Engineering Of Plants To Exhibit Self-Incompatibility
Field of the invention
The majority of flowering plants are hermaphrodites; they possess both male and female reproductive tissues closely adjacent. As a consequence, they generally undergo self-pollination and fertilization. Self-incompatibility (Sl) is a genetically- controlled mechanism used by some species of flowering plants to prevent self- pollination or pollination by a genetically-related plant. As a result, these species are naturally out-crossing. The present invention relates to the establishment that a multi- allelic pollen-expressed gene, PrpS, of the common field poppy (Papaver rhoeas) together with a previously identified multi-allelic pistil-expressed gene (the pistil S gene) which, together, are responsible for the SI system of that species. Thus, use of those genes alone, or equivalent genes of related Papaver species, is now shown to confer SI on plants which do not normally possess a SI system.
Background to the invention
Three mechanistically distinct SI systems have previously been identified in other genera of plants: Brassicaceae, Solanaceae, Rosaceae and Plantaginaceae (Takayama and Isogai, (2005) Ann. Rev. Plant Biol. 56, 467-489; McClure et al. (2006) Planta 224. 233-245). An SLF - RNase system has also been disclosed in Petunia inflata (Huang US2005/0246788). All these involve an allele— specific interaction between a pistil (female) protein and a corresponding pollen (male) protein both of which are encoded by genes residing at a single genetic locus, referred to as the S locus. This highly specific interaction results in inhibition of pollen tube growth, thus preventing self-pollination. The pistil and pollen S genes exist in different allelic forms which control pollination specificities. Thus, a plant carrying the Si allele cannot pollinate itself or another Si plant but can pollinate plants of the same species carrying different S alleles.
Although the three known SI systems exhibit similarities in their genetic control, they have evolved independently and, as noted above, are mechanistically distinct. While it was hoped that characterisation of these systems would enable SI to be engineered into plants, so far this objective has not been achieved. The inventors have now
elucidated that the SI system of the common poppy depends on pollen membrane receptor-pistil small protein ligand interaction and can be engineered into plants by simply introducing a pair of S gene alleles encoding pistil and pollen proteins which interact.
Pistil S alleles of Papaver rhoeas have previously been cloned and the expression product of such an allele has been shown to interact with incompatible pollen, triggering a Ca2+-dependent signalling network, resulting in the inhibition of pollen tube growth and programmed cell death (Foote et al. (1994) Proc. Natl. Acad. Sci. USA 9_1, 2265-2269; Thomas and Franklin-Tong (2004) Nature 429, 305-309; Thomas et al. (2006) J. Cell Biol. 174, 221-229). Sequence information for the P. rhoeas pistil Si, S3 and S3 alleles is available from databases as detailed below:
- Pistil S1: GenBank accession no. X74333 (Foote et al. (1994) ibid);
- Pistil S3: EMBL, GenBank and DDBJ databases: accession numbers X87100 and X87101 ( Walker et al. (1996) Plant Molecular Biology 30, 983-994); and
- Pistil S8: EMBL # AJ005741 (Kurup et al. (1998) Sexual Plant Reproduction H, 192-198).
Although the inventors previously also identified a pistil S protein-binding glycoprotein in pollen, subsequent studies indicated that it was not the pollen S determinant, but that it might modulate the SI response (Hearn et al. (1996) The Plant Journal 9, 467-475). More recent analysis of a genomic λ clone of a limited region surrounding the pistil S1 allele of Papaver rhoeas also failed to reveal a candidate for the pollen Si gene (Wheeler et al. (2003) J. Exp. Bot. 54, 131-139). However, by probing a genomic cosmid library from the S locus of S1S3 Papaver rhoeas using pistil S1 cDNA, the inventors have now identified the corresponding pollen Si gene (designated PrpSi. Papaver rhoeas pollen S1) in a 42 kb region and cloned a S locus segment that encodes both the Papaver rhoeas pistil and pollen S1 genes separated at their 3' ends by only 467 base pairs (see Figure 5a). Two further Papaver rhoeas pollen S alleles (PrpSβ and PrpS3) were subsequently identified from pollen cDNA and genomic DNA of S3S8 plants using a PφS, primer (the oligonucleotide of SEQ. ID no. 1 as set out in Example 1 ), consistent with the polymorphism to be expected of a S locus component for Sl.
The mRNA sequences for the PrPS1 and PrpS8 alleles have been made available in the EMBL/NCBI database with accession numbers AM743176 and AM743177, but it is the studies now reported herein which established the utility of those sequences together with the appropriate previously identified pistil S alleles (S1 and S8 respectively) for conferring SI on genetically-engineered plants.
The identified PrpS alleles encode an approximately 20 kDa protein with (at least) three predicted transmembrane domains and with no homology to proteins in existing databases. PrpS protein was shown to be associated with plasma membrane consistent with the proposal that it is a transmembrane protein. As there are no homologues, the Papaver pollen S protein represents a distinct class of transmembrane protein.
Evidence that the PrpS^ PrpS3 and PrpS8 alleles are involved in SI was obtained by confirming tight genetic linkage with the pistil Sy, S3 and S8 alleles respectively by segregation analysis using gene-specific primers (see Figure 7) and by using PrpS allele specific antisense oligonucleotides to alleviate inhibition in vitro of incompatible pollen by recombinant pistil S protein. Moreover, a peptide based on a predicted external domain portion of the PrPS1 protein was also shown to be capable of blocking the inhibition of pollen tube growth (inhibition) by recombinant S protein in an in vitro SI assay.
Given the postulated key receptor-ligand interaction responsible for poppy Sl, it was hypothesised that just two poppy genes may suffice to transfer SI into other plant species thus overcoming previous problem in achieving this highly desired goal. Significantly, it has been shown using the cruciferous model plant Arabidopsis thaliana (a self-compatible species, not closely-related to poppy), that a PrpS allele and its corresponding pistil S allele when engineered into such plants are indeed sufficient to confer Sl. Thus, Arabidopsis pollen expressing PrPS1 as a fluorescent fusion protein, when grown in vitro, was shown to be inhibited by addition of the corresponding recombinant pistil S1 protein. Moreover, transgenic Arabidopsis plant lines co- expressing the same pistil and pollen S proteins exhibited reduced male fertility owing to self-pollination inhibition. These experiments provided proof of principle that it is be possible to use a Papaver S locus to engineer SI into other unrelated plants which do not normally possess a SI system.
Further studies confirmed this. In /Krabidopsis plant lines transformed with vectors to express the PrPS1 gene, the percentage germination and mean length of pollen tubes were not significantly different from the wild type. Hence, the inserted genes did not affect the behaviour of the pollen grains, that is, pollen hydration and germination were as normal wild type. The inserted PrPS1 gene linked to GFP did not interfere with the normal functioning of pollen grains. In fact, no transgenic pollen tubes expressing PrPS1 germinated in the presence of active S1 proteins, and this was a highly significant result. In the presence of PrSS1 proteins, no transgenic tubes that expressed GFP germinated because they expressed the PrPS1 gene (Figure 10). This is thought to be due to the PrPS1 interacting with the PrsSi proteins in the growth medium, resulting in the arrest of pollen tube growth.
This data has also now been replicated in vivo, showing that pollen bearing PrPS1 formed pollen tubes from wild type stigmas, but not from cell lines (designated herein as HZ cell lines) also expressing the Si allele (as PrSS1).
Therefore, the poppy SI system has been introduced into the A. thaliana model and only worked in the presence of its active complementary PrsS protein. This confirms that the poppy PrPS gene is functional in A. thaliana. In other words, the recombinant poppy pistil PrSS1 protein and the pollen protein, PrPS1 expressed in A. thaliana were alone sufficient to induce S-specific pollen inhibition in A. thaliana.
In turn, this suggests that the events downstream of the interaction are well conserved in unrelated species and are, therefore, the present SI system will likely function in a broad range of plant species.
Summary of the invention
In one aspect, the present invention thus provides a method of obtaining plants which exhibit self-incompatibilty (Sl), or in which SI is inducible, which comprises transforming plants or cultured plant cells with both (i) a pollen S allele of a Papaver S locus or a functional variant thereof and (ii) a pistil S allele of said Papaver S locus or a functional variant thereof, said pollen and pistil S alleles encoding respectively pollen and pistil
proteins of a Papaver SI system which prevents self-pollination, and, if need be, further generating plants from transformed cultured cells.
Such transformation may be followed by controlled pollination of transformed plants to obtain plants stably transformed and homozygous for the pollen S allele or functional variant thereof and the pistil S allele or functional variant thereof.
At its simplest, the SI system is a 2-component system comprising the pollen S allele (or a variant) and the pistil S allele (or a variant).
Engineered plants thus obtained which exhibit Sl, or in which SI is inducible, constitute further aspects of the invention. Thus, the present invention provides a plant engineered to express both a pollen S allele and the corresponding pistil S allele of a Papaver S locus, or an equivalent plant wherein one or both of said alleles is substituted by a functional variant, whereby SI is maintained or is inducible.
Such a functional variant may comprise a cDNA sequence, e.g. a cDNA which retains coding sequences for both the pistil S protein and pollen S protein of a native Papaver S locus. Conveniently, however, a complete native Papaver S locus, e.g. an S locus of P. rhoeas or P. nudicale, may be employed. For example and preferably, the S1 locus providing both the PrpS^ and pistil Sj alleles of P. rhoeas may be employed, which as noted above can be advantageously isolated in a S locus genomic DNA with less than 500 bp 3' end separation. However, it will be appreciated that native pistil and pollen S alleles may alternatively be isolated as separate alleles and provided as a cassette comprising a synthetic S locus. This may be preferred where the native pistil and pollen S alleles are separated by far greater then 500 bp such as found for the P. rhoeas PrpS3 and pistil S3 allele pair and the PrpS8 and pistil S8 allele pair (see Example 1 ). As indicated above, initial introduction into a plant of an S locus may be followed by controlled pollination to obtain a plant line stably transformed and homozygous for that locus.
As also indicated above, the chosen alleles to provide SI may have native promoters substituted by inducible promoters, e.g. such that SI can be turned on by chemical spraying.
Such transfer of SI into plants that do not normally possess SI has a number of potentially important uses, for example: i. Many crop species do not possess SI systems, or in some cases have been selected so that they are no longer functional. This represents a significant problem for plant-breeders and seed companies who make widespread use of and sell Fi-hybrid varieties, which generally have better characteristics than their parents. This is because the production of F1 seed in the absence of SI is dependent on laborious and time-consuming hand emasculation of individual plants to prevent self-pollination. Introduction of a Papaver SI system into such plants would obviate the use of hand-emasculation and make production of F1 hybrids easier and cheaper. If a crop species is self- incompatible, then it can be crossed without any emasculation, as no pollen can fertilise the originating plant Obtaining of F1 hybrid seed from plants engineered to express an SI system in accordance with the invention, and use of such seed to obtain F1 hybrid plant varieties, thus represents a potentially commercially important further aspect of the invention.
ii. Once a flowering plant has been pollinated, a senescence pathway is induced and the petals are rapidly shed. This has a significant effect on the "shelf-life" of ornamental cut flowers or plants and is of considerable horticultural economic importance. However, if self-pollination is blocked by Sl1 the senescence pathway will not be activated, thus prolonging shelf-life of ornamental plants or cut flowers
As noted above, the Papaver rhoeas pollen S gene (PrpS) displays the polymorphism typical of an SI component. Such a coding sequence may be transcriptionally-linked to its native pollen promoter for directing expression in pollen, e.g. as part of a complete native S locus for use in engineering SI into plants as discussed above, or a heterologous promoter, which may be tissue specific. Such a heterologous promoter may be inducible. It will be appreciated that cells engineered using such a DNA to express a pollen S protein or functional analogue thereof may be subjected to targeted cell ablation by contact with, or co-expression of, a pistil S protein or functional analogue thereof whereby SI system-type induced programmed cell death (PCD) is induced. Such targeted cell ablation constitutes a further aspect of the invention and
may be employed in ectopic tissues and, for example, in removing pollen from a mixture of pollens.
The alleles are preferably present in a complete native Papaver S locus. A PrpS and pistil S allele pair of Papaver rhoeas are preferably employed. More preferably, the PrPS1 and pistil S, allele pair of P. rhoeas are employed. The plants or cells to be transformed may contain, or may be simultaneously transformed with, a transgene for a further desired characteristic.
The method may also further comprise controlled pollination of transformed plants to obtain plants stably transformed and homozygous for said pollen S allele or a functional variant thereof and said pistil S allele or a functional variant thereof. Preferably, said further comprises crossing said plants homozygous for said pollen S allele or a functional variant thereof and said pistil S allele or a functional variant thereof to obtain F1 hybrid seed and optionally growing from said seed F1 hybrid plants. F1 hybrid seed thereby obtained and F1 hybrid plants derived therefrom are provided.
Also provided is a kit of polynucleotides, for instance for use in the present method. Said kit may comprise two polynucleotides. The first polynucleotide may have a pollen S allele of a Papaver S locus or a functional variant thereof. The second polynucleotide may have a pistil S allele of said Papaver S locus or a functional variant thereof. The pollen and pistil S alleles encode, respectively, pollen and pistil proteins of a Papaver SI system which prevents self-pollination. The polynucleotides may be separate, i.e. different chains, or may be part of the same polynucleotide chain, compassing both the pistil and pollen alleles or variants thereof. Suitable promoters for expression of the corresponding S alleles in the pistil or pollen are preferably provided.
The kit may also comprise a vector comprising said both polynucleotides, or two vectors each comprising one or other of said polynucleotides. The kit may also comprise instructions for use.
Transformation may be achieved using standard plant vectors, such as Agrobacterium, or delivery by a gene gun, for instance where the polynucleotide(s) are attached to gold
particles. Where Agrobacterium is used, transformation of plants by floral dip is preferred.
Plants obtained by the present method and seeds produced therefrom, are also provided. Indeed, plants grown from these seeds are also provided, as are any plants grown or transformed to comprise the present SI system provided said plants are not Papaver in which the system occurs naturally.
A plant obtained by the present method, which exhibits Sl, or in which SI can be induced, by virtue of said pollen S allele or functional variant thereof and said pistil S allele or functional variant thereof, is also provided. The plant may be homozygous for said alleles conferring Sl. Cultured plant cells transformed in accordance with the invention are provided as well.
The plant may be an ornamental plant. Seed therefor and cut flowers derived therefrom are provided. The plants in which the present SI system may be used can be monocots or dicots. Preferred are ornamental flowers and crops. Crop plants of interest may include, but are not limited to, soybean (including the variety known as Glycine max), cotton, canola (also known as rape), corn (also known as maize and Zea mays), wheat, sunflower, sorghum, alfalfa, barley, millet, rice, fruit and vegetable crops.
The invention will be further described below with reference to the following listed figures.
Brief description of the figures
Figure 1 : (a) the P. rhoeas PrPS1 full length cDNA in which the translation start codon (ATG) and translation stop codon (TAA) are shown in bold underlined (SEQ. ID no. 2) and (b) the corresponding PrPS1 protein sequence (SEQ. ID no. 3).
Figure 2: (a) the P. rhoeas PrpS3 coding cDNA sequence in which the translation start codon (ATG) and translation stop codon (TAA) are shown in bold underlined (SEQ. ID no. 4) and (b) the corresponding PrpS3 protein sequence (SEQ. ID no. 5).
Figure 3: (a) the P. rhoeas PrpS8 full length cDNA sequence in which the translation start codon (ATG) and translation stop codon (TAA) are shown in bold underlined (SEQ. ID no. 6) and (b) the corresponding PrpS8 protein sequence (SEQ. ID no. 7).
Figure 4: P. rhoeas pistil S allele cDNAs (S1, S3,and S8) and the corresponding deduced amino acid sequences (SEQ. ID nos. 8 to 13)
Figure 5:
(a) Organization of the S1 locus of P. rhoeas. Blocked arrows indicate the S1 and PrPS1 coding sequences and their orientation; transcription start site (+1 ).
(b) Alignment of PrPS1, PrP3 and PrpS8 deduced amino acid sequences (SEQ. ID no. 3, SEQ ID no. 5 and SEQ. ID no. 7 respectively);
* indicates identical amino acids;
. indicates hypervariable amino acids across all 3 alleles; and
: indicates 2 out of 3 amino acids are conserved.
Figure 6:
RT-PCR Segregation analysis described in Example 2 showing the linkage of PrpS to the cognate pistil S in crosses of the segregating families 1 ,3/3,8 and 1 ,8/3,8.
Figure 7:
(a) Effect of PrPS1 extracellular domain peptide added to Sl-induced pollen from plants carrying S1S3 alleles. The peptide "rescued" pollen from inhibition (middle panel); randomized peptide 2 had no effect [right panel). Left panel shows typical SI induced inhibition of S1S3 pollen in the presence of S1 and S3 proteins but in the absence of PrPS1 peptide.
(b) Effect of PrPS1 and PrpS8 antisense oligonucleotides (as-ODNs: as-PrpS1t as- PrpSg) on pollen subject to Sl-induced inhibition. The as-ODNs "rescued" pollen, carrying S1S3 or S3S8 alleles from Sl-induced inhibition in an S-specific manner, while PrPS1 and PrpS8 sense oligonucleotides (s-ODNs: s-PrpS-i, s-PrpS8) did not. Controls: untreated pollen and as-ODNs without SI induction controls (white bars); Sl-induced pollen (black bars); Sl-induced in presence of as-ODN (crosshatched bars); Sl-induced in presence of s-ODNs (dotted bars).
Figure 8: P. rhoeas, expressing the S, and S8 haplotypes, was used to verify whether the S proteins were functional. In the presence of S1 proteins alone, partial inhibition (P=O-OOO1 n=100x3) was achieved while a combination of Si and S8 proteins completely prevented pollen tubes from growing (p=0.000, n=100x3);
Figure 9: S proteins had no effect on CoIO (p=0.760, n=100x3). There was no significant difference in the frequency of germination of pollen tubes between CoIO and BG16.8.3 (p=0.400, n=100x3);
Figure 10: shows the % germination of pollen tubes with different S proteins. There was no significant difference observed in the percentage germination of BG16.8.3 pollen tubes subjected to various treatments (p=0.315, n=100x3);
Figure 11 : the inserted PrPSi gene triggered SI in an S-specific manner and prevented the growth of pollen tubes, which expressed GFP only, in the presence of active S1 proteins. Denatured S1 protein was used as a control to show that active S1 protein was responsible for triggering the SI response (p=0.005, n=100x3). S8 proteins were added as another control to verify that SI was induced in an S-specificity manner (p=0.000, n=100x3);
Figure 12: the viability of Arabidopsis wild type pollen (blue bars) and pollen expressing PrpS-GFP (yellow bars) at t=0 h and t=2 h in the absence and presence of poppy recombinant female S-determinant PrSS1;
Figure 13: the viability of Arabidopsis wild type pollen (black bars) and pollen expressing PrpS-GFP (yellow bars) at t=0 h and t=4 h in the absence and presence of poppy recombinant female determinant PrSS1; and
Figure 14: the viability of Arabidopsis wild type pollen (dark green bars) and pollen expressing PrpS-GFP (yellow bars) at t=0 h and t>8 h in the absence and presence of poppy recombinant female determinant PrSS1.
Detailed description
The genes required to provide the required S locus proteins in an engineered plant of the invention may be introduced into plant cells using conventional techniques such as Ti plasmids, electroporation and gene gun delivery of DNA-coated microparticles, followed by generation of transformed plants, e.g. from transformed cultured cells, again using routine techniques. By way of example, Example 4 illustrates use of Ti plasmids carrying a P. rhoeas S1 locus and antibiotic resistance gene to transform Arabidopsis plants as referred to above with initial screening of T0 seed for presence of the antibiotic resistance gene and generation of transformed plants (T1) from selected seed carrying the S1 locus. Controlled pollination may then be carried out to obtain the desired stably transformed plant line, homozygous for the S locus and exhibiting Sl. The genes of the S locus may be introduced into plant cells already transformed with a transgene to provide a further desired characteristic or simultaneously with such a transgene.
The S locus genes might be transfected separately but generally it will be preferred to introduce a complete S locus, either a S gene expression cassette or a native locus. As indicated above, the S locus may be conveniently a complete native Papaver S locus in a genomic DNA fragment, e.g. a complete native Papaver rhoeas S locus, preferably an S1 locus providing both the PrpS-\ and pistil S, alleles of Papaver rhoeas as shown in Figure 5a. As detailed in Example 4, such an S1 locus may be conveniently obtained in a genomic DNA restriction fragment, e.g. a Notl fragment of 6.8 kb, suitable for insertion into a vector such as a Ti plasmid for direct transfection of plant cells.
Whilst any PrpS allele or encoded peptide is preferred, the PrpS3 or PrpS6 alleles or encoded peptides are more preferable and the PrpS, allele or encoded peptide is particularly preferred. It is therefore expected that any cognate pair would work, for instance PrsS2 and PrpS2 should work as a cognate incompatible pair. Other matching sS and pS alleles should also function in an SI system.
It will be appreciated, however, that either or both of the pollen S allele and the pistil S allele may be replaced by a functional variant whereby SI is maintained or is inducible. The 3 pollen S alleles PrpS1t PrpS3 and PrpS8 have been found to contain an intron, for example the PrPS1 allele intron of 94 bp is found near the 3' end of the gene (shown in
Figure 5a). It will be recognised therefore that, for example, genomic DNA of a native P. rhoeas S1 locus may be substituted by a cDNA encoding the same S locus proteins for transformation of plant cells in accordance with the invention. It will also be appreciated that a native promoter may be substituted by a heterologous promoter of the same tissue specificity, e.g. a Papaver pollen S protein coding sequence such as the PφSi allele coding sequence may be transcriptionally linked to the promoter of ntp303, a Nicotiana tabacum gene which is known to be specifically active in pollen and provide higher levels of expression (see Example 4).
In principle, any good pollen or pistil-specific promoter that gives high expression in these tissues in the relevant crop is useful linteh present invention. Suitable promoters may include the Lat52 promoter or the cognate Prpsi promoter, whilst the ntp303 promoter mention above is particularly preferred.
Expression of pistil S may be driven by the STIG1 promoter from Nicotiana tabacum. Homologous promoter sequences from other flowering plant species, including A thaliana, may be employed. One or both of the S locus coding sequences may be varied provided an S locus is retained which provides a pistil protein and pollen protein which interact to provide Sl.
Cultured plant cells transformed as above to acquire genes conferring SI on a plant generated therefrom constitute a further aspect of the invention.
The identification of the key protein interaction for SI in P. rhoeas opens the way not only for a variety of Papaver S locus gene pairs to be used to confer SI in engineered plants, but also as already briefly discussed above, use of Papaver pollen S gene coding sequences alone, or co-expressed with an appropriate pistil S gene coding sequence, to enable targeted programmed cell death (PCD) in a plant tissue, using an appropriate tissue-specific promoter.
Thus in a still further aspect of the invention, there is provided a method of targeted plant cell ablation in plant tissue wherein the cells of the tissue express as a heterologous protein the pollen S component of a Papaver SI system or a functional analogue thereof, which comprises contacting said cells with, or co-expressing in said cells, a Papaver pistil S protein or functional analogue thereof whereby programmed
cell death occurs. Expression of either or both the pollen S protein and pistil S protein may be under the control of a tissue specific inducible promoter such that S locus- induced PCD may be turned on as desired. A suitable tissue specific inducible promoter is dexamethosone.
Hence, of interest are DNAs wherein the coding sequence for the pollen S component of a Papaver SI system, e.g. a P. rhoeas SI system, is transcriptionally-linked to a heterologous promoter suitable for directing expression in a specific plant tissue, which may be pollen or a non-pollen tissue. Such DNAs may also encode a pistil S protein or functional analogue thereof whereby the DNA provides a complete S locus which causes, or can be induced to cause, S locus-induced programmed cell death. As indicated above, by means of choice of promoter it is envisaged that such S locus- induced PCD may be provided in inducible manner to target ectopic tissues.
Such a method may also be used to target pollen carrying a transgene for expression of the pollen S component of a Papaver SI system and may find use in identifying further such genes and as previously noted above inhibiting pollen in a mixture of pollens.
Example 14, for instance, is useful in determining when or if key features of SI have been triggered in the target plant. Example 16 shows how to determine if the present SI system is functional in vivo in barley, an important example of a crop plant.
The following examples illustrate the invention.
Examples
Example 1 : Cloning & Characterisation of PrpS1r PrpS3 and PrpS8
Summary
A genomic clone of PrpSi was identified by nucleotide sequence analysis of a cloned 42 kb fragment carrying the S1 locus, obtained by screening a Papaver rhoeas S1S3 cosmid library with the pistil S, cDNA. A PrpS1: PrpS3 and PrpS8 cDNA clone were subsequently obtained using a combination of RT-PCR, 5'-RACE and 3'-RACE PCR.
Detailed methods Cloning and sequence analysis
A genomic DNA library from Papaver rhoeas S1S3 plants was constructed in SuperCosi (Stratagene) following the manufacturer's instructions. The library was constructed by BamHI/Xbal digestion and cloning into the BamHI/Xbal sites of SuperCosi . Screening the library with pistil S1 cDNA (see Figure 4; SEQ. ID no. 8) resulted in the isolation of a 42 kb fragment containing the pistil Sj allele. The DNA upstream and downstream of the pistil S1 allele was sequenced and analyzed using BLAST (http://ncbi.nlm.nih.gov/BLAST). ORF Finder
(http://searchlauncher.bcm.tmc.edu) [Worley et al. (1995) Genome Res. 5 173-184: An enhanced BLAST-based search tool that integrates multiple biological information resources into sequence similarity search results] and TMHMM (http://www.cbs.dtu.dk/services/TMHMM) [Krogh et al. (2001 ) J. MoI. Biol. 305, 567- 580: Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes]. The presence and organization of the final S1 locus sequence was confirmed by PCR on genomic DNA of Sr and non-S; containing plants.
The PrpS8 allele was obtained from pollen cDNA and genomic DNA of S3S8 plants by standard PCR techniques including 5' and 3' RACE using a PrPS1 primer (GCGACCGAAGTGGCATG; SEQ. ID. NO.1 ) at low annealing temperatures (48 0C). It was expected that further alleles of PrpS could be quite divergent from PrPS1 so 8 different primers were designed against regions of the sequence. 3' RACE was carried out using all 8 primers and then PCR products blotted and probed with PrpSp Products
amplified using one primer hybridised most strongly to the PφS, probe and therefore this primer was selected for use in further experiments.
To obtain PrpS3, degenerate primers were designed using PrPS1 and PrpS8 sequences (9 primer set combinations). This was followed by use of 3' and 5' Race primers to obtain and confirm full length PrpS3
Expression analysis
Standard PCR techniques including 3' and 5' RACE were used for expression analysis. Anthers from plants carrying the S1 allele at different stages of flower development were collected and total RNA was extracted using the RNAeasy plant mini kit (QIAGEN) following the manufacturer's instructions. After DNase treatment cDNA was synthesized using the standard Omniscript RT protocol (QIAGEN). PCR with primers against Papaver rhoeas glyceraldehyde-3-phosphate dehydrogenase (GAPD) transcripts was used as a control; gene-specific primers were used to amplify PrPS1 transcripts using 30 PCR cycles.
Production of antisera
The predicted 60 amino acid cytoplasmic C-terminus of PrPS1 was expressed as a HIS- tagged recombinant protein using pET21b (Novagen). Recombinant protein was isolated from E. coli (BL21 ) using Ni-NTA resin following the manufacturer's (QIAGEN) protocol. Antisera (PrpS1-60C) was raised in rats (ISL Immune Systems, Paignton,
UK).
Protein extraction for SDS-PAGE and Western blotting
Extracts enriched for membrane proteins from PrpSrcontaining pollen grown in vitro for 30 mins, leaf, stigma and root tissue were made with 100 mM Tris-HCI, 200 mM NaCI, 2mM EDTA, 1 M sucrose, 0.5% Triton X-100, and a cocktail of protease inhibitors (Roche Ltd) and protein concentrations were determined. Proteins were separated by 12.5% SDS-PAGE with a Mini-PROTEAN III system (BioRad) using standard procedures (Laemmli (1970) Nature 227, 680-685) and electroblotted (3 hrs at 400 mA). Hybond C membranes (GE Healthcare) were incubated with the PrpS1- 6OC antibody (1 :2000) for 2 hrs and alkaline phosphatase conjugated anti-rat secondary antibody (Sigma), and NBT/BCIP substrate used for detection.
Immuno-localisation
Papaver rhoeas pollen (S1ZS3) was grown in germination medium (GM; Snowman et al. (2002) Plant Cell 14, 2613-2626) for 1hr at 25°C before fixation with 2% paraformaldehyde for 1hr. Pollen tubes were collected and washed three times in Tris- buffered saline pH 7.4 (TBS), then in 15 mM MES buffer pH 5.0 before being treated for 10 mins with 0.05% cellulase and 0.05% macerozyme in MES, 0.1 mM PMSF and 1% BSA. 0.1% Triton X-100 in TBS was added for 10 mins and pollen tubes incubated with blocking buffer (TBS+1 % BSA) for 30 min, followed by incubation with the PrpS1- 6OC antibody (1 :500 in TBS+1%BSA) at 4°C overnight and then FITC-conjugated goat anti-rat antibody (1 :50) for 1.5 hrs. Pollen tubes were mounted on glass slides with Vectashield (Vector Laboratories, USA) and imaged using confocal microscopy (Bio- Rad Radiance 200MP; Nikon Diaphot). Single scan images were collected with a 100x plan-Apo 1.4 NA oil objective (Nikon). When preimmune antiserum was used instead of primary antibody, no signal was obtained using identical additions and settings.
Discussion
Analysis of the cosmid clone comprising the 42kb region of the Si locus first identified a novel putative open reading frame (ORF) in the vicinity of the S1 pistil gene (see Figure 5a). Expression analysis using RT-PCR revealed that the ORF was specifically transcribed in pollen, with maximum expression around anthesis. The temporal expression pattern is very similar to that of the pistil S gene (Foote et al. (1994) ibid). These data suggested that the ORF was a candidate for a Papaver pollen S gene (designated PrPS1). The genomic copy of PrPS1 comprises 1206 bp and has a predicted 94 bp intron near the 3' end of the gene (see Figure 5a). The full length corresponding cDNA (Figure 1a) obtained using RT-PCR, 3' and 5' RACE revealed a 579 bp ORF encoding a protein with a predicted Mr of 20.5 kDa, pi 7.55 (Figures 1b).
The subsequently cloned PrpS8 cDNA coding region was found to be 582 bp as shown in Figure 3a and encode a protein of predicted Mr 21.1 kDa, pi 6.57 (Figure 3b). As noted above, a high level of sequence polymorphism is a well-documented feature of other S locus proteins; S alleles have unusually high amino acid sequence divergence within species. Papaver rhoeas is no exception with the pistil S1 and S8 proteins having 63.7% identity (Kurup et al. (1998) Sexual Plant Reproduction JM , 192-198). PrpS also exhibits the level of polymorphism typical of an S locus product since the full length
PrpSi and PrpS8 sequences are only 58.9 % identical at the amino acid level (see Figure 5b). As indicated above, details of the cloned PrpS3 cDNA coding region are shown in both Figure 2a and Figure 5b.
A key requirement to maintain a functional SI system is that the pistil and pollen components must be genetically tightly linked at the S locus. As noted above, sequence analysis of the S1 cosmid showed that the PrPS1 and pistil S1 genes likely fulfill this requirement as their 3' ends are separated by only 467 bp (see Figure 5a). Analysis of a 6 kb fragment flanking the pistil S8 gene, obtained by inverse-PCR, did not reveal the presence of PφS8. Thus, the physical separation of the S8 locus genes is greater than that of their S1 locus counterparts. Considerable variation in the physical distance between S locus genes, up to several hundred kb, has previously been reported in Brassica (Boyes and Nasrallah. (1993) MoI. Gen. Genet. 236, 369-373; Casselman et al. (2000) Plant Cell .12, 23-24). To obtain evidence of genetic linkage between S8 and PrpS8, and between S3 and PrpS3, segregation analysis was conducted as detailed in Example 2.
PrPS1 encodes a protein with a predicted Mr of 20.5 kDa, pi 7.55. PrpS3 and PrpS8 encode proteins of predicted Mr of 20.9 kDa (pi 8.8) and 21.1 kDa (pi 6.57) respectively Sequence analysis indicated that PrPS1, PrpS3 and PrpS8 both have a predicted 35 amino acid extracellular domain and three predicted transmembrane domains (Figure 5b); the C-terminus is predicted to be cytosolic.
As noted above, neither PrPS1, PrpS3 nor PrpS8 exhibits sequence homology to any protein in existing databases. These data suggest that PrpS is a distinct type of transmembrane protein. In support of this, Western analysis using antisera raised against PrPS1 revealed that PrpS1 was detected specifically in Sj pollen membrane- enriched extracts and was not detected in cytosolic extracts. Analysis of Western blots revealed that the antisera detect the predicted -20 kDa PrpS product. Immuno- localization studies, investigating the distribution of PrPS1 , revealed a clear association with the pollen plasma membrane. This localization is consistent with the hypothesis that PrpS is a transmembrane receptor for the pistil S protein.
Example 2: Linkage analysis
In summary, linkage analysis was carried out on DNA extracted from individual plants from full-sib families segregating either for the haplotypes S1S3 and S3S8 or SiS8 and S3S8 using gene specific primers for both pistil S and PrpS, in order to demonstrate linkage of PrpS with pistil S and, therefore, the S locus.
Method
The genomic DNA from leaf of >30 plants from a single family segregating for SiS3 or
S3S8 was extracted using Nucleon Phytopure plant DNA extraction kit (Amersham
Biosciences). PCR was carried out on the DNA samples, testing for the presence of the
S), S3, Se genes and the PrpS^ Prp3 and PrpS8 genes, using gene-specific primers as follows
Si 5' primer - GGCATATGTTCTTTCCTGTTATTGAGGTGCGT (SEQ. ID no. 14)
31 primer - CCGGATCCTCAGGTTCGACCTTCCTTCC (SEQ. ID no. 15) S3 5' primer - CGCATATGATCGGCTTTACACGTATTCAAGTG (SEQ. ID no.16)
3' primer - CCGGATCCTCAGACTTCCTTCTCACCCATTCC (SEQ.ID no.17) S8 5' primer - CTTCTTGACCTTGGCCTCATCTCG (SEQ. ID no. 18)
31 primer - CTTCGCCAAATAATAGAGCTGCC (SEQ. ID no.19) PrPS1 51 primer - CAGGATCCGTTGCCATAAAAGCTA I I I I I GCTC (SEQ. ID no.20)
31 primer - GAATCCG CTTTTCCAG CGAG (SEQ ID. No.21) PrpS3 5" primer - CATGTGAAG G G AG AC ACTTGTC AG C (SEQ. ID no. 22)
31 primer - CCTAGACACCTAAAATTGTAATGGCTGC (SEQ. ID no. 23) PφS8 5' primer - GGGCACAGCTTCAGTAATGTACG (SEQ. ID. No. 24)
3' primer - GGCTGACGCAAAACTAATCCATCC (SEQ ID. No. 25)
Results
PrPS1 was amplified only from plants carrying S,, PrpS3 was amplified only from plants carrying S3 and PrpS8 was amplified only from plants carrying the S8 allele. The pistil S alleles S1, S3 and S8 were also amplified only from plants carrying the S1, S3 and S8 alleles respectively; the S3 allele was amplified from all S1S3 and S3S8 plants as
expected. This demonstrates linkage of PrpSu PrpS3 and PrpS8, and the pistil genes S,, S3 and S8 to their respective S loci, as there is no recombination (P <0.05%).
Example 3: Pollen inhibition in in vitro SI assays
Summary
A 15 amino acid peptide corresponding to part of the predicted external domain of PrpSi was tested for ability to block pollen tube growth inhibition in an in vitro SI assay in which pollen was grown on solid germination medium before SI induction using recombinant pistil S protein (Thomas and Franklin-Tong (2004) ibid). To confirm a functional role and allele specificity for PrpSi and PrpS8 in pollen tube inhibition, a gene specific antisense approach was also used with an in vitro SI assay.
Methods
Peptide bioassay
Based on the TMHMM (http://www.cbs.dtu.dk/services/TMHMM) prediction of PrPS1, a 15 amino acid residue peptide (DQKWWAFGTAAICD; SEQ. ID no. 26) corresponding to part of the predicted 35 amino acid residue external domain (see Fig. 5b) and two randomized versions of this peptide (1 :G WCAWI FDTAAQKD (SEQ. ID no. 27) and 2: FTVDVKDCAAAWGQI (SEQ. ID no. 28)) were synthesized by Alta Bioscience (University of Birmingham, UK). Using pollen from S1S3 P. rhoeas and S3S8 P. rhoeas, pollen inhibition was compared in the presence of S proteins alone (Sl-induced), with SI in the presence of PrpS peptide (Sl + peptide) or with SI in the presence of randomizd PrpS peptide (Sl + control peptide). Each peptide was mixed with recombinant S proteins for 20 mins at room temperature prior to adding to pollen, which was grown for 1 hr in vitro. Pollen grains and tubes were scored according to two categories: "inhibition" or "growth"; a minimum of 100 pollen grains/tubes was scored for each sample. Data were analysed using Fisher's Exact Test for 2 x 2 contingency tables.
Antisense oligo silencing of PrpS expression.
Phosphorothioated gene-specific antisense oligodeoxynucleotides (as-ODN) and their sense controls (s-ODN) were designed for PrPS1 and PrpS8 mRNA:
PrPS1 as-ODN: gtccTCCCAGTATTAttga (SEQ. ID no. 29) PrpS^ s-ODN: tcaaTAATACTGGGAggac (SEQ. ID no. 30) PrpSβ as-ODN: ttccCACCAGCACAGCaatt (SEQ. ID. No. 31 ) PrpSβ s-ODN: aattGCTGTGCTGGTGggaa (SEQ. ID. No. 32).
Pollen was grown in vitro and pre-treated with as-ODNs and s-ODNs for 1hr (Moutinho et al. (2001 ) Sexual Plant Reproduction .14, 101-104; de Graaf et al. (2006) Nature 444, 490-493) prior to induction of SI with recombinant Si, S3 and S8 proteins (Foote et al (1994) ibid). After 2 hours, pollen tubes were fixed in 2% paraformaldehyde and 50 pollen tube lengths were measured for each experiment. Each set of data presented in Figure 7 is the combined result of three independent experiments, thus 150 pollen tubes in total (n=3).
Results
Pollen from plants of haplotype S1S3 when challenged with incompatible S proteins was rescued from inhibition by PrpSi peptide (n = 6) whereas randomized peptides based on the same amino acids had no effect (n=3). The demonstration that the PrPS1 peptide blocked Sl-induced pollen tube inhibition indicates a role for PrpS in regulating Sl. As noted above, the antisense studies provided further evidence for this.
It was hypothesized that if a PrpS allele functions as the pollen S receptor, knockdown of its expression should result in alleviation of S-specific pollen tube inhibition. The pollen genotype/phenotype of plants carrying S1S3 alleles should theoretically be 50% S7 and 50% S3; those from plants carrying S3S8 should be 50% S3 and 50% S8 Thus, addition of as-ODN for PrPS1 should only affect pollen carrying the S1 allele, if the interaction is S-specific; furthermore, the theoretical maximum alleviation of inhibition by the as-ODN should be 50%, as only half of the pollen carries the S1 allele.
SI induced strong inhibition of pollen tube growth (a 79% reduction in length compared to the controls) and a significant alleviation of this inhibition was observed in an incompatible combination in the presence of corresponding as-ODN and not with corresponding s-ODN (Figure 7). Thus with pollen from plants carrying S1S3 alleles, SI induced strong inhibition of pollen tube length (22.1%, P=<0.001 , n=300). Addition of
as-PrpSj-ODN gave a significant recovery of S protein-treated tubes, 58.3% increase in length (P=<0.001 , n=150). As expected, the s-PrpS -ODN did not affect the SI response (P=0.591 , n=150). S-specificity was also demonstrated; as-PφSs-ODN did not alleviate Sl-induced inhibition when added to pollen from plants carrying S1S3 alleles (P=O.604, n=150). Using pollen from plants carrying S3S8 alleles, SI resulted in inhibited pollen tubes (19.8% of the control, n=300). Addition of the as-PφS8-ODN alleviated the SI induced inhibition, giving a highly significant 100.3% increase in pollen tube length (P=<0.001 , n=150), whereas there was little or no effect using as-PrpSr ODN or s-PφS8-ODN.
This data is consistent with the hypothesis that the PφS alleles encode a transmembrane protein that mediates S-specific recognition and pollen inhibition and is thus the Papaver pollen S-determinant. Such proteins are very different from both the other S determinants so far identified: the Brassica pollen SCR/SP11 and the pollen F- box protein SLF/SFB of the S-RNase based SI system.
Example 4: Production of transgenic Arabidopsis thaliana with a P. rhoeas SI system
The pistil Sr and pollen S1 genes of P. rhoeas obtained as above in a 42 kb genomic DNA fragment were used for the transformation study. 6.8 kb of the cloned S1 locus was introduced into Arabidopsis thaliana plants, strain Columbia-0. This fragment contains the coding sequences for pistil S, and pollen PφSj and 2.1 kb and 2.8 kb upstream promoter sequences respectively. Primers were designed with Notl restriction sites and the 6.8 kb S1 fragment (S1g6.8) was obtained by PCR with the original 42 kb genomic DNA clone as a template. S1g6.8 was sequenced and cloned into the Notl site of pGreen0029, a binary Ti vector which confers kanamycin resistance in plants together with the transgene (Helens et al. (2002) Plant MoI. Biol. 42, 819-832).
Agrobacterium strain GV3101 carrying the T-DNA plasmid with S1g6.8 was used for stable transformation of Arabidopsis plants by the floral dip method (Clough & Bent. (1998) Plant J. 16, 735-743).
40 transformed Arabidopsis plants (T1) were obtained by screening for kanamycin resistance of T0 seed, and the presence of the transgene cassette S1g6.8 was confirmed by PCR of pistil S1 and pollen PrPS1 genes.
Since both transgenes present on the 6.8 kb T-DNA fragment are linked, in the absence of a recombination event between both genes, they can be regarded as a "single" T-DNA and should show Mendelian genetics. Single copy insertions present in the T1 generation of AtPrSI plants, without affecting pollen viability, would be expected segregate in a 3:1 ratio. Instead, when backcrossed to wild-type plants, pollen from these plants with single T-DNA insertion segregate 1 :1.
Controlled pollinations by emasculation and manual pollinations, e.g. selfings and back -crosses to wild-type Arabidopsis plants, were carried out of several T1 Arabidopsis plants (BG06 Arabidopsis line: AtPrSI) and the segregation of kanamycin resistance analysed. In a normal situation, that is without changes in pollen and/or pistil functions, a 3:1 ratio (K+ vs. K-) is expected. However, a couple of the AtPrSI plants showed a 2:1 segregation ratio after self-pollination. Remarkably, pollination of these AtPrSI plants with wild type pollen or pollination of Arabidopsis Columbia-0 plants with AtPrSl pollen (heterozygous) showed segregation percentages as indicated above (1:1 ).
These results suggest that the transfer of the S1g6.8 cassette by AtPrSI pollen is affected in AtPrSI plants. The analysis, including silique size, of the T2 generation (10 plants per independent AtPrSI line) resulted in 70% 'normal' siliques (25-30 mm) and 30% with 'smaller' siliques (between 10 and 15 mm). Random segregation analysis of the T3 generations showed that all T2 generation plants with smaller siliques were homozygous for the T-DNA. These results indicate that pollen germination, tube growth and fertilization are affected in AtPrSI plants. The expression of Papaver rhoeas S1 and PrPS1 in Arabidopsis pistils and pollen, respectively, results in reduced seed set.
In a second set of experiments, a chimeric pollen PrpSrGFP gene was constructed for localization studies in pollen by transient expression and in pollen of stably transformed Arabidopsis plants. The chimeric gene comprises a green fluorescent protein (GFP) cDNA fused in frame with the 3' end of the genomic copy of PrPS1 (gPrpS^. For the expression of this fusion protein use was made of the upstream promoter and 3' terminator sequence of ntp303, a Nicotiana tabacum gene which as previously noted
above is known to be specifically active in pollen, including Papaver rhoeas and Arabidopsis pollen. Again we made use of the pGreen0029 T-DNA plasmid for construction of the chimeric gene ntp303p-gPrpS1-GFP-3'utr303.
Agrobacterium mediated transformation of Arabidopsis Columbia-0 plants (see above) and screening for kanamycin resistance resulted in 35 T1 plants (BG16 Arabidopsis line) of which pollen was analyzed by fluorescence microscopy for the expression of PrpS^GFP fusion protein. Segregation analysis of a subset of these plants with single insertion of the transgene showed normal (3:1 ) ratios, demonstrating that the expression of PrpSrGFP did not affect Arabidopsis pollen germination, tube growth and fertilization.
Pollen from BG16 plants expressing PrpSrGFP was used in an in vitro SI assay as developed for Papaver pollen (Foote et al. 1994 ibid) but adjusted for Arabidopsis pollen. Pollen was cultured on agarose in Arabidopsis pollen germination medium (GM). Pollen was grown in GM only or in the presence of recombinant Papaver rhoeas PrsSi, PrsS3l PrsS8 or PrsS3+ PrsS8 pistil proteins. Papaver pollen (S1 S8) grown in Arabidopsis pollen GM was used as a control.
The germination and pollen tube growth of BG16 pollen was unaffected in the presence of poppy recombinant PrsS3 or PrsS8 proteins or PrsS3+ PrsS8 proteins. Adding PrsS1 proteins resulted in a 50% reduction of pollen germination and all the non- germinating pollen grains were identified as PrpSrGFP expressing pollen. This experiment thus unequivocally demonstrated that the expression of PrPS1 (PrpSi-GFP) proteins in Arabidopsis pollen makes this pollen express a "PrpS1" phenotype that is recognized when it interacts with poppy PrsSi protein but not with PrsS3 or PrsSδ recombinant proteins. In other words, cognate sS1 and pS1 pairs render a "self- incomaptible" with the result that this pollen is inhibited.
Example 5 - Materials generated
(1) PrpS and PrsS constructs put into Arabidopsis
This was done in accordance with the assistance of Dr. Barend de Graaf, Cardiff University.
Stable transformants - transgenic Arabidopsis thaliana lines:
T0 is seed collected after floral dip, to screen for primary transformants.
T1 is seed from primary transformant numbering: BG06.1., BG06.2 etc
T2 is seed from second generation plants from a single T1 plant: 6.1.1., 06.1.2 etc sometimes with 'HET' (heterozygous) or 'HOM' (homozygous)
The following Arabidopsis thaliana (At) cell lines were generated (AtBGOI , 02 etc.), see below, where Kan = Kanamycin; pGr0029 = Pgreen (A vector has been developed where the three major components of a plasmid have been optimised for the improvement of plant transformation via Agrobacterium see http://www.pgreen.ac.uk/ for details); STIG1 = stigma-specific promoter from Celestina Mariani lab. (NL) [Stigi is a 12-kD protein called stigma-specific protein 1 (STIG1 )].
Controls
AtBGOI => pGr0029 control T (Kan in plants) AtBG04 => pGrO229 control T (Bar in plants) AtBG05 => pGr0029 control T (Kan)
Whole S-locus (?including poppy promoters)
AtBG06 => pGr-S1g6.4 (pGr0029 / Kan) whole S1 locus = pistil S1 & PrpS1
AtBGOδ => pGr-S1g6.4 (pGrO229 / Bar) whole S1 locus = pistil S1 & PrpS1
Constitutive expression of PrpS (S35 promoter)
AtBG02 => pGr35S-PrpS1A (in pGr0029 / Kan) PrpS1 AtBG03 => pGr35S-PrpS1G (in pGr0029 / Kan) PrpS1 genomic
Tissue-specific expression of PrpS8 (PrpS1 promoter)
AtBG14 => PrpS1p-PrpS8G-nosT (in pGr0029 / Kan) PrpS8 genomic with. Si- locus promoter
AtBG15 => PrpS1p-PrpS8G-nosT (in pGr0229 / Bar) PrpS8 genomic with. Si- locus promoter
GFP constructs so can track PrpS
AtBG11 => PrpS1 p-PrpS1G-GFP-303utr (in pGr0029 / Kan) PrpS1 genomic- GFP
AtBG 16 => pGr-NGC-PrpS1G (in pGr0029 /
Kan - NGC = bombardment cassette) PrpS1 genomic- GFP w. ntp303promoter for high expression
AtBGI 7 => pGr35S-PrpS1G-YFP (in pGr0029 / Kan) PrpS1 genomic-YFP
Pistil (stigma) S8 (tissue-specific expression)
AtBG 12 => S1p-S8-nosT (in pGrO229 / Bar) stigma S8 AtBG 13 => STIG1p-S8-nosT (in pGrO229 / Bar) stigma S8 with. STIG1 should be higher expression
Example 6 - Construction of four further expression vectors
We have generated a number of additional lines of transgenic Arabidopsis for experimental studies. These comprise: pollen PrpS3-GFP and PrpS8-GFP, as well as pistil PrsS1 and PrsS3.
Having these Arabidopsis lines allowed us to perform reciprocal pollinations using combinations of different alleles of the gene to check specificity as well as function. The combinations include: PrpS1-GFP, PrpS3-GFP or PrpS8-GFP with PrsS1 , PrsS3, PrsS8.
6.1 - Prps3-GFP
Construction of pGreen0029-NTP303-Prps3-GFP-303utr
The following flow diagram shows the protocol for construction of pGreen0029- NTP303-Prps3-GFP-303utr:
PCR product with adding Nco I/BamH I sites of cPrps3 from related plasmid
ligation of PCR product into pDπve
— NTP303-STMlG-GFP-303utr (from BG)- pDrive-Pφs3
Cut with Nco I/BamH I Cut with Nco I/BamH I to get cPrps3 to remove STMlG
Recovery of backbone of pGreer>0029 --Nco I— cPrps3 — BamH I—
Lligation overnigh pGreen0029-NTP303-Pφs3-GFP-303utr ( Labelled as pNGC-Prps3)
6.1.1 Ligation of cPrps3 into pDrive
Two primers of:
SEQ ID NO: 33: 5' TCCCCATG G C ACG AAATAG ACATG C 3' (sense, Nco I site underlined); and
SEQ ID NO: 34 5' TATGGATCCAGCCTCATTAGGACATGG 3' (anti-sense, BamH I site underlined): were used to get the PCR product of cPrps3. After ligation into pDrive, double enzymatic digest of Nco I/BamH I was performed to check the recombinant plasmid.
Clone 2 was sequenced for confirmation. cPrps3 was ligated into pDrive and the recombinant plasmid was named as HZpDrive-Prps3.
6.1.2 Ligation of cPrps3 into pGreen0029 expression vector
The recombinant plasmid of pDrive-Prps3 was digested by Nco I/BamH I to release the cPrps3. cPrps3 was then ligated with the backbone of the expression vector pGreen0029-NTP303-Prps8-GFP-303utr digested with the same double enzymes. After ligation the recombinant plasmid was checked by digesting with Hpa I/Pst I.
Figure 4 showed that the cPrps3 was probably ligated into pGreen0029. The following sequencing result also confirmed this (Figure 5) and this recombinant plasmid was named as HZpNGC-Prps3.
6.2 Prps8-GFP
Construction of pGreen0029-NTP303-Prps8-GFP-303utr
The following flow diagram shows the protocol for construction of pGreen0029- NTP303-Prps8-GFP-303utr
PCR product with adding Nco 1/Bgl II sites of cPφsδ from related plasmid
ligation of PCR product into pDnve
— NTP303-STM 1 G-G FP-303utr ( from BG)- pDπve-Prps8
Cut with Nco I/BarnH I Cut with Nco I/Bgl II to get cPrpsδ to remove STMlG
Recovery of backbone of pGreen0029 --Nco I— cPrps8 — BgI li¬
Lligati oonn oveπughi pGreenOO29-NTP3O3-Prps8-GFP-3O3utr ( Labelled as pNGC-Prps8)
6.2.1 Ligation of cPrpsδ into pDrive
Two primers of:
SEQ ID NO: 35: 5' TGCCCATGGCACGACATGCAATTGTTGTTC 3' (sense, Nco I site underlined); and
SEQ ID NO: 36: 5' CGAAGATCTAACCTCAACACTACGGTGGG 3' (anti-sense, BgI Il site underlined); were used to get the PCR product of cPrpsδ. After ligation into pDrive, double enzymatic digest of Nco I/Bgl Il was performed to check the recombinant plasmid.
Clone 6 was sequenced for confirmation. cPrpsδ was ligated into pDrive and the recombinant plasmid was named as HZpDrive-Prpsδ.
6.2.2 Ligation of cPrpsδ into pGreenOO29 expression vector
The recombinant plasmid of pDrive-Prpsδ was digested by Nco I/Bgl Il to release the cPrpsδ. cPrpsδ was then ligated with the backbone of the expression vector pGreen0029-NTP303-Prpsδ-GFP-303utr digested with Nco l/BamH I. After ligation,
the recombinant plasmid was checked by digesting with Nco 1/BamH I (There is a BamH I site inside the cPrpsδ sequence).
Electrophoresis result showed that the cPrpsδ was ligated into pGreen0029. Sequencing confirmed this. This recombinant plasmid was named as HZpNGC-Prpsδ.
6.3 STIG1-S1
Construction of pGreen0229-STIG1-S1-nosT
The following flow diagram shows the protocol for construction of pGreenO229-STIG1- S1-nosT
PCR product with adding Nco I/Not I sites of cPistil Sl from related plasmid
Ligation of the PCR product into pDπve
— STMlp-S8-nosT-X (from BG)- pDπve-S 1
Cut with Nco 1/ Not ] Cut with Nco I/Not 1 to get cPistil Sl to remove S 8
Recovery of backbone of pGreenO229 --Nco I— cPistil Sl -- Not 1 —
Ligation overnight
pGreen0229-STIGl-Sl-nosT— X (Labelled as Stiglp-Sl-nos)
6.3.1 Ligation of S1 into pDrive
Two primers of:
SEQ ID NO: 37: 5' GCCCCATGGGCAACATATTTTATGTTATTGTGCTG 3' (sense, Nco I site underlined); and
SEQ ID NO: 38: 5' AATGCGGCCGCTCAGGTTCGACCTTCCTTCCTTTC 3' (anti- sense, Not I site underlined); were used to get the PCR product of Sl After ligation into pDrive, double enzymatic digest of Nco I/ Not I was performed to check the recombinant plasmid. And then the third clone was chosen for sequencing for further conformation. S1 was ligated into pDrive and the recombinant plasmid was named as HZpDrive-S1.
6.3.2 Ligation of S1 into pGreenO229 expression vector
The recombinant plasmid of pDrive-S1 was digested by Nco I/Not I to release the S1. S1 was then ligated with the backbone of the expression vector pGreenO229-STIG1- S8-nosT digested with the same double enzymes. After ligation the recombinant plasmid was checked by digesting with Nco I/Not I. Electrophoresis results showed that the S1 was ligated into pGreen0029 (figure 13). Sequencing confirmed this. This recombinant plasmid was named HZStig1p-S1-nos.
6.4 STIG1-S3
Construction of pGreen0229-STIG1-S3-nosT
The following flow diagram shows the protocol for construction of pGreenO229-STIG1- S3-nosT
PCR product with adding Nco I/Not I sites of cPistil S3 from related plasmid
Ligation of the PCR product into pDrive
— STMlp-S8-nosT-X (from BG)- pDrive-S3
Cut with Nco I/ Not I Cut with Nco I/Not I to get cPistil S3 to remove S8
Recovery of backbone of pGreen0229 --Nco I— cPistil S3— Not I —
Ligation overnight
pGreen0229-STIGl-S3-nosT— X (Labelled as Stigl p-S3-nos)
6.4.1 Ligation of S1 into pDrive
Two primers of:
SEQ ID NO: 39: 5' GCCCCATGGGCAAGATATTGTGCGTTATTGTGCTTC 3' (sense, Nco I site); and
SEQ ID NO: 40: 5' AATGCGGCCGCTCAGACTTCCTTCTCACCCATTC 3' (anti- sense, Not I site); were used to get the PCR product of S3. After ligation into pDrive, double enzymatic digest of Nco I/ Not I was performed to check the recombinant plasmid. And then the
third clone was chosen for sequcencing for further conformation. S3 was ligated into pDrive and the recombinant plasmid was named as HZpDrive-S3.
6.4.2 Ligation of S3 into pGreen0029 expression vector
The recombinant plasmid of pDrive-S3 was digested by Nco I/Not I to release the S3. S3 was then ligated with the backbone of the expression vector pGreenO229-STIG1- S8-nosT digested with the same double enzymes. After ligation the recombinant plasmid was checked by digesting with Nco I/Not I. Electrophoresis results showed that the S3 was ligated into pGreen0029. Sequencing confirmed this and this recombinant plasmid was named as HZStig1p-S3-nos.
Example 7 - Transformation of the four constructs into Agrobacterium
These 4 constructs together with pSop plasmid were transformed into competent Agrobacterium cells. 3-4 days later, monoclones were found. Several monoclones of each construct were selected for culture overnight in LB+Kan++Tet++Rif liquid medium and then extracted plasmids from these transformants. Then the plasmids from Agrobacterium were transformed into DH5α. Monoclones of DH5α transformants were selected for culture in LB+Kan++Tet++Rif liquid medium and extracted plasmids from these transformants again. Finally, the plasmids from DH5α transformants were checked by digesting with enzymes. The 4 constructs were all successfully transformed into Agrobacterium.
These constructs were called HZDHδαXXX (PrpS3, 8, S1, S3).
Example 8 - Infection of Arabidopsis via floral dipping
After floral dipping, we collected seeds, and selected the transformants via antibiotic and basta resistances.
Example 9 - Seed and progeny
• We now have TO and T1 seed of all of these HZ-lines.
• We are currently selecting the T1 transformants for antibiotic and basta resistances.
• These have been tested for inserts using PCR, and we will shortly test for level of expression in flowers using RT-PCR.
Example 10 - Analysis of transformed lines of Examples 6-9
To date, all analysis has been carried out on At line BG16 (carrying PrpS1-GFP).
Methods
MEASUREMENT OF LENGTH AND % GERMINATION
Pollen grains from the second transformant lines of AtBG16 (BG16.7.4, BG16.8.3, BG16.15.1 , BG16.15.2 and BG16.15.3), generated by Barend de Graaf, and wild type CoIO were germinated and pictures taken under the 1Ox objective at time intervals using a Nikon eclipse Tε300 inverted microscope and the Nikon Imaging Software elements BR3.0 program. The experiment included six technical replicates and two biological replicates. Randomised samples of one hundred pollen tubes/grains were analysed per biological replicate (n=100x2) and the number of grains and tubes were counted and the length of the tubes was measured using the NIS elements BR3.0 software package.
IN VITRO SI INDUCTION
The same type of set-up as used for Papaver "In vitro SI induction" was used; see (Snowman, 2002). This comprises germinating pollen in vitro on slides in the presence of recombinant PrsS proteins. In an incompatible combination this gives an incompatible response, i.e. pollen rejection and inhibition. Several downstream events are triggered in incompatible pollen and are used as markers for SI in Papaver (see (Geitmann et al., 2000; Thomas and Franklin-Tong, 2004; Bosch and Franklin-Tong, 2007; Poulter et al., 2008), and (Bosch et al., 2008) for a recent review.
For the experiments described below, the in vitro SI induction was as follows: pollen from BG16.8.3, wild type CoIO and P. rhoeas plants were germinated in the appropriate pollen growth medium on multiwell slides. Recombinant PrsS (see below) was added where required to a final concentration of 20 μg ml-1. PrSS1 proteins were denatured by boiling for 5 minutes. The test experiment consisted of BG16.8.3 grown in the presence of S1 proteins. The controls included CoIO alone, CoIO with PrSS1 and PrsS8 proteins, BG16.8.3 alone, BG16.8.3 with denatured PrSS1 and BG16.8.3 with PrsS8 protein. P. rhoeas were grown alone, in the presence of S1 and in the presence of both PrSS1 and PrsS8. The experiment had two technical replicates and three biological replicates (n= 100x3).
PrsS PROTEINS
Recombinant PrsS proteins (PrSS1 and PrsS8) (Foote et al., 1994; Walker et al., 1996; Kakeda et al., 1998) were dialysed overnight at 40C from Tris buffer into 13.5% growth medium. To determine which concentration of PrsS was needed to induce Sl, the PrsS-proteins were diluted to a final concentration of 5 μg ml"1, 10 μg ml"1 and 20 μg ml" 1 when added to the germinating BG16.8.3 pollen in vitro.
MICROSCOPY AND SCORING CRITERIA
Randomised samples of 100 pollen grains/tubes were analysed per biological replicate under the 10x objective using a Nikon ε400 microscope and the Cellp Soft Imaging System for Life Science microscopy program. Pictures were taken simultaneously under brightfield (with an exposure time of 50 ms at a CCD gain of 0) and with 492/18x Single Band Blue exciter for FITC (with an exposure time of 1 s at a CCD gain of 200). The number of pollen grains and tubes were scored according to the scoring criteria, as shown in Table 1 below.
Evans blue staining
Viable cells are not stained. Non-viable (dead) cells are stained dark blue with this viability stain. Pollen was stained with 0.05 % Evans blue for 15 minutes. After incubation, samples were washed to remove excess dye. 20 μL of sample was mounted on a microscope slide and pollen was visualised using brightfield microscopy (Nikon Eclipse Tε300). Scoring categories were: unstained (live), heavily stained (dead). Each experiment was repeated 3x with 180 pollen counted each time.
STATISTICAL ANALYSIS
X2 test was used for segregation analysis and one-way analysis of variance (ANOVA) was used to test for the significant difference between experiment and controls.
Table 1. Scoring criteria for the pollen grains and pollen tubes, as observed under the 1Ox objective of the Nikon microscope.
RESULTS
GERMINATION AND LENGTH
Purpose: Before any studies could be undertaken, it was important to establish whether the transgenic pollen behaved as normally as wild type CoIO pollen.
The germination of A. thaliana pollen is a laborious process and showed considerable variation. It is well known that A. thaliana pollen is notoriously difficult to grow, with highly variable results (Johnson-Brousseau and McCormick, 2004). Pollen was germinated on liquid pollen growth medium and the percentage germination and lengths of pollen tubes were recorded, using the scoring criteria indicated in Table 1. We compared if the AtBGI 6 lines differed significantly from the wild type CoIO. Oneway ANOVA confirmed that the percentage germination and mean length of pollen tubes were not significantly different from the wild type CoIO (p=0.477 and p=0.996
respectively, n=100x2). Hence, the inserted genes did not affect the behaviour of the pollen grains, that is, pollen hydration and germination were as normal wild type.
SEGREGATION ANALYSIS
The primary transformants of the AtBG16 lines were believed to be heterozygous and a segregation analysis was performed to verify this. Since the transgenic plants had kanamycin resistance marker to distinguish them from untransformed plants, the seeds from the primary transformants were sterilised and plated on growth medium containing the kanamycin antibiotic. Those that were homozygous or heterozygous for the inserted gene would grow on the kanamycin growth medium, while those that lacked the transgene would die.
X2 test confirmed that the primary transformants had a normal expected segregation ratio of 3:1 (X2= 5.52, p>0.05, n=100x3). Pollen containing the PrPS1 transgene behaved like wild type CoIO pollen and had no problem in hydrating, germinating and fertilising ovules to produce viable seeds. Therefore, the inserted PrPS1 gene linked to GFP did not interfere with the normal functioning of pollen grains.
IN VITRO SI ASSAY
In order to assess the functional role of the PrPS1 gene from P. rhoeas in A. thaliana, pollen from BG16.8.3 was challenged with recombinant PrSS1 proteins (20 μg ml"1) in the appropriate pollen growth medium, using the "in vitro SI induction", as described earlier. Denatured S1 proteins and S8 proteins were included to verify that active S proteins were responsible for SI induction and that SI response was triggered in an S- specific manner.
As a control, to verify that the PrsS proteins were functional in the in vitro SI system, germination of poppy pollen was tested. This was significantly reduced with high concentration of S1 and S8 proteins (p=0.000, n=100x3). This is illustrated in Figure 8. Since pollen from P. rhoeas, carrying the S1- and S8-haplotype, was used, it was expected that in the absence of S proteins, the majority of tubes would germinate (50% ± 0) and that addition of S1 protein would inhibit the PrPS1 expressing pollen tubes alone, such that only the PrpS8 expressing pollen tubes could germinate (29.7% ± 0.577, p=0.000, n=100x3). The best interpretation for this is that those pollen which expressed PrPS1, bound their cognate PrSS1 proteins and were inhibited, while the
tubes that expressed PrPS8 were not inhibited because PrSS1 protein was not their cognate ligand. They therefore grew normally. Addition of both PrsSi and PrsS8 proteins caused most of the tubes to be inhibited (1% ± 1 , p=0.000, n= 100x3), as predicted, as SI was induced.
CoIO was unaffected by PrsS proteins (Figure 9, p=0.760, n=100x3). Since it was untransformed, it did not express the PrPS gene and was therefore self-compatible and did not express GFP. Moreover, the percentage germination was not significantly different between BG16.8.3 and CoIO (p=0.400, n=100x3).
Figure 10 summarises the effect of recombinant PrsS proteins on the germination of BG16.8.3 pollen (analysis of all pollen). It was expected that in the presence of PrsSi protein, the percentage germination of BG16.8.3 pollen would decrease, but not all of the pollen would be affected, as these plants are segregating (as they are not homozygous lines), and only about 50% of the BG16.8.3 pollen tubes were expected to express the PrPS1 gene fused to GFP. Thus, only the PrPS1 expressing pollen tubes would be expected to be inhibited. Although the percentage germination of BG16.8.3 did decrease upon addition of PrSS1 (see Figure 10) it was not a statistically significant fall in germination (p=0.315, n=100x3). This is probably because only half of all pollen is expressing PrPS1 and only these would be expected to be inhibited.
Denatured S1 protein was expected to be inactive and incapable of inducing Sl; there was no significant difference in germination of BG16.8.3 pollen (p=0.720, n=100x3). Similarly, the percentage germination of BG 16.8.3 was expected to be unaffected by PrsS8 protein because BG16.8.3 was transformed with PrPS1 gene, which was inhibited specifically with PrSS1 proteins and not PrsS8 proteins; there was no significant difference observed in the percentage of germination of BG16.8.3 pollen tubes (p=0.804, n=100x3).
In summary, Figure 10 shows the % germination of pollen tubes with different S proteins. There was no significant difference observed in the percentage germination of BG16.8.3 pollen tubes subjected to various treatments (p=0.315, n=100x3).
As predicted (see Figure 11), when we focused our analysis on just the percentage of germinated tubes which expressed the PrPSrGFP, the effect was much better than
that in Fig 10. We plotted only the pollen that was seen to be expressing GFP (assessed by microscopy). When we did this, no transgenic pollen tubes expressing PrPSi germinated in the presence of active S1 proteins. This was a highly significant result (p=0.000, n=100x3). In the presence of PrsSi proteins, no transgenic tubes that expressed GFP germinated because they expressed the PrPS1 gene (Figure 10). This could be interpreted as being due to the PrPSi interacting with the PrSS1 proteins in the growth medium, resulting in the arrest of pollen tube growth.
Those tubes that did grow in the presence of PrSS1 proteins lacked the PrPS1 gene and did not express GFP. Thus, in the absence of S1 proteins, or in the presence of PrsSδ protein or biologically inactive PrsS1 , inhibition of PrPS1-GFP pollen was not observed, and there was no significant difference in the percentage of germination of BG 16 pollen tubes expressing PrPS1-GFP in the other control treatments (p>0.05, n=100x3). Denatured PrSS1 protein was biologically inactivate and incapable of inducing SI and also acted as a control. As expected, the effect of denatured PrSS1 proteins on BG16.8.3 tubes was not significantly different from untreated samples in the (p=0.963, n=100x3). Similarly, the percentage of germinated BG16 pollen tubes expressing GFP was expected to be unaffected by PrsS8 proteins because BG16.8.3 was transformed with PrPS1 gene and PrsS8 proteins had no significant effect on the percentage of GFP- expressing BG16.8.3 vs untreated samples (p=0.124, n=100x3). This clearly demonstrates the S-specificity of the effect of the pistil S determinant PrsS1 on BG-16 GFP-expressing pollen PrPS1 with its complementary PrSS1 ligand.
In summary, transgenic A. thaliana lines, expressing the PrPS1 gene fused to GFP (a BG 16 line), show that SI is mediated by PrPS expression in A. thaliana pollen in the presence of active recombinant poppy PrSS1 proteins. Recombinant PrsS proteins inhibit pollen tube growth in an S-specific manner. The poppy SI system which was introduced into A. thaliana worked in the presence of its active complementary PrsS protein alone. This confirms that the poppy PrPS gene is functional in A. thaliana. The recombinant poppy pistil PrSS1 protein and the pollen protein, PrPS1 expressed in A. thaliana alone were sufficient to induce S-specific pollen inhibition in A. thaliana. This suggests that the events downstream of the interaction are well conserved in unrelated species, and are likely be present in all species where the SI system might be transferred to. Thus, this data provides a strong basis for believing that the poppy SI system can be transferred to other species.
We have also performed other studies on line BG16 (Pollen PrpS1 ) to further establish that poppy SI is functional in Arabidopsis, using recombinant PrsS proteins to challenge pollen grown in vitro. These studies are also using the "in vitro Sf system (addition of recombinant PrsS1 protein to induce SI in PrpS1 -containing pollen).
Example 11 - Viability results - effect of addition of recombinant PrsS1 protein on AtBGI 6 pollen
We used Evans blue to test for viability of At-BGI 6 (containing PrpS1 ) pollen grains that were given an "in vitro Sl" treatment (challenged with recombinant PrsS in vitro- see above for methods). This resulted in a reduction in viability of BG16 with PrsS1 added compared to wild type pollen challenged.
Figure 12 shows the viability of Arabidopsis wild type pollen (blue bars) and pollen expressing PrpS-GFP (yellow bars) at t=0 h and t=2 h in the absence and presence of poppy recombinant female S-determinant PrsSi.
Figure 13 shows the viability of Arabidopsis wild type pollen (black bars) and pollen expressing PrpS-GFP (yellow bars) at t=0 h and t=4 h in the absence and presence of poppy recombinant female determinant PrSS1.
Figure 14 shows the viability of Arabidopsis wild type pollen (dark green bars) and pollen expressing PrpS-GFP (yellow bars) at t=0 h and t>8 h in the absence and presence of poppy recombinant female determinant PrSS1.
In summary:
BG16 + PrSS1 has 35 times lower viability compared to WT+Sτ pollen at t=2 h.
- BG 16 + PrSS1 has 53 times lower viability compared to WTH-S1 pollen at t=4 h.
- BG 16 + PrSS1 has 45 times lower viability compared to WT+Sτ pollen at t>8 h.
Decreased viability in Arabidopsis pollen expressing PrPS1 suggests that death is triggered in some of the BG 16 pollen (again, note that only 50% of the pollen is expected to carry PrpS1 , so only half will be expected to respond).
This suggests that programmed cell death (PCD) may well be triggered by "in vitro Sl" in BG16, further suggesting that poppy SI mechanisms may be triggered in Arabidopsis when the right PrpS-PrsS combination is used.
This will be explored next, together with tests for specificity (challenge with recombinant PrsS3 or 8).
Example 12 - in vivo pollination data - aniline blue assessment
Analysis of pollinations using aniline blue staining to visualize (UV x10 and Bright Field x 10) pollen grains and tubes, allowed us to assess pollen rejection for the different crosses.
Pistils of Arabidopsis line HZ1 were emasculated prior to anthesis and left to mature. They were then pollinated with BG 16 pollen and left overnight. Pollinations were made in pair-wise combinations, so we used exactly the same BG16 pollen (prpS1 ) on both wt and HZ stigmas to give a proper comparison. Controls comprised wildtype pistils pollinated with BG 16 pollen to check that pollen was viable and functioning properly. HZ pistils were also pollinated with wildtype pollen for controls to ensure they were normal and functional.
The pistils were then harvested and placed in aniline blue, left for several hours and then viewed using UV microscopy.
Crosses were attempted with HZ1 independent transfomants (Hz1.3 and Hz1.5): HZ1.3 x BG16 and HZ1.5 x BG16. Each cross was replicated with BG16 pollen on two HZ stigmas; the control was BG16 pollen on a wild type stigma. The results for the wt stigma cross with BG16 pollen was normal, showing lots of long (stained) pollen tubes growing down into the style. However, the results for the HZ1.3 stigmas showed markedly different staining patterns to the control pollination (BG16 x wt), even though the pollen is all from the same sample. In the HZ1.3 stigmas, the staining was
concentrated at the top of the pistil, showing evidence of inhibited pollen grains and pollen tubes providing evidence that at least some of the pollen was inhibited. As BG 16 plants are heterozygous, only 50% of pollen produced will be PrpS-GFP, so only 50% should be inhibited. Thus, we expect a "half-compatible response, with 50% pollen inhibited and 50% growing normally. There is certainly evidence of inhibition in this HZ1.3 x BG16 cross, especially if one compares it with wild type controls.
Similar patterns were seen for the HZ1.5 x BG16 cross and its accompanying control (wt stigma x BG16 pollen).
The data shows that there is rejection of cognate PrpS1 pollen when a PrsS1 pistil (the HZ1 line expressed PrsS1) is pollinated with BG16 (again expressing PrpS1) pollen. In some instances the rejection appears to be very marked. This data shows that the BG 16 pollen and, therefore, the present SI system is functional in vivo.
Example 13 - in vivo pollination data using combinations of PrpS1-GFP, PrpS3- GFP or PrpS8-GFP with PrsS1, PrsS3, PrsS8
Example 12 is repeated in vivo using combinations of PrpS1-GFP, PrpS3-GFP or PrpS8-GFP with PrsS1 , PrsS3, PrsSδ in pairwise comparisons respectively.
Crosses in different PrpS-PrsS combinations were made to obtain expected "self, "cross" and control (vs wt) combinations. For example (using plants with PrsS as female recipient, and plants with PrpS as male pollinator): PrsS1 x PrpS1 , PrsS3 x PrpS3 and PrsSδ x PrpSδ are expected to be incompatible (no seed); PrsS1 x PrpS3, PrsS1 x PrpSδ, PrsS3 x PrpSδ are expected to be compatible (seed), and these lines vs wild type should all set seed.
Crosses can also be performed between the lines produced, to generate lines with the S-locus allelic pairs together. We can then perform further functional crossing tests, as outlined above, on these lines.
Example 14 - Biochemical/cell biology analysis
The purpose of this experiment is to ascertain if key features of SI are triggered This approach can be used to identify whether key features such as programmed cell death (PCD) of incompatible pollen of Poppy SI are triggered in incompatible combinations of PrpS-PrsS in Arabidopsis. This provides evidence that the mechanisms triggered by SI are triggered in the "self (incompatible) combination interaction, i.e. confirming that rejection is due to this effect.
This is tested using combinations of cell lines containing PrpS1-GFP, PrpS3-GFP or PrpS8-GFP with PrsS1 , PrsS3, PrsSδ, respectively, in pairwise comparisons. Where "cognate" pairwise combinations are used, i.e. "incompatible" combinations (eg sS1 & pS1 , sS3 & pS3, sS8 & pS8) these result in PCD, and where controls were employed using non-cognate pairs, i.e. compatible combinations (e.g. sS1 & pS3, sS1 & pS8, sS1 & pS8, sS3 & pS1, sS3 & pS8, Ss8 & pS3) or wild-type controls, no PCD results.
The following approaches were used:
(1) Test for cell viability. This is a quick test to check if cells were dead, as a precursor to testing for PCD. This employs viability stains, such as Evans blue or propidium iodide (dead cell stains), or fluorescein diacetate (a live cell stain). Incompatible combinations result in cell death, while compatible or controls do not undergo PCD, so no dead cells above basal background levels are detected.
(2) TUNEL assays &/or caspase assays are used to assess if programmed cell death (PCD) is triggered in an incompatible combination (and not a compatible combination). TUNEL protocols use procedures to assess levels of DNA fragmentation, which is an end-product of PCD, as described in Thomas et al (2004). Caspase assays involve production of cell extracts after the interaction and measurement of these extracts to ascertain whether caspase activity is triggered. This is, detected by using a fluorescent substrate to assess the cleavage activity (using methods as described in Bosch et al (2007). Incompatible combinations result in PCD so stain positive with TUNEL, while compatible or controls do not undergo PCD, so are TUNEL-negative.
(3) Alterations in actin cytoskeleton are triggered specifically in incompatible and not in compatible combinations. Typical experiments use rhodamine-phalloidin staining of fixed pollen tubes and are visualized using fluorescence microscopy. Incompatible reactions are characterized by actin depolymerisation and formation of large actin foci later (see Geitmann et al 2000; Snowman et al 2002). Incompatible combinations result in deploymerization and later formation of large actin foci, and compatible or controls display normal actin arrays.
Example 15 - Other Cell Lines
Further cell lines (we have already generated one called BG03), with constitutive expression of PrpS1 , have been used to test for signs of PCD after addition of poppy recombinant PrsS1 protein in leaf tissue. This ascertains if this system can be used in other cells types to trigger PCD or death. This experiment confirms whether the system might be used for ablation of particular cell types if the correct tissue-specific promoter is used. Preliminary data (not shown) indicates that there is an SI effect.
Example 16 - Other Plant Species
Example 12 was performed in Arabidopsis. It is repeatable in other plant species, for instance barley. Suitable barley cells lines expressing the pistil and pollen S alleles are created, using the constructs based on HZ and BG: WH1 = PrsS3, WH2 = PrpS3, WH3 = PrpS1 line. These were transferred into barley using Agrobacterium-mediated transformation, as described above.
The pistil and pollen S allele lines are then crossed as described in Example 12 and analysis of pollinations performed using aniline blue staining and fluorescence microscopy to visualize pollen grains and tubes. This, allowed an assessment of pollen
rejection for the different crosses. Pistils of barley WH 1 (carrying PrsS3) were emasculated prior to anthesis and left to mature. They were then pollinated with the barley transgenic line WH2 (carrying PrpS3) or WH3 (carrying PrpS1 ) and bagged to prevent contamination with any other pollen source. Controls comprised wildtype pistils pollinated with WH2 or WH3 to check that pollen was viable and functioning properly. WH1 pistils were also pollinated with wildtype pollen for controls to ensure they were normal and functional. Pollinated pistils were left for 24 hours. Some pistils were then harvested and placed in aniline blue, left for several hours or overnight and then viewed using UV microscopy to assess pollen rejection. Other pistils were left to set seed.
It is predicted that the crosses should have the following outcomes: Assuming WH lines are heterozygous for PrsS and PrpS, rejection should be partial (50%). WH1 x WH2 have 50% rejection of pollen, and lower seed set. WH1 x WH3 have no pollen inhibition and 100% seed set. All pollinations with wt pollen or pistils have no pollen rejection and 100% seed set. This would show that the present SI system is functional in vivo in barley, an important example of a crop plant.
References
All references cited herein are incorporated by reference.
Bosch M, Franklin-Tong VE (2007) Temporal and spatial activation of caspase-like enzymes induced by self-incompatibility in Papaver pollen. Proceedings of the National Academy of Sciences USA 104: 18327-18332
Bosch M, Poulter NS, Vatovec S, Franklin-Tong VE (2008) Initiation of Programmed Cell Death in Self-Incompatibility: Role for Cytoskeleton Modifications and Several Caspase-Like Activities. Molecular Plant 1: 879-887
Foote HCC, Ride JP, Franklintong VE, Walker EA, Lawrence MJ, Franklin FCH
(1994) Cloning and Expression of a Distinctive Class of Self- Incompatibility (S) Gene from Papaver rhoeas L. Proceedings of the National Academy of Sciences of the United States of America 91: 2265-2269
Geitmann A, Snowman BN, Emons AMC, Franklin-Tong VE (2000) Alterations in the actin cytoskeleton of pollen tubes are induced by the self-incompatibility reaction in Papaver rhoeas. Plant Cell 12: 1239-1251
Kakeda K, Jordan ND, Conner A, Ride JP, Franklin-Tong VE, Franklin FCH (1998) Identification of residues in a hydrophilic loop of the Papaver rhoeas S protein that play a crucial role in recognition of incompatible pollen. Plant Cell 10: 1723- 1731
Poulter NS, Vatovec S, Franklin-Tong VE (2008) Microtubules Are a Target for Self- Incompatibility Signaling in Papaver Pollen. Plant Physiol. 146: 1358-1367
Snowman BN, Kovar, D.R., Shevchenko, G., Franklin-Tong, V.E., and Staiger, CJ. (2002) Signal-mediated depolymerization of actin in pollen during the self- incompatibility response. Plant Cell 14: 2613-2626
Thomas SG, Franklin-Tong VE (2004) Self-incompatibility triggers programmed cell death in Papaver pollen. Nature 429: 305-309
Walker EA, Ride JP, Kurup S, FranklinTong VE, Lawrence MJ, Franklin FCH
(1996) Molecular analysis of two functional homologues of the S-3 allele of the Papaver rhoeas self-incompatibility gene isolated from different populations. Plant Molecular Biology 30: 983-994