WO2010062707A1 - Methods and compositions for producing carbon-based products of interest in micro-organisms - Google Patents

Methods and compositions for producing carbon-based products of interest in micro-organisms Download PDF

Info

Publication number
WO2010062707A1
WO2010062707A1 PCT/US2009/062884 US2009062884W WO2010062707A1 WO 2010062707 A1 WO2010062707 A1 WO 2010062707A1 US 2009062884 W US2009062884 W US 2009062884W WO 2010062707 A1 WO2010062707 A1 WO 2010062707A1
Authority
WO
WIPO (PCT)
Prior art keywords
accession number
seq
gene
spp
host cell
Prior art date
Application number
PCT/US2009/062884
Other languages
French (fr)
Inventor
David Arthur Berry
Dan Eric Robertson
Brian Green
Frank Anthony Skraly
Sriram Kosuri
Nikos Reppas
Original Assignee
Joule Unlimited, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Joule Unlimited, Inc. filed Critical Joule Unlimited, Inc.
Publication of WO2010062707A1 publication Critical patent/WO2010062707A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C12P7/065—Ethanol, i.e. non-beverage with microorganisms other than yeasts
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Definitions

  • This invention generally relates to genes useful in producing carbon-based products of interest in host cells.
  • the invention also relates to methods for producing fuels and chemicals through engineering metabolic pathways in photosynthetic and non- photosynthetic organisms.
  • the invention relates to a metabolic system and methods employing such systems in the production of bio fuels and chemicals.
  • Various microorganisms are genetically engineered to use pyruvate decarboxylase, alcohol dehydrogenase and/or a bi-functional alcohol dehydrogenase for the production of ethanol.
  • the invention therefore, provides isolated polynucleotides comprising or consisting of nucleic acid sequences selected from the group consisting of coding sequences for an alcohol dehydrogenase gene, a pyruvate decarboxylase gene, and a bi-functional alcohol dehydrogenase gene, codon/expression optimized variants for these nucleic acid sequences and related nucleic acid sequences and fragments. Also provided are vectors and host cells comprising these isolated polynucleotides.
  • the invention further provides isolated polypeptides comprising or consisting of polypeptide sequences selected from the group consisting of sequences encoded by an alcohol dehydrogenase gene, a pyruvate decarboxylase gene, and a bi-functional alcohol dehydrogenase gene, and related polypeptide sequences, fragments and fusions.
  • Antibodies that specifically bind to the isolated polypeptides of the invention are also provided.
  • the invention also provides methods for expressing in a host cell a heterologous nucleic acid sequence encoding improved alcohol dehydrogenase activity of the alcohol dehydrogenase gene, improved pyruvate decarboxylase activity of the pyruvate decarboxylase gene, and/or improved bi-functional alcohol dehydrogenase activity of the bi- functional alcohol dehydrogenase gene.
  • the invention also provides coding sequences for the alcohol dehydrogenase gene, the pyruvate decarboxylase gene, and the bi-functional alcohol dehydrogenase gene, nucleic acid sequences that are a codon optimized coding sequences for the alcohol dehydrogenase gene, the pyruvate decarboxylase gene, and the bi-functional alcohol dehydrogenase gene and related nucleic acid sequences and fragments.
  • the invention described herein provides genes which can be expressed at high levels in a range of organisms that encode enzymes required to decarboxylate pyruvate and reduce acetaldehyde for the production of ethanol and other carbon based products of interest.
  • organisms such as a recombinant or ethanologenic bacterium (for example, cyanobacteria) are genetically modified to optimize production of ethanol using light, water and carbon dioxide.
  • microorganisms are used to produce ethanol using a renewable food source (for example, exogenous biomass such as fermentable sugars).
  • nucleic acid refers to a polymeric form of nucleotides of at least 10 bases in length.
  • the term includes DNA molecules (e.g., cDNA or genomic or synthetic DNA) and RNA molecules (e.g., mRNA or synthetic RNA), as well as analogs of DNA or RNA containing non-natural nucleotide analogs, non-native inter- nucleoside bonds, or both.
  • the nucleic acid can be in any topological conformation. For instance, the nucleic acid can be single-stranded, double-stranded, triple-stranded, quadruplexed, partially double-stranded, branched, hair-pinned, circular, or in a padlocked conformation.
  • nucleic acid comprising SEQ ID NO:1 refers to a nucleic acid, at least a portion of which has either (i) the sequence of SEQ ID NO:1, or (ii) a sequence complementary to SEQ ID NO: 1.
  • the choice between the two is dictated by the context. For instance, if the nucleic acid is used as a probe, the choice between the two is dictated by the requirement that the probe be complementary to the desired target.
  • An "isolated” or “substantially pure” nucleic acid or polynucleotide is one which is substantially separated from other cellular components that naturally accompany the native polynucleotide in its natural host cell, e.g., ribosomes, polymerases and genomic sequences with which it is naturally associated.
  • the term embraces a nucleic acid or polynucleotide that (1) has been removed from its naturally occurring environment, (2) is not associated with all or a portion of a polynucleotide in which the "isolated polynucleotide” is found in nature, (3) is operatively linked to a polynucleotide which it is not linked to in nature, or (4) does not occur in nature.
  • isolated or substantially pure also can be used in reference to recombinant or cloned DNA isolates, chemically synthesized polynucleotide analogs, or polynucleotide analogs that are biologically synthesized by heterologous systems.
  • isolated does not necessarily require that the nucleic acid or polynucleotide so described has itself been physically removed from its native environment.
  • an endogenous nucleic acid sequence in the genome of an organism is deemed “isolated” herein if a heterologous sequence is placed adjacent to the endogenous nucleic acid sequence, such that the expression of this endogenous nucleic acid sequence is altered.
  • a heterologous sequence is a sequence that is not naturally adjacent to the endogenous nucleic acid sequence, whether or not the heterologous sequence is itself endogenous (originating from the same host cell or progeny thereof) or exogenous (originating from a different host cell or progeny thereof).
  • a promoter sequence can be substituted (e.g., by homologous recombination) for the native promoter of a gene in the genome of a host cell, such that this gene has an altered expression pattern.
  • This gene would now become “isolated” because it is separated from at least some of the sequences that naturally flank it.
  • a nucleic acid is also considered “isolated” if it contains any modifications that do not naturally occur to the corresponding nucleic acid in a genome.
  • an endogenous coding sequence is considered “isolated” if it contains an insertion, deletion or a point mutation introduced artificially, e.g., by human intervention.
  • An "isolated nucleic acid” also includes a nucleic acid integrated into a host cell chromosome at a heterologous site and a nucleic acid construct present as an episome.
  • an "isolated nucleic acid” can be substantially free of other cellular material or substantially free of culture medium when produced by recombinant techniques or substantially free of chemical precursors or other chemicals when chemically synthesized.
  • the phrase "degenerate variant" of a reference nucleic acid sequence encompasses nucleic acid sequences that can be translated, according to the standard genetic code, to provide an amino acid sequence identical to that translated from the reference nucleic acid sequence.
  • the term "degenerate oligonucleotide” or “degenerate primer” is used to signify an oligonucleotide capable of hybridizing with target nucleic acid sequences that are not necessarily identical in sequence but that are homologous to one another within one or more particular segments.
  • sequence identity refers to the residues in the two sequences which are the same when aligned for maximum correspondence.
  • the length of sequence identity comparison may be over a stretch of at least about nine nucleotides, usually at least about 20 nucleotides, more usually at least about 24 nucleotides, typically at least about 28 nucleotides, more typically at least about 32 nucleotides, and preferably at least about 36 or more nucleotides.
  • polynucleotide sequences can be compared using FASTA, Gap or Bestfit, which are programs in Wisconsin Package Version 10.0, Genetics Computer Group (GCG), Madison, Wis.
  • FASTA provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. Pearson, Methods Enzymol. 183:63-98 (1990) (hereby incorporated by reference in its entirety).
  • percent sequence identity between nucleic acid sequences can be determined using FASTA with its default parameters (a word size of 6 and the NOPAM factor for the scoring matrix) or using Gap with its default parameters as provided in GCG Version 6.1, herein incorporated by reference.
  • sequences can be compared using the computer program, BLAST (Altschul et al., J. MoI. Biol. 215:403-410 (1990); Gish and States, Nature Genet. 3:266-272 (1993); Madden et al, Meth. Enzymol. 266:131-141 (1996); Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997); Zhang and Madden, Genome Res. 7:649-656 (1997)), especially blastp or tblastn (Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997)).
  • BLAST Altschul et al., J. MoI. Biol. 215:403-410 (1990); Gish and States, Nature Genet. 3:266-272 (1993); Madden et al, Meth. Enzymol. 266:131-141 (1996); Altschul et al., Nucleic Acids Res. 25:3389-340
  • a particular, non- limiting example of a mathematical algorithm utilized for the comparison of sequences is that of Karlin and Altschul (Proc. Natl. Acad. Sci. (1990) USA 87:2264-68; Proc. Natl. Acad. Sci. USA (1993) 90: 5873-77) as used in the NBLAST and XBLAST programs (version 2.0) of Altschul et al. (J. MoI. Biol. (1990) 215:403-10).
  • Gapped BLAST can be utilized as described in Altschul et al. (Nucleic Acids Research (1997) 25(17):3389-3402).
  • the default parameters of the respective programs e.g., XBLAST and NBLAST
  • nucleic acid or fragment thereof indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, preferably at least about 90%, and more preferably at least about 95%, 96%, 97%, 98% or 99% of the nucleotide bases, as measured by any well-known algorithm of sequence identity, such as FASTA, BLAST or Gap, as discussed above.
  • nucleic acid or fragment thereof hybridizes to another nucleic acid, to a strand of another nucleic acid, or to the complementary strand thereof, under stringent hybridization conditions.
  • Stringent hybridization conditions and “stringent wash conditions” in the context of nucleic acid hybridization experiments depend upon a number of different physical parameters. Nucleic acid hybridization will be affected by such conditions as salt concentration, temperature, solvents, the base composition of the hybridizing species, length of the complementary regions, and the number of nucleotide base mismatches between the hybridizing nucleic acids, as will be readily appreciated by those skilled in the art. One having ordinary skill in the art knows how to vary these parameters to achieve a particular stringency of hybridization.
  • “stringent hybridization” is performed at about 25 0 C below the thermal melting point (T m ) for the specific DNA hybrid under a particular set of conditions.
  • “Stringent washing” is performed at temperatures about 5 0 C lower than the T m for the specific DNA hybrid under a particular set of conditions.
  • the T m is the temperature at which 50% of the target sequence hybridizes to a perfectly matched probe.
  • stringent conditions are defined for solution phase hybridization as aqueous hybridization (i.e., free of formamide) in 6xSSC (where 2OxSSC contains 3.0 M NaCl and 0.3 M sodium citrate), 1% SDS at 65 0 C for 8-12 hours, followed by two washes in 0.2xSSC, 0.1% SDS at 65 0 C for 20 minutes. It will be appreciated by the skilled worker that hybridization at 65 0 C will occur at different rates depending on a number of factors including the length and percent identity of the sequences which are hybridizing.
  • a preferred, non-limiting example of stringent hybridization conditions includes hybridization in 4x sodium chloride/sodium citrate (SSC), at about 65-70 0 C (or hybridization in 4x SSC plus 50% formamide at about 42-50 0 C) followed by one or more washes in Ix SSC, at about 65-70 0 C.
  • a preferred, non-limiting example of highly stringent hybridization conditions includes hybridization in Ix SSC, at about 65-70 0 C (or hybridization in Ix SSC plus 50% formamide at about 42-50 0 C) followed by one or more washes in 0.3x SSC, at about 65-70 0 C.
  • a preferred, non-limiting example of reduced stringency hybridization conditions includes hybridization in 4x SSC, at about 50-60 0 C (or alternatively hybridization in 6x SSC plus 50% formamide at about 40-45 0 C) followed by one or more washes in 2x SSC, at about 50-60 0 C. Intermediate ranges e.g., at 65-70 0 C or at 42-50 0 C are also within the scope of the invention.
  • SSPE (Ix SSPE is 0.15 M NaCl, 10 mM NaH 2 PO 4 , and 1.25 mM EDTA, pH 7.4) can be substituted for SSC (Ix SSC is 0.15 M NaCl and 15 mM sodium citrate) in the hybridization and wash buffers; washes are performed for 15 minutes each after hybridization is complete.
  • reagents can be added to hybridization and/or wash buffers.
  • blocking agents including but not limited to, BSA or salmon or herring sperm carrier DNA and/or detergents, including but not limited to, SDS, chelating agents EDTA, Ficoll, PVP and the like can be used.
  • an additional, non-limiting example of stringent hybridization conditions is hybridization in 0.25-0.5M NaH 2 PO 4 , 7% SDS at about 65 0 C, followed by one or more washes at 0.02M NaH 2 PO 4 , 1% SDS at 65 0 C (Church and Gilbert (1984) Proc. Natl. Acad. Sci. USA 81 :1991-1995,) or, alternatively, 0.2x SSC, 1% SDS.
  • the nucleic acids (also referred to as polynucleotides) of this invention may include both sense and antisense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. They may be modified chemically or biochemically or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art.
  • Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, intemucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.) Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions.
  • uncharged linkages e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.
  • Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule.
  • Other modifications can include, for example, analogs in which the ribose ring contains a bridging moiety or other structure such as the modifications found in "locked" nucleic acids.
  • mutated when applied to nucleic acid sequences means that nucleotides in a nucleic acid sequence may be inserted, deleted or changed compared to a reference nucleic acid sequence. A single alteration may be made at a locus (a point mutation) or multiple nucleotides may be inserted, deleted or changed at a single locus. In addition, one or more alterations may be made at any number of loci within a nucleic acid sequence.
  • a nucleic acid sequence may be mutated by any method known in the art including but not limited to mutagenesis techniques such as "error-prone PCR" (a process for performing PCR under conditions where the copying fidelity of the DNA polymerase is low, such that a high rate of point mutations is obtained along the entire length of the PCR product; see, e.g., Leung et al., Technique, 1 :11-15 (1989) and Caldwell and Joyce, PCR Methods Applic.
  • mutagenesis techniques such as "error-prone PCR” (a process for performing PCR under conditions where the copying fidelity of the DNA polymerase is low, such that a high rate of point mutations is obtained along the entire length of the PCR product; see, e.g., Leung et al., Technique, 1 :11-15 (1989) and Caldwell and Joyce, PCR Methods Applic.
  • oligonucleotide-directed mutagenesis a process which enables the generation of site-specific mutations in any cloned DNA segment of interest; see, e.g., Reidhaar-Olson and Sauer, Science 241 :53-57 (1988)).
  • the term "derived from” is intended to include the isolation (in whole or in part) of a polynucleotide segment from an indicated source.
  • the term is intended to include, for example, direct cloning, PCR amplification, or artificial synthesis from, or based on, a sequence associated with the indicated polynucleotide source.
  • gene refers to a nucleotide sequence that can direct synthesis of an enzyme or other polypeptide molecule (e.g., can comprise coding sequences, for example, a contiguous open reading frame (ORF) which encodes a polypeptide) or can itself be functional in the organism.
  • ORF open reading frame
  • a gene in an organism can be clustered within an operon, as defined herein, wherein the operon is separated from other genes and/or operons by intergenic DNA. Individual genes contained within an operon can overlap without intergenic DNA between the individual genes.
  • An "isolated gene,” as described herein, includes a gene which is essentially free of sequences which naturally flank the gene in the chromosomal DNA of the organism from which the gene is derived (i.e., is free of adjacent coding sequences which encode a second or distinct polypeptide or RNA molecule, adjacent structural sequences or the like) and optionally includes 5' and 3' regulatory sequences, for example promoter sequences and/or terminator sequences.
  • an isolated gene includes predominantly coding sequences for a polypeptide.
  • expression when used in relation to the transcription and/or translation of a nucleotide sequence as used herein generally includes expression levels of the nucleotide sequence being enhanced, increased, resulting in basal or housekeeping levels in the host cell, constitutive, attenuated, decreased or repressed.
  • Attenuate generally refers to a functional deletion, including a mutation, partial or complete deletion, insertion, or other variation made to a gene sequence or a sequence controlling the transcription of a gene sequence, which reduces or inhibits production of the gene product, or renders the gene product non- functional. In some instances a functional deletion is described as a knockout mutation. Attenuation also includes amino acid sequence changes by altering the nucleic acid sequence, placing the gene under the control of a less active promoter, down-regulation, expressing interfering RNA, ribozymes or antisense sequences that target the gene of interest, or through any other technique known in the art.
  • the sensitivity of a particular enzyme to feedback inhibition or inhibition caused by a composition that is not a product or a reactant is lessened such that the enzyme activity is not impacted by the presence of a compound.
  • an enzyme that has been altered to be less active can be referred to as attenuated.
  • a “deletion” is the removal of one or more nucleotides from a nucleic acid molecule or one or more amino acids from a protein, the regions on either side being joined together.
  • a “knock-out” is a gene whose level of expression or activity has been reduced to zero. In some examples, a gene is knocked-out via deletion of some or all of its coding sequence. In other examples, a gene is knocked-out via introduction of one or more nucleotides into its open-reading frame, which results in translation of a non-sense or otherwise non- functional protein product.
  • the term "codon usage” is intended to refer to analyzing a nucleic acid sequence to be expressed in a recipient host organism (or acellular extract thereof) for the occurrence and use of preferred codons the host organism transcribes advantageously for optimal nucleic acid sequence transcription.
  • the recipient host may be recombinantly altered with any preferred codon.
  • a particular cell host can be selected that already has superior codon usage, or the nucleic acid sequence can be genetically engineered to change a limiting codon to a non-limiting codon (e.g., by introducing a silent mutation(s)).
  • vector as used herein is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • plasmid refers to a circular double stranded DNA loop into which additional DNA segments may be ligated.
  • Other vectors include cosmids, bacterial artificial chromosomes (BAC) and yeast artificial chromosomes (YAC), fosmids, phage and phagemids.
  • BAC bacterial artificial chromosome
  • YAC yeast artificial chromosomes
  • phage and phagemids a type of vector
  • viral vector wherein additional DNA segments may be ligated into the viral genome (discussed in more detail below).
  • vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., vectors having an origin of replication which functions in the host cell). Other vectors can be integrated into the genome of a host cell upon introduction into the host cell, and are thereby replicated along with the host genome. Moreover, certain preferred vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as “recombinant expression vectors" (or simply "expression vectors").
  • Expression optimization is defined as one or more optional modifications to the nucleotide sequence in the promoter and terminator elements resulting in desired rates and levels of transcription and translation into a protein product encoded by said nucleotide sequence.
  • Expression optimization also includes designing an effectual predicted secondary structure (for example, stem-loop structures and termination sequences) of the messenger ribonucleic acid (mRNA) sequence to promote desired levels of protein production.
  • mRNA messenger ribonucleic acid
  • Other genes and gene combinations essential for the production of a protein may be used, for example genes for proteins in a biosynthetic pathway, required for post-translational modifications or required for a heteromultimeric protein, wherein combinations of genes are chosen for the effect of optimizing expression of the desired levels of protein product.
  • one or more genes optionally may be "knocked-out” or otherwise altered such that lower or eliminated expression of said gene or genes achieves the desired expression levels of protein.
  • expression optimization can be achieved through codon optimization. Codon optimization, as used herein, is defined as modifying a nucleotide sequence for effectual use of host cell bias in relative concentrations of transfer ribonucleic acids (tRNA) such that the desired rate and levels of gene nucleotide sequence translation into a final protein product are achieved, without altering the peptide sequence encoded by the nucleotide sequence.
  • tRNA transfer ribonucleic acids
  • expression control sequence refers to polynucleotide sequences which are necessary to affect the expression of coding sequences to which they are operatively linked.
  • Expression control sequences are sequences which control the transcription, post-transcriptional events and translation of nucleic acid sequences.
  • Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (e.g., ribosome binding sites); sequences that enhance protein stability; and when desired, sequences that enhance protein secretion.
  • control sequences differs depending upon the host organism; in prokaryotes, such control sequences generally include promoter, ribosomal binding site, and transcription termination sequence.
  • control sequences is intended to include, at a minimum, all components whose presence is essential for expression, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences.
  • “Operatively linked” or “operably linked” expression control sequences refers to a linkage in which the expression control sequence is contiguous with the gene of interest to control the gene of interest, as well as expression control sequences that act in trans or at a distance to control the gene of interest.
  • recombinant host cell (or simply “host cell”), as used herein, is intended to refer to a cell into which a recombinant vector has been introduced. It should be understood that such terms are intended to refer not only to the particular subject cell but to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term "host cell” as used herein.
  • a recombinant host cell may be an isolated cell or cell line grown in culture or may be a cell which resides in a living tissue or organism.
  • peptide refers to a short polypeptide, e.g., one that is typically less than about 50 amino acids long and more typically less than about 30 amino acids long.
  • the term as used herein encompasses analogs and mimetics that mimic structural and thus biological function.
  • polypeptide encompasses both naturally-occurring and non-naturally- occurring proteins, and fragments, mutants, derivatives and analogs thereof.
  • a polypeptide may be monomeric or polymeric. Further, a polypeptide may comprise a number of different domains each of which has one or more distinct activities.
  • isolated protein or "isolated polypeptide” is a protein or polypeptide that by virtue of its origin or source of derivation (1) is not associated with naturally associated components that accompany it in its native state, (2) exists in a purity not found in nature, where purity can be adjudged with respect to the presence of other cellular material (e.g., is free of other proteins from the same species) (3) is expressed by a cell from a different species, or (4) does not occur in nature (e.g., it is a fragment of a polypeptide found in nature or it includes amino acid analogs or derivatives not found in nature or linkages other than standard peptide bonds).
  • polypeptide that is chemically synthesized or synthesized in a cellular system different from the cell from which it naturally originates will be “isolated” from its naturally associated components.
  • a polypeptide or protein may also be rendered substantially free of naturally associated components by isolation, using protein purification techniques well known in the art.
  • isolated does not necessarily require that the protein, polypeptide, peptide or oligopeptide so described has been physically removed from its native environment.
  • an isolated or purified polypeptide is substantially free of cellular material or other contaminating polypeptides from the expression host cell from which the polypeptide is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized.
  • an isolated or purified polypeptide has less than about 30% (by dry weight) of contaminating polypeptide or chemicals, more advantageously less than about 20% of contaminating polypeptide or chemicals, still more advantageously less than about 10% of contaminating polypeptide or chemicals, and most advantageously less than about 5% contaminating polypeptide or chemicals.
  • polypeptide fragment refers to a polypeptide that has a deletion, e.g., an amino-terminal and/or carboxy-terminal deletion compared to a full-length polypeptide.
  • the polypeptide fragment is a contiguous sequence in which the amino acid sequence of the fragment is identical to the corresponding positions in the naturally-occurring sequence. Fragments typically are at least 5, 6, 7, 8, 9 or 10 amino acids long, preferably at least 12, 14, 16 or 18 amino acids long, more preferably at least 20 amino acids long, more preferably at least 25, 30, 35, 40 or 45, amino acids, even more preferably at least 50 or 60 amino acids long, and even more preferably at least 70 amino acids long.
  • a “modified derivative” refers to polypeptides or fragments thereof that are substantially homologous in primary structural sequence but which include, e.g., in vivo or in vitro chemical and biochemical modifications or which incorporate amino acids that are not found in the native polypeptide. Such modifications include, for example, acetylation, carboxylation, phosphorylation, glycosylation, ubiquitination, labeling, e.g., with radionuclides, and various enzymatic modifications, as will be readily appreciated by those skilled in the art.
  • a variety of methods for labeling polypeptides and of substituents or labels useful for such purposes are well known in the art, and include radioactive isotopes such as 125 1, 32 P, 35 S, and 3 H, ligands which bind to labeled antiligands (e.g., antibodies), fluorophores, chemiluminescent agents, enzymes, and antiligands which can serve as specific binding pair members for a labeled ligand.
  • the choice of label depends on the sensitivity required, ease of conjugation with the primer, stability requirements, and available instrumentation.
  • Methods for labeling polypeptides are well known in the art. See, e.g., Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992, and Supplements to 2002) (hereby incorporated by reference).
  • thermal stability and “thermostability” are used interchangeably and refer to the ability of an enzyme (e.g., whether expressed in a cell, present in an cellular extract, cell lysate, or in purified or partially purified form) to exhibit the ability to catalyze a reaction at least at about 20 0 C, preferably at about 25°C to 35°C, more preferably at about 37°C or higher, in more preferably at about 50 0 C or higher, and even more preferably at least about 60 0 C or higher.
  • an enzyme e.g., whether expressed in a cell, present in an cellular extract, cell lysate, or in purified or partially purified form
  • chimeric refers to an expressed or translated polypeptide in which a domain or subunit of a particular homologous or non-homologous protein is genetically engineered to be transcribed, translated and/or expressed collinearly in the nucleotide and amino acid sequence of another homologous or non-homologous protein.
  • fusion protein refers to a polypeptide comprising a polypeptide or fragment coupled to heterologous amino acid sequences. Fusion proteins are useful because they can be constructed to contain two or more desired functional elements from two or more different proteins.
  • a fusion protein comprises at least 10 contiguous amino acids from a polypeptide of interest, more preferably at least 20 or 30 amino acids, even more preferably at least 40, 50 or 60 amino acids, yet more preferably at least 75, 100 or 125 amino acids. Fusions that include the entirety of the proteins of the invention have particular utility.
  • the heterologous polypeptide included within the fusion protein of the invention is at least 6 amino acids in length, often at least 8 amino acids in length, and usefully at least 15, 20, and 25 amino acids in length.
  • Fusions that include larger polypeptides, such as an IgG Fc region, and even entire proteins, such as the green fluorescent protein ("GFP") chromophore- containing proteins, have particular utility. Fusion proteins can be produced recombinantly by constructing a nucleic acid sequence which encodes the polypeptide or a fragment thereof in frame with a nucleic acid sequence encoding a different protein or peptide and then expressing the fusion protein. Alternatively, a fusion protein can be produced chemically by crosslinking the polypeptide or a fragment thereof to another protein.
  • GFP green fluorescent protein
  • protomer refers to a polymeric form of amino acids forming a subunit of a larger oligomeric protein structure.
  • Protomers of an oligomeric structure may be identical or non-identical.
  • Protomers can combine to form an oligomeric subunit, which can combine further with other identical or non-identical protomers to form a larger oligomeric protein.
  • antibody refers to a polypeptide, at least a portion of which is encoded by at least one immunoglobulin gene, or fragment thereof, and that can bind specifically to a desired target molecule.
  • the term includes naturally-occurring forms, as well as fragments and derivatives.
  • fragments within the scope of the term "antibody” include those produced by digestion with various proteases, those produced by chemical cleavage and/or chemical dissociation and those produced recombinantly, so long as the fragment remains capable of specific binding to a target molecule.
  • fragments include Fab, Fab', Fv, F(ab')2, and single chain Fv (scFv) fragments.
  • Derivatives within the scope of the term include antibodies (or fragments thereof) that have been modified in sequence, but remain capable of specific binding to a target molecule, including: interspecies chimeric and humanized antibodies; antibody fusions; heteromeric antibody complexes and antibody fusions, such as diabodies (bispecific antibodies), single-chain diabodies, and intrabodies (see, e.g., Intracellular Antibodies: Research and Disease Applications (1998) Marasco,ed., Springer- Verlag New York, Inc.), the disclosure of which is incorporated herein by reference in its entirety).
  • antibodies can be produced by any known technique, including harvest from cell culture of native B lymphocytes, harvest from culture of hybridomas, recombinant expression systems and phage display.
  • non-peptide analog refers to a compound with properties that are analogous to those of a reference polypeptide.
  • a non-peptide compound may also be termed a "peptide mimetic” or a "peptidomimetic.” See, e.g., Jones, Amino Acid and Peptide Synthesis, Oxford University Press (1992); Jung, Combinatorial Peptide and Nonpeptide Libraries: A Handbook, John Wiley (1997); Bodanszky et al., Peptide Chemistry— A Practical Textbook, Springer Verlag (1993); Synthetic Peptides: A Users Guide, (Grant, ed., W. H. Freeman and Co., 1992); Evans et al., J. Med. Chem.
  • a "polypeptide mutant” or “mutein” refers to a polypeptide whose sequence contains an insertion, duplication, deletion, rearrangement or substitution of one or more amino acids compared to the amino acid sequence of a native or wild-type protein.
  • a mutein may have one or more amino acid point substitutions, in which a single amino acid at a position has been changed to another amino acid, one or more insertions and/or deletions, in which one or more amino acids are inserted or deleted, respectively, in the sequence of the naturally-occurring protein, and/or truncations of the amino acid sequence at either or both the amino or carboxy termini.
  • a mutein may have the same but preferably has a different biological activity compared to the naturally-occurring protein.
  • a mutein has at least 85% overall sequence homology to its wild-type counterpart. Even more preferred are muteins having at least 90% overall sequence homology to the wild- type protein.
  • a mutein exhibits at least 95% sequence identity, even more preferably 98%, even more preferably 99% and even more preferably 99.9% overall sequence identity.
  • Sequence homology may be measured by any common sequence analysis algorithm, such as Gap or Bestf ⁇ t.
  • Amino acid substitutions can include those which: (1) reduce susceptibility to proteolysis, (2) reduce susceptibility to oxidation, (3) alter binding affinity for forming protein complexes, (4) alter binding affinity or enzymatic activity, and (5) confer or modify other physicochemical or functional properties of such analogs.
  • Examples of unconventional amino acids include: 4-hydroxyproline, ⁇ -carboxyglutamate, C-N 5 N 5 N- trimethyllysine, C -N-acetyllysine, O-phosphoserine, N-acetylserine, N-formylmethionine, 3-methylhistidine, 5 -hydroxy Iy sine, N-methylarginine, and other similar amino acids and imino acids (e.g., 4-hydroxyproline).
  • the left-hand end corresponds to the amino terminal end and the right-hand end corresponds to the carboxy-terminal end, in accordance with standard usage and convention.
  • a protein has "homology” or is “homologous” to a second protein if the nucleic acid sequence that encodes the protein has a similar sequence to the nucleic acid sequence that encodes the second protein.
  • a protein has homology to a second protein if the two proteins have "similar” amino acid sequences.
  • homology between two regions of amino acid sequence is interpreted as implying similarity in function.
  • Sequence homology for polypeptides is typically measured using sequence analysis software. See, e.g., the Sequence Analysis Software Package of the Genetics Computer Group (GCG), University of Wisconsin Biotechnology Center, 910 University Avenue, Madison, Wis. 53705. Protein analysis software matches similar sequences using a measure of homology assigned to various substitutions, deletions and other modifications, including conservative amino acid substitutions. For instance, GCG contains programs such as "Gap” and "Bestfit” which can be used with default parameters to determine sequence homology or sequence identity between closely related polypeptides, such as homologous polypeptides from different species of organisms or between a wild-type protein and a mutein thereof. See, e.g., GCG Version 6.1.
  • a preferred algorithm when comparing a particular polypeptide sequence to a database containing a large number of sequences from different organisms is the computer program BLAST (Altschul et al, J. MoI. Biol. 215:403-410 (1990); Gish and States, Nature Genet. 3:266-272 (1993); Madden et al, Meth. Enzymol. 266:131-141 (1996); Altschul et al, Nucleic Acids Res. 25:3389-3402 (1997); Zhang and Madden, Genome Res. 7:649-656 (1997)), especially blastp or tblastn (Altschul et al, Nucleic Acids Res. 25:3389-3402 (1997)).
  • Preferred parameters for BLASTp are: Expectation value: 10 (default); Filter: seg (default); Cost to open a gap: 11 (default); Cost to extend a gap: 1 (default); Max. alignments: 100 (default); Word size: 11 (default); No. of descriptions: 100 (default); Penalty Matrix: BLOWSUM62.
  • the length of polypeptide sequences compared for homology will generally be at least about 16 amino acid residues, usually at least about 20 residues, more usually at least about 24 residues, typically at least about 28 residues, and preferably more than about 35 residues.
  • database searching using amino acid sequences can be measured by algorithms other than blastp known in the art.
  • polypeptide sequences can be compared using FASTA, a program in GCG Version 6.1. FASTA provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. (Pearson, Methods Enzymol.
  • percent sequence identity between amino acid sequences can be determined using FASTA with its default parameters (a word size of 2 and the PAM250 scoring matrix), as provided in GCG Version 6.1, herein incorporated by reference.
  • the sequences are aligned for optimal comparison purposes, and, if necessary, gaps can be introduced in the first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence.
  • gaps can be introduced in the first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence.
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences as evaluated, for example, by calculating # of identical positions/total # of positions x 100. Additional evaluations of the sequence alignment can include a numeric penalty taking into account the number of gaps and size of said gaps necessary to produce an optimal alignment.
  • Specific binding refers to the ability of two molecules to bind to each other in preference to binding to other molecules in the environment.
  • “specific binding” discriminates over adventitious binding in a reaction by at least two-fold, more typically by at least 10-fold, often at least 100-fold.
  • the affinity or avidity of a specific binding reaction, as quantified by a dissociation constant is about 10 "7 M or stronger (e.g., about 10 "8 M, 10 "9 M or even stronger).
  • region refers to a physically contiguous portion of the primary structure of a biomolecule. In the case of proteins, a region is defined by a contiguous portion of the amino acid sequence of that protein.
  • domain refers to a structure of a biomolecule that contributes to a known or suspected function of the biomolecule. Domains may be coextensive with regions or portions thereof; domains may also include distinct, non-contiguous regions of a biomolecule. Examples of protein domains include, but are not limited to, an Ig domain, an extracellular domain, a transmembrane domain, and a cytoplasmic domain.
  • molecule means any compound, including, but not limited to, a small molecule, peptide, protein, sugar, nucleotide, nucleic acid, lipid, etc., and such a compound can be natural or synthetic.
  • substrate affinity refers to the binding kinetics or the kinetics of binding and catalytic turnover, K 1n , the Michaelis-Menten constant as understood by one having skill in the art, for a substrate.
  • sugar refers to any carbohydrate endogenously produced from sunlight, carbon dioxide and water, any carbohydrate produced endogenously and/or any carbohydrate from any exogenous carbon source such as biomass, comprising a sugar molecule or pool or source of such sugar molecules. Said sugars potentially can be depolymerized and bioconverted to ethanol and ethanol precursors by fermentative processes and methods of the invention.
  • carbon source refers to carbon dioxide, exogenous sugar or biomass.
  • Biomass refers to biological material produced by a biological system including material useful as a renewable energy source.
  • “Carbon-based products of interest” include alcohols such as ethanol, propanol, isopropanol, butanol, fatty alcohols, fatty acid esters, wax esters; hydrocarbons and alkanes such as propane, octane, diesel, Jet Propellant 8 (JP8); polymers such as terephthalate, 1,3-propanediol, 1,4-butanediol, polyols, Polyhydroxyalkanoates (PHA), poly-beta- hydroxybutyrate (PHB), acrylate, adipic acid, ⁇ -caprolactone, isoprene, caprolactam, rubber; commodity chemicals such as lactate, docosahexaenoic acid (DHA), 3-hydroxypropionate, ⁇ -valerolactone, lysine, serine, aspartate, as
  • DHA do
  • Biofuel as used herein is any fuel that derives from a biological source.
  • Biofuel refers to one or more hydrocarbons, one or more alcohols, one or more fatty esters or a mixture thereof.
  • liquid hydrocarbons are used.
  • hydrocarbon generally refers to a chemical compound that consists of the elements carbon (C), hydrogen (H) and optionally oxygen (O).
  • C carbon
  • H hydrogen
  • O optionally oxygen
  • hydrocarbons e.g., aromatic hydrocarbons, saturated hydrocarbons and unsaturated hydrocarbons such as alkenes, alkynes, and dienes.
  • the term also includes fuels, biofuels, plastics, waxes, solvents and oils.
  • Hydrocarbons encompass biofuels, as well as plastics, waxes, solvents and oils.
  • Zinc binding alcohol dehydrogenases are class I alcohol dehydrogenases with a zinc co-factor that catalyze the formation of an ethanol molecule by the reduction of acetaldehyde with either NADH or NADPH.
  • the enzymes are designated “adhl .”
  • the genes encoding adhl are designated “adhl.”
  • Iron binding alcohol dehydrogenases are class II alcohol dehydrogenases with an iron co-factor that catalyze the formation of an ethanol molecule by the reduction of acetaldehyde with NADH or NADPH.
  • the enzymes are designated “adh2.”
  • the genes encoding adh2 are designated "adh2.”
  • Bi-functional alcohol dehydrogenases are bi-functional, two-domain alcohol dehydrogenase/aldehyde oxidoreductase enzymes that catalyze step-wise both the formation of an ethanol molecule by reductive conversion of acetyl-coenzyme A (acetyl-CoA) to acetaldehyde and acetaldehyde to ethanol with iron and NADH co-factors.
  • the enzymes are designated “adhE.”
  • the genes encoding adhE are designated "adhE.”
  • Pyruvate decarboxylases are enzymes that catalyze the formation of an acetaldehyde molecule and a carbon dioxide molecule from a pyruvate molecule.
  • the enzymes are designated "pdc.”
  • the genes encoding pdc are designated "pdc.”
  • ethanologenic and "ethanologen” as used herein refers to the ability of a microorganism to metabolize a carbohydrate to produce ethanol as a primary fermentation product using exogenous sugar and/or light, water and carbon dioxide.
  • a host cell can be a naturally occurring ethanologenic host cell, an ethanologenic host cell with a natural or induced mutation, or ethanologenic host cell which has been genetically modified.
  • ethanologenesis and "ethanologenic” as used herein with reference to a gene, gene product or protein capable of conferring on a host cell the capacity to produce, metabolically use or tolerate ethanol or is capable of improving any aspect of cellular production of ethanol, such as, e.g., substrate uptake, substrate processing, ethanol tolerance, etc.
  • genes include a gene encoding pyruvate decarboxylase and alcohol dehydrogenases I, II, III, IV, V and/or A, B, C or E and genes encoding a bi-functional alcohol dehydrogenase.
  • catabolic and “catabolism” as used herein refers to the process of molecule breakdown or degradation of large molecules into smaller molecules. Catabolic or catabolism refers to a specific reaction pathway wherein the molecule breakdown occurs through a single catalytic component or a multitude thereof or a general, whole cell process wherein the molecule breakdown occurs using more than one specified reaction pathway and a multitude of catalytic components.
  • anabolic and “anabolism” as used herein refers to the process of chemical construction of small molecules into larger molecules.
  • Anabolic refers to a specific reaction pathway wherein the molecule construction occurs through a single catalytic component or a multitude thereof or a general, whole cell process wherein the molecule construction occurs using more than one specified reaction pathway and a multitude of catalytic components.
  • correlated saturation mutagenesis refers to altering an amino acid type at two or more positions of a polypeptide to achieve an altered functional or structural attribute differing from the structural or functional attribute of the polypeptide from which the changes were made.
  • Pyruvate decarboxylase catalyzes the conversion of pyruvate into acetaldehyde and alcohol dehydrogenase in turn catalyzes the conversion of acetaldehyde to ethanol.
  • Bi- functional alcohol dehydrogenase is an enzyme catalyzing the two-step conversion of acetyl- coA to ethanol by chemical reduction with NADH. Ethanol can then be isolated and used for other industrial applications as well as an alternative fuel source.
  • the invention described herein concerns the use of various enzymes for the production of ethanol.
  • a host cell may use pyruvate dehydrogenase to convert a molecule of pyruvate into acetyl-coenzyme A (acetyl-CoA), which is then used in the citric acid cycle to carry out cellular respiration.
  • acetyl-CoA acetyl-CoA
  • certain host cells may use pyruvate decarboxylase to convert pyruvate into acetaldehyde, which in turn is converted to ethanol through the activity of an endogenous alcohol dehydrogenase enzyme.
  • Objects of the invention described herein include diverting pyruvate acetyl-CoA away from the citric acid cycle by incorporating into a host cell heterologous genes encoding pyruvate decarboxylase, alcohol dehydrogenase and bi-functional alcohol dehydrogenase capable of converting pyruvate or acetyl-CoA to acetaldehyde and acetaldehyde to ethanol or other carbon based products of interest, in either aerobic or anaerobic conditions.
  • the invention provides isolated nucleic acid molecules having pdc gene activity, variants thereof, codon and expression optimized forms of said pdc genes and methods of improvement thereon.
  • SEQ ID NO: 1 is pdc from wild-type Zymomonas mobilis ZM-4 (accession number NC 006526).
  • SEQ ID NO:2 represents the encoded enzyme from SEQ ID NO:1.
  • SEQ ID NO:4 is pdc from wild-type Zymobacter palmae ATCC 51623 (accession number AF474145).
  • SEQ ID NO:5 represents the enzyme coded by SEQ ID NO:4.
  • Table 1 is pdc from wild-type Zymomonas mobilis ZM-4 (accession number NC 006526).
  • SEQ ID NO:2
  • the invention also provides isolated nucleic acid molecules having adh2 gene activity, variants thereof, codon and expression optimized forms of said adh2 genes, and methods of improvement thereon.
  • the full-length nucleic acid sequence for this gene which encodes a pyruvate decarboxylase enzyme (E. C. 1.1.1.1), has been identified and sequenced.
  • a coding sequence for the wild type adh2 gene SEQ ID NO: 7 from Zymomonas mobilis ZM-4 (accession number NC_006526).
  • SEQ ID NO:8 represents the encoded amino acid sequence for the adh2 enzyme.
  • other representatives of wild-type adh2 genes are shown in Table 2.
  • Aeromonas salmonicida ADH YP_001142661 Shewanella amazonensis ADH II YP 928329 Caldicellulosiruptor saccharolyticus ADH YP_001179237 Photorhabdus luminescens hypothetical protein NP_928854 Carboxydothermus hydrogenoformans putative lactaldehyde reductase YP_359772 Moritella sp.
  • the invention also provides isolated nucleic acid molecules having adhl gene activity, variants thereof, expression optimized forms of said adhl genes, and methods of improvement thereon.
  • coding sequences for wild type adhl genes SEQ ID NO: 10 from Zymomonas mobilis ZM-4 (accession number NC 006526) and SEQ ID NO: 13 from Entamoeba histolytica (accession number P35630).
  • SEQ ID NO: 11 represents the encoded enzyme, adhl, from SEQ ID NO: 10.
  • SEQ ID NO: 14 represents the encoded enzyme, adhl, from SEQ ID NO:13.
  • adhl represents the encoded enzyme, adhl, from SEQ ID NO:13.
  • other representatives of wild-type adhl genes are shown in Table 3 as obtained from nucleotide BLAST searches yielding homologues to SEQ ID NO: 10.
  • adhl gene homologues useful herein include those from Phytomonas sp.
  • ADU-2003 accession number AAP39869
  • Xanthobacter autotrophicus accession number YP_001415578
  • Methylibium petroleiphilum accession number YP_001021255
  • Alkalilimnicola ehrlichei accession number YP_742969
  • Sinorhizobium meliloti accession number NP_435872.
  • Table 3 Species with Representative Alcohol Dehydrogenase I ⁇ adhl genes homologous to SEQ ID NO: 10
  • adhl gene homologues useful herein include those from Methanocorpusculum labreanum Z (accession number YP_001030202.1), Arcobacter ⁇ wfe/e ⁇ _RM4018 (accession number YP OO 1489971.1), Thermoanaerobacter ethanolicus X514 (accession number ZP_01454904.1) and Thermoanaerobacter ethanolicus ATCC 33223 (accession number ZP_00779753.1). Table 4. Species with Representative Alcohol Dehydrogenase I ⁇ adhl) genes homologous to SEQ ID NOS: 13 and 15
  • the invention also provides isolated nucleic acid molecules having adhE gene activity, variants thereof, expression optimized forms of said adhE genes, and methods of improvement thereon.
  • the full-length nucleic acid sequence for this gene which encodes a bi-functional alcohol dehydrogenase and acetaldehyde dehydrogenase (generally, aldehyde oxido-reductase) enzyme (E. C. 1.2.1.10), has been identified and sequenced.
  • nucleotide coding sequence for the wild type adhE gene SEQ ID NO: 16 from Thermosynechococcus elongatus BP-I accession number BA000039.2
  • a codon optimized nucleotide coding sequence SEQ ID NO: 18, of the Thermosynechococcus elongatus BP- lwild type adhE gene
  • K- 12 accession number CP000948.1
  • SEQ ID NO: 17 represents the encoded amino acid sequence of the adhE enzyme from Thermosynechococcus elongatus BP-I.
  • SEQ ID NO:20 represents the encoded amino acid sequence of the adhE enzyme from Escherichia coli str. K- 12.
  • the invention provides isolated nucleic acid molecules having sequences comprising or consisting o ⁇ pdc, adh2, adhl, and adhE gene homo logs, variants and derivatives of the wild-type coding sequences of Table 15.
  • the invention provides nucleic acid molecules comprising or consisting of sequences which are structurally and functionally optimized versions of the wild-type genes of Table 15.
  • nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences optimized for substrate affinity and/or substrate catalytic conversion rate are provided.
  • the invention provides nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the pdc gene having at least 80% identity to SEQ ID NO:3 or 79% identity to SEQ ID NO:6.
  • Representatives of species with pdc genes homologous to SEQ ID NO: 3 as obtained from a BLAST search are shown in Table 5.
  • Representatives of species with pdc genes homologous to SEQ ID NO: 6 as obtained from a BLAST search are shown in Table 6.
  • the invention provides nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the pdc gene having at least 80% identity to SEQ ID NO:3 or at least 79% identity to SEQ ID NO:6 and optimized for substrate affinity, substrate catalytic conversion rate, improved thermostability, activity at a different pH and/or optimized codon usage for improved expression in a host cell.
  • the nucleic acid sequences can be preferably 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to SEQ ID NO:1 or 79%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to SEQ ID NO:4, the wild-type sequences.
  • Echinochloa crus-galli PDC AF497855 [0102]
  • the invention provides nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the adh2 gene having at least 77% identity to SEQ ID NO:9. Representatives of species with adh2 genes homologous to SEQ ID NO:9 as obtained from a BLAST search are shown in Table 7.
  • the invention provides nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the adh2 gene having at least 77% identity to SEQ ID NO: 9 and optimized for substrate affinity, substrate catalytic conversion rate, improved thermostability, activity at a different pH and/or optimized codon usage for improved expression in a host cell.
  • the nucleic acid sequences can be preferably 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to the wild-type gene of SEQ ID NO:7.
  • the invention provides nucleic acid molecules and homo logs, variants and derivatives comprising or consisting of sequences which are variants of the adh2 gene having at least 79% identity to SEQ ID NO:23.
  • SEQ ID NO:22 represents the encoded amino acid sequence for the adh2 enzyme represented by SEQ ID NO:23.
  • the invention provides nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the adh2 gene having at least 79% identity to SEQ ID NO:23 and optimized for substrate affinity, substrate catalytic conversion rate, improved thermostability, activity at a different pH and/or optimized codon usage for improved expression in a host cell.
  • the nucleic acid sequences can be preferably 79%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to the wild-type gene.
  • nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the adhl gene having at least 80% identity to SEQ ID NO: 12 or at least 71% identity to SEQ ID NO: 15.
  • nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the adhl gene having at least 80% identity to SEQ ID NO: 12 or at least 71% identity to SEQ ID NO: 15 and optimized for substrate affinity, substrate catalytic conversion rate, improved thermostability, activity at a different pH and/or optimized codon usage for improved expression in a host cell.
  • the nucleic acid sequences can be preferably 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to SEQ ID NO: 10 or 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to SEQ ID NO: 13.
  • nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the adhE gene having at least 78% identity to SEQ ID NO: 18 or at least 80% identity to SEQ ID NO:21.
  • nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the adhE gene having at least 78% identity to SEQ ID NO: 18 or at least 80% identity to SEQ ID NO:21 and optimized for substrate affinity, substrate specificity, substrate catalytic conversion rate, improved thermostability, activity at a different pH and/or optimized codon usage for improved expression in a host cell.
  • the nucleic acid sequences can be preferably 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to SEQ ID NO:16 or 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to SEQ ID NO: 19.
  • CP000753 Yersinia pseudotuberculosis spp. CPOO 1048 Yersinia pestis spp. CP000901 Vibrio parahaemolyticus BA000031 Elusimicrobium minutum CP001055 Shewanella putrefaciens CP000681 Shewanella pealeana CP000851 Mastigamoeba balamuthi AY113188 Shewanella frigidimarina CP000447
  • Shigella dysenteriae CP000034 Shigella boydii spp. CP001063 Shigella flexneri spp. CP000266 Shigella sonnei CP000038 Citrobacter koseri CP000822 Klebsiella pneumoniae spp. CP000964 Salmonella enterica sp CPOOl 120 Salmonella typhimurium spp. AE008777 Klebsiella oxytoca EU021506 Enterobacter sakazakii CP000783 Enterobactex spp.
  • CP000901 Erwinia tasmaniensis CU468135 Aeromonas hydrophila CP000462 Aeromonas salmonicida CP000644 Photorhabdus luminescens BX571867 Xenorhabdus nematophila AY363171 Proteus mirabilis AM942759 Chromobacterium violaceum AEO 16825 Vibrio cholerae spp.
  • CP000627 Rhodopseudomonas palustris CP000463 Shewanella amazonensis CP000507 Rhodopseudomonas palustris CP000301 Shewanella oneidensis AEO 14299 Vibrio vulnificus spp.
  • the nucleic acid molecules of the invention encode a polypeptide having any one of the amino acid sequences of Table 16. Also provided are nucleic acid molecules encoding a polypeptide sequence that is at least 50% identical to any one of the amino acid sequences of Table 16. Preferably, the nucleic acid molecule of the invention encodes a polypeptide sequence at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% identical to any one of the amino acid sequences of Table 16, and the identity can even more preferably be 98%, 99%, 99.9% or even higher.
  • the invention also provides nucleic acid molecules that hybridize under stringent conditions to the above-described nucleic acid molecules.
  • stringent hybridizations are performed at about 25 0 C below the thermal melting point (T m ) for the specific DNA hybrid under a particular set of conditions, where the T m is the temperature at which 50% of the target sequence hybridizes to a perfectly matched probe.
  • Stringent washing can be performed at temperatures about 5 0 C lower than the T m for the specific DNA hybrid under a particular set of conditions.
  • the nucleic acid molecule of the invention includes DNA molecules (e.g., linear, circular, cDNA, chromosomal DNA, double stranded or single stranded) and RNA molecules (e.g., tRNA, rRNA, mRNA) and analogs of the DNA or RNA molecules of the described herein using nucleotide analogs.
  • the isolated nucleic acid molecule of the invention includes a nucleic acid molecule free of naturally flanking sequences (i.e., sequences located at the 5' and 3' ends of the nucleic acid molecule) in the chromosomal DNA of the organism from which the nucleic acid is derived.
  • an isolated nucleic acid molecule can contain less than about 10 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, 0.1 kb, 50 bp, 25 bp or 10 bp of naturally flanking nucleotide chromosomal DNA sequences of the microorganism from which the nucleic acid molecule is derived.
  • the pdc, adhl, adh2 and adhE genes include nucleic acid molecules, for example, a polypeptide or RNA-encoding nucleic acid molecule, separated from another gene or other genes by intergenic DNA (for example, an intervening or spacer DNA which naturally flanks the gene and/or separates genes in the chromosomal DNA of the organism).
  • nucleic acid molecules for example, a polypeptide or RNA-encoding nucleic acid molecule, separated from another gene or other genes by intergenic DNA (for example, an intervening or spacer DNA which naturally flanks the gene and/or separates genes in the chromosomal DNA of the organism).
  • Nucleic acid molecules comprising a fragment of any one of the above-described nucleic acid sequences are also provided. These fragments preferably contain at least 20 contiguous nucleotides. More preferably the fragments of the nucleic acid sequences contain at least 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 or even more contiguous nucleotides.
  • a nucleic acid molecule of the invention hybridizes to all or a portion of a nucleic acid molecule having any one of the sequences set forth in Table 17 or hybridizes to all or a portion of a nucleic acid molecule having a nucleotide sequence that encodes a polypeptide having any one of the amino acid sequences of Table 16.
  • Such hybridization conditions are known to those skilled in the art (see, for example, Current Protocols in Molecular Biology, Ausubel et ah, eds., John Wiley & Sons, Inc. (1995); Molecular Cloning: A Laboratory Manual, Sambrook et ah, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989)).
  • an isolated nucleic acid molecule comprises a nucleotide sequence that is complementary to any one of the sequences in Tables 15 or 103.
  • the nucleic acid sequence fragments of the invention display utility in a variety of systems and methods.
  • the fragments may be used as probes in various hybridization techniques.
  • the target nucleic acid sequences may be either DNA or RNA.
  • the target nucleic acid sequences may be fractionated (e.g., by gel electrophoresis) prior to the hybridization, or the hybridization may be performed on samples in situ.
  • nucleic acid probes of known sequence find utility in determining chromosomal structure (e.g., by Southern blotting) and in measuring gene expression (e.g., by Northern blotting).
  • sequence fragments are preferably detectably labeled, so that their specific hybridization to target sequences can be detected and optionally quantified.
  • nucleic acid fragments of the invention may be used in a wide variety of blotting techniques not specifically described herein.
  • nucleic acid sequence fragments disclosed herein also find utility as probes when immobilized on microarrays.
  • Methods for creating microarrays by deposition and fixation of nucleic acids onto support substrates are well known in the art. Reviewed in DNA Microarrays: A Practical Approach (Practical Approach Series), Schena (ed.), Oxford University Press (1999) (ISBN: 0199637768); Nature Genet. 21(l)(suppl):l-60 (1999); Microarray Biochip: Tools and Technology, Schena (ed.), Eaton Publishing Company/BioTechniques Books Division (2000) (ISBN: 1881299376), the disclosures of which are incorporated herein by reference in their entireties.
  • microarrays comprising nucleic acid sequence fragments, such as the nucleic acid sequence fragments disclosed herein, are well-established utility for sequence fragments in the field of cell and molecular biology.
  • sequence fragments immobilized on microarrays are described in Gerhold et al., Trends Biochem. Sci. 24:168-173 (1999) and Zweiger, Trends Biotechnol. 17:429-436 (1999); DNA Microarrays: A Practical Approach (Practical Approach Series), Schena (ed.), Oxford University Press (1999) (ISBN: 0199637768); Nature Genet.
  • enzyme activities are measured in various ways.
  • the pyrophosphoro lysis of OMP may be followed spectroscopically .
  • Grubmeyer et al J. Biol. Chem. 268:20299-20304 (1993).
  • the activity of the enzyme is followed using chromatographic techniques, such as by high performance liquid chromatography. Chung and Sloan, J. Chromatogr. 371 :71-81 (1986).
  • the activity is indirectly measured by determining the levels of product made from the enzyme activity. More modern techniques include using gas chromatography linked to mass spectrometry (Niessen, W. M. A. (2001). Current practice of gas chromatography— mass spectrometry.
  • LCMS liquid chromatography-mass spectrometry
  • HPLC high performance liquid chromatography
  • MALDI-TOF MS Matrix- Assisted Laser Desorption Ionization time of flight-mass spectrometry
  • NMR nuclear magnetic resonance
  • NIR near-infrared
  • mutant nucleic acid molecules or genes comprises mutant or chimeric nucleic acid molecules or genes.
  • a mutant nucleic acid molecule or mutant gene is comprised of a nucleotide sequence that has at least one alteration including, but not limited to, a simple substitution, insertion or deletion.
  • the polypeptide of said mutant can exhibit an activity that differs from the polypeptide encoded by the wild-type nucleic acid molecule or gene.
  • a chimeric mutant polypeptide includes an entire domain derived from another polypeptide that is genetically engineered to be collinear with a corresponding domain.
  • a mutant nucleic acid molecule or mutant gene encodes a polypeptide having improved activity such as substrate affinity, improved thermostability, activity at a different pH, or optimized codon usage for improved expression in a host cell.
  • the recombinant vector can be altered, modified or engineered to have different or a different quantity of nucleic acid sequences than in the derived or natural recombinant vector nucleic acid molecule.
  • the recombinant vector includes a gene or recombinant nucleic acid molecule of the invention operably linked to regulatory sequences including, but not limited to, promoter sequences, terminator sequences and/or artificial ribosome binding sites (RBSs), as defined herein.
  • the one or more copies of one or more of the genes of the invention are operably linked to regulatory sequence(s) in a manner which allows for the desired expression characteristics of the nucleotide sequence.
  • one or more of the genes of the invention is transcribed and translated into a gene product encoded by the nucleotide sequence when the recombinant nucleic acid molecule is included in a recombinant vector, as defined herein, and is introduced into a microorganism.
  • the regulatory sequence may be comprised of nucleic acid sequences which modulate, regulate or otherwise affect expression of other nucleic acid sequences.
  • a regulatory sequence can be in a similar or identical position and/or orientation relative to a nucleic acid sequence of the invention as observed in its natural state, e.g., in a native position and/or orientation.
  • a gene of interest can be included in a recombinant nucleic acid molecule or recombinant vector operably linked to a regulatory sequence which accompanies or is adjacent to the gene of interest in the natural host cell, or can be adjacent to a different gene in the natural host cell, or can be operably linked to a regulatory sequence from another organism.
  • Regulatory sequences operably linked to a gene of the invention can be from other bacterial regulatory sequences, bacteriophage regulatory sequences and the like.
  • a regulatory sequence is a sequence which has been modified, mutated, substituted, derivated, deleted, including sequences which are chemically synthesized.
  • regulatory sequences include promoters, enhancers, termination signals, anti-termination signals and other expression control elements that, for example, serve as sequences to which repressors or inducers bind or serve as or encode binding sites for transcriptional and/or translational regulatory polypeptides, for example, in the transcribed mRNA (see Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual.
  • Regulatory sequences include promoters directing constitutive expression of a nucleotide sequence in a host cell, promoters directing inducible expression of a nucleotide sequence in a host cell and promoters which attenuate or repress expression of a nucleotide sequence in a host cell.
  • Regulating expression of a gene of interest also can be done by removing or deleting regulatory sequences. For example, sequences involved in the negative regulation of transcription can be removed such that expression of a gene of interest is enhanced.
  • a recombinant nucleic acid molecule or recombinant vector of the invention includes a nucleic acid sequence or gene that encodes at least one bacterial gene product of the invention operably linked to a promoter or promoter sequence.
  • promoters of the invention include native promoters, surrogate promoters and/or bacteriophage promoters.
  • a promoter is associated with a biochemical housekeeping gene or a promoter associated with an ethanologenic pathway.
  • a promoter is a bacteriophage promoter.
  • Other promoters include tef (the translational elongation factor (TEF) promoter) which promotes high level expression in Bacillus (e.g., Bacillus subtilis).
  • TEF translational elongation factor
  • Additional advantageous promoters, for example, for use in Gram positive microorganisms include, but are not limited to, the amyE promoter or phage SP02 promoters.
  • Additional advantageous promoters for example, for use in Gram negative microorganisms include, but are not limited to tac, trp, tet, trp-tet, lpp, lac, lpp-lac, laclq, T7, T5, T3, gal, trc,
  • a recombinant nucleic acid molecule or recombinant vector of the invention includes a transcription terminator sequence or sequences.
  • terminator sequences refer to the regulatory sequences which serve to terminate transcription of a gene. Terminator sequences (or tandem transcription terminators) can further serve to stabilize mRNA (e.g., by adding structure to mRNA), for example, against nucleases.
  • a recombinant nucleic acid molecule or recombinant vector of the invention has sequences allowing for detection of the vector containing sequences (i.e., detectable and/or selectable markers), for example, sequences that overcome auxotrophic mutations, for example, ura3 or ilvE, fluorescent markers, and/or calorimetric markers (e.g., lacZ/ ⁇ -galactosidase), and/or antibiotic resistance genes (e.g., bla or tet).
  • any one of the genes of the invention can be introduced into a vector also comprising one or more ethanologenic genes and/or a gene encoding a gene product suitable for fermenting an exogenous sugar or degrading an exogenous sugar for subsequent fermentation and/or used to produce ethanol using light, water and carbon dioxide.
  • vectors including expression vectors, which comprise the above nucleic acid molecules of the invention, as described further herein.
  • the vectors include the isolated nucleic acid molecules described above.
  • the vectors of the invention include the above-described nucleic acid molecules operably linked to one or more expression control sequences.
  • the vectors of the instant invention may thus be used to express an adhl and/or adh2 polypeptide having activity for alcohol dehydrogenase; a pdc polypeptide having activity for pyruvate decarboxylase; and/or adhE polypeptide having activity for bi-functional alcohol dehydrogenase.
  • a useful vector herein is plasmid pCDFDuet-1 that is available from Novagen.
  • Another useful vector of the invention is the endogenous Synechococcus sp. PCC 7002 plasmid pAQl (Genbank accession number NC O 10476). Isolated Polypeptides
  • polypeptides encoded by nucleic acid sequences of the invention are produced by recombinant DNA techniques and can be isolated from expression host cells by an appropriate purification scheme using standard polypeptide purification techniques.
  • polypeptides encoded by nucleic acid sequences of the invention are synthesized chemically using standard peptide synthesis techniques.
  • pdc polypeptides or gene products that are derived polypeptides or gene products encoded by naturally-occurring bacterial genes (Tables 1, 5 and 6). Further, included within the scope of the invention, are bacteria-derived polypeptides or gene products which differ from wild-type genes, including genes that have altered, inserted or deleted nucleic acids but which encode polypeptides substantially similar in structure and/or function to those encoded by the wild-type pdc gene.
  • adh2 polypeptides or gene products that are derived polypeptides or gene products encoded by naturally-occurring bacterial genes (Tables 2 and 7). Further, included within the scope of the invention, are bacteria-derived polypeptides or gene products which differ from wild-type genes, including genes that have altered, inserted or deleted nucleic acids but which encode polypeptides substantially similar in structure and/or function to those encoded by the wild-type adh2 gene.
  • adhl polypeptides or gene products that are derived polypeptides or gene products encoded by naturally-occurring bacterial genes (Tables 3 and 4). Further, included within the inventive scope, are bacteria-derived polypeptides or gene products which differ from wild-type genes, including genes that have altered, inserted or deleted nucleic acids but which encode polypeptides substantially similar in structure and/or function to those encoded by the wild-type adhl gene.
  • adhE polypeptides or gene products that are derived polypeptides or gene products encoded by naturally-occurring bacterial genes (Tables 8 and 9). Further, included within the inventive scope, are bacteria-derived polypeptides or gene products which differ from wild-type genes, including genes that have altered, inserted or deleted nucleic acids but which encode polypeptides substantially similar in structure and/or function to those encoded by the wild-type adhE gene.
  • nucleic acids which, due to the degeneracy of the genetic code, encode for an identical amino acid as that encoded by the naturally-occurring gene. This may be desirable in order to improve the codon usage of a nucleic acid to be expressed in a particular organism.
  • mutate e.g., substitute nucleic acids which encode for conservative amino acid substitutions.
  • one of skill in the art can substitute, add or delete amino acids to a certain degree to improve upon or at least insubstantially affect the function and/or structure of a gene product (e.g., alcohol dehydrogenase, pyruvate decarboxylase or bi-functional aldehyde oxido-reductase/alcohol dehydrogenase activities) as compared with a naturally- occurring gene product, each instance of which is intended to be included within the scope of the invention.
  • a gene product e.g., alcohol dehydrogenase, pyruvate decarboxylase or bi-functional aldehyde oxido-reductase/alcohol dehydrogenase activities
  • the enzyme activity, enzyme/substrate affinity, enzyme thermostability, and/or enzyme activity at various pHs can be unaffected or rationally altered and readily evaluated using the assays described herein.
  • the iron binding alcohol dehydrogenase enzymes of the invention exhibit an acetaldehyde substrate affinity (K m ) of about 1 to about 5 milli-molar (mM); more particularly the K m is optimized over endogenous activity for the purposes described herein.
  • the iron binding alcohol dehydrogenase enzymes of the invention exhibit an ethanol substrate affinity (K 1n ) of about 10 to about 40 milli-molar (rnM); more particularly the K 1n is optimized over endogenous activity for the purposes described herein.
  • the iron binding alcohol dehydrogenase enzymes of the invention exhibit an affinity (K 1n ) of about 1 to about 12 milli-molar (mM) for reduced nicotinamide adenine dinucleotide substrate (NADH); more particularly the K 1n is optimized over endogenous activity for the purposes described herein.
  • the iron binding alcohol dehydrogenase enzymes of the invention exhibit an affinity (K 1n ) of about 60 to about 100 milli-molar (mM) for oxidized nicotinamide adenine dinucleotide substrate (NAD+); more particularly the K 1n is optimized over endogenous activity for the purposes described herein.
  • the zinc binding alcohol dehydrogenase enzymes exhibit an acetaldehyde substrate affinity (K 1n ) of about 50 to about 100 micro-molar ( ⁇ M); more particularly the K 1n is optimized over endogenous activity for the purposes described herein.
  • the zinc binding alcohol dehydrogenase enzymes exhibit an ethanol substrate affinity (K 1n ) of about 1 to about 10 milli-molar (mM); more particularly the K 1n is optimized over endogenous activity for the purposes described herein.
  • the NADH-dependent zinc binding alcohol dehydrogenase enzymes exhibit an affinity (K 1n ) of about 20 to about 30 ⁇ M for reduced nicotinamide adenine dinucleotide substrate (NADH); more particularly the K 1n is optimized over endogenous activity for the purposes described herein.
  • the NADH-dependent zinc binding alcohol dehydrogenase enzymes exhibit an affinity (K 1n ) of about 60 to about 80 ⁇ M for oxidized nicotinamide adenine dinucleotide substrate (NAD+); more particularly the K 1n is optimized over endogenous activity for the purpose of the invention described herein.
  • the NADPH-dependent zinc binding alcohol dehydrogenase enzyme exhibit an affinity (K 1n ) of about 80 to about 100 ⁇ M for reduced nicotinamide adenine dinucleotide phosphate substrate (NADPH); more particularly the K 1n is optimized over endogenous activity for the purposes described herein.
  • the NADPH-dependent zinc binding alcohol dehydrogenase enzymes exhibit an affinity (K 1n ) of about 20 to about 40 ⁇ M for oxidized nicotinamide adenine dinucleotide phosphate substrate (NADP+) (Kumar, A., et al. (1992). Proc Natl Acad Sci USA 89: 10188-10192); more particularly the K 1n is optimized over endogenous activity for the purpose of the invention described herein.
  • the bi-functional alcohol dehydrogenase enzymes exhibit an acetaldehyde substrate affinity (K 1n ) of about about 10 milli-molar (mM); more particularly the K 1n is optimized over endogenous activity for the purposes described herein.
  • the bi- functional alcohol dehydrogenase enzymes exhibit an ethanol substrate affinity (K m ) of about 10 to about 40 milli-molar (mM); more particularly the K 1n is optimized over endogenous activity for the purposes described herein.
  • the bi-functional alcohol dehydrogenase enzymes exhibit an affinity (K m ) of about 25 micro-molar (mM) for reduced nicotinamide adenine dinucleotide substrate (NADH); more particularly the K m is optimized over endogenous activity for the purposes described herein.
  • the bi-functional alcohol dehydrogenase enzymes exhibit an affinity (K m ) of about 80 micro-molar ( ⁇ M) for oxidized nicotinamide adenine dinucleotide substrate (NAD+); more particularly the K m is optimized over endogenous activity for the purposes described herein. More particularly, the K m for ethanol is optimized over endogenous activity for the purposes described herein.
  • the pyruvate decarboxylase enzymes of the invention exhibit a substrate affinity (K m ) of about 0.1 to about 1 milli-molar (mM), more particularly a K m of about 0.1 mM to about 0.5 mM, even more particularly a K m of about 0.2 mM to about of about 0.4 mM.
  • K m substrate affinity
  • isolated polypeptides (including muteins, allelic variants, fragments, derivatives, and analogs) encoded by the nucleic acid molecules of the invention are provided.
  • the isolated polypeptide comprises a polypeptide sequence corresponding to any one of the sequences in Table 16.
  • the isolated polypeptide comprises a polypeptide sequence at least 50% identical to any one of the sequences in Table 16.
  • the isolated polypeptide of the invention has at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or even higher identity to the sequences of the invention optimized for substrate affinity and/or substrate catalytic conversion rate.
  • isolated polypeptides comprising a fragment of the above-described polypeptide sequences are provided. These fragments preferably include at least 20 contiguous amino acids, more preferably at least 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 or even more contiguous amino acids.
  • the polypeptides of the invention also include fusions between the above- described polypeptide sequences and heterologous polypeptides.
  • the heterologous sequences can, for example, include sequences designed to facilitate purification, e.g., histidine tags, and/or visualization of recombinantly-expressed proteins.
  • Other non- limiting examples of protein fusions include those that permit display of the encoded protein on the surface of a phage or a cell, fusions to intrinsically fluorescent proteins, such as green fluorescent protein (GFP), and fusions to the IgG Fc region.
  • GFP green fluorescent protein
  • host cells transformed with the nucleic acid molecules or vectors of the invention, and descendants thereof are provided.
  • these cells carry the nucleic acid sequences of the invention on vectors, which may but need not be freely replicating vectors.
  • the nucleic acids have been integrated into the genome of the host cells.
  • the host cell encoding pyruvate decarboxylase can be a host cell lacking the pyruvate dehydrogenase gene, a host cell with a gene encoding a pyruvate decarboxylase gene or a host cell engineered to express pdc polypeptide.
  • the host cell encoding alcohol dehydrogenase can be a host cell lacking an alcohol dehydrogenase gene, a host cell with a gene encoding an alcohol dehydrogenase gene or a host cell engineered to express adhl and/or adh2 polypeptide.
  • the host cell encoding bi-functional alcohol dehydrogenase can be a host cell lacking an alcohol dehydrogenase or bi-functional alcohol dehydrogenase gene, a host cell with a gene encoding an alcohol dehydrogenase or bi-functional alcohol dehydrogenase gene or a host cell engineered to express adhE polypeptide.
  • the host cell comprises one or more copies of one or more nucleic acids of Table 17.
  • the host cells of the invention can be mutated by recombination with a disruption, deletion or mutation of the isolated nucleic acid of the invention so that the activity of any or all of the pdc, adhl, adh2, or adhE polypeptides in the host cell is reduced or eliminated compared to a host cell lacking the mutation.
  • the host cell of the invention containing a gene of the invention can be ethanologenic, and/or further comprise an ethanologenic gene(s) encoding alcohol dehydrogenase, pyruvate decarboxylase or a combination thereof.
  • the host cell is suitable for fermenting ethanol from a sugar.
  • the host cell is a recombinant ethanologenic host cell comprising a heterologous nucleic acid encoding a gene from Table 17.
  • the invention provides a method for expressing a polypeptide of the invention under suitable culture conditions and choice of host cell line for optimal enzyme expression, activity and stability (codon usage, salinity, pH, temperature, etc.).
  • the invention provides a method for producing acetaldehyde and/or ethanol by culturing a host cell under conditions in which pyruvate decarboxylase, alcohol dehydrogenase and/or bi-functional alcohol dehydrogenase are expressed at sufficient levels to produce a measureable quantity of acetaldehyde and/or ethanol from sugar.
  • the method for producing acetaldehyde and/or ethanol is performed by contacting a cell lysate obtained from the above host cell under conditions in which acetaldehyde and/or ethanol is produced from a sugar.
  • the invention provides enzyme extracts having improved alcohol dehydrogenase, pyruvate decarboxylase, and/or bifunctional alcohol dehydrogenase activities and having, for example, thermal stability, activity at various pH, superior substrate affinity and/or specificity.
  • Microorganism Includes prokaryotic and eukaryotic microbial species from the Domains Archaea, Bacteria and Eucarya, the latter including yeast and filamentous fungi, protozoa, algae, or higher Protista.
  • microbial cells and “microbes” are used interchangeably with the term microorganism.
  • Photoautotrophic organisms include eukaryotic plants and algae, as well as prokaryotic cyanobacteria, green-sulfur bacteria, green non-sulfur bacteria, purple sulfur bacteria, and purple non-sulfur bacteria.
  • the host cell can be a Gram-negative bacterial cell or a Gram-positive bacterial cell.
  • a Gram-negative host cell of the invention can be, e.g., Gluconobacter, Rhizobium, Bradyrhizobium, Alcaligenes, Rhodobacter, Rhodococcus. Azospirillum, Rhodospirillum, Sphingomonas, Burkholderia, Desuifomonas, Geospirillum, Succinomonas, Aeromonas, Shewanella, Halochromatium, Citrobacter, Escherichia, Klebsiella, Zymomonas Zymobacter, or Acetobacter.
  • a Gram-positive host cell of the invention can be, e.g., Fibrobacter, Acidobacter, Bacteroides, Sphingobacterium, Actinomyces, Corynebacterium, Nocardia, Rhodococcus, Propionibacterium, Bifidobacterium, Bacillus, Geobacillus, Paenibacillus, Sulfobacillus, Clostridium, Anaerobacter, Eubacterium, Streptococcus, Lactobacillus, Leuconostoc, Enterococcus, Lactococcus, Thermobifida, Cellulomonas, or Sarcina. [0153] Extremophiles are also contemplated as suitable organisms.
  • Such organisms withstand various environmental parameters such as temperature, radiation, pressure, gravity, vacuum, desiccation, salinity, pH, oxygen tension, and chemicals. They include hyperthermophiles, which grow at or above 80 0 C such as Pyrolobus fumarii; thermophiles, which grow between 60-80 0 C such as Synechococcus lividis; mesophiles, which grow between 15-60 0 C and psychrophiles, which grow at or below 15°C such as Psychrobacter and some insects.
  • Radiation-tolerant organisms include Deinococcus radiodurans .
  • Pressure- tolerant organisms include piezophiles or barophiles, which tolerate pressure of 130 MPa.
  • Vacuumtolerant organisms include tardigrades, insects, microbes and seeds.
  • Dessicant- tolerant and anhydrobiotic organisms include xerophiles such as Artemia salina; nematodes, microbes, fungi and lichens.
  • Salt-tolerant organisms include halophiles (e.g., 2-5 M NaCl) Halobacteriacea and Dunaliella salina.
  • pH-tolerant organisms include alkaliphiles such as Natronobacterium, Bacillus firmus OF4, Spirulina spp.
  • Anaerobes which cannot tolerate O 2 such as Methanococcus jannaschii; microaerophils, which tolerate some O 2 such as Clostridium and aerobes, which require O 2 are also contemplated.
  • Gas-tolerant organisms, which tolerate pure CO 2 include Cyanidium caldarium and metal-tolerant organisms include metalotolerants such as Ferroplasma acidarmanus (e.g., Cu, As, Cd, Zn), Ralstonia sp. CH34 (e.g., Zn, Co, Cd, Hg, Pb). Gross, Michael.
  • Plants include but are not limited to the following genera: Arabidopsis, Beta, Glycine, Jatropha, Miscanthus, Panicum, Phalaris, Populus, Saccharum, Salix, Simmondsia and Zea.
  • Algae and cyanobacteria include but are not limited to the following genera: Acanthoceras, Acanthococcus, Acaryochloris, Achnanthes, Achnanthidium, Actinastrum, Actinochloris, Actinocyclus, Actinotaenium, Amphichrysis, Amphidinium, Amphikrikos, Amphipleura, Amphiprora, Amphithrix, Amphora, Anabaena, Anabaenopsis, Aneumastus, Ankistrodesmus, Ankyra, Anomoeoneis, Apatococcus, Aphanizomenon, Aphanocapsa, Aphanochaete, Aphanothece, Apiocystis, Apistonema, Arthrodesmus, Artherospira, Ascochloris, Asterionella, Asterococcus, Audouinella, Aulacoseira, Bacillaria, Balbiania, Bambusina,
  • Green non-sulfur bacteria include but are not limited to the following genera: Chloroflexus, Chloronema, Oscillochloris, Heliothrix, Herpetosiphon, Roseiflexus, and Thermomicrobium.
  • Green sulfur bacteria include but are not limited to the following genera: Chlorobium, Clathrochloris, and Prosthecochloris .
  • Purple sulfur bacteria include but are not limited to the following genera: Allochromatium, Chromatium, Halochromatium, Isochromatium, Marie hromatium, Rhodovulum, Thermochromatium, Thiocapsa, Thiorhodococcus, and Thiocystis,
  • Purple non-sulfur bacteria include but are not limited to the following genera: Phaeospirillum, Rhodobaca, Rhodobacter, Rhodomicrobium, Rhodopila, Rhodopseudomonas, Rhodothalassium, Rhodospirillum, Rodovibrio, and Roseospira.
  • Aerobic chemolithotrophic bacteria include but are not limited to nitrifying bacteria such as Nitrobacteraceae sp., Nitrobacter sp., Nitrospina sp., Nitrococcus sp., Nitrospira sp., Nitrosomonas sp., Nitrosococcus sp., Nitrosospira sp., Nitrosolobus sp., Nitrosovibrio sp.; colorless sulfur bacteria such as, Thiovulum sp., Thiobacillus sp., Thiomicrospira sp., Thiosphaera sp., Thermothrix sp.; obligately chemolithotrophic hydrogen bacteria such as Hydrogenobacter sp., iron and manganese-oxidizing and/or depositing bacteria such as Siderococcus sp., and magnetotactic bacteria such as Aquaspirillum sp.
  • nitrifying bacteria such as Nitro
  • Archaeobacteria include but are not limited to methanogenic archaeobacteria such as Methanobacterium sp., Methanobrevibacter sp., Methanothermus sp., Methanococcus sp., Methanomicrobium sp., Methanospirillum sp., Methanogenium sp., Methanosarcina sp., Methanolobus sp., Methanothrix sp., Methanococcoides sp., Methanoplanus sp.; extremely thermophilic sulfur-metabolizers such as Thermoproteus sp., Pyrodictium sp., Sulfolobus sp., Acidianus sp.
  • methanogenic archaeobacteria such as Methanobacterium sp., Methanobrevibacter sp., Methanothermus sp., Methanococcus sp.,
  • microorganisms such as, Bacillus subtilis, Saccharomyces cerevisiae, Streptomyces sp., Ralstonia sp., Rhodococcus sp., Corynebacteria sp., Brevibacteria sp., Mycobacteria sp., and oleaginous yeast.
  • HyperPhotosynthetic conversion requires extensive genetic modification; thus, in preferred embodiments the parental photoautotrophic organism can be transformed with exogenous DNA.
  • Preferred organisms for HyperPhotosynthetic conversion include: Arabidopsis thaliana, Panicum virgatum, Miscanthus giganteus, and Zea mays (plants), Botryococcus braunii, Chlamydomonas reinhardtii and Dunaliela salina (algae), Synechococcus sp PCC 7002, Synechococcus sp. PCC 7942, Synechocystis sp.
  • PCC 6803 PCC 6803, and Thermosynechococcus elongatus BP-I (cyanobacteria), Chlorobium tepidum (green sulfur bacteria), Chloroflexus auranticus (green non-sulfur bacteria), Chromatium tepidum and Chromatium vinosum (purple sulfur bacteria), Rhodospirillum rubrum, Rhodobacter capsulatus, and Rhodopseudomonas palusris (purple non-sulfur bacteria).
  • Suitable organisms include synthetic cells or cells produced by synthetic genomes as described in Venter et al. US Pat. Pub. No. 2007/0264688, and cell-like systems or synthetic cells as described in Glass et al. US Pat. Pub. No. 2007/0269862.
  • suitable organisms include microorganisms that can be engineered to fix carbon dioxide bacteria such as Escherichia coli, Acetobacter aceti, Bacillus subtilis, yeast and fungi such as Clostridium ljungdahlii, Clostridium thermocellum, Penicillium chrysogenum, Pichiapastoris, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pseudomonas fluorescens, or Zymomonas mobilis.
  • carbon dioxide bacteria such as Escherichia coli, Acetobacter aceti, Bacillus subtilis, yeast and fungi such as Clostridium ljungdahlii, Clostridium thermocellum, Penicillium chrysogenum, Pichiapastoris, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pseudomonas fluorescens, or Zym
  • a common theme in selecting or engineering a suitable organism is autotrophic fixation Of CO 2 to products. This would cover photosynthesis and methanogenesis. Acetogenesis, encompassing the three types of CO 2 fixation; Calvin cycle, acetyl-CoA pathway and reductive TCA pathway is also covered. The capability to use carbon dioxide as the sole source of cell carbon (autotrophy) is found in almost all major groups ofprokaryotes. The CO 2 fixation pathways differ between groups, and there is no clear distribution pattern of the four presently-known autotrophic pathways. Fuchs, G. 1989. Alternative pathways of autotrophic CO 2 fixation, p. 365-382. In H. G. Schlegel, and B. Bowien (ed.), Autotrophic bacteria.
  • the reductive pentose phosphate cycle (Calvin-Bassham-Benson cycle) represents the CO 2 fixation pathway in many aerobic autotrophic bacteria, for example, cyanobacteria.
  • genes of the invention and/or ethanologenic genes can be propagated by insertion into the host cell genome. Integration into the genome of the host cell is optionally done at particular loci to impair or disable unwanted gene products or metabolic pathways.
  • useful integration sites in Synechococcus sp. include, but are not limited to, gene loci Idh, cytCI, adh, glgAl, glgA2, glgB, nifJ, acsA, ndhB and ndbA.
  • apdc, adhl, adh2 or adhE gene into a plasmid.
  • the plasmid can express one or more genes of the invention, optionally an operon including one or more genes of the invention, preferably one or more ethanologenic genes, or more preferably one or more ethanologenic genes of a related metabolic pathway.
  • ethanologenic genes and/or genes of the invention can be inserted into plasmids including, but not limited to, pAQl (Synechococcus sp. 7002, accession number NC O 10476), pJB5 as described herein, or pCDFDuet-1 (Novagen).
  • Yet another embodiment of the invention is to integrate one or more ethanologenic genes and/or genes of the invention into an expression vector including, but not limited to, pAQl, pJB5, or pCDFDuet-1 (Novagen) and into the host genome, for example Synechococcus gene loci Idh, cytCI, adh, glgAl, glgA2, glgB, nifl, acsA, ndhB and ndbA.
  • an expression vector including, but not limited to, pAQl, pJB5, or pCDFDuet-1 (Novagen) and into the host genome, for example Synechococcus gene loci Idh, cytCI, adh, glgAl, glgA2, glgB, nifl, acsA, ndhB and ndbA.
  • the invention provides isolated antibodies, including fragments and derivatives thereof that bind specifically to the isolated polypeptides and polypeptide fragments of the invention or to one or more of the polypeptides encoded by the isolated nucleic acids of the invention.
  • the antibodies of the invention may be specific for linear epitopes, discontinuous epitopes or conformational epitopes of such polypeptides or polypeptide fragments, either as present on the polypeptide in its native conformation or, in some cases, as present on the polypeptides as denatured, as, e.g., by solubilization in SDS.
  • useful antibody fragments provided by the instant invention are Fab, Fab', Fv, F(ab')2, and single chain Fv fragments.
  • bind specifically and “specific binding” is here intended the ability of the antibody to bind to a first molecular species in preference to binding to other molecular species with which the antibody and first molecular species are admixed.
  • An antibody is said specifically to "recognize” a first molecular species when it can bind specifically to that first molecular species.
  • the degree to which an antibody can discriminate as among molecular species in a mixture will depend, in part, upon the conformational relatedness of the species in the mixture; typically, the antibodies of the invention will discriminate over adventitious binding to unrelated polypeptides by at least two-fold, more typically by at least 5-fold, typically by more than 10-fold, 25-fold, 50-fold, 75-fold, and often by more than 100-fold, and on occasion by more than 500-fold or 1000-fold.
  • the affinity or avidity of an antibody (or antibody multimer, as in the case of an IgM pentamer) of the invention for a polypeptide or polypeptide fragment of the invention will be at least about 1x10 6 M, typically at least about 5x10 7 M, usefully at least about 1x10 7 M, with affinities and avidities of 1x10 8 M, 5x10 9 M, 1x10 "10 M and even stronger proving especially useful.
  • the isolated antibodies of the invention may be naturally-occurring forms, such as IgG, IgM, IgD, IgE, and IgA, from any mammalian species.
  • antibodies are usefully obtained from species including rodents-typically mouse, but also rat, guinea pig, and hamster-lagomorphs, typically rabbits, and also larger mammals, such as sheep, goats, cows, and horses.
  • the animal is typically affirmatively immunized, according to standard immunization protocols, with the polypeptide or polypeptide fragment of the invention.
  • Virtually all fragments of 8 or more contiguous amino acids of the polypeptides of the invention may be used effectively as immunogens when conjugated to a carrier, typically a protein such as bovine thyroglobulin, keyhole limpet hemocyanin, or bovine serum albumin, conveniently using a bifunctional linker. Immunogenicity may also be conferred by fusion of the polypeptide and polypeptide fragments of the invention to other moieties.
  • peptides of the invention can be produced by solid phase synthesis on a branched polylysine core matrix; these multiple antigenic peptides (MAPs) provide high purity, increased avidity, accurate chemical definition and improved safety in vaccine development. See, e.g., Tarn et al, Proc. Natl. Acad. Sci. USA 85:5409-5413 (1988); Posnett et al, J. Biol. Chem. 263, 1719-1725 (1988).
  • Protocols for immunization are well-established in the art. Such protocols often include multiple immunizations, either with or without adjuvants such as Freund's complete adjuvant and Freund's incomplete adjuvant.
  • Antibodies of the invention may be polyclonal or monoclonal, with polyclonal antibodies having certain advantages in immunohistochemical detection of the proteins of the invention and monoclonal antibodies having advantages in identifying and distinguishing particular epitopes of the proteins of the invention. Following immunization, the antibodies of the invention may be produced using any art-accepted technique. Host cells for recombinant antibody production-either whole antibodies, antibody fragments, or antibody derivatives-can be prokaryotic or eukaryotic.
  • Prokaryotic hosts are particularly useful for producing phage displayed antibodies, as is well known in the art.
  • Eukaryotic cells including mammalian, insect, plant and fungal cells are also useful for expression of the antibodies, antibody fragments, and antibody derivatives of the invention.
  • Antibodies of the invention can also be prepared by cell free translation.
  • the isolated antibodies can usefully be labeled. It is, therefore, another aspect of the invention to provide labeled antibodies that bind specifically to one or more of the polypeptides and polypeptide fragments of the invention.
  • the choice of label depends, in part, upon the desired use.
  • the antibodies of the invention may usefully be labeled with an enzyme.
  • the antibodies may be labeled with colloidal gold or with a fluorophore.
  • the antibodies of the invention may usefully be labeled with biotin.
  • the antibodies When used, e.g., for Western blotting applications, they may usefully be labeled with radioisotopes, such as 33 P, 32 P, 35 S, 3 H and 125 I. As would be understood, use of the labels described above is not restricted to any particular application.
  • Increased acetaldehyde and/or ethanol production can be achieved through the expression and optimization of pyruvate decarboxylase and alcohol dehydrogenase in organisms well suited for modern genetic engineering techniques, that rapidly grow, are capable of fostering on inexpensive food resources, and from which isolation of a desired product is easily and inexpensively achieved.
  • pyruvate decarboxylase and alcohol dehydrogenase in organisms well suited for modern genetic engineering techniques, that rapidly grow, are capable of fostering on inexpensive food resources, and from which isolation of a desired product is easily and inexpensively achieved.
  • variants of the enzymes of the invention including but not limited to, variants optimized for substrate affinity, substrate specificity, substrate catalytic conversion rate, improved thermostability, activity at a different pH and/or optimized codon usage for improved expression in a host cell.
  • one method for the design of ethanologenic proteins of the invention utilizes computational and bioinformatic analysis to design and select for advantageous changes in primary amino acid sequences encoding ethanologenic enzyme activity.
  • Computational methods and bioinformatics provide tractable alternatives for rational design of protein structure and function.
  • algorithms analyzing protein structure for biophysical character for example, motional dynamics and total energy or Gibb's Free Energy evaluations
  • biophysical character for example, motional dynamics and total energy or Gibb's Free Energy evaluations
  • polypeptide sequences of the invention or related homologues in a complex with a substrate are obtained from the Protein Data Bank (PDB; HM Berman, et al, Nucleic Acids Research (2000) vol. 28:235-242) for computational analysis on steady state and/or changes in Gibb's free energy relative to the wild type protein. Substitutions of one amino acid residue for another are accomplished in silico interactively as a means for identifying specific residue substitutions that optimize structural or catalytic contacts between the protein and substrate using standard software programs for viewing molecules as is well known to those skilled in the art.
  • PDB Protein Data Bank
  • silico structures are available through the PDB including pyruvate carboxylase protein crystal structures without a bound substrate (lpvd (Saccharomyces cerivisea), lpyd (Saccharomyces cerivisea), 2gli (Kluyveromyces lactis) and 2vbi (Acetobacter pasteurianus)) and pyruvate carboxylase protein crystal structures bound with natural substrate analogues (lqpb ⁇ Saccharomyces cerivisea) and lzpd (Zymomonas mobilis)).
  • An in silico structure is available through the PDB for an iron-bound alcohol dehydrogenase bound to a substrate and nicotinamide-adenine-dinucleotide-phosphate (Io2d (Thermotoga maritima), lpyd (Saccharomyces cerivisea), 2gli (Kluyveromyces lactis) and 2vbi (Acetobacter pasteurianus)).
  • Io2d Thermotoga maritima
  • lpyd Sacharomyces cerivisea
  • 2gli Kluyveromyces lactis
  • 2vbi Acetobacter pasteurianus
  • the overall energetic change of the substitution protein model when unbound and bound to its substrate is calculated and assessed by one having skill in the art to be evaluated for the change in free energy for correlations to overall structural stability (e.g., Meiler, J. and D. Baker, Proteins (2006) 65:538-548).
  • a rational design change to the primary structure of the protein sequences of the invention minimally alter the Gibb's free energy state of the unbound polypeptides and maintain a folded, functional and similar wild-type enzyme structure. More preferably a lower computational total free energy change of protein sequences of the invention is achieved to indicate the potential for optimized enzyme structural stability.
  • lower free energy of a protein structure relative to the wild type structure is an indicator of thermodynamic stability, the positive correlation of increased thermal stability to optimized function does not always exist.
  • optimal catalytic contacts between the modified protein structure and the substrate are achieved with a concomitant predicted favorable change in total free energy of the catabolic reaction, for example by rationally designing protein/substrate interactions that stabilize the transition state of the enzymatic reaction while maintaining a similar or favorable change in free energy of the unbound protein for a desired environment in which a host cell expresses the mutant protein.
  • rationally selected amino acid changes result in a substantially increased pdc enzyme's decarboxylation protein/substrate reaction, for example wherein pyruvate is converted to acetaldehyde for a desired environment in which a host cell expresses the mutant pdc protein.
  • rationally selected amino acid changes result in a substantially decreased pdc enzyme's acetoin by-product from protein/hydroxyethyl thiamine diphosphate reaction intermediate upon acetaldehyde binding and increased pdc enzyme's decarboxylation protein/substrate reaction, for example wherein pyruvate is converted to acetaldehyde for a desired environment in which a host cell expresses the mutant pdc protein.
  • pdc sequences are codon and expression optimized for the specific expression host cell.
  • adhl and adh2 enzymes For the adhl and adh2 enzymes, rationally selected amino acid changes result in a substantially decreased enzyme's anabolic protein/substrate reaction or increase the enzyme's catabolic protein/substrate reaction, for example wherein acetaldehyde is converted to ethanol for a desired environment in which a host cell expresses the mutant adhl/adh2 protein.
  • adhl/adh2 sequences of the invention are codon and expression optimized for the specific expression host cell.
  • adhE enzymes In another embodiment of adhE enzymes, rationally selected amino acid changes result in a substantially decreased adhE enzyme's oxidative protein/substrate reaction or increase the adhE enzyme's reductive protein/substrate reaction, for example wherein acetyl- CoA is converted to ethanol for a desired environment in which a host cell expresses the mutant adhE protein.
  • adhE sequences are expression optimized for the specific expression host cell.
  • PCR Polymerase Chain Reaction
  • the resultant mutant DNA sequences are genetically engineered into an appropriate vector to be expressed in a host cell and analyzed to screen and select for the desired effect on whole cell production of a product or process of interest.
  • random mutagenesis of nucleotide sequences of the invention is generated through error prone PCR using techniques well known to one skilled in the art. Resultant nucleotide sequences are analyzed for structural and functional attributes through clonal screening assays and other methods as described herein.
  • a specifically desired protein mutant is generated a using site-directed mutagenesis.
  • site-directed mutagenesis For example, with overlap extension (An, et al., Appl. Microbiol. Biotech. (2005) vol. 68(6):774-778) or mega-primer PCR (E. Burke and S. Barik, Methods MoI. Bio. (2003) vol 226:525-532) one can use nucleotide primers that have been altered at corresponding codon positions in the parent nucleotide to yield DNA progeny sequences containing the desired mutation. Alternatively, one can use cassette mutagenesis (Kegler- Ebo, et al., Nucleic Acids Res. (1994) vol. 22(9): 1593-1599) as is commonly known by one skilled in the art.
  • Another embodiment of the invention is to select for a polypeptide variant for expression in a recipient host cell by comparing a first nucleic acid sequence encoding the polypeptide with the nucleic acid sequence of a second, related nucleic acid sequence encoding a polypeptide having more desirable qualities, and altering at least one codon of the first nucleic acid sequence to have identity with the corresponding codon of the second nucleic acid sequence, such that improved polypeptide activity, substrate specificity, substrate affinity, substrate catalytic conversion rate, improved thermostability, activity at a different pH and/or optimized codon usage for expression and/or structure of the altered polypeptide is achieved in the host cell.
  • all amino acid residue variations are encoded at any desired, specified nucleotide codon position using such methods as site saturation mutagenesis (Meyers, et al., Science (1985) Vol. 229:242-247; Derbyshire, et al., Gene (1986) Vol. 46:145-152; U.S. Patent 6,171,820).
  • Site saturation mutagenesis Meth. Enzym. (2004) Vol. 388:3-11
  • All amino acid residue variations are encoded at every nucleotide codon position.
  • Both methods yield a population of protein variants differing from the parent polypeptide by one amino acid, with each amino acid substitution being correlated to structural/functional attributes at any position in the polypeptide.
  • Saturation mutagenesis uses PCR and primers homologous to the parent sequence wherein one or more codon encoding nucleotide triplets is randomized. Randomization results in the incorporation of codons corresponding to all amino acid replacements in the final, translated polypeptide.
  • Each PCR product is genetically engineered into an expression vector to be introduced into an expression host and screened for structural and functional attributes through clonal screening assays and other methods as described herein.
  • CSM correlated saturation mutagenesis
  • two or more amino acids at rationally designated positions are changed concomitantly to different amino acid residues to engineer improved enzyme function and structure.
  • Correlated saturation mutagenesis allows for the identification of complimentary amino acid changes having positive, synergistic effects on enzyme structure and function.
  • synergistic effects include, but are not limited to, significantly altered enzyme stability, substrate affinity or catalytic turnover rate, independently or concomitantly increasing advantageously the production of acetaldehyde and/or ethanol.
  • CSM is used at pdc residue positions (relative to SEQ ID NO:2) 437, 438, 439, 440, 441, 442, 443, 464, 465, 466, 467, 468 and 469, which are involved in or located near magnesium binding co-factor.
  • CSM is used at pdc residue positions (relative to SEQ ID NO:2) 110, 111, 112,113,114, 470, 471, 472, 472, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483 and 484, which are involved in or located near the enzyme active site.
  • CSM is used at pdc residue positions (relative to SEQ ID NO:2) 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 307, 308, 309, 310, 311, 312, 313, 316, 317, 318, 319, 320, 321, 322 and 323, which are involved in binding the substrate or located near the substrate binding site.
  • CSM is used at pdc residue positions (relative to SEQ ID NO:2) 25, 26, 27, 49, 50, 51, 74, 75, 76, 389, 390, 391, 411, 412, 413, 414, 415, 416, 417, 438, 437, 440, 441, 442, 443, 444, 445, 446, 447, 468, 469, 470, 471, 472, 473 and 474, which are involved in binding or located near the binding site for the thiamine diphosphate co-factor.
  • CSM is used to change pdc residue positions (relative to SEQ ID NO:2) 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112 and 113 concomitantly with each of all possible amino acid residues at any of residue positions 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, and 304, wherein each residue position is involved in or located near inter-subunit protomeric binding sites.
  • CSM is used at pdc residue positions (relative to SEQ ID NO:5) 432, 433, 434, 435, 436, 437, 438, 459, 460, 461, 462, 463 and 464, which are involved in binding or located near the binding site for the magnesium binding co-factor.
  • CSM is used at pdc residue positions (relative to SEQ ID NO:5) 109, 110, 111, 112, 113, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478 and 479 , which are involved in or located near the enzyme active site.
  • CSM is used at pdc residue positions (relative to SEQ ID NO:5) 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 306, 307, 308, 309, 310, 311, 312, 315, 316, 317, 318, 319, 320, 321 and 322, which are involved in binding or located near the binding site for the substrate.
  • CSM is used at pdc residue positions (relative to SEQ ID NO:5) 24, 25, 26, 48, 49, 50, 73, 74, 75, 384, 385, 386, 406, 407, 408, 409, 410, 411, 412, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 463, 464, 465, 466, 467, 468 and 469, which are involved in binding or located near the binding site for the thiamine pyrophosphate co-factor.
  • CSM is used to change pdc residue positions (relative to SEQ ID NO:5) 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111 and 112 concomitantly with each of all possible amino acid residues at any of residue positions 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, and 303, wherein each residue position is involved in or located near the inter-subunit protomeric binding sites.
  • CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:8) adh2 residue positions 192, 193, 194, 195, 196, 197, 198, 199, 200, 299, 300 and 301, which are involved in binding or located near the binding site for the iron co- factor.
  • CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:8) adh2 residue positions 9, 13, 31, 90 and 250, which are involved in structural thermostability.
  • CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:8) adh2 residue positions 119, 120, 121, 122, 151, 152, 153, 154, 155, 159, 160, 161, 162, 162, 163, 164, 165 and 166, which are involved in binding or located near the binding site for the substrate.
  • CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:8) adh2 residue positions 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282 and 283, which are involved in or located near the active site.
  • CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:8) adh2 residue positions 37, 38, 39, 40, 41, 42, 44, 45, 46, 69, 70, 71, 96, 97, 98, 99 100, 101, 102, 103, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 158, 159, 160, 181, 182, 183, 186, 187, 188, 190, 191, 192, 193, 194, 195, 197, 198, 199, 276, 277 and 278, which are involved in binding or located near the binding site for the nicotinamide adenine dinucleotide co-factor.
  • CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:8) adh2 residue positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 210, 211, 212, 213, 214 and 215, wherein each residue position is involved in or located near inter- subunit protomeric binding sites.
  • CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:11) adhl residue positions 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125 and 126, which are involved in binding or located near the binding site for the zinc co-factor.
  • CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:11) adhl residue positions 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 100, 101, 102, 103, 104, 105, 106, 107, 108, 147, 148, 149, 150, 151, 152, 153, 154, 155, 254, 255, 256, 257, 258, 259, 260, 261, 262, 26
  • CSM is used to alter the amino acids of homologous (relative to SEQ ID NO: 11) adhl residue positions 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 164, 165, 166, 167, 168, 169, 170, 179, 180, 181, 182, 183,
  • CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:14) adhl residue positions 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 56, 57, 58, 59, 60, 61, 62, 63, 64, 148, 149, 150, 151, 152, and 153, which are involved in binding or located near the binding site for the zinc co-factor.
  • CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:14) adhl residue positions 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 182, 183, 184,
  • CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:14) adhl residue positions 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 108, 109, 110, 111, 112, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253,
  • CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:14) adhl residue positions 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 251, 252, 253, 254, 255, 256, 257, 258, 2
  • CSM is used to alter the amino acids of SEQ ID NO:17 positions 660, 661, 662, 663, 664, 665, 666, 667, 668, 766, 767, and 768, and amino acids of SEQ ID NO:20 positions 654, 655, 656, 657, 658, 659, 660, 661 and 662, and homologous positions in adhE homologues of Table 8 and 9, which are involved in binding or located near the binding site for the iron co-factor.
  • CSM is used to alter the amino acids of SEQ ID NO: 17 positions 275, 276, 277, 573, 574 and 575, and amino acids of SEQ ID NO:20 positions 266, 267, 268, 567, 568 and 569, and homologous positions in adhE homologues of Table 8 and 9, which are involved in or located near regions involved in metal catalyzed protein oxidation.
  • CSM is used to alter the amino acids of SEQ ID NO:17 positions 449, 450, 451, 452, 453, 470, 471, 472, 528, 529, 530, 722, 723 and 724, and amino acids of SEQ ID NO:20 positions 441, 442, 443, 444, 445, 462, 463, 464, 522, 523, 524, 716, 717 and 718, and homologous positions in adhE homologues of Table 8 and 9, which are involved in structural thermostability.
  • CSM is used to alter the amino acids of SEQ ID NO:17 positions 573, 574, 575, 576, 616, 617, 618, 619, 620, 621, 625, 626, 627, 628, 629, 630, 631, 632, 633 and 634, and amino acids of SEQ ID NO:20 positions 567, 568, 569, 570, 571, 610, 611, 612, 613, 614, 615, 619, 620, 621, 622, 623, 624, 625, 626, 627 and 628, and homologous positions in adhE homologues of Table 8 and 9, which are involved in binding or located near the substrate binding site of the adhE alcohol dehydrogenase domain.
  • CSM is used to alter the amino acids of SEQ ID NO:17 positions 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753 and 754, and amino acids of SEQ ID NO:20 positions 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747 and 748, and homologous positions in adhE homologues of Table 8 and 9, which are involved in or located near the active site of the adhE alcohol dehydrogenase domain.
  • CSM is used to alter the amino acids of SEQ ID NO:17 positions 492, 493, 494, 495, 496, 497, 498, 499, 500, 523, 524, 525, 550, 551, 552, 553, 554, 555, 556, 557, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 747, 748 and 749, and amino acids of SEQ ID NO:20 positions 486, 487, 488, 489, 490, 491, 492, 493, 494, 517, 518, 519, 544, 5
  • CSM is used to alter the amino acids of SEQ ID NO: 17 positions 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190 ,191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209 and 210, and amino acids of SEQ ID NO:20 positions 110,
  • CSM is used to alter the amino acids of SEQ ID NO: 17 positions 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 104, 105, 106, 107, 108, 109, 110, 111,
  • CSM is used to alter the amino acids of SEQ ID NO: 17 positions 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486 and 487, and amino acids of SEQ ID NO: 20 positions 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479 and 480, and homologous positions in adhE homologues of Table 8 and 9, which are involved in or located near an inter-domain linker region.
  • amino acid substitution combinations of CSM derived protein variants being optimized for a particular function are combined with one or more CSM derived protein variants being optimized for another particular function to derive a pdc, adhl, adh2, and/or adhE protein variant exhibiting multiple optimized structural and functional characteristics.
  • amino acid changes in combinatorial mutants showing optimized protomer interactions, thermostability are combined with amino acid changes in combinatorial mutants showing optimized catalytic turnover.
  • mutational variants derived from the methods described herein are cloned.
  • DNA sequences produced by saturation mutagenesis are designed to have restriction sites at the ends of the gene sequences to allow for excision and transformation into a host cell plasmid.
  • Generated plasmid stocks are transformed into a host cell and incubated at optimal growth conditions to identify successfully transformed colonies.
  • Another embodiment utilizes gene shuffling (P. Stemmer, Nature (1994) Vol. 370:389-391) or gene reassembly (US 5,958,672) to develop improved protein structure/function through the generation of chimeric proteins.
  • gene shuffling two or more homologous nucleotide sequences both encoding alcohol dehydrogenase, pyruvate decarboxylase or bi-functional alcohol dehydrogenase are treated with endonucleases at random positions, mixed together, heated until sufficiently melted and reannealed.
  • non-bi-functional, single domain protein homologue encoding nucleotide sequences can be treated similarly and used together with a bi-functional alcohol dehydrogenase for gene shuffling.
  • Nucleotide sequences from homologues will anneal to develop a population of chimeric genes that are repaired to fill in any gaps resulting from the re-annealing process, expressed and screened for improved structure/function enzyme chimeras.
  • Gene reassembly is similar to gene shuffling; however, nucleotide sequences for specific, homologous alcohol dehydrogenase, protein pyruvate decarboxylase or bi-functional alcohol dehydrogenase domains are targeted and swapped with other homologous domains for reassembly into a chimeric gene.
  • the genes are expressed and screened for improved structure/function enzyme chimeras.
  • any and/or all sequences additionally are codon and expression optimized for the specific expression host cell.
  • Variations in expressed polypeptide sequences may result in measurable differences in the whole-cell rate of substrate conversion. It is desirable to determine differences in the rate of substrate conversion by assessing productivity in a host cell having a particular protein variant relative to other whole cells having a different protein variant. Additionally, it would be desirable to determine the efficacies of whole-cell substrate conversion as a function of environmental factors including, but not limited to, pH, temperature nutrient concentration and salinity.
  • the biophysical analyses described herein on protein variants of the invention are performed to measure structural/functional attributes.
  • Standard analyses of polypeptide activity are well known to one of ordinary skill in the art. Such analysis can require the expression and high purification of large quantities of polypeptide, followed by various physical methods (including, but not limited to, calorimetry, fluorescence, spectrophotometric, spectrometric, liquid chromatography (LC), mass spectrometry (MS), LC-MS, affinity chromatography, light scattering, nuclear magnetic resonance and the like) to assay function, function in a specific environment or functional differences among homologues.
  • polypeptides are expressed, purified and subject to the aforementioned analytical techniques to assess the functional difference among polypeptide sequence homologues, for example, the rate of substrate conversion specific for a particular enzyme function.
  • Batch culture (or closed system culture) analysis is well known in the art and can provide information on host cell population effects for host cells expressing genetically engineered genes. In batch cultures a host cell population will grow until available nutrients are depleted from the culture media.
  • the polypeptides are expressed in a batch culture and analyzed for approximate doubling times, expression efficacy of the engineered polypeptide and end-point net product formation and net biomass production.
  • Turbidostats are well known in the art as one form of a continuous culture within which media and nutrients are provided on an uninterrupted basis and allow for non-stop propagation of host cell populations. Turbidostats allow the user to determine information on whole cell propagation and steady-state productivity for a particular biologically produced end product such as host cell doubling time, temporally delimited biomass production rates for a particular host cell population density, temporally delimited host cell population density effects on substrate conversion and net productivity of a host cell substrate conversion of, for example, acetyl-CoA or pyruvate to acetaldehyde and acetaldehyde to ethanol. Turbidostats can be designed to monitor the partitioning of substrate conversion products to the liquid or gaseous state.
  • identical host cell lines differing only in the nucleic acid and expressed polypeptide sequence of a homologous enzyme are cultured in a uniform- environment turbidostat to determine highest whole cell efficacy for the desired carbon-based product of interest.
  • identical host cell lines differing only in the nucleic acid and expressed polypeptide sequence of a homologous enzyme are cultured in a batch culture or a turbidostat in varying environments (e.g., temperature, pH, salinity, nutrient exposure) to determine highest whole cell efficacy for the desired carbon-based product of interest.
  • mutational variants derived from the methods described herein are cloned.
  • DNA sequences produced by saturation mutagenesis are designed to have restriction sites at the ends of the gene sequences to allow for excision and transformation into a host cell plasmid.
  • Generated plasmid stocks are transformed into a host cell and incubated at optimal growth conditions to identify successfully transformed colonies.
  • a colorimetric assay is used to screen for acetaldehyde to qualitatively determine enzymatic activity of protein variants.
  • Schiff reagents such as mixtures of pararosaniline and bisulfate have been used to detect aldehydes in organisms such as Z. mobilis that produce aldehydes (Lillie, R.D. (1977) H.J. Conn 's Biological Stains, 9 th ed. (The Williams & Wilkins Co., Baltimore) p259-266).
  • the reagents are combined in a low light or dark environment into a top agar solid medium, allowed to cool to near ambient temperatures and poured on top of A + plates incubated with transformed bacteria. After continued incubation of the top agar plates with transformed bacterial colonies in the dark, acetaldehyde present from pdc variant enzyme activity in pdc-positive cells turn red (Conway, et ah, J. BacterioL, (1987) Vol. 169:2591-2597).
  • narrow bandwidth light sources or narrow through- pass light filters are used to screen for acetaldehyde and qualitatively determine pdc activity of protein variants.
  • Pararosaniline has a maximum absorbance of around 550 nm that converts the reagent from clear to red.
  • Transformed host cells are plated on media containing the Schiff reagent and incubated with monochromatic light emitting diodes or a blue shifted bandpass filter.
  • Such light sources will maximize light wavelengths available to the cell above 600 nm, and preferably above 650 nm, and minimize or eliminate light waves below 600 nm.
  • Indicator plates are prepared as described in Conway, et al. (J. BacterioL, (1987) Vol. 169:2591-2597). Genes for the adhl and/or adh2 variants are integrated into an expression plasmid, for example pCDFDuet-1 and transformed into a suitable host, for example, E. coli strain NEB DH5 ⁇ (Novagen). Transformed colonies grown on indicator plates having a functional adhl and/or adh2 variant convert ethanol in the indicator plate media to acetaldehyde. The acetaldehyde will react with the paroraniline, converting it to the leuco form that is an intense red dye color.
  • This screen assay indicates a functional alcohol dehydrogenase enzyme for which the efficacy of the desired reverse reaction, acetaldehyde to ethanol, is quantitatively determined.
  • Quantitative evaluation of the efficacy of acetaldehyde to ethanol conversion by the adhl and/or adh2 variant is performed by engineering the functional adhl and/or adh2 variants into host cells expressing pyruvate decarboxylase and grown in batch culture or a turbidostat. Pyruvate decarboxylase converts cellular pyruvate to acetaldehyde, which in turns serves as the substrate for adh2.
  • Acetaldehyde is used primarily as an intermediate chemical for the production of compounds including, but not limited to, acetic acid, acetic anhydride, n-butanol, ethyl acetate, peracetic acid, pentaerythritol, chloral, glyoxal, alkylamines, pyridines and 2-ethylhexanol.
  • Such end-compounds are used, for example, in the commercial and industrial production of flavorings, beverages, perfumes, plastics, aniline dyes, synthetic rubber and laboratory research.
  • acetaldehyde also serves as a substrate for the production of ethanol through the fermentative process of biological organisms.
  • Ethanol has various commercial applications including use as a solvent, antiseptic, rocket propellant, renewable automotive fuel source and as a base compound for the manufacture of other industrially important organic compounds.
  • the invention includes the conversion of pyruvate into acetaldehyde using the pdc enzymes described herein.
  • the invention includes producing acetaldehyde from pyruvate using genetically engineered host cells expressing a pdc gene and the pdc gene product.
  • the genetically engineered host cells produce pyruvate, or convertible analog thereof, which can be a substrate for the conversion into acetaldehyde, or an analog thereof.
  • the genetically engineered host cells expresses a pdc gene and gene product and one or more ethanologenic genes enabling the host cell to convert a sugar capable of being converted into pyruvate, or a pyruvate analog, under culture conditions wherein acetaldehyde (or analog thereof) is produced.
  • the genetically engineered host cell is processed into an enzymatic lysate for performing the above conversion reaction.
  • the pdc gene product is purified, as described herein, for carrying out the conversion reaction.
  • the host cells and/or enzymes (e.g., in the lysate, partially purified, or purified) used in the conversion reactions are in a form allowing them to perform their intended function (e.g., producing a desired compound, e.g., acetaldehyde).
  • the microorganisms used can be whole cells, or can be only those portions of the cells necessary to obtain the desired end result.
  • the microorganisms can be suspended (e.g., in an appropriate solution such as buffered solutions or media), rinsed (e.g., rinsed free of media from culturing the microorganism), acetone-dried, immobilized (e.g., with polyacrylamide gel or ⁇ -carrageenan or on synthetic supports, for example, beads, matrices and the like), fixed, cross-linked or permeabilized (e.g., have permeabilized membranes and/or walls such that compounds, for example, substrates, intermediates or products can more easily pass through said membrane or wall).
  • an appropriate solution such as buffered solutions or media
  • rinsed e.g., rinsed free of media from culturing the microorganism
  • acetone-dried e.g., immobilized (e.g., with polyacrylamide gel or ⁇ -carrageenan or on synthetic supports, for example, beads, matrices and the like)
  • immobilized e.g., with polyacryl
  • purified or unpurified pdc enzymes are used in the conversion reactions.
  • the enzyme is in a form that allows it to perform its intended function.
  • the enzyme can be immobilized, conjugated or floating freely.
  • the pdc enzymes are chimeric wherein a polypeptide linker is encoded between the pdc enzyme and another enzyme.
  • the vector encoding pdc also encodes a non-enzymatically functional linker and an alcohol dehydrogenase enzyme as one transcriptional unit.
  • two enzymes of a metabolic pathway are tethered together by a polypeptide linker.
  • Such arrangement of two or more functionally related proteins tethered together in a host cell increases the local effective concentration of metabolically related enzymes that can increase the efficiency of substrate conversion.
  • Ethanol has various commercial applications including use as a solvent, antiseptic, rocket propellant, renewable fuel source and as a base compound for the manufacture of other industrially important organic compounds. Therefore, it is desirable to engineer into an organism better suited for industrial use a genetic system from which ethanol can be produced efficiently and cleanly.
  • the invention includes the conversion of acetaldehyde into ethanol using the alcohol dehydrogenase and bi-functional alcohol dehydrogenase enzymes described herein.
  • the invention includes producing ethanol from acetaldehyde using genetically engineered host cells expressing an adhl and/or adh2 gene and the adhl and/or adh2 gene product.
  • the genetically engineered host cells produce acetaldehyde, or convertible analog thereof, which can be a substrate for the conversion into ethanol, or an analog thereof.
  • the invention includes the conversion of acetyl-CoA into ethanol using the bi-functional alcohol dehydrogenase enzymes described herein.
  • the invention includes producing ethanol from acetyl-CoA using genetically engineered host cells expressing an adhE gene.
  • the genetically engineered host cells produce acetaldehyde, or convertible analog thereof, from acetyl-CoA, which can be a substrate for the conversion into ethanol, or an analog thereof.
  • the genetically engineered host cells expresses an adhl, adh2, and/or adhE gene and gene product and one or more ethanologenic genes enabling the host cell to convert a sugar capable of being converted into acetaldehyde, or a acetaldehyde analog, under culture conditions wherein ethanol (or analog thereof) is produced.
  • the genetically engineered host cell is processed into an enzymatic lysate for performing the above conversion reaction.
  • the adhl, adh2, and/or adhE gene product is purified, as described herein, for carrying out the conversion reaction.
  • the host cells and/or enzymes (e.g., in the lysate, partially purified, or purified) used in the conversion reactions are in a form allowing them to perform their intended function (e.g., producing a desired compound, e.g., ethanol).
  • the microorganisms used can be whole cells, or can be only those portions of the cells necessary to obtain the desired end result.
  • the microorganisms can be suspended (e.g., in an appropriate solution such as buffered solutions or media), rinsed (e.g., rinsed free of media from culturing the microorganism), acetone-dried, immobilized (e.g., with polyacrylamide gel or ⁇ -carrageenan or on synthetic supports, for example, beads, matrices and the like), fixed, cross-linked or permeabilized (e.g., have permeabilized membranes and/or walls such that compounds, for example, substrates, intermediates or products can more easily pass through said membrane or wall).
  • an appropriate solution such as buffered solutions or media
  • rinsed e.g., rinsed free of media from culturing the microorganism
  • acetone-dried e.g., immobilized (e.g., with polyacrylamide gel or ⁇ -carrageenan or on synthetic supports, for example, beads, matrices and the like)
  • immobilized e.g., with polyacryl
  • purified or unpurified adhl, adh2, and/or adhE enzymes are used in the conversion reactions.
  • the enzyme is in a form that allows it to perform its intended function.
  • the enzyme can be immobilized, conjugated or floating freely.
  • adhl, adh2, and/or adhE enzymes are chimeric wherein a polypeptide linker is encoded between the adhl, adh2, or adhE enzyme and another enzyme.
  • the vector encoding adhl, adh2, or adhE also encodes a non- enzymatically functional linker and a pyruvate dehydrogenase enzyme as one transcriptional unit.
  • two enzymes of a metabolic pathway are tethered together by a polypeptide linker.
  • Such arrangement of two or more functionally related proteins tethered together in a host cell increases the local effective concentration of metabolically related enzymes that can increase the efficiency of substrate conversion.
  • the DNA sequences encoding the promoter, open reading frames, and intergenic sequences in the case of operons are as follows.
  • the first lower case sequence corresponds to the aphll promoter (SEQ ID NO:24)
  • the first upper case sequence to pdc from Z. palmae SEQ ID NO:25
  • the second lower case sequence the cpcB promoter from Synechocystis sp. PCC 6803
  • the second upper case sequence the adhl sequence from Z. mobilis SEQ ID NO:
  • the lower case sequence corresponds to the cpcB promoter from Synechocystis sp. PCC 6803 (SEQ ID NO:28) and the upper case sequence to the bifunctional adhE sequence from E. coli (SEQ ID NO:29) (this sequence encodes a E568K point mutation that minimizes the oxygen sensitivity of the enzyme (Holland-Staley, C. A. et al, J. Bacteriol. 182:6049-6054 (2000)):
  • the first lower case sequence corresponds to the aphll promoter (SEQ ID NO:30), the first upper case sequence to pdc from Z. palmae (SEQ ID NO:31), the second lower case sequence the cpcB promoter from Synechocystis sp. PCC 6803 (SEQ ID NO:32), and the second upper case sequence the codon-optimized adhE gene from E. histolytica (SEQ ID NO:33):
  • the first lower case sequence corresponds to the aphll promoter (SEQ ID NO:34), the first upper case sequence to pdc from Z. mobilis (SEQ ID NO:35), the second lower case sequence is an intergenic sequence (SEQ ID NO: 36), and the second upper case sequence the adhll gene from Z. mobilis (SEQ ID NO: 37):
  • the first lower case sequence corresponds to the aphll promoter ((SEQ ID NO:38), the first upper case sequence to pdc from Z mobilis (SEQ ID NO:39), the second lower case sequence is an intergenic sequence (SEQ ID NO:40), and the second upper case sequence the adhl gene from Z. mobilis (SEQ ID NO:41):
  • each flask culture was determined so that sterile dH 2 O could be added at sampling times to account for evaporation.
  • 300 ⁇ l of culture was removed and the cultures were replenished with an equal amount of fresh JB2.1 medium.
  • samples were taken and their OD730 was measured.
  • 100 ⁇ l of cell-free samples was used to determine the liquid EtOH concentration by gas chromatography/flame ionization detection (GC/FID).
  • GC/FID gas chromatography/flame ionization detection
  • the stripping rate of EtOH was determined in cell-free cultures under the same conditions used.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Genes encoding alcohol dehydrogenase and pyruvate decarboxylase, methods improving alcohol dehydrogenase and pyruvate decarboxylase activities, methods for optimizing expression of alcohol dehydrogenase and pyruvate decarboxylase in host cells, and methods for the production of carbon-based products of interest by the host cells are disclosed.

Description

METHODS AND COMPOSITIONS FOR PRODUCING CARBON-BASED PRODUCTS OF INTEREST IN MICRO-ORGANISMS
David Arthur Berry, Dan Eric Robertson, Brian Green, Frank Anthony Skraly,
Sriram Kosuri, Nikos Reppas
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. provisional applications 61/109,878, 61/109,866, and 61/109,874 filed October 30, 2008; 61/121,087 and 61/121,091 filed December 9, 2008; and 61/139,511 filed December 19, 2008.
FIELD OF THE INVENTION
[0002] This invention generally relates to genes useful in producing carbon-based products of interest in host cells. The invention also relates to methods for producing fuels and chemicals through engineering metabolic pathways in photosynthetic and non- photosynthetic organisms.
BACKGROUND OF THE INVENTION
[0003] The United States produces over 8 billion gallons of fuel ethanol each year from corn starch or cane syrup using methods of bioconversion with microorganisms. However, both cane sugar and corn starch are relatively expensive starting materials, having competing uses as food products. Furthermore, these carbohydrate sources represent only a fraction of the potentially usable carbohydrate resources available from plants for conversion to ethanol, although the metabolic intermediates of other plant carbohydrates yield sugars that cannot be efficiently and rapidly converted to ethanol. Therefore, alternative methods are desirable for the clean and efficient production of ethanol that would have widespread commercial and industrial benefits.
[0004] Natural metabolic pathways for producing ethanol through fermentative processes are commonly found in plants, yeast and various fungi, while being less common in bacteria and entirely absent in animals. One ethanol production pathway utilizes two key enzymes, pyruvate decarboxylase and alcohol dehydrogenase. Pyruvate decarboxylase, only rarely found in bacteria, converts pyruvate to acetaldehyde, with acetaldehyde also having important industrial applications. Alcohol dehydrogenase, more commonly found in a diverse array of bacterial organisms, converts acetaldehyde to ethanol. It has been demonstrated that an ethanol production metabolic pathway utilizing pyruvate decarboxylase and alcohol dehydrogenase can be engineered into microorganisms for the production of ethanol from nutrient rich growth media (Brau and Sahm (1986) Arch. Microbiol. Vol. 144:296-301; U.S. 5,000,000; US 5,028,539). Another ethanol production pathway utilizes one key enzyme having two functional domains: aldehyde oxido-reductase and iron-binding alcohol dehydrogenase. Research efforts have shown that this so-called bi-functional alcohol dehydrogenase enzyme can be made functional in aerobic conditions amenable for ethanol synthesis (Holland-Staley, et al, (2000) J. Bacteriology Vol. 182:6049-6054). While these genes have been characterized for the kinetics and thermodynamics of ethanol production, optimization efforts for these genes in an engineered organism has not led to significant increases in ethanol production. Specifically, the level of ethanol produced by these engineered microorganisms has been insufficient for commercial sale.
SUMMARY OF THE INVENTION
[0005] The invention relates to a metabolic system and methods employing such systems in the production of bio fuels and chemicals. Various microorganisms are genetically engineered to use pyruvate decarboxylase, alcohol dehydrogenase and/or a bi-functional alcohol dehydrogenase for the production of ethanol.
[0006] The invention, therefore, provides isolated polynucleotides comprising or consisting of nucleic acid sequences selected from the group consisting of coding sequences for an alcohol dehydrogenase gene, a pyruvate decarboxylase gene, and a bi-functional alcohol dehydrogenase gene, codon/expression optimized variants for these nucleic acid sequences and related nucleic acid sequences and fragments. Also provided are vectors and host cells comprising these isolated polynucleotides.
[0007] The invention further provides isolated polypeptides comprising or consisting of polypeptide sequences selected from the group consisting of sequences encoded by an alcohol dehydrogenase gene, a pyruvate decarboxylase gene, and a bi-functional alcohol dehydrogenase gene, and related polypeptide sequences, fragments and fusions.
[0008] Antibodies that specifically bind to the isolated polypeptides of the invention are also provided.
[0009] The invention also provides methods for expressing in a host cell a heterologous nucleic acid sequence encoding improved alcohol dehydrogenase activity of the alcohol dehydrogenase gene, improved pyruvate decarboxylase activity of the pyruvate decarboxylase gene, and/or improved bi-functional alcohol dehydrogenase activity of the bi- functional alcohol dehydrogenase gene.
[0010] The invention also provides coding sequences for the alcohol dehydrogenase gene, the pyruvate decarboxylase gene, and the bi-functional alcohol dehydrogenase gene, nucleic acid sequences that are a codon optimized coding sequences for the alcohol dehydrogenase gene, the pyruvate decarboxylase gene, and the bi-functional alcohol dehydrogenase gene and related nucleic acid sequences and fragments.
[0011] Accordingly, the invention described herein provides genes which can be expressed at high levels in a range of organisms that encode enzymes required to decarboxylate pyruvate and reduce acetaldehyde for the production of ethanol and other carbon based products of interest. When used in combination with other genes essential for the biosynthetic production of ethanol high levels of ethanol production are achieved. Organisms such as a recombinant or ethanologenic bacterium (for example, cyanobacteria) are genetically modified to optimize production of ethanol using light, water and carbon dioxide. Alternatively, microorganisms are used to produce ethanol using a renewable food source (for example, exogenous biomass such as fermentable sugars).
DETAILED DESCRIPTION OF THE INVENTION
[0012] Unless otherwise defined herein, scientific and technical terms used in connection with the invention shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular. Generally, nomenclatures used in connection with, and techniques of, biochemistry, enzymology, molecular and cellular biology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well known and commonly used in the art. The methods and techniques of the invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. See, e.g., Sambrook et al. Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. (1989); Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992, and Supplements to 2002); Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. (1990); Taylor and Drickamer, Introduction to Glycobiology, Oxford Univ. Press (2003); Worthington Enzyme Manual, Worthington Biochemical Corp., Freehold, N. J.; Handbook of Biochemistry: Section A Proteins, Vol. I, CRC Press (1976); Handbook of Biochemistry: Section A Proteins, Vol. II, CRC Press (1976); Essentials of Glycobiology, Cold Spring Harbor Laboratory Press (1999).
[0013] The following terms, unless otherwise indicated, shall be understood to have the following meanings:
[0014] The term "polynucleotide" or "nucleic acid molecule" refers to a polymeric form of nucleotides of at least 10 bases in length. The term includes DNA molecules (e.g., cDNA or genomic or synthetic DNA) and RNA molecules (e.g., mRNA or synthetic RNA), as well as analogs of DNA or RNA containing non-natural nucleotide analogs, non-native inter- nucleoside bonds, or both. The nucleic acid can be in any topological conformation. For instance, the nucleic acid can be single-stranded, double-stranded, triple-stranded, quadruplexed, partially double-stranded, branched, hair-pinned, circular, or in a padlocked conformation.
[0015] Unless otherwise indicated, and as an example for all sequences described herein under the general format "SEQ ID NO:", "nucleic acid comprising SEQ ID NO:1" refers to a nucleic acid, at least a portion of which has either (i) the sequence of SEQ ID NO:1, or (ii) a sequence complementary to SEQ ID NO: 1. The choice between the two is dictated by the context. For instance, if the nucleic acid is used as a probe, the choice between the two is dictated by the requirement that the probe be complementary to the desired target.
[0016] An "isolated" or "substantially pure" nucleic acid or polynucleotide (e.g., an RNA, DNA or a mixed polymer) is one which is substantially separated from other cellular components that naturally accompany the native polynucleotide in its natural host cell, e.g., ribosomes, polymerases and genomic sequences with which it is naturally associated. The term embraces a nucleic acid or polynucleotide that (1) has been removed from its naturally occurring environment, (2) is not associated with all or a portion of a polynucleotide in which the "isolated polynucleotide" is found in nature, (3) is operatively linked to a polynucleotide which it is not linked to in nature, or (4) does not occur in nature. The term "isolated" or "substantially pure" also can be used in reference to recombinant or cloned DNA isolates, chemically synthesized polynucleotide analogs, or polynucleotide analogs that are biologically synthesized by heterologous systems. [0017] However, "isolated" does not necessarily require that the nucleic acid or polynucleotide so described has itself been physically removed from its native environment. For instance, an endogenous nucleic acid sequence in the genome of an organism is deemed "isolated" herein if a heterologous sequence is placed adjacent to the endogenous nucleic acid sequence, such that the expression of this endogenous nucleic acid sequence is altered. In this context, a heterologous sequence is a sequence that is not naturally adjacent to the endogenous nucleic acid sequence, whether or not the heterologous sequence is itself endogenous (originating from the same host cell or progeny thereof) or exogenous (originating from a different host cell or progeny thereof). By way of example, a promoter sequence can be substituted (e.g., by homologous recombination) for the native promoter of a gene in the genome of a host cell, such that this gene has an altered expression pattern. This gene would now become "isolated" because it is separated from at least some of the sequences that naturally flank it.
[0018] A nucleic acid is also considered "isolated" if it contains any modifications that do not naturally occur to the corresponding nucleic acid in a genome. For instance, an endogenous coding sequence is considered "isolated" if it contains an insertion, deletion or a point mutation introduced artificially, e.g., by human intervention. An "isolated nucleic acid" also includes a nucleic acid integrated into a host cell chromosome at a heterologous site and a nucleic acid construct present as an episome. Moreover, an "isolated nucleic acid" can be substantially free of other cellular material or substantially free of culture medium when produced by recombinant techniques or substantially free of chemical precursors or other chemicals when chemically synthesized.
[0019] As used herein, the phrase "degenerate variant" of a reference nucleic acid sequence encompasses nucleic acid sequences that can be translated, according to the standard genetic code, to provide an amino acid sequence identical to that translated from the reference nucleic acid sequence. The term "degenerate oligonucleotide" or "degenerate primer" is used to signify an oligonucleotide capable of hybridizing with target nucleic acid sequences that are not necessarily identical in sequence but that are homologous to one another within one or more particular segments.
[0020] The term "percent sequence identity" or "identical" in the context of nucleic acid sequences refers to the residues in the two sequences which are the same when aligned for maximum correspondence. The length of sequence identity comparison may be over a stretch of at least about nine nucleotides, usually at least about 20 nucleotides, more usually at least about 24 nucleotides, typically at least about 28 nucleotides, more typically at least about 32 nucleotides, and preferably at least about 36 or more nucleotides. There are a number of different algorithms known in the art which can be used to measure nucleotide sequence identity. For instance, polynucleotide sequences can be compared using FASTA, Gap or Bestfit, which are programs in Wisconsin Package Version 10.0, Genetics Computer Group (GCG), Madison, Wis. FASTA provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. Pearson, Methods Enzymol. 183:63-98 (1990) (hereby incorporated by reference in its entirety). For instance, percent sequence identity between nucleic acid sequences can be determined using FASTA with its default parameters (a word size of 6 and the NOPAM factor for the scoring matrix) or using Gap with its default parameters as provided in GCG Version 6.1, herein incorporated by reference. Alternatively, sequences can be compared using the computer program, BLAST (Altschul et al., J. MoI. Biol. 215:403-410 (1990); Gish and States, Nature Genet. 3:266-272 (1993); Madden et al, Meth. Enzymol. 266:131-141 (1996); Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997); Zhang and Madden, Genome Res. 7:649-656 (1997)), especially blastp or tblastn (Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997)).
[0021] A particular, non- limiting example of a mathematical algorithm utilized for the comparison of sequences is that of Karlin and Altschul (Proc. Natl. Acad. Sci. (1990) USA 87:2264-68; Proc. Natl. Acad. Sci. USA (1993) 90: 5873-77) as used in the NBLAST and XBLAST programs (version 2.0) of Altschul et al. (J. MoI. Biol. (1990) 215:403-10). BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to nucleic acid molecules of the invention. BLAST polypeptide searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to polypeptide molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (Nucleic Acids Research (1997) 25(17):3389-3402). When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used
(http://www.ncbi.nlm.nih.gov). One skilled in the art may also use the ALIGN program incorporating the non-linear algorithm of Myers and Miller (Comput. Appl. Biosci. (1988) 4:11-17). For amino acid sequence comparison using the ALIGN program one skilled in the art may use a PAM 120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. [0022] The term "substantial homology" or "substantial similarity," when referring to a nucleic acid or fragment thereof, indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, preferably at least about 90%, and more preferably at least about 95%, 96%, 97%, 98% or 99% of the nucleotide bases, as measured by any well-known algorithm of sequence identity, such as FASTA, BLAST or Gap, as discussed above.
[0023] Alternatively, substantial homology or similarity exists when a nucleic acid or fragment thereof hybridizes to another nucleic acid, to a strand of another nucleic acid, or to the complementary strand thereof, under stringent hybridization conditions. "Stringent hybridization conditions" and "stringent wash conditions" in the context of nucleic acid hybridization experiments depend upon a number of different physical parameters. Nucleic acid hybridization will be affected by such conditions as salt concentration, temperature, solvents, the base composition of the hybridizing species, length of the complementary regions, and the number of nucleotide base mismatches between the hybridizing nucleic acids, as will be readily appreciated by those skilled in the art. One having ordinary skill in the art knows how to vary these parameters to achieve a particular stringency of hybridization.
[0024] In general, "stringent hybridization" is performed at about 25 0C below the thermal melting point (Tm) for the specific DNA hybrid under a particular set of conditions. "Stringent washing" is performed at temperatures about 5 0C lower than the Tm for the specific DNA hybrid under a particular set of conditions. The Tm is the temperature at which 50% of the target sequence hybridizes to a perfectly matched probe. See Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989), page 9.51, hereby incorporated by reference. For purposes herein, "stringent conditions" are defined for solution phase hybridization as aqueous hybridization (i.e., free of formamide) in 6xSSC (where 2OxSSC contains 3.0 M NaCl and 0.3 M sodium citrate), 1% SDS at 65 0C for 8-12 hours, followed by two washes in 0.2xSSC, 0.1% SDS at 650C for 20 minutes. It will be appreciated by the skilled worker that hybridization at 65 0C will occur at different rates depending on a number of factors including the length and percent identity of the sequences which are hybridizing. [0025] A preferred, non- limiting example of stringent hybridization conditions includes hybridization in 4x sodium chloride/sodium citrate (SSC), at about 65-70 0C (or hybridization in 4x SSC plus 50% formamide at about 42-50 0C) followed by one or more washes in Ix SSC, at about 65-70 0C. A preferred, non-limiting example of highly stringent hybridization conditions includes hybridization in Ix SSC, at about 65-70 0C (or hybridization in Ix SSC plus 50% formamide at about 42-50 0C) followed by one or more washes in 0.3x SSC, at about 65-70 0C. A preferred, non-limiting example of reduced stringency hybridization conditions includes hybridization in 4x SSC, at about 50-60 0C (or alternatively hybridization in 6x SSC plus 50% formamide at about 40-45 0C) followed by one or more washes in 2x SSC, at about 50-60 0C. Intermediate ranges e.g., at 65-70 0C or at 42-50 0C are also within the scope of the invention. SSPE (Ix SSPE is 0.15 M NaCl, 10 mM NaH2PO4, and 1.25 mM EDTA, pH 7.4) can be substituted for SSC (Ix SSC is 0.15 M NaCl and 15 mM sodium citrate) in the hybridization and wash buffers; washes are performed for 15 minutes each after hybridization is complete. The hybridization temperature for hybrids anticipated to be less than 50 base pairs in length should be 5-10 0C less than the melting temperature (Tm) of the hybrid, where Tm is determined according to the following equations. For hybrids less than 18 base pairs in length, Tm (°C)=2(# of A+T bases)+4(# of G+C bases). For hybrids between 18 and 49 base pairs in length, Tm(°C)=81.5+16.6(logi0[Na+]) +0.41 (% G+C)-(600/N), where N is the number of bases in the hybrid, and [Na+] is the concentration of sodium ions in the hybridization buffer ([Na+] for Ix SSC=0.165 M).
[0026] The skilled practitioner recognizes that reagents can be added to hybridization and/or wash buffers. For example, to decrease non-specific hybridization of nucleic acid molecules to, for example, nitrocellulose or nylon membranes, blocking agents, including but not limited to, BSA or salmon or herring sperm carrier DNA and/or detergents, including but not limited to, SDS, chelating agents EDTA, Ficoll, PVP and the like can be used. When using nylon membranes, in particular, an additional, non-limiting example of stringent hybridization conditions is hybridization in 0.25-0.5M NaH2PO4, 7% SDS at about 65 0C, followed by one or more washes at 0.02M NaH2PO4, 1% SDS at 65 0C (Church and Gilbert (1984) Proc. Natl. Acad. Sci. USA 81 :1991-1995,) or, alternatively, 0.2x SSC, 1% SDS.
[0027] The nucleic acids (also referred to as polynucleotides) of this invention may include both sense and antisense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. They may be modified chemically or biochemically or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, intemucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.) Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule. Other modifications can include, for example, analogs in which the ribose ring contains a bridging moiety or other structure such as the modifications found in "locked" nucleic acids.
[0028] The term "mutated" when applied to nucleic acid sequences means that nucleotides in a nucleic acid sequence may be inserted, deleted or changed compared to a reference nucleic acid sequence. A single alteration may be made at a locus (a point mutation) or multiple nucleotides may be inserted, deleted or changed at a single locus. In addition, one or more alterations may be made at any number of loci within a nucleic acid sequence. A nucleic acid sequence may be mutated by any method known in the art including but not limited to mutagenesis techniques such as "error-prone PCR" (a process for performing PCR under conditions where the copying fidelity of the DNA polymerase is low, such that a high rate of point mutations is obtained along the entire length of the PCR product; see, e.g., Leung et al., Technique, 1 :11-15 (1989) and Caldwell and Joyce, PCR Methods Applic. 2:28-33 (1992)); and "oligonucleotide-directed mutagenesis" (a process which enables the generation of site-specific mutations in any cloned DNA segment of interest; see, e.g., Reidhaar-Olson and Sauer, Science 241 :53-57 (1988)).
[0029] The term "derived from" is intended to include the isolation (in whole or in part) of a polynucleotide segment from an indicated source. The term is intended to include, for example, direct cloning, PCR amplification, or artificial synthesis from, or based on, a sequence associated with the indicated polynucleotide source.
[0030] The term "gene" as used herein refers to a nucleotide sequence that can direct synthesis of an enzyme or other polypeptide molecule (e.g., can comprise coding sequences, for example, a contiguous open reading frame (ORF) which encodes a polypeptide) or can itself be functional in the organism. A gene in an organism can be clustered within an operon, as defined herein, wherein the operon is separated from other genes and/or operons by intergenic DNA. Individual genes contained within an operon can overlap without intergenic DNA between the individual genes.
[0031] An "isolated gene," as described herein, includes a gene which is essentially free of sequences which naturally flank the gene in the chromosomal DNA of the organism from which the gene is derived (i.e., is free of adjacent coding sequences which encode a second or distinct polypeptide or RNA molecule, adjacent structural sequences or the like) and optionally includes 5' and 3' regulatory sequences, for example promoter sequences and/or terminator sequences. In one embodiment, an isolated gene includes predominantly coding sequences for a polypeptide.
[0032] The term "expression" when used in relation to the transcription and/or translation of a nucleotide sequence as used herein generally includes expression levels of the nucleotide sequence being enhanced, increased, resulting in basal or housekeeping levels in the host cell, constitutive, attenuated, decreased or repressed.
[0033] The term "attenuate" as used herein generally refers to a functional deletion, including a mutation, partial or complete deletion, insertion, or other variation made to a gene sequence or a sequence controlling the transcription of a gene sequence, which reduces or inhibits production of the gene product, or renders the gene product non- functional. In some instances a functional deletion is described as a knockout mutation. Attenuation also includes amino acid sequence changes by altering the nucleic acid sequence, placing the gene under the control of a less active promoter, down-regulation, expressing interfering RNA, ribozymes or antisense sequences that target the gene of interest, or through any other technique known in the art. In one example, the sensitivity of a particular enzyme to feedback inhibition or inhibition caused by a composition that is not a product or a reactant (non-pathway specific feedback) is lessened such that the enzyme activity is not impacted by the presence of a compound. In other instances, an enzyme that has been altered to be less active can be referred to as attenuated.
[0034] A "deletion" is the removal of one or more nucleotides from a nucleic acid molecule or one or more amino acids from a protein, the regions on either side being joined together. [0035] A "knock-out" is a gene whose level of expression or activity has been reduced to zero. In some examples, a gene is knocked-out via deletion of some or all of its coding sequence. In other examples, a gene is knocked-out via introduction of one or more nucleotides into its open-reading frame, which results in translation of a non-sense or otherwise non- functional protein product.
[0036] The term "codon usage" is intended to refer to analyzing a nucleic acid sequence to be expressed in a recipient host organism (or acellular extract thereof) for the occurrence and use of preferred codons the host organism transcribes advantageously for optimal nucleic acid sequence transcription. The recipient host may be recombinantly altered with any preferred codon. Alternatively, a particular cell host can be selected that already has superior codon usage, or the nucleic acid sequence can be genetically engineered to change a limiting codon to a non-limiting codon (e.g., by introducing a silent mutation(s)).
[0037] The term "vector" as used herein is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid," which refers to a circular double stranded DNA loop into which additional DNA segments may be ligated. Other vectors include cosmids, bacterial artificial chromosomes (BAC) and yeast artificial chromosomes (YAC), fosmids, phage and phagemids. Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome (discussed in more detail below). Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., vectors having an origin of replication which functions in the host cell). Other vectors can be integrated into the genome of a host cell upon introduction into the host cell, and are thereby replicated along with the host genome. Moreover, certain preferred vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors" (or simply "expression vectors").
[0038] "Expression optimization" as used herein is defined as one or more optional modifications to the nucleotide sequence in the promoter and terminator elements resulting in desired rates and levels of transcription and translation into a protein product encoded by said nucleotide sequence. Expression optimization as used herein also includes designing an effectual predicted secondary structure (for example, stem-loop structures and termination sequences) of the messenger ribonucleic acid (mRNA) sequence to promote desired levels of protein production. Other genes and gene combinations essential for the production of a protein may be used, for example genes for proteins in a biosynthetic pathway, required for post-translational modifications or required for a heteromultimeric protein, wherein combinations of genes are chosen for the effect of optimizing expression of the desired levels of protein product. Conversely, one or more genes optionally may be "knocked-out" or otherwise altered such that lower or eliminated expression of said gene or genes achieves the desired expression levels of protein. Additionally, expression optimization can be achieved through codon optimization. Codon optimization, as used herein, is defined as modifying a nucleotide sequence for effectual use of host cell bias in relative concentrations of transfer ribonucleic acids (tRNA) such that the desired rate and levels of gene nucleotide sequence translation into a final protein product are achieved, without altering the peptide sequence encoded by the nucleotide sequence.
[0039] The term "expression control sequence" as used herein refers to polynucleotide sequences which are necessary to affect the expression of coding sequences to which they are operatively linked. Expression control sequences are sequences which control the transcription, post-transcriptional events and translation of nucleic acid sequences. Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (e.g., ribosome binding sites); sequences that enhance protein stability; and when desired, sequences that enhance protein secretion. The nature of such control sequences differs depending upon the host organism; in prokaryotes, such control sequences generally include promoter, ribosomal binding site, and transcription termination sequence. The term "control sequences" is intended to include, at a minimum, all components whose presence is essential for expression, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences.
[0040] "Operatively linked" or "operably linked" expression control sequences refers to a linkage in which the expression control sequence is contiguous with the gene of interest to control the gene of interest, as well as expression control sequences that act in trans or at a distance to control the gene of interest.
[0041] The term "recombinant host cell" (or simply "host cell"), as used herein, is intended to refer to a cell into which a recombinant vector has been introduced. It should be understood that such terms are intended to refer not only to the particular subject cell but to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term "host cell" as used herein. A recombinant host cell may be an isolated cell or cell line grown in culture or may be a cell which resides in a living tissue or organism.
[0042] The term "peptide" as used herein refers to a short polypeptide, e.g., one that is typically less than about 50 amino acids long and more typically less than about 30 amino acids long. The term as used herein encompasses analogs and mimetics that mimic structural and thus biological function.
[0043] The term "polypeptide" encompasses both naturally-occurring and non-naturally- occurring proteins, and fragments, mutants, derivatives and analogs thereof. A polypeptide may be monomeric or polymeric. Further, a polypeptide may comprise a number of different domains each of which has one or more distinct activities.
[0044] The term "isolated protein" or "isolated polypeptide" is a protein or polypeptide that by virtue of its origin or source of derivation (1) is not associated with naturally associated components that accompany it in its native state, (2) exists in a purity not found in nature, where purity can be adjudged with respect to the presence of other cellular material (e.g., is free of other proteins from the same species) (3) is expressed by a cell from a different species, or (4) does not occur in nature (e.g., it is a fragment of a polypeptide found in nature or it includes amino acid analogs or derivatives not found in nature or linkages other than standard peptide bonds). Thus, a polypeptide that is chemically synthesized or synthesized in a cellular system different from the cell from which it naturally originates will be "isolated" from its naturally associated components. A polypeptide or protein may also be rendered substantially free of naturally associated components by isolation, using protein purification techniques well known in the art. As thus defined, "isolated" does not necessarily require that the protein, polypeptide, peptide or oligopeptide so described has been physically removed from its native environment.
[0045] An isolated or purified polypeptide is substantially free of cellular material or other contaminating polypeptides from the expression host cell from which the polypeptide is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized. In one embodiment, an isolated or purified polypeptide has less than about 30% (by dry weight) of contaminating polypeptide or chemicals, more advantageously less than about 20% of contaminating polypeptide or chemicals, still more advantageously less than about 10% of contaminating polypeptide or chemicals, and most advantageously less than about 5% contaminating polypeptide or chemicals.
[0046] The term "polypeptide fragment" as used herein refers to a polypeptide that has a deletion, e.g., an amino-terminal and/or carboxy-terminal deletion compared to a full-length polypeptide. In a preferred embodiment, the polypeptide fragment is a contiguous sequence in which the amino acid sequence of the fragment is identical to the corresponding positions in the naturally-occurring sequence. Fragments typically are at least 5, 6, 7, 8, 9 or 10 amino acids long, preferably at least 12, 14, 16 or 18 amino acids long, more preferably at least 20 amino acids long, more preferably at least 25, 30, 35, 40 or 45, amino acids, even more preferably at least 50 or 60 amino acids long, and even more preferably at least 70 amino acids long.
[0047] A "modified derivative" refers to polypeptides or fragments thereof that are substantially homologous in primary structural sequence but which include, e.g., in vivo or in vitro chemical and biochemical modifications or which incorporate amino acids that are not found in the native polypeptide. Such modifications include, for example, acetylation, carboxylation, phosphorylation, glycosylation, ubiquitination, labeling, e.g., with radionuclides, and various enzymatic modifications, as will be readily appreciated by those skilled in the art. A variety of methods for labeling polypeptides and of substituents or labels useful for such purposes are well known in the art, and include radioactive isotopes such as 1251, 32P, 35S, and 3H, ligands which bind to labeled antiligands (e.g., antibodies), fluorophores, chemiluminescent agents, enzymes, and antiligands which can serve as specific binding pair members for a labeled ligand. The choice of label depends on the sensitivity required, ease of conjugation with the primer, stability requirements, and available instrumentation. Methods for labeling polypeptides are well known in the art. See, e.g., Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992, and Supplements to 2002) (hereby incorporated by reference).
[0048] The terms "thermal stability" and "thermostability" are used interchangeably and refer to the ability of an enzyme (e.g., whether expressed in a cell, present in an cellular extract, cell lysate, or in purified or partially purified form) to exhibit the ability to catalyze a reaction at least at about 200C, preferably at about 25°C to 35°C, more preferably at about 37°C or higher, in more preferably at about 500C or higher, and even more preferably at least about 600C or higher. [0049] The term "chimeric" refers to an expressed or translated polypeptide in which a domain or subunit of a particular homologous or non-homologous protein is genetically engineered to be transcribed, translated and/or expressed collinearly in the nucleotide and amino acid sequence of another homologous or non-homologous protein.
[0050] The term "fusion protein" refers to a polypeptide comprising a polypeptide or fragment coupled to heterologous amino acid sequences. Fusion proteins are useful because they can be constructed to contain two or more desired functional elements from two or more different proteins. A fusion protein comprises at least 10 contiguous amino acids from a polypeptide of interest, more preferably at least 20 or 30 amino acids, even more preferably at least 40, 50 or 60 amino acids, yet more preferably at least 75, 100 or 125 amino acids. Fusions that include the entirety of the proteins of the invention have particular utility. The heterologous polypeptide included within the fusion protein of the invention is at least 6 amino acids in length, often at least 8 amino acids in length, and usefully at least 15, 20, and 25 amino acids in length. Fusions that include larger polypeptides, such as an IgG Fc region, and even entire proteins, such as the green fluorescent protein ("GFP") chromophore- containing proteins, have particular utility. Fusion proteins can be produced recombinantly by constructing a nucleic acid sequence which encodes the polypeptide or a fragment thereof in frame with a nucleic acid sequence encoding a different protein or peptide and then expressing the fusion protein. Alternatively, a fusion protein can be produced chemically by crosslinking the polypeptide or a fragment thereof to another protein.
[0051] As used herein, the term "protomer" refers to a polymeric form of amino acids forming a subunit of a larger oligomeric protein structure. Protomers of an oligomeric structure may be identical or non-identical. Protomers can combine to form an oligomeric subunit, which can combine further with other identical or non-identical protomers to form a larger oligomeric protein.
[0052] As used herein, the term "antibody" refers to a polypeptide, at least a portion of which is encoded by at least one immunoglobulin gene, or fragment thereof, and that can bind specifically to a desired target molecule. The term includes naturally-occurring forms, as well as fragments and derivatives.
[0053] Fragments within the scope of the term "antibody" include those produced by digestion with various proteases, those produced by chemical cleavage and/or chemical dissociation and those produced recombinantly, so long as the fragment remains capable of specific binding to a target molecule. Among such fragments are Fab, Fab', Fv, F(ab')2, and single chain Fv (scFv) fragments.
[0054] Derivatives within the scope of the term include antibodies (or fragments thereof) that have been modified in sequence, but remain capable of specific binding to a target molecule, including: interspecies chimeric and humanized antibodies; antibody fusions; heteromeric antibody complexes and antibody fusions, such as diabodies (bispecific antibodies), single-chain diabodies, and intrabodies (see, e.g., Intracellular Antibodies: Research and Disease Applications (1998) Marasco,ed., Springer- Verlag New York, Inc.), the disclosure of which is incorporated herein by reference in its entirety).
[0055] As used herein, antibodies can be produced by any known technique, including harvest from cell culture of native B lymphocytes, harvest from culture of hybridomas, recombinant expression systems and phage display.
[0056] The term "non-peptide analog" refers to a compound with properties that are analogous to those of a reference polypeptide. A non-peptide compound may also be termed a "peptide mimetic" or a "peptidomimetic." See, e.g., Jones, Amino Acid and Peptide Synthesis, Oxford University Press (1992); Jung, Combinatorial Peptide and Nonpeptide Libraries: A Handbook, John Wiley (1997); Bodanszky et al., Peptide Chemistry— A Practical Textbook, Springer Verlag (1993); Synthetic Peptides: A Users Guide, (Grant, ed., W. H. Freeman and Co., 1992); Evans et al., J. Med. Chem. 30:1229 (1987); Fauchere, J. Adv. Drug Res. 15:29 (1986); Veber and Freidinger, Trends Neurosci., 8:392-396 (1985); and references sited in each of the above, which are incorporated herein by reference. Such compounds are often developed with the aid of computerized molecular modeling. Peptide mimetics that are structurally similar to useful peptides of the invention may be used to produce an equivalent effect and are therefore envisioned to be part of the invention.
[0057] A "polypeptide mutant" or "mutein" refers to a polypeptide whose sequence contains an insertion, duplication, deletion, rearrangement or substitution of one or more amino acids compared to the amino acid sequence of a native or wild-type protein. A mutein may have one or more amino acid point substitutions, in which a single amino acid at a position has been changed to another amino acid, one or more insertions and/or deletions, in which one or more amino acids are inserted or deleted, respectively, in the sequence of the naturally-occurring protein, and/or truncations of the amino acid sequence at either or both the amino or carboxy termini. A mutein may have the same but preferably has a different biological activity compared to the naturally-occurring protein.
[0058] A mutein has at least 85% overall sequence homology to its wild-type counterpart. Even more preferred are muteins having at least 90% overall sequence homology to the wild- type protein.
[0059] In an even more preferred embodiment, a mutein exhibits at least 95% sequence identity, even more preferably 98%, even more preferably 99% and even more preferably 99.9% overall sequence identity.
[0060] Sequence homology may be measured by any common sequence analysis algorithm, such as Gap or Bestfϊt.
[0061] Amino acid substitutions can include those which: (1) reduce susceptibility to proteolysis, (2) reduce susceptibility to oxidation, (3) alter binding affinity for forming protein complexes, (4) alter binding affinity or enzymatic activity, and (5) confer or modify other physicochemical or functional properties of such analogs.
[0062] As used herein, the twenty conventional amino acids and their abbreviations follow conventional usage. See Immunology-A Synthesis (Golub and Gren eds., Sinauer Associates, Sunderland, Mass., 2nd ed. 1991), which is incorporated herein by reference. Stereoisomers (e.g., D-amino acids) of the twenty conventional amino acids, unnatural amino acids such as α-, α-disubstituted amino acids, N-alkyl amino acids, and other unconventional amino acids may also be suitable components for polypeptides of the invention. Examples of unconventional amino acids include: 4-hydroxyproline, γ-carboxyglutamate, C-N5N5N- trimethyllysine, C -N-acetyllysine, O-phosphoserine, N-acetylserine, N-formylmethionine, 3-methylhistidine, 5 -hydroxy Iy sine, N-methylarginine, and other similar amino acids and imino acids (e.g., 4-hydroxyproline). In the polypeptide notation used herein, the left-hand end corresponds to the amino terminal end and the right-hand end corresponds to the carboxy-terminal end, in accordance with standard usage and convention.
[0063] A protein has "homology" or is "homologous" to a second protein if the nucleic acid sequence that encodes the protein has a similar sequence to the nucleic acid sequence that encodes the second protein. Alternatively, a protein has homology to a second protein if the two proteins have "similar" amino acid sequences. (Thus, the term "homologous proteins" is defined to mean that the two proteins have similar amino acid sequences.) As used herein, homology between two regions of amino acid sequence (especially with respect to predicted structural similarities) is interpreted as implying similarity in function.
[0064] When "homologous" is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions. A "conservative amino acid substitution" is one in which an amino acid residue is substituted by another amino acid residue having a side chain (R group) with similar chemical properties (e.g., charge or hydrophobicity). In general, a conservative amino acid substitution will not substantially change the functional properties of a protein. In cases where two or more amino acid sequences differ from each other by conservative substitutions, the percent sequence identity or degree of homology may be adjusted upwards to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art. See, e.g., Pearson, 1994, Methods MoI. Biol. 24:307-331 and 25:365-389 (herein incorporated by reference).
[0065] The following six groups each contain amino acids that are conservative substitutions for one another: 1) Serine (S), Threonine (T); 2) Aspartic Acid (D), Glutamic Acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Alanine (A), Valine (V), and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).
[0066] Sequence homology for polypeptides, which is also referred to as percent sequence identity, is typically measured using sequence analysis software. See, e.g., the Sequence Analysis Software Package of the Genetics Computer Group (GCG), University of Wisconsin Biotechnology Center, 910 University Avenue, Madison, Wis. 53705. Protein analysis software matches similar sequences using a measure of homology assigned to various substitutions, deletions and other modifications, including conservative amino acid substitutions. For instance, GCG contains programs such as "Gap" and "Bestfit" which can be used with default parameters to determine sequence homology or sequence identity between closely related polypeptides, such as homologous polypeptides from different species of organisms or between a wild-type protein and a mutein thereof. See, e.g., GCG Version 6.1.
[0067] A preferred algorithm when comparing a particular polypeptide sequence to a database containing a large number of sequences from different organisms is the computer program BLAST (Altschul et al, J. MoI. Biol. 215:403-410 (1990); Gish and States, Nature Genet. 3:266-272 (1993); Madden et al, Meth. Enzymol. 266:131-141 (1996); Altschul et al, Nucleic Acids Res. 25:3389-3402 (1997); Zhang and Madden, Genome Res. 7:649-656 (1997)), especially blastp or tblastn (Altschul et al, Nucleic Acids Res. 25:3389-3402 (1997)).
[0068] Preferred parameters for BLASTp are: Expectation value: 10 (default); Filter: seg (default); Cost to open a gap: 11 (default); Cost to extend a gap: 1 (default); Max. alignments: 100 (default); Word size: 11 (default); No. of descriptions: 100 (default); Penalty Matrix: BLOWSUM62.
[0069] The length of polypeptide sequences compared for homology will generally be at least about 16 amino acid residues, usually at least about 20 residues, more usually at least about 24 residues, typically at least about 28 residues, and preferably more than about 35 residues. When searching a database containing sequences from a large number of different organisms, it is preferable to compare amino acid sequences. Database searching using amino acid sequences can be measured by algorithms other than blastp known in the art. For instance, polypeptide sequences can be compared using FASTA, a program in GCG Version 6.1. FASTA provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. (Pearson, Methods Enzymol. 183:63-98 (1990) (herein incorporated by reference). For example, percent sequence identity between amino acid sequences can be determined using FASTA with its default parameters (a word size of 2 and the PAM250 scoring matrix), as provided in GCG Version 6.1, herein incorporated by reference.
[0070] To determine the percent identity of two amino acid sequences or of two nucleic acids, the sequences are aligned for optimal comparison purposes, and, if necessary, gaps can be introduced in the first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences as evaluated, for example, by calculating # of identical positions/total # of positions x 100. Additional evaluations of the sequence alignment can include a numeric penalty taking into account the number of gaps and size of said gaps necessary to produce an optimal alignment. [0071] "Specific binding" refers to the ability of two molecules to bind to each other in preference to binding to other molecules in the environment. Typically, "specific binding" discriminates over adventitious binding in a reaction by at least two-fold, more typically by at least 10-fold, often at least 100-fold. Typically, the affinity or avidity of a specific binding reaction, as quantified by a dissociation constant, is about 10"7 M or stronger (e.g., about 10"8 M, 10"9 M or even stronger).
[0072] The term "region" as used herein refers to a physically contiguous portion of the primary structure of a biomolecule. In the case of proteins, a region is defined by a contiguous portion of the amino acid sequence of that protein.
[0073] The term "domain" as used herein refers to a structure of a biomolecule that contributes to a known or suspected function of the biomolecule. Domains may be coextensive with regions or portions thereof; domains may also include distinct, non-contiguous regions of a biomolecule. Examples of protein domains include, but are not limited to, an Ig domain, an extracellular domain, a transmembrane domain, and a cytoplasmic domain.
[0074] As used herein, the term "molecule" means any compound, including, but not limited to, a small molecule, peptide, protein, sugar, nucleotide, nucleic acid, lipid, etc., and such a compound can be natural or synthetic.
[0075] The term "substrate affinity" as used herein refers to the binding kinetics or the kinetics of binding and catalytic turnover, K1n, the Michaelis-Menten constant as understood by one having skill in the art, for a substrate.
[0076] The term "sugar" as used herein refers to any carbohydrate endogenously produced from sunlight, carbon dioxide and water, any carbohydrate produced endogenously and/or any carbohydrate from any exogenous carbon source such as biomass, comprising a sugar molecule or pool or source of such sugar molecules. Said sugars potentially can be depolymerized and bioconverted to ethanol and ethanol precursors by fermentative processes and methods of the invention.
[0077] The term "carbon source" as used herein refers to carbon dioxide, exogenous sugar or biomass.
[0078] Biomass refers to biological material produced by a biological system including material useful as a renewable energy source. [0079] "Carbon-based products of interest" include alcohols such as ethanol, propanol, isopropanol, butanol, fatty alcohols, fatty acid esters, wax esters; hydrocarbons and alkanes such as propane, octane, diesel, Jet Propellant 8 (JP8); polymers such as terephthalate, 1,3-propanediol, 1,4-butanediol, polyols, Polyhydroxyalkanoates (PHA), poly-beta- hydroxybutyrate (PHB), acrylate, adipic acid, ε-caprolactone, isoprene, caprolactam, rubber; commodity chemicals such as lactate, docosahexaenoic acid (DHA), 3-hydroxypropionate, γ-valerolactone, lysine, serine, aspartate, aspartic acid, sorbitol, ascorbate, ascorbic acid, isopentenol, lanosterol, omega-3 DHA, lycopene, itaconate, 1,3-butadiene, ethylene, propylene, succinate, citrate, citric acid, glutamate, malate, 3-hydroxypropionic acid (HPA), lactic acid, THF, gamma butyrolactone, pyrrolidones, hydroxybutyrate, glutamic acid, levulinic acid, acrylic acid, malonic acid; specialty chemicals such as carotenoids, isoprenoids, itaconic acid; pharmaceuticals and pharmaceutical intermediates such as 7- aminodeacetoxycephalosporanic acid (7-ADCA)/cephalosporin, erythromycin, polyketides, statins, paclitaxel, docetaxel, terpenes, peptides, steroids, omega fatty acids and other such suitable products of interest. Such products are useful in the context of bio fuels, industrial and specialty chemicals, as intermediates used to make additional products, such as nutritional supplements, neutraceuticals, polymers, paraffin replacements, personal care products and pharmaceuticals.
[0080] A "biofuel" as used herein is any fuel that derives from a biological source. Biofuel refers to one or more hydrocarbons, one or more alcohols, one or more fatty esters or a mixture thereof. Preferably, liquid hydrocarbons are used.
[0081] As used herein, the term "hydrocarbon" generally refers to a chemical compound that consists of the elements carbon (C), hydrogen (H) and optionally oxygen (O). There are essentially three types of hydrocarbons, e.g., aromatic hydrocarbons, saturated hydrocarbons and unsaturated hydrocarbons such as alkenes, alkynes, and dienes. The term also includes fuels, biofuels, plastics, waxes, solvents and oils. Hydrocarbons encompass biofuels, as well as plastics, waxes, solvents and oils.
[0082] Zinc binding alcohol dehydrogenases are class I alcohol dehydrogenases with a zinc co-factor that catalyze the formation of an ethanol molecule by the reduction of acetaldehyde with either NADH or NADPH. The enzymes are designated "adhl ." The genes encoding adhl are designated "adhl." [0083] Iron binding alcohol dehydrogenases are class II alcohol dehydrogenases with an iron co-factor that catalyze the formation of an ethanol molecule by the reduction of acetaldehyde with NADH or NADPH. The enzymes are designated "adh2." The genes encoding adh2 are designated "adh2."
[0084] Bi-functional alcohol dehydrogenases are bi-functional, two-domain alcohol dehydrogenase/aldehyde oxidoreductase enzymes that catalyze step-wise both the formation of an ethanol molecule by reductive conversion of acetyl-coenzyme A (acetyl-CoA) to acetaldehyde and acetaldehyde to ethanol with iron and NADH co-factors. The enzymes are designated "adhE." The genes encoding adhE are designated "adhE."
[0085] Pyruvate decarboxylases are enzymes that catalyze the formation of an acetaldehyde molecule and a carbon dioxide molecule from a pyruvate molecule. The enzymes are designated "pdc." The genes encoding pdc are designated "pdc."
[0086] The term "ethanologenic" and "ethanologen" as used herein refers to the ability of a microorganism to metabolize a carbohydrate to produce ethanol as a primary fermentation product using exogenous sugar and/or light, water and carbon dioxide. A host cell can be a naturally occurring ethanologenic host cell, an ethanologenic host cell with a natural or induced mutation, or ethanologenic host cell which has been genetically modified.
[0087] The term "ethanologenesis" and "ethanologenic" as used herein with reference to a gene, gene product or protein capable of conferring on a host cell the capacity to produce, metabolically use or tolerate ethanol or is capable of improving any aspect of cellular production of ethanol, such as, e.g., substrate uptake, substrate processing, ethanol tolerance, etc. For instance, such genes include a gene encoding pyruvate decarboxylase and alcohol dehydrogenases I, II, III, IV, V and/or A, B, C or E and genes encoding a bi-functional alcohol dehydrogenase.
[0088] The term "catabolic" and "catabolism" as used herein refers to the process of molecule breakdown or degradation of large molecules into smaller molecules. Catabolic or catabolism refers to a specific reaction pathway wherein the molecule breakdown occurs through a single catalytic component or a multitude thereof or a general, whole cell process wherein the molecule breakdown occurs using more than one specified reaction pathway and a multitude of catalytic components.
[0089] The term "anabolic" and "anabolism" as used herein refers to the process of chemical construction of small molecules into larger molecules. Anabolic refers to a specific reaction pathway wherein the molecule construction occurs through a single catalytic component or a multitude thereof or a general, whole cell process wherein the molecule construction occurs using more than one specified reaction pathway and a multitude of catalytic components.
[0090] The term "correlated" in "correlated saturation mutagenesis" as used herein refers to altering an amino acid type at two or more positions of a polypeptide to achieve an altered functional or structural attribute differing from the structural or functional attribute of the polypeptide from which the changes were made.
[0091] Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can also be used in the practice of the invention and will be apparent to those of skill in the art. All publications and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. The materials, methods, and examples are illustrative only and not intended to be limiting.
[0092] Throughout this specification and claims, the word "comprise" or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. Nucleic Acid Sequences
[0093] Pyruvate decarboxylase catalyzes the conversion of pyruvate into acetaldehyde and alcohol dehydrogenase in turn catalyzes the conversion of acetaldehyde to ethanol. Bi- functional alcohol dehydrogenase is an enzyme catalyzing the two-step conversion of acetyl- coA to ethanol by chemical reduction with NADH. Ethanol can then be isolated and used for other industrial applications as well as an alternative fuel source. The invention described herein concerns the use of various enzymes for the production of ethanol.
[0094] Under aerobic conditions a host cell may use pyruvate dehydrogenase to convert a molecule of pyruvate into acetyl-coenzyme A (acetyl-CoA), which is then used in the citric acid cycle to carry out cellular respiration. In anaerobic conditions certain host cells may use pyruvate decarboxylase to convert pyruvate into acetaldehyde, which in turn is converted to ethanol through the activity of an endogenous alcohol dehydrogenase enzyme. Objects of the invention described herein include diverting pyruvate acetyl-CoA away from the citric acid cycle by incorporating into a host cell heterologous genes encoding pyruvate decarboxylase, alcohol dehydrogenase and bi-functional alcohol dehydrogenase capable of converting pyruvate or acetyl-CoA to acetaldehyde and acetaldehyde to ethanol or other carbon based products of interest, in either aerobic or anaerobic conditions.
[0095] Accordingly, the invention provides isolated nucleic acid molecules having pdc gene activity, variants thereof, codon and expression optimized forms of said pdc genes and methods of improvement thereon. The full-length nucleic acid sequences for two pdc genes, which encode pyruvate decarboxylase enzymes (E. C. 4.1.1.1), have been identified and sequenced. SEQ ID NO: 1 is pdc from wild-type Zymomonas mobilis ZM-4 (accession number NC 006526). SEQ ID NO:2 represents the encoded enzyme from SEQ ID NO:1. SEQ ID NO:4 is pdc from wild-type Zymobacter palmae ATCC 51623 (accession number AF474145). SEQ ID NO:5 represents the enzyme coded by SEQ ID NO:4. Alternatively, other representatives of wild-type pdc genes are shown in Table 1.
Table 1. Species with Representative Pyruvate Decarboxylase (pdc) genes
Species Gene Genebank oroduct accession#
Gluconacetobacter diazotrophicus PDC NC 010125
Beijerinckia indica Bind 0083 NC 010581
Gluconobacter oxydans PDC YP 191506
Acetobacter pasteurianus aldl AF368435
Zymobacter palmae PDC AF474145
Schizosaccharomyces pombe predicted NP 592796
Podospora anserina hypothetical XP 001904289
Aspergillus fumigatus PDC XP 753176
Neurospora crassa PDC XP 959587
Gibberella zeae hypothetical XP 390622
Planctomyces marts PDC ZP 01856731
Oryza sativa PDC3 NP 001049811
Oryza punctata unnamed protein product AK223957
Zea mays PDC2 clone NP 001105052
Arabidopsis thaliana PDC3 NP 195753
Petunia x hybrida PDC2 AAX33299
Lotus corniculatus PDCl AAO72533
Physcomitrella patens subsp. patens hypothetical XP 001756932
Lycoris aurea PDC ABJ995
Dianthus caryophyllus PDC AAP96920
Citrus sinensis PDC AAZ05069
Fragaria x ananassa PDCl AAL37492
Vitis vinifera unnamed protein product CAO21424
Pisum sativum PDCl P51850
Lotus japonicus PDCl CAG30578
Prunus armeniaca PDC ABZ79223
Nicotiana tabacum PDCl P51846
Solanum tuberosum stPDC BAC23043
Legionella pneumophila PDC YP 123481
Aspergillus clavatus PDC XP 001270421
Aspergillus terreus predicted XP 001217746
Aspergillus niger hypothetical XP 001396467
Clostridium acetobutylicum PDC NP 149189
Nostoc punctiforme thiamine pyrophosphate protein YP 001865677
Geobacter lovleyi thiamine pyrophosphate protein YP 001952626
Cyanothece sp. PCC 8801 thiamine pyrophosphate protein ZP 02939948
Microcystis aeruginosa unnamed protein product CAO88944
Podospora anserina hypothetical XM 001904254
Chlamydomonas reinhardtii PDC3 XM 001703478
Triticum aestivum PDC BT009420
Bacillus cereus Indole-3-PDC NP 832195
Bacillus anthracis Indole-PDC NP 844861
Bacillus thuringiensis Indole-PDC YP 036605
Lyngbya spp. PC8106 Indole-3-PDC ZP 01623010
Saccharum officianarium PDC AJ251246
Coix lacryma-jobi PDC DQ455583
Lactococcus lactis α-ketoacid decarboxlase AY548760
Echinochloa crus-galli PDC AF497855
Zvmomonas mobilis PDC NC 006526
[0096] The invention also provides isolated nucleic acid molecules having adh2 gene activity, variants thereof, codon and expression optimized forms of said adh2 genes, and methods of improvement thereon. The full-length nucleic acid sequence for this gene, which encodes a pyruvate decarboxylase enzyme (E. C. 1.1.1.1), has been identified and sequenced. Provided herein is a coding sequence for the wild type adh2 gene SEQ ID NO: 7 from Zymomonas mobilis ZM-4 (accession number NC_006526). SEQ ID NO:8 represents the encoded amino acid sequence for the adh2 enzyme. Alternatively, other representatives of wild-type adh2 genes are shown in Table 2.
Table 2. Species with Representative Alcohol Dehydrogenase II (adh2) genes
Species Gene Genebank product accession#
Azotobacter vinelandii Fe-ADH ZP 00419082
Proteus mirabilis probable ADH YP 002150424
Rhodoferax ferrireducens Fe-ADH YP 524107
Pseudomonas fluorescens Fe-ADH YP 347043
Rhodospirillum rubrum Fe-ADH YP 426018
Pseudomonas syringae ADH II NP 794041
Shewanella putrefaciens Fe-ADH YP 964231
Salmonella enterica Fe-ADH ZP 02660347
Psychromonas sp. putative ADH ZP 01215093
Pseudomonas entomophila ADH II YP 608524
Shewanella pealeana Fe-ADH YP 001501014
Vibrio angustum putative ADH ZP 01236991
Vibrio sp. Ex25 ADH IV YP 002075051
Shewanella halifaxensis Fe-ADH YP 001673424
Idiomarina loihiensis ADH YP 155185
Vibrionales bacterium ADH IV ZP 01813426
Vibrio campbellii sensory histidine kinase ZP 02194254
Vibrio splendidus ADH ZP 00991458
Shewanella woodyi Fe-ADH YP 001759746
Vibrio sp. MED222 ADH ZP 01062675
Vibrio alginolyticus ADH ZP 01261565
Photobacterium sp. SKA34 putative ADH ZP 01160527
Shewanella baltica Fe-ADH YP 001553783
Escherichia coli probable ADH NP 756272
Vibrio fischeri Fe-ADH YP 002155987
Escherichia albertii ADH II ZP 02901351
Shewanella benthica ADH II ZP 02156716
Shewanella loihica Fe-ADH YP 001093295
Vibrio vulnificus ADH IV NP 936583
Shewanella frigidimarina Fe-ADH YP 751477
Shewanella denitrificans Fe-ADH YP 563580
Shigella boydii putative ADH YP 409898
Photobacterium profundum putative ADH YP 130703
Vibrio parahaemolyticus ADH NP 800076
Serratia proteamaculans Fe-ADH YP 001479882
Citrobacter koseri putative ADH YP 001456524
Enter obacter sp. 638 putative ADH YP 001174883
Vibrio parahaemolyticus ADH II ZP 01990056
Shigella flexneri putative ADH NP 709367
Shigella dysenteriae ADH II ZP 03063520
Shewanella sp. MR-4 Fe-ADH YP 734890
Shewanella sp. ANA-3 Fe-ADH YP 870570
Enterobacter sakazakii putative ADH YP 001439895
Vibrio harveyi ADH YP 001447544
Azoarcus sp. EbNl ADH II YP 159645
Shewanella oneidensis ADH II NP 717107
Aliivibrio salmonicida ADH II CAQ79473
Rhodopseudomonas palustris Fe-ADH YP 531841
Shewanella sediminis Fe-ADH YP 001472997
Aeromonas hydrophila 1,3 -propanediol dehydrogenase YP 856001
Pseudoalteromonas atlantica Fe-ADH YP 661058
Chromobacterium violaceum ADH NP 902398 Table 2. (con'f) Species with Representative Alcohol Dehydrogenase II (adhl) genes
Species Gene Genebank product accession#
Aeromonas salmonicida ADH YP_001142661 Shewanella amazonensis ADH II YP 928329 Caldicellulosiruptor saccharolyticus ADH YP_001179237 Photorhabdus luminescens hypothetical protein NP_928854 Carboxydothermus hydrogenoformans putative lactaldehyde reductase YP_359772 Moritella sp. PE36 putative ADH ZP_01897480 Vibrio shilonii putative ADH ZP_01867301 Clostridium perfringens ADH II YP_697771 Desulfitobacterium hafniense hypothetical Fe-ADH YP 516798 Bacillus coagulans Fe-ADH ZP O 1696278 Mannheimia succiniciproducens EutG protein YP 088994 Schizosaccharomyces pombe ADH IV NP_592819 Pelotomaculum thermopropionicum ADH YP_001211156 Geobacter uraniireducens Fe-ADH YP_001231172 Pelobacter propionicus Fe-ADH YP_900574 Desulfotomaculum reducens Fe-ADH YP_001113612 Acinetobacter baumannii putative ADH IV YP_001707033 Burkholderia thailandensis Fe-ADH CP000086 Psychrobacter sp. PRwf-1 Fe-ADH CP000713 Pelobacter carbinolicus ADH IV CP000142 Burkholderia pseudomallei EutG protein CP000572 Burkholderia mallei hypothetical protein CPOOOOlO Saccharomyces cerevisiae ADH IV Z72778 Geobacter metallireducens Fe-ADH CP000148 Kluyveromyces lactis hypothetical protein XM_453065 Desulfotalea psychrophila probable ADH CR522870 Gryllus bimaculatus hypothetical ADH, from mRNA AK276395
[0097] The invention also provides isolated nucleic acid molecules having adhl gene activity, variants thereof, expression optimized forms of said adhl genes, and methods of improvement thereon. The full-length nucleic acid sequences for two versions of this gene, which encode two alcohol dehydrogenase enzymes (E. C. 1.1.1.1 and E. C. 1.1.1.2), have been identified and sequenced. Provided herein are coding sequences for wild type adhl genes SEQ ID NO: 10 from Zymomonas mobilis ZM-4 (accession number NC 006526) and SEQ ID NO: 13 from Entamoeba histolytica (accession number P35630). SEQ ID NO: 11 represents the encoded enzyme, adhl, from SEQ ID NO: 10. SEQ ID NO: 14 represents the encoded enzyme, adhl, from SEQ ID NO:13. Alternatively, other representatives of wild-type adhl genes are shown in Table 3 as obtained from nucleotide BLAST searches yielding homologues to SEQ ID NO: 10. More preferably, adhl gene homologues useful herein include those from Phytomonas sp. ADU-2003 (accession number AAP39869), Xanthobacter autotrophicus (accession number YP_001415578), Methylibium petroleiphilum (accession number YP_001021255), Alkalilimnicola ehrlichei (accession number YP_742969) and Sinorhizobium meliloti (accession number NP_435872). Table 3. Species with Representative Alcohol Dehydrogenase I {adhl) genes homologous to SEQ ID NO: 10
Species Genebank accession#
Shigella dysenteriae 1012 ZP_03064170
Escherichia coli spp. YP_002292842
Enterobacter cancerogenus ATCC 35316 ZP_03282582
Salmonella enterica spp. YP_001587957
Serratia proteamaculans 568 YP_001478632
Klebsiella pneumoniae subsp. pneumoniae YP_001335514
Shigella flexneri 2a str. 301 NP_707612
Pseudomonas putida spp YP_001267259
Erwinia tasmaniensis Etl/99 YP OO 1908360
Bacillus amyloliquefaciens FZB42 YP_001421338
Bacillus coagulans 36Dl ZP 01695986
Neisseria meningitidis spp YP_974586
Staphylococcus aureus subsp. aureus MW2 NP_645385
Actinobacillus pleuropneumoniae serovar ZP_00134308
Bacillus cereus subsp. cytotoxis spp YP_001374103
Bacillus thuringiensis YP 036379
Bacillus weihenstephanensis YP_001644942
Bacillus anthracis str. Ames NPJS44655
Exiguobacterium sp. ATIb ZP 02989690
Streptococcus pneumoniae spp ZP_01817011
Streptococcus sanguinis SK36 YP_001035842
Streptococcus gordonii γp_001449881
Neisseria gonorrhoeae spp YP 208496
Lactobacillus brevis spp γp_794451
Staphylococcus epidermidis spp YP_187853
Streptococcus suis spp YPJ)Ol 197647
Streptococcus pyogenes spp NP_606374
Enterococcus faecalis V583 NPJS 15523
Lactococcus lactis spp NPJZ67964
Streptococcus equi subsp. zooepidemicus YP_002122442
Streptococcus agalactiae spp NP_687090
Lactobacillus reuteri spp ZP 03072955
Lactobacillus sakei subsp. sakei 23K YP 396315
Lactobacillus fermentum IFO 3956 YPJ)01844344
Oenococcus oeni PSU-I YP 810141
[0098] Alternatively, other representatives of wild-type adhl genes are shown in Table 4 as obtained from nucleotide BLAST searches yielding homologues to SEQ ID NO: 13 and SEQ ID NO: 15. adhl gene homologues useful herein include those from Methanocorpusculum labreanum Z (accession number YP_001030202.1), Arcobacter δwfe/eπ_RM4018 (accession number YP OO 1489971.1), Thermoanaerobacter ethanolicus X514 (accession number ZP_01454904.1) and Thermoanaerobacter ethanolicus ATCC 33223 (accession number ZP_00779753.1). Table 4. Species with Representative Alcohol Dehydrogenase I {adhl) genes homologous to SEQ ID NOS: 13 and 15
Species Genebank accession#
Entamoeba dispar SAW760 XM_001741780
Arcobacter butzleri RM4018 CP000361
Clostridium beijerinckii strain NRRL B593 AF157307
Entamoeba dispar SAW760 XM_001733263
Trichomonas vaginalis spp. XM_001314150
Methanocorpusculum labreanum Z CP000559
Malassezia globosa CBS 7966 spp XMJ)01729044
Lactobacillus fermentum IFO 3956 AP008937
Brachyspira hyodysenteriae strain WAl EF488203
Brachyspira pilosicoli strain 95/1000 EF488210
Thermoanaerobacterpseudethanolicus ATCC 33223 CP000924
Thermo anaerobacter brockii X64841
Thermo anaerobacter ethanolicus U49975
Arcobacter butzleri RM4018 CP000361
Thermoanaerobacter sp. X514 CP000923
Methanosarcina barkeri str. Fusaro CP000099
Thermoanaerobacter ethanolicus DQ323135
Thermoanaerobacter tengcongensis MB4 AEO 13038
Methanosarcina acetivorans str. C2A AEO 10299
Mycoplasma pneumoniae M129 U00089
[0099] The invention also provides isolated nucleic acid molecules having adhE gene activity, variants thereof, expression optimized forms of said adhE genes, and methods of improvement thereon. The full-length nucleic acid sequence for this gene, which encodes a bi-functional alcohol dehydrogenase and acetaldehyde dehydrogenase (generally, aldehyde oxido-reductase) enzyme (E. C. 1.2.1.10), has been identified and sequenced. Provided herein is a nucleotide coding sequence for the wild type adhE gene SEQ ID NO: 16 from Thermosynechococcus elongatus BP-I (accession number BA000039.2), a codon optimized nucleotide coding sequence, SEQ ID NO: 18, of the Thermosynechococcus elongatus BP- lwild type adhE gene, a nucleotide coding sequence for the wild type adhE gene SEQ ID NO: 19 from Escherichia coli str. K- 12 (accession number CP000948.1) and a codon optimized nucleotide coding sequence, SEQ ID NO:21 of the Escherichia coli str. K- 12 wild type adhE gene. SEQ ID NO: 17 represents the encoded amino acid sequence of the adhE enzyme from Thermosynechococcus elongatus BP-I. SEQ ID NO:20 represents the encoded amino acid sequence of the adhE enzyme from Escherichia coli str. K- 12.
[0100] In one embodiment, the invention provides isolated nucleic acid molecules having sequences comprising or consisting oϊpdc, adh2, adhl, and adhE gene homo logs, variants and derivatives of the wild-type coding sequences of Table 15. The invention provides nucleic acid molecules comprising or consisting of sequences which are structurally and functionally optimized versions of the wild-type genes of Table 15. In a preferred embodiment, nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences optimized for substrate affinity and/or substrate catalytic conversion rate are provided.
[0101] In a further embodiment, the invention provides nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the pdc gene having at least 80% identity to SEQ ID NO:3 or 79% identity to SEQ ID NO:6. Representatives of species with pdc genes homologous to SEQ ID NO: 3 as obtained from a BLAST search are shown in Table 5. Representatives of species with pdc genes homologous to SEQ ID NO: 6 as obtained from a BLAST search are shown in Table 6. In a further embodiment, the invention provides nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the pdc gene having at least 80% identity to SEQ ID NO:3 or at least 79% identity to SEQ ID NO:6 and optimized for substrate affinity, substrate catalytic conversion rate, improved thermostability, activity at a different pH and/or optimized codon usage for improved expression in a host cell. The nucleic acid sequences can be preferably 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to SEQ ID NO:1 or 79%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to SEQ ID NO:4, the wild-type sequences.
Table 5. Species with Representative Pyruvate Decarboxylase (pdc) genes homologous to SEQ ID NO:3
Species Gene Genebank product accession#
Gluconacetobacter diazotrophicus PDC NC 010125
Beijerinckia indica Bind 0083 NC 010581
Gluconobacter oxydans PDC YP 191506
Acetobacter pasteurianus aldl AF368435
Zymobacter palmae PDC AF474145
Schizosaccharomyces pombe predicted NP 592796
Podospora anserina hypothetical XP 001904289
Aspergillus fumigatus PDC XP 753176
Neurospora crassa PDC XP 959587
Gibberella zeae hypothetical XP 390622
Oryza sativa PDC3 NP 001049811
Oryza punctata unnamed protein product AK223957
Zea mays PDC2 clone NP 001105052
Arabidopsis thaliana PDC3 NP 195753
Physcomitrella patens subsp. patens hypothetical XP 001756932
Lycoris aurea PDC ABJ995
Dianthus caryophyllus PDC AAP96920
Vitis vinifera unnamed protein product CAO21424
Prunus armeniaca PDC ABZ79223
Chlamydomonas reinhardtii PDC3 XM 001703478
Triticum aestivum PDC BT009420
Saccharum officianarium PDC AJ251246
Coix lacryma-jobi PDC DQ455583
Aspergillus nidulans hypothetical XM 676573
Table 6. Species with Representative Pyruvate Decarboxylase (pdc) genes homologous to SEQ ID NO:6
Species Gene Genebank product accession#
Gluconacetobacter diazotrophicus PDC NC 010125
Beijerinckia indica Bind 0083 NC 010581
Gluconobacter oxydans PDC YP 191506
Acetobacter pasteurianus aldl AF368435
Zymomonas mobilis PDC NC 006526
Schizosaccharomyces pombe predicted NP 592796
Podospora anserina hypothetical XP 001904289
Neurospora crassa PDC XP 959587
Oryza sativa PDC3 NP 001049811
Zea mays PDC2 clone NP 001105052
Arabidopsis thaliana PDC3 NP 195753
Lotus corniculatus PDCl AAO72533
Physcomitrella patens subsp. patens hypothetical XP 001756932
Lycoris aurea PDC ABJ995
Dianthus caryophyllus PDC AAP96920
Fragaria x ananassa PDCl AAL37492
Vitis vinifera unnamed protein product CAO21424
Solanum tuberosum stPDC BAC23043
Chlamydomonas reinhardtii PDC3 XM 001703478
Oryza glaberrima PDC AC213130
Coix lacryma-jobi PDC DQ455583
Echinochloa crus-galli PDC AF497855 [0102] In a further embodiment, the invention provides nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the adh2 gene having at least 77% identity to SEQ ID NO:9. Representatives of species with adh2 genes homologous to SEQ ID NO:9 as obtained from a BLAST search are shown in Table 7. In a further embodiment, the invention provides nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the adh2 gene having at least 77% identity to SEQ ID NO: 9 and optimized for substrate affinity, substrate catalytic conversion rate, improved thermostability, activity at a different pH and/or optimized codon usage for improved expression in a host cell. The nucleic acid sequences can be preferably 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to the wild-type gene of SEQ ID NO:7.
Table 7. Species with Representative adh2 genes homologous to SEQ ID NO: 9
Species Gene Genebank product accession#
Proteus mirabilis probable ADH YP 002150424
Rhodoferax ferrireducens Fe-ADH YP 524107
Pseudomonas fluorescens Fe-ADH YP 347043
Rhodospirillum rubrum Fe-ADH YP 426018
Pseudomonas syringae ADH II NP 794041
Salmonella enterica Fe-ADH ZP 02660347
Pseudomonas entomophila ADH II YP 608524
Shewanella pealeana Fe-ADH YP 001501014
Shewanella halifaxensis Fe-ADH YP 001673424
Idiomarina loihiensis ADH YP 155185
Shewanella woodyi Fe-ADH YP 001759746
Shewanella baltica Fe-ADH YP 001553783
Escherichia coli probable ADH NP 756272
Vibrio fischeri Fe-ADH YP 002155987
Shewanella loihica Fe-ADH YP 001093295
Vibrio vulnificus ADH IV NP 936583
Shewanella denitrificans Fe-ADH YP 563580
Shigella boydii putative ADH YP 409898
Photobacterium profundum putative ADH YP 130703
Serratia proteamaculans Fe-ADH YP 001479882
Citrobacter koseri putative ADH YP 001456524
Enter obacter sp. 638 putative ADH YP 001174883
Shigella flexneri putative ADH NP 709367
Shewanella sp. MR-4 Fe-ADH YP 734890
Shewanella sp. ANA-3 Fe-ADH YP 870570
Enterobacter sakazakii putative ADH YP 001439895
Vibrio harveyi ADH YP 001447544
Azoarcus sp. EbNl ADH II YP 159645
Shewanella oneidensis ADH II NP 717107
Rhodopseudomonas palustris Fe-ADH YP 531841
Shewanella sediminis Fe-ADH YP 001472997
Aeromonas hydrophila 1,3 -propanediol dehydrogenase YP 856001
Pseudoalteromonas atlantica Fe-ADH YP 661058
Chromobacterium violaceum ADH NP 902398
Aeromonas salmonicida ADH YP 001142661
Shewanella amazonensis ADH II YP 928329
Carboxydothermus hydro genof or mans putative lactaldehyde reductase YP 359772
Desulfitobacterium hafniense hypothetical Fe-ADH YP 516798
Mannheimia succiniciproducens EutG protein YP 088994
Geobacter uraniireducens Fe-ADH YP 001231172
Pelobacter propionicus Fe-ADH YP 900574
Desulfotomaculum reducens Fe-ADH YP 001113612
Acinetobacter baumannii putative ADH IV YP 001707033
Burkholderia thailandensis Fe-ADH CP000086
Pelobacter carbinolicus ADH IV CP000142
Burkholderia pseudomallei EutG protein CP000572
Burkholderia mallei hypothetical protein CPOOOOlO
Geobacter metallireducens Fe-ADH CP000148
Gryllus bimaculatus hypothetical ADH, from mRNA AK276395
Shewanella sp. MR-7 Fe-ADH CP000444
Ralstonia eutropha ADH IV AM260479
Desulfovibrio desulfuricans Fe-ADH CPOOOl 12
Geobacter bemidjiensis Fe-ADH CPOOl 124
Actinobacillus succinogenes Fe-ADH CP000746
Aliivibrio salmonicida unnamed FM178379
Caldicellulosiruptor saccharolyticus ADH CP000679 [0103] In another further embodiment, the invention provides nucleic acid molecules and homo logs, variants and derivatives comprising or consisting of sequences which are variants of the adh2 gene having at least 79% identity to SEQ ID NO:23. SEQ ID NO:22 represents the encoded amino acid sequence for the adh2 enzyme represented by SEQ ID NO:23. In a further embodiment, the invention provides nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the adh2 gene having at least 79% identity to SEQ ID NO:23 and optimized for substrate affinity, substrate catalytic conversion rate, improved thermostability, activity at a different pH and/or optimized codon usage for improved expression in a host cell. The nucleic acid sequences can be preferably 79%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to the wild-type gene.
[0104] In a further embodiment is provided nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the adhl gene having at least 80% identity to SEQ ID NO: 12 or at least 71% identity to SEQ ID NO: 15. In a further embodiment provided nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the adhl gene having at least 80% identity to SEQ ID NO: 12 or at least 71% identity to SEQ ID NO: 15 and optimized for substrate affinity, substrate catalytic conversion rate, improved thermostability, activity at a different pH and/or optimized codon usage for improved expression in a host cell. The nucleic acid sequences can be preferably 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to SEQ ID NO: 10 or 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to SEQ ID NO: 13.
[0105] In a further embodiment is provided nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the adhE gene having at least 78% identity to SEQ ID NO: 18 or at least 80% identity to SEQ ID NO:21. In a further embodiment provided nucleic acid molecules and homologs, variants and derivatives comprising or consisting of sequences which are variants of the adhE gene having at least 78% identity to SEQ ID NO: 18 or at least 80% identity to SEQ ID NO:21 and optimized for substrate affinity, substrate specificity, substrate catalytic conversion rate, improved thermostability, activity at a different pH and/or optimized codon usage for improved expression in a host cell. The nucleic acid sequences can be preferably 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to SEQ ID NO:16 or 80%, 81%, 82%, 83%, 84%, 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to SEQ ID NO: 19.
[0106] Other representatives of wild-type adhE genes useful for the invention and homologous to the codon-optimized Thermosynechococcus elongatus BP-I adhE gene representative SEQ ID NO: 18 are shown in Table 8 and wild-type adhE genes homologous to codon-optimized Escherichia coli str. K- 12 adhE gene representative SEQ ID NO:21, are shown in Table 9.
Table 8. Species with Representative adhE Gene Homologues to SEQ ID NO: 18
Species Genebank accession#
Synechococcus sp. JA-3-3Ab CP000239 Synechococcus sp. JA-2-3B'a CP000240 Acaryochloris marina MBICl 1017 CP000828 Chromobacterium violaceum AEO 16825 Chlamydomonas reinhardtii spp. XM_001703533 Aeromonas hydrophila CP000462 Aeromonas salmonicida CP000644 Microcystis aeruginosa spp. AP009552 Shewanella loihica CP000606 Shewanella amazonensis CP000507 Enterobacter sakazakii CP000783 Citrobacter koseri CP000822 Sodalis glossinidius AP008232 Klebsiella pneumoniae spp. CP000647 Rhodopseudomonas palustris spp. CP000301 Shigella dysenteriae CP000034 Escherichia coli spp. CPOOl 164 Shigella flexneri spp. CP000266 Shigella sonnei CP000038 Shigella boydii spp. CP001063 Klebsiella oxytoca EU021506 Salmonella enterica spp. FM200053 Salmonella typhimurium AE008777 Serratia proteamaculans CP000826 Erwinia tasmaniensis CU468135 Erwinia carotovora BX950851 Shewanella oneidensis AEO 14299 Enterobacter sp. 638 CP000653 Shewanella spp. CP000446 Photobacterium profundum CR378666 Photorhabdus luminescens BX571867 Vibrio cholerae spp. CP000627 Yersinia enterocolitica AM286415 Shewanella baltica spp. CP000753 Yersinia pseudotuberculosis spp. CPOO 1048 Yersinia pestis spp. CP000901 Vibrio parahaemolyticus BA000031 Elusimicrobium minutum CP001055 Shewanella putrefaciens CP000681 Shewanella pealeana CP000851 Mastigamoeba balamuthi AY113188 Shewanella frigidimarina CP000447
Table 9. Species with Representative adhE Gene Homologues to SEQ ID NO:21
Species Genebank accession#
Shigella dysenteriae CP000034 Shigella boydii spp. CP001063 Shigella flexneri spp. CP000266 Shigella sonnei CP000038 Citrobacter koseri CP000822 Klebsiella pneumoniae spp. CP000964 Salmonella enterica sp CPOOl 120 Salmonella typhimurium spp. AE008777 Klebsiella oxytoca EU021506 Enterobacter sakazakii CP000783 Enterobactex spp. CP000653 Serratia proteamaculans CP000826 Erwinia carotovora BX950851 Yersinia enterocolitica AM286415 Sodalis glossinidius AP008232 Yersinia pseudotuberculosis spp. CP000950 Yersinia pestis spp. CP000901 Erwinia tasmaniensis CU468135 Aeromonas hydrophila CP000462 Aeromonas salmonicida CP000644 Photorhabdus luminescens BX571867 Xenorhabdus nematophila AY363171 Proteus mirabilis AM942759 Chromobacterium violaceum AEO 16825 Vibrio cholerae spp. CP000627 Rhodopseudomonas palustris CP000463 Shewanella amazonensis CP000507 Rhodopseudomonas palustris CP000301 Shewanella oneidensis AEO 14299 Vibrio vulnificus spp. BA000037 Shewanella spp. CP000446 Shewanella loihica CP000606 Photobacterium profundum CR378666 Vibrio parahaemolyticus BA000031 Shewanella baltica spp. CP000753 Vibrio harveyi CP000789 Shewanella woodyi CP000961 Aliivibrio salmonicida FM178379 Shewanella piezotolerans CP000472 Shewanella halifaxensis CP000931 Shewanella sediminis CP000821 Shewanella frigidimarina CP000447 Shewanella pealeana CP000851 Psychromonas ingrahamii 37 CP000510 Salmonella typhi AF145591
[0107] In another embodiment, the nucleic acid molecules of the invention encode a polypeptide having any one of the amino acid sequences of Table 16. Also provided are nucleic acid molecules encoding a polypeptide sequence that is at least 50% identical to any one of the amino acid sequences of Table 16. Preferably, the nucleic acid molecule of the invention encodes a polypeptide sequence at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% identical to any one of the amino acid sequences of Table 16, and the identity can even more preferably be 98%, 99%, 99.9% or even higher.
[0108] The invention also provides nucleic acid molecules that hybridize under stringent conditions to the above-described nucleic acid molecules. As defined above, and as is well known in the art, stringent hybridizations are performed at about 250C below the thermal melting point (Tm) for the specific DNA hybrid under a particular set of conditions, where the Tm is the temperature at which 50% of the target sequence hybridizes to a perfectly matched probe. Stringent washing can be performed at temperatures about 50C lower than the Tm for the specific DNA hybrid under a particular set of conditions.
[0109] The nucleic acid molecule of the invention includes DNA molecules (e.g., linear, circular, cDNA, chromosomal DNA, double stranded or single stranded) and RNA molecules (e.g., tRNA, rRNA, mRNA) and analogs of the DNA or RNA molecules of the described herein using nucleotide analogs. The isolated nucleic acid molecule of the invention includes a nucleic acid molecule free of naturally flanking sequences (i.e., sequences located at the 5' and 3' ends of the nucleic acid molecule) in the chromosomal DNA of the organism from which the nucleic acid is derived. In various embodiments, an isolated nucleic acid molecule can contain less than about 10 kb, 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, 0.1 kb, 50 bp, 25 bp or 10 bp of naturally flanking nucleotide chromosomal DNA sequences of the microorganism from which the nucleic acid molecule is derived.
[0110] The pdc, adhl, adh2 and adhE genes, as described herein, include nucleic acid molecules, for example, a polypeptide or RNA-encoding nucleic acid molecule, separated from another gene or other genes by intergenic DNA (for example, an intervening or spacer DNA which naturally flanks the gene and/or separates genes in the chromosomal DNA of the organism).
[0111] Nucleic acid molecules comprising a fragment of any one of the above-described nucleic acid sequences are also provided. These fragments preferably contain at least 20 contiguous nucleotides. More preferably the fragments of the nucleic acid sequences contain at least 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 or even more contiguous nucleotides.
[0112] In another embodiment, a nucleic acid molecule of the invention hybridizes to all or a portion of a nucleic acid molecule having any one of the sequences set forth in Table 17 or hybridizes to all or a portion of a nucleic acid molecule having a nucleotide sequence that encodes a polypeptide having any one of the amino acid sequences of Table 16. Such hybridization conditions are known to those skilled in the art (see, for example, Current Protocols in Molecular Biology, Ausubel et ah, eds., John Wiley & Sons, Inc. (1995); Molecular Cloning: A Laboratory Manual, Sambrook et ah, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989)). In another embodiment, an isolated nucleic acid molecule comprises a nucleotide sequence that is complementary to any one of the sequences in Tables 15 or 103.
[0113] The nucleic acid sequence fragments of the invention display utility in a variety of systems and methods. For example, the fragments may be used as probes in various hybridization techniques. Depending on the method, the target nucleic acid sequences may be either DNA or RNA. The target nucleic acid sequences may be fractionated (e.g., by gel electrophoresis) prior to the hybridization, or the hybridization may be performed on samples in situ. One of skill in the art will appreciate that nucleic acid probes of known sequence find utility in determining chromosomal structure (e.g., by Southern blotting) and in measuring gene expression (e.g., by Northern blotting). In such experiments, the sequence fragments are preferably detectably labeled, so that their specific hybridization to target sequences can be detected and optionally quantified. One of skill in the art will appreciate that the nucleic acid fragments of the invention may be used in a wide variety of blotting techniques not specifically described herein.
[0114] It should also be appreciated that the nucleic acid sequence fragments disclosed herein also find utility as probes when immobilized on microarrays. Methods for creating microarrays by deposition and fixation of nucleic acids onto support substrates are well known in the art. Reviewed in DNA Microarrays: A Practical Approach (Practical Approach Series), Schena (ed.), Oxford University Press (1999) (ISBN: 0199637768); Nature Genet. 21(l)(suppl):l-60 (1999); Microarray Biochip: Tools and Technology, Schena (ed.), Eaton Publishing Company/BioTechniques Books Division (2000) (ISBN: 1881299376), the disclosures of which are incorporated herein by reference in their entireties. Analysis of, for example, gene expression using microarrays comprising nucleic acid sequence fragments, such as the nucleic acid sequence fragments disclosed herein, is a well-established utility for sequence fragments in the field of cell and molecular biology. Other uses for sequence fragments immobilized on microarrays are described in Gerhold et al., Trends Biochem. Sci. 24:168-173 (1999) and Zweiger, Trends Biotechnol. 17:429-436 (1999); DNA Microarrays: A Practical Approach (Practical Approach Series), Schena (ed.), Oxford University Press (1999) (ISBN: 0199637768); Nature Genet. 21(l)(suppl):l-60 (1999); Microarray Biochip: Tools and Technology, Schena (ed.), Eaton Publishing Company/BioTechniques Books Division (2000) (ISBN: 1881299376), the disclosures of each of which is incorporated herein by reference in its entirety.
[0115] As is well known in the art, enzyme activities are measured in various ways. For example, the pyrophosphoro lysis of OMP may be followed spectroscopically . Grubmeyer et al, J. Biol. Chem. 268:20299-20304 (1993). Alternatively, the activity of the enzyme is followed using chromatographic techniques, such as by high performance liquid chromatography. Chung and Sloan, J. Chromatogr. 371 :71-81 (1986). As another alternative the activity is indirectly measured by determining the levels of product made from the enzyme activity. More modern techniques include using gas chromatography linked to mass spectrometry (Niessen, W. M. A. (2001). Current practice of gas chromatography— mass spectrometry. New York, N.Y: Marcel Dekker. (ISBN: 0824704738)). Additional modern techniques for identification of recombinant protein activity and products including liquid chromatography-mass spectrometry (LCMS), high performance liquid chromatography (HPLC), capillary electrophoresis, Matrix- Assisted Laser Desorption Ionization time of flight-mass spectrometry (MALDI-TOF MS), nuclear magnetic resonance (NMR), near-infrared (NIR) spectroscopy, viscometry (Knothe, G., R.O. Dunn, and M. O. Bagby. 1997. "Biodiesel: The use of vegetable oils and their derivatives as alternative diesel fuels." Am. Chem. Soc. Symp. Series 666: 172-208), physical property-based methods, wet chemical methods, etc. are used to analyze the levels and the identity of the product produced by the organisms of the invention. Other methods and techniques may also be suitable for the measurement of enzyme activity, as would be known by one of skill in the art.
[0116] Another embodiment of the invention comprises mutant or chimeric nucleic acid molecules or genes. Typically, a mutant nucleic acid molecule or mutant gene is comprised of a nucleotide sequence that has at least one alteration including, but not limited to, a simple substitution, insertion or deletion. The polypeptide of said mutant can exhibit an activity that differs from the polypeptide encoded by the wild-type nucleic acid molecule or gene. Typically, a chimeric mutant polypeptide includes an entire domain derived from another polypeptide that is genetically engineered to be collinear with a corresponding domain. Preferably, a mutant nucleic acid molecule or mutant gene encodes a polypeptide having improved activity such as substrate affinity, improved thermostability, activity at a different pH, or optimized codon usage for improved expression in a host cell. Vectors
[0117] The recombinant vector can be altered, modified or engineered to have different or a different quantity of nucleic acid sequences than in the derived or natural recombinant vector nucleic acid molecule. Preferably, the recombinant vector includes a gene or recombinant nucleic acid molecule of the invention operably linked to regulatory sequences including, but not limited to, promoter sequences, terminator sequences and/or artificial ribosome binding sites (RBSs), as defined herein.
[0118] Typically, the one or more copies of one or more of the genes of the invention are operably linked to regulatory sequence(s) in a manner which allows for the desired expression characteristics of the nucleotide sequence. Preferably one or more of the genes of the invention is transcribed and translated into a gene product encoded by the nucleotide sequence when the recombinant nucleic acid molecule is included in a recombinant vector, as defined herein, and is introduced into a microorganism.
[0119] The regulatory sequence may be comprised of nucleic acid sequences which modulate, regulate or otherwise affect expression of other nucleic acid sequences. In one embodiment, a regulatory sequence can be in a similar or identical position and/or orientation relative to a nucleic acid sequence of the invention as observed in its natural state, e.g., in a native position and/or orientation. For example, a gene of interest can be included in a recombinant nucleic acid molecule or recombinant vector operably linked to a regulatory sequence which accompanies or is adjacent to the gene of interest in the natural host cell, or can be adjacent to a different gene in the natural host cell, or can be operably linked to a regulatory sequence from another organism. Regulatory sequences operably linked to a gene of the invention can be from other bacterial regulatory sequences, bacteriophage regulatory sequences and the like.
[0120] In one embodiment, a regulatory sequence is a sequence which has been modified, mutated, substituted, derivated, deleted, including sequences which are chemically synthesized. Preferably, regulatory sequences include promoters, enhancers, termination signals, anti-termination signals and other expression control elements that, for example, serve as sequences to which repressors or inducers bind or serve as or encode binding sites for transcriptional and/or translational regulatory polypeptides, for example, in the transcribed mRNA (see Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989). Regulatory sequences include promoters directing constitutive expression of a nucleotide sequence in a host cell, promoters directing inducible expression of a nucleotide sequence in a host cell and promoters which attenuate or repress expression of a nucleotide sequence in a host cell. Regulating expression of a gene of interest also can be done by removing or deleting regulatory sequences. For example, sequences involved in the negative regulation of transcription can be removed such that expression of a gene of interest is enhanced. In one embodiment, a recombinant nucleic acid molecule or recombinant vector of the invention includes a nucleic acid sequence or gene that encodes at least one bacterial gene product of the invention operably linked to a promoter or promoter sequence. Preferably, promoters of the invention include native promoters, surrogate promoters and/or bacteriophage promoters.
[0121] In one embodiment, a promoter is associated with a biochemical housekeeping gene or a promoter associated with an ethanologenic pathway. In another embodiment, a promoter is a bacteriophage promoter. Other promoters include tef (the translational elongation factor (TEF) promoter) which promotes high level expression in Bacillus (e.g., Bacillus subtilis). Additional advantageous promoters, for example, for use in Gram positive microorganisms include, but are not limited to, the amyE promoter or phage SP02 promoters. Additional advantageous promoters, for example, for use in Gram negative microorganisms include, but are not limited to tac, trp, tet, trp-tet, lpp, lac, lpp-lac, laclq, T7, T5, T3, gal, trc,
Figure imgf000044_0001
[0122] In another embodiment, a recombinant nucleic acid molecule or recombinant vector of the invention includes a transcription terminator sequence or sequences. Typically, terminator sequences refer to the regulatory sequences which serve to terminate transcription of a gene. Terminator sequences (or tandem transcription terminators) can further serve to stabilize mRNA (e.g., by adding structure to mRNA), for example, against nucleases.
[0123] In another embodiment, a recombinant nucleic acid molecule or recombinant vector of the invention has sequences allowing for detection of the vector containing sequences (i.e., detectable and/or selectable markers), for example, sequences that overcome auxotrophic mutations, for example, ura3 or ilvE, fluorescent markers, and/or calorimetric markers (e.g., lacZ/β-galactosidase), and/or antibiotic resistance genes (e.g., bla or tet).
[0124] It is understood that any one of the genes of the invention can be introduced into a vector also comprising one or more ethanologenic genes and/or a gene encoding a gene product suitable for fermenting an exogenous sugar or degrading an exogenous sugar for subsequent fermentation and/or used to produce ethanol using light, water and carbon dioxide.
[0125] Also provided are vectors, including expression vectors, which comprise the above nucleic acid molecules of the invention, as described further herein. In a first embodiment, the vectors include the isolated nucleic acid molecules described above. In an alternative embodiment, the vectors of the invention include the above-described nucleic acid molecules operably linked to one or more expression control sequences. The vectors of the instant invention may thus be used to express an adhl and/or adh2 polypeptide having activity for alcohol dehydrogenase; a pdc polypeptide having activity for pyruvate decarboxylase; and/or adhE polypeptide having activity for bi-functional alcohol dehydrogenase.
[0126] Vectors useful for expression of nucleic acids in prokaryotes are well known in the art. A useful vector herein is plasmid pCDFDuet-1 that is available from Novagen. Another useful vector of the invention is the endogenous Synechococcus sp. PCC 7002 plasmid pAQl (Genbank accession number NC O 10476). Isolated Polypeptides
[0127] In one embodiment, polypeptides encoded by nucleic acid sequences of the invention are produced by recombinant DNA techniques and can be isolated from expression host cells by an appropriate purification scheme using standard polypeptide purification techniques. In another embodiment, polypeptides encoded by nucleic acid sequences of the invention are synthesized chemically using standard peptide synthesis techniques.
[0128] Included within the scope of the invention are pdc polypeptides or gene products that are derived polypeptides or gene products encoded by naturally-occurring bacterial genes (Tables 1, 5 and 6). Further, included within the scope of the invention, are bacteria-derived polypeptides or gene products which differ from wild-type genes, including genes that have altered, inserted or deleted nucleic acids but which encode polypeptides substantially similar in structure and/or function to those encoded by the wild-type pdc gene.
[0129] Included within the scope of the invention are adh2 polypeptides or gene products that are derived polypeptides or gene products encoded by naturally-occurring bacterial genes (Tables 2 and 7). Further, included within the scope of the invention, are bacteria-derived polypeptides or gene products which differ from wild-type genes, including genes that have altered, inserted or deleted nucleic acids but which encode polypeptides substantially similar in structure and/or function to those encoded by the wild-type adh2 gene.
[0130] Included within the scope of the invention are adhl polypeptides or gene products that are derived polypeptides or gene products encoded by naturally-occurring bacterial genes (Tables 3 and 4). Further, included within the inventive scope, are bacteria-derived polypeptides or gene products which differ from wild-type genes, including genes that have altered, inserted or deleted nucleic acids but which encode polypeptides substantially similar in structure and/or function to those encoded by the wild-type adhl gene.
[0131] Included within the scope of the invention are adhE polypeptides or gene products that are derived polypeptides or gene products encoded by naturally-occurring bacterial genes (Tables 8 and 9). Further, included within the inventive scope, are bacteria-derived polypeptides or gene products which differ from wild-type genes, including genes that have altered, inserted or deleted nucleic acids but which encode polypeptides substantially similar in structure and/or function to those encoded by the wild-type adhE gene.
[0132] For example, it is well understood that one of skill in the art can mutate (e.g., substitute) nucleic acids which, due to the degeneracy of the genetic code, encode for an identical amino acid as that encoded by the naturally-occurring gene. This may be desirable in order to improve the codon usage of a nucleic acid to be expressed in a particular organism. Moreover, it is well understood that one of skill in the art can mutate (e.g., substitute) nucleic acids which encode for conservative amino acid substitutions. It is further well understood that one of skill in the art can substitute, add or delete amino acids to a certain degree to improve upon or at least insubstantially affect the function and/or structure of a gene product (e.g., alcohol dehydrogenase, pyruvate decarboxylase or bi-functional aldehyde oxido-reductase/alcohol dehydrogenase activities) as compared with a naturally- occurring gene product, each instance of which is intended to be included within the scope of the invention. For example, the enzyme activity, enzyme/substrate affinity, enzyme thermostability, and/or enzyme activity at various pHs can be unaffected or rationally altered and readily evaluated using the assays described herein.
[0133] Typically, the iron binding alcohol dehydrogenase enzymes of the invention exhibit an acetaldehyde substrate affinity (Km) of about 1 to about 5 milli-molar (mM); more particularly the Km is optimized over endogenous activity for the purposes described herein. The iron binding alcohol dehydrogenase enzymes of the invention exhibit an ethanol substrate affinity (K1n) of about 10 to about 40 milli-molar (rnM); more particularly the K1n is optimized over endogenous activity for the purposes described herein. The iron binding alcohol dehydrogenase enzymes of the invention exhibit an affinity (K1n) of about 1 to about 12 milli-molar (mM) for reduced nicotinamide adenine dinucleotide substrate (NADH); more particularly the K1n is optimized over endogenous activity for the purposes described herein. The iron binding alcohol dehydrogenase enzymes of the invention exhibit an affinity (K1n) of about 60 to about 100 milli-molar (mM) for oxidized nicotinamide adenine dinucleotide substrate (NAD+); more particularly the K1n is optimized over endogenous activity for the purposes described herein.
[0134] Typically, the zinc binding alcohol dehydrogenase enzymes exhibit an acetaldehyde substrate affinity (K1n) of about 50 to about 100 micro-molar (μM); more particularly the K1n is optimized over endogenous activity for the purposes described herein. The zinc binding alcohol dehydrogenase enzymes exhibit an ethanol substrate affinity (K1n) of about 1 to about 10 milli-molar (mM); more particularly the K1n is optimized over endogenous activity for the purposes described herein. The NADH-dependent zinc binding alcohol dehydrogenase enzymes exhibit an affinity (K1n) of about 20 to about 30 μM for reduced nicotinamide adenine dinucleotide substrate (NADH); more particularly the K1n is optimized over endogenous activity for the purposes described herein. The NADH-dependent zinc binding alcohol dehydrogenase enzymes exhibit an affinity (K1n) of about 60 to about 80 μM for oxidized nicotinamide adenine dinucleotide substrate (NAD+); more particularly the K1n is optimized over endogenous activity for the purpose of the invention described herein.
[0135] The NADPH-dependent zinc binding alcohol dehydrogenase enzyme exhibit an affinity (K1n) of about 80 to about 100 μM for reduced nicotinamide adenine dinucleotide phosphate substrate (NADPH); more particularly the K1n is optimized over endogenous activity for the purposes described herein. The NADPH-dependent zinc binding alcohol dehydrogenase enzymes exhibit an affinity (K1n) of about 20 to about 40 μM for oxidized nicotinamide adenine dinucleotide phosphate substrate (NADP+) (Kumar, A., et al. (1992). Proc Natl Acad Sci USA 89: 10188-10192); more particularly the K1n is optimized over endogenous activity for the purpose of the invention described herein.
[0136] Typically, the bi-functional alcohol dehydrogenase enzymes exhibit an acetaldehyde substrate affinity (K1n) of about about 10 milli-molar (mM); more particularly the K1n is optimized over endogenous activity for the purposes described herein. The bi- functional alcohol dehydrogenase enzymes exhibit an ethanol substrate affinity (Km) of about 10 to about 40 milli-molar (mM); more particularly the K1n is optimized over endogenous activity for the purposes described herein. The bi-functional alcohol dehydrogenase enzymes exhibit an affinity (Km) of about 25 micro-molar (mM) for reduced nicotinamide adenine dinucleotide substrate (NADH); more particularly the Km is optimized over endogenous activity for the purposes described herein. The bi-functional alcohol dehydrogenase enzymes exhibit an affinity (Km) of about 80 micro-molar (μM) for oxidized nicotinamide adenine dinucleotide substrate (NAD+); more particularly the Km is optimized over endogenous activity for the purposes described herein. More particularly, the Km for ethanol is optimized over endogenous activity for the purposes described herein.
[0137] Typically, the pyruvate decarboxylase enzymes of the invention exhibit a substrate affinity (Km) of about 0.1 to about 1 milli-molar (mM), more particularly a Km of about 0.1 mM to about 0.5 mM, even more particularly a Km of about 0.2 mM to about of about 0.4 mM.
[0138] According to another aspect of the invention, isolated polypeptides (including muteins, allelic variants, fragments, derivatives, and analogs) encoded by the nucleic acid molecules of the invention are provided. In one embodiment, the isolated polypeptide comprises a polypeptide sequence corresponding to any one of the sequences in Table 16. In an alternative embodiment of the invention, the isolated polypeptide comprises a polypeptide sequence at least 50% identical to any one of the sequences in Table 16. Preferably the isolated polypeptide of the invention has at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or even higher identity to the sequences of the invention optimized for substrate affinity and/or substrate catalytic conversion rate.
[0139] According to other embodiments of the invention, isolated polypeptides comprising a fragment of the above-described polypeptide sequences are provided. These fragments preferably include at least 20 contiguous amino acids, more preferably at least 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 or even more contiguous amino acids.
[0140] The polypeptides of the invention also include fusions between the above- described polypeptide sequences and heterologous polypeptides. The heterologous sequences can, for example, include sequences designed to facilitate purification, e.g., histidine tags, and/or visualization of recombinantly-expressed proteins. Other non- limiting examples of protein fusions include those that permit display of the encoded protein on the surface of a phage or a cell, fusions to intrinsically fluorescent proteins, such as green fluorescent protein (GFP), and fusions to the IgG Fc region. Host Cell Transformants
[0141] In another aspect of the invention, host cells transformed with the nucleic acid molecules or vectors of the invention, and descendants thereof, are provided. In some embodiments of the invention, these cells carry the nucleic acid sequences of the invention on vectors, which may but need not be freely replicating vectors. In other embodiments of the invention, the nucleic acids have been integrated into the genome of the host cells.
[0142] The host cell encoding pyruvate decarboxylase can be a host cell lacking the pyruvate dehydrogenase gene, a host cell with a gene encoding a pyruvate decarboxylase gene or a host cell engineered to express pdc polypeptide.
[0143] The host cell encoding alcohol dehydrogenase can be a host cell lacking an alcohol dehydrogenase gene, a host cell with a gene encoding an alcohol dehydrogenase gene or a host cell engineered to express adhl and/or adh2 polypeptide.
[0144] The host cell encoding bi-functional alcohol dehydrogenase can be a host cell lacking an alcohol dehydrogenase or bi-functional alcohol dehydrogenase gene, a host cell with a gene encoding an alcohol dehydrogenase or bi-functional alcohol dehydrogenase gene or a host cell engineered to express adhE polypeptide.
[0145] In a preferred embodiment, the host cell comprises one or more copies of one or more nucleic acids of Table 17.
[0146] In an alternative embodiment, the host cells of the invention can be mutated by recombination with a disruption, deletion or mutation of the isolated nucleic acid of the invention so that the activity of any or all of the pdc, adhl, adh2, or adhE polypeptides in the host cell is reduced or eliminated compared to a host cell lacking the mutation.
[0147] In another embodiment, the host cell of the invention containing a gene of the invention can be ethanologenic, and/or further comprise an ethanologenic gene(s) encoding alcohol dehydrogenase, pyruvate decarboxylase or a combination thereof. In yet another embodiment, the host cell is suitable for fermenting ethanol from a sugar. In a particular embodiment, the host cell is a recombinant ethanologenic host cell comprising a heterologous nucleic acid encoding a gene from Table 17. [0148] In another aspect, the invention provides a method for expressing a polypeptide of the invention under suitable culture conditions and choice of host cell line for optimal enzyme expression, activity and stability (codon usage, salinity, pH, temperature, etc.).
[0149] In another aspect, the invention provides a method for producing acetaldehyde and/or ethanol by culturing a host cell under conditions in which pyruvate decarboxylase, alcohol dehydrogenase and/or bi-functional alcohol dehydrogenase are expressed at sufficient levels to produce a measureable quantity of acetaldehyde and/or ethanol from sugar. In a related embodiment, the method for producing acetaldehyde and/or ethanol is performed by contacting a cell lysate obtained from the above host cell under conditions in which acetaldehyde and/or ethanol is produced from a sugar. Accordingly, the invention provides enzyme extracts having improved alcohol dehydrogenase, pyruvate decarboxylase, and/or bifunctional alcohol dehydrogenase activities and having, for example, thermal stability, activity at various pH, superior substrate affinity and/or specificity.
Selected or Engineered Microorganisms For the Production of Carbon-Based Products of Interest
[0150] Microorganism: Includes prokaryotic and eukaryotic microbial species from the Domains Archaea, Bacteria and Eucarya, the latter including yeast and filamentous fungi, protozoa, algae, or higher Protista. The terms "microbial cells" and "microbes" are used interchangeably with the term microorganism.
[0151] A variety of host organisms can be transformed to produce a product of interest. Photoautotrophic organisms include eukaryotic plants and algae, as well as prokaryotic cyanobacteria, green-sulfur bacteria, green non-sulfur bacteria, purple sulfur bacteria, and purple non-sulfur bacteria.
[0152] The host cell can be a Gram-negative bacterial cell or a Gram-positive bacterial cell. A Gram-negative host cell of the invention can be, e.g., Gluconobacter, Rhizobium, Bradyrhizobium, Alcaligenes, Rhodobacter, Rhodococcus. Azospirillum, Rhodospirillum, Sphingomonas, Burkholderia, Desuifomonas, Geospirillum, Succinomonas, Aeromonas, Shewanella, Halochromatium, Citrobacter, Escherichia, Klebsiella, Zymomonas Zymobacter, or Acetobacter. A Gram-positive host cell of the invention can be, e.g., Fibrobacter, Acidobacter, Bacteroides, Sphingobacterium, Actinomyces, Corynebacterium, Nocardia, Rhodococcus, Propionibacterium, Bifidobacterium, Bacillus, Geobacillus, Paenibacillus, Sulfobacillus, Clostridium, Anaerobacter, Eubacterium, Streptococcus, Lactobacillus, Leuconostoc, Enterococcus, Lactococcus, Thermobifida, Cellulomonas, or Sarcina. [0153] Extremophiles are also contemplated as suitable organisms. Such organisms withstand various environmental parameters such as temperature, radiation, pressure, gravity, vacuum, desiccation, salinity, pH, oxygen tension, and chemicals. They include hyperthermophiles, which grow at or above 800C such as Pyrolobus fumarii; thermophiles, which grow between 60-800C such as Synechococcus lividis; mesophiles, which grow between 15-600C and psychrophiles, which grow at or below 15°C such as Psychrobacter and some insects. Radiation-tolerant organisms include Deinococcus radiodurans . Pressure- tolerant organisms include piezophiles or barophiles, which tolerate pressure of 130 MPa. Hypergravity- (e.g., >lg) hypogravity- (e.g., <lg) tolerant organisms are also contemplated. Vacuumtolerant organisms include tardigrades, insects, microbes and seeds. Dessicant- tolerant and anhydrobiotic organisms include xerophiles such as Artemia salina; nematodes, microbes, fungi and lichens. Salt-tolerant organisms include halophiles (e.g., 2-5 M NaCl) Halobacteriacea and Dunaliella salina. pH-tolerant organisms include alkaliphiles such as Natronobacterium, Bacillus firmus OF4, Spirulina spp. (e.g., pH > 9) and acidophiles such as Cyanidium caldarium, Ferroplasma sp. (e.g., low pH). Anaerobes, which cannot tolerate O2 such as Methanococcus jannaschii; microaerophils, which tolerate some O2 such as Clostridium and aerobes, which require O2 are also contemplated. Gas-tolerant organisms, which tolerate pure CO2 include Cyanidium caldarium and metal-tolerant organisms include metalotolerants such as Ferroplasma acidarmanus (e.g., Cu, As, Cd, Zn), Ralstonia sp. CH34 (e.g., Zn, Co, Cd, Hg, Pb). Gross, Michael. Life on the Edge: Amazing Creatures Thriving in Extreme Environments. New York: Plenum (1998) and Seckbach, J. "Search for Life in the Universe with Terrestrial Microbes Which Thrive Under Extreme Conditions." In Cristiano Batalli Cosmovici, Stuart Bowyer, and Dan Wertheimer, eds., Astronomical and Biochemical Origins and the Search for Life in the Universe, p. 511. Milan: Editrice Compositori (1997).
[0154] Plants include but are not limited to the following genera: Arabidopsis, Beta, Glycine, Jatropha, Miscanthus, Panicum, Phalaris, Populus, Saccharum, Salix, Simmondsia and Zea.
[0155] Algae and cyanobacteria include but are not limited to the following genera: Acanthoceras, Acanthococcus, Acaryochloris, Achnanthes, Achnanthidium, Actinastrum, Actinochloris, Actinocyclus, Actinotaenium, Amphichrysis, Amphidinium, Amphikrikos, Amphipleura, Amphiprora, Amphithrix, Amphora, Anabaena, Anabaenopsis, Aneumastus, Ankistrodesmus, Ankyra, Anomoeoneis, Apatococcus, Aphanizomenon, Aphanocapsa, Aphanochaete, Aphanothece, Apiocystis, Apistonema, Arthrodesmus, Artherospira, Ascochloris, Asterionella, Asterococcus, Audouinella, Aulacoseira, Bacillaria, Balbiania, Bambusina, Bangia, Basichlamys, Batrachospermum, Binuclearia, Bitrichia, Blidingia, Botrdiopsis, Botrydium, Botryococcus, Botryosphaerella, Brachiomonas, Brachysira, Brachytrichia, Brebissonia, Bulbochaete, Bumilleria, Bumilleriopsis, Caloneis, Calothrix, Campy iodiscus, Capsosiphon, Carteria, Catena, Cavinula, Centritractus, Centronella, Ceratium, Chaetoceros, Chaetochloris, Chaetomorpha, Chaetonella, Chaetonema, Chaetopeltis, Chaetophora, Chaetosphaeridium, Chamaesiphon, Chara, Characiochloris, Characiopsis, Characium, Charales, Chilomonas, Chlainomonas, Chlamydoblepharis, Chlamydocapsa, Chlamydomonas, Chlamydomonopsis, Chlamydomyxa, Chlamydonephris, Chlorangiella, Chlorangiopsis, Chlorella, Chlorobotrys, Chlorobrachis, Chlorochytrium, Chlorococcum, Chlorogloea, Chlorogloeopsis, Chlorogonium, Chlorolobion, Chloromonas, Chlorophysema, Chlorophyta, Chlorosaccus, Chlorosarcina, Choricystis, Chromophyton, Chromulina, Chroococcidiopsis, Chroococcus, Chroodactylon, Chroomonas, Chroothece, Chrysamoeba, Chrysapsis, Chrysidiastrum, Chrysocapsa, Chrysocapsella, Chrysochaete, Chrysochromulina, Chrysococcus, Chrysocrinus, Chrysolepidomonas, Chrysolykos, Chrysonebula, Chrysophyta, Chrysopyxis, Chrysosaccus, Chrysophaerella, Chrysostephanosphaera, Clodophora, Clastidium, Closteriopsis, Closterium, Coccomyxa, Cocconeis, Coelastrella, Coelastrum, Coelosphaerium, Coenochloris, Coenococcus, Coenocystis, Colacium, Coleochaete, Collodictyon, Compsogonopsis, Compsopogon, Conjugatophyta, Conochaete, Coronastrum, Cosmarium, Cosmioneis, Cosmocladium, Crateriportula, Craticula, Crinalium, Crucigenia, Crucigeniella, Cryptoaulax, Cryptomonas, Cryptophyta, Ctenophora, Cyanodictyon, Cyanonephron, Cyanophora, Cyanophyta, Cyanothece, Cyanothomonas, Cyclonexis, Cyclostephanos, Cyclotella, Cylindrocapsa, Cylindrocystis, Cylindrospermum, Cylindrotheca, Cymatopleura, Cymbella, Cymbellonitzschia, Cystodinium Dactylococcopsis, Debarya, Denticula, Dermatochrysis, Dermocarpa, Dertnocarpella, Desmatractum, Desmidium, Desmococcus, Desmonema, Desmosiphon, Diacanthos, Diacronema, Diadesmis, Diatoma, Diatomella, Dicellula, Dichothrix, Dichotomococcus, Dicranochaete, Dictyochloris, Dictyococcus, Dictyosphaerium, Didymocystis, Didymogenes, Didymosphenia, Dilabifilum, Dimorphococcus, Dinobryon, Dinococcus, Diplochloris, Diploneis, Diplostauron, Distrionella, Docidium, Draparnaldia, Dunaliella, Dysmorphococcus, Ecballocystis, Elakatothrix, Ellerbeckia, Encyonema, Enter omorpha, Entocladia, Entomoneis, Entophysalis, Epichrysis, Epipyxis, Epithemia, Eremosphaera, Euastropsis, Euastrum, Eucapsis, Eucocconeis, Eudorina, Euglena, Euglenophyta, Eunotia, Eustigmatophyta, Eutreptia, Fallacia, Fischerella, Fragilaria, Fragilariforma, Franceia, Frustulia, Curcilla, Geminella, Genicularia, Glaucocystis, Glaucophyta, Glenodiniopsis, Glenodinium, Gloeocapsa, Gloeochaete, Gloeochrysis, Gloeococcus, Gloeocystis, Gloeodendron, Gloeomonas, Gloeoplax, Gloeothece, Gloeotila, Gloeotrichia, Gloiodictyon, Golenkinia, Golenkiniopsis, Gomontia, Gomphocymbella, Gomphonema, Gomphosphaeria, Gonatozygon, Gongrosia, Gongrosira, Goniochloris, Gonium, Gonyostomum, Granulochloris, Granulocystopsis, Groenbladia, Gymnodinium, Gymnozyga, Gyrosigma, Haematococcus, Hafniomonas, Hallassia, Hammatoidea, Hannaea, Hantzschia, Hapalosiphon, Haplotaenium, Haptophyta, Haslea, Hemidinium, Hemitonia, Heribaudiella, Heteromastix, Heterothrix, Hibberdia, Hildenbrandia, Hillea, Holopedium, Homoeothrix, Hormanthonema, Hormotila, Hyalobrachion, Hyalocardium, Hyalodiscus, Hyalogonium, Hyalotheca, Hydrianum, Hydrococcus, Hydrocoleum, Hydrocoryne, Hydrodictyon, Hydrosera, Hydrurus, Hyella, Hymenomonas, Isthmochloron, Johannesbaptistia, Juranyiella, Karayevia, Kathablepharis, Katodinium, Kephyrion, Keratococcus, Kirchneriella, Klebsormidium, Kolbesia, Koliella, Komarekia, Korshikoviella, Kraskella, Lagerheimia, Lagynion, Lamprothamnium, Lemanea, Lepocinclis, Leptosira, Lobococcus, Lobocystis, Lobomonas, Luticola, Lyngbya, Malleochloris, Mallomonas, Mantoniella, Marssoniella, Martyana, Mastigocoleus, Gastogloia, Melosira, Merismopedia, Mesostigma, Mesotaenium, Micractinium, Micrasterias, Microchaete, Microcoleus, Microcystis, Microglena, Micromonas, Microspora, Microthamnion, Mischococcus, Monochrysis, Monodus, Monomastix, Monoraphidium, Monostroma, Mougeotia, Mougeotiopsis, Myochloris, Myromecia, Myxosarcina, Naegeliella, Nannochloris, Nautococcus, Navicula, Neglectella, Neidium, Nephroclamys, Nephrocytium, Nephrodiella, Nephroselmis, Netrium, Nitella, Nitellopsis, Nitzschia, Nodularia, Nostoc, Ochromonas, Oedogonium, Oligochaetophora, Onychonema, Oocardium, Oocystis, Opephora, Ophiocytium, Orthoseira, Oscillatoria, Oxyneis, Pachycladella, Palmella, Palmodictyon, Pnadorina, Pannus, Paralia, Pascherina, Paulschulzia, Pediastrum, Pedinella, Pedinomonas, Pedinopera, Pelagodictyon, Penium, Peranema, Peridiniopsis, Peridinium, Peronia, Petroneis, Phacotus, Phacus, Phaeaster, Phaeodermatium, Phaeophyta, Phaeosphaera, Phaeothamnion, Phormidium, Phycopeltis, Phyllariochloris, Phyllocardium, Phyllomitas, Pinnularia, Pitophora, Placoneis, Planctonema, Planktosphaeria, Planothidium, Plectonema, Pleodorina, Pleurastrum, Pleurocapsa, Pleurocladia, Pleurodiscus, Pleurosigma, Pleurosira, Pleurotaenium, Pocillomonas, Podohedra, Polyblepharides, Polychaetophora, Polyedriella, Polyedriopsis, Poly goniochloris, Polyepidomonas, Polytaenia, Polytoma, Polytomella, Porphyridium, Posteriochromonas, Prasinochloris, Prasinocladus, Prasinophyta, Prasiola, Prochlorphyta, Prochlorothrix, Protodertna, Protosiphon, Provasoliella, Prymnesium, Psammodictyon, Psammothidium, Pseudanabaena, Pseudenoclonium, Psuedocarteria, Pseudochate, Pseudocharacium, Pseudococcomyxa, Pseudodictyosphaerium, Pseudokephyrion, Pseudoncobyrsa, Pseudoquadrigula, Pseudosphaerocystis, Pseudostaurastrum, Pseudostaurosira, Pseudotetrastrum, Pteromonas, Punctastruata, Pyramichlamys, Pyramimonas, Pyrrophyta, Quadrichloris, Quadricoccus, Quadrigula, Radiococcus, Radiofilum, Raphidiopsis, Raphidocelis, Raphidonema, Raphidophyta, Peimeria, Rhabdodertna, Rhabdomonas, Rhizoclonium, Rhodomonas, Rhodophyta, Rhoicosphenia, Rhopalodia, Rivularia, Rosenvingiella, Rossithidium, Roya, Scenedesmus, Scherjfelia, Schizochlamydella, Schizochlamys, Schizomeris, Schizothrix, Schroederia, Scolioneis, Scotiella, Scotiellopsis, Scourfieldia, Scytonema, Selenastrum, Selenochloris, Sellaphora, Semiorbis, Siderocelis, Diderocystopsis, Dimonsenia, Siphononema, Sirocladium, Sirogonium, Skeletonema, Sorastrum, Spermatozopsis, Sphaerellocystis, Sphaerellopsis, Sphaerodinium, Sphaeroplea, Sphaerozosma, Spiniferomonas, Spirogyra, Spirotaenia, Spirulina, Spondylomorum, Spondylosium, Sporotetras, Spumella, Staurastrum, Stauerodesmus, Stauroneis, Staurosira, Staurosirella, Stenopterobia, Stephanocostis, Stephanodiscus, Stephanoporos, Stephanosphaera, Stichococcus, Stichogloea, Stigeoclonium, Stigonema, Stipitococcus, Stokesiella, Strombomonas, Stylochrysalis, Stylodinium, Styloyxis, Stylosphaeridium, Surirella, Sykidion, Symploca, Synechococcus, Synechocystis, Synedra, Synochromonas, Synura, Tabellaria, Tabularia, Teilingia, Temnogametum, Tetmemorus, Tetrachlorella, Tetracyclus, Tetradesmus, Tetraedriella, Tetraedron, Tetraselmis, Tetraspora, Tetrastrum, Thalassiosira, Thamniochaete, Thorakochloris, Thorea, Tolypella, Tolypothrix, Trachelomonas, Trachydiscus, Trebouxia, Trentepholia, Treubaria, Tήbonema, Trichodesmium, Trichodiscus, Trochiscia, Tryblionella, Ulothrix, Uroglena, Uronema, Urosolenia, Urospora, Uva, Vacuolaria, Vaucheria, Volvox, Volvulina, Westella, Woloszynskia, Xanthidium, Xanthophyta, Xenococcus, Zygnema, Zygnemopsis, and Zygonium.
[0156] Green non-sulfur bacteria include but are not limited to the following genera: Chloroflexus, Chloronema, Oscillochloris, Heliothrix, Herpetosiphon, Roseiflexus, and Thermomicrobium.
[0157] Green sulfur bacteria include but are not limited to the following genera: Chlorobium, Clathrochloris, and Prosthecochloris . [0158] Purple sulfur bacteria include but are not limited to the following genera: Allochromatium, Chromatium, Halochromatium, Isochromatium, Marie hromatium, Rhodovulum, Thermochromatium, Thiocapsa, Thiorhodococcus, and Thiocystis,
[0159] Purple non-sulfur bacteria include but are not limited to the following genera: Phaeospirillum, Rhodobaca, Rhodobacter, Rhodomicrobium, Rhodopila, Rhodopseudomonas, Rhodothalassium, Rhodospirillum, Rodovibrio, and Roseospira.
[0160] Aerobic chemolithotrophic bacteria include but are not limited to nitrifying bacteria such as Nitrobacteraceae sp., Nitrobacter sp., Nitrospina sp., Nitrococcus sp., Nitrospira sp., Nitrosomonas sp., Nitrosococcus sp., Nitrosospira sp., Nitrosolobus sp., Nitrosovibrio sp.; colorless sulfur bacteria such as, Thiovulum sp., Thiobacillus sp., Thiomicrospira sp., Thiosphaera sp., Thermothrix sp.; obligately chemolithotrophic hydrogen bacteria such as Hydrogenobacter sp., iron and manganese-oxidizing and/or depositing bacteria such as Siderococcus sp., and magnetotactic bacteria such as Aquaspirillum sp.
[0161] Archaeobacteria include but are not limited to methanogenic archaeobacteria such as Methanobacterium sp., Methanobrevibacter sp., Methanothermus sp., Methanococcus sp., Methanomicrobium sp., Methanospirillum sp., Methanogenium sp., Methanosarcina sp., Methanolobus sp., Methanothrix sp., Methanococcoides sp., Methanoplanus sp.; extremely thermophilic sulfur-metabolizers such as Thermoproteus sp., Pyrodictium sp., Sulfolobus sp., Acidianus sp. and other microorganisms such as, Bacillus subtilis, Saccharomyces cerevisiae, Streptomyces sp., Ralstonia sp., Rhodococcus sp., Corynebacteria sp., Brevibacteria sp., Mycobacteria sp., and oleaginous yeast.
[0162] HyperPhotosynthetic conversion requires extensive genetic modification; thus, in preferred embodiments the parental photoautotrophic organism can be transformed with exogenous DNA.
[0163] Preferred organisms for HyperPhotosynthetic conversion include: Arabidopsis thaliana, Panicum virgatum, Miscanthus giganteus, and Zea mays (plants), Botryococcus braunii, Chlamydomonas reinhardtii and Dunaliela salina (algae), Synechococcus sp PCC 7002, Synechococcus sp. PCC 7942, Synechocystis sp. PCC 6803, and Thermosynechococcus elongatus BP-I (cyanobacteria), Chlorobium tepidum (green sulfur bacteria), Chloroflexus auranticus (green non-sulfur bacteria), Chromatium tepidum and Chromatium vinosum (purple sulfur bacteria), Rhodospirillum rubrum, Rhodobacter capsulatus, and Rhodopseudomonas palusris (purple non-sulfur bacteria). [0164] Yet other suitable organisms include synthetic cells or cells produced by synthetic genomes as described in Venter et al. US Pat. Pub. No. 2007/0264688, and cell-like systems or synthetic cells as described in Glass et al. US Pat. Pub. No. 2007/0269862.
[0165] Still, other suitable organisms include microorganisms that can be engineered to fix carbon dioxide bacteria such as Escherichia coli, Acetobacter aceti, Bacillus subtilis, yeast and fungi such as Clostridium ljungdahlii, Clostridium thermocellum, Penicillium chrysogenum, Pichiapastoris, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pseudomonas fluorescens, or Zymomonas mobilis.
[0166] A common theme in selecting or engineering a suitable organism is autotrophic fixation Of CO2 to products. This would cover photosynthesis and methanogenesis. Acetogenesis, encompassing the three types of CO2 fixation; Calvin cycle, acetyl-CoA pathway and reductive TCA pathway is also covered. The capability to use carbon dioxide as the sole source of cell carbon (autotrophy) is found in almost all major groups ofprokaryotes. The CO2 fixation pathways differ between groups, and there is no clear distribution pattern of the four presently-known autotrophic pathways. Fuchs, G. 1989. Alternative pathways of autotrophic CO2 fixation, p. 365-382. In H. G. Schlegel, and B. Bowien (ed.), Autotrophic bacteria. Springer- Verlag, Berlin, Germany. The reductive pentose phosphate cycle (Calvin-Bassham-Benson cycle) represents the CO2 fixation pathway in many aerobic autotrophic bacteria, for example, cyanobacteria. Gene Integration and Propagation
[0167] The genes of the invention and/or ethanologenic genes can be propagated by insertion into the host cell genome. Integration into the genome of the host cell is optionally done at particular loci to impair or disable unwanted gene products or metabolic pathways. For example, useful integration sites in Synechococcus sp. include, but are not limited to, gene loci Idh, cytCI, adh, glgAl, glgA2, glgB, nifJ, acsA, ndhB and ndbA.
[0168] Alternatively, another embodiment is integration of apdc, adhl, adh2 or adhE gene into a plasmid. The plasmid can express one or more genes of the invention, optionally an operon including one or more genes of the invention, preferably one or more ethanologenic genes, or more preferably one or more ethanologenic genes of a related metabolic pathway. For example, ethanologenic genes and/or genes of the invention can be inserted into plasmids including, but not limited to, pAQl (Synechococcus sp. 7002, accession number NC O 10476), pJB5 as described herein, or pCDFDuet-1 (Novagen). [0169] Yet another embodiment of the invention is to integrate one or more ethanologenic genes and/or genes of the invention into an expression vector including, but not limited to, pAQl, pJB5, or pCDFDuet-1 (Novagen) and into the host genome, for example Synechococcus gene loci Idh, cytCI, adh, glgAl, glgA2, glgB, nifl, acsA, ndhB and ndbA. Antibodies
[0170] In another aspect, the invention provides isolated antibodies, including fragments and derivatives thereof that bind specifically to the isolated polypeptides and polypeptide fragments of the invention or to one or more of the polypeptides encoded by the isolated nucleic acids of the invention. The antibodies of the invention may be specific for linear epitopes, discontinuous epitopes or conformational epitopes of such polypeptides or polypeptide fragments, either as present on the polypeptide in its native conformation or, in some cases, as present on the polypeptides as denatured, as, e.g., by solubilization in SDS. Among the useful antibody fragments provided by the instant invention are Fab, Fab', Fv, F(ab')2, and single chain Fv fragments.
[0171] By "bind specifically" and "specific binding" is here intended the ability of the antibody to bind to a first molecular species in preference to binding to other molecular species with which the antibody and first molecular species are admixed. An antibody is said specifically to "recognize" a first molecular species when it can bind specifically to that first molecular species.
[0172] As is well known in the art, the degree to which an antibody can discriminate as among molecular species in a mixture will depend, in part, upon the conformational relatedness of the species in the mixture; typically, the antibodies of the invention will discriminate over adventitious binding to unrelated polypeptides by at least two-fold, more typically by at least 5-fold, typically by more than 10-fold, 25-fold, 50-fold, 75-fold, and often by more than 100-fold, and on occasion by more than 500-fold or 1000-fold.
[0173] Typically, the affinity or avidity of an antibody (or antibody multimer, as in the case of an IgM pentamer) of the invention for a polypeptide or polypeptide fragment of the invention will be at least about 1x10 6 M, typically at least about 5x10 7 M, usefully at least about 1x10 7 M, with affinities and avidities of 1x10 8 M, 5x10 9 M, 1x10"10 M and even stronger proving especially useful. [0174] The isolated antibodies of the invention may be naturally-occurring forms, such as IgG, IgM, IgD, IgE, and IgA, from any mammalian species. For example, antibodies are usefully obtained from species including rodents-typically mouse, but also rat, guinea pig, and hamster-lagomorphs, typically rabbits, and also larger mammals, such as sheep, goats, cows, and horses. The animal is typically affirmatively immunized, according to standard immunization protocols, with the polypeptide or polypeptide fragment of the invention.
[0175] Virtually all fragments of 8 or more contiguous amino acids of the polypeptides of the invention may be used effectively as immunogens when conjugated to a carrier, typically a protein such as bovine thyroglobulin, keyhole limpet hemocyanin, or bovine serum albumin, conveniently using a bifunctional linker. Immunogenicity may also be conferred by fusion of the polypeptide and polypeptide fragments of the invention to other moieties. For example, peptides of the invention can be produced by solid phase synthesis on a branched polylysine core matrix; these multiple antigenic peptides (MAPs) provide high purity, increased avidity, accurate chemical definition and improved safety in vaccine development. See, e.g., Tarn et al, Proc. Natl. Acad. Sci. USA 85:5409-5413 (1988); Posnett et al, J. Biol. Chem. 263, 1719-1725 (1988).
[0176] Protocols for immunization are well-established in the art. Such protocols often include multiple immunizations, either with or without adjuvants such as Freund's complete adjuvant and Freund's incomplete adjuvant. Antibodies of the invention may be polyclonal or monoclonal, with polyclonal antibodies having certain advantages in immunohistochemical detection of the proteins of the invention and monoclonal antibodies having advantages in identifying and distinguishing particular epitopes of the proteins of the invention. Following immunization, the antibodies of the invention may be produced using any art-accepted technique. Host cells for recombinant antibody production-either whole antibodies, antibody fragments, or antibody derivatives-can be prokaryotic or eukaryotic. Prokaryotic hosts are particularly useful for producing phage displayed antibodies, as is well known in the art. Eukaryotic cells, including mammalian, insect, plant and fungal cells are also useful for expression of the antibodies, antibody fragments, and antibody derivatives of the invention. Antibodies of the invention can also be prepared by cell free translation.
[0177] The isolated antibodies, including fragments and derivatives thereof, can usefully be labeled. It is, therefore, another aspect of the invention to provide labeled antibodies that bind specifically to one or more of the polypeptides and polypeptide fragments of the invention. The choice of label depends, in part, upon the desired use. In some cases, the antibodies of the invention may usefully be labeled with an enzyme. Alternatively, the antibodies may be labeled with colloidal gold or with a fluorophore. For secondary detection using labeled avidin, streptavidin, captavidin or neutravidin, the antibodies of the invention may usefully be labeled with biotin. When the antibodies are used, e.g., for Western blotting applications, they may usefully be labeled with radioisotopes, such as 33 P, 32P, 35S, 3H and 125I. As would be understood, use of the labels described above is not restricted to any particular application. Methods for Designing Protein Variants
[0178] Increased acetaldehyde and/or ethanol production can be achieved through the expression and optimization of pyruvate decarboxylase and alcohol dehydrogenase in organisms well suited for modern genetic engineering techniques, that rapidly grow, are capable of thriving on inexpensive food resources, and from which isolation of a desired product is easily and inexpensively achieved. To increase the rate of acetaldehyde and/or ethanol production it would be advantageous to design and select variants of the enzymes of the invention, including but not limited to, variants optimized for substrate affinity, substrate specificity, substrate catalytic conversion rate, improved thermostability, activity at a different pH and/or optimized codon usage for improved expression in a host cell. See, for example, amino acid changes correlated to alterations in the catalytic rate while maintaining similar affinities (RL Zheng and RG Kemp, J. Biol. Chem. (1994) Vol. 269:18475-18479) or amino acid changes correlated with changes in the stability of the transition state that affect catalytic turnover (MA Phillips, et al, J. Biol. Chem., (1990) Vol. 265:20692-20698). It would be another advantage to design and select for ethanologenic enzymes altered to have substantially decreased reverse reaction activity in which enzyme-substrate products would be the result of energetically unfavorable bond formation or molecular re-configuration of the substrate or have improved forward reaction activity in which enzyme-substrate products would be the result of energetically favorable molecular bond reduction or molecular reconfiguration (for example, chemical reduction of acetaldehyde to ethanol or decarboxylation of pyruvate to acetaldehyde). It would be yet another advantage to design and select for ethanologenic enzymes altered to have substantially decreased unwanted substrate by-product conversion reactions (for example, production of acetoin for the pyruvate decarboxylase substrate intermediate hydroxyethyl thiamine diphophosphate).
[0179] Accordingly, one method for the design of ethanologenic proteins of the invention utilizes computational and bioinformatic analysis to design and select for advantageous changes in primary amino acid sequences encoding ethanologenic enzyme activity. Computational methods and bioinformatics provide tractable alternatives for rational design of protein structure and function. Recently, algorithms analyzing protein structure for biophysical character (for example, motional dynamics and total energy or Gibb's Free Energy evaluations) have become a commercially feasible methodology supplementing protein sequence analysis data that assess homology, identity and/or degree of sequence and domain conservation to improve upon or design the desirable qualities of a protein (Rosetta++, University of Washington). For example, an in silico redesign of the endonuclease I-Msol was based on computational evaluation of biophysical parameters of rationally selected changes to the primary amino acid sequence. Researchers were able to maintain wild-type binding selectivity and affinity yet improve the catalytic turnover by four orders of magnitude (Ashworth, et al, Nature (2006) vol. 441 :656-659).
[0180] In one embodiment of the invention, polypeptide sequences of the invention or related homologues in a complex with a substrate are obtained from the Protein Data Bank (PDB; HM Berman, et al, Nucleic Acids Research (2000) vol. 28:235-242) for computational analysis on steady state and/or changes in Gibb's free energy relative to the wild type protein. Substitutions of one amino acid residue for another are accomplished in silico interactively as a means for identifying specific residue substitutions that optimize structural or catalytic contacts between the protein and substrate using standard software programs for viewing molecules as is well known to those skilled in the art.
[0181] In silico structures are available through the PDB including pyruvate carboxylase protein crystal structures without a bound substrate (lpvd (Saccharomyces cerivisea), lpyd (Saccharomyces cerivisea), 2gli (Kluyveromyces lactis) and 2vbi (Acetobacter pasteurianus)) and pyruvate carboxylase protein crystal structures bound with natural substrate analogues (lqpb {Saccharomyces cerivisea) and lzpd (Zymomonas mobilis)).
[0182] An in silico structure is available through the PDB for an iron-bound alcohol dehydrogenase bound to a substrate and nicotinamide-adenine-dinucleotide-phosphate (Io2d (Thermotoga maritima), lpyd (Saccharomyces cerivisea), 2gli (Kluyveromyces lactis) and 2vbi (Acetobacter pasteurianus)).
[0183] In silico structures homologous to adhl described herein are available through the PDB for a zinc-bound alcohol dehydrogenase bound to a substrate and nicotinamide adenine dinucleotide: If8f (Acinetobacter calcoaceticus); Ii jw {Bacillus stearothermophilus); lllu (Pseudomonas aeruginosa).
[0184] In silico structures for adhl described herein and homologues are available through the PDB for a zinc-bound alcohol dehydrogenase bound to a substrate and nicotinamide adenine dinucleotide phosphate: Iy9a {Entamoeba hystolytica); 2oui {Entamoeba hystolytica D275P mutant); lykf {Thermoanaerobacter brockii P275D mutant) and 2nvb {Thermoanaerobacter brockii).
[0185] In silico structures for iron-bound alcohol dehydrogenase and aldehyde oxidoreductase homologues are available through the PDB. Analysis among the functional domains of adhE and the known structures of functional homologues are available with Io2d and lvhd {Thermotoaga maritime); 1 wnb, lwnd, 2opx, 2ilu and 2hg2 {Escherichia coli); 2evh, levh and lqil and Iqi6 {Streptococcus mutans); 3b4w {Mycobacterium tuberculosis); 3ed6 {Staphylococcus aureus); 3ekl {Brucella mellitensis); leyy and lezO {Vibrio harveyi).
[0186] Specific amino acid substitutions are rationally chosen based on substituted residue characteristics that optimize, for example, Van der Waal's interactions, hydrophobicity, hydrophilicity, steric non-interferences, pH-dependent electrostatics and related chemical interactions. The overall energetic change of the substitution protein model when unbound and bound to its substrate (for example, acetaldehyde or an acetaldehyde analogue substrates; pyruvate or a pyruvate analogue substrates and pyruvate decarboxylase; or acetyl-CoA and acetyl-CoA analogue substrates) is calculated and assessed by one having skill in the art to be evaluated for the change in free energy for correlations to overall structural stability (e.g., Meiler, J. and D. Baker, Proteins (2006) 65:538-548). In addition, such computational methods provide a means for accurately predicting quaternary protein structure interactions such that in silico modifications are predictive or determinative of overall multimeric structural stability (Wollacott, AM, et al., Protein Science (2007) 16:165- 175; Joachimiak, LA, et al, J. MoI. Biol. (2006) 361 :195-208).
[0187] Preferably, a rational design change to the primary structure of the protein sequences of the invention minimally alter the Gibb's free energy state of the unbound polypeptides and maintain a folded, functional and similar wild-type enzyme structure. More preferably a lower computational total free energy change of protein sequences of the invention is achieved to indicate the potential for optimized enzyme structural stability. [0188] Although lower free energy of a protein structure relative to the wild type structure is an indicator of thermodynamic stability, the positive correlation of increased thermal stability to optimized function does not always exist. Therefore, preferably, optimal catalytic contacts between the modified protein structure and the substrate are achieved with a concomitant predicted favorable change in total free energy of the catabolic reaction, for example by rationally designing protein/substrate interactions that stabilize the transition state of the enzymatic reaction while maintaining a similar or favorable change in free energy of the unbound protein for a desired environment in which a host cell expresses the mutant protein.
[0189] More preferably, for the pdc enzyme, rationally selected amino acid changes result in a substantially increased pdc enzyme's decarboxylation protein/substrate reaction, for example wherein pyruvate is converted to acetaldehyde for a desired environment in which a host cell expresses the mutant pdc protein. Even more preferably, rationally selected amino acid changes result in a substantially decreased pdc enzyme's acetoin by-product from protein/hydroxyethyl thiamine diphosphate reaction intermediate upon acetaldehyde binding and increased pdc enzyme's decarboxylation protein/substrate reaction, for example wherein pyruvate is converted to acetaldehyde for a desired environment in which a host cell expresses the mutant pdc protein. Additionally, pdc sequences are codon and expression optimized for the specific expression host cell.
[0190] For the adhl and adh2 enzymes, rationally selected amino acid changes result in a substantially decreased enzyme's anabolic protein/substrate reaction or increase the enzyme's catabolic protein/substrate reaction, for example wherein acetaldehyde is converted to ethanol for a desired environment in which a host cell expresses the mutant adhl/adh2 protein. In a further embodiment adhl/adh2 sequences of the invention are codon and expression optimized for the specific expression host cell.
[0191] In another embodiment of adhE enzymes, rationally selected amino acid changes result in a substantially decreased adhE enzyme's oxidative protein/substrate reaction or increase the adhE enzyme's reductive protein/substrate reaction, for example wherein acetyl- CoA is converted to ethanol for a desired environment in which a host cell expresses the mutant adhE protein. In a further embodiment adhE sequences are expression optimized for the specific expression host cell. Methods for Generating Protein Variants
[0192] Several methods well known to those with skill in the art are available to generate random nucleotide sequence variants for a corresponding polypeptide sequence using the Polymerase Chain Reaction ("PCR") (US Patent 4,683,202). In one embodiment of the invention is the generation of gene variants using the method of error prone PCR. (R. Cadwell and G. Joyce, PCR Meth. Appl (1991) Vol. 2:28-33; Leung, et al., Technique (1989) Vol. 1 :11-15). Error prone PCR is achieved by the establishment of a chemical environment during the PCR experiment that causes an increase in unfaithful replication of a parent copy of DNA sought to be replicated. For example, increasing the manganese or magnesium ion content of the chemical admixture used in the PCR experiment, very low annealing temperatures, varying the balance among di-deoxy nucleotides added, starting with a low population of parent DNA templates or using polymerases designed to have increased inefficiencies in accurate DNA replication all result in nucleotide changes in progeny DNA sequences during the PCR replication process. The resultant mutant DNA sequences are genetically engineered into an appropriate vector to be expressed in a host cell and analyzed to screen and select for the desired effect on whole cell production of a product or process of interest. In one embodiment of the invention, random mutagenesis of nucleotide sequences of the invention is generated through error prone PCR using techniques well known to one skilled in the art. Resultant nucleotide sequences are analyzed for structural and functional attributes through clonal screening assays and other methods as described herein.
[0193] In another embodiment a specifically desired protein mutant is generated a using site-directed mutagenesis. For example, with overlap extension (An, et al., Appl. Microbiol. Biotech. (2005) vol. 68(6):774-778) or mega-primer PCR (E. Burke and S. Barik, Methods MoI. Bio. (2003) vol 226:525-532) one can use nucleotide primers that have been altered at corresponding codon positions in the parent nucleotide to yield DNA progeny sequences containing the desired mutation. Alternatively, one can use cassette mutagenesis (Kegler- Ebo, et al., Nucleic Acids Res. (1994) vol. 22(9): 1593-1599) as is commonly known by one skilled in the art.
[0194] Rellos, et al. (Prot. Exp. Purific. (1998) Vol. 12:61-66) have demonstrated amino acid substitutions F9S, M13I, K31R, F90L and/or G250D from the wild-type Zymomonas mobilis alcohol dehydrogenase protein sequence enhance protein fold thermostability. In one aspect of the invention, using site-directed mutagenesis and cassette mutagenesis, all 31 possible mutational combinations of these substitutions at homologous amino acid positions in SEQ ID NO: 8 and SEQ ID NO:22 are made, transformed into a suitable high expression vector and expressed at high levels in a suitable expression host cell. Purified aliquots at concentrations necessary for the appropriate biophysical analytical technique are obtained by methods as known to those with skill in the art (P. Rellos and R.K. Scopes, Prot. Exp. Purific. (1994) Vol. 5:270-277).
[0195] Several authors (Korkhin, et al, J. MoL Bio (1998) vol. 278:967-981; E. Goiberg, et al, Proteins (2008) vol. 72:711-719) have demonstrated protein amino acid substitutions at single positions in the alcohol dehydrogenase protein sequence enhance protein fold thermostability. In one aspect, using site-directed mutagenesis and cassette mutagenesis, all possible positions in SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, and SEQ ID NO:20 are changed to a proline, transformed into a suitable high expression vector and expressed at high levels in a suitable expression host cell. Purified aliquots at concentrations necessary for the appropriate biophysical analytical technique are obtained by methods as known to those with skill in the art (P. Rellos and R.K. Scopes, Prot. Exp. Purific. (1994) Vol. 5:270-277) and evaluated for increased thermostability.
[0196] Another embodiment of the invention is to select for a polypeptide variant for expression in a recipient host cell by comparing a first nucleic acid sequence encoding the polypeptide with the nucleic acid sequence of a second, related nucleic acid sequence encoding a polypeptide having more desirable qualities, and altering at least one codon of the first nucleic acid sequence to have identity with the corresponding codon of the second nucleic acid sequence, such that improved polypeptide activity, substrate specificity, substrate affinity, substrate catalytic conversion rate, improved thermostability, activity at a different pH and/or optimized codon usage for expression and/or structure of the altered polypeptide is achieved in the host cell.
[0197] In yet another embodiment of the invention, all amino acid residue variations are encoded at any desired, specified nucleotide codon position using such methods as site saturation mutagenesis (Meyers, et al., Science (1985) Vol. 229:242-247; Derbyshire, et al., Gene (1986) Vol. 46:145-152; U.S. Patent 6,171,820). Whole gene site saturation mutagenesis (K. Kretz, et al., Meth. Enzym. (2004) Vol. 388:3-11) is preferred wherein all amino acid residue variations are encoded at every nucleotide codon position. Both methods yield a population of protein variants differing from the parent polypeptide by one amino acid, with each amino acid substitution being correlated to structural/functional attributes at any position in the polypeptide. Saturation mutagenesis uses PCR and primers homologous to the parent sequence wherein one or more codon encoding nucleotide triplets is randomized. Randomization results in the incorporation of codons corresponding to all amino acid replacements in the final, translated polypeptide. Each PCR product is genetically engineered into an expression vector to be introduced into an expression host and screened for structural and functional attributes through clonal screening assays and other methods as described herein.
[0198] In one aspect of saturation mutagenesis, correlated saturation mutagenesis ("CSM") is used wherein two or more amino acids at rationally designated positions are changed concomitantly to different amino acid residues to engineer improved enzyme function and structure. Correlated saturation mutagenesis allows for the identification of complimentary amino acid changes having positive, synergistic effects on enzyme structure and function. Such synergistic effects include, but are not limited to, significantly altered enzyme stability, substrate affinity or catalytic turnover rate, independently or concomitantly increasing advantageously the production of acetaldehyde and/or ethanol.
[0199] In one embodiment, CSM is used at pdc residue positions (relative to SEQ ID NO:2) 437, 438, 439, 440, 441, 442, 443, 464, 465, 466, 467, 468 and 469, which are involved in or located near magnesium binding co-factor.
[0200] In another embodiment, CSM is used at pdc residue positions (relative to SEQ ID NO:2) 110, 111, 112,113,114, 470, 471, 472, 472, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483 and 484, which are involved in or located near the enzyme active site.
[0201] In another embodiment, CSM is used at pdc residue positions (relative to SEQ ID NO:2) 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 307, 308, 309, 310, 311, 312, 313, 316, 317, 318, 319, 320, 321, 322 and 323, which are involved in binding the substrate or located near the substrate binding site.
[0202] In yet another embodiment, CSM is used at pdc residue positions (relative to SEQ ID NO:2) 25, 26, 27, 49, 50, 51, 74, 75, 76, 389, 390, 391, 411, 412, 413, 414, 415, 416, 417, 438, 437, 440, 441, 442, 443, 444, 445, 446, 447, 468, 469, 470, 471, 472, 473 and 474, which are involved in binding or located near the binding site for the thiamine diphosphate co-factor.
[0203] In yet another embodiment, CSM is used to change pdc residue positions (relative to SEQ ID NO:2) 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112 and 113 concomitantly with each of all possible amino acid residues at any of residue positions 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, and 304, wherein each residue position is involved in or located near inter-subunit protomeric binding sites.
[0204] In one embodiment, CSM is used at pdc residue positions (relative to SEQ ID NO:5) 432, 433, 434, 435, 436, 437, 438, 459, 460, 461, 462, 463 and 464, which are involved in binding or located near the binding site for the magnesium binding co-factor.
[0205] In another embodiment, CSM is used at pdc residue positions (relative to SEQ ID NO:5) 109, 110, 111, 112, 113, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478 and 479 , which are involved in or located near the enzyme active site.
[0206] In another embodiment, CSM is used at pdc residue positions (relative to SEQ ID NO:5) 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 306, 307, 308, 309, 310, 311, 312, 315, 316, 317, 318, 319, 320, 321 and 322, which are involved in binding or located near the binding site for the substrate.
[0207] In yet another embodiment, CSM is used at pdc residue positions (relative to SEQ ID NO:5) 24, 25, 26, 48, 49, 50, 73, 74, 75, 384, 385, 386, 406, 407, 408, 409, 410, 411, 412, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 463, 464, 465, 466, 467, 468 and 469, which are involved in binding or located near the binding site for the thiamine pyrophosphate co-factor.
[0208] In yet another embodiment, CSM is used to change pdc residue positions (relative to SEQ ID NO:5) 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111 and 112 concomitantly with each of all possible amino acid residues at any of residue positions 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, and 303, wherein each residue position is involved in or located near the inter-subunit protomeric binding sites.
[0209] In one embodiment, CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:8) adh2 residue positions 192, 193, 194, 195, 196, 197, 198, 199, 200, 299, 300 and 301, which are involved in binding or located near the binding site for the iron co- factor.
[0210] In another embodiment, CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:8) adh2 residue positions 9, 13, 31, 90 and 250, which are involved in structural thermostability. [0211] In another embodiment, CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:8) adh2 residue positions 119, 120, 121, 122, 151, 152, 153, 154, 155, 159, 160, 161, 162, 162, 163, 164, 165 and 166, which are involved in binding or located near the binding site for the substrate.
[0212] In another embodiment, CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:8) adh2 residue positions 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282 and 283, which are involved in or located near the active site.
[0213] In yet another embodiment, CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:8) adh2 residue positions 37, 38, 39, 40, 41, 42, 44, 45, 46, 69, 70, 71, 96, 97, 98, 99 100, 101, 102, 103, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 158, 159, 160, 181, 182, 183, 186, 187, 188, 190, 191, 192, 193, 194, 195, 197, 198, 199, 276, 277 and 278, which are involved in binding or located near the binding site for the nicotinamide adenine dinucleotide co-factor.
[0214] In yet another embodiment, CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:8) adh2 residue positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 210, 211, 212, 213, 214 and 215, wherein each residue position is involved in or located near inter- subunit protomeric binding sites.
[0215] In one embodiment, CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:11) adhl residue positions 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125 and 126, which are involved in binding or located near the binding site for the zinc co-factor.
[0216] In another embodiment, CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:11) adhl residue positions 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 100, 101, 102, 103, 104, 105, 106, 107, 108, 147, 148, 149, 150, 151, 152, 153, 154, 155, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 303, 304, 305, 306, 307, 308, 309, 310 and 311, which are involved in binding or located near the binding site for the substrate and active site.
[0217] In yet another embodiment, CSM is used to alter the amino acids of homologous (relative to SEQ ID NO: 11) adhl residue positions 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 164, 165, 166, 167, 168, 169, 170, 179, 180, 181, 182, 183,
184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 228, 229, 230, 231, 232, 233, 234, 253, 254, 255, 256, 257, 258, 259, 272, 273, 274, 275, 276, 277, 278, 295, 296, 297, 298, 299, 300, 301, 302, 321, 322, 323 and 347, which are involved in binding or located near the binding site for the nicotinamide adenine dinucleotide co-factor.
[0218] In one embodiment, CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:14) adhl residue positions 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 56, 57, 58, 59, 60, 61, 62, 63, 64, 148, 149, 150, 151, 152, and 153, which are involved in binding or located near the binding site for the zinc co-factor.
[0219] In another embodiment, CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:14) adhl residue positions 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 182, 183, 184,
185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 295, 196, 197, 198, 199, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295 and 296, which are involved in binding or located near the binding site for the substrate and active site.
[0220] In yet another embodiment, CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:14) adhl residue positions 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 108, 109, 110, 111, 112, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 263, 264, 265, 266, 267, 268, 269, 270, 283, 284, 285, 286, 287, 288, 338, 339, 340, 341, 342 and 343, which are involved in binding or located near the binding site for the nicotinamide adenine dinucleotide phosphate co-factor.
[0221] In yet another embodiment, CSM is used to alter the amino acids of homologous (relative to SEQ ID NO:14) adhl residue positions 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 251, 252, 253, 254, 255, 256, 257, 258, 259, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 00, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311 and 312 , which are involved in or located near multimerization interfaces.
[0222] In one embodiment of the invention, CSM is used to alter the amino acids of SEQ ID NO:17 positions 660, 661, 662, 663, 664, 665, 666, 667, 668, 766, 767, and 768, and amino acids of SEQ ID NO:20 positions 654, 655, 656, 657, 658, 659, 660, 661 and 662, and homologous positions in adhE homologues of Table 8 and 9, which are involved in binding or located near the binding site for the iron co-factor.
[0223] In another embodiment of the invention, CSM is used to alter the amino acids of SEQ ID NO: 17 positions 275, 276, 277, 573, 574 and 575, and amino acids of SEQ ID NO:20 positions 266, 267, 268, 567, 568 and 569, and homologous positions in adhE homologues of Table 8 and 9, which are involved in or located near regions involved in metal catalyzed protein oxidation.
[0224] In another embodiment of the invention, CSM is used to alter the amino acids of SEQ ID NO:17 positions 449, 450, 451, 452, 453, 470, 471, 472, 528, 529, 530, 722, 723 and 724, and amino acids of SEQ ID NO:20 positions 441, 442, 443, 444, 445, 462, 463, 464, 522, 523, 524, 716, 717 and 718, and homologous positions in adhE homologues of Table 8 and 9, which are involved in structural thermostability.
[0225] In another embodiment of the invention, CSM is used to alter the amino acids of SEQ ID NO:17 positions 573, 574, 575, 576, 616, 617, 618, 619, 620, 621, 625, 626, 627, 628, 629, 630, 631, 632, 633 and 634, and amino acids of SEQ ID NO:20 positions 567, 568, 569, 570, 571, 610, 611, 612, 613, 614, 615, 619, 620, 621, 622, 623, 624, 625, 626, 627 and 628, and homologous positions in adhE homologues of Table 8 and 9, which are involved in binding or located near the substrate binding site of the adhE alcohol dehydrogenase domain.
[0226] In another embodiment of the invention, CSM is used to alter the amino acids of SEQ ID NO:17 positions 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753 and 754, and amino acids of SEQ ID NO:20 positions 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747 and 748, and homologous positions in adhE homologues of Table 8 and 9, which are involved in or located near the active site of the adhE alcohol dehydrogenase domain.
[0227] In yet another embodiment of the invention, CSM is used to alter the amino acids of SEQ ID NO:17 positions 492, 493, 494, 495, 496, 497, 498, 499, 500, 523, 524, 525, 550, 551, 552, 553, 554, 555, 556, 557, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 747, 748 and 749, and amino acids of SEQ ID NO:20 positions 486, 487, 488, 489, 490, 491, 492, 493, 494, 517, 518, 519, 544, 545, 546, 547, 548, 549, 550, 551, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 741, 742 and 743, and homologous positions in adhE homologues of Table 8 and 9, which are involved in binding or located near the binding site for the nicotinamide adenine dinucleotide co-factor of the adhE alcohol dehydrogenase.
[0228] In another embodiment, CSM is used to alter the amino acids of SEQ ID NO: 17 positions 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190 ,191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209 and 210, and amino acids of SEQ ID NO:20 positions 110,
111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200 and 201, and homologous positions in adhE homologues of Table 8 and 9, which are involved in binding or located near the binding site for the nicotinamide adenine dinucleotide co-factor of the adhE aldehyde oxidoreductase.
[0229] In another embodiment, CSM is used to alter the amino acids of SEQ ID NO: 17 positions 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 104, 105, 106, 107, 108, 109, 110, 111,
112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419 and 420, and amino acids of SEQ ID NO:20 positions 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409 and 410, and homologous positions in adhE homologues of Table 8 and 9, which are involved in binding or located near the binding site for the substrate of the adhE aldehyde oxidoreductase.
[0230] In yet another embodiment, CSM is used to alter the amino acids of SEQ ID NO: 17 positions 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486 and 487, and amino acids of SEQ ID NO: 20 positions 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479 and 480, and homologous positions in adhE homologues of Table 8 and 9, which are involved in or located near an inter-domain linker region.
[0231] In yet another embodiment, amino acid substitution combinations of CSM derived protein variants being optimized for a particular function are combined with one or more CSM derived protein variants being optimized for another particular function to derive a pdc, adhl, adh2, and/or adhE protein variant exhibiting multiple optimized structural and functional characteristics. For example, amino acid changes in combinatorial mutants showing optimized protomer interactions, thermostability, are combined with amino acid changes in combinatorial mutants showing optimized catalytic turnover.
[0232] In one embodiment, mutational variants derived from the methods described herein are cloned. DNA sequences produced by saturation mutagenesis are designed to have restriction sites at the ends of the gene sequences to allow for excision and transformation into a host cell plasmid. Generated plasmid stocks are transformed into a host cell and incubated at optimal growth conditions to identify successfully transformed colonies.
[0233] Another embodiment utilizes gene shuffling (P. Stemmer, Nature (1994) Vol. 370:389-391) or gene reassembly (US 5,958,672) to develop improved protein structure/function through the generation of chimeric proteins. With gene shuffling, two or more homologous nucleotide sequences both encoding alcohol dehydrogenase, pyruvate decarboxylase or bi-functional alcohol dehydrogenase are treated with endonucleases at random positions, mixed together, heated until sufficiently melted and reannealed. Alternatively, in the case of bi-functional alcohol dehydrogenases, non-bi-functional, single domain protein homologue encoding nucleotide sequences (for example, those encoding individual aldehyde oxidoreductases or alcohol dehydrogenases) can be treated similarly and used together with a bi-functional alcohol dehydrogenase for gene shuffling. Nucleotide sequences from homologues will anneal to develop a population of chimeric genes that are repaired to fill in any gaps resulting from the re-annealing process, expressed and screened for improved structure/function enzyme chimeras. Gene reassembly is similar to gene shuffling; however, nucleotide sequences for specific, homologous alcohol dehydrogenase, protein pyruvate decarboxylase or bi-functional alcohol dehydrogenase domains are targeted and swapped with other homologous domains for reassembly into a chimeric gene. The genes are expressed and screened for improved structure/function enzyme chimeras.
[0234] In a further embodiment any and/or all sequences additionally are codon and expression optimized for the specific expression host cell. Methods for Measuring Protein Variant Efficacy
[0235] Variations in expressed polypeptide sequences may result in measurable differences in the whole-cell rate of substrate conversion. It is desirable to determine differences in the rate of substrate conversion by assessing productivity in a host cell having a particular protein variant relative to other whole cells having a different protein variant. Additionally, it would be desirable to determine the efficacies of whole-cell substrate conversion as a function of environmental factors including, but not limited to, pH, temperature nutrient concentration and salinity.
[0236] Therefore, in one embodiment, the biophysical analyses described herein on protein variants of the invention are performed to measure structural/functional attributes. Standard analyses of polypeptide activity are well known to one of ordinary skill in the art. Such analysis can require the expression and high purification of large quantities of polypeptide, followed by various physical methods (including, but not limited to, calorimetry, fluorescence, spectrophotometric, spectrometric, liquid chromatography (LC), mass spectrometry (MS), LC-MS, affinity chromatography, light scattering, nuclear magnetic resonance and the like) to assay function, function in a specific environment or functional differences among homologues.
[0237] In another embodiment, the polypeptides are expressed, purified and subject to the aforementioned analytical techniques to assess the functional difference among polypeptide sequence homologues, for example, the rate of substrate conversion specific for a particular enzyme function.
[0238] Batch culture (or closed system culture) analysis is well known in the art and can provide information on host cell population effects for host cells expressing genetically engineered genes. In batch cultures a host cell population will grow until available nutrients are depleted from the culture media.
[0239] In one embodiment, the polypeptides are expressed in a batch culture and analyzed for approximate doubling times, expression efficacy of the engineered polypeptide and end-point net product formation and net biomass production.
[0240] Turbidostats are well known in the art as one form of a continuous culture within which media and nutrients are provided on an uninterrupted basis and allow for non-stop propagation of host cell populations. Turbidostats allow the user to determine information on whole cell propagation and steady-state productivity for a particular biologically produced end product such as host cell doubling time, temporally delimited biomass production rates for a particular host cell population density, temporally delimited host cell population density effects on substrate conversion and net productivity of a host cell substrate conversion of, for example, acetyl-CoA or pyruvate to acetaldehyde and acetaldehyde to ethanol. Turbidostats can be designed to monitor the partitioning of substrate conversion products to the liquid or gaseous state. Additionally, quantitative evaluation of net productivity of a carbon-based product of interest can be accurately performed due to the exacting level of control that one skilled in the art has over the operation of the turbidostat. These types of information are useful to assess the parsed and net efficacies of a host cell genetically engineered to produce a specific carbon-based product of interest.
[0241] In one embodiment, identical host cell lines differing only in the nucleic acid and expressed polypeptide sequence of a homologous enzyme are cultured in a uniform- environment turbidostat to determine highest whole cell efficacy for the desired carbon-based product of interest.
[0242] In another embodiment, identical host cell lines differing only in the nucleic acid and expressed polypeptide sequence of a homologous enzyme are cultured in a batch culture or a turbidostat in varying environments (e.g., temperature, pH, salinity, nutrient exposure) to determine highest whole cell efficacy for the desired carbon-based product of interest. Methods for Generating Protein Variants
[0243] In one embodiment, mutational variants derived from the methods described herein are cloned. DNA sequences produced by saturation mutagenesis are designed to have restriction sites at the ends of the gene sequences to allow for excision and transformation into a host cell plasmid. Generated plasmid stocks are transformed into a host cell and incubated at optimal growth conditions to identify successfully transformed colonies.
[0244] In one embodiment, to select protein variants, a colorimetric assay is used to screen for acetaldehyde to qualitatively determine enzymatic activity of protein variants. Schiff reagents such as mixtures of pararosaniline and bisulfate have been used to detect aldehydes in organisms such as Z. mobilis that produce aldehydes (Lillie, R.D. (1977) H.J. Conn 's Biological Stains, 9th ed. (The Williams & Wilkins Co., Baltimore) p259-266).
pdc
[0245] Because pararosaline is light sensitive with a tendency to darken when exposed to conditions favoring bacterial growth, the reagents are combined in a low light or dark environment into a top agar solid medium, allowed to cool to near ambient temperatures and poured on top of A+ plates incubated with transformed bacteria. After continued incubation of the top agar plates with transformed bacterial colonies in the dark, acetaldehyde present from pdc variant enzyme activity in pdc-positive cells turn red (Conway, et ah, J. BacterioL, (1987) Vol. 169:2591-2597).
[0246] In an alternative embodiment, narrow bandwidth light sources or narrow through- pass light filters are used to screen for acetaldehyde and qualitatively determine pdc activity of protein variants. Pararosaniline has a maximum absorbance of around 550 nm that converts the reagent from clear to red. Transformed host cells are plated on media containing the Schiff reagent and incubated with monochromatic light emitting diodes or a blue shifted bandpass filter. Such light sources will maximize light wavelengths available to the cell above 600 nm, and preferably above 650 nm, and minimize or eliminate light waves below 600 nm. Culture plates have Schiff reagents such as mixtures of pararosaniline and bisulfate directly integrated upon on which transformed colonies are grown in high intensity, monochromatic light with little effect darkening or clouding effects on pararosaline. Overnight incubation of transformed clones producing acetaldehyde with functional pdc protein variants produces intensely red colonies whereas those transformants without a functional pdc variant remain uncolored.
adhl and adh2
[0247] Indicator plates are prepared as described in Conway, et al. (J. BacterioL, (1987) Vol. 169:2591-2597). Genes for the adhl and/or adh2 variants are integrated into an expression plasmid, for example pCDFDuet-1 and transformed into a suitable host, for example, E. coli strain NEB DH5α (Novagen). Transformed colonies grown on indicator plates having a functional adhl and/or adh2 variant convert ethanol in the indicator plate media to acetaldehyde. The acetaldehyde will react with the paroraniline, converting it to the leuco form that is an intense red dye color. This screen assay indicates a functional alcohol dehydrogenase enzyme for which the efficacy of the desired reverse reaction, acetaldehyde to ethanol, is quantitatively determined. Quantitative evaluation of the efficacy of acetaldehyde to ethanol conversion by the adhl and/or adh2 variant is performed by engineering the functional adhl and/or adh2 variants into host cells expressing pyruvate decarboxylase and grown in batch culture or a turbidostat. Pyruvate decarboxylase converts cellular pyruvate to acetaldehyde, which in turns serves as the substrate for adh2. Methods for Producing Acetaldehyde
[0248] Clean, efficient and inexpensive production of acetaldehyde has prevalent commercial and industrial appeal. Acetaldehyde is used primarily as an intermediate chemical for the production of compounds including, but not limited to, acetic acid, acetic anhydride, n-butanol, ethyl acetate, peracetic acid, pentaerythritol, chloral, glyoxal, alkylamines, pyridines and 2-ethylhexanol. Such end-compounds are used, for example, in the commercial and industrial production of flavorings, beverages, perfumes, plastics, aniline dyes, synthetic rubber and laboratory research. Significantly, acetaldehyde also serves as a substrate for the production of ethanol through the fermentative process of biological organisms.
[0249] Therefore, it is desirable to engineer into an organism better suited for industrial use a genetic system from which acetaldehyde can be produced for conversion into ethanol. Ethanol, in turn, has various commercial applications including use as a solvent, antiseptic, rocket propellant, renewable automotive fuel source and as a base compound for the manufacture of other industrially important organic compounds.
[0250] Accordingly, the invention includes the conversion of pyruvate into acetaldehyde using the pdc enzymes described herein. In one embodiment, the invention includes producing acetaldehyde from pyruvate using genetically engineered host cells expressing a pdc gene and the pdc gene product. In a preferred embodiment the genetically engineered host cells produce pyruvate, or convertible analog thereof, which can be a substrate for the conversion into acetaldehyde, or an analog thereof. [0251] In another preferred embodiment the genetically engineered host cells expresses a pdc gene and gene product and one or more ethanologenic genes enabling the host cell to convert a sugar capable of being converted into pyruvate, or a pyruvate analog, under culture conditions wherein acetaldehyde (or analog thereof) is produced.
[0252] In another embodiment of the invention, the genetically engineered host cell is processed into an enzymatic lysate for performing the above conversion reaction. In yet another embodiment, the pdc gene product is purified, as described herein, for carrying out the conversion reaction.
[0253] The host cells and/or enzymes (e.g., in the lysate, partially purified, or purified) used in the conversion reactions are in a form allowing them to perform their intended function (e.g., producing a desired compound, e.g., acetaldehyde). The microorganisms used can be whole cells, or can be only those portions of the cells necessary to obtain the desired end result. The microorganisms can be suspended (e.g., in an appropriate solution such as buffered solutions or media), rinsed (e.g., rinsed free of media from culturing the microorganism), acetone-dried, immobilized (e.g., with polyacrylamide gel or κ-carrageenan or on synthetic supports, for example, beads, matrices and the like), fixed, cross-linked or permeabilized (e.g., have permeabilized membranes and/or walls such that compounds, for example, substrates, intermediates or products can more easily pass through said membrane or wall).
[0254] In yet another embodiment, purified or unpurified pdc enzymes (alone or in combination with other ethanologenic enzymes) are used in the conversion reactions. The enzyme is in a form that allows it to perform its intended function. For example, the enzyme can be immobilized, conjugated or floating freely.
[0255] In yet another embodiment the pdc enzymes are chimeric wherein a polypeptide linker is encoded between the pdc enzyme and another enzyme. For example, the vector encoding pdc also encodes a non-enzymatically functional linker and an alcohol dehydrogenase enzyme as one transcriptional unit. Upon translation into a polypeptide, two enzymes of a metabolic pathway are tethered together by a polypeptide linker. Such arrangement of two or more functionally related proteins tethered together in a host cell increases the local effective concentration of metabolically related enzymes that can increase the efficiency of substrate conversion. Methods for Producing Ethanol
[0256] Ethanol has various commercial applications including use as a solvent, antiseptic, rocket propellant, renewable fuel source and as a base compound for the manufacture of other industrially important organic compounds. Therefore, it is desirable to engineer into an organism better suited for industrial use a genetic system from which ethanol can be produced efficiently and cleanly.
[0257] Accordingly, the invention includes the conversion of acetaldehyde into ethanol using the alcohol dehydrogenase and bi-functional alcohol dehydrogenase enzymes described herein.
[0258] In one embodiment, the invention includes producing ethanol from acetaldehyde using genetically engineered host cells expressing an adhl and/or adh2 gene and the adhl and/or adh2 gene product. In a preferred embodiment the genetically engineered host cells produce acetaldehyde, or convertible analog thereof, which can be a substrate for the conversion into ethanol, or an analog thereof.
[0259] In another embodiment, the invention includes the conversion of acetyl-CoA into ethanol using the bi-functional alcohol dehydrogenase enzymes described herein. In one embodiment, the invention includes producing ethanol from acetyl-CoA using genetically engineered host cells expressing an adhE gene. In another embodiment the genetically engineered host cells produce acetaldehyde, or convertible analog thereof, from acetyl-CoA, which can be a substrate for the conversion into ethanol, or an analog thereof.
[0260] In another preferred embodiment the genetically engineered host cells expresses an adhl, adh2, and/or adhE gene and gene product and one or more ethanologenic genes enabling the host cell to convert a sugar capable of being converted into acetaldehyde, or a acetaldehyde analog, under culture conditions wherein ethanol (or analog thereof) is produced.
[0261] In another embodiment of the invention, the genetically engineered host cell is processed into an enzymatic lysate for performing the above conversion reaction. In yet another embodiment, the adhl, adh2, and/or adhE gene product is purified, as described herein, for carrying out the conversion reaction.
[0262] The host cells and/or enzymes (e.g., in the lysate, partially purified, or purified) used in the conversion reactions are in a form allowing them to perform their intended function (e.g., producing a desired compound, e.g., ethanol). The microorganisms used can be whole cells, or can be only those portions of the cells necessary to obtain the desired end result. The microorganisms can be suspended (e.g., in an appropriate solution such as buffered solutions or media), rinsed (e.g., rinsed free of media from culturing the microorganism), acetone-dried, immobilized (e.g., with polyacrylamide gel or κ-carrageenan or on synthetic supports, for example, beads, matrices and the like), fixed, cross-linked or permeabilized (e.g., have permeabilized membranes and/or walls such that compounds, for example, substrates, intermediates or products can more easily pass through said membrane or wall).
[0263] In yet another embodiment, purified or unpurified adhl, adh2, and/or adhE enzymes (alone or in combination with other ethanologenic enzymes) are used in the conversion reactions. The enzyme is in a form that allows it to perform its intended function. For example, the enzyme can be immobilized, conjugated or floating freely.
[0264] In yet another embodiment the adhl, adh2, and/or adhE enzymes are chimeric wherein a polypeptide linker is encoded between the adhl, adh2, or adhE enzyme and another enzyme. For example, the vector encoding adhl, adh2, or adhE also encodes a non- enzymatically functional linker and a pyruvate dehydrogenase enzyme as one transcriptional unit. Upon translation into a polypeptide, two enzymes of a metabolic pathway are tethered together by a polypeptide linker. Such arrangement of two or more functionally related proteins tethered together in a host cell increases the local effective concentration of metabolically related enzymes that can increase the efficiency of substrate conversion.
[0265] The following examples are for illustrative purposes and are not intended to limit the scope of the invention.
EXAMPLE 1 Ethanol Production
[0266] Different ethanologenic genes were cloned into Synechococcus sp. PCC 7002 and ethanol was successfully produced by the modified host cells. The following plasmids were cloned into Synechococcus sp. PCC 7002: Table 10. Strain Definitions
Figure imgf000078_0001
Figure imgf000079_0001
[0267] The DNA sequences encoding the promoter, open reading frames, and intergenic sequences in the case of operons are as follows. For Strain 1, the first lower case sequence corresponds to the aphll promoter (SEQ ID NO:24), the first upper case sequence to pdc from Z. palmae (SEQ ID NO:25), the second lower case sequence the cpcB promoter from Synechocystis sp. PCC 6803 (SEQ ID NO:26), and the second upper case sequence the adhl sequence from Z. mobilis (SEQ ID NO:27):
[0268] gggggggggggggaaagccacgttgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatga acaataaaactgtctgcttacataaacagtaatacaaggggtcatATGTATACCGTTGGTATGTACTTGGCAG
AACGCCTAGCCCAGATCGGCCTGAAACACCACTTTGCCGTGGCCGGTGACTACA
ACCTGGTGTTGCTTGATCAGCTCCTGCTGAACAAAGACATGGAGCAGGTCTACTG
CTGTAACGAACTTAACTGCGGCTTTAGCGCCGAAGGTTACGCTCGTGCACGTGGT
GCCGCCGCTGCCATCGTCACGTTCAGCGTAGGTGCTATCTCTGCAATGAACGCCA TCGGTGGCGCCTATGCAGAAAACCTGCCGGTCATCCTGATCTCTGGCTCACCGAA
CACCAATGACTACGGCACAGGCCACATCCTGCACCACACCATTGGTACTACTGAC
TATAACTATCAGCTGGAAATGGTAAAACACGTTACCTGCGCACGTGAAAGCATC
GTTTCTGCCGAAGAAGCACCGGCAAAAATCGACCACGTCATCCGTACGGCTCTAC
GTGAACGCAAACCGGCTTATCTGGAAATCGCATGCAACGTCGCTGGCGCTGAAT
GTGTTCGTCCGGGCCCGATCAATAGCCTGCTGCGTGAACTCGAAGTTGACCAGAC
CAGTGTCACTGCCGCTGTAGATGCCGCCGTAGAATGGCTGCAGGACCGCCAGAA
CGTCGTCATGCTGGTCGGTAGCAAACTGCGTGCCGCTGCCGCTGAAAAACAGGCT
GTTGCCCTAGCGGACCGCCTGGGCTGCGCTGTCACGATCATGGCTGCCGAAAAA
GGCTTCTTCCCGGAAGATCATCCGAACTTCCGCGGCCTGTACTGGGGTGAAGTCA
GCTCCGAAGGTGCACAGGAACTGGTTGAAAACGCCGATGCCATCCTGTGTCTGG
CACCGGTATTCAACGACTATGCTACCGTTGGCTGGAACTCCTGGCCGAAAGGCGA
CAATGTCATGGTCATGGACACCGACCGCGTCACTTTCGCAGGACAGTCCTTCGAA
GGTCTGTCATTGAGCACCTTCGCCGCAGCACTGGCTGAGAAAGCACCTTCTCGCC
CGGCAACGACTCAAGGCACTCAAGCACCGGTACTGGGTATTGAGGCCGCAGAGC
CCAATGCACCGCTGACCAATGACGAAATGACGCGTCAGATCCAGTCGCTGATCA
CTTCCGACACTACTCTGACAGCAGAAACAGGTGACTCTTGGTTCAACGCTTCTCG
CATGCCGATTCCTGGCGGTGCTCGTGTCGAACTGGAAATGCAATGGGGTCATATC
GGTTGGTCCGTACCTTCTGCATTCGGTAACGCCGTTGGTTCTCCGGAGCGTCGCC
ACATCATGATGGTCGGTGATGGCTCTTTCCAGCTGACTGCTCAAGAAGTTGCTCA
GATGATCCGCTATGAAATCCCGGTCATCATCTTCCTGATCAACAACCGCGGTTAC
GTCATCGAAATCGCTATCCATGACGGCCCTTACAACTACATCAAAAACTGGAACT
ACGCTGGCCTGATCGACGTCTTCAATGACGAAGATGGTCATGGCCTGGGTCTGAA
AGCTTCTACTGGTGCAGAACTAGAAGGCGCTATCAAGAAAGCACTCGACAATCG
TCGCGGTCCGACGCTGATCGAATGTAACATCGCTCAGGACGACTGCACTGAAAC
CCTGATTGCTTGGGGTAAACGTGTAGCAGCTACCAACTCTCGCAAACCACAAGCG
TAAttaactcgacttcgttataaaataaacttaacaaatctatacccacctgtagagaagagtccctgaatatcaaaatggtgggataaa aagctcaaaaaggaaagtaggctgtggttccctaggcaacagtcttccctaccccactggaaactaaaaaaacgagaaaagttcgcac cgaacatcaattgcataattttagccctaaaacataagctgaacgaaactggttgtcttcccttcccaatccaggacaatctgagaatccc ctgcaacattacttaacaaaaaagcaggaataaaattaacaagatgtaacagacataagtcccatcaccgttgtataaagttaactgtgg gattgcaaaagcattcaagcctaggcgctgagctgtttgagcatcccggtggcccttgtcgctgcctccgtgtttctccctggatttattta ggtaatatctctcataaatccccgggtagttaacgaaagttaatggagatcagtaacaataactctagggtcattactttggactccctcag tttatccgggggaattgtgtttaagaaaatcccaactcataaagtcaagtaggagattaatcatATGAAAGCAGCCGTCA
TAACTAAAGATCATACGATCGAAGTGAAAGACACCAAATTACGCCCTCTGAAAT ACGGGGAAGCGCTTTTGGAAATGGAATATTGCGGGGTATGTCATACCGATCTCCA
CGTGAAAAACGGGGATTTTGGCGATGAAACCGGCAGAATTACCGGCCATGAAGG
CATCGGTATCGTCAAGCAGGTCGGGGAAGGGGTTACTTCTCTGAAAGTCGGTGA
CCGTGCCAGTGTTGCATGGTTCTTCAAAGGCTGCGGCCATTGCGAATATTGTGTC
AGTGGAAATGAAACGCTTTGCCGCAACGTTGAAAATGCCGGTTATACGGTTGAC
GGCGCTATGGCAGAAGAATGCATCGTCGTTGCCGATTACTCGGTCAAAGTGCCA
GATGGTCTTGATCCTGCGGTTGCCAGCAGCATCACTTGCGCGGGTGTAACCACCT
ATAAAGCAGTCAAAGTTTCTCAGATACAGCCGGGACAATGGCTGGCTATCTATG
GCTTGGGCGGTTTAGGCAATCTAGCCCTTCAATATGCCAAGAATGTTTTCAACGC
CAAAGTGATCGCGATCGATGTCAATGATGAACAGCTCGCTTTTGCCAAAGAGCTG
GGCGCAGATATGGTCATCAATCCGAAAAACGAAGATGCTGCCAAAATCATTCAG
GAAAAAGTCGGCGGCGCACATGCGACGGTGGTGACAGCTGTTGCCAAATCCGCC
TTTAACTCGGCTGTTGAGGCTATCCGCGCGGGTGGCCGTGTTGTCGCCGTTGGTC
TGCCTCCTGAAAAAATGGATTTGAGCATTCCTCGCTTGGTGCTTGACGGTATCGA
AGTCTTAGGTTCTTTGGTCGGAACGCGGGAAGATTTGAAAGAAGCCTTCCAGTTT
GCAGCCGAAGGTAAGGTCAAACCGAAAGTCACCAAGCGTAAAGTCGAAGAAAT
CAACCAAATCTTTGACGAAATGGAACATGGTAAATTCACAGGCCGTATGGTTGTT
GATTTTACCCATCACTAG
[0269] For Strain 2, the lower case sequence corresponds to the cpcB promoter from Synechocystis sp. PCC 6803 (SEQ ID NO:28) and the upper case sequence to the bifunctional adhE sequence from E. coli (SEQ ID NO:29) (this sequence encodes a E568K point mutation that minimizes the oxygen sensitivity of the enzyme (Holland-Staley, C. A. et al, J. Bacteriol. 182:6049-6054 (2000))):
[0270] ttcgttataaaataaacttaacaaatctatacccacctgtagagaagagtccctgaatatcaaaatggtgggataaaaag ctcaaaaaggaaagtaggctgtggttccctaggcaacagtcttccctaccccactggaaactaaaaaaacgagaaaagttcgcaccga acatcaattgcataattttagccctaaaacataagctgaacgaaactggttgtcttcccttcccaatccaggacaatctgagaatcccctgc aacattacttaacaaaaaagcaggaataaaattaacaagatgtaacagacataagtcccatcaccgttgtataaagttaactgtgggattg caaaagcattcaagcctaggcgctgagctgtttgagcatcccggtggcccttgtcgctgcctccgtgtttctccctggatttatttaggtaa tatctctcataaatccccgggtagttaacgaaagttaatggagatcagtaacaataactctagggtcattactttggactccctcagtttatc cgggggaattgtgtttaagaaaatcccaactcataaagtcaagtaggagattaatcatATGGCGGTTACTAATGTCGC
TGAACTTAACGCACTCGTAGAGCGTGTAAAAAAAGCCCAGCGTGAATATGCCAG
TTTCACTCAAGAGCAAGTAGACAAAATCTTCCGCGCCGCCGCTCTGGCTGCTGCA
GATGCTCGAATCCCACTCGCGAAAATGGCCGTTGCCGAATCCGGCATGGGTATCG TCGAAGATAAAGTGATCAAAAACCACTTTGCTTCTGAATATATCTACAACGCCTA
TAAAGATGAAAAAACCTGTGGTGTTCTGTCTGAAGACGACACTTTTGGTACCATC
ACTATCGCTGAACCAATCGGTATTATTTGCGGTATCGTTCCGACCACTAACCCGA
CTTCAACTGCTATCTTCAAATCGCTGATCAGTCTGAAGACCCGTAACGCCATTAT
CTTCTCCCCGCACCCGCGTGCAAAAGATGCCACCAACAAAGCGGCTGATATCGTT
CTGCAGGCTGCTATCGCTGCCGGTGCTCCGAAAGATCTGATCGGCTGGATCGATC
AACCTTCTGTTGAACTGTCTAACGCACTGATGCACCACCCAGACATCAACCTGAT
CCTCGCGACTGGTGGTCCGGGCATGGTTAAAGCCGCATACAGCTCCGGTAAACC
AGCTATCGGTGTAGGCGCGGGCAACACTCCAGTTGTTATCGATGAAACTGCTGAT
ATCAAACGTGCAGTTGCATCTGTACTGATGTCCAAAACCTTCGACAACGGCGTAA
TCTGTGCTTCTGAACAGTCTGTTGTTGTTGTTGACTCTGTTTATGACGCTGTACGT
GAACGTTTTGCAACCCACGGCGGCTATCTGTTGCAGGGTAAAGAGCTGAAAGCT
GTTCAGGATGTTATCCTGAAAAACGGTGCGCTGAACGCGGCTATCGTTGGTCAGC
CAGCCTATAAAATTGCTGAACTGGCAGGCTTCTCTGTACCAGAAAACACCAAGAT
TCTGATCGGTGAAGTGACCGTTGTTGATGAAAGCGAACCGTTCGCACATGAAAA
ACTGTCCCCGACTCTGGCAATGTACCGCGCTAAAGATTTCGAAGACGCGGTAGA
AAAAGCAGAGAAACTGGTTGCTATGGGCGGTATCGGTCATACCTCTTGCCTGTAC
ACTGACCAGGATAACCAACCGGCTCGCGTTTCTTACTTCGGTCAGAAAATGAAAA
CGGCGCGTATCCTGATTAACACCCCAGCGTCTCAGGGTGGTATCGGTGACCTGTA
TAACTTCAAACTCGCACCTTCCCTGACTCTGGGTTGTGGTTCTTGGGGTGGTAACT
CCATCTCTGAAAACGTTGGTCCGAAACACCTGATCAACAAGAAAACCGTTGCTA
AGCGAGCTGAAAACATGTTGTGGCACAAACTTCCGAAATCTATCTACTTCCGCCG
TGGCTCCCTGCCAATCGCGCTGGATGAAGTGATTACTGATGGCCACAAACGTGCG
CTCATCGTGACTGACCGCTTCCTGTTCAACAATGGTTATGCTGATCAGATCACTTC
CGTACTGAAAGCAGCAGGCGTTGAAACTGAAGTCTTCTTCGAAGTAGAAGCGGA
CCCGACCCTGAGCATCGTTCGTAAAGGTGCAGAACTGGCAAACTCCTTCAAACCA
GACGTGATTATCGCGCTGGGTGGTGGTTCCCCGATGGACGCCGCGAAGATCATGT
GGGTTATGTACGAACATCCGGAAACTCACTTCGAAAAACTGGCGCTGCGCTTTAT
GGATATCCGTAAACGTATCTACAAGTTCCCGAAAATGGGCGTGAAAGCGAAAAT
GATCGCTGTCACCACCACTTCTGGTACAGGTTCTGAAGTCACTCCGTTTGCGGTT
GTAACTGACGACGCTACTGGTCAGAAATATCCGCTGGCAGACTATGCGCTGACTC
CGGATATGGCGATTGTCGACGCCAACCTGGTTATGGACATGCCGAAGTCCCTGTG
TGCTTTCGGTGGTCTGGACGCAGTAACTCACGCCATGGAAGCTTATGTTTCTGTA
CTGGCATCTGAGTTCTCTGATGGTCAGGCTCTGCAGGCACTGAAACTGCTGAAAG AATATCTGCCAGCGTCCTACCACGAAGGGTCTAAAAATCCGGTAGCGCGTGAAC
GTGTTCACAGTGCAGCGACTATCGCGGGTATCGCGTTTGCGAACGCCTTCCTGGG
TGTATGTCACTCAATGGCGCACAAACTGGGTTCCCAGTTCCATATTCCGCACGGT
CTGGCAAACGCCCTGCTGATTTGTAACGTTATTCGCTACAATGCGAACGACAACC
CGACCAAGCAGACTGCATTCAGCCAGTATGACCGTCCGCAGGCTCGCCGTCGTTA
TGCTGAAATTGCCGACCACTTGGGTCTGAGCGCACCGGGCGACCGTACTGCTGCT
AAGATCGAGAAACTGCTGGCATGGCTGGAAACGCTGAAAGCTGAACTGGGTATT
CCGAAATCTATCCGTGAAGCTGGCGTTCAGGAAGCAGACTTCCTGGCGAACGTG
GATAAACTGTCTGAAGATGCATTCGATGACCAGTGCACCGGCGCTAACCCGCGTT
ACCCGCTGATCTCCGAGCTGAAACAGATTCTGCTGGATACCTACTACGGTCGTGA
TTATGTAGAAGGTGAAACTGCAGCGAAGAAAGAAGCTGCTCCGGCTAAAGCTGA
GAAAAAAGCGAAAAAATCCGCTTAA
[0271] For Strain 3, the first lower case sequence corresponds to the aphll promoter (SEQ ID NO:30), the first upper case sequence to pdc from Z. palmae (SEQ ID NO:31), the second lower case sequence the cpcB promoter from Synechocystis sp. PCC 6803 (SEQ ID NO:32), and the second upper case sequence the codon-optimized adhE gene from E. histolytica (SEQ ID NO:33):
[0272] gggggggggggggaaagccacgttgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatga acaataaaactgtctgcttacataaacagtaatacaaggggtcatATGTATACCGTTGGTATGTACTTGGCAG
AACGCCTAGCCCAGATCGGCCTGAAACACCACTTTGCCGTGGCCGGTGACTACA
ACCTGGTGTTGCTTGATCAGCTCCTGCTGAACAAAGACATGGAGCAGGTCTACTG
CTGTAACGAACTTAACTGCGGCTTTAGCGCCGAAGGTTACGCTCGTGCACGTGGT
GCCGCCGCTGCCATCGTCACGTTCAGCGTAGGTGCTATCTCTGCAATGAACGCCA
TCGGTGGCGCCTATGCAGAAAACCTGCCGGTCATCCTGATCTCTGGCTCACCGAA
CACCAATGACTACGGCACAGGCCACATCCTGCACCACACCATTGGTACTACTGAC
TATAACTATCAGCTGGAAATGGTAAAACACGTTACCTGCGCACGTGAAAGCATC
GTTTCTGCCGAAGAAGCACCGGCAAAAATCGACCACGTCATCCGTACGGCTCTAC
GTGAACGCAAACCGGCTTATCTGGAAATCGCATGCAACGTCGCTGGCGCTGAAT
GTGTTCGTCCGGGCCCGATCAATAGCCTGCTGCGTGAACTCGAAGTTGACCAGAC
CAGTGTCACTGCCGCTGTAGATGCCGCCGTAGAATGGCTGCAGGACCGCCAGAA
CGTCGTCATGCTGGTCGGTAGCAAACTGCGTGCCGCTGCCGCTGAAAAACAGGCT
GTTGCCCTAGCGGACCGCCTGGGCTGCGCTGTCACGATCATGGCTGCCGAAAAA
GGCTTCTTCCCGGAAGATCATCCGAACTTCCGCGGCCTGTACTGGGGTGAAGTCA GCTCCGAAGGTGCACAGGAACTGGTTGAAAACGCCGATGCCATCCTGTGTCTGG
CACCGGTATTCAACGACTATGCTACCGTTGGCTGGAACTCCTGGCCGAAAGGCGA
CAATGTCATGGTCATGGACACCGACCGCGTCACTTTCGCAGGACAGTCCTTCGAA
GGTCTGTCATTGAGCACCTTCGCCGCAGCACTGGCTGAGAAAGCACCTTCTCGCC
CGGCAACGACTCAAGGCACTCAAGCACCGGTACTGGGTATTGAGGCCGCAGAGC
CCAATGCACCGCTGACCAATGACGAAATGACGCGTCAGATCCAGTCGCTGATCA
CTTCCGACACTACTCTGACAGCAGAAACAGGTGACTCTTGGTTCAACGCTTCTCG
CATGCCGATTCCTGGCGGTGCTCGTGTCGAACTGGAAATGCAATGGGGTCATATC
GGTTGGTCCGTACCTTCTGCATTCGGTAACGCCGTTGGTTCTCCGGAGCGTCGCC
ACATCATGATGGTCGGTGATGGCTCTTTCCAGCTGACTGCTCAAGAAGTTGCTCA
GATGATCCGCTATGAAATCCCGGTCATCATCTTCCTGATCAACAACCGCGGTTAC
GTCATCGAAATCGCTATCCATGACGGCCCTTACAACTACATCAAAAACTGGAACT
ACGCTGGCCTGATCGACGTCTTCAATGACGAAGATGGTCATGGCCTGGGTCTGAA
AGCTTCTACTGGTGCAGAACTAGAAGGCGCTATCAAGAAAGCACTCGACAATCG
TCGCGGTCCGACGCTGATCGAATGTAACATCGCTCAGGACGACTGCACTGAAAC
CCTGATTGCTTGGGGTAAACGTGTAGCAGCTACCAACTCTCGCAAACCACAAGCG
TAAttaactcgacttcgttataaaataaacttaacaaatctatacccacctgtagagaagagtccctgaatatcaaaatggtgggataaa aagctcaaaaaggaaagtaggctgtggttccctaggcaacagtcttccctaccccactggaaactaaaaaaacgagaaaagttcgcac cgaacatcaattgcataattttagccctaaaacataagctgaacgaaactggttgtcttcccttcccaatccaggacaatctgagaatccc ctgcaacattacttaacaaaaaagcaggaataaaattaacaagatgtaacagacataagtcccatcaccgttgtataaagttaactgtgg gattgcaaaagcattcaagcctaggcgctgagctgtttgagcatcccggtggcccttgtcgctgcctccgtgtttctccctggatttattta ggtaatatctctcataaatccccgggtagttaacgaaagttaatggagatcagtaacaataactctagggtcattactttggactccctcag tttatccgggggaattgtgtttaagaaaatcccaactcataaagtcaagtaggagattaatcatATGAAAGGCTTGGCGA
TGCTGGGTATCGGTCGCATCGGCTGGATTGAGAAAAAGATTCCTGAGTGTGGTCC
GCTGGATGCGCTGGTTCGCCCGCTGGCCCTGGCCCCATGCACCAGCGATACCCAT
ACCGTCTGGGCGGGTGCGATCGGCGACCGCCATGACATGATTCTGGGCCATGAG
GCCGTGGGCCAGATTGTTAAGGTTGGTAGCCTGGTGAAGCGCCTGAAAGTGGGC
GATAAGGTCATTGTCCCGGCAATTACGCCGGACTGGGGCGAAGAAGAGAGCCAA
CGCGGTTATCCGATGCACAGCGGTGGCATGCTGGGTGGTTGGAAGTTCTCTAACT
TCAAAGATGGTGTGTTCAGCGAAGTCTTTCACGTCAATGAGGCCGACGCGAACTT
GGCACTGCTGCCGCGTGACATCAAACCGGAGGACGCCGTTATGCTGAGCGACAT
GGTGACCACCGGTTTTCATGGTGCAGAACTGGCGAACATCAAATTGGGTGACAC
GGTGTGTGTGATCGGTATTGGTCCGGTCGGCCTGATGAGCGTTGCTGGTGCAAAT
CACCTGGGCGCTGGCCGTATCTTCGCGGTTGGCTCCCGTAAACATTGCTGCGACA TTGCTCTGGAGTACGGCGCGACGGATATCATCAATTACAAGAATGGCGATATTGT
CGAACAAATCCTGAAGGCGACGGATGGTAAGGGTGTGGATAAAGTTGTGATTGC
GGGTGGCGATGTTCACACGTTTGCGCAGGCAGTCAAAATGATCAAACCAGGTAG
CGACATCGGTAATGTTAACTACCTGGGCGAAGGTGACAACATCGACATCCCGCG
TAGCGAGTGGGGTGTGGGTATGGGTCACAAGCACATCCATGGCGGCCTGACGCC
GGGTGGTCGTGTTCGTATGGAAAAGCTGGCCTCCCTGATTTCGACCGGCAAGCTG
GACACCAGCAAACTGATTACTCACCGTTTTGAGGGTCTGGAGAAAGTGGAAGAT
GCGCTGATGCTGATGAAGAACAAACCGGCAGATTTGATTAAGCCGGTCGTTCGT
ATCCACTATGACGACGAAGATACCTTGCACTGA
[0273] For Strain 4, the first lower case sequence corresponds to the aphll promoter (SEQ ID NO:34), the first upper case sequence to pdc from Z. mobilis (SEQ ID NO:35), the second lower case sequence is an intergenic sequence (SEQ ID NO: 36), and the second upper case sequence the adhll gene from Z. mobilis (SEQ ID NO: 37):
[0274] gggggggggggggaaagccacgttgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatga acaataaaactgtctgcttacataaacagtaatacaaggggtcatATGAGTTATACTGTCGGTACCTATTTAG
CGGAGCGGCTTGTCCAGATTGGTCTCAAGCATCACTTCGCAGTCGCGGGCGACTA
CAACCTCGTCCTTCTTGACAACCTGCTTTTGAACAAAAACATGGAGCAGGTTTAT
TGCTGTAACGAACTGAACTGCGGTTTCAGTGCAGAAGGTTATGCTCGTGCCAAAG
GCGCAGCAGCAGCCGTCGTTACCTACAGCGTCGGTGCGCTTTCCGCATTTGATGC
TATCGGTGGCGCCTATGCAGAAAACCTTCCGGTTATCCTGATCTCCGGTGCTCCG
AACAACAATGATCACGCTGCTGGTCACGTGTTGCATCACGCTCTTGGCAAAACCG
ACTATCACTATCAGTTGGAAATGGCCAAGAACATCACGGCCGCAGCTGAAGCGA
TTTACACCCCAGAAGAAGCTCCGGCTAAAATCGATCACGTGATTAAAACTGCTCT
TCGTGAGAAGAAGCCGGTTTATCTCGAAATCGCTTGCAACATTGCTTCCATGCCC
TGCGCCGCTCCTGGACCGGCAAGCGCATTGTTCAATGACGAAGCCAGCGACGAA
GCTTCTTTGAATGCAGCGGTTGAAGAAACCCTGAAATTCATCGCCAACCGCGACA
AAGTTGCCGTCCTCGTCGGCAGCAAGCTGCGCGCAGCTGGTGCTGAAGAAGCTG
CTGTCAAATTTGCTGATGCTCTCGGTGGCGCAGTTGCTACCATGGCTGCTGCAAA
AAGCTTCTTCCCAGAAGAAAACCCGCATTACATCGGTACCTCATGGGGTGAAGTC
AGCTATCCGGGCGTTGAAAAGACGATGAAAGAAGCCGATGCGGTTATCGCTCTG
GCTCCTGTCTTCAACGACTACTCCACCACTGGTTGGACGGATATTCCTGATCCTA
AGAAACTGGTTCTCGCTGAACCGCGTTCTGTCGTCGTTAACGGCGTTCGCTTCCC
CAGCGTTCATCTGAAAGACTATCTGACCCGTTTGGCTCAGAAAGTTTCCAAGAAA ACCGGTGCTTTGGACTTCTTCAAATCCCTCAATGCAGGTGAACTGAAGAAAGCCG
CTCCGGCTGATCCGAGTGCTCCGTTGGTCAACGCAGAAATCGCCCGTCAGGTCGA
AGCTCTTCTGACCCCGAACACGACGGTTATTGCTGAAACCGGTGACTCTTGGTTC
AATGCTCAGCGCATGAAGCTCCCGAACGGTGCTCGCGTTGAATATGAAATGCAG
TGGGGTCACATCGGTTGGTCCGTTCCTGCCGCCTTCGGTTATGCCGTCGGTGCTCC
GGAACGTCGCAACATCCTCATGGTTGGTGATGGTTCCTTCCAGCTGACGGCTCAG
GAAGTCGCTCAGATGGTTCGCCTGAAACTGCCGGTTATCATCTTCTTGATCAATA
ACTATGGTTACACCATCGAAGTTATGATCCATGATGGTCCGTACAACAACATCAA
GAACTGGGATTATGCCGGTCTGATGGAAGTGTTCAACGGTAACGGTGGTTATGAC
AGCGGTGCTGGTAAAGGCCTGAAGGCTAAAACCGGTGGCGAACTGGCAGAAGCT
ATCAAGGTTGCTCTGGCAAACACCGACGGCCCAACCCTGATCGAATGCTTCATCG
GTCGTGAAGACTGCACTGAAGAATTGGTCAAATGGGGTAAGCGCGTTGCTGCCG
CCAACAGCCGTAAGCCTGTT AACAAGCTCCTCTAGttaactcgagttgtaacaccgtgcgtgttgacta ttttacctctggcggtgataatggttgcaggatccttttgctggaggaaaaccatATGGCTTCTTCAACTTTTTATAT
TCCTTTCGTCAACGAAATGGGCGAAGGTTCGCTTGAAAAAGCAATCAAGGATCTT
AACGGCAGCGGCTTTAAAAATGCGCTGATCGTTTCTGATGCTTTCATGAACAAAT
CCGGTGTTGTGAAGCAGGTTGCTGACCTGTTGAAAGCACAGGGTATTAATTCTGC
TGTTTATGATGGCGTTATGCCGAACCCGACTGTTACCGCAGTTCTGGAAGGCCTT
AAGATCCTGAAGGATAACAATTCAGACTTCGTCATCTCCCTCGGTGGTGGTTCTC
CCCATGACTGCGCCAAAGCCATCGCTCTGGTCGCAACCAATGGTGGTGAAGTCA
AAGACTACGAAGGTATCGACAAATCTAAGAAACCTGCCCTGCCTTTGATGTCAAT
CAACACGACGGCTGGTACGGCTTCTGAAATGACGCGTTTCTGCATCATCACTGAT
GAAGTCCGTCACGTTAAGATGGCCATTGTTGACCGTCACGTTACCCCGATGGTTT
CCGTCAACGATCCTCTGTTGATGGTTGGTATGCCAAAAGGCCTGACCGCCGCCAC
CGGTATGGATGCTCTGACCCACGCATTTGAAGCTTATTCTTCAACGGCAGCTACT
CCGATCACCGATGCTTGCGCCTTGAAGGCTGCGTCCATGATCGCTAAGAATCTGA
AGACCGCTTGCGACAACGGTAAGGATATGCCAGCTCGTGAAGCTATGGCTTATG
CCCAATTCCTCGCTGGTATGGCCTTCAACAACGCTTCGCTTGGTTATGTCCATGCT
ATGGCTCACCAGTTGGGCGGCTACTACAACCTGCCGCATGGTGTCTGCAACGCTG
TTCTGCTTCCGCATGTTCTGGCTTATAACGCCTCTGTCGTTGCTGGTCGTCTGAAA
GACGTTGGTGTTGCTATGGGTCTCGATATCGCCAATCTCGGTGATAAAGAAGGCG
CAGAAGCCACCATTCAGGCTGTTCGCGATCTGGCTGCTTCCATTGGTATTCCAGC
AAATCTGACCGAGCTGGGTGCTAAGAAAGAAGATGTGCCGCTTCTTGCTGACCA CGCTCTGAAAGATGCTTGTGCTCTGACCAACCCGCGTCAGGGTGATCAGAAAGA AGTTGAAGAACTCTTCCTGAGCGCTTTCTAA
[0275] For Strain 5, the first lower case sequence corresponds to the aphll promoter ((SEQ ID NO:38), the first upper case sequence to pdc from Z mobilis (SEQ ID NO:39), the second lower case sequence is an intergenic sequence (SEQ ID NO:40), and the second upper case sequence the adhl gene from Z. mobilis (SEQ ID NO:41):
[0276] gggggggggggggaaagccacgttgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatga acaataaaactgtctgcttacataaacagtaatacaaggggtcatATGAGTTATACTGTCGGTACCTATTTAG
CGGAGCGGCTTGTCCAGATTGGTCTCAAGCATCACTTCGCAGTCGCGGGCGACTA
CAACCTCGTCCTTCTTGACAACCTGCTTTTGAACAAAAACATGGAGCAGGTTTAT
TGCTGTAACGAACTGAACTGCGGTTTCAGTGCAGAAGGTTATGCTCGTGCCAAAG
GCGCAGCAGCAGCCGTCGTTACCTACAGCGTCGGTGCGCTTTCCGCATTTGATGC
TATCGGTGGCGCCTATGCAGAAAACCTTCCGGTTATCCTGATCTCCGGTGCTCCG
AACAACAATGATCACGCTGCTGGTCACGTGTTGCATCACGCTCTTGGCAAAACCG
ACTATCACTATCAGTTGGAAATGGCCAAGAACATCACGGCCGCAGCTGAAGCGA
TTTACACCCCAGAAGAAGCTCCGGCTAAAATCGATCACGTGATTAAAACTGCTCT
TCGTGAGAAGAAGCCGGTTTATCTCGAAATCGCTTGCAACATTGCTTCCATGCCC
TGCGCCGCTCCTGGACCGGCAAGCGCATTGTTCAATGACGAAGCCAGCGACGAA
GCTTCTTTGAATGCAGCGGTTGAAGAAACCCTGAAATTCATCGCCAACCGCGACA
AAGTTGCCGTCCTCGTCGGCAGCAAGCTGCGCGCAGCTGGTGCTGAAGAAGCTG
CTGTCAAATTTGCTGATGCTCTCGGTGGCGCAGTTGCTACCATGGCTGCTGCAAA
AAGCTTCTTCCCAGAAGAAAACCCGCATTACATCGGTACCTCATGGGGTGAAGTC
AGCTATCCGGGCGTTGAAAAGACGATGAAAGAAGCCGATGCGGTTATCGCTCTG
GCTCCTGTCTTCAACGACTACTCCACCACTGGTTGGACGGATATTCCTGATCCTA
AGAAACTGGTTCTCGCTGAACCGCGTTCTGTCGTCGTTAACGGCGTTCGCTTCCC
CAGCGTTCATCTGAAAGACTATCTGACCCGTTTGGCTCAGAAAGTTTCCAAGAAA
ACCGGTGCTTTGGACTTCTTCAAATCCCTCAATGCAGGTGAACTGAAGAAAGCCG
CTCCGGCTGATCCGAGTGCTCCGTTGGTCAACGCAGAAATCGCCCGTCAGGTCGA
AGCTCTTCTGACCCCGAACACGACGGTTATTGCTGAAACCGGTGACTCTTGGTTC
AATGCTCAGCGCATGAAGCTCCCGAACGGTGCTCGCGTTGAATATGAAATGCAG
TGGGGTCACATCGGTTGGTCCGTTCCTGCCGCCTTCGGTTATGCCGTCGGTGCTCC
GGAACGTCGCAACATCCTCATGGTTGGTGATGGTTCCTTCCAGCTGACGGCTCAG
GAAGTCGCTCAGATGGTTCGCCTGAAACTGCCGGTTATCATCTTCTTGATCAATA ACTATGGTTACACCATCGAAGTTATGATCCATGATGGTCCGTACAACAACATCAA
GAACTGGGATTATGCCGGTCTGATGGAAGTGTTCAACGGTAACGGTGGTTATGAC
AGCGGTGCTGGTAAAGGCCTGAAGGCTAAAACCGGTGGCGAACTGGCAGAAGCT
ATCAAGGTTGCTCTGGCAAACACCGACGGCCCAACCCTGATCGAATGCTTCATCG
GTCGTGAAGACTGCACTGAAGAATTGGTCAAATGGGGTAAGCGCGTTGCTGCCG
CCAACAGCCGTAAGCCTGTT AACAAGCTCCTCTAGttaactcgagttgtaacaccgtgcgtgttgacta ttttacctctggcggtgataatggttgcaggatccttttgctggaggaaaaccatATGAAAGCAGCCGTCATAACTA
AAGATCATACGATCGAAGTGAAAGACACCAAATTACGCCCTCTGAAATACGGGG
AAGCGCTTTTGGAAATGGAATATTGCGGGGTATGTCATACCGATCTCCACGTGAA
AAACGGGGATTTTGGCGATGAAACCGGCAGAATTACCGGCCATGAAGGCATCGG
TATCGTCAAGCAGGTCGGGGAAGGGGTTACTTCTCTGAAAGTCGGTGACCGTGCC
AGTGTTGCATGGTTCTTCAAAGGCTGCGGCCATTGCGAATATTGTGTCAGTGGAA
ATGAAACGCTTTGCCGCAACGTTGAAAATGCCGGTTATACGGTTGACGGCGCTAT
GGCAGAAGAATGCATCGTCGTTGCCGATTACTCGGTCAAAGTGCCAGATGGTCTT
GATCCTGCGGTTGCCAGCAGCATCACTTGCGCGGGTGTAACCACCTATAAAGCAG
TCAAAGTTTCTCAGATACAGCCGGGACAATGGCTGGCTATCTATGGCTTGGGCGG
TTTAGGCAATCTAGCCCTTCAATATGCCAAGAATGTTTTCAACGCCAAAGTGATC
GCGATCGATGTCAATGATGAACAGCTCGCTTTTGCCAAAGAGCTGGGCGCAGAT
ATGGTCATCAATCCGAAAAACGAAGATGCTGCCAAAATCATTCAGGAAAAAGTC
GGCGGCGCACATGCGACGGTGGTGACAGCTGTTGCCAAATCCGCCTTTAACTCGG
CTGTTGAGGCTATCCGCGCGGGTGGCCGTGTTGTCGCCGTTGGTCTGCCTCCTGA
AAAAATGGATTTGAGCATTCCTCGCTTGGTGCTTGACGGTATCGAAGTCTTAGGT
TCTTTGGTCGGAACGCGGGAAGATTTGAAAGAAGCCTTCCAGTTTGCAGCCGAA
GGTAAGGTCAAACCGAAAGTCACCAAGCGTAAAGTCGAAGAAATCAACCAAATC
TTTGACGAAATGGAACATGGTAAATTCACAGGCCGTATGGTTGTTGATTTTACCC
ATCACTAG
[0277] To generate the recombinant strains described in Table 10, the following procedure was used. 2-5 μg of the plasmid DNA bearing the indicated pdc-adh construct and antibiotic marker gene was linearized with Xbal and added to 0.5-1.0 ml of (OD730 ~1) Synechococcus sp. PCC 7002 or Synechococcus sp. PCC 7002 pAQ7(ldh):ϊP{cI}-adhA kan μl as appropriate . The cell-DNA mixture was incubated with gentle roation at 37 0C in the dark for 4 hours and then plated onto an A+ agar plate and incubated at 370C (~50μE) in air. After 24 hours the plates were underlaid with kanamycin to a final concentration of 50 μg/ml or spectinomycin to 25 μg/ml as appropriate_and incubated as above. After 5 days background growth was diminished and KmR colonies began to be visible, at which point the plates were transferred to 370C (~50μE) + 1% CO2. After 3 additional days, two antibiotic- resistant colonies from each transformation were streaked onto A+ 100 μg/ml kanamycin or 100 μg/ml spectinomycin agar plates for single colony segregation. Streaked plates were incubated for 4 days at 370C (~50μE) in air and then transferred to 370C (~50μE) + 1% CO2 for an additional 3 days; colonies from these plates were used to inonculate seed cultures which were subsequently used for EtOH production analysis in batch culture.
[0278] Batch Ethanol in Flasks: A single colony of one clone from the original streak plate from each transformation was inoculated into 5 ml A+ and 5-1000 μg/ml of either kanamycin or spectinomycin broth in a 16mm x 150mm plastic-capped culture tube and incubated in the Infers incubator (370C, 150rpm, 2% CO2) at a -60 angle. After 3 days the cultures were transferred into foam-plugged unbaffled 125 -ml Erlenmeyer flasks containing 30 ml JB2.1 with antibiotic concentrations that were used in the initial test-tube seed cultures at an initial OD730 of 0.1. The initial weight of each flask culture was determined so that sterile dH2O could be added at sampling times to account for evaporation. At each sampling point, 300 μl of culture was removed and the cultures were replenished with an equal amount of fresh JB2.1 medium. At roughly 24 hour intervals, samples were taken and their OD730 was measured. In addition, 100 μl of cell-free samples was used to determine the liquid EtOH concentration by gas chromatography/flame ionization detection (GC/FID). In order to account for the EtOH lost due to evaporative stripping, the stripping rate of EtOH was determined in cell-free cultures under the same conditions used. This strip rate was then used to correct for EtOH lost due to evaporation; the total, cumulative, EtOH production rate could thereby be calculated (Table 11). All strains produced ethanol. The data for each strain is provided in Tables 11-14. DCW stands for "dry cell weight". Table 11 Data for Strain 1
Figure imgf000089_0001
Figure imgf000090_0001
Table 12 Data for Strain 2
Figure imgf000090_0002
Table 13 Data for Strain 3
Figure imgf000090_0003
Table 14 Data for Strains 4 and 5
Figure imgf000091_0001
[0279] All publications, patents and other references mentioned herein are hereby incorporated by reference in their entireties.
INFORMAL SEQUENCE LISTING
Table 15. Wild- Type Sequences of Genes
Figure imgf000092_0001
Figure imgf000093_0001
Gene Wild-Type Sequence atttggtgtctttcacttcgatcgtatgatctttagttatgacggctgctttcat adhl SEQ ID NO: 13 atggaaggaaaaaccacaatgaaaggacttgctatgcttggaattggaagaattggatggattgaaaagaaaatccca gaatgtggaccacttgatgcattagttagaccattagcacttgcaccatgtacatcagatacacataccgtttgggcagg agctattggagatagacatgatatgattcttggacatgaagcggttggacaaattgttaaagttggatcattagttaagag attaaaagttggagataaagttattgtaccagctattacaccagattggggagaagaagaatcgcaaagaggatatcca atgcattcaggaggaatgcttggaggatggaaattctcaaatttcaaggatggagttttttcagaagttttccatgttaatg aagcagatgccaatcttgcacttcttccaagagatattaaaccagaagatgcagttatgttatcagatatggtaactactg gattccatggagcagaattagctaatattaaacttggagatactgtttgtgttattggtattggaccagttggattaatgtca gttgcaggagcaaaccatcttggagcaggaagaatctttgcagtaggatcaagaaaacattgttgtgatattgcattgg aatatggagcaacagatattattaattataaaaatggagatattgtagaacaaattcttaaagctacagacggcaaagga gttgataaagtcgttattgcaggaggtgatgttcatacatttgcacaagcagtcaaaatgattaaaccaggatcagatatt ggaaatgttaattatcttggagaaggagataatattgatattccaagaagtgaatggggagttggaatgggtcataaaca cattcatggaggtttaaccccaggtggaagagtcagaatggaaaaattagcatcacttatttcaactggtaaattagata cttctaaacttattacacatagatttgaaggattagaaaaagttgaagatgcattaatgttaatgaagaataaaccagcag accttatcaaaccagttgtcagaattcattatgatgatgaagatactcttcattaaattcattaattcaaagtattaaac adhE SEQ ID NO: 16 atgaatgccccaaccttgaccagtgacccccccgttcaaagccttgccgatctggaagggctgattgagcgcgtccaa cgggcgcagagtcagtacgcccaatttacccaagagcaagtggatcacattttccacgaagcagccatggcggcca accaagcccggattcccctggccaaacaagccgtagccgaaacgggcatgggggttgtcgaagataaagttattaaa aatcactttgcttcggaatacatctacaacaagtacaaaaatgagaaaacctgcggcgtcattgaggatgaccccatctt tggtatccaaaaaattgctgaaccggtggggatcattgccggtgtggtgccggtcacgaaccccacttcaacgaccat ctttaaggcactgattgccctgaagactcgcaatggcattatcttttcgccccacccccgggcaaaggcctgtacggtt gcagcggccaaggtagtgttggatgcagcggtcgctgccggcgcaccccccgatattattggctggattgatgagcc gacgattgaactctcccaagccctgatgcagcacccgcagatcaagctgattttggccacggggggaccaggtatgg tcaaggcagcctattcctctggccatccggcgatcggggtcggggccgggaatacccccgtgctcattgatgccaca gccgatattcccacggcagtgagttcgattctcctcagtaaggcctttgacaatggcatgatctgtgcctcggagcagg cagtgattgttgtggatgagatttatgacgcacttaaagctgagtttcaacggcgaggggcctaccttctctcccctgag gaacggcagcaggtggcacaactactgctgaaggatggtcgcctcaatgccgccattgttggtcaatcggccgccac cattgccgcaatggccaatatccaagtaccgccagaaacccgggtactcattggcgaggtgagtgaagtggggccg caggagccattttcctatgagaaactctgtccggtattggcgttatatcgggcaccccagttccataaaggggtggaga ttgcggcccagttggtgaattttgggggcaaggggcatacatctgtgctctataccgatccccgcaatcaagatgatatt gcctatttcaaataccgcatgcaaacggcgcgggttctgattaacaccccttcttcccagggggcaattggcgatctcta caacttcaagttagatccgtcgctaacccttggttgtggtacgtggggcggcaacgtcacatcggaaaatgttggtccc cgtcacttgctgaatattaaaacggtgagcgatcgccgggaaaatatgctttggtttcgggtgccgcccaagatctactt caaacccggctgtttgcccattgccctgcgggagctggcggggaaaaaacgcgccttcctcgtgacggataaaccc ctctttgacttggggatcactgaaccgattgtccataccctcgaagaactgggcatcaagtatgacatcttccatgaagt ggaaccagatccaaccctcagtaccgttaaccgcggtctagggttgctgcggcaatatcagccggatgtgattgttgct gtggggggtggctcacctatggatgcagccaaggtgatgtggctgttgtatgagcatccggaggtggagtttgacgg ccttgcgatgcgcttcatggatattcgcaagcgggtgtatcaactgcctcccttgggtcaaaaggcaatcctggtggct attcccaccacctcggggacgggttcagaggtgaccccctttgccgtggttaccgacgatcgcgtggggattaaatat cccttggcagactatgcccttacgccaacgatggcgattgtggatcccgacttggtgctgcacatgcccaagaaactg acggcctacggtggcattgatgcgctgacccatgccctggaggcctatgtgtcggtgctctcgacggagtttacggag ggactggctctagaggccattaaactgctctttacctacctaccccgtgcctatcgcttgggggcggcggatccggag gcacgggagaaggtccactatgcggcgacgatcgctggcatggcctttgcgaatgccttcttgggggtctgccactc gctggcccacaaactaggctccaccttccacgtgccccacggcttggcgaatgcactcatgatttcccatgtgattcgc Gene Wild-Type Sequence tacaatgccacggatgctcccctgaagcaggcgattttcccgcagtacaagtatccccaagcgaaggagcgctatgc ccaaattgccgacttcctcgaattggggggcacgaccccagaggaaaaagtggagcgtctcattgcggcaattgagg atttgaaagcccaattagaaattcccgccacgattaaggaggccctcaacagtgaggatcaagcgttctatgagcagg tggagagcatggccgaactggcctttgacgatcagtgcacgggggccaatccccgctatccgctgatccaagacctc aaggagttgtatatcctggcctatatggggtgtcggcgggatgcggcagcctactatgggggggaggcaacgggga gttga adhE SEQ ID NO: 19 atggctgttactaatgtcgctgaacttaacgcactcgtagagcgtgtaaaaaaagcccagcgtgaatatgccagtttcac tcaagagcaagtagacaaaatcttccgcgccgccgctctggctgctgcagatgctcgaatcccactcgcgaaaatgg ccgttgccgaatccggcatgggtatcgtcgaagataaagtgatcaaaaaccactttgcttctgaatatatctacaacgcc tataaagatgaaaaaacctgtggtgttctgtctgaagacgacacttttggtaccatcactatcgctgaaccaatcggtatt atttgcggtatcgttccgaccactaacccgacttcaactgctatcttcaaatcgctgatcagtctgaagacccgtaacgc cattatcttctccccgcacccgcgtgcaaaagatgccaccaacaaagcggctgatatcgttctgcaggctgctatcgct gccggtgctccgaaagatctgatcggctggatcgatcaaccttctgttgaactgtctaacgcactgatgcaccacccag acatcaacctgatcctcgcgactggtggtccgggcatggttaaagccgcatacagctccggtaaaccagctatcggtg taggcgcgggcaacactccagttgttatcgatgaaactgctgatatcaaacgtgcagttgcatctgtactgatgtccaaa accttcgacaacggcgtaatctgtgcttctgaacagtctgttgttgttgttgactctgtttatgacgctgtacgtgaacgtttt gcaacccacggcggctatctgttgcagggtaaagagctgaaagctgttcaggatgttatcctgaaaaacggtgcgctg aacgcggctatcgttggtcagccagcctataaaattgctgaactggcaggcttctctgtaccagaaaacaccaagattc tgatcggtgaagtgaccgttgttgatgaaagcgaaccgttcgcacatgaaaaactgtccccgactctggcaatgtacc gcgctaaagatttcgaagacgcggtagaaaaagcagagaaactggttgctatgggcggtatcggtcatacctcttgcc tgtacactgaccaggataaccaaccggctcgcgtttcttacttcggtcagaaaatgaaaacggcgcgtatcctgattaa caccccagcgtctcagggtggtatcggtgacctgtataacttcaaactcgcaccttccctgactctgggttgtggttcttg gggtggtaactccatctctgaaaacgttggtccgaaacacctgatcaacaagaaaaccgttgctaagcgagctgaaaa catgttgtggcacaaacttccgaaatctatctacttccgccgtggctccctgccaatcgcgctggatgaagtgattactg atggccacaaacgtgcgctcatcgtgactgaccgcttcctgttcaacaatggttatgctgatcagatcacttccgtactg aaagcagcaggcgttgaaactgaagtcttcttcgaagtagaagcggacccgaccctgagcatcgttcgtaaaggtgc agaactggcaaactccttcaaaccagacgtgattatcgcgctgggtggtggttccccgatggacgccgcgaagatcat gtgggttatgtacgaacatccggaaactcacttcgaagagctggcgctgcgctttatggatatccgtaaacgtatctaca agttcccgaaaatgggcgtgaaagcgaaaatgatcgctgtcaccaccacttctggtacaggttctgaagtcactccgtt tgcggttgtaactgacgacgctactggtcagaaatatccgctggcagactatgcgctgactccggatatggcgattgtc gacgccaacctggttatggacatgccgaagtccctgtgtgctttcggtggtctggacgcagtaactcacgccatggaa gcttatgtttctgtactggcatctgagttctctgatggtcaggctctgcaggcactgaaactgctgaaagaatatctgcca gcgtcctaccacgaagggtctaaaaatccggtagcgcgtgaacgtgttcacagtgcagcgactatcgcgggtatcgc gtttgcgaacgccttcctgggtgtatgtcactcaatggcgcacaaactgggttcccagttccatattccgcacggtctgg caaacgccctgctgatttgtaacgttattcgctacaatgcgaacgacaacccgaccaagcagactgcattcagccagt atgaccgtccgcaggctcgccgtcgttatgctgaaattgccgaccacttgggtctgagcgcaccgggcgaccgtact gctgctaagatcgagaaactgctggcatggctggaaacgctgaaagctgaactgggtattccgaaatctatccgtgaa gctggcgttcaggaagcagacttcctggcgaacgtggataaactgtctgaagatgcattcgatgaccagtgcaccgg cgctaacccgcgttacccgctgatctccgagctgaaacagattctgctggatacctactacggtcgtgattatgtagaa ggtgaaactgcagcgaagaaagaagctgctccggctaaagctgagaaaaaagcgaaaaaatccgcttaa Table 16. Amino Acid Sequences of Product of Gene Expression
Figure imgf000096_0001
Figure imgf000097_0001
Figure imgf000098_0001
Figure imgf000099_0001
Table 17. Optimized Variants of Genes
Gene Optimized Variants of Genes pdc SEQ ID NO:3
ATGAGCTACACCGTTGGTACTTATCTGGCCGAGCGCTTGGTTCAGATCG
GTCTGAAACACCACTTCGCGGTTGCGGGCGACTATAACCTGGTCCTGCT
GGATAATCTGTTGTTGAATAAGAATATGGAGCAGGTCTATTGCTGTAAC
GAACTGAATTGTGGTTTTAGCGCCGAAGGTTATGCCCGTGCGAAAGGTG
CCGCAGCGGCCGTCGTGACGTACAGCGTGGGTGCGCTGTCGGCCTTTGA
TGCCATTGGTGGTGCCTATGCAGAGAACCTGCCGGTTATTCTGATCAGC
GGTGCTCCGAATAACAACGATCACGCCGCAGGCCATGTTCTGCATCACG
CACTGGGTAAGACCGATTATCATTACCAGCTGGAAATGGCGAAAAACA
TTACCGCGGCAGCGGAGGCCATCTACACGCCGGAAGAGGCTCCGGCGA
AGATTGACCACGTGATCAAGACCGCGCTGCGTGAGAAGAAACCGGTGT
ACCTGGAGATCGCTTGCAATATCGCCAGCATGCCGTGCGCTGCCCCTGG
TCCGGCGAGCGCGCTGTTTAACGATGAAGCGTCTGACGAGGCGTCCCTG
AATGCAGCGGTTGAAGAGACTCTGAAGTTCATTGCAAATCGTGACAAG
GTGGCTGTGCTGGTGGGTAGCAAACTGCGTGCAGCGGGTGCAGAAGAG
GCAGCGGTTAAGTTTGCAGACGCCCTGGGCGGTGCCGTGGCCACCATG
GCAGCGGCTAAGAGCTTCTTCCCTGAAGAAAATCCGCATTACATCGGCA
CGAGCTGGGGCGAGGTCAGCTATCCGGGTGTCGAGAAAACCATGAAAG
AGGCGGACGCCGTGATTGCGCTGGCCCCAGTCTTTAACGACTACTCTAC
CACCGGTTGGACGGATATTCCTGACCCGAAGAAGCTGGTCTTGGCAGA
GCCGCGTTCCGTTGTGGTTAACGGTGTGCGTTTCCCGAGCGTCCACCTG
AAGGACTACCTGACCCGTCTGGCGCAAAAAGTGAGCAAAAAGACTGGT
GCTTTGGACTTTTTCAAGTCCCTGAACGCCGGTGAGCTGAAAAAGGCAG
CGCCAGCAGATCCGAGCGCACCGCTGGTTAACGCGGAGATTGCTCGCC
AAGTTGAAGCGTTGCTGACCCCGAACACGACGGTTATTGCAGAAACCG
GCGATTCGTGGTTCAATGCGCAACGCATGAAGCTGCCGAACGGTGCGC
GCGTTGAATATGAGATGCAGTGGGGCCATATTGGTTGGTCTGTTCCGGC
AGCGTTTGGTTACGCGGTGGGCGCACCGGAGCGTCGTAACATTCTGATG
GTCGGTGATGGTAGCTTTCAGCTGACCGCGCAAGAGGTGGCTCAGATG
GTCCGTCTGAAACTGCCAGTGATTATCTTCCTGATCAACAACTATGGCT
ACACGATTGAGGTGATGATCCACGACGGTCCGTACAATAACATCAAGA
ATTGGGACTATGCGGGTTTGATGGAAGTGTTCAATGGCAATGGCGGCTA
TGACTCCGGCGCTGGCAAGGGTCTGAAAGCGAAAACCGGTGGCGAACT
GGCGGAAGCAATCAAAGTCGCGCTGGCGAATACGGATGGCCCGACCCT
GATCGAATGCTTCATTGGCCGCGAGGACTGTACGGAAGAGCTGGTTAA
GTGGGGCAAACGTGTCGCAGCGGCAAATAGCCGCAAACCGGTTAACAA
ACTGCTGTAA pdc SEQ ID NO:6
ATGTATACGGTGGGCATGTATCTGGCGGAACGTCTGGCGCAAATCGGC
CTGAAACATCACTTCGCGGTCGCGGGTGATTACAATCTGGTTCTGCTGG
ACCAGCTGCTGCTGAACAAAGACATGGAACAGGTCTATTGTTGCAATG
AGCTGAATTGCGGTTTCAGCGCGGAGGGTTACGCGCGTGCCCGTGGTGC
AGCCGCTGCTATCGTTACTTTTTCTGTTGGTGCAATCAGCGCTATGAATG
CGATCGGTGGCGCGTATGCGGAAAATCTGCCGGTTATTCTGATTTCGGG
CTCCCCGAACACCAACGATTATGGCACGGGTCATATCCTGCACCATACG
Figure imgf000101_0001
Figure imgf000102_0001
Figure imgf000103_0001
Gene Optimized Variants of Genes
ATACAGCTCTGGCCATCCGGCGATCGGCGTCGGTGCCGGTAACACCCCG
GTGCTGATCGACGCCACGGCAGATATTCCTACCGCGGTTTCCAGCATTC
TGCTGTCCAAGGCTTTCGACAACGGTATGATCTGTGCGAGCGAACAAGC
GGTCATTGTTGTGGATGAGATTTACGACGCGCTGAAAGCGGAGTTTCAG
CGTCGTGGCGCATATCTGCTGAGCCCGGAAGAGCGCCAGCAGGTTGCC
CAACTGCTGCTGAAGGATGGCCGCTTGAACGCGGCGATTGTTGGTCAGT
CCGCAGCGACCATTGCCGCGATGGCGAATATCCAGGTGCCGCCAGAAA
CCCGTGTGCTGATTGGTGAGGTTTCTGAGGTCGGTCCGCAGGAACCGTT
TTCCTATGAGAAGCTGTGTCCGGTCCTGGCGCTGTACCGCGCACCGCAG
TTCCACAAGGGCGTCGAAATTGCGGCCCAACTGGTGAATTTCGGTGGTA
AAGGTCACACGAGCGTGTTGTATACCGACCCTCGCAATCAGGACGATA
TTGCGTACTTTAAGTACCGTATGCAAACCGCCCGTGTTCTGATCAATAC
CCCGAGCAGCCAGGGCGCGATCGGTGACCTGTACAACTTCAAGTTGGA
CCCGAGCTTGACCCTGGGTTGTGGTACCTGGGGTGGTAACGTGACCTCG
GAGAACGTTGGCCCACGCCATCTGCTGAATATCAAAACTGTCTCTGATC
GCCGTGAGAATATGCTGTGGTTCCGCGTCCCGCCGAAGATCTATTTCAA
ACCGGGTTGCCTGCCGATCGCGTTGCGCGAACTGGCGGGCAAGAAGCG
TGCATTTCTGGTTACCGACAAACCGCTGTTCGATCTGGGTATTACCGAA
CCGATTGTCCACACTCTGGAAGAACTGGGTATCAAGTATGACATTTTCC
ACGAAGTTGAACCGGACCCGACGCTGAGCACCGTGAATCGCGGTTTGG
GTCTGCTGCGCCAGTATCAACCGGACGTCATCGTGGCAGTCGGCGGTGG
TAGCCCGATGGATGCGGCTAAAGTTATGTGGCTGTTGTATGAGCACCCG
GAGGTGGAATTTGACGGTCTGGCCATGCGTTTCATGGACATTCGTAAAC
GTGTTTACCAACTGCCGCCGTTGGGTCAAAAAGCCATCTTGGTGGCAAT
TCCGACCACGAGCGGCACCGGCAGCGAGGTGACCCCGTTTGCTGTCGTT
ACCGACGATCGTGTTGGTATCAAGTATCCGCTGGCGGATTATGCGCTGA
CGCCGACGATGGCTATCGTGGACCCGGATCTGGTCCTGCACATGCCAAA
GAAACTGACCGCCTACGGCGGTATTGACGCCCTGACCCACGCCCTGGA
GGCGTATGTGTCCGTGCTGAGCACGGAGTTCACCGAAGGTCTGGCACTG
GAGGCGATCAAACTGCTGTTCACCTATCTGCCGCGTGCGTACCGTCTGG
GTGCGGCGGACCCGGAAGCGCGCGAAAAAGTTCATTATGCAGCAACGA
TTGCAGGTATGGCGTTCGCAAATGCTTTCCTGGGTGTTTGCCATAGCTT
GGCCCACAAGCTGGGCAGCACCTTTCACGTGCCGCACGGTTTGGCGAA
CGCCTTGATGATCAGCCATGTGATTCGTTACAATGCGACCGATGCACCG
CTGAAACAAGCGATCTTTCCGCAATACAAGTACCCGCAAGCAAAAGAG
CGTTACGCACAAATTGCGGATTTCCTGGAATTGGGTGGTACTACCCCGG
AAGAAAAAGTCGAACGCCTGATTGCTGCCATCGAGGACTTGAAAGCGC
AGCTGGAGATTCCGGCGACGATCAAAGAAGCGCTGAATAGCGAAGATC
AGGCCTTCTATGAGCAGGTCGAGAGCATGGCCGAATTGGCCTTTGATGA
CCAGTGCACGGGTGCAAATCCACGTTACCCGCTGATTCAGGATCTGAAA
GAGTTGTACATCCTGGCCTATATGGGCTGCCGTCGTGATGCAGCTGCGT
ACTATGGCGGTGAAGCGACCGGCAGCTAA adhE SEQ ID NO:21
ATGGCAGTGACTAATGTGGCGGAGCTGAACGCTCTGGTGGAACGTGTG
AAGAAGGCGCAGCGTGAGTACGCCAGCTTCACGCAAGAACAAGTGGAC
AAGATCTTTCGTGCTGCCGCCCTGGCGGCAGCGGACGCACGTATCCCGT
TGGCGAAGATGGCGGTCGCCGAGTCCGGTATGGGCATTGTTGAAGATA Gene Optimized Variants of Genes
AAGTTATCAAAAACCATTTTGCCAGCGAGTACATCTACAATGCGTACAA
AGACGAGAAAACTTGCGGTGTTCTGAGCGAGGACGATACGTTTGGTAC
CATTACGATTGCAGAGCCGATTGGCATCATCTGCGGTATCGTTCCTACC
ACCAACCCGACCAGCACCGCGATCTTTAAGAGCCTGATCTCCCTGAAAA
CGCGTAACGCAATCATCTTTAGCCCGCACCCACGTGCAAAAGATGCGA
CCAACAAAGCAGCGGACATCGTCTTGCAGGCGGCCATCGCAGCAGGTG
CCCCGAAGGATTTGATCGGTTGGATCGACCAGCCGTCGGTTGAGCTGAG
CAATGCGCTGATGCACCATCCAGACATTAACCTGATTCTGGCCACCGGC
GGTCCGGGCATGGTGAAGGCGGCATATAGCAGCGGCAAACCGGCGATC
GGTGTGGGTGCCGGCAACACGCCGGTCGTCATTGACGAAACGGCCGAC
ATTAAGCGTGCAGTCGCCTCTGTGTTGATGTCTAAAACCTTCGACAACG
GCGTTATCTGTGCGTCTGAGCAGAGCGTTGTCGTGGTTGATAGCGTTTA
TGACGCAGTCCGCGAGCGTTTCGCTACCCACGGTGGTTACCTGCTGCAA
GGTAAAGAACTGAAGGCAGTGCAGGACGTGATCCTGAAGAATGGTGCT
TTGAATGCTGCGATTGTCGGCCAGCCGGCGTACAAAATCGCAGAGTTG
GCAGGTTTTAGCGTCCCGGAGAACACCAAGATTCTGATCGGCGAGGTG
ACCGTTGTGGATGAGTCTGAACCGTTTGCGCACGAAAAGCTGTCGCCGA
CGCTGGCGATGTATCGCGCAAAGGACTTTGAAGATGCGGTCGAAAAGG
CGGAAAAGTTGGTTGCGATGGGTGGCATTGGCCACACCAGCTGCCTGT
ACACCGATCAGGACAATCAGCCGGCACGTGTTAGCTATTTCGGTCAGA
AAATGAAAACCGCGCGTATCCTGATTAACACCCCAGCGAGCCAAGGCG
GTATTGGTGACCTGTATAACTTTAAGCTGGCACCTTCGCTGACTTTGGG
TTGCGGCAGCTGGGGTGGCAACAGCATTAGCGAGAATGTGGGTCCGAA
ACACCTGATCAACAAAAAGACCGTGGCGAAGCGCGCTGAGAACATGCT
GTGGCATAAGCTGCCGAAGTCCATCTACTTTCGCCGTGGCAGCCTGCCG
ATCGCCCTGGACGAAGTGATTACCGATGGTCACAAGCGCGCTCTGATTG
TGACGGACCGCTTTCTGTTTAACAATGGTTACGCGGATCAGATTACCAG
CGTGCTGAAAGCAGCCGGTGTTGAAACCGAGGTGTTTTTCGAAGTGGA
AGCCGATCCAACGCTGTCCATCGTCCGTAAAGGTGCTGAGCTGGCCAAT
AGCTTCAAACCGGATGTCATCATTGCACTGGGTGGCGGTAGCCCAATGG
ATGCGGCGAAGATTATGTGGGTCATGTACGAGCATCCGGAAACCCATTT
TGAAGAATTGGCGTTGCGCTTTATGGATATTCGTAAACGCATTTACAAG
TTCCCGAAGATGGGTGTCAAGGCCAAAATGATTGCCGTTACCACGACC
AGCGGTACGGGCAGCGAAGTCACGCCGTTCGCGGTTGTGACTGACGAT
GCGACGGGCCAAAAGTATCCTCTGGCCGATTACGCGCTGACCCCGGAT
ATGGCGATTGTTGACGCGAATCTGGTCATGGATATGCCGAAGAGCCTGT
GCGCGTTCGGTGGTCTGGATGCTGTTACGCACGCGATGGAGGCGTACGT
TTCCGTGCTGGCGAGCGAGTTCTCCGATGGCCAAGCTTTGCAAGCGCTG
AAACTGCTGAAAGAATACCTGCCTGCGAGCTACCATGAGGGCAGCAAG
AACCCGGTTGCGCGCGAGCGCGTTCACAGCGCGGCTACGATTGCGGGC
ATCGCTTTCGCCAATGCGTTCCTGGGTGTCTGTCACAGCATGGCGCATA
AACTGGGTAGCCAGTTCCACATTCCGCATGGTCTGGCGAATGCGCTGCT
GATCTGTAATGTCATTCGCTATAACGCGAACGACAATCCTACCAAACAA
ACCGCATTCAGCCAGTATGACCGTCCGCAAGCACGTCGCCGCTATGCAG
AGATTGCTGACCACCTGGGCCTGAGCGCACCGGGTGACCGTACTGCTGC
AAAGATTGAGAAACTGTTGGCCTGGCTGGAAACCCTGAAGGCGGAGTT
GGGTATTCCGAAAAGCATCCGTGAGGCAGGCGTTCAGGAAGCGGATTT
CCTGGCCAATGTCGATAAGCTGAGCGAAGATGCATTTGATGACCAATGT Gene Optimized Variants of Genes
ACCGGTGCCAATCCGCGTTATCCGCTGATCTCCGAGCTGAAACAGATTC TGCTGGACACTTACTATGGCCGTGATTATGTCGAGGGCGAAACGGCTGC GAAGAAAGAGGCAGCACCGGCCAAAGCGGAGAAAAAGGCTAAGAAAT CTGCGTAA

Claims

CLAIMSWhat is claimed is:
1. A method for producing ethanol comprising:
a) genetically engineering an isolated or recombinant nucleotide sequence encoding a polypeptide sequence selected from the group consisting of SEQ ID NO: 17, SEQ ID NO:20, SEQ ID NO:42 and SEQ ID NO:43 into a host cell;
b)culturing the host cell to produce ethanol; and
c) removing the ethanol.
2. The method of claim 1 wherein the host cell is a phototroph.
3. The method of claim 2 wherein the host cell is a cyanobacterium.
4. A method for producing ethanol comprising:
a) genetically engineering an isolated or recombinant nucleotide sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:29, and SEQ ID NO:33 into a host cell;
b)culturing the host cell to produce ethanol; and
c) removing the ethanol.
5. The method of claim 4 wherein the host cell is a phototroph.
6. The method of claim 5 wherein the host cell is a cyanobacterium.
7. An isolated or recombinant polynucleotide comprising or consisting of a nucleic acid sequence selected from the group consisting of:
a) any one of the sequences from Table 17; b)a nucleic acid sequence that is a degenerate variant of any one of the sequences in Table 17;
c) a nucleic acid sequence at least 95%, at least 98%, at least 99% or at least 99.9% identical to any one of the sequences in Table 17; and
d)a nucleic acid sequence that hybridizes under stringent conditions to any one of the sequences in Table 17.
8. The isolated or recombinant polynucleotide of claim 7, wherein the nucleic acid sequence encodes a polypeptide having the activity of any one of the polypeptide sequences in Table 16.
9. The isolated polynucleotide or recombinant of claim 7 or 8, wherein the nucleic acid sequence and the sequence of interest are operably linked to one or more expression control sequences.
10. A vector comprising the isolated or recombinant polynucleotide of claim 7 or 8.
11. A vector comprising the isolated or recombinant polynucleotide of claim 8, wherein said vector expresses said polypeptide.
12. A fusion protein comprising any one of the polypeptide sequences in Table 16 fused to a heterologous amino acid sequence.
13. A host cell comprising the isolated or recombinant polynucleotide of claim 7 or 8.
14. The host cell of claim 13, wherein the host cell is selected from the group consisting of prokaryotes, eukaryotes, yeasts, filamentous fungi, protozoa, algae and synthetic cells.
15. The host cell of claims 13 or 14 wherein the host cell produces carbon-based products of interest.
16. The host cell of claim 13 wherein the host cell is a phototroph.
17. The host cell of claim 13 wherein the host cell is a cyanobacterium.
18. The host cell of either of claim 16 or 17 wherein the isolated polynucleotide comprises one of the group consisting of SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:12, SEQ ID N0:15, SEQ ID N0:16, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:29, and SEQ ID NO:33.
19. The isolated or recombinant polynucleotide of claim 7, wherein the nucleotide codon encoding amino acid position 574 of SEQ ID NO: 17 is selected from the group consisting of cysteine, glutamine, isoleucine, methionine, phenylalanine, pro line, threonine, tryptophan, tyrosine and valine.
20. The isolated or recombinant polynucleotide of claim 7, wherein the nucleotide codon encoding amino acid position 568 of SEQ ID NO:20 is selected from the group consisting of cysteine, glutamine, isoleucine, methionine, phenylalanine, pro line, threonine, tryptophan, tyrosine and valine.
21. An isolated antibody or antigen-binding fragment or derivative thereof which binds selectively to the isolated polypeptide of claim 8.
22. A method for improving pyruvate decarboxylase activity comprising:
a) modifying a pyruvate decarboxylase gene employing rational design, error prone PCR, site-directed mutagenesis, whole gene site saturation mutagenesis, site- directed site saturation mutagenesis, gene shuffling or correlated site saturation mutagenesis;
b) expressing the pyruvate decarboxylase gene in a host cell; and
c) screening the host cell for pyruvate decarboxylase activity.
23. The method of claim 22 wherein screening for pyruvate decarboxylase activity comprises any one of the group consisting of growing host cells with pararosaniline, isolating the pyruvate decarboxylase enzyme from the host cell and analyzing enzyme biophysical characteristics, batch culturing the host cell expressing the pyruvate decarboxylase, and culturing the host cell in a turbidostat.
24. An improved pyuvate decarboxylase enzyme of any one of claims 22-23.
25. The improved enzyme of claim 24 wherein improved activities comprises substrate affinity, substrate catalytic conversion rate, improved thermostability, activity at a different pH or optimized codon usage for improved expression in a host cell.
26. The method of claim 22 wherein the pdc gene comprises SEQ ID NO: 3 or SEQ ID NO:6.
27. The method of claim 22 wherein the pdc gene is selected from Gluconacetobacter diazotrophicus, Beijerinckia indica, Gluconobacter oxydans, Acetobacter pasteurianus, Zymomonas mobilis, Zymobacter palmae, Schizosaccharomyces pombe, Podospora anserine, Aspergillus fumigatus, Neurospora crassa, Gibberella zeae, Planctomyces maris, Oryza sativa, Oryza punctata, Zea mays, Arabidopsis thaliana, Petunia x hybrid, Lotus corniculatus, Physcomitrella patens subsp. patens, Lycoris aurea, Dianthus caryophyllus, Citrus sinensis, Fragaria x ananassa, Vitis vinifera, Pisum sativum, Lotus japonicas, Prunus armeniaca, Nicotiana tabacum, Solanum tuberosum, Legionella pneumophila, Aspergillus clavatus, Aspergillus terreus, Aspergillus niger, Clostridium acetobutylicum, Nostoc punctiforme, Geobacter lovleyi, Cyanothece sp. PCC 8801, Microcystis aeruginosa, Lactococcus lactis, Chlamydomonas reinhardtii, Triticum aestivum, Bacillus cereus, Bacillus anthracis, Bacillus thuringiensis, Lyngbya spp. PC8106, Saccharum officianarium, Coix lacryma-jobi and Echinochloa crus-galli.
28. The method of claim 22 wherein the pdc gene is from Oryza glaberrima.
29. The method of claim 22wherein the pdc gene is from Aspergillus nidulans.
30. A method for improving alcohol dehydrogenase activity comprising:
a) modifying a gene for alcohol dehydrogenase by employing rational design, error prone PCR, site-directed mutagenesis, whole gene site saturation mutagenesis, site- directed site saturation mutagenesis, gene shuffling or correlated site saturation mutagenesis;
b) expressing the alcohol dehydrogenase gene in a host cell; and
c) screening the host cell for alcohol dehydrogenase activity.
31. The method of claim 30 wherein screening for alcohol dehydrogenase activity comprises any one of the group consisting of growing host cells with pararosaniline, isolating the alcohol dehydrogenase enzyme from the host cell and analyzing enzyme biophysical characteristics, batch culturing the host cell expressing the alcohol dehydrogenase, and culturing the host cell in a turbidostat.
32. An improved alcohol dehydrogenase enzyme of any one of claims 30-31.
33. The improved enzyme of claim 32 wherein improved activities comprises substrate affinity, substrate catalytic conversion rate, improved thermostability, activity at a different pH or optimized codon usage for improved expression in a host cell.
34. The method of claim 30 wherein the gene for an alcohol dehydrogenase comprises SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:15, or SEQ ID NO:23.
35. The method of claim 21 wherein the gene for an alcohol degrogenase is adhl or adh2.
36. The method of claim 30 wherein the gene for an alcohol dehydrogenase adhl and is selected from the group consisting of Shigella dysenteriae 1012 (accession number ZP_03064170), Escherichia coli spp. (accession number YP_002292842) Enterobacter cancerogenus ATCC 35316 (accession number ZP_03282582), Salmonella enterica spp. (accession number YP_001587957) Serratia proteamaculans 568 (accession number YP_001478632), Klebsiella pneumoniae subsp. pneumonia (accession number YP_001335514), Shigella flexneri 2a str. 301 (accession number NP_707612), Pseudomonas putida spp (accession number YP 001267259), Erwinia tasmaniensis Etl/99 (accession number YP OO 1908360), Bacillus amyloliquefaciens FZB42 (accession number YP 001421338), Bacillus coagulans 36Dl (accession number ZP 01695986), Neisseria meningitidis spp (accession number YP_974586), Staphylococcus aureus subsp. aureus MW2 (accession number NP _645385), Actinobacillus pleuropneumoniae serovar (accession number ZP OO 134308), Bacillus cereus subsp. cytotoxis spp (accession number YP OO 1374103), Bacillus thuringiensis (accession number YP_036379), Bacillus weihenstephanensis (accession number YP OO 1644942), Bacillus anthracis str. Ames (accession number NP_844655), Exiguobacterium sp. ATIb (accession number ZP 02989690), Streptococcus pneumoniae spp (accession number ZP 01817011), Streptococcus sanguinis SK36 (accession number YP 001035842), Streptococcus gordonii (accession number YP_001449881), Neisseria gonorrhoeae spp. (accession number YP_208496), Lactobacillus brevis spp (accession number YP_794451), Staphylococcus epidermidis spp (accession number YP_187853), Streptococcus suis spp (accession number YP OOl 197647), Streptococcus pyogenes spp (accession number NP_606374), Enterococcus faecalis V583 (accession number NP_815523), Lactococcus lactis spp (accession number NP_267964), Streptococcus equi subsp. zooepidemicus (accession number YP_002122442), Streptococcus agalactiae spp (accession number NP 687090) and Lactobacillus reuteri spp (accession number ZP 03072955).
I l l
37. The method of claim 30 wherein the alcohol dehydrogenase gene is an adh2 gene and is selected from the group consisting of Phytomonas sp. ADU-2003 (accession number AAP39869), Xanthobacter autotrophicus (accession number YP_001415578), Methylibium petroleiphilum (YP_001021255), Alkalilimnicola ehrlichei (YP_742969) and Sinorhizobium meliloti (NP_435872).
38. The method of claim 30 wherein the alcohol dehydrogenase gene is an adhl gene and is selected from the group consisting of Entamoeba dispar SAW760 (accession number XM OO 1741780), Arcobacter butzleri RM4018 (accession number CP000361), Clostridium beijerinckii strain NRRL B593 (accession number AF 157307), Entamoeba dispar SAW760 (accession number XM_001733263), Trichomonas vaginalis spp. (accession number XM 001314150), Methanocorpusculum labreanum Z (accession number CP000559), Malassezia globosa CBS 7966 spp (accession number
XM OO 1729044), Lactobacillus fermentum IFO 3956 (accession number AP008937), Brachyspira hyodysenteriae strain WAl (accession number EF488203), Brachyspira pilosicoli strain 95/1000 (accession number EF488210), Thermoanaerobacter pseudethanolicus ATCC 33223 (accession number CP000924), Thermoanaerobacter brockii (accession number X64841), Thermoanaerobacter ethanolicus (accession number U49975), Arcobacter butzleri RM4018 (accession number CP000361), Thermoanaerobacter sp. X514 (accession number CP000923), Methanosarcina barkeri str. Fusaro (accession number CP000099), Thermoanaerobacter ethanolicus (accession number DQ323135), Thermoanaerobacter tengcongensis MB4 (accession number AEO 13038), Methanosarcina acetivorans str. C2A (accession number AEO 10299) and Mycoplasma pneumoniae M129 (accession number U00089).
39. The method of claim 30 wherein the alcohol dehydrogenase gene is an adhl gene and is selected from the group consisting of Methanocorpusculum labreanum Z (accession number YP OO 1030202.1), Arcobacter δwfe/eπ_RM4018 (accession number YP OO 1489971.1), Thermo anaerobacter ethanolicus X514 (accession number ZP_01454904.1) and Thermoanaerobacter ethanolicus ATCC 33223 (accession number ZP 00779753.1).
40. The method of claim 30 wherein the alcohol dehydrogenase gene is an adh2 gene and is selected from the group consisting of Azotobacter vinelandii, Proteus mirabilis, Rhodoferax ferrireducens, Pseudomonas fluorescens, Rhodospirillum rubrum, Pseudomonas syringae, Shewanella putrefaciens, Salmonella enteric, Psychromonas sp., Pseudomonas entomophila, Shewanella pealeana, Vibrio angustum, Vibrio sp. Ex25, Shewanella halifaxensis, Idiomarina loihiensis, Vibrionales bacterium, Vibrio campbellii, Vibrio splendidus, Shewanella woodyi, Vibrio sp. MED222, Vibrio alginolyticus, Photobacterium sp. SKA34, Shewanella baltica, Escherichia coli, Vibrio βscheri, Escherichia albertii, Shewanella benthica, Shewanella loihica, Vibrio vulnificus, Shewanella frigidimarina, Shewanella denitrificans, Shigella boydii, Photobacterium profundum, Vibrio par ahaemolyticus, Serratia proteamaculans, Citrobacter koseri, Enterobacter sp. 638, Vibrio par ahaemolyticus, Shigella flexneri, Shigella dysenteriae, Shewanella sp. MR-4, Shewanella sp. ANA-3, Enterobacter sakazakii, Vibrio harveyi, Azoarcus sp. EbNl, Shewanella oneidensis, Aliivibrio salmonicida, Rhodopseudomonas palustris, Shewanella sediminis, Aeromonas hydrophila, Pseudoalteromonas atlantica, Chromobacterium violaceum, Aeromonas salmonicida, Shewanella amazonensis, Caldicellulosiruptor saccharolyticus, Photorhabdus luminescens, Carboxydothermus hydrogenoformans, Moritella sp. PE36, Vibrio shilonii, Clostridium perfringens, Desulfitobacterium hafniense, Bacillus coagulans, Mannheimia succiniciproducens, Schizosaccharomyces pombe, Pelotomaculum thermopropionicum, Geobacter uraniireducens, Pelobacter propionicus, Desulfotomaculum reducens, Acinetobacter baumannii, Burkholderia thailandensis, Psychrobacter sp. PRwf-1, Pelobacter carbinolicus, Burkholderia pseudomallei, Burkholderia mallei, Saccharomyces cerevisiae, Geobacter metallireducens, Kluyveromyces lactis, Desulfotalea psychrophila, Gryllus bimaculatus, Thermotoga maritime, and Acetobacter pasteurianus.
41. The method of claim 30 wherein the alcohol dehydrogenase gene is an adh2 gene and is selected from the group consisting of Shewanella sp. MR-7, Thermatoga marina, Ralstonia eutropha, Desulfovibrio desulfuricans, Geobacter bemidjiensis, Actinobacillus succinogenes, Aliivibrio salmonicida and Caldicellulosiruptor saccharolyticus.
42. A method for improving alcohol dehydrogenase activity comprising:
a) modifying a gene for bi-functional alcohol dehydrogenase by employing rational design, error prone PCR, site-directed mutagenesis, whole gene site saturation mutagenesis, site-directed site saturation mutagenesis, gene shuffling or correlated site saturation mutagenesis;
b) expressing the bi-functional alcohol dehydrogenase gene in a host cell; and
c) screening the host cell for bi-functional alcohol dehydrogenase activity.
43. The method of claim 42 wherein screening for bi-functional alcohol dehydrogenase activity comprises any one of the group consisting of growing host cells with pararosaniline, isolating the bi-functional alcohol dehydrogenase enzyme from the host cell and analyzing enzyme biophysical characteristics, batch culturing the host cell expressing the bi-functional alcohol dehydrogenase, and culturing the host cell in a turbidostat.
44. An improved bi-functional alcohol dehydrogenase enzyme of any one of claims 42-43.
45. The improved enzyme of claim 44 wherein improved activities comprises substrate affinity, substrate specificity, substrate catalytic conversion rate, improved thermostability, activity at a different pH or optimized codon usage for improved expression in a host cell.
46. The method of claim 42 wherein the gene for a bi- functional alcohol dehydrogenase comprises SEQ ID NO: 18 or SEQ ID NO:21.
47. The method of claim 42 wherein the gene for a bi-functional alcohol dehydrogenase is selected from the group consisting of Synechococcus sp. JASSAb, Synechococcus sp. JA-2SB 'a, Acaryochloris marina MBICl 1017, Chromobacterium violaceum, Chlamydomonas reinhardtii spp., Aeromonas hydrophila, Aeromonas salmonicida, Microcystis aeruginosa spp., Shewanella loihica, Shewanella amazonensis, Enterobacter sakazakii, Citrobacter koseri, Sodalis glossinidius, Klebsiella pneumoniae spp., Rhodopseudomonas palustris spp., Shigella dysenteriae, Escherichia coli spp., Shigella flexneri spp., Shigella sonnei, Shigella boydii spp., Klebsiella oxytoca, Salmonella enterica spp., Salmonella typhimurium, Serratia proteamaculans, Erwinia tasmaniensis, Erwinia carotovora, Shewanella oneidensis, Enterobacter sp. 638, Shewanella spp., Photobacterium profundum, Photorhabdus luminescens, Vibrio cholerae spp., Yersinia enter ocolitica, Shewanella baltica spp., Yersinia pseudotuberculosis spp., Yersinia pestis spp., Vibrio parahaemolyticus, Elusimicrobium minutum, Shewanella putrefaciens, Shewanella pealeana, Mastigamoeba balamuthi and Shewanella frigidimarina.
48. The method of claim 42 wherein the gene for a bi-functional alcohol dehydrogenase is selected from the group consisting of Shigella dysenteriae, Shigella boydii spp., Shigella flexneri spp., Shigella sonnei, Citrobacter koseri, Klebsiella pneumoniae spp., Salmonella enterica spp., Salmonella typhimurium spp., Klebsiella oxytoca, Enterobacter sakazakii, Enterobactev spp., Serratia proteamaculans, Erwinia carotovora, Yersinia enter ocolitica, Sodalis glossinidius, Yersinia pseudotuberculosis spp., Yersinia pestis spp., Erwinia tasmaniensis, Aeromonas hydrophila, Aeromonas salmonicida, Photorhabdus luminescens, Xenorhabdus nematophila, Proteus mirabilis, Chromobacterium violaceum, Vibrio cholerae spp., Rhodopseudomonas palustris, Shewanella amazonensis, Rhodopseudomonas palustris, Shewanella oneidensis, Vibrio vulnificus spp., Shewanella spp., Shewanella loihica, Photobacterium profundum, Vibrio par ahaemolyticus, Shewanella baltica spp., Vibrio harveyi, Shewanella woodyi, Aliivibrio salmonicida, Shewanella piezotolerans, Shewanella halifaxensis, Shewanella sediminis, Shewanella frigidimarina, Shewanella pealeana, Psychromonas ingrahamii 37 and Salmonella typhi.
PCT/US2009/062884 2008-10-30 2009-10-30 Methods and compositions for producing carbon-based products of interest in micro-organisms WO2010062707A1 (en)

Applications Claiming Priority (12)

Application Number Priority Date Filing Date Title
US10986608P 2008-10-30 2008-10-30
US10987408P 2008-10-30 2008-10-30
US10987808P 2008-10-30 2008-10-30
US61/109,874 2008-10-30
US61/109,878 2008-10-30
US61/109,866 2008-10-30
US12109108P 2008-12-09 2008-12-09
US12108708P 2008-12-09 2008-12-09
US61/121,087 2008-12-09
US61/121,091 2008-12-09
US13951108P 2008-12-19 2008-12-19
US61/139,511 2008-12-19

Publications (1)

Publication Number Publication Date
WO2010062707A1 true WO2010062707A1 (en) 2010-06-03

Family

ID=42225989

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2009/062884 WO2010062707A1 (en) 2008-10-30 2009-10-30 Methods and compositions for producing carbon-based products of interest in micro-organisms

Country Status (1)

Country Link
WO (1) WO2010062707A1 (en)

Cited By (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102242065A (en) * 2011-06-22 2011-11-16 北京大学 Synechococcus engineering bacterium capable of improving yield of cellulose, and preparation method and application thereof
US8394614B2 (en) 2008-10-23 2013-03-12 Matrix Genetics, Llc Modified photosynthetic microorganisms for producing triglycerides
CN102978273A (en) * 2012-11-13 2013-03-20 中国科学院沈阳应用生态研究所 Method using three-bacterium mixed fermentation to convert sorbose into 2-keto-L-gulonic acid
US20140256011A1 (en) * 2012-11-09 2014-09-11 Mascoma Corporation Method for Acetate Consumption During Ethanolic Fermentaion of Cellulosic Feedstocks
US8835137B2 (en) 2008-12-23 2014-09-16 Matrix Genetics, Llc Modified photosynthetic microorganisms with reduced glycogen and their use in producing carbon-based products
US8980613B2 (en) 2010-04-06 2015-03-17 Matrix Genetics, Llc Modified photosynthetic microorganisms for producing lipids
CN105110489A (en) * 2015-10-10 2015-12-02 中国水产科学研究院淡水渔业研究中心 Water-purifying and weed-protecting biological agent for shrimp and crab culture in high-temperature period as well as preparation method and application of biological agent
CN105132348A (en) * 2015-07-31 2015-12-09 天津大学 Error-prone whole-genome shuffling method of zymomonas mobilis and furfural-tolerant zymomonas mobilis
CN106906189A (en) * 2017-02-21 2017-06-30 江苏省中国科学院植物研究所 A kind of p-Coumaric Acid -3- hydroxylases and its encoding gene and application
CN107896972A (en) * 2017-11-09 2018-04-13 四川农业大学 A kind of method by the perennial feeding Job's tears of distant hybridization selection and breeding
CN108192899A (en) * 2018-01-15 2018-06-22 清华大学 A kind of streptococcus zooepidemicus lactate dehydrogenase gene mutant and its application
CN108841746A (en) * 2018-06-25 2018-11-20 青岛农业大学 Cellulase-producing and bacillus thuringiensis and the application method for inhibiting Vibrio splindidus
CN109430292A (en) * 2018-09-21 2019-03-08 桂林润泰生物科技有限公司 A kind of Biocidal is taken root duplicate protection agent and its preparation and application method
CN110004192A (en) * 2018-10-17 2019-07-12 许传高 A kind of method of preparing granular type threonine
CN110452828A (en) * 2019-03-24 2019-11-15 广西大学 L. reuteri strain and its application
CN110904061A (en) * 2019-12-28 2020-03-24 南京朗恩生物科技有限公司 Alcohol dehydrogenase mutant with enhanced thermal stability and application thereof
CN112961868A (en) * 2013-12-31 2021-06-15 合成基因组股份有限公司 Biomass productivity regulator
CN113249281A (en) * 2020-02-07 2021-08-13 中国科学院青岛生物能源与过程研究所 Recombinant bacterium for producing phloroglucinol by using ethanol and construction method and application thereof
CN113308412A (en) * 2021-07-09 2021-08-27 清华大学 Bacillus cereus and potato stem and leaf degradation and in-situ decomposition and field returning process
US11166968B2 (en) 2015-09-29 2021-11-09 Kimberly-Clark Worldwide, Inc. Synergistic composition for maintenance of healthy balance of microflora
CN114410562A (en) * 2022-02-08 2022-04-29 安徽工程大学 Klebsiella engineered bacterium and application thereof in ethanol production
CN114477471A (en) * 2022-02-16 2022-05-13 杭州秀川科技有限公司 Method for treating emamectin benzoate amination wastewater by using composite flora
CN114507608A (en) * 2020-11-17 2022-05-17 中国科学院天津工业生物技术研究所 Recombinant filamentous fungus for producing ethanol in mitochondria and construction and application thereof
CN114908124A (en) * 2022-04-24 2022-08-16 浙江大学 Application of zinc-combined alcohol dehydrogenase gene in regulation of insect mating behavior
CN118064311A (en) * 2024-02-28 2024-05-24 中国水产科学研究院南海水产研究所 Sulfate type saline-alkali water pond microcystis water bloom algicidal bacterium BCTC1 and application thereof
US12029748B2 (en) 2017-02-28 2024-07-09 Kimberly-Clark Worldwide, Inc. Synergistic composition for maintenance of healthy balance of microflora

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010044940A1 (en) * 2000-01-27 2001-11-22 Jorn Gorlach Expressed sequences of arabidopsis thaliana
US20020042111A1 (en) * 1997-02-19 2002-04-11 Enol Energy Inc. Genetically modified Cyanobacteria for the production of ethanol, the constructs and method thereof
US20030087368A1 (en) * 2001-05-04 2003-05-08 University Of Florida Cloning and sequencing of pyruvate decarboxylase (PDC) genes from bacteria and uses therefor
US20030199035A1 (en) * 1997-12-17 2003-10-23 Jose Arnau Metabolically engineered lactic acid bacteria and means for providing same
US20050084921A1 (en) * 2001-11-09 2005-04-21 Cranley Paul E. Enzyme-based system and sensor for measuring acetone
US7060458B1 (en) * 1997-08-14 2006-06-13 Wyeth Nucleic acid and amino acid sequences relating to Staphylococcus epidermidis for diagnostics and therapeutics
US20070015237A1 (en) * 2005-03-18 2007-01-18 Richard Bailey Production of carotenoids in oleaginous yeast and fungi
US20070092957A1 (en) * 2005-10-26 2007-04-26 Donaldson Gail K Fermentive production of four carbon alcohols
US20070118916A1 (en) * 2005-10-14 2007-05-24 Metanomics Gmbh Process for the production of fine chemicals
WO2007094646A1 (en) * 2006-02-16 2007-08-23 Macrogen Inc. Method for mass production of primary metabolites, strain for mass production of primary metabolites, and method for preparation thereof
US20080009046A1 (en) * 2004-11-17 2008-01-10 Basf Aktiengesellschaft Method for the Production of Optically-Active Alcohols
US20080220487A1 (en) * 2006-07-28 2008-09-11 The Board Of Trustees Operating Michigan State University Molecular design of thermostable alcohol dehydrogenase for synthesis for chiral aromatic alcohols

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020042111A1 (en) * 1997-02-19 2002-04-11 Enol Energy Inc. Genetically modified Cyanobacteria for the production of ethanol, the constructs and method thereof
US7060458B1 (en) * 1997-08-14 2006-06-13 Wyeth Nucleic acid and amino acid sequences relating to Staphylococcus epidermidis for diagnostics and therapeutics
US20030199035A1 (en) * 1997-12-17 2003-10-23 Jose Arnau Metabolically engineered lactic acid bacteria and means for providing same
US20010044940A1 (en) * 2000-01-27 2001-11-22 Jorn Gorlach Expressed sequences of arabidopsis thaliana
US20030087368A1 (en) * 2001-05-04 2003-05-08 University Of Florida Cloning and sequencing of pyruvate decarboxylase (PDC) genes from bacteria and uses therefor
US20050084921A1 (en) * 2001-11-09 2005-04-21 Cranley Paul E. Enzyme-based system and sensor for measuring acetone
US20080009046A1 (en) * 2004-11-17 2008-01-10 Basf Aktiengesellschaft Method for the Production of Optically-Active Alcohols
US20070015237A1 (en) * 2005-03-18 2007-01-18 Richard Bailey Production of carotenoids in oleaginous yeast and fungi
US20070118916A1 (en) * 2005-10-14 2007-05-24 Metanomics Gmbh Process for the production of fine chemicals
US20070092957A1 (en) * 2005-10-26 2007-04-26 Donaldson Gail K Fermentive production of four carbon alcohols
WO2007094646A1 (en) * 2006-02-16 2007-08-23 Macrogen Inc. Method for mass production of primary metabolites, strain for mass production of primary metabolites, and method for preparation thereof
US20080220487A1 (en) * 2006-07-28 2008-09-11 The Board Of Trustees Operating Michigan State University Molecular design of thermostable alcohol dehydrogenase for synthesis for chiral aromatic alcohols

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
KUMAR ET AL.: "Cloning and expression of an NADP(+)-dependent alcohol dehydrogenase gene of Entamoeba histolytica'", PNAS, no. 21, 1992, USA, pages 10188 - 10192 *

Cited By (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8394614B2 (en) 2008-10-23 2013-03-12 Matrix Genetics, Llc Modified photosynthetic microorganisms for producing triglycerides
US8394621B2 (en) 2008-10-23 2013-03-12 Matrix Genetrics, LLC Modified photosynthetic microorganisms for producing triglycerides
US9029120B2 (en) 2008-10-23 2015-05-12 Matrix Genetics, Llc Modified photosynthetic microorganisms for producing triglycerides
US8835137B2 (en) 2008-12-23 2014-09-16 Matrix Genetics, Llc Modified photosynthetic microorganisms with reduced glycogen and their use in producing carbon-based products
US8980613B2 (en) 2010-04-06 2015-03-17 Matrix Genetics, Llc Modified photosynthetic microorganisms for producing lipids
CN102242065A (en) * 2011-06-22 2011-11-16 北京大学 Synechococcus engineering bacterium capable of improving yield of cellulose, and preparation method and application thereof
CN104903441A (en) * 2012-11-09 2015-09-09 拉勒曼德匈牙利流动管理有限责任公司 Method for acetate consumption during ethanolic fermentation of cellulosic feedstocks
US20140256011A1 (en) * 2012-11-09 2014-09-11 Mascoma Corporation Method for Acetate Consumption During Ethanolic Fermentaion of Cellulosic Feedstocks
CN102978273B (en) * 2012-11-13 2014-01-08 中国科学院沈阳应用生态研究所 Method using three-bacterium mixed fermentation to convert sorbose into 2-keto-L-gulonic acid
CN102978273A (en) * 2012-11-13 2013-03-20 中国科学院沈阳应用生态研究所 Method using three-bacterium mixed fermentation to convert sorbose into 2-keto-L-gulonic acid
CN112961868A (en) * 2013-12-31 2021-06-15 合成基因组股份有限公司 Biomass productivity regulator
CN105132348B (en) * 2015-07-31 2018-04-06 天津大学 The fallibility full-length genome Shuffling Method of zymomonas mobilis and tolerance furfural zymomonas mobilis
CN105132348A (en) * 2015-07-31 2015-12-09 天津大学 Error-prone whole-genome shuffling method of zymomonas mobilis and furfural-tolerant zymomonas mobilis
US11166968B2 (en) 2015-09-29 2021-11-09 Kimberly-Clark Worldwide, Inc. Synergistic composition for maintenance of healthy balance of microflora
CN105110489A (en) * 2015-10-10 2015-12-02 中国水产科学研究院淡水渔业研究中心 Water-purifying and weed-protecting biological agent for shrimp and crab culture in high-temperature period as well as preparation method and application of biological agent
CN106906189B (en) * 2017-02-21 2020-10-23 江苏省中国科学院植物研究所 P-coumaric acid-3-hydroxylase and coding gene and application thereof
CN106906189A (en) * 2017-02-21 2017-06-30 江苏省中国科学院植物研究所 A kind of p-Coumaric Acid -3- hydroxylases and its encoding gene and application
US12029748B2 (en) 2017-02-28 2024-07-09 Kimberly-Clark Worldwide, Inc. Synergistic composition for maintenance of healthy balance of microflora
CN107896972A (en) * 2017-11-09 2018-04-13 四川农业大学 A kind of method by the perennial feeding Job's tears of distant hybridization selection and breeding
CN108192899A (en) * 2018-01-15 2018-06-22 清华大学 A kind of streptococcus zooepidemicus lactate dehydrogenase gene mutant and its application
CN108841746B (en) * 2018-06-25 2020-07-03 青岛农业大学 Bacillus thuringiensis for producing cellulase and inhibiting vibrio splendidus and using method
CN108841746A (en) * 2018-06-25 2018-11-20 青岛农业大学 Cellulase-producing and bacillus thuringiensis and the application method for inhibiting Vibrio splindidus
CN109430292A (en) * 2018-09-21 2019-03-08 桂林润泰生物科技有限公司 A kind of Biocidal is taken root duplicate protection agent and its preparation and application method
CN110004192A (en) * 2018-10-17 2019-07-12 许传高 A kind of method of preparing granular type threonine
CN110452828A (en) * 2019-03-24 2019-11-15 广西大学 L. reuteri strain and its application
CN110904061A (en) * 2019-12-28 2020-03-24 南京朗恩生物科技有限公司 Alcohol dehydrogenase mutant with enhanced thermal stability and application thereof
CN110904061B (en) * 2019-12-28 2021-05-18 南京朗恩生物科技有限公司 Alcohol dehydrogenase mutant with enhanced thermal stability and application thereof
CN113249281A (en) * 2020-02-07 2021-08-13 中国科学院青岛生物能源与过程研究所 Recombinant bacterium for producing phloroglucinol by using ethanol and construction method and application thereof
CN113249281B (en) * 2020-02-07 2022-11-11 中国科学院青岛生物能源与过程研究所 Recombinant bacterium for producing phloroglucinol by using ethanol and construction method and application thereof
CN114507608A (en) * 2020-11-17 2022-05-17 中国科学院天津工业生物技术研究所 Recombinant filamentous fungus for producing ethanol in mitochondria and construction and application thereof
CN114507608B (en) * 2020-11-17 2023-08-22 中国科学院天津工业生物技术研究所 Recombinant filamentous fungus for producing ethanol in online granule body and construction and application thereof
CN113308412A (en) * 2021-07-09 2021-08-27 清华大学 Bacillus cereus and potato stem and leaf degradation and in-situ decomposition and field returning process
CN113308412B (en) * 2021-07-09 2022-03-11 清华大学 Bacillus cereus and potato stem and leaf degradation and in-situ decomposition and field returning process
CN114410562A (en) * 2022-02-08 2022-04-29 安徽工程大学 Klebsiella engineered bacterium and application thereof in ethanol production
CN114477471A (en) * 2022-02-16 2022-05-13 杭州秀川科技有限公司 Method for treating emamectin benzoate amination wastewater by using composite flora
CN114908124A (en) * 2022-04-24 2022-08-16 浙江大学 Application of zinc-combined alcohol dehydrogenase gene in regulation of insect mating behavior
CN114908124B (en) * 2022-04-24 2023-12-26 浙江大学 Application of zinc-combined alcohol dehydrogenase gene in regulation and control of insect mating behavior
CN118064311A (en) * 2024-02-28 2024-05-24 中国水产科学研究院南海水产研究所 Sulfate type saline-alkali water pond microcystis water bloom algicidal bacterium BCTC1 and application thereof

Similar Documents

Publication Publication Date Title
WO2010062707A1 (en) Methods and compositions for producing carbon-based products of interest in micro-organisms
WO2010036951A2 (en) Methods and compositions for producing carbon-based products of interest in micro-organisms
US9074225B2 (en) Biosynthesis of 1-alkenes in engineered microorganisms
US8399227B2 (en) Methods and compositions for the recombinant biosynthesis of fatty acids and esters
EP2584032B1 (en) Methods and compositions for the recombinant biosynthesis of n-alkanes
US7955820B1 (en) Methods and compositions for the recombinant biosynthesis of n-alkanes
US20110020867A1 (en) Constructs And Methods For Efficient Transformation Of Micro-Organisms For Production Of Carbon-Based Products Of Interest
US20150176033A1 (en) Reactive oxygen species-resistant microorganisms
US20120164705A1 (en) Metabolic Switch
US20140186877A1 (en) Compositions and methods for the biosynthesis of 1-alkenes in engineered microorganisms
US8580542B2 (en) Methods and compositions for producing alkenes of various chain length
WO2016181205A2 (en) Controlled production of carbon-based products of interest
US9029124B2 (en) Photoalkanogens with increased productivity
WO2011143592A1 (en) Methods and compositions for the recombinant biosynthesis of propanol
WO2015200335A1 (en) Engineered photosynthetic microbes and recombinant synthesis of carbon-based products

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09829655

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09829655

Country of ref document: EP

Kind code of ref document: A1