modified cell obtainable by the method of the invention.
  • the genetically modified cell of the invention is cultivated under suitable cultivation conditions in a medium comprising fucose and an acceptor substrate.
  • Suitable acceptor substrates are for example a mono-, di- or oligosaccharide or a peptide, for example lactose, 2 ' -fucosyllactose or 3-fucosyllactose.
  • the preferred fucosylated compounds obtained by the production method are fucosyllactoses, preferably 2'-fucosyllactose or 3-fucosyllactose or lactodifucotetraose.
  • fucose salvage pathway fucose is first phosphorylated to fucose-1-phosphate by the enzyme fucose kinase.
  • the fucose-1-phosphate is then converted to GDP-fucose by the action of the enzyme fucose-1-P- guanylyltransferase.
  • Fkp the first bacterial enzyme, Fkp, with both fucose kinase and L-fucose-1-P-guanylyltransferase activity was described (Coyne et al., 2005).
  • the intestinal bacterium Bacteroides fragilis uses the enzyme for the production of GDP-fucose, which serves for the decoration of capsular polysaccharides and glycoproteins with fucose residues.
  • Figure 1 discloses the structures of the prominent complex human milk oligosaccharides (HMOs) 2'-fucosyllactose and 3-fucosyllactose.
  • HMOs human milk oligosaccharides
  • Figure 2 shows a scheme of the photometric assay for determination of Fkp activity by coupled enzyme reactions and determination of NADH oxidation;
  • Fkp bifunctional fucose kinase / fucose-1-phosphate guanylyltransferase, PK pyruvate kinase,
  • LDH L-lactate dehydrogenase, PEP phosphoenolpyruvate.
  • Figure 3 shows a scheme of the photometric assay for determination of FucT activity by coupled enzyme reactions and determination of NADH oxidation;
  • FucT fucosyltransferase
  • PK pyruvate kinase
  • LDH L-lactate dehydrogenase
  • PEP phosphoenolpyruvate.
  • FIG. 4 shows the protein formation after induction.
  • Lanes 1-4 expression of soluble Fkp (105,7 kDa) and/or FutAco (49,3 kDa) or FucT2 (35,9 kDa), in crude extracts from E. coli BW25113 ⁇ fucA (DE3) pCOLA-fkp-fucP (lane 1), E. coli BW25113 ⁇ fucA (DE3) pEJ-futAco (lane 2), E. coli BW25113 ⁇ fucA (DE3) pCOLA-fkp-fucP + pETfutAco (lane 3) and E.
  • Figure 5 shows a radio thin layer chromatography (radio-TLC) of 3 H-fucose, developed with butanol : acetone: acetic acid :water (35 :35:7: 23) and analyzed using a radio-TLC reader.
  • radio-TLC radio thin layer chromatography
  • Figure 6 shows a radio-TLC of a cell extract from E. coli BW25113 ⁇ fucA (DE3) pCOLADuet-1 pETDuet-1 showing fucose and fuculose and fuculose-1- phosphate, however degradation of fuculose-1-phosphate is inhibited due to the genomic knockout of the fuculose-1-phosphate aldolase gene (fucA) .
  • Figure 7 shows radio-TLC of cell extract from E. coli BW25113 ⁇ fucA (DE3) pCOLA-fkp-fucP showing accumulating GDP-fucose produced by bifunctional fucose kinase / fucose- 1-phosphate guanylyltransferase Fkp from Bacteroides fragilis as well as fucose and degradation products fuculose and fuculose-1- phosphate.
  • Figure 8 shows a radio-TLC of a cell extract from E. coli BW25113 ⁇ fucA (DE3) pCOLA-fkp-fucP pEJ-futAco showing accumulating 3-fucosyllactose produced by codon optimized fucosyltransferase of Helicobacter pylori via GDP-fucose provided by bifunctional fucose kinase / fucose-1-phosphate guanylyltransferase (Fkp). Fucose and degradation products fuculose and fuculose-1-phosphate are only minimally present; GDP-fucose amount is significantly reduced due to 3-fucosyllactose production.
  • Figure 9 shows a HPAED analysis of cell lysate from negative control strain E. coli BW25113 ⁇ fucA (DE3) pCOLADuet-1 pETDuet-1 showing intracellular L- fucose, lactose, glycerol and L-rhamnose, but no fucosyllactose.
  • Figure 10 shows a cell lysate of strain E. coli BW25113 ⁇ fucA (DE3) pCOLA- fkp-fucP pEJ-futAco producing 3-fucosyllactose (retention time of about 11 min); furthermore L-fucose, lactose, glycerol and L-rhamnose peaks can be seen.
  • Figure 11 shows a HPAED analysis of cell lysate from strain E. coli BW25113 ⁇ fucA (DE3) pCOLA-fkp-fucP pCAW55 showed production of 2 ' -fucosyllactose (retention time of about 22 min). Additionally, L-fucose, lactose, glycerol and L-rhamnose can be seen.
  • Figure 12 a and b show HPLC-analysis with electrochemical detection of GDP- fucose expression in E. coli JM 109 (DE3) ⁇ fucA ( Figure 12a) and E. coli JM 109 (DE3) ⁇ fucA pCOLA-fkp-fucP ( Figure 12b).
  • fucA coding for the key catabolic enzyme fuculose-1-phosphate aldolase had to be deleted from the genome of E. coli strain BW25113.
  • the methodology of (Datsenko & Wanner, 2000) was applied.
  • an inducible T7 RNA polymerase was incorporated into the deletion strain E. coli BW25113 ⁇ fucA by using the ⁇ DE3 lysogenization kit (Novagen). The resulting strain was then named E. coli BW25113 ⁇ fucA (DE3).
  • the plasmids pCOLA- fkp-fucP and pET- futAco were constructed using the pCOLADuet-1 and pETDuet-1 expression vectors (Novagen). All primers used for the construction are listed in Table 2.
  • Gene fkp (GeneBank ace. no. AY849806) was amplified by PCR with primers fkp-NcoI-forward and fkp-Notl-reverse using genomic DNA of Bacteroides fragilis ATCC 25285D.
  • the fucP gene (GeneBank ace. no. CP000948) of Escherichia coli K12 was amplified from genomic DNA of E.
  • coli TOPlO (Invitrogen, USA) using primers FucP-Ndel-forward and FucP-XhoI-reverse. Both fkp and fucP were inserted into the first and second multiple cloning site (MCS) of pCOLADuet-1, respectively, using the indicated restriction sites. The resulting plasmid was designated pCOLA- fkp- fucP.
  • the futA gene (GeneBank ace. no. AE000511) of H. pylori strain 26695 was codon-optimized for expression in E. coli and prepared synthetically by GenScript Corporation (Piscataway, NJ, USA).
  • the gene was amplified using the primers FutAco-NcoI- forward and FutAco-BamHI-reverse, and inserted into the first MCS of pETDuet-1, yielding pEJ-futAco.
  • the correct insertion of cloned genes was checked by restriction analysis and sequencing using the recommended primers pACYCDuetUPl, pET-Upstream, DuetDOWN-1, DuetUP2 and T7- Terminator listed in the Duet Vectors Manual (Novagen). Plasmid pCAW55 containing the gene fucT2 coding for ⁇ l,2-fucosyltransferase from Helicobacter pylori NCTC364 was donated by C.
  • restriction endonuclease recognition sites are underlined.
  • E. coli strains were inoculated in 10 ml_ of 2xYT broth (Sambrook & Russell, 2001), containing 100 ⁇ g mL "1 ampicillin and/or 50 ⁇ g mL "1 kanamycin, and incubated overnight in a rotary shaker at 37°C. The next day, 30 mL fresh 2xYT broth supplemented with the appropriate antibiotics was inoculated 1/100 from the overnight culture, and incubated at 37°C in a rotary shaker providing good aeration.
  • heterologous proteins was checked by SDS-PAGE (Sambrook & Russell, 2001). Protein extracts were prepared in Ix SDS gel- loading buffer, and polyacrylamide gels were stained with Coomassie Brilliant Blue.
  • fucose kinase activity of the enzyme was measured by the amount of arising ADP from ATP, used as a substrate by pyruvate kinase (PK) while dephosphorylating phosphoenolpyruvate (PEP), whereas the resulting pyruvate was then converted to L-lactate by L-lactate dehydrogenase (LDH) under NADH consumption.
  • PK pyruvate kinase
  • PEP dephosphorylating phosphoenolpyruvate
  • LDH L-lactate dehydrogenase
  • Each 1000 ⁇ l_ reaction was performed in 65 mM MOPS buffer (pH 7.5) containing 10 mM L-fucose, 15 mM PEP, 5 mM MgSO 4 , 0.2 mM of each ATP and NADH, and 5 U of each PK and LDH.
  • MOPS buffer pH 7.5
  • oxidation of NADH to NAD was monitored via the decrease of absorption at 340 nm using a V-630 Bio spectrophotometer (JASCO GmbH, Germany).
  • FucT activity was (as shown in Figure 3) measured by arising GDP (from the donor GDP-L-fucose) which was phosphorylated to GTP by PK under conversion of PEP to pyruvate.
  • LDH catalyzed the final reaction of pyruvate reduction to L-lactate with concomitant NADH consumption.
  • Cellular extracts (25 ⁇ L) were tested in a 1000 ⁇ L reaction containing 10 mM lactose, 100 ⁇ M GDP-L-fucose, 5 mM MgSO 4 , 0.2 mM of each ATP and NADH, and 5 U of each PK and LDH in 50 mM Tris-HCI buffer (pH 7.5). The decrease of NADH was monitored at 340 nm.
  • HPAED high performance anion exchange chromatography
  • a Decade II pulsed amperometric detector from Antec Leyden (Netherlands) and a CarboPac PA20 column (Dionex, Germany) connected to a HPLC system (Shimadzu, Germany).
  • the detector sensitivity was set at 50 ⁇ A with a 0.05-V applied pulse potential.
  • Mono-, di-, and oligosaccharides eluted with 10 mM sodium hydroxide at a flow rate of 0.4 mL min "1 . After 30 min isocratic elution with 10 mM NaOH the column was washed for 20 min with 200 mM NaOH to obtain constant retention times and thereafter regenerated with 10 mM NaOH for 20 min.
  • E. coli BW25113 ⁇ fucA (DE3) cells were transformed with the vectors pCOLADuet-1, pETDuet-1, pCOLA-fkp-fucP and pET-futAco to generate the following strains:
  • E. coli BW25113 ⁇ fucA (DE3) pCOLADuet-1 pETDuet-1 served as empty vector control in the feeding experiments. All three strains were then used for tritium labeled fucose feeding experiments.
  • cells were cultured in 3 ml of 2xYT medium containing 20 ⁇ l L-5,6- 3 H-Fucose (40- 60 Ci/mmol and 1 mCi/mL), 50 mM lactose and 1 mM IPTG.
  • 2xYT medium was supplemented with 100 ⁇ g mL "1 ampicillin and/or 50 ⁇ g mL "1 kanamycin.
  • E. coli cultures were incubated at room temperature overnight. Cells were then collected by centrifugation and separated from the culture media, the obtained cell pellets were resuspended in 200 ⁇ L of ddH 2 O and boiled for 5 min. After cooling on ice for 10 min cell debris were collected by centrifugation at 13000 rpm for 10 min. From the so obtained E. coli cell supernatants 20 ⁇ L of each culture were applied to a silica gel TLC plate (Silica gel 60). For the development of the TLC plate a solvent mixture consisting of butanol : acetone : acetic acid : water (35: 35:7: 23) was employed. Radio-TLC analysis was then performed with a Radio-TLC reader (Raytest).
  • the TLC plate was sprayed with anisaldehyde solution (5 mL cone. H 2 SO 4 , 100 mL ethanol, 1.5 mL acetic acid, 2 mL anisaldehyde) and heated.
  • anisaldehyde solution 5 mL cone. H 2 SO 4 , 100 mL ethanol, 1.5 mL acetic acid, 2 mL anisaldehyde
  • lacZ ⁇ ⁇ -galactosidase deficient E. coli strain BW25113 was chosen to circumvent the problem of rapid lactose degradation (Datsenko & Wanner, 2000).
  • L-Fucose can be also effectively degraded by wild type E. coli via isomerization to fuculose, phosphorylation to fuculose-1-phosphate and subsequent retro-aldol cleavage of fuculose-1-phosphate to glycerin-3- phosphate and L-lactaldehyde.
  • fucA encoding the key catabolic enzyme of the fucose degradation pathway fuculose-1-phosphate aldolase (FucA)
  • fucA fuculose-1-phosphate aldolase
  • nucleotide activation of fucose to GDP-fucose is very limited in nature and was also for a long time only known from several mammals (human, pig, mouse). Nucleotide activation of fucose is mediated here by two successive enzymatic steps, first the phosphorylation of fucose to fucose-1-phosphate, catalyzed by fucose kinase and followed by the conversion of fucose-1-phosphate to GDP-Fucose, catalyzed by guanylyltransferase, respectively. Whereas in mammals the fucose salvage pathway comprises two separate enzyme catalyzed reactions, the recently discovered bacterial and plant proteins comprise both enzymatic activities.
  • the resulting gene futAco was inserted in the expression vector pETDuet-1, and expression was tested with and without co-expression of Fkp and FucP.
  • Fkp, FucP and FutAco or FucT2 were co-expressed.
  • Protein formation was examined after induction with IPTG and/or L-rhamnose with SDS-PAGE (see Figure 4), documenting pronounced soluble production of Fkp protein, whereas induction of membrane localized fucose permease protein (FucP) could, as expected, not be detected in cell cytoplasm by SDS-PAGE.
  • the gene products of futAco and fucT2 proved to be primarily located in inclusion bodies with only a small soluble fraction detectable.
  • E. coli cells coexpressing bifunctional fucose kinase / fucose-1-phosphate guanylyltransferase Fkp from Bacteroides fragilis show the production of GDP- fucose (see Figure 7) which is apparently accumulating in the cells and may only minimally divert into other metabolic pathways whose products would otherwise appear on the radio-TLC.
  • Cell extracts from strain E. coli BW25113 ⁇ fucA (DE3) pCOLA-fkp-fucP pET- futAco show production of 3-fucosyllactose and only a small amount of GDP- fucose (see Figure 8). This result is consistent with the initial aim of the experiment, i.e.
  • E. coli BW25113 ⁇ fucA harboring pCOUK-fkp-fucP and either the futAco or fucT2 gene in a separate expression vector, as well as E. coli BW25113 ⁇ fucA (DE3) harboring the empty vectors pCOLADuet-1 and pETDuet-1 (negative control) were grown in 2xYT broth, and protein expression was induced with IPTG and/or L-rhamnose for 15 h at 28°C. The cells were subsequently washed with PBS and resuspended in modified M9 medium supplemented with L-fucose, lactose and guanosine, IPTG and L- rhamnose. After a fermentation phase (28°C, 15 h), the cells were harvested, supernatants collected and cell lysates prepared as described above.
  • Codon optimized ⁇ l,3- fucosyltransferase FutAco initially derived from Helicobacter pylori or ⁇ l,2- fucosyltransferase FucT2 from Helicobacter pylori, respectively, can convert the so supplied GDP-fucose into 2'- and 3-fucosyllactose.
  • Elevation of intracellular GDP-fucose content due to expression of Fkp was shown by parallel cultivation of an E. coli strain expressing Fkp from a plasmid and an E. coli strain not containing a copy of Fkp.
  • Strain E. coli JM 109 (DE3) ⁇ fucA was in this case used as control strain without Fkp.
  • the strain expressing Fkp was the same strain E.
  • HPLC analysis was carried out by electrochemical detection with a Decade II pulsed amperometric detector (Antec Leyden, Netherlands). 20 mM sodium hydroxide + 825 mM sodium acetate was used as eluent on a CarboPac PA20 column (Dionex, USA). GDP-fucose eluted with a retention time of 16,0 minutes.
  • Table 3 Intracellular GDP-fucose content of E. coli JM109 (DE3) ⁇ fucA with and without expression of fucose kinase / fucose-1-phosphate guanylyltransferase Fkp from pCOLA- fkp- fucP.
  • Figure 12a shows HPLC-analysis of E. coli JM109 (DE3) ⁇ fucA cells for GDP- fucose expression without expression of FKP protein.
  • Campylobacter jejuni binds intestinal H(O) antigen

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

A method for making a genetically modified cell having the ability to produce fucosylated compounds comprising the steps of: transforming the cell to express a fucose kinase, transforming the cell to express a fucose-1-phosphate guanylyltransferase, transforming the cell to express a fucosyltransferase.

Description

Synthesis of fucosylated compounds
The present invention is related to methods of making fucosylated compounds and cells related thereto.
Human milk consists of a complex mixture of carbohydrates, proteins, lipids, hormones, and micronutrients, providing all necessary nutrients for infant development. In addition human milk contains several protective agents. Besides immunoglobulins human milk contains an array of complex oligosaccharides with protective properties. Human milk oligosaccharide (HMO) fraction comprise beside the principal carbohydrate component lactose, more than 130 different complex oligosaccharides. This structural diversity of complex oligosaccharides and their occurrence at high amounts is unique to humans. In contrast, only trace amounts of much less complex oligosaccharides are found in bovine milk, and consequently commonly used infant formula lacks these oligosaccharides.
Clinical data showed that breast-fed infants have lower incidence of diarrhea, respiratory disease, and otitis media than formula-fed infants. For a long time these protective effects of human milk have been attributed to the presence of secreted immunoglobulins, however, it has now been recognized that the HMOs may be a major line of defense against pathogens for breast-fed infants.
Many of the complex HMOs show homology to cell surface glycoconjugates such as the Lewis x (Lex) histo-blood group antigen Gal(βl-4)[Fuc-(αl- 3)]GlcNAc(βl) (Newburg, 2001), which often serve as pathogen receptors. Thus, by excreting soluble decoys, mimicking cell surface glycoconjugate structures, nature developed here an efficient mechanism to prevent infections. For example it was shown that HMOs can drastically reduce the virulence of pathogenic Escherichia coli (Cravioto et al., 1991), Vibrio cholerae (Coppa et al., 2006), Streptococcus pneumoniae (Andersson et al., 1986) or Campylobacter jejuni (Ruiz-Palacios et al., 2003) and are also able to neutralize toxins, like the heat-stable enterotoxin of E. coli (Crane et al., 1994). Besides the mentioned local effects in the intestinal tract, HMOs are also capable of eliciting systemic effects in infants by entering the systemic circulation (Gnoth et al., 2001).
The impact of HMOs on protein-carbohydrate interactions, e.g., selectin- leukocyte binding, can modulate immune responses and reduce inflammatory responses (Bode, 2006, Kunz & Rudloff, 2006).
Complex oligosaccharides represent the third largest component of human milk, after lactose and fat. They almost all have in common lactose at the reducing end, and are decorated with fucose and/or sialic acid at the non- reducing end. They are build from 3 to up to 32 monosaccharides and most of them contain fucose, with 1 to 15 fucose units. Thus, fucosylated oligosaccharides show great potential as bioactive food ingredients with anti- infective and prebiotic attributes.
Fucosyltransferases (FucTs), which catalyze the transfer of fucose residues from the donor guanosine-diphosphate activated L-fucose (GDP-L-fucose) to several acceptor molecules, are expressed in animals, plants, fungi and bacteria (Ma et al., 2006). They are categorized according to the site of fucose addition, therefore αl,2, αl,3/4, and αl,6 FucTs are distinguished. Besides human FucTs, which are originally responsible for the biosynthesis of HMOs and blood group antigens, several bacterial FucTs have been described. FucT activity has been best documented for the human gastric pathogen Helicobacter pylori, which decorates its lipopolysaccharide (LPS) with fucose- containing Lewis antigens (Wang et al., 2000). The exact role of these Lewis antigenic structures during H. pylori infection is unclear, but molecular mimicry to evade the host immune system, adhesion and colonization are discussed (Bergman et al., 2006).
Due to the great potential of HMOs as health-promoting food supplements, there is strong interest in the cost-effective large-scale production. Biocatalytic production via bacterial fermentation processes is highly favorable over extraction of HMOs from human milk, and chemical synthesis, which is laborious and requires multiple protection and deprotection steps (Kretzschmar & Stahl, 1998). During the last decade, several attempts of HMO synthesis using either fermentation with recombinant E. coli or in vitro enzymatic conversion, have been published (Albermann et al., 2001, Dumon et al., 2006, Dumon et al., 2001, Dumon et al., 2004, Koizumi et al., 2000). The bottleneck in the production of fucosylated oligosaccharides is, however, the availability of the donor nucleotide sugar GDP-fucose. This high-energy molecule is currently neither efficiently nor cost-effectively accessible via chemical or enzymatic synthesis. Most publications reporting production systems for fucosylated compounds rely on the endogenous GDP-fucose pool of E. coli, which however is extremely limited and only used for the inducible synthesis of the fucose-containing exopolysaccharide colanic acid (Grant et al., 1970).
For example Albermann et al. (2001) use recombinant enzymes in an enzymatic synthesis. GDP-β-L-fucose is prepared by conversion of GDP-D- mannose to GDP-4-keto-6-deoxy-D-mannose. This is treated with a GDP-4- keto-6-deoxy-D-mannose 3,5 epimerase-4-reductase to produce GDP-β-L- fucose, which is purified by preparative HPLC.
Another approach by Koizumi and co-workers to synthesize Lex from N- acetyllactosamine (LacNAc) involved the combination of GTP production from supplemented GMP by Corynebacterium ammoniagenes, GDP-fucose synthesis via GDP-mannose, and fucosylation of LacNAc by overexpression of a H. pylori αl,3-FucT in separate E. coli strains (Koizumi et al., 2000). Since permeabilization, and thus killing the cells, had to be used for this bacterial coupling approach, a continuous and large-scale fermentation process is not possible with this chosen approach.
There is still a need for methods for producing fucosylated compounds which overcome at least some of the drawbacks of prior art.
One embodiment of the invention is a method for making a genetically modified cell having the ability to produce fucosylated compounds comprising the steps of
- transforming the cell to express a fucose kinase transforming the cell to express a fucose-1 -phosphate guanylyltransferase transforming the cell to express a fucosyltransferase.
According to the method of the invention a genetically modified cell is produced. It has been transformed to express a fucosekinase, a fucose-1- phosphate guanylyltransferase and a fucosyltransferase.
Methods of introducing genes into a cell are known to the skilled person.
In a preferred embodiment, the genetically modified cell is a microorganism selected from the group consisting of the genera Escherichia, Klebsiella, Helicobacter, Bacillus, Lactobacillus, Streptococcus, Lactococcus, Pichia, Saccharomyces and Kluyveromyces.
In a preferred embodiment of the invention, the fucose kinase and the fucose- 1-phosphate guanylyltransferase activity are combined in a bifunctional enzyme. Suitable genes for transformation, coding for a fucose kinase, a fucose-1-phosphate guanylyltransferase and/or a bifunctional fucose kinase/fucose-1-phosphate guanylyltransferase can be obtained from the genera Bacteroides, Lentisphaera, Ruminococcus, Solibacter, Arabidopsis, Oryza, Physcomitrella, Vitis, Danio, Bos, Equus, Macaca, Pan, Homo, Rattus, Mus and Xenopus.
Suitable fucosyltransferase genes can be derived from organisms selected from the group of the genera Helicobacter, Escherichia , Yersinia, Enterococcus , Shigella, Klebsiella, Salmonella, Bacteroides, Dictyostelium , Arabidopsis, Drosophila, Homo, Bos, Mus, Rattus, Gall us, Canis and Sus.
Depending on the source of the gene and the cell used for expression, a codon optimization may be helpful to increase the expression.
Some cells have a catabolic pathway for fucose. In this case, it is recommendable to inactivate this catabolic pathway. Suitable methods comprise inactivating one or several genes selected from the group consisting of a fucose-1-phosphate aldolase gene, a fucose isomerase gene and a fuculose kinase gene.
Suitable fucose derived compounds which can be prepared by the genetically modified cells of the present invention are fucosyllactoses, preferably T- fucosyllactose, 3-fucosyllactose or lactodifucotetraose.
The present invention is a synthesis in a cell starting from fucose instead of a preparative synthesis with recombinant enzymes starting from GDP-D- mannose as described by Albermann et al. (2001).
A further embodiment of the invention is the genetically modified cell obtainable by the method of the invention. To produce fucosylated compounds, the genetically modified cell of the invention is cultivated under suitable cultivation conditions in a medium comprising fucose and an acceptor substrate.
Suitable acceptor substrates are for example a mono-, di- or oligosaccharide or a peptide, for example lactose, 2 '-fucosyllactose or 3-fucosyllactose. The preferred fucosylated compounds obtained by the production method are fucosyllactoses, preferably 2'-fucosyllactose or 3-fucosyllactose or lactodifucotetraose.
This is the first report of efficient GDP-fucose synthesis in E. coli from externally supplied L-fucose and thus the establishment of an fucose "salvage pathway" in E. coli. However, this approach may also be transferred to other easy to culture organisms of interest to food or pharmaceutical industry (for example Lactobacillus spp.). Usage of this newly discovered pathway offers utterly new perspective for production of oligosaccharides, besides T- fucosyllactose and 3-fucosyllactose, without the need to rely on costly and laborious provision of GDP-fucose (in vitro) or endogenous, highly regulated, GDP-fucose biosynthetic pathways (in vivo).
In the so called "fucose salvage pathway" fucose is first phosphorylated to fucose-1-phosphate by the enzyme fucose kinase. The fucose-1-phosphate is then converted to GDP-fucose by the action of the enzyme fucose-1-P- guanylyltransferase. Recently, the first bacterial enzyme, Fkp, with both fucose kinase and L-fucose-1-P-guanylyltransferase activity was described (Coyne et al., 2005). The intestinal bacterium Bacteroides fragilis uses the enzyme for the production of GDP-fucose, which serves for the decoration of capsular polysaccharides and glycoproteins with fucose residues.
Brief description of the figures
Figure 1 discloses the structures of the prominent complex human milk oligosaccharides (HMOs) 2'-fucosyllactose and 3-fucosyllactose.
Figure 2 shows a scheme of the photometric assay for determination of Fkp activity by coupled enzyme reactions and determination of NADH oxidation; Fkp = bifunctional fucose kinase / fucose-1-phosphate guanylyltransferase, PK pyruvate kinase, LDH = L-lactate dehydrogenase, PEP phosphoenolpyruvate.
Figure 3 shows a scheme of the photometric assay for determination of FucT activity by coupled enzyme reactions and determination of NADH oxidation; FucT = fucosyltransferase, PK = pyruvate kinase, LDH = L-lactate dehydrogenase, PEP = phosphoenolpyruvate.
Figure 4 shows the protein formation after induction. Lanes 1-4: expression of soluble Fkp (105,7 kDa) and/or FutAco (49,3 kDa) or FucT2 (35,9 kDa), in crude extracts from E. coli BW25113 ΔfucA (DE3) pCOLA-fkp-fucP (lane 1), E. coli BW25113 ΔfucA (DE3) pEJ-futAco (lane 2), E. coli BW25113 ΔfucA (DE3) pCOLA-fkp-fucP + pETfutAco (lane 3) and E. coli BW25113 ΔfucA (DE3) pCOLA-fkp-fucP + pCAW55 (lane 4); lane 5: PageRuler™ Prestained Protein Ladder (Fermentas, Germany); lanes 6-9: expression of insoluble Fkp and/or FutAco or FucT2, in cell debris resuspended in 6 M urea from E. coli BW25113 ΔfucA (DE3) pCOLA-fkp-fucP (lane 6), E. coli BW25113 ΔfucA (DE3) pET- futAco (lane 7), E. coli BW25113 ΔfucA (DE3) pCOLA-fkp-fucP + pETfutAco (lane 8) and E. coli BW25113 ΔfucA (DE3) pCOLA- fkp- fucP + pCAW55 (lane 9). Figure 5 shows a radio thin layer chromatography (radio-TLC) of 3H-fucose, developed with butanol : acetone: acetic acid :water (35 :35:7: 23) and analyzed using a radio-TLC reader.
Figure 6 shows a radio-TLC of a cell extract from E. coli BW25113 ΔfucA (DE3) pCOLADuet-1 pETDuet-1 showing fucose and fuculose and fuculose-1- phosphate, however degradation of fuculose-1-phosphate is inhibited due to the genomic knockout of the fuculose-1-phosphate aldolase gene (fucA) .
Figure 7 shows radio-TLC of cell extract from E. coli BW25113 ΔfucA (DE3) pCOLA-fkp-fucP showing accumulating GDP-fucose produced by bifunctional fucose kinase / fucose- 1-phosphate guanylyltransferase Fkp from Bacteroides fragilis as well as fucose and degradation products fuculose and fuculose-1- phosphate.
Figure 8 shows a radio-TLC of a cell extract from E. coli BW25113 ΔfucA (DE3) pCOLA-fkp-fucP pEJ-futAco showing accumulating 3-fucosyllactose produced by codon optimized fucosyltransferase of Helicobacter pylori via GDP-fucose provided by bifunctional fucose kinase / fucose-1-phosphate guanylyltransferase (Fkp). Fucose and degradation products fuculose and fuculose-1-phosphate are only minimally present; GDP-fucose amount is significantly reduced due to 3-fucosyllactose production.
Figure 9 shows a HPAED analysis of cell lysate from negative control strain E. coli BW25113 ΔfucA (DE3) pCOLADuet-1 pETDuet-1 showing intracellular L- fucose, lactose, glycerol and L-rhamnose, but no fucosyllactose.
Figure 10 shows a cell lysate of strain E. coli BW25113 ΔfucA (DE3) pCOLA- fkp-fucP pEJ-futAco producing 3-fucosyllactose (retention time of about 11 min); furthermore L-fucose, lactose, glycerol and L-rhamnose peaks can be seen.
Figure 11 shows a HPAED analysis of cell lysate from strain E. coli BW25113 ΔfucA (DE3) pCOLA-fkp-fucP pCAW55 showed production of 2 '-fucosyllactose (retention time of about 22 min). Additionally, L-fucose, lactose, glycerol and L-rhamnose can be seen.
Figure 12 a and b show HPLC-analysis with electrochemical detection of GDP- fucose expression in E. coli JM 109 (DE3) ΔfucA (Figure 12a) and E. coli JM 109 (DE3) ΔfucA pCOLA-fkp-fucP (Figure 12b).
Examples
This invention is further explained by the following, non-limiting examples:
Example 1
Construction of expression plasm ids and development of production strains
To successfully prevent the degradation of externally supplied fucose the fucA gene, coding for the key catabolic enzyme fuculose-1-phosphate aldolase had to be deleted from the genome of E. coli strain BW25113. For construction of the fucA deletion the methodology of (Datsenko & Wanner, 2000) was applied. For heterologous gene expression using the T7 promoter an inducible T7 RNA polymerase was incorporated into the deletion strain E. coli BW25113 ΔfucA by using the λDE3 lysogenization kit (Novagen). The resulting strain was then named E. coli BW25113 ΔfucA (DE3). The plasmids pCOLA- fkp-fucP and pET- futAco were constructed using the pCOLADuet-1 and pETDuet-1 expression vectors (Novagen). All primers used for the construction are listed in Table 2. Gene fkp (GeneBank ace. no. AY849806) was amplified by PCR with primers fkp-NcoI-forward and fkp-Notl-reverse using genomic DNA of Bacteroides fragilis ATCC 25285D. The fucP gene (GeneBank ace. no. CP000948) of Escherichia coli K12 was amplified from genomic DNA of E. coli TOPlO (Invitrogen, USA) using primers FucP-Ndel-forward and FucP-XhoI-reverse. Both fkp and fucP were inserted into the first and second multiple cloning site (MCS) of pCOLADuet-1, respectively, using the indicated restriction sites. The resulting plasmid was designated pCOLA- fkp- fucP. The futA gene (GeneBank ace. no. AE000511) of H. pylori strain 26695 was codon-optimized for expression in E. coli and prepared synthetically by GenScript Corporation (Piscataway, NJ, USA). The gene was amplified using the primers FutAco-NcoI- forward and FutAco-BamHI-reverse, and inserted into the first MCS of pETDuet-1, yielding pEJ-futAco. The correct insertion of cloned genes was checked by restriction analysis and sequencing using the recommended primers pACYCDuetUPl, pET-Upstream, DuetDOWN-1, DuetUP2 and T7- Terminator listed in the Duet Vectors Manual (Novagen). Plasmid pCAW55 containing the gene fucT2 coding for αl,2-fucosyltransferase from Helicobacter pylori NCTC364 was donated by C. Albermann (Institute for Microbiology, University of Stuttgart) and is based on vector pJOE2702 (Stumpp et al., 2000). Gene fucT2 is inserted via restriction sites Ndel/Pstl and controlled by L-rhamnose-inducible promoter rhaPBAD- E. coli BW25113 ΔfucA (DE3) was transformed with the expression vectors by electroporation (Dower et al., 1988). All bacterial strains used in this study are listed in Table 1.
Table 1. Bacterial strains and plasmids used.
Relevant characteristic(s)* References Name
E. coli strains BW25113 Δ(araD-araB)567, (Datsenko &
ΔlacZ4787(: :rrnB-3), lambda", Wanner, rph-1, Δ(rhaD-rhaB)568, 2000) hsdR514
BW25113ΔfucA (DE3) BW25113 fucA mutant, carrying This study chromosomal copy of λDE3 T7
RNA polymerase gene
BW25113ΔfucA (DE3) pCOLADuet-1 Negative control strain This study pETDuet-1 harboring empty vectors, ApR,
KanR
BW25113ΔfucA (DE3) pCOLA-fkp-fucP KmR This study
BW25113ΔfucA (DE3) pCOLA-fkp-fucP ApR, KmR This study pET-futAco
B\N25113ΔfucA (DE3) pCOLA-fkp-fucP ApR, KmR This study pCAW55 Plasmids pCOLADuet-1 KmR Novagen pETDuet-1 ApR Novagen pCOLA-fkp-fucP KmR This study pET-futAco ApR This study
PCAW55 ApR C. Albermann
* ApR, ampicillin resistant, KmR, kanamycin resistant. Table 2. Primers.
Name Sequence (5 ' ^3 ' ) Added restrictio n site
Fkp-NcoI-forward AAGGAAACCATGGGCCAAAAACTACTATCTTTACCG NCOI
TCCAATCTGGTTCAGTC
Fkp-Notl-reverse AAGGAAATTGCGGCCGCATTATGATCGTGATACTTG Notl
GAATCCCTTATCAGATAACG
FucP-Ndel-forward AAGGAATACATATGGGAAACACATCAATACAAACGC Ndel
AGAGTTACCGTGCGG
FucP-XhoI-reverse AAGGAAACTCGAGTCAGTTAGTTGCCGTTTGAGAAC Xhol
GGAAACGGGCAAAG
FutAco-NcoI-forward AAGGGAAACCATGGCTATGTTCCAGCCGCTGCTGG NCOI
ACGCGTTTATCGAGTCTGC
FutAco-BamHI-reverse AAGGGAAAGGATCCGGGTCCTATTACAGACCCAGT Bam HI
I I I I I CACCAG pACYCDuetUPl GGATCTCGACGCTCTCCCT pET-Upstream-Primer ATGCGTCCGGCGTAGA
DuetDOWN-l-Primer GATTATGCGGCCGTGTACAA
DuetUP2-Prinner TTGTACACGGCCGCATAATC
T7 -Terminator-Primer TATGCTAGTTATTGCTCAG
The restriction endonuclease recognition sites are underlined.
Example 2
Cultivation conditions and preparation of cell extracts
E. coli strains were inoculated in 10 ml_ of 2xYT broth (Sambrook & Russell, 2001), containing 100 μg mL"1 ampicillin and/or 50 μg mL"1 kanamycin, and incubated overnight in a rotary shaker at 37°C. The next day, 30 mL fresh 2xYT broth supplemented with the appropriate antibiotics was inoculated 1/100 from the overnight culture, and incubated at 37°C in a rotary shaker providing good aeration. When the cultures reached an optical density (OD60O nm) of approximately 0.5, inducers isopropyl-1-thio-β-D-galactopyranoside (IPTG) and/or L-rhamnose were added in a concentration of 0.1 mM and 0.1 %, respectively. The cultures were further incubated at 28°C overnight (approx. 15 h) under constant shaking. For photometric activity assay an aliquot of cell culture was removed, cells were pelleted and resuspended in five times weight/volume 50 mM Tris-HCI pH 7.5. Glass beads were added four times the weight of cell pellet and the resulting suspension was vortexed two times for five minutes each and in between placed on ice for additional five minutes. Cell debris was removed by centrifugation (13200 rpm, 5 min, 4°C) and the resulting crude extract was stored at 4°C.
For in vivo production of fucosyllactose, cells were washed with one culture volume of phosphate buffered saline pH 7.4 (PBS) (Sambrook & Russell, 2001), and resuspended in 30 ml_ of modified M9 mineral medium; to the standard M9 recipe (Sambrook & Russell, 2001), the following substances were added : 20 mM L-fucose, 20 mM lactose, 0.5% glycerol, 0.5 mM guanosine and Ix GIBCO MEM Vitamin Solution (100X) (Invitrogen, USA). Inducers L-rhamnose (0.1 %) and IPTG (0.1 mM) were also added to all cultures regardless of which strain was cultivated to avoid different culture conditions. Again, the cultures were incubated at 28°C overnight (approx. 15 h) under constant shaking. The cultures were centrifuged and the supernatants were decanted and stored at -200C. The cells were subsequently washed with PBS, resuspended in distilled water, and permeabilized by autoclaving (1000C, 5 min). To remove cell debris, the samples were centrifuged (8500 rpm, 30 min) and the clear cell lysate was stored at -200C.
Example 3
SDS-PAGE
The expression of heterologous proteins was checked by SDS-PAGE (Sambrook & Russell, 2001). Protein extracts were prepared in Ix SDS gel- loading buffer, and polyacrylamide gels were stained with Coomassie Brilliant Blue.
Example 4
Enzymatic photometer assays
Example 4a
To determine Fkp activity, fucose kinase activity of the enzyme was measured by the amount of arising ADP from ATP, used as a substrate by pyruvate kinase (PK) while dephosphorylating phosphoenolpyruvate (PEP), whereas the resulting pyruvate was then converted to L-lactate by L-lactate dehydrogenase (LDH) under NADH consumption. The corresponding reactions are summarized in Figure 2. Each 1000 μl_ reaction was performed in 65 mM MOPS buffer (pH 7.5) containing 10 mM L-fucose, 15 mM PEP, 5 mM MgSO4, 0.2 mM of each ATP and NADH, and 5 U of each PK and LDH. After the addition of 25 μL crude extract, the oxidation of NADH to NAD was monitored via the decrease of absorption at 340 nm using a V-630 Bio spectrophotometer (JASCO GmbH, Germany).
Example 4b
Analogously, FucT activity was (as shown in Figure 3) measured by arising GDP (from the donor GDP-L-fucose) which was phosphorylated to GTP by PK under conversion of PEP to pyruvate. LDH catalyzed the final reaction of pyruvate reduction to L-lactate with concomitant NADH consumption. Cellular extracts (25 μL) were tested in a 1000 μL reaction containing 10 mM lactose, 100 μM GDP-L-fucose, 5 mM MgSO4, 0.2 mM of each ATP and NADH, and 5 U of each PK and LDH in 50 mM Tris-HCI buffer (pH 7.5). The decrease of NADH was monitored at 340 nm.
Example 5
Detection of oligosaccharides
Samples were analyzed by high performance anion exchange chromatography (HPAED) using a Decade II pulsed amperometric detector from Antec Leyden (Netherlands) and a CarboPac PA20 column (Dionex, Germany) connected to a HPLC system (Shimadzu, Germany). The detector sensitivity was set at 50 μA with a 0.05-V applied pulse potential. Mono-, di-, and oligosaccharides eluted with 10 mM sodium hydroxide at a flow rate of 0.4 mL min"1. After 30 min isocratic elution with 10 mM NaOH the column was washed for 20 min with 200 mM NaOH to obtain constant retention times and thereafter regenerated with 10 mM NaOH for 20 min.
Example 6
3H-Fucose feeding experiments
E. coli BW25113 ΔfucA (DE3) cells were transformed with the vectors pCOLADuet-1, pETDuet-1, pCOLA-fkp-fucP and pET-futAco to generate the following strains:
E. coli BW25113 ΔfucA (DE3) pCOLADuet-1 pETDuet-1
E. coli BW25113 ΔfucA (DE3) pCOLA-fkp-fucP
E. coli BW25113 ΔfucA (DE3) pCOLA-fkp-fucP pET-futAco.
Strain E. coli BW25113 ΔfucA (DE3) pCOLADuet-1 pETDuet-1 served as empty vector control in the feeding experiments. All three strains were then used for tritium labeled fucose feeding experiments. For the feeding experiments cells were cultured in 3 ml of 2xYT medium containing 20 μl L-5,6-3H-Fucose (40- 60 Ci/mmol and 1 mCi/mL), 50 mM lactose and 1 mM IPTG. According to the used expression vectors 2xYT medium was supplemented with 100 μg mL"1 ampicillin and/or 50 μg mL"1 kanamycin. The 3 mL E. coli cultures were incubated at room temperature overnight. Cells were then collected by centrifugation and separated from the culture media, the obtained cell pellets were resuspended in 200 μL of ddH2O and boiled for 5 min. After cooling on ice for 10 min cell debris were collected by centrifugation at 13000 rpm for 10 min. From the so obtained E. coli cell supernatants 20 μL of each culture were applied to a silica gel TLC plate (Silica gel 60). For the development of the TLC plate a solvent mixture consisting of butanol : acetone : acetic acid : water (35: 35:7: 23) was employed. Radio-TLC analysis was then performed with a Radio-TLC reader (Raytest). For the determination of Rf-values of nonradioactive reference material the TLC plate was sprayed with anisaldehyde solution (5 mL cone. H2SO4, 100 mL ethanol, 1.5 mL acetic acid, 2 mL anisaldehyde) and heated. Example 7
Establishment of an efficient L-fucose salvage pathway in E. coli
Since lactose was used as acceptor substrate for the fucosyltransferases, the β-galactosidase deficient (lacZ~) E. coli strain BW25113 was chosen to circumvent the problem of rapid lactose degradation (Datsenko & Wanner, 2000). L-Fucose can be also effectively degraded by wild type E. coli via isomerization to fuculose, phosphorylation to fuculose-1-phosphate and subsequent retro-aldol cleavage of fuculose-1-phosphate to glycerin-3- phosphate and L-lactaldehyde. To prevent degradation of supplied fucose the gene fucA, encoding the key catabolic enzyme of the fucose degradation pathway fuculose-1-phosphate aldolase (FucA), was deleted in the genome of strain E. coli BW25113. The resulting strain E. coli BW25113 ΔfucA was unable to grow on fucose as well as lactose as sole carbon source on M9 minimal plates. Lysogenization with recombinant phage λDE3 resulted in strain E. coli BW25113 ΔfucA (DE3) compatible with the use of T7 promoter driven expression vectors. The ability of nucleotide activation of fucose to GDP-fucose is very limited in nature and was also for a long time only known from several mammals (human, pig, mouse). Nucleotide activation of fucose is mediated here by two successive enzymatic steps, first the phosphorylation of fucose to fucose-1-phosphate, catalyzed by fucose kinase and followed by the conversion of fucose-1-phosphate to GDP-Fucose, catalyzed by guanylyltransferase, respectively. Whereas in mammals the fucose salvage pathway comprises two separate enzyme catalyzed reactions, the recently discovered bacterial and plant proteins comprise both enzymatic activities. Heterologous expression of human fucose kinase in E. coli resulted only in barely detectable activity (Hinderlich et al., 2002). Biochemical studies showed that mammalian fucokinase represents a highly regulated enzyme (Park et al., 1998). To examine of whether the recently discovered B. fragilis Fkp enzyme is more suitable for activation of fucose and to efficiently provide GDP-fucose for the synthesis of fucosylated oligosaccharides in E. coli we amplified the gene from B. fragilis genomic DNA and cloned it into a bacterial expression vector for heterologous expression.
For the synthesis of T- and 3-fucosyllactose the following fucosyltransferases were chosen for co-expression : The futA gene of H. pylori 26695 (Appelmelk et al., 1999), encoding an αl,3-fucosyltransferase, and the αl,2 '- fucosyltransferase gene fucT2 of H. pylori NCTC364 (Albermann et al., 2001). Before the start of the cloning process, the codon usage of futA was optimized for expression in E. coli and the gene was then synthesized by GenScript corporation (USA). The resulting gene futAco was inserted in the expression vector pETDuet-1, and expression was tested with and without co-expression of Fkp and FucP. Using standard induction conditions, Fkp, FucP and FutAco or FucT2 were co-expressed. Protein formation was examined after induction with IPTG and/or L-rhamnose with SDS-PAGE (see Figure 4), documenting pronounced soluble production of Fkp protein, whereas induction of membrane localized fucose permease protein (FucP) could, as expected, not be detected in cell cytoplasm by SDS-PAGE. However, the gene products of futAco and fucT2 proved to be primarily located in inclusion bodies with only a small soluble fraction detectable.
Example 8
Photometric detection of enzymatic activity
The crude extracts derived from induced cultures were tested for fucose kinase and fucosyltransferase activity using auxiliary enzymes in coupled enzymatic assays as described above. Apparently, there is a considerable background of either NADH oxidase and/or phosphatase activity in E. coli BW25113 ΔfucA (DE3), which was responsible for non-reproducible results and low measured fucose kinase and fucosyltransferase activity of the different strains. Therefore, it was decided to determine enzymatic activity by monitoring intracellular product formation (GDP-fucose and fucosyllactose).
Example 9
Examination of utilization of externally fed 3H-L-fucose for GDP-fucose and 3- fucosyllactose production by recombinant E. coli
The aim of this experiment was the verification of 3-fucosyllactose production from fucose and lactose via GDP-fucose production by the fucose salvage pathway bifunctional enzyme Fkp from Bacteroides fragilis. Negative control strain E. coli BW25113 ΔfucA (DE3) pCOLADuet-1 pETDuet-1, as well as Fkp and fucose permease expressing strain E. coli BW25113 ΔfucA (DE3) pCOLA- fkp-fucP and Fkp, fucose-permease and αl,3-fucosyltransferase expressing strain E. coli BW25113 ΔfucA (DE3) pCOLA-fkp-fucP pET-futAco were treated as described above. Cell extracts derived from these strains were applied to a TLC plate, developed as described above and analyzed by radio-TLC reader. Additionally, 3H-labelled L-fucose standard was applied to a TLC plate and developed (see Figure 5). Non-radioactive standards for L-fucose and L- fuculose-1-phosphate, GDP-L-fucose, as well as 3-fucosyllactose were analyzed similarly by TLC and subsequent staining by anisaldehyde solution (data not shown).
The results of the negative control experiment (see Figure 6) showed products of the first and second catabolic steps from the fucose metabolism, i.e. L- fuculose (produced from fucose by fucose isomerase) and L-fuculose-1- phosphate (produced from fuculose by fuculose kinase). Further degradation of fucose is effectively inhibited by the knock-out of the gene fucA, which encodes the enzyme fuculose-1-phosphate aldolase, which catalyzes the retro- aldol cleavage reaction of fuculose-1-phosphate to L-lactaldehyde and dihydroxyacetone phosphate.
E. coli cells coexpressing bifunctional fucose kinase / fucose-1-phosphate guanylyltransferase Fkp from Bacteroides fragilis show the production of GDP- fucose (see Figure 7) which is apparently accumulating in the cells and may only minimally divert into other metabolic pathways whose products would otherwise appear on the radio-TLC. Cell extracts from strain E. coli BW25113 ΔfucA (DE3) pCOLA-fkp-fucP pET- futAco show production of 3-fucosyllactose and only a small amount of GDP- fucose (see Figure 8). This result is consistent with the initial aim of the experiment, i.e. to show the production of 3-fucosyllactose via GDP-fucose supply by bifunctional salvage pathway enzyme Fkp from Bacteroides fragilis. The amount of fucose degradation products fuculose and fuculose-1-phosphate is also greatly diminished, due to the consumption of GDP-fucose in fucosyllactose production and the deriving drift of the reaction equilibrium from fuculose-1-phosphate and fuculose to fucose, which is constantly drawn from the reaction by GDP-fucose production.
Example 10
Examination of 2'-fucosyllactose and 3-fucosyllactose production by recombinant E. coli
Strain E. coli BW25113 ΔfucA (DE3) harboring pCOUK-fkp-fucP and either the futAco or fucT2 gene in a separate expression vector, as well as E. coli BW25113 ΔfucA (DE3) harboring the empty vectors pCOLADuet-1 and pETDuet-1 (negative control) were grown in 2xYT broth, and protein expression was induced with IPTG and/or L-rhamnose for 15 h at 28°C. The cells were subsequently washed with PBS and resuspended in modified M9 medium supplemented with L-fucose, lactose and guanosine, IPTG and L- rhamnose. After a fermentation phase (28°C, 15 h), the cells were harvested, supernatants collected and cell lysates prepared as described above.
Analysis via HPAED showed retention times on the used HPLC column of approximately 3 min for the L-fucose standard, approx. 17 min for the lactose standard, approx. 11 min for the 3-fucosyllactose standard, and of approx. 22 min for the used 2 '-fucosyllactose standard (data not shown). Glycerol, that is, as carbon source, part of the culture medium, was recorded with a retention time of approx. 1.5 min, and inducer L-rhamnose with a retention time of 5.5 min. Both substances are detected intracellular^ during analysis of cell lysates.
Cell lysates from E. coli BW25113 ΔfucA (DE3) pCOLADuet-1 pETDuet-1 negative control strain showed intracellular L-fucose and lactose, but, as expected, no fucosyllactose (see Fig. 9). In addition to the aforementioned molecules also the medium supplied carbon source glycerol and the transcription inducer L-rhamnose are detected in the analysis.
HPAED analysis of cell lysate from strain E. coli BW25113 ΔfucA (DE3) pCOLA- fkp-fucP pEJ-futAco, coexpressing the B. fragilis fkp gene and E. coli fucose permease gene in combination with the codon optimized Helicobacter pylori αl,3-fucosyltransferase gene, showed the intracellular production of 3- fucosyllactose (peak at about 11 min, see Fig. 10). L-fucose and lactose are also components of the cell lysate, as well as glycerol and L-rhamnose.
Cell lysate from strain E. coli BW25113 ΔfucA (DE3) pCOLA-fkp-fucP pCAW55 showed intracellular production of 2 '-fucosyllactose (see Fig. 11), due to the coexpression of αl,2-fucosyltransferase FucT2. Additionally, L-fucose, lactose, glycerol and L-rhamnose can be seen in cell lysate, just as in cell lysate from negative control and 3-fucosyllactose producing strain E. coli BW25113 ΔfucA (DE3) pCOLA-fkp-fucP pET-futAco.
These results clearly show the production of 3- and 2'-fucosyllactose in recombinant E. coli cells from externally supplied L-fucose and lactose. By heterologous expression of B. fragilis Fkp protein, catalyzing the two-step reaction of fucose phosphorylation and fucose-1-phosphate guanylyl transfer, efficient production of GDP-fucose was obtained. Codon optimized αl,3- fucosyltransferase FutAco initially derived from Helicobacter pylori or αl,2- fucosyltransferase FucT2 from Helicobacter pylori, respectively, can convert the so supplied GDP-fucose into 2'- and 3-fucosyllactose.
Example 11
Expression of GDP-fucose in E. coli JM 109 cells
Elevation of intracellular GDP-fucose content due to expression of Fkp was shown by parallel cultivation of an E. coli strain expressing Fkp from a plasmid and an E. coli strain not containing a copy of Fkp. Strain E. coli JM 109 (DE3) ΔfucA was in this case used as control strain without Fkp. The strain expressing Fkp was the same strain E. coli JM 109 (DE3) ΔfucA, this time containing the plasmid pCOLA- fkp- fucP, and bearing thus the genes coding for fucose kinase / fucose-1-phosphate guanylyltransferase Fkp and fucose permease FucP. As the genes were cloned in multiple cloning sites (MCS) 1 and 2 of vector pCOLADuet-1 (Novagen, UK), expression of both genes can be induced by addition of IPTG, as both MCS are flanked by a T7 promoter / operator on the 5' side.
Both strains were cultured in duplicate in 30 ml 2YT medium, supplemented with kanamycin for the strain with pCOlΛ-fkp-fucP for plasmid maintenance, at 37 0C and 220 rpm. Induction of Fkp expression was started at OD660 = 0,5 by addition of 1 mM IPTG and both strains were supplied with 20 mM fucose and then cultivated for additional 3 hours at 37 0C and 220 rpm. Cells were pelleted by centrifugation and pellets were resuspended in 5 v/w distilled water. These cell suspensions were incubated at 95 0C for 10 minutes to lyse the cells. Cell debris was removed by centrifugation and the supernatants were analyzed by HPLC.
HPLC analysis was carried out by electrochemical detection with a Decade II pulsed amperometric detector (Antec Leyden, Netherlands). 20 mM sodium hydroxide + 825 mM sodium acetate was used as eluent on a CarboPac PA20 column (Dionex, USA). GDP-fucose eluted with a retention time of 16,0 minutes.
Table 3: Intracellular GDP-fucose content of E. coli JM109 (DE3) ΔfucA with and without expression of fucose kinase / fucose-1-phosphate guanylyltransferase Fkp from pCOLA- fkp- fucP.
Figure imgf000014_0001
Figure 12a shows HPLC-analysis of E. coli JM109 (DE3) ΔfucA cells for GDP- fucose expression without expression of FKP protein.
Figur 12b is an analysis of E. coli JM109 (DE3) ΔfucA pCOLA-fkp-fucP cells co- expressing the Fkp protein together with the fucose importer FucP. The peak at 16.0 min corresponds to GDP-fucose, as verified with an authentic standard.
References
Albermann, C, W. Piepersberg & U. F. Wehmeier, (2001) Synthesis of the milk oligosaccharide 2'-fucosyllactose using recombinant bacterial enzymes. Carbohydr Res 334: 97-103.
Andersson, B., O. Porras, L. A. Hanson, T. Lagergard & C. Svanborg-Eden, (1986) Inhibition of attachment of Streptococcus pneumoniae and Haemophilus influenzae by human milk and receptor oligosaccharides. J Infect Dis 153: 232-237.
Appelmelk, B. J., S. L. Martin, M. A. Monteiro, C. A. Clayton, A. A. McColm, P. Zheng, T. Verboom, J. J. Maaskant, D. H. van den Eijnden, C. H. Hokke, M. B. Perry, C. M. Vandenbroucke-Grauls & J. G. Kusters, (1999) Phase variation in Helicobacter pylori lipopolysaccharide due to changes in the lengths of poly(C) tracts in alpha3-fucosyltransferase genes. Infect Immun 67: 5361-5366.
Appelmelk, B. J., M. C. Martino, E. Veenhof, M. A. Monteiro, J. J. Maaskant, R. Negrini, F. Lindh, M. Perry, G. Del Giudice & C. M. Vandenbroucke- Grauls, (2000) Phase variation in H type I and Lewis a epitopes of Helicobacter pylori lipopolysaccharide. Infect Immun 68: 5928-5932.
Bergman, M., G. Del Prete, Y. van Kooyk & B. Appelmelk, (2006) Helicobacter pylori phase variation, immune modulation and gastric autoimmunity. Nat Rev Microbiol 4 : 151-159.
Bode, L., (2006) Recent advances on structure, metabolism, and function of human milk oligosaccharides. J Nutr 136: 2127-2130.
Coppa, G. V., L. Zampini, T. Galeazzi, B. Facinelli, L. Ferrante, R. Capretti & G. Orazio, (2006) Human milk oligosaccharides inhibit the adhesion to Caco-2 cells of diarrheal pathogens: Escherichia coli, Vibrio cholerae, and Salmonella fyris. Pediatr Res 59: 377-382.
Coyne, M. J., B. Reinap, M. M. Lee & L. E. Comstock, (2005) Human symbionts use a host-like pathway for surface fucosylation. Science 307: 1778- 1781.
Crane, J. K., S. S. Azar, A. Stam & D. S. Newburg, (1994) Oligosaccharides from human milk block binding and activity of the Escherichia coli heat- stable enterotoxin (STa) in T84 intestinal cells. J Nutr 124: 2358-2364.
Cravioto, A., A. TeIIo, H. Villafan, J. Ruiz, S. del Vedovo & J. R. Neeser, (1991) Inhibition of localized adhesion of enteropathogenic Escherichia coli to HEp-2 cells by immunoglobulin and oligosaccharide fractions of human colostrum and breast milk. J Infect Dis 163: 1247-1255.
Datsenko, K. A. & B. L. Wanner, (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97: 6640-6645.
Dower, W. J., J. F. Miller & C. W. Ragsdale, (1988) High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res 16: 6127-6145.
Dumon, C, C. Bosso, J. P. Utille, A. Heyraud & E. Samain, (2006) Production of Lewis x tetrasaccharides by metabolically engineered Escherichia coli. Chembiochem 7: 359-365. Dumon, C, B. Priem, S. L. Martin, A. Heyraud, C. Bosso & E. Samain, (2001) In vivo fucosylation of lacto-N-neotetraose and lacto-N-neohexaose by heterologous expression of Helicobacter pylori alpha-1,3 fucosyltransferase in engineered Escherichia coli. Glycoconj J 18: 465- 474.
Dumon, C, E. Samain & B. Priem, (2004) Assessment of the two Helicobacter pylori alpha-l,3-fucosyltransferase ortholog genes for the large-scale synthesis of LewisX human milk oligosaccharides by metabolically engineered Escherichia coli. Biotechnol Prog 20: 412-419.
Ge, Z., N. W. Chan, M. M. Palcic & D. E. Taylor, (1997) Cloning and heterologous expression of an alphal,3-fucosyltransferase gene from the gastric pathogen Helicobacter pylori. J Biol Chem 272: 21357- 21363.
Gnoth, M. J., S. Rudloff, C. Kunz & R. K. Kinne, (2001) Investigations of the in vitro transport of human milk oligosaccharides by a Caco-2 monolayer using a novel high performance liquid chromatography-mass spectrometry technique. J Biol Chem 276: 34363-34370.
Grant, W. D., I. W. Sutherland & J. F. Wilkimson, (1970) Control of colanic acid synthesis. J Bacteriol 103: 89-96.
Hinderlich S, Berger, M., Blume, A., Chen, H., Ghaderi, D. & Bauer, C. (2002) Identification of human L-fucose kinase amino acid sequence. Biochem. Biophys. Res. Commun. 294, 650-654.
Koizumi, S., T. Endo, K. Tabata, H. Nagano, J. Ohnishi & A. Ozaki, (2000) Large-scale production of GDP-fucose and Lewis X by bacterial coupling. J Ind Microbiol Biotechnol 25: 213-217.
Kretzschmar, G. & W. Stahl, (1998) Large scale synthesis of linker-modified sialyl-Lewis(X), Lewis(X) and N-acetyllactosamine. Tetrahedron 54: 6341-6358.
Kunz, C. & S. Rudloff, (2006) Health promoting aspects of milk oligosaccharides. Int Dairy J 16: 1341-1346.
Li, M., X. W. Liu, J. Shao, J. Shen, Q. Jia, W. Yi, J. K. Song, R. Woodward, C. S. Chow & P. G. Wang, (2008) Characterization of a novel alphal,2- fucosyltransferase of Escherichia coli 0128: bl2 and functional investigation of its common motif. Biochemistry 47: 378-387.
Ma, B., J. L. Simala-Grant & D. E. Taylor, (2006) Fucosylation in prokaryotes and eukaryotes. Glycobiology 16: 158R- 184 R.
Martin, S. L., M. R. Edbrooke, T. C. Hodgman, D. H. van den Eijnden & M. I. Bird, (1997) Lewis X biosynthesis in Helicobacter pylori. Molecular cloning of an alpha(l,3)-fucosyltransferase gene. J Biol Chem 272: 21349-21356.
Newburg, D. S., (2001) Bioactive components of human milk: evolution, efficiency, and protection. Adv Exp Med Biol 501 : 3-10.
Newburg, D. S. & S. H. Neubauer, (1995) Carbohydrates in milk. In : Handbook of Milk Composition. R. G. Jensen (ed). San Diego, CA: Academic Press, pp. 273-349.
Rasko, D. A., G. Wang, M. M. Palcic & D. E. Taylor, (2000) Cloning and characterization of the alpha(l,3/4) fucosyltransferase of Helicobacter pylori. J Biol Chem 275: 4988-4994. Ruiz-Palacios, G. M., L. E. Cervantes, P. Ramos, B. Chavez-Munguia & D. S.
Newburg, (2003) Campylobacter jejuni binds intestinal H(O) antigen
(Fuc alpha 1, 2GaI beta 1, 4GIcNAc), and fucosyloligosaccharides of human milk inhibit its binding and infection. J Biol Chem 278: 14112-
14120. Sambrook, J. & D. W. Russell, (2001) Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Stumpp, T., B. Wilms & J. Altenbuchner, (2000) Ein neues L-Rhamnose- induzierbares Expressionssystem fϋr Escherichia coli. BIOspektrum 6:
33-36. Wang, G., Z. Ge, D. A. Rasko & D. E. Taylor, (2000) Lewis antigens in
Helicobacter pylori: biosynthesis and phase variation. MoI Microbiol 36:
1187-1196. Wang, G., D. A. Rasko, R. Sherburne & D. E. Taylor, (1999) Molecular genetic basis for the variable expression of Lewis Y antigen in Helicobacter pylori: analysis of the alpha (1,2) fucosyltransferase gene. MoI Microbiol
31 : 1265-1274. Park, S. H., I. Pastuszak, R. Drake & A. D. Elbein, (1998). Purification to apparent homogenicity and properties of pig kidney L-fucose kinase. J
Biol Chem 273: 5685-5691.

Claims

Claims
1. A method for making a genetically modified cell having the ability to produce fucosylated compounds comprising the steps of
-transforming the cell to express a fucose kinase
-transforming the cell to express a fucose-1-phosphate guanylyltransferase -transforming the cell to express a fucosyltransferase.
2. The method of claim 1, wherein the genetically modified cell is a microorganism selected from the group consisting of the genera Escherichia, Klebsiella, Helicobacter, Bacillus, Lactobacillus, Streptococcus, Lactococcus, Pichia, Saccharomyces and Kluyveromyces.
3. The method of claim 1 or 2, wherein the fucose kinase and the fucose-1- phosphate guanylyltransferase are combined in a bifunctional enzyme.
4. The method of claim 3, wherein the bifunctional fucose kinase/fucose-1- phosphate guanylyltransferase is selected of bifunctional fucose kinase/fucose-1-phosphate guanylyltransferase derived from the group consisting of the genera Bacteroides, Lentisphaera, Ruminococcus, Solibacter, Arabidopsis, Oryza, Physcomitrella, Vitis, Danio, Bos, Equus, Macaca, Pan, Homo, Rattus, Mus and Xenopus.
5. The method of any one of claims 1 to 4, wherein the fucosyltransferase is derived from an organism selected from the group consisting of the genera Helicobacter, Escherichia, Yersinia, Enterococcus, Shigella, Klebsiella, Salmonella, Bacteroides, Dictyostelium, Arabidopsis, Drosophila, Homo, Bos, Mus, Rattus, Gall us, Canis and Sus.
6. The method of any one of claims 1 to 5, wherein a catabolic pathway of said cell for fucose is inactivated.
7. The method of claim 6, wherein the catabolic pathway for fucose is inactivated by inactivating one or several genes selected from the group consisting of a fucose-1-phosphate aldolase gene, a fucose isomerase gene and a fuculose kinase gene.
8. The method of any one of claims 1 to 7, wherein the fucosylated compound is a fucosyllactose, preferably 2'-fucosyllactose, 3- fucosyllactose or lactodifucotetraose.
9. A genetically modified cell obtainable by the method of anyone of the claims 1 to 8.
10. A method for making fucosylated compound comprising the steps of cultivating the cell of claim 9 under suitable cultivation conditions in a medium comprising fucose and an acceptor substrate.
11. The method of claim 10, wherein the acceptor substrate is a mono-, di- or oligosaccharide or a peptide.
12. The method of claims 10 or 11, wherein the acceptor substrate is lactose, 2'-fucosyllactose or 3-fucosyllactose.
13. The method of any one of claims 10 to 12, wherein the fucosylated compound is a fucosyllactose, preferably 2'-fucosyllactose or 3- fucosyllactose, or lactodifucotetraose.
PCT/EP2009/067531 2008-12-19 2009-12-18 Synthesis of fucosylated compounds Ceased WO2010070104A1 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
MYPI2011002757A MY183602A (en) 2008-12-19 2009-12-18 Synthesis of fucosylated compounds
MX2011006371A MX2011006371A (en) 2008-12-19 2009-12-18 Synthesis of fucosylated compounds.
NZ593448A NZ593448A (en) 2008-12-19 2009-12-18 Synthesis of fucosylated compounds
EP09797036.2A EP2379708B1 (en) 2008-12-19 2009-12-18 Synthesis of fucosylated compounds
SG2011037785A SG171814A1 (en) 2008-12-19 2009-12-18 Synthesis of fucosylated compounds
JP2011541476A JP5726751B2 (en) 2008-12-19 2009-12-18 Synthesis of fucosylated compounds
CN200980151270XA CN102257128A (en) 2008-12-19 2009-12-18 Synthesis of fucosylated compounds
HK11113658.3A HK1159173B (en) 2008-12-19 2009-12-18 Synthesis of fucosylated compounds
RU2011129780/10A RU2584599C2 (en) 2008-12-19 2009-12-18 Synthesis of fucosylated compounds
BRPI0923433-0A BRPI0923433B1 (en) 2008-12-19 2009-12-18 METHOD TO PRODUCE A GENETICALLY MODIFIED CELL HAVING THE ABILITY TO PRODUCE FUCOSYLATE COMPOUNDS AND METHOD TO MAKE A FUCOSYLATE COMPOUND
US13/140,548 US20110300584A1 (en) 2008-12-19 2009-12-18 Synthesis of fucosylated compounds
AU2009329543A AU2009329543B2 (en) 2008-12-19 2009-12-18 Synthesis of fucosylated compounds
US16/440,777 US11390855B2 (en) 2008-12-19 2019-06-13 Synthesis of fucosylated compounds

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP08172267 2008-12-19
EP08172267.0 2008-12-19

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/140,548 A-371-Of-International US20110300584A1 (en) 2008-12-19 2009-12-18 Synthesis of fucosylated compounds
US16/440,777 Division US11390855B2 (en) 2008-12-19 2019-06-13 Synthesis of fucosylated compounds

Publications (1)

Publication Number Publication Date
WO2010070104A1 true WO2010070104A1 (en) 2010-06-24

Family

ID=40550215

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2009/067531 Ceased WO2010070104A1 (en) 2008-12-19 2009-12-18 Synthesis of fucosylated compounds

Country Status (14)

Country Link
US (2) US20110300584A1 (en)
EP (1) EP2379708B1 (en)
JP (1) JP5726751B2 (en)
CN (1) CN102257128A (en)
AU (1) AU2009329543B2 (en)
BR (1) BRPI0923433B1 (en)
CO (1) CO6362044A2 (en)
IN (1) IN2011MU01050A (en)
MX (1) MX2011006371A (en)
MY (1) MY183602A (en)
NZ (1) NZ593448A (en)
RU (1) RU2584599C2 (en)
SG (1) SG171814A1 (en)
WO (1) WO2010070104A1 (en)

Cited By (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102120999A (en) * 2010-12-17 2011-07-13 天津科技大学 Method for synthesizing human milk fucosylation oligosaccharide by using genetic engineering strain through coupling and fermenting
WO2012092154A1 (en) * 2010-12-31 2012-07-05 Abbott Laboratories Methods of using human milk oligosaccharides for improving airway respiratory health
WO2012127045A1 (en) 2011-03-23 2012-09-27 Glycode A yeast recombinant cell capable of producing gdp-fucose
JP2012191905A (en) * 2011-03-17 2012-10-11 National Institute Of Advanced Industrial Science & Technology Synthesis method of sugar nucleotide using yeast
WO2013025104A1 (en) 2011-08-16 2013-02-21 Friesland Brands B.V. Nutritional compositions comprising human milk oligosaccharides and uses thereof
US20140024820A1 (en) * 2011-01-20 2014-01-23 Jennewein Biotechnologie Gmbh Novel fucosyltransferases and their applications
US8652808B2 (en) 2009-06-08 2014-02-18 Jennewein Biotechnologie Gmbh Method for the production of fucosyllactose in bacterial cells
US8703737B2 (en) 2010-12-31 2014-04-22 Abbott Laboratories Nutritional formulations including human milk oligosaccharides and antioxidants and uses thereof
EP2728009A1 (en) * 2012-10-31 2014-05-07 Jennewein Biotechnologie GmbH Process for producing monosaccharides
WO2014075680A1 (en) * 2012-11-13 2014-05-22 Glycom A/S Crystalline 3-o-fucosyllactose
WO2014086373A1 (en) 2012-12-07 2014-06-12 Glycom A/S Crystallisation of human milk oligosaccharides (hmo)
EP2845905A1 (en) 2013-09-10 2015-03-11 Jennewein Biotechnologie GmbH Production of oligosaccharides
WO2015032413A1 (en) * 2013-09-06 2015-03-12 Glycom A/S Fermentative production of oligosaccharides
WO2015032412A1 (en) 2013-09-06 2015-03-12 Glycom A/S Fermentative production of oligosaccharides
WO2015188834A1 (en) 2014-06-11 2015-12-17 Glycom A/S Separation of 2'-o-fucosyllactose from fermentation broth
WO2015197082A1 (en) 2014-06-27 2015-12-30 Glycom A/S Oligosaccharide production
US9283240B2 (en) 2010-12-31 2016-03-15 Abbott Laboratories Human milk oligosaccharides for modulating inflammation
WO2016095924A1 (en) 2014-12-16 2016-06-23 Glycom A/S Separation of 2'-fl from a fermentation broth
EP2877574A4 (en) * 2012-07-25 2016-07-20 Glycosyn LLC ALPHA (1,2) FUCOSYLTRANSFERASES SUITABLE FOR USE IN THE PRODUCTION OF FUCOSYLATED OLIGOSACCHARIDES
US9539269B2 (en) 2010-12-31 2017-01-10 Abbott Laboratories Methods for decreasing the incidence of necrotizing enterocolitis in infants, toddlers, or children using human milk oligosaccharides
AU2015215937B2 (en) * 2010-07-12 2017-03-16 Inbiose N.V. Metabolically engineered organisms for the production of added value bio-products
JP2017093432A (en) * 2011-02-16 2017-06-01 グリコシン リミテッド ライアビリティー カンパニー Biosynthesis of human milk oligosaccharides in engineered bacteria
WO2017101958A1 (en) 2015-12-18 2017-06-22 Glycom A/S Fermentative production of oligosaccharides
US9763970B2 (en) 2010-12-31 2017-09-19 Abbott Laboratories Nutritional compositions comprising human milk oligosaccharides and nucleotides and uses thereof for treating and/or preventing enteric viral infection
US9795623B2 (en) 2010-12-31 2017-10-24 Abbott Laboratories Methods for reducing the incidence of oxidative stress using human milk oligosaccharides, vitamin C and anti-inflammatory agents
US9816122B2 (en) 2012-09-25 2017-11-14 Glycom A/S Glycoconjugate synthesis
WO2018041803A1 (en) 2016-08-31 2018-03-08 Prismagen Gmbh Use of human milk oligosaccharides in calves fattening
EP3315610A1 (en) * 2016-10-29 2018-05-02 Jennewein Biotechnologie GmbH Improved process for the production of fucosylated oligosaccharides
CN103201380B (en) * 2010-10-11 2018-07-24 詹尼温生物技术有限责任公司 New Fucosyltransferases and Their Applications
WO2019071021A2 (en) 2017-10-04 2019-04-11 The Regents Of The University Of California Immunomodulatory oligosaccharides
WO2019101629A1 (en) 2017-11-21 2019-05-31 Jennewein Biotechnologie Gmbh Process for the purification of l-fucose from a fermentation broth
EP3494804A1 (en) 2017-12-08 2019-06-12 Jennewein Biotechnologie GmbH Spray-dried 3-fucosyllactose
EP3494806A1 (en) 2017-12-08 2019-06-12 Jennewein Biotechnologie GmbH Spray-dried lacto-n-fucopentaose
EP3494807A1 (en) 2017-12-11 2019-06-12 Jennewein Biotechnologie GmbH Spray-dried sialyllactose
EP3494805A1 (en) 2017-12-08 2019-06-12 Jennewein Biotechnologie GmbH Spray-dried tetrasaccharides
WO2019110806A1 (en) 2017-12-08 2019-06-13 Jennewein Biotechnologie Gmbh Spray-dried lacto-n-fucopentaose
EP3524067A1 (en) 2018-02-08 2019-08-14 Jennewein Biotechnologie GmbH Spray-dried mixture of human milk oligosaccharides
WO2020079114A1 (en) 2018-10-18 2020-04-23 Basf Se Method for obtaining crystalline 2'-fucosyllactose
US10639319B2 (en) 2011-08-29 2020-05-05 Abbott Laboratories Human milk oligosaccharides for preventing injury and/or promoting healing of the gastrointestinal tract
WO2021094133A2 (en) 2019-11-13 2021-05-20 Basf Se Enzymatic hydrolysis of 2',3-difucosyllactose
EP3848471A1 (en) 2020-01-10 2021-07-14 Chr. Hansen HMO GmbH Sequential fermentative production of oligosaccharides
JP2021121215A (en) * 2011-12-16 2021-08-26 インビオース エヌ.ヴェ.Inbiose N.V. Mutant microorganisms for synthesizing cholanoic acid, mannosylated and / or fucosylated oligosaccharides
WO2021181349A1 (en) 2020-03-12 2021-09-16 Glycom A/S Crystallization of 2'-fl
US11142541B2 (en) 2017-06-30 2021-10-12 Glycom A/S Purification of oligosaccharides
WO2022013143A1 (en) 2020-07-13 2022-01-20 Glycom A/S Oligosaccharide production
US11337990B2 (en) 2010-12-31 2022-05-24 Abbott Laboratories Human milk oligosaccharides to promote growth of beneficial bacteria
US11505567B2 (en) 2017-07-12 2022-11-22 Glycom A/S Amorphous mixture comprising a neutral mono- or oligosaccharide and an acidic non-carbohydrate component
WO2022243311A1 (en) 2021-05-17 2022-11-24 Dsm Ip Assets B.V. Microbial strain expressing an invertase/sucrose hydrolase
WO2022242860A1 (en) 2021-05-20 2022-11-24 Chr. Hansen A/S Sequential fermentative production of oligosaccharides
WO2024046993A1 (en) 2022-08-29 2024-03-07 Chr. Hansen A/S Process for the production of a purified human milk oligosaccharide derived from a microbial fermentation process
US11926858B2 (en) 2014-06-27 2024-03-12 Glycom A/S Oligosaccharide production
US12060593B2 (en) 2017-07-07 2024-08-13 Chr. Hansen HMO GmbH Fucosyltransferases and their use in producing fucosylated oligosaccharides

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2701163T3 (en) 2014-01-20 2019-02-21 Jennewein Biotechnologie Gmbh Procedure for the efficient purification of neutral human milk oligosaccharides (HMOs) from microbial fermentation
US20170204443A1 (en) * 2014-07-14 2017-07-20 Basf Se Biotechnological production of lnt, lnnt and the fucosylated derivatives thereof
CN113195730A (en) 2018-12-19 2021-07-30 巴斯夫欧洲公司 Method for separating biomass from a solution comprising biomass and at least one oligosaccharide
WO2021019104A2 (en) 2019-09-18 2021-02-04 Basf Se A production host for producing human milk oligosaccharides
CN110672756B (en) * 2019-11-07 2020-12-29 江南大学 A kind of detection method of 2'-fucosyllactose content in milk powder
WO2021122687A1 (en) 2019-12-19 2021-06-24 Basf Se Increasing space-time-yield, carbon-conversion-efficiency and carbon substrate flexibility in the production of fine chemicals
EP3922727A1 (en) 2020-06-12 2021-12-15 Basf Se Method for separating biomass from a solution comprising biomass and at least one aroma compound
KR20230022867A (en) 2020-06-12 2023-02-16 바스프 에스이 Improved demineralization of fermentation broth and purification of fine chemicals such as oligosaccharides

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1426441A1 (en) * 2001-08-24 2004-06-09 Kyowa Hakko Kogyo Co., Ltd. Alpha-1,2-fucosyl transferase and dna encoding the same
WO2006135075A1 (en) * 2005-06-17 2006-12-21 Ajinomoto Co., Inc. A method for producing an l-amino acid using a bacterium of the enterobacteriaceae family with enhanced expression of the fucpikur operon
WO2008112092A2 (en) * 2007-03-07 2008-09-18 Glycofi, Inc. Production of glycoproteins with modified fucosylation

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2125092C1 (en) * 1991-10-15 1999-01-20 Дзе Скриппс Рисерч Инститьют Method of synthesis of fucosylated carbohydrate, method of synthesis of fucosylated sialylated carbohydrate molecule, reaction system in vitro
US6238894B1 (en) 1998-11-04 2001-05-29 Diane Taylor α1,2 fucosyltransferase
EP1131415A4 (en) 1998-11-18 2002-09-11 Neose Technologies Inc Low cost manufacture of oligosaccharides
US20040058418A1 (en) * 2000-04-11 2004-03-25 Tetsuo Endo Alpha 1,2-fucosyltransferase and process for producing fucose-containing complex carbohydrate
ATE440959T1 (en) 2000-06-28 2009-09-15 Glycofi Inc METHOD FOR PRODUCING MODIFIED GLYCOPROTEINS
US20020132320A1 (en) 2001-01-10 2002-09-19 Wang Peng George Glycoconjugate synthesis using a pathway-engineered organism
FR2840920B1 (en) * 2002-06-18 2006-06-23 Biochimie Appliquee Soc NEW MICROORGANISM OF THE ENTEROBACTERIACEAE FAMILY
EP2497478A3 (en) * 2003-12-05 2012-11-07 Children's Hospital Medical Center Oligosaccaride compositions and use thereof in the treatment of infection
US7326770B2 (en) * 2004-01-22 2008-02-05 Neose Technologies, Inc. H. pylori fucosyltransferases
US20080145899A1 (en) * 2004-09-17 2008-06-19 Neose Technologies Inc Production of Oligosaccharides By Microorganisms
AU2007222375B2 (en) * 2006-03-09 2012-12-20 Centre National De La Recherche Scientifique (Cnrs) Method of producing sialylated oligosaccharides
US20070221747A1 (en) 2006-03-22 2007-09-27 Siemens Vdo Automotive Corporation Super imposed signal for an actuator and heater of a fuel injector

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1426441A1 (en) * 2001-08-24 2004-06-09 Kyowa Hakko Kogyo Co., Ltd. Alpha-1,2-fucosyl transferase and dna encoding the same
WO2006135075A1 (en) * 2005-06-17 2006-12-21 Ajinomoto Co., Inc. A method for producing an l-amino acid using a bacterium of the enterobacteriaceae family with enhanced expression of the fucpikur operon
WO2008112092A2 (en) * 2007-03-07 2008-09-18 Glycofi, Inc. Production of glycoproteins with modified fucosylation

Non-Patent Citations (39)

* Cited by examiner, † Cited by third party
Title
ALBERMANN C ET AL: "Synthesis of the milk oligosaccharide 2'-fucosyllactose using recombinant bacterial enzymes", CARBOHYDRATE RESEARCH, ELSEVIER SCIENTIFIC PUBLISHING COMPANY. AMSTERDAM, NL, vol. 334, no. 2, 23 August 2001 (2001-08-23), pages 97 - 103, XP004298614, ISSN: 0008-6215 *
ALBERMANN, C.; W. PIEPERSBERG; U. F. WEHMEIER: "Synthesis of the milk oligosaccharide 2'-fucosyllactose using recombinant bacterial enzymes", CARBOHYDR RES, vol. 334, 2001, pages 97 - 103, XP004298614, DOI: doi:10.1016/S0008-6215(01)00177-X
ANDERSSON, B.; O. PORRAS; L. A. HANSON; T. LAGERGARD; C. SVANBORG-EDEN: "Inhibition of attachment of Streptococcus pneumoniae and Haemophilus influenzae by human milk and receptor oligosaccharides", J INFECT DIS, vol. 153, 1986, pages 232 - 237, XP003028148
APPELMELK, B. J.; M. C. MARTINO; E. VEENHOF; M. A. MONTEIRO; J. J. MAASKANT; R. NEGRINI; F. LINDH; M. PERRY; G. DEL GIUDICE; C. M.: "Phase variation in H type I and Lewis a epitopes of Helicobacter pylori lipopolysaccharide", INFECT IMMUN, vol. 68, 2000, pages 5928 - 5932, XP002953882, DOI: doi:10.1128/IAI.68.10.5928-5932.2000
APPELMELK, B. J.; S. L. MARTIN; M. A. MONTEIRO; C. A. CLAYTON; A. A. MCCOLM; P. ZHENG; T. VERBOOM; J. J. MAASKANT; D. H. VAN DEN E: "Phase variation in Helicobacter pylori lipopolysaccharide due to changes in the lengths of poly(C) tracts in alpha3-fucosyltransferase genes", INFECT IMMUN, vol. 67, 1999, pages 5361 - 5366
BERGMAN, M.; G. DEL PRETE; Y. VAN KOOYK; B. APPELMELK: "Helicobacter pylori phase variation, immune modulation and gastric autoimmunity", NAT REV MICROBIOL, vol. 4, 2006, pages 151 - 159
BODE, L.: "Recent advances on structure, metabolism, and function of human milk oligosaccharides", J NUTR, vol. 136, 2006, pages 2127 - 2130
COPPA, G. V.; L. ZAMPINI; T. GALEAZZI; B. FACINELLI; L. FERRANTE; R. CAPRETTI; G. ORAZIO: "Human milk oligosaccharides inhibit the adhesion to Caco-2 cells of diarrheal pathogens", ESCHERICHIA COLI, VIBRIO CHOLERAE, AND SALMONELLA FYRIS. PEDIATR RES, vol. 59, 2006, pages 377 - 382, XP009156919, DOI: doi:10.1203/01.pdr.0000200805.45593.17
COYNE MICHAET J ET AL: "Human symbionts use a host-like pathway for surface fucosylation", SCIENCE (WASHINGTON D C), vol. 307, no. 5716, 18 March 2005 (2005-03-18), pages 1778 - 1781, XP001539269, ISSN: 0036-8075 *
COYNE, M. J.; B. REINAP; M. M. LEE; L. E. COMSTOCK: "Human symbionts use a host-like pathway for surface fucosylation", SCIENCE, vol. 307, 2005, pages 1778 - 1781, XP001539269, DOI: doi:10.1126/science.1106469
CRANE, J. K.; S. S. AZAR; A. STAM; D. S. NEWBURG: "Oligosaccharides from human milk block binding and activity of the Escherichia coli heat-stable enterotoxin (STa) in T84 intestinal cells", J NUTR, vol. 124, 1994, pages 2358 - 2364
CRAVIOTO, A.; A. TELLO; H. VILLAFAN; J. RUIZ; S. DEL VEDOVO; J. R. NEESER: "Inhibition of localized adhesion of enteropathogenic Escherichia coli to HEp-2 cells by immunoglobulin and oligosaccharide fractions of human colostrum and breast milk", J INFECT DIS, vol. 163, 1991, pages 1247 - 1255, XP000940484
DATSENKO, K. A.; B. L. WANNER: "One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products", PROC NATL ACAD SCI U SA, vol. 97, 2000, pages 6640 - 6645, XP002210218, DOI: doi:10.1073/pnas.120163297
DOWER, W. J.; J. F. MILLER; C. W. RAGSDALE: "High efficiency transformation of E. coli by high voltage electroporation", NUCLEIC ACIDS RES, vol. 16, 1988, pages 6127 - 6145, XP001084265
DUMON, C.; B. PRIEM; S. L. MARTIN; A. HEYRAUD; C. BOSSO; E. SAMAIN: "In vivo fucosylation of lacto-N-neotetraose and lacto-N-neohexaose by heterologous expression of Helicobacter pylori alpha-1,3 fucosyltransferase in engineered", ESCHERICHIA COLI. GLYCOCONJ J, vol. 18, 2001, pages 465 - 474, XP002380631, DOI: doi:10.1023/A:1016086118274
DUMON, C.; C. BOSSO; J. P. UTILLE; A. HEYRAUD; E. SAMAIN: "Production of Lewis x tetrasaccharides by metabolically engineered", ESCHERICHIA COLI. CHEMBIOCHEM, vol. 7, 2006, pages 359 - 365, XP055100092, DOI: doi:10.1002/cbic.200500293
DUMON, C.; E. SAMAIN; B. PRIEM: "Assessment of the two Helicobacter pylori alpha-1,3-fucosyltransferase ortholog genes for the large-scale synthesis of LewisX human milk oligosaccharides by metabolically engineered Escherichia coli", BIOTECHNOL PROG, vol. 20, 2004, pages 412 - 419
GE, Z.; N. W. CHAN; M. M. PALCIC; D. E. TAYLOR: "Cloning and heterologous expression of an alphal,3-fucosyltransferase gene from the gastric pathogen Helicobacter pylori", J BIOL CHEM, vol. 272, 1997, pages 21357 - 21363, XP002085413, DOI: doi:10.1074/jbc.272.34.21357
GNOTH, M. J.; S. RUDLOFF; C. KUNZ; R. K. KINNE: "Investigations of the in vitro transport of human milk oligosaccharides by a Caco-2 monolayer using a novel high performance liquid chromatography-mass spectrometry technique", J BIOL CHEM, vol. 276, 2001, pages 34363 - 34370
GRANT, W. D.; I. W. SUTHERLAND; J. F. WILKIMSON: "Control of colanic acid synthesis", J BACTERIOL, vol. 103, 1970, pages 89 - 96
HINDERLICH S; BERGER, M.; BLUME, A.; CHEN, H.; GHADERI, D.; BAUER, C.: "Identification of human L-fucose kinase amino acid sequence", BIOCHEM. BIOPHYS. RES. COMMUN, vol. 294, 2002, pages 650 - 654
KOIZUMI S ET AL: "LARGE-SCALE PRODUCTION OF GDP-FUCOSE AND LEWIS X BY BACTERIAL COUPLING", JOURNAL OF INDUSTRIAL MICROBIOLOGY AND BIOTECHNOLOGY, BASINGSTOKE, GB, vol. 25, no. 4, 1 October 2000 (2000-10-01), pages 213 - 217, XP008015256, ISSN: 1367-5435 *
KOIZUMI, S.; T. ENDO; K. TABATA; H. NAGANO; J. OHNISHI; A. OZAKI: "Large-scale production of GDP-fucose and Lewis X by bacterial coupling", J IND MICROBIOL BIOTECHNOL, vol. 25, 2000, pages 213 - 217, XP008015256, DOI: doi:10.1038/sj.jim.7000055
KRETZSCHMAR, G.; W. STAHL: "Large scale synthesis of linker-modified sialyl-Lewis(X), Lewis(X) and N-acetyllactosamine", TETRAHEDRON, vol. 54, 1998, pages 6341 - 6358
KUNZ, C.; S. RUDLOFF: "Health promoting aspects of milk oligosaccharides", INT DAIRY J, vol. 16, 2006, pages 1341 - 1346, XP024963268, DOI: doi:10.1016/j.idairyj.2006.06.020
LI, M.; X. W. LIU; J. SHAO; J. SHEN; Q. JIA; W. YI; J. K. SONG; R. WOODWARD; C. S. CHOW; P. G. WANG: "Characterization of a novel alphal,2-fucosyltransferase of Escherichia coli O128:b12 and functional investigation of its common motif", BIOCHEMISTRY, vol. 47, 2008, pages 378 - 387, XP055252068, DOI: doi:10.1021/bi701345v
MA BING ET AL: "Fucosylation in prokaryotes and eukaryotes", GLYCOBIOLOGY, OXFORD UNIVERSITY PRESS, US, vol. 16, no. 12, 1 December 2006 (2006-12-01), pages 158R - 184R, XP002490822, ISSN: 0959-6658 *
MA, B.; J. L. SIMALA-GRANT; D. E. TAYLOR: "Fucosylation in prokaryotes and eukaryotes", GLYCOBIOLOGY, vol. 16, 2006, pages 158R - 184R, XP002490822, DOI: doi:10.1093/glycob/cwl040
MARTIN, S. L.; M. R. EDBROOKE; T. C. HODGMAN; D. H. VAN DEN EIJNDEN; M. I. BIRD: "Lewis X biosynthesis in Helicobacter pylori. Molecular cloning of an alpha(1,3)-fucosyltransferase gene", J BIOL CHEM, vol. 272, 1997, pages 21349 - 21356
NEWBURG, D. S.: "Bioactive components of human milk: evolution, efficiency, and protection", ADV EXP MED BIOL, vol. 501, 2001, pages 3 - 10
NEWBURG, D. S.; S. H. NEUBAUER: "Handbook of Milk Composition", 1995, ACADEMIC PRESS, article "Carbohydrates in milk", pages: 273 - 349
NIMTZ M ET AL: "IN VITRO ALPHA1-3 OR ALPHA1-4 FUCOSYLATION OF TYPE I AND II OLIGOSACCHARIDES WITH SECRETED FORMS OF RECOMBINANT HUMAN FUCOSYLTRANSFERASES III AND VI", GLYCOCONJUGATE JOURNAL, CHAPMAN & HALL, GB, vol. 15, 1 January 1998 (1998-01-01), pages 873 - 883, XP002950635, ISSN: 0282-0080 *
PARK, S.H.; I. PASTUSZAK; R. DRAKE; A.D. ELBEIN: "Purification to apparent homogenicity and properties of pig kidney L-fucose kinase", J BIOL CHEM, vol. 273, 1998, pages 5685 - 5691, XP002919201, DOI: doi:10.1074/jbc.273.10.5685
RASKO, D. A.; G. WANG; M. M. PALCIC; D. E. TAYLOR: "Cloning and characterization of the alpha(1,3/4) fucosyltransferase of Helicobacter pylori", J BIOL CHEM, vol. 275, 2000, pages 4988 - 4994, XP002992989, DOI: doi:10.1074/jbc.275.7.4988
RUIZ-PALACIOS, G. M.; L. E. CERVANTES; P. RAMOS; B. CHAVEZ-MUNGUIA; D. S. NEWBURG: "Campylobacter jejuni binds intestinal H(O) antigen (Fuc alpha 1, 2Gal beta 1, 4GIcNAc), and fucosyloligosaccharides of human milk inhibit its binding and infection", J BIOL CHEM, vol. 278, 2003, pages 14112 - 14120
SAMBROOK, J.; D. W. RUSSELL: "Molecular cloning: a laboratory manual", 2001, COLD SPRING HARBOR LABORATORY PRESS
STUMPP, T.; B. WILMS; J. ALTENBUCHNER: "Ein neues L-Rhamnose- induzierbares Expressionssystem fur Escherichia coli", BIOSPEKTRUM, vol. 6, 2000, pages 33 - 36, XP009004621
WANG, G.; D. A. RASKO; R. SHERBURNE; D. E. TAYLOR: "Molecular genetic basis for the variable expression of Lewis Y antigen in Helicobacter pylori: analysis of the alpha (1,2) fucosyltransferase gene", MOL MICROBIOL, vol. 31, 1999, pages 1265 - 1274, XP002938950, DOI: doi:10.1046/j.1365-2958.1999.01268.x
WANG, G.; Z. GE; D. A. RASKO; D. E. TAYLOR: "Lewis antigens in Helicobacter pylori: biosynthesis and phase variation", MOL MICROBIOL, vol. 36, 2000, pages 1187 - 1196, XP002408490, DOI: doi:10.1046/j.1365-2958.2000.01934.x

Cited By (119)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8652808B2 (en) 2009-06-08 2014-02-18 Jennewein Biotechnologie Gmbh Method for the production of fucosyllactose in bacterial cells
US9512433B2 (en) 2009-06-08 2016-12-06 Jennewein Biotechnologie Gmbh Method for the production of fucosyllactose in bacterial cells
AU2015215937B2 (en) * 2010-07-12 2017-03-16 Inbiose N.V. Metabolically engineered organisms for the production of added value bio-products
CN103201380B (en) * 2010-10-11 2018-07-24 詹尼温生物技术有限责任公司 New Fucosyltransferases and Their Applications
CN102120999A (en) * 2010-12-17 2011-07-13 天津科技大学 Method for synthesizing human milk fucosylation oligosaccharide by using genetic engineering strain through coupling and fermenting
US11337990B2 (en) 2010-12-31 2022-05-24 Abbott Laboratories Human milk oligosaccharides to promote growth of beneficial bacteria
US11701376B2 (en) 2010-12-31 2023-07-18 Abbott Laboratories Nutritional compositions comprising human milk oligosaccharides and nucleotides and uses thereof for treating and/or preventing enteric viral infection
US8703737B2 (en) 2010-12-31 2014-04-22 Abbott Laboratories Nutritional formulations including human milk oligosaccharides and antioxidants and uses thereof
US11197875B2 (en) 2010-12-31 2021-12-14 Abbott Laboratories Nutritional formulations including human milk oligosaccharides and antioxidants and uses thereof
US11633412B2 (en) 2010-12-31 2023-04-25 Abbott Laboratories Nutritional formulations including human milk oligosaccharides and antioxidants and uses thereof
US10471081B2 (en) 2010-12-31 2019-11-12 Abbott Laboratories Methods for decreasing the incidence of necrotizing enterocolitis in infants, toddlers, or children using human milk oligosaccharides
US10709720B2 (en) 2010-12-31 2020-07-14 Abbott Laboratories Human milk oligosaccharides for modulating inflammation
US8802650B2 (en) 2010-12-31 2014-08-12 Abbott Laboratories Methods of using human milk oligosaccharides for improving airway respiratory health
US12594288B2 (en) 2010-12-31 2026-04-07 Abbott Laboratories Nutritional compositions comprising human milk oligosaccharides and nucleotides and uses thereof for treating and/or preventing enteric viral infection
US12343355B2 (en) 2010-12-31 2025-07-01 Abbott Laboratories Methods for decreasing the incidence of necrotizing enterocolitis in infants, toddlers, or children using human milk oligosaccharides
US10369164B2 (en) 2010-12-31 2019-08-06 Abbott Laboratories Nutritional formulations including human milk oligosaccharides and antioxidants and uses thereof
US12280069B2 (en) 2010-12-31 2025-04-22 Abbott Laboratories Methods of using human milk oligosaccharides for improving airway respiratory health
US11975014B2 (en) 2010-12-31 2024-05-07 Abbott Laboratories Nutritional formulations including human milk oligosaccharides and antioxidants and uses thereof
US9283240B2 (en) 2010-12-31 2016-03-15 Abbott Laboratories Human milk oligosaccharides for modulating inflammation
US11311562B2 (en) 2010-12-31 2022-04-26 Abbott Laboratories Methods for reducing the incidence of oxidative stress using human milk oligosaccharides, vitamin c and anti-inflammatory agents
US11524018B2 (en) 2010-12-31 2022-12-13 Abbott Laboratories Nutritional formulations including human milk oligosaccharides and antioxidants and uses thereof
US10813940B2 (en) 2010-12-31 2020-10-27 Abbott Laboratories Nutritional compositions comprising human milk oligosaccharides and nucleotides and uses thereof for treating and/or preventing enteric viral infection
US11179406B2 (en) 2010-12-31 2021-11-23 Abbott Laboratories Methods for decreasing the incidence of necrotizing enterocolitis in infants, toddlers, or children using human milk oligosaccharides
US9539269B2 (en) 2010-12-31 2017-01-10 Abbott Laboratories Methods for decreasing the incidence of necrotizing enterocolitis in infants, toddlers, or children using human milk oligosaccharides
EP3473257A1 (en) * 2010-12-31 2019-04-24 Abbott Laboratories Methods of using human milk oligosaccharides for improving airway respiratory health
US11654156B2 (en) 2010-12-31 2023-05-23 Abbott Laboratories Nutritional formulations including human milk oligosaccharides and antioxidants and uses thereof
US11207335B2 (en) 2010-12-31 2021-12-28 Abbott Laboratories Methods of using human milk oligosaccharides for improving airway respiratory health
US11690859B2 (en) 2010-12-31 2023-07-04 Abbott Laboratories Methods for decreasing the incidence of necrotizing enterocolitis in infants, toddlers, or children using human milk oligosaccharides
US9763970B2 (en) 2010-12-31 2017-09-19 Abbott Laboratories Nutritional compositions comprising human milk oligosaccharides and nucleotides and uses thereof for treating and/or preventing enteric viral infection
US9795623B2 (en) 2010-12-31 2017-10-24 Abbott Laboratories Methods for reducing the incidence of oxidative stress using human milk oligosaccharides, vitamin C and anti-inflammatory agents
US9808474B2 (en) 2010-12-31 2017-11-07 Abbott Laboratories Nutritional formulations including human milk oligosaccharides and antioxidants and uses thereof
WO2012092154A1 (en) * 2010-12-31 2012-07-05 Abbott Laboratories Methods of using human milk oligosaccharides for improving airway respiratory health
US10973837B2 (en) 2010-12-31 2021-04-13 Abbott Laboratories Nutritional formulations including human milk oligosaccharides and antioxidants and uses thereof
US11464793B2 (en) 2010-12-31 2022-10-11 Abbott Laboratories Nutritional formulations including human milk oligosaccharides and antioxidants and uses thereof
US9611285B2 (en) * 2011-01-20 2017-04-04 Jennewein Biotechnologie Gmbh Fucosyltransferases and their applications
US20140024820A1 (en) * 2011-01-20 2014-01-23 Jennewein Biotechnologie Gmbh Novel fucosyltransferases and their applications
JP2017093432A (en) * 2011-02-16 2017-06-01 グリコシン リミテッド ライアビリティー カンパニー Biosynthesis of human milk oligosaccharides in engineered bacteria
US11028419B2 (en) 2011-02-16 2021-06-08 Glycosyn LLC Biosynthesis of human milk oligosaccharides in engineered bacteria
US9970018B2 (en) 2011-02-16 2018-05-15 Glycosyn LLC Biosynthesis of human milk oligosaccharides in engineered bacteria
JP2021007417A (en) * 2011-02-16 2021-01-28 グリコシン リミテッド ライアビリティー カンパニー Biosynthesis of human milk oligosaccharides in engineered bacteria
US10815511B2 (en) 2011-02-16 2020-10-27 Glycosyn LLC Biosynthesis of human milk oligosaccharides in engineered bacteria
US10487346B2 (en) 2011-02-16 2019-11-26 Glycosyn LLC Biosynthesis of human milk oligosaccharides in engineered bacteria
JP2012191905A (en) * 2011-03-17 2012-10-11 National Institute Of Advanced Industrial Science & Technology Synthesis method of sugar nucleotide using yeast
WO2012127045A1 (en) 2011-03-23 2012-09-27 Glycode A yeast recombinant cell capable of producing gdp-fucose
WO2013025104A1 (en) 2011-08-16 2013-02-21 Friesland Brands B.V. Nutritional compositions comprising human milk oligosaccharides and uses thereof
US10639319B2 (en) 2011-08-29 2020-05-05 Abbott Laboratories Human milk oligosaccharides for preventing injury and/or promoting healing of the gastrointestinal tract
JP2021121215A (en) * 2011-12-16 2021-08-26 インビオース エヌ.ヴェ.Inbiose N.V. Mutant microorganisms for synthesizing cholanoic acid, mannosylated and / or fucosylated oligosaccharides
AU2013293116B2 (en) * 2012-07-25 2019-06-06 Glycosyn LLC Alpha (1,2) fucosyltransferases suitable for use in the production of fucosylated oligosaccharides
US10273516B2 (en) 2012-07-25 2019-04-30 Glycosyn LLC Alpha (1,2) fucosyltransferases suitable for use in the production of fucosylated oligosaccharides
EP3587567A1 (en) * 2012-07-25 2020-01-01 Glycosyn LLC Alpha (1,2) fucosyltransferases suitable for use in the production of fucosylated oligosaccharides
US11236376B2 (en) 2012-07-25 2022-02-01 Glycosyn LLC Alpha (1,2) fucosyltransferases suitable for use in the production of fucosylated oligosaccharides
EP2877574A4 (en) * 2012-07-25 2016-07-20 Glycosyn LLC ALPHA (1,2) FUCOSYLTRANSFERASES SUITABLE FOR USE IN THE PRODUCTION OF FUCOSYLATED OLIGOSACCHARIDES
US9816122B2 (en) 2012-09-25 2017-11-14 Glycom A/S Glycoconjugate synthesis
KR101812018B1 (en) 2012-10-31 2018-01-25 젠와인 바이오테크놀로지 게엠바하 Process for producing monosaccharides
US9938549B2 (en) 2012-10-31 2018-04-10 Jennewein Biotechnologie Gmbh Process for producing monosaccharides
WO2014067696A1 (en) * 2012-10-31 2014-05-08 Jennewein Biotechnologie Gmbh Process for producing monosacchcarides
EP2728009A1 (en) * 2012-10-31 2014-05-07 Jennewein Biotechnologie GmbH Process for producing monosaccharides
US9834574B2 (en) 2012-11-13 2017-12-05 Glycom A/S Crystalline 3-O-fucosyllactose
EP2943500A4 (en) * 2012-11-13 2016-06-22 Glycom As 3-O-FUCOSYLLACTOSE CRYSTALLINE
WO2014075680A1 (en) * 2012-11-13 2014-05-22 Glycom A/S Crystalline 3-o-fucosyllactose
WO2014086373A1 (en) 2012-12-07 2014-06-12 Glycom A/S Crystallisation of human milk oligosaccharides (hmo)
WO2015032412A1 (en) 2013-09-06 2015-03-12 Glycom A/S Fermentative production of oligosaccharides
WO2015032413A1 (en) * 2013-09-06 2015-03-12 Glycom A/S Fermentative production of oligosaccharides
US10364449B2 (en) 2013-09-06 2019-07-30 Glycom A/S Fermentative production of oligosaccharides
US9902984B2 (en) 2013-09-06 2018-02-27 Glycom A/S Fermentative production of oligosaccharides
EP2845905A1 (en) 2013-09-10 2015-03-11 Jennewein Biotechnologie GmbH Production of oligosaccharides
EP3572520A1 (en) 2013-09-10 2019-11-27 Jennewein Biotechnologie GmbH Production of oligosaccharides
EP3572521A1 (en) 2013-09-10 2019-11-27 Jennewein Biotechnologie GmbH Production of oligosaccharides
WO2015188834A1 (en) 2014-06-11 2015-12-17 Glycom A/S Separation of 2'-o-fucosyllactose from fermentation broth
WO2015197082A1 (en) 2014-06-27 2015-12-30 Glycom A/S Oligosaccharide production
US10731193B2 (en) 2014-06-27 2020-08-04 Glycom A/S Oligosaccharide production
EP4477741A2 (en) 2014-06-27 2024-12-18 Glycom A/S Oligosaccharide production
US11293042B2 (en) 2014-06-27 2022-04-05 Glycom A/S Oligosaccharide production
US11926858B2 (en) 2014-06-27 2024-03-12 Glycom A/S Oligosaccharide production
US12060594B2 (en) 2014-12-16 2024-08-13 Glycom A/S Separation of 2′-FL from a fermentation broth
WO2016095924A1 (en) 2014-12-16 2016-06-23 Glycom A/S Separation of 2'-fl from a fermentation broth
US10676770B2 (en) 2014-12-16 2020-06-09 Glycom A/S Separation of 2′-FL from a fermentation broth
EP4151645A2 (en) 2014-12-16 2023-03-22 Glycom A/S Separation of 2'-fl from a fermentation broth
US10829508B2 (en) 2015-12-18 2020-11-10 Glycom A/S Fermentative production of oligosaccharides
WO2017101958A1 (en) 2015-12-18 2017-06-22 Glycom A/S Fermentative production of oligosaccharides
WO2018041803A1 (en) 2016-08-31 2018-03-08 Prismagen Gmbh Use of human milk oligosaccharides in calves fattening
WO2018077892A1 (en) * 2016-10-29 2018-05-03 Jennewein Biotechnologie Gmbh Improved process for the production of fucosylated oligosaccharides
US11898185B2 (en) 2016-10-29 2024-02-13 Chr Hansen Hmo Gmbh Process for the production of fucosylated oligosaccharides
EP3315610A1 (en) * 2016-10-29 2018-05-02 Jennewein Biotechnologie GmbH Improved process for the production of fucosylated oligosaccharides
US11142541B2 (en) 2017-06-30 2021-10-12 Glycom A/S Purification of oligosaccharides
US12065462B2 (en) 2017-06-30 2024-08-20 Glycom A/S Purification of oligosaccharides
US11214588B2 (en) 2017-06-30 2022-01-04 Glycom A/S Synthesis of oligosaccharides
US11919919B2 (en) 2017-06-30 2024-03-05 Glycom A/S Synthesis of oligosaccharides
US12060593B2 (en) 2017-07-07 2024-08-13 Chr. Hansen HMO GmbH Fucosyltransferases and their use in producing fucosylated oligosaccharides
US11505567B2 (en) 2017-07-12 2022-11-22 Glycom A/S Amorphous mixture comprising a neutral mono- or oligosaccharide and an acidic non-carbohydrate component
US12054513B2 (en) 2017-07-12 2024-08-06 Glycom A/S Amorphous mixture comprising a neutral mono- or oligosaccharide and an acidic non-carbohydrate component
US11939351B2 (en) 2017-07-12 2024-03-26 Glycom A/S Amorphous mixture comprising a neutral mono- or oligosaccharide and an acidic non-carbohydrate component
WO2019071021A2 (en) 2017-10-04 2019-04-11 The Regents Of The University Of California Immunomodulatory oligosaccharides
US11732282B2 (en) 2017-11-21 2023-08-22 Chr. Hansen HMO GmbH Process for the purification of L-fucose from a fermentation broth
WO2019101629A1 (en) 2017-11-21 2019-05-31 Jennewein Biotechnologie Gmbh Process for the purification of l-fucose from a fermentation broth
WO2019110801A1 (en) 2017-12-08 2019-06-13 Jennewein Biotechnologie Gmbh Spray-dried 3-fucosyllactose
EP3494804A1 (en) 2017-12-08 2019-06-12 Jennewein Biotechnologie GmbH Spray-dried 3-fucosyllactose
US11582994B2 (en) 2017-12-08 2023-02-21 Chr. Hansen HMO GmbH Spray-dried 3-fucosyllactose
EP3494806A1 (en) 2017-12-08 2019-06-12 Jennewein Biotechnologie GmbH Spray-dried lacto-n-fucopentaose
WO2019110800A1 (en) 2017-12-08 2019-06-13 Jennewein Biotechnologie Gmbh Spray-dried mixture of human milk oligosacchrides
EP3494805A1 (en) 2017-12-08 2019-06-12 Jennewein Biotechnologie GmbH Spray-dried tetrasaccharides
WO2019110804A1 (en) 2017-12-08 2019-06-13 Jennewein Biotechnologie Gmbh Spray-dried tetrasaccharides
WO2019110803A1 (en) 2017-12-08 2019-06-13 Jennewein Biotechnologie Gmbh Spray-dried sialyllactose
WO2019110806A1 (en) 2017-12-08 2019-06-13 Jennewein Biotechnologie Gmbh Spray-dried lacto-n-fucopentaose
EP3494807A1 (en) 2017-12-11 2019-06-12 Jennewein Biotechnologie GmbH Spray-dried sialyllactose
EP3524067A1 (en) 2018-02-08 2019-08-14 Jennewein Biotechnologie GmbH Spray-dried mixture of human milk oligosaccharides
US11685759B2 (en) 2018-10-18 2023-06-27 Basf Se Method for obtaining crystalline 2′-fucosyllactose
WO2020079146A1 (en) 2018-10-18 2020-04-23 Basf Se Crystalline form ii of 2'-o-fucosyllactose, process for its preparation, nutritional, cosmetic or pharmaceutical formulation containing the same
WO2020079114A1 (en) 2018-10-18 2020-04-23 Basf Se Method for obtaining crystalline 2'-fucosyllactose
WO2021094133A2 (en) 2019-11-13 2021-05-20 Basf Se Enzymatic hydrolysis of 2',3-difucosyllactose
EP3848471A1 (en) 2020-01-10 2021-07-14 Chr. Hansen HMO GmbH Sequential fermentative production of oligosaccharides
WO2021181349A1 (en) 2020-03-12 2021-09-16 Glycom A/S Crystallization of 2'-fl
US12479878B2 (en) 2020-03-12 2025-11-25 Glycom A/S Crystallization of 2′-FL
WO2022013143A1 (en) 2020-07-13 2022-01-20 Glycom A/S Oligosaccharide production
WO2022243311A1 (en) 2021-05-17 2022-11-24 Dsm Ip Assets B.V. Microbial strain expressing an invertase/sucrose hydrolase
WO2022243310A1 (en) 2021-05-17 2022-11-24 Dsm Ip Assets B.V. Novel technology to enable sucrose utilization in strains for biosyntetic production
US12534701B2 (en) 2021-05-17 2026-01-27 Dsm Ip Assets B.V. Microbial strain expressing an invertase/sucrose hydrolase
WO2022242860A1 (en) 2021-05-20 2022-11-24 Chr. Hansen A/S Sequential fermentative production of oligosaccharides
WO2024046993A1 (en) 2022-08-29 2024-03-07 Chr. Hansen A/S Process for the production of a purified human milk oligosaccharide derived from a microbial fermentation process

Also Published As

Publication number Publication date
MY183602A (en) 2021-03-02
IN2011MU01050A (en) 2011-12-30
MX325472B (en) 2014-11-20
BRPI0923433A2 (en) 2015-08-11
HK1159173A1 (en) 2012-07-27
CN102257128A (en) 2011-11-23
EP2379708A1 (en) 2011-10-26
CO6362044A2 (en) 2012-01-20
AU2009329543B2 (en) 2015-04-16
SG171814A1 (en) 2011-07-28
RU2584599C2 (en) 2016-05-20
US20190382737A1 (en) 2019-12-19
JP2012512643A (en) 2012-06-07
RU2011129780A (en) 2013-01-27
NZ593448A (en) 2012-06-29
AU2009329543A1 (en) 2010-06-24
EP2379708B1 (en) 2016-04-27
US11390855B2 (en) 2022-07-19
BRPI0923433B1 (en) 2021-06-01
JP5726751B2 (en) 2015-06-03
MX2011006371A (en) 2011-09-27
US20110300584A1 (en) 2011-12-08

Similar Documents

Publication Publication Date Title
US11390855B2 (en) Synthesis of fucosylated compounds
JP7362831B2 (en) Production of human milk oligosaccharides in a microbial host with modified uptake/excretion
RU2517602C2 (en) Hmo synthesis
JP2024010049A (en) Sialyltransferase and its use in the production of sialylated oligosaccharides
Sugita et al. Transporter engineering enables the efficient production of lacto-N-triose II and lacto-N-tetraose in Escherichia coli
JP7565801B2 (en) Fermentative production of sialylated sugars
Li et al. Pathway optimization of 2′-fucosyllactose production in engineered Escherichia coli
AU780290B2 (en) Method for producing oligopolysaccharides
WO2002077165A2 (en) Glycoconjugate synthesis using a pathway-engineered organism
AU2015315110A1 (en) Alpha (1,3) fucosyltransferases for use in the production of fucosylated oligosaccharides
WO2022242860A1 (en) Sequential fermentative production of oligosaccharides
HK1159173B (en) Synthesis of fucosylated compounds
WO2025045721A1 (en) N-acetylglucosaminyltransferase enzymes with altered substrate specificity and their use in fermentative oligosaccharide production
CN117355613A (en) Method for generating HMO blend distributions with LNFP-I and 2’-FL as main compounds
진영욱 Production of 2-fucosyllactose, a human milk oligosaccharide by metabolically engineered escherichia coli
HK1163736B (en) Hmo synthesis
HK1163736A (en) Hmo synthesis

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200980151270.X

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09797036

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2009329543

Country of ref document: AU

Ref document number: 1050/MUMNP/2011

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 593448

Country of ref document: NZ

Ref document number: MX/A/2011/006371

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2009329543

Country of ref document: AU

Date of ref document: 20091218

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 12011501243

Country of ref document: PH

WWE Wipo information: entry into national phase

Ref document number: 13140548

Country of ref document: US

Ref document number: 11076212

Country of ref document: CO

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2011541476

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2011129780

Country of ref document: RU

Ref document number: 2009797036

Country of ref document: EP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: PI0923433

Country of ref document: BR

ENP Entry into the national phase

Ref document number: PI0923433

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20110615