WO2010061215A1

WO2010061215A1 - Improvements in or relating to lipid content of plants

Info

Publication number: WO2010061215A1
Application number: PCT/GB2009/051589
Authority: WO
Inventors: Stuart Casson; Jennifer Topping; Keith Lindsey
Original assignee: University Of Durham
Priority date: 2008-11-26
Filing date: 2009-11-23
Publication date: 2010-06-03
Also published as: GB0821589D0

Abstract

Disclosed is a method of altering the lipid content of a plant or part thereof, the method comprising the steps of: introducing into a plant or plant cell an isolated polynucleotide, which polynucleotide encodes a polypeptide comprising at least 600 amino acid residues of the sequence shown in Figure 1b, or a polypeptide having at least 65% sequence identity with the sequence shown in Figure 1b; and, optionally, growing a plant or plantlet from the plant or plant cell or otherwise forming progeny therefrom, which plant, plantlet or progeny substantially retains the introduced polynucleotide.

Description

Improvements in or relating to lipid content of plants

Field of the Invention

This invention relates to the oil content of plants. More especially, the invention is concerned with isolated polynucleotides per se, and with their use in the production of transgenic plants having altered oil content, and with transgenic plants and their progeny containing said polynucleotides, and a method of altering the oil content of a plant or part thereof, and a method of obtaining oil from a transgenic plant or the progeny thereof.

Background to the Invention

The anticipated increase in the market demand for seed oils, in large part due to their use in bio fuels, is driving a massive investment in the development of transgenic oilseed crops. The market for oils is growing at 3% per annum and has reached a value of approximately $32 billion per annum. This market demand is anticipated to accelerate further as legislative pressures to use renewable resources, such as plant-derived lubricants and fuels, intensify. The European Union is supporting this initiative through a subsidy of €35 for each hectare devoted to growing crops for fuel. However, this has led to farmers devoting more land to growing crops for fuel, reducing food production and increasing food prices. Whilst the measure of encouraging farmers to grow these crops supports the move to use carbon neutral fuel, there is recognition that a significant increase in the oil content of rape seed or other plants is required to make biodiesel costs competitive with the cost of conventional diesel. Thus, there is a considerable unfilled need to achieve an increase in oil content of plants.

Oils are synthesised and stored in oil crops predominantly in the seed, and in the developing embryo of brassicaceae (such as Arabidopsis and oilseed rape). The programme of oil accumulation is therefore one aspect of embryonic identity which is under genetic control. Although a number of genes that encode enzymes in the storage oil biosynthetic pathway have been identified, less is known about the transcriptional control of the entire pathway, whereby the genes encoding the enzymes are presumed to be co-ordinately regulated. Two genes known to activate the oil biosynthetic pathway are LEAFY COTYLEDON 1 (LEC 1) and WRINKLED 1 (WRI 1). The LEAFY COTYLEDON class of genes (for example, LEC 1, LEC 2, FUSCA

3 and FUS 3) have been identified as key regulators of late embryogenesis (Parcy et al., 1997; Lotan et al, 1998; Luerβen et al., 1998; Stone et al., 2001). LEC 1 encodes a transcription factor subunit related to the HAP3 subunit of the CCAAT binding factor family (Lotan et al., 1998), whilst FUS 3 and LEC 2 encode B3 domain transcription factors (Luerβen et al., 1998; Stone et al, 2001). Loss-of-function mutations in each of these genes result in embryos that are dessication intolerant and defective in the production of storage products. WRINKLED 1 is an AP2/EREBP transcription factor required for the control of storage compound biosynthesis (Cernac and Benning, 2005). Furthermore, the PICKLE (PKL) gene of Arabidopsis, which encodes a CHD3 chromatin remodelling factor (Ogas et al, 1999), is required to prevent the expression of LEC and FUS genes in vegetative tissues. Loss-of- function mutations of PKL lead to the accumulation of storage oils in vegetative tissues of Arabidopsis (Ogas et al., 1997; Dean Rider et al., 2003). It is possible that other transcription factors are involved in the control of embryonic identity and oil biosynthesis, but these await discovery.

Summary of the Invention

The Arabidopsis Genome Initiative (AGI) is an international collaboration to sequence the genome of the model plant Arabidopsis thaliana. Gene sequences obtained from Arabidopsis thaliana are given a specific AGI code.

Through a programme of gene identification using the model species Arabidopsis thaliana, the present inventors have identified a previously uncharacterised gene, designated MERISTEM- DEFECTIVE (MDF). The gene (At5gl6780) was identified using the technique of laser-capture microdissection of developing Arabidopsis embryos to isolate cells, followed by RNA amplification and DNA microarray analysis to characterise RNA expression profiles during embryo development (Casson et al., 2005; Spencer et al., 2007).

According to a first aspect, the invention provides an isolated polynucleotide, which isolated polynucleotide encodes a polypeptide comprising at least 600 amino acid residues of the sequence shown in Figure Ib (SEQ. ID NO: 3), or a polypeptide comprising at least 600 amino acid residues and having at least 65% amino acid sequence identity with the sequence shown in Figure Ib. Preferably the isolated polynucleotide encodes a polypeptide comprising at least 700 amino acid residues of the sequence in Figure Ib, or a polypeptide comprising at least 700 residues having at least 65% identity with the sequence shown in Figure Ib. More preferably the isolated polynucleotide encodes a polypeptide comprising at least 750, and most preferably at least 800 amino acids of the sequence shown in Figure Ib or a polypeptide of this length having at least 65% identity with the sequence shown in Figure Ib.

Desirably the polypeptide encoded by the isolated polynucleotide has a portion at least 700 amino acids, more preferably a portion at least 750 amino acids, and most preferably a portion at least 800 amino acids, which exhibits at least 70% sequence identity with the sequence shown in Figure Ib, preferably at least 75% identity, more preferably at least 85% identity, and most preferably at least 95% identity.

In one embodiment, the isolated polynucleotide encodes a polypeptide comprising the entire amino acid sequence shown in Figure Ib. In a particular embodiment the isolated polynucleotide encodes a polypeptide consisting of the amino acid sequence shown in Figure Ib.

Those skilled in the art will appreciate that the amino acid sequence shown in Figure Ib can be varied to some extent without significantly disrupting or destroying the relevant biological properties of the polypeptide. In particular, the present inventors have found that the MDF polypeptide acts a transcription regulatory factor in plant cells. Portions of the polypeptide outside the domains critical for performance of their function can be altered without significant loss of activity. In particular, conservative amino acid substitutions can be made, especially in non "function critical" domains. For present purposes, conservative substitutions may be defined as those which substitute an amino acid in one chemical group for another in the same group.

For present purposes, the different chemical groups of amino acid residues may be defined as follows: a) Aliphatic side chains (glycine, alanine, valine, leucine, iso leucine) b) Aliphatic hydroxyl side chains (serine, threonine) c) Secondary amino group (proline) d) Aromatic side chains (phenylalanine, tyrosine, tryptophan) e) Basic side chains (lysine, arginine, histidine) f) Aci di c side chains (asp artate , glutamate) g) Amide side chains (asparagine, glutamine) h) Sulphur-containing side chains (cysteine, methionine)

In view of the foregoing, isolated polynucleotides which encode a polypeptide with as little as 65% identity with the sequence shown in Figure Ib may nevertheless encode polypeptides which possess a transcription regulatory activity qualitatively similar to the polypeptide of Figure Ib per se.

In addition, those skilled in the art will appreciate that the isolated polynucleotide may encode a polypeptide which comprises one or more additional domains. The additional domain/s may be within the sequence shown in Figure Ib or, more preferably may be at or near the C- and/or N- terminal of the sequence shown in Figure Ib. "Near" the C- or N-terminal means up to, and including, ten amino acid residues from either end. Alterations or additions at or near the C- and/or N-terminal end regions are less likely to interfere with the transcription regulatory activity of the polypeptide. The one or more additional domains may, for instance, modify the transcription regulatory activity, or may be completely unconnected therewith e.g. encode a 'his' tag or other sequence to assist purification of the polypeptide.

In preferred embodiments, the isolated polynucleotide comprises a cDNA sequence i.e. a sequence which lacks at least one of the introns present in the wild type genomic DNA sequence of At5gl6780. More typically the cDNA sequence will lack substantially all of the introns present in the genomic sequence of At5gl6780.

The person skilled in the art can readily ascertain which portions of the genomic sequence of At5gl6780 constitute introns, by comparing the genomic sequence with the cDNA sequence shown in Figure Ia (SEQ. ID NO: 1).

Preferably, the isolated polynucleotide may comprise from about 2500, 2600, 2700, 2800, 2900 or 3000 bases of the sequence shown in Figure Ia, or a molecule of equivalent size (i.e. 2500- 3000 bases), which hybridises under stringent hybridisation conditions with the complement of the sequence shown in Figure Ia. In a particular embodiment, the isolated polynucleotide comprises the nucleotide sequence shown in Figure Ia. In one embodiment the isolated polynucleotide consists of the nucleotide sequence shown in Figure Ia. In other embodiments the isolated polynucleotide may comprise the coding sequence shown in Figure 2 (SEQ. ID

NO: 2) or exhibit at least 65% sequence identity therewith, preferably at least 70%, more preferably at least 75% and most preferably at least 80% identity with the sequence shown in Figure 2 and/or will hybridise under stringent hybridisation conditions with the complement of the sequence shown in Figure 2.

For the purposes of the present specification, hybridisation under stringent hybridisation conditions means remaining hybridised after washing with 0. IxSSC, 0.5% SDS at a temperature of at least 6O⁰C, as described by Sambrook et al. (Molecular Cloning. A Laboratory Manual. Second Edition. Cold Spring Harbor Press).

In some embodiments, the isolated polynucleotide of the present invention is operab Iy- linked to the promoter sequence of the MDF gene (AGI code At5g 16780) or an effective portion thereof, such that when present in a non-embryonic plant cell, the expression of the MDF gene is increased and leads to an increase in MDF transcript abundance in e.g. seedlings and other post- embryonic stages of development. For present purposes, the MDF transcript is defined as a ribopolynucleotide, comprising at least 2000 ribonucleotides, preferably at least 3000 ribonucleotides, which ribopolynucleotide possesses at least 70% identity, more preferably at least 85% identity, and most preferably at least 95% identity with the RNA transcript produced in vitro using the wild type MDF gene defined by AGI code At5gl6780 and a suitable in vitro expression system such as the Ambion MEGAscript kit, which uses T7 RNA polymerase. The % sequence identity is determined using suitable computer sequence alignment software, as described below. Equally, the coding sequence portion of the isolated polynucleotide of the invention could be operably linked to any suitable (heterologous) promoter, which is active in the particular host cell in which it is desired to express the polynucleotide.

MDF encodes a predicted polypeptide of 820 amino acids (Figure Ib; SEQ. ID NO: 3). Putative orthologues of MDF have been found to exist in brassica, rice, medicago, vine and Physcomitrella. Searches using the sequence alignment programme BLAST (e.g. http://blast.ncbi.nlm.nih.gov), well known to those skilled in the art, reveal homology with the animal SART-I family of proteins, with 41% identity being found between MDF and human SART-I (hSART-1) in the 250 amino acid C-terminal domains, but only limited homology being found elsewhere. Studies have shown that hS ART-I is a SR (serine/arginine-rich) -related protein of the U4/U6.U5 tri-small nuclear ribonucleoprotein (tri-snRNP) complex of the spliceosome, and is required for correct spliceosome assembly (Markova et al., 2001).

As with hSART-1 , the N-terminus of MDF contains a putative RS domain characterised by a number of arginine residues alternating with serine, glutamate or aspartate dipeptides, indicating that MDF is a putative SR-related protein (Figure 1; Neugebauer et al., 1995; Blencowe et al, 1999). SR-related proteins are involved in a number of stages of the generation of mature RNAs, and have roles in chromatin remodelling, transcriptional control, constitutive and regulated splicing and 3'-end processing (Blencowe et al., 1999; Boucher et al., 2001). The MDF polypeptide is predicted to contain a C-terminal nuclear localisation motif and an N- terminal RNA binding domain. No other conserved domains were identified (Figure 1, Prosite, MWΛll^Η^L§∑P33y.iΦJw.9.3.lϊ§l,' RNAB ind R, Terribilini et al., 2007). Thus, it is likely that MDF is involved in transcriptional regulation.

Sequences similar or homologous (i.e. at least 70% sequence identity) to the sequences disclosed herein are also part of the invention. In some embodiments, the sequence identity at the amino acid level can be about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher. At the nucleic acid level, the sequence identity can be about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher. Alternatively, substantial identity exists when the nucleic acid segments will hybridize under selective hybridisation conditions (e.g. very high stringency hybridisation conditions), to the complement of the strand. The nucleic acids may be present in whole cells, in a cell lysate, or in a partially purified or substantially pure form.

Calculations of "homology" or "sequence identity" or "similarity" between two sequences (the terms are substantially interchangeable herein) are performed as follows. The sequences are aligned for optimal comparison purposes (e.g. gaps can be introduced in one or both of a first and second amino acid or nucleic acid sequence for optimal alignment). In a preferred embodiment, the length of a reference sequence aligned for comparison purposes is preferably at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at least 70%, 80%, 90%, or 100% of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid "homology" is equivalent to amino acid or nucleic acid "identity"). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.

The term "isolated" as used herein refers to a nucleic acid or polypeptide component which is substantially free from other components that normally interact with the polypeptide or nucleic acid as found in its natural environment or, if the polypeptide or nucleic acid is in its natural environment, the component has been altered by human intervention to form a novel composition and/or, in the case of a nucleic acid, has been placed at a locus in the cell other than the native locus.

The term "promoter" includes reference to a region of DNA upstream from the transcription start site of a gene and "promoter activity" refers to the recognition and binding of RNA polymerase and other proteins to initiate transcription. Methods for detecting or measuring promoter activity (especially in plants such as Arabidopsis) may involve detecting or measuring the level of expression of a reporter gene, such as, for example, GFP or GUS. The isolated polynucleotide of the present invention may, when introduced into a plant cell (typically an Arabidopsis cell) in non-embryonic tissue, in a suitable construct, lead to an increase in expression of the encoded polypeptide.

For present purposes, the term "embryonic tissue" means tissue present in a seed from a plant such as Arabidopsis from the maturation of the seed up until germination. The term "non- embryonic tissue" means tissue from e.g. an Arabidopsis seedling upon or after germination.

The term "operable linkage" means, for the purposes of the present specification, that a promoter is operably associated with a polynucleotide coding sequence such that, in suitable conditions, the promoter causes transcription of the associated polynucleotide.

The coding sequence of the MDF gene is shown in Figure 2 (SEQ. ID NO: 2).

Preferably, the isolated polynucleotide is such that when introduced into a suitable host cell, such as a plant cell, the polynucleotide is transcribed. Typically, the level of transcription of the MDF gene is increased in the host cell by at least 10%, preferably at least 20%, more preferably at least 40% and most preferably at least 50%, 60%, 70%, 80%, 90% or 100%. Methods of measuring levels of transcription are known to those skilled in the art and include, for example, measuring the mRNA abundance or protein abundance/activity of the operably linked coding sequence before and after induction of the promoter. Alternatively, the level of transcription can be measured using a co-expressed reporter gene, such as GUS (beta- glucuronidase), or GFP (green fluorescent protein).

In a second aspect, the invention provides a recombinant nucleic acid construct comprising the isolated polynucleotide of the first aspect.

Conveniently, the construct may additionally comprise any one or more, preferably two or more, of the following:

T-DNA to facilitate the introduction of the construct into plant cells; an origin of replication to allow the construct to be amplified in a suitable host cell (which may be prokaryotic or eukaryotic); a nucleotide sequence encoding a polypeptide, which sequence is typically operably linked to the polynucleotide of the first aspect; a selectable marker (such as an antibiotic or herbicide resistance gene); and an enhancer.

In a third aspect, the invention provides a host cell into which the polynucleotide of the first aspect has been introduced (for example, but not necessarily, as part of a construct in accordance with the second aspect). The host cell may be prokaryotic or eukaryotic. In particular, the host cell may be a bacterium, a plant cell, a mammalian cell, an insect cell, a yeast cell or a filamentous fungal cell. Suitable cells to act as hosts are well-known to those skilled in the art and readily available. The polynucleotide is preferably introduced into the host cell as part of a nucleic acid construct in accordance with the second aspect of the invention defined above. The molecule preferably is stably integrated into the genome of the host cell, especially into one or more chromosomes of the host cell, but may be on a replicating plasmid or other structure in a fungal or bacterial host cell. The invention also extends to the daughter cells or progeny of the host cell, which daughter cells or progeny retain the introduced molecule stably integrated within their genome or as a replicating plasmid or other structure. Advantageously, the invention is such that a host cell, host organism or part or progeny thereof, expresses a polypeptide which it would not normally express, as a result of the introduction of the polynucleotide, and/or expresses the polypeptide at a higher level then it would normally do so. In a fourth aspect, the invention provides a method of causing transcription of the isolated polynucleotide of the first aspect, the method comprising the step of placing the polynucleotide to be transcribed in operable linkage with a suitable promoter. The nucleic acid sequence to be transcribed may be all or part of the MDF gene, (to form a novel combination of MDF coding sequence and altered MDF promoter, which combination does not exist in nature) or in other embodiments comprises all or part of the MDF coding sequence and a heterologous promoter. The method may be performed entirely in vitro, or at least partly in planta. Preferably, the polynucleotide sequence to be transcribed is placed in operable linkage with a promoter in a plant cell. Conveniently, but not necessarily, the method results in the sequence being transcribed in the embryo and/or meristem, or in vegetative tissues.

For present purposes, transcription can be considered as being in vegetative tissues if the responsible promoter generally causes no detectable transcription in cells other than vegetative cells or a sub-population thereof, or causes in embryonic and/or meristem cells less than 30% of the level of transcription in vegetative cells, preferably less than 20%, more preferably less than 10%, and most preferably less than 5%. In accordance with the present invention, the promoter activity is preferably substantially restricted to embryonic and/or vegetative cells, but not meristem tissues. As mentioned above, there are standard techniques for measuring the level of transcription.

In one embodiment the nucleic acid construct comprises at least a fragment of the Arabiodopsis thaliana At5g 16780 gene. More preferably, the nucleic acid construct comprises a sequence which encodes at least 700 amino acid residues of the MDF polypeptide sequence shown in Figure IB, more preferably at least 750 residues, and most preferably at least 800 residues of the sequence shown in Figure IB.

Advantageously, the isolated polynucleotide of the first aspect of the invention is operably linked to a promoter such that, when transcribed (and optionally translated), it confers embryonic and/or stem cell-like activity on vegetative tissue in a plant or part thereof (into which the molecule is introduced) or the progeny of such a plant in which the sequence is stably maintained. In addition, such increased embryonic or stem cell-like activity preferably promotes the biosynthesis and/or accumulation of storage lipids within the plant. This mechanism can be independent of other known regulators such as LEC 1. In a fifth aspect, the present invention provides an altered plant, wherein the isolated polynucleotide in accordance with the first aspect has been introduced into a plant cell or cells and a plantlet subsequently generated from the cell(s), or the progeny of such a plant cell or plant. Methods of transforming plant cells and of generating plantlets from transformed plant cells are well known to those skilled in the art. These include transformation with Agrobacterial vectors, transfection, "biolistic" methods, protoplast transformation and fusion, and so on. Some examples of altered plants that may be prepared within the scope of the present invention include, but are not limited to, tomato (for example Solarium lycopersicum spp.) potato (for example, Solarium tuberosum spp.) rice, grasses such as Miscanthus sp. and members of the Brassicaceae family. Preferably the alteration is such as to cause accumulation of a lipid in a plant which does not normally accumulate lipid and/or causes the accumulation of a lipid in a part or parts of a plant which do not normally accumulate a lipid.

The invention also provides a method of altering a plant or part thereof, the method comprising the step of introducing into the plant or part thereof an isolated polynucleotide in accordance with the first aspect of the invention. Preferably the introduced nucleic acid will comprise the isolated polynucleotide of the first aspect operably linked to a promoter molecule such that the sequence is transcribed and confers embryonic and/or stem cell-like activity on the host plant or part thereof in which the sequence is expressed. The transcribed sequence may be, for example, a coding sequence which is translated into an amino acid sequence, which in turn exerts an effect (e.g. lipid accumulation). Alternatively, the transcribed sequence may exert an effect at the RNA level (e.g. via an antisense or an RNAi mechanism). Preferably the method alters the plant by increasing the lipid content of the plant or a part thereof.

In a further aspect, the present invention provides a method of altering, and especially increasing, the lipid content of a plant or a part thereof. In particular the present invention provides a method of increasing the lipid content of a seed and/or embryonic tissue of a plant, or a non- embryonic tissue of a plant (e.g. including, but not restricted to, leaf, stem, root, or tuber). This aspect of the invention is described in greater detail below. References herein to "lipid" are intended to encompass any plant-synthesised lipid. The term thus includes fat, oils, waxes, sterols, mono-, di- and triglycerides, phospholipids, fatty acyls (including fatty acids), prenol lipids and polyketides. In particular the lipid is preferably a plant storage lipid, such as might be found in a seed. Storage lipids are generally understood to be triacylgycerides, as opposed to lipid components of membranes (such as phospholipids, sphingolipids etc.).

In particular, it should be possible to cause the expression, preferably at high level, of a sequence corresponding to the polynucleotide of the first aspect (possibly present in multiple copies), in a plant or part thereof to cause the accumulation of lipid in plants in which lipids do not normally accumulate, and/or the accumulation of lipid in a part of parts of a plant, which part or parts do not normally accumulate lipid. For example, it may be possible, by means of the method of the invention to cause the accumulation of lipid in the tuber of a potato, or it may be possible to cause accumulation of lipid in the non-embryonic tissues of plants in which lipids usually accumulate in embryonic tissues in the seed.

The lipid content of a transgenic plant could be further enhanced using conventional plant breeding techniques, and may be further modified using conventional genetic modification techniques involving manipulation of one or more promoter elements or genes involved in synthesis or storage of oils, e.g. LEC or WRINKLED genes.

The lipid content of plants or parts thereof can readily be assessed qualitatively by staining samples with Fat Red Stain and examining the samples visually, either with the naked eye or with the aid of a microscope.

The present inventors have found that ectopic expression of the MDF gene enhances the biosynthesis and accumulation of storage lipids. Thus, the MDF gene and potentially related genes from other species, can be used as tools to increase storage lipid biosynthesis and accumulation in plants or plant tissues that do not normally accumulate significant levels of storage lipids. This property of the MDF gene was previously unrecognised, and its application as a tool to influence oil content was previously unknown. This discovery may have significant application in the regulation of the lipid content plants, as described below:

1. The Arabidopsis MDF cDNA or genomic sequence or at least a functional portion thereof, may be introduced into plants under the transcriptional control of one or more promoters that cause overexpression in the embryo and/or in tissues other than the embryo, to increase lipid biosynthesis and accumulation in those tissues. The promoters used may be expressed in a broad range of tissues (e.g. the CaMV35S RNA gene promoter, NOS promoter), or tissue-specific promoters may be used, in order to localise the site of lipid biosynthesis and accumulation

(e.g. patatin promoter). Standard techniques, such as Agrobacterium tumefaciens-mediated transformation, or direct gene transfer methods such as microprojectile bombardment or protoplast transfection, known to those skilled in the art, could be used for the transformation of suitable crop plants. The resulting plants, or their progeny, will have an increased lipid content.

2. The Arabidopsis MDF cDNA or gene, or at least a functional portion thereof, could be introduced into in vitro plant cell cultures under the transcriptional control of one or more gene promoters that cause expression in these tissues, to induce lipid biosynthesis and accumulation. These promoters might include the CaMV35S RNA gene promoter which is active in cell cultures, or other promoters having a similar function, known to those skilled in the art. Such plant cell cultures could be used to produce lipids in vitro.

3. It is also possible to over-express structurally and/or functionally related genes from target crop species in transgenic plants, or in vitro cultured plant cells or tissues, to regulate the biosynthesis and accumulation of lipids in one or more tissues. A number of agronomically important plant species contain homologues of the Arabidopsis MDF gene. Examples include Oryza sativa (rice, GenBank Accession No. Os02g0511500, with 58% identity to MDF at the amino acid level), Medicago truncatula (GenBank Accession No. MtrDRAFT_AC149089gl3vl, with 66% identity to MDF at the amino acid level to MDF) and Brassica oleracea (wild cabbage, EST identified, GenBank Accession No. AM059281, with 67% identity to MDF over 144 amino acids). It is likely that these homologues are functionally equivalent to the Arabidopsis MDF protein and thus are also attractive targets for the manipulation of lipid deposition in vegetative tissue. Similar genes from these and other species could be isolated by standard molecular biology techniques known to those skilled in the art. For example, homologous genes could be isolated by degenerate PCR; cDNA libraries prepared from RNA from target crop species may be screened using Arabidopsis RNA or DNA sequences as probes; genomic libraries made from RNA from target crop species may be screened using Arabidopsis RNA or DNA sequences as probes; or genomic or cDNA sequence information may be used to design gene-specific PCR primers to allow the amplification and cloning of relevant genes or cDNAs. The expression of MDF or its homologues may be caused by constitutive and/or widely-expressed promoters, such as the CaMV35S promoter, or by other promoters available to those skilled in the art. Alternatively, expression may be caused by gene promoters that are involved in regulating expression in specific tissues or organs. 4. It may be possible to modify the expression of MDF homologues in the host crop species by selective breeding. Such processes may be used in concert with a genetic "TILLING" approach to induce mutations, a method known to those skilled in the art. For example, as discussed above, the promoter of the MDF gene in Arabidopsis is involved in regulating tissue-specific expression. Mutation of the promoter can be expected to disrupt this tissue-specificity, and in some instances may lead to dominant (gain-of-function) mutations resulting in ectopic expression of the gene, and thus ectopic lipid biosynthesis and accumulation. This has been observed in the case of the "turnip" mutant of Arabidopsis, whereby a deletion mutation of the promoter of the LECl gene led to a gain-of-function mutant phenotype, resulting in ectopic expression of the gene in vegetative tissues, with consequent ectopic biosynthesis and accumulation of storage products (Starch and Oil, Casson and Lindsey 2006). "TILLING" ("Targeting Induced Local Lesions IN Genomes", reviewed by Gilchrist & Haughn 2005) of the MDF homologous loci in crop species may lead to mutations which may be used to select mutant plants exhibiting ectopic lipid accumulation. These plants can then be bred into elite varieties using standard breeding techniques known to those skilled in the art.

For the avoidance of doubt, it is hereby expressly stated that features described herein as "preferable", "convenient", "desirable", "advantageous" or the like may be used in the invention in isolation or in any combination with one or more other features so described, unless the context dictates otherwise. Further, unless the context dictates otherwise, features described herein as "preferable", convenient", "desirable" "advantageous" or the like in relation to one aspect of the invention will generally also be applicable to the other aspects of the invention detailed herein.

The following examples illustrate, but do not limit, the invention. The examples refer to drawings in which:

Figure Ia (SEQ. ID NO: 1) shows the full length cDNA for MDF from Arabidopsis (the presumed start codon is underlined);

Figure Ib (SEQ ID NO: 3) shows the predicted amino acid sequence of the MDF polypeptide from Arabidopsis; RS, SR, RE and RD dipeptides in the MDF sequence are shown highlighted - these may form part of an SART-I -like domain; "plus" symbols beneath the sequence indicates residues predicted to be involved in RNA binding, according to the software RNABindR,

(Terribilini et al).

Figure 2 shows the MDF coding sequence (SEQ. ID No. 2). The ATG start codon of the coding sequence shown in Figure 2 is found at nucleotides 305-307 of the cDNA sequence shown in Figure Ia.

Figure 3 (a to e) shows the expression levels of the MDF gene and protein in various experiments;

Figure 4 (a to d) is a schematic illustration of the MDF gene locus - exons are represented by the light shaded blocks;

Figure 5 (a to t) shows the results of analysis of MDF mutants in various experiments;

Figure 6 (a to e) shows the results of analysis of various pro35S::MDF seedling phenotypes;

Figure 7 shows the polynucleotide sequence (SEQ. ID No. 4) of the pET3-Strep 3 vector used in experiments described herein;

Figure 8 shows the polynucleotide sequence (SEQ. ID NO: 5) of the pBIN-Strep 3 vector used in experiments described herein (the upper case letters in Figures 7 and 8 denote non-MDF coding portions which encode tags fused to the MDF polypeptide to facilitate purification); and

Figure 9 shows the polynucleotide sequence (SEQ. ID No. 6) of the pBIN-Strep 3:MDF vector used in experiments described herein, (the letters in upper case correspond to the sequence of MDF).

Examples

Microarray data provide evidence to show that the MDF gene is expressed in embryos (Table 1).

To determine the spatial expression pattern of MDF in seedlings, Arabidopsis plants were transformed with a promoter-GUS fusion, proMDF: :GUS, and examined by histochemical staining. This is achieved by incubating transgenic tissues in a buffer containing X-gluc (5- bromo-4-chloro -3-indolyl glucuronide), which yields a blue dye following GUS-mediated hydrolysis. Histochemical staining for GUS activity in conjunction with light microscopical analysis allows accurate localisation of expression down to the single cell level. X-gluc is made up as a 20 x stock solution, whereby 20 mM X-gluc made up in N-N-dimethyl formamide (DMF), for use as a working solution. X-gluc is added to histochemical staining buffer (100 mM NaPO4 pH 7.0, 10 mM EDTA, 0.1% (v/v) Triton X-100, 0.5 mM potassium ferri/ferrocyanide) to make a 1 mM final concentration. GUS expression was observed in the meristems. In the root, expression was found in cells of the lateral root cap, columella and meristem, and strongly in the quiescent centre (Figure 3a). Expression was also observed in young lateral root primordia, with weaker expression through the rest of the meristem and vasculature (Figure 3b). Expression was also found in the shoot meristem (Figure 3c). Analysis of plants expressing a proMDF: :GFP:MDF protein fusion construct confirmed that the MDF polypeptide is preferentially localised to the nucleus in cells of the root meristem (Figure 3d, e). GFP is visualized using for example confocal scanning laser micrscopy, after counterstaining tissues with 10 mg/ml propidium iodide. A nuclear localisation for MDF is also predicted by the Plant- PLoc protein localisation software (Chou and Shen 2007).

To characterise the developmental role of the MDF gene, two T-DNA insertion alleles were identified. The mdf-1 allele contains an insertion within the 9^th predicted intron, whilst the mdf- 2 allele has an insertion within the 9^th exon (denoted by large arrowheads in Figure 4a). Exon 1 (5' to the ATG) is non-coding. A wild-type MDF transcript could not be detected in plants homozygous for either mdf-l or mdf-2 using either semi-quantitaive RT-PCR or quantitative real-time RT-PCR, indicating that these are putative null alleles (Figure 4b). Homozygous mdf- 1 and mdf-2 seedlings displayed similar phenotypes. Consistent with MDF gene expression during embryo development, mutant embryos were defective in cell division and patterning (Figure 4c). Mutant seedlings were severely dwarfed, typically comprising three cotyledons and a reduced root system (Fig 4d). The mutation was typically seedling-lethal by 20 dpg (days post- germination). This phenotype segregated with the T-DNA insertions in the MDF gene and was complemented by the introduction of a MDF cDNA (proMDF::MDF), confirming function. Detailed phenotypic and molecular analysis provided evidence to suggest that the mdf mutant seedling is unable to maintain meristem activity, due to a loss of stem cell-like activity in both the shoot and root (Figure 5). Since mdf mutants are unable to maintain correct embryogenesis and meristem activity, experiments were carried out to investigate whether MDF expression is sufficient to promote embryonic or stem cell identity. MDF cDNA was overexpressed ectopically in transgenic Arabidopsis plants under the control of the CaMV35S RNA gene promoter (Fig. 6a). Several independent pro35S::MDF lines were generated and several of the Tl and T2 lines were found to exhibit ectopic accumulation of storage oils at the root-hypocotyl junction (as revealed by Fat Red staining), indicative of the promotion of embryonic tissue identity (Figure 6b-e).

Fat Red is a stain for lipids.

To make up (2OmL) of Fat Red stain:

- 1OmL of Polyethylene glycol (PEG) 400 was mixed with 0.02g of Sudan III (Fat Red) in a 5OmL conical flask, heated to 9O⁰C and mixed vigorously for 30 minutes

- 1OmL of 90% Glycerol solvent was added to the PEG + Fat Red, heated to 9O⁰C and mixed vigorously for a further 30 minutes.

Solution was left to cool to room temperature before being filtered through No.l Whatman filter paper into a small glass culture bottle. Store bottle wrapped in aluminium foil (to keep dark).

Fat Red Staining:

Seedlings were added to 0.5mLs of Fat Red stain in a 1.5mL eppendorf tube in sterile conditions and left over night to stain.

Seedlings were washed using 50% Glycerol solvent, placed on a Phytagel plate and photographed at low power.

The phenotypes of these pro35S::MDF seedlings did not correlate with changes in the mRNA levels of the meristem regulators PLTl , PLT2, SCR, SHR or the embryo-specific LECl transcription factor, and the expression of these genes was not influenced following inducible overexpression of MDF (data not shown). Furthermore, the penetrance of the phenotypes of the pro35S::MDF lines was not influenced by growth in the presence of phyto hormones (data not shown), as has been demonstrated for pickle (Ogas et al. 1997) and tnp mutants (Casson and Lindsey 2006). These results have led to the suggestion that MDF is able to confer embryonic or stem cell-like identity on vegetative tissue, and regulating the biosynthesis and accumulation of storage oils. This mechanism is independent of other known regulators, such as LECl . Protocol for cloning and ectopic expression of the MDF gene in transgenic plants.

The transcription of the MDF cDNA or gene in transgenic plants may be regulated by different gene promoters. As an example, the following protocol describes the procedure for the molecular cloning of a gene construct wherein the MDF cDNA is placed under the transcriptional control of the CaMV35S promoter. However, other promoters may also be used to regulate tissue- or organ-specific expression in plants. For example, the patatin promoter may be used to regulate tuber-specific expression in potato, and seed storage protein gene promoters may be used to regulate expression in cereals or oil crops, such as brassica.

The first stage in generating a 35S:MDF construct involved amplifying the MDF coding sequence (Figure 2) from cDNA using the technique of PCR. The MDF coding sequence was cloned into the pET Strep3 vector the sequence of which is shown in (Figure 7), and then transferred to the pBIN-Strep3 vector (the binary vector for plant transformation, containing a CaMV 35 S promoter sequence, which sequence regulates constitutive expression of the MDF coding sequence in plants following transformation, Figure 8).

In Figures 7 & 8, the portions shown in upper case letters denote the sequence of the 'tag' regions, which become fused to the MDF polypeptide coding region to facilitate purification of the resulting fusion protein. Thus, they do not represent or constitute a portion of the MDF coding sequence, and should be disregarded for the purposes of assessing % identity or homology.

In detail, RNA was first extracted from 7 dpg seedlings using the Qiagen Plant RNeasy kit (manufacturers protocol, www.Qiagen.com). The first strand of cDNA was synthesised by heating 5μg RNA, 0.5μg Oligo (dT)is primer (made up to lOμl with RNAse free water) in an 500μl microcentrifuge tube, at 7O⁰C for 5 mins, before transferring to ice. After heating, 5μl 5 x M-MLV RT Buffer, 2μl dNTP mix (1OmM each), 2μl (40 units) M-MuLV Reverse Transcriptase and 6μl RNAse free water were combined (such that the total volume was 25 μl) and further heated at 37⁰C for 45 minutes.

The technique of PCR was used to amplify the MDF coding sequence using the following primers:

NdelMDF-Forward CATATGGAAGTGGAGAAGTCTAAATC (SEQ. ID NO. 7) Sail MDF-Reverse GTCGACGCCCTTGATCCTCAAGGCTTTGGTC (SEQ ID NO. 8)

The PCR reaction was carried out using 2.5μl cDNA (from above), lμl Nde MDF-Forward (50pMol/μl), lμl S all MDF-Reverse (50pMol/μl), lμl dNTP mixture (1OmM each), 5μl 1OxPCR buffer, 3μl MgCl₂ (5OmM), 0.5μl BioTaq (5units/μl, Bioline) and 36μl water. The PCR mixture was heated at 94⁰C for 5 minutes, followed by 30 cycles of the following conditions: 94⁰C for 30 seconds, 55⁰C for 30 seconds, and 72⁰C for 2 minutes. Final extension was carried out at 72⁰C for 7 minutes.

The MDF cDNA was then purified using the High Pure PCR Product Purification Kit (Roche, following the manufacturer's instructions).

Digestion of MDF cDNA and pET-Strep3 Vector was performed by combining lμg MDF cDNA or pET-Strep3, lμl Ndel (10 units), lμl Sail (10 units), 2.5μl 10x Buffer D and water, to a final volume of 25μl. The mixture was incubated at 37⁰C for 4 hours. A volume of lμl Shrimp alkaline phosphatase (10 units) was added 30 minutes before the end of the digest.

Ligation was then carried out by combining 600ng pET-Strep3, 200ng MDF, lμl 10x T4 DNA ligase buffer, lμl T4 DNA ligase (10 units) and water to a volume of lOμl. The mixture was incubated at 4⁰C for 16 hours.

The PCR product was transformed into electrocompetent E. coli strain DH5 alpha cells and colonies were selected on 50mg/l kanamycin. Clones containing the MDF coding sequence cDNA in the pET-Strep3 vector were grown and the plasmid was isolated using the Promega Wizard plus SV miniprep kit (following the manufacturer's instructions). The MDF coding sequence was then shuttled from the pET-Strep3 vector into the pBIN-Strep3 vector, as a Pacl- BstXl fragment. The techniques of digestion, ligation and transformation into E. coli DH5alpha cells were carried out as described above, with the exception that selection was carried out using 50mg/ml spectinomycin. The clones were verified by sequencing with the following primers:

pBINstrepSeqA CTATCCTTCGCAAGACCTTCCTC (SEQ ID NO. 9)

pBINstrepSeqB CTGTGT AT AAGGGAGCCTGAC (SEQ ID NO. 10) Agrobacterium transformation was carried out using the strain C58 pGV2260 (as many agrobacterium strains are resistant to spectinomycin or streptomycin). Initially, a culture of 300ml C58 pGBV2260 in LB media was grown overnight with shaking at 28⁰C. Agrobacterium cells were collected by centrifugation and the pellet was resuspended in a volume of 100ml of buffer containing ImM HEPES, pH7 (with KOH), at 4⁰C. The cells were collected in a centrifuge at 4⁰C and the above washing step was repeated three times. The bacteria were collected and resuspended in 4ml sterile glycerol (20%) at 4°C and lOOμl aliquots were prepared.

Electroporation was carried out using a BioRad Gene Pulser, wherein lμl (50mg) of pBIN StrepMDF plasmid was added to an aliquot (as prepared above) at 4°C. The sample was placed in a cold electroporation cell (BioRad), the electroporator was set at 2.5kv, 125uF and 400Ω and pulsed. A volume of 600μl LB medium at 4°C was immediately added and the cells were transferred to a sterile 1.5μl microcentrifuge tube. The cells were allowed to recover for 6 hours at 28⁰C with shaking and were subsequently spread onto solid LB plates containing 50mg/l spectinomycin/streptomycin.

The sequence of the pBIN-Strep 3:MDF vector is shown in Figure 9.

References

Blencowe, B. J., et al., (1999). SR-related proteins and the processing of messenger RNA precursors. Biochem Cell Biol. 77:277-291.

Boucher, L., et al., (2001) A genome-wide survey of RS domain proteins. Bioinformatics 7:1693-1710.

Casson, S., & Lindsey, K. (2006). The turnip mutant of Arabidopsis reveals that LECl expression mediates the effects of auxin and sugars to promote embryonic cell identity. Plant Physiol. 142:526-541.

Casson, S. et al., (2005). Laser Capture microdissection for the analysis of gene expression during embryogenesis of Arabidopsis. Plant J. 42 : 111 - 123. Cernac A., & Benning C. (2004) WRINKLEDl encodes an AP2/EREB domain protein involved in the control of storage compound biosynthesis in Arabidopsis. Plant J 40:575-585.

Chou, K.C., & Shen, H. B. (2007). Large-scale plant protein subcellular location prediction. J. Cell. Biochem. 100:665-678.

Dean Rider, S. Jr., et al., (2003). Coordinate repression of regulators of embryonic identity by PICKLE during germination in Arabidopsis. Plant J. 35: 33-43.

Gilchrist, E.J. & Haughn, G.W. (2005). TILLING without a plough: a new method with applications for reverse genetics. Curr. Op. Plant Biol. 8_. : 211-215.

Lotan T. et al., (1998) Arabidopsis LEAFY COTYLEDONl is sufficient to induce embryo development in vegetative cells. Cell 93:1195-1205.

Luerben H. et al., (1998) FUSCA3 encodes a protein with a conserved VP l/AB13-like B3 domain which is of functional importance for the regulation of seed maturation in Arabidopsis thailana. Plant J 15:755-764.

Makarova, O.V. et al., (2001). The 65 and 110 kDa SR-related proteins of the U4/U6.U5 tri- snRNP are essential for the assembly of mature spliceosomes. EMBO J. 20:2553-2563.

Neugebauer, K.M. et al., (1995). A conserved epitope on a subset of SR proteins defines a larger family ofpre-mRNA splicing factors. J. Cell Biol. 129:899-908.

Ogas, J. et al., (1997). Cellular differentiation regulated by gibberellin in the Arabidopsis thaliana pickle mutant. Science 277:91-94.

Ogas, J. et al., (1999). PICKLE is a CHD3 chromatin-remodelling factor that regulates the transition from embryonic to vegetative development in Arabidopsis. Proc. Natl. Acad. Sci. USA 96: 13839-13844. Parcy F. et al, (1997) The ABSCISIC ACID- INSENSITIVE3, FUSCA3, and LEAFY

COTYLEDON 1 loci act in concert to control multiple aspects of Arabidopsis seed development. Plant Cell 9: 1265-1277.

Spencer, M. W. et al., (2007). Transcriptional profiling of the Arabidopsis embryo. Plant Physiol. 143:924-940.

Stone S. L., et al., (2001) LEAFY COTYLEDON2 encodes a B3 domain transcription factor that induces embryo development. Proc Natl Acad Sci USA 98:11806-11811.

Terribilini, M., et al., (2007). RNABindR: a server for analysing and predicting RNA-binding sites in proteins. Nucleic Acids Res. 35: W578-584.

Claims

1. A method of altering the lipid content of a plant or part thereof, the method comprising the steps of: introducing into a plant or plant cell an isolated polynucleotide, which polynucleotide encodes a polypeptide comprising at least 600 amino acid residues of the sequence shown in Figure Ib, or a polypeptide having at least 65% sequence identity with the sequence shown in Figure Ib; and, optionally, growing a plant or plantlet from the plant or plant cell or otherwise forming progeny therefrom, which plant, plantlet or progeny substantially retains the introduced polynucleotide.

2. A method according to claim 1, wherein the encoded polypeptide comprises at least 700, more preferably at least 750, and most preferably at least 800 amino acid residues of the sequence shown in Figure Ib.

3. A method according to claim 1 or 2, wherein the encoded polypeptide exhibits at least 70% identity, preferably at least 75% identity, more preferably at least 85% identity, and most preferably at least 95% identity with the sequence shown in Figure Ib.

4. A method according to any one of the preceding claims, wherein the polypeptide encoded by the polynucleotide possesses transcription regulatory activity.

5. A method according to any one of the preceding claims, which involves overexpression of the encoded polypeptide.

6. A method according to any one of the preceding claims, which causes increased accumulation of lipid in the plant or plant cell or progeny thereof.

7. A method according to any one of the preceding claims, comprising the step of assessing, quantitatively or qualitatively, the amount of lipid present in the plant, plant cell or progeny thereof.

8. A method according to any one of the preceding claims, wherein the step of forming progeny includes the step of forming seed.

9. A method according to any one of the preceding claims, wherein the method results in the accumulation of lipid in a part of a plant which does not naturally accumulate storage lipid.

10. A method according to any one of the preceding claims, wherein the polynucleotide is introduced as part of a nucleic acid construct, said construct further comprising one or more of the following:

T-DNA to facilitate the introduction of the construct into plant cells; an origin of replication to allow the construct to be amplified in a suitable host cell, which may be prokaryotic or eukaryotic; a promoter which is operable in a desired host; a selectable marker, such as an antibiotic or herbicide resistance gene; and an enhancer.

11. A method according to any one of the preceding claims, performed in vitro.

12. A method according to any one of the preceding claims wherein the polynucleotide defined in claim 1 is other than a plant genomic DNA sequence.

13. A method according to claim 12, wherein the polynucleotide is a cDNA sequence or other sequence substantially without introns.

14. A method according to any one of the preceding claims, wherein the coding sequence of the polynucleotide is placed in operable linkage with a heterologous promoter.

15. A method of obtaining storage lipid-containing biomass, the method comprising the steps of: harvesting a plant or part thereof which has a lipid content altered by the method of any one of the preceding claims, or is the progeny of such a plant or part thereof and which retains the introduced polynucleotide.

16. A method according to claim 15, wherein the part of a plant is a plant cell, and the method comprises culturing the cell under suitable growth conditions in vitro to form a plurality of plant cells with increased lipid content.

17. A method according to claim 15 , wherein the part of a plant is a tuber, seed, leaf, stem or other structure.

18. A method according to any one of claims 15, 16 or 17, further comprising the step of extracting and/or purifying the lipid content from the rest of the biomass.

19. A method according to any one of claims 15-18, used to manufacture a lipid-based fuel.

20. A method according to any one of the preceding claims, wherein the plant or part thereof, is selected from the group consisting of: Oryza sativa, Solanum tuberosum, Brassica sp., Medicago truncatula, Zea mays; Triticum aestivum, and Miscanthus sp.

21. A plant or part thereof having increased lipid content relative to the corresponding wild type plant, the plant or part thereof being obtainable or obtained by the method of any one of claims 1-14.

22. A plant or part thereof according to claim 21, selected from the group consisting of: Oryza sativa, Solanum tuberosum, Brassica sp., Medicago truncatula, and Miscanthus sp.

23. An isolated polynucleotide encloding a polypeptide comprising at least 600 amino residues of the sequence shown in Figure Ib, or a polypeptide at least 600 amino acid residues and having at least 65% amino acid sequence identity with the sequence shown in Figure Ib.

24. An isolated polynucleotide according to claim 23, wherein the polypeptide coding sequence is in operable linkage with a heterologous promoter.

25. A nucleic acid construct comprising the isolated polynucleotide of claim 23 or 24.

26. A host cell comprising the isolated polynucleotide of claim 23 or 24, or the nucleic acid construct of claim 25.