WO2010041942A1

WO2010041942A1 - Improved env peptides and proteins

Info

Publication number: WO2010041942A1
Application number: PCT/NL2009/050609
Authority: WO
Inventors: Rogier Willem Sanders; Benjamin Berkhout
Original assignee: Academisch Medisch Centrum Bij De Universiteit Van Amsterdam
Priority date: 2008-10-08
Filing date: 2009-10-08
Publication date: 2010-04-15

Abstract

The invention relates to molecular biology, virology and vaccine development and provides means and methods for alternative vaccine strategies for HIV.

Description

Title: Improved Env peptides and proteins

The invention relates to the fields of molecular biology, virology and vaccine development.

In 1984, after the confirmation of the etiological agent of AIDS by scientists at the U.S. National Institutes of Health and the Pasteur Institute, the United States Health and Human Services Secretary Margaret Heckler declared that a vaccine would be available within two years.

However, the classical vaccination approaches that have been successful in the control of various viral diseases by priming the adaptive immunity to recognize the viral envelope proteins have failed in the case of human immunodeficiency virus (HIV), as the epitopes of the HIV viral envelope glycoprotein complex (Env) are too variable. Furthermore, the functionally important epitopes of the HIV Env are masked by glycosylation, trimerisation and receptor-induced conformational changes making it difficult to block HIV with neutralizing antibodies.

The ineffectiveness of previously developed vaccines primarily stems from two related factors. Firstly, HIV is highly mutatable. Due to the virus' ability to rapidly respond to selective pressures imposed by the immune system, a population of virus in an infected individual typically evolves in a way that allows it to evade the two major arms of the adaptive immune system; humoral (antibody-mediated) and cellular (mediated by T cells) immunity. Second, HIV isolates are themselves highly variable. HIV can be categorized into multiple clades and subtypes with a high degree of genetic divergence. Therefore, the immune responses raised by any HIV vaccine are preferably broad enough to account for this variability. Any HIV vaccine that lacks this breadth is not always effective.

The typical animal model for vaccine research is the monkey, often the macaque. The monkeys can be infected with SIV or the chimeric SHIV for research purposes. However, the well-proven route of trying to induce neutralizing antibodies by vaccination has stalled because of the great difficulty in stimulating antibodies that neutralise heterologous primary HIV isolates. Some vaccines based on the virus envelope have protected chimpanzees or macaques from homologous virus challenge, but in clinical trials, individuals who were immunised with similar constructs became infected after later exposure to HIV.

The human body can defend itself against HIV, as work with monoclonal antibodies (MAb) has proven. That certain individuals can be asymptomatic for decades after infection is encouraging.

Although many Env-based HIV vaccines have failed to neutralize diverse primary virus isolates, the HIV envelope glycoprotein complex (Env) is still the principle target of vaccine research aimed at raising an effective antiviral humoral immune response, which is likely to be an essential component of vaccine-induced immunity. The isolation of a small number of broadly active neutralizing antibodies from HIV-infected individuals serves as a rationale for the search for vaccines that elicit such antibodies. Further, as the Envelope glycoprotein (Env) is the sole viral protein present on the surface of HIV, it is deemed to be the only proteinaceous target for recognition by the adaptive immune system. Relatively straightforward vaccine strategies that worked for other pathogens - for example the use of unmodified surface antigens - have been explored without satisfactory results for HIV, emphasizing the necessity for alternative vaccine strategies.

The current invention provides means and methods for such alternative vaccine strategies for HIV.

In a first embodiment, the invention provides a peptide comprising an amino acid sequence of a gpl20 molecule of HIV envelope glycoprotein complex (Env) or a functional analogue thereof, wherein at least 5 amino acids of the Vl loop and at least 5 amino acids of the V2 loop of said gpl20 molecule are absent, and wherein said peptide comprises at least one amino acid exchange and/or at least one amino acid insertion in the remainder of said amino acid sequence as compared to wild-type gpl20. The amino acids directly adjacent to the deleted parts are preferably reconnected, either directly or indirectly, such that a continuous amino acid sequence, is regained. It is of course also possible to reconnect the amino acids adjacent to the deleted parts with a non-amino acid spacer. In a preferred embodiment, a peptide according to the invention is provided which comprises at least one amino acid exchange and/or at least one amino acid insertion in the region corresponding to amino acid positions 114-210 of HXB2, wherein the amino acid positions are indicated in Figure 10. An amino acid mutation in this region is particularly well capable of improving folding and/or secretion of loop- deleted Env trimers and/or improving replication of a virus comprising such loop-deleted Env trimers. As used herein, the term "loop-deleted Env" means an Env peptide wherein at least 5 amino acids of the Vl loop and/or at least 5 amino acids of the V2 loop have been deleted. It is emphasized that the Vl loop and/or the V2 loop need not to be deleted entirely.

Said at least one amino acid exchange and/or amino acid insertion preferably comprises a compensatory change resulting in improved folding and/or secretion of loop- deleted Env trimers. Most preferably, said at least one amino acid exchange and/or amino acid insertion results in improved replication of a virus comprising loop-deleted Env trimers with said at least one amino acid exchange and/or amino acid insertion, as compared to a virus comprising the same loop- deleted Env trimers without said at least one amino acid exchange and/or amino acid insertion. As shown in Figure 12, and outlined in more detail in the Examples, the present invention provides a variety of such compensatory amino acid changes. Env peptides comprising at least one of said compensatory changes are particularly preferred because, on the one hand, viruses comprising such Env peptides are capable of eliciting a better immune response against HIV, as compared to wild type Env peptides. On the other hand, viruses comprising an Env peptide with at least one of said compensatory changes provided by the invention are better capable of replicating, as compared to a virus with a loop-deleted Env mutant without said compensatory changes.

With a functional analogue is meant a polypeptide which retains essentially the same biological function, i.e. facilitate viral entry into a cell, as said gpl20 molecule. Thus, a functional analogue for instance includes a proprotein portion to produce an active mature polypeptide.

With the mutations according to the invention, a modified Env peptide is obtained which is particularly well capable of eliciting an immune response against HIV. Hence, a modified Env peptide according to the invention is particularly suitable for (at least in part) counteracting or preventing HIV infection and/or HIV spreading.

The functional wild-type HIV Env complex, which mediates viral entry into CD4⁺ host cells, is a polymer, consisting of six individual subunits: three gpl20 molecules and three gp41 molecules. Env is synthesized as a 160 kDa precursor protein (gplδO). It folds and trimerizes in the endoplasmic reticulum (ER) of the host cell, where it obtains ten disulfides and ~30 N- linked glycans depending on the viral isolate. In the Golgi complex, gplδO is cleaved by a cellular protease into a soluble subunit, gpl20, and a transmembrane subunit, gp41. They remain non-covalently associated on the surface of infected cells and on virions. Together, the two Env subunits mediate viral entry: gpl20 is responsible for binding to the receptor (CD4) and the coreceptor (CCR5 or CXCR4) on the host cell, and gp41 is needed for subsequent fusion of the viral and cellular membranes.

First, gpl20 binds to the CD4 receptor, a process that induces conformational changes to create and expose the co-receptor binding site. The conformational changes in gpl20 involve the movement of the first, second and third variable loops (Vl, V2 and V3 loops) that normally shield the co-receptor binding site. Additional conformational changes in the trimeric complex lead to the exposure of hydrophobic fusion peptides at the C-termini of the gp41 subunits, culminating in fusion of the viral and cellular membranes. In a normal situation, conserved amino acid stretches, such as those encoding receptor and co-receptor binding sites, are shielded such that they are concealed from the immune system, rendering them poorly immunogenic. The invention provides a peptide that is mutated such that an epitope of gpl20 and/or gp41 is unshielded from immune surveillance, allowing recognition of said epitope by the immune system. An epitope can either be linear or conformational and can be recognized, after processing by the antigen presenting machinery of the immune system, for instance by T cells and/or B- cells. Preferably, a peptide according to the invention allows recognition of a conserved epitope of gpl20 and/or gp41 by the immune system. As such conserved amino acid stretches, or epitopes, are thought to be important for function of the protein, and an immune response against these regions conceivably lead to loss of said function, a peptide according to the invention is especially useful in alternative vaccine strategies for HIV.

For instance antibodies directed against a conserved receptor or co- receptor site are sufficiently broad to be able to bind several clades and subtypes of HIV with a high degree of genetic divergence. Furthermore, antibodies directed against said receptor and/or co-receptor site abrogate binding of the virus to its receptor and thus abrogate or at least decrease viral entry into CD4+ T cells. Now that the invention provides the insight that a modified gpl20 peptide according to the invention is especially useful in alternative vaccine strategies, the invention further provides a method for production of a peptide according to the invention, said method comprising a) generating or providing a nucleotide sequence encoding a gpl20 molecule of HIV envelope glycoprotein complex (Env) or a functional analogue thereof; b) deleting or functionally deleting part of said nucleotide sequence encoding at least 5 amino acids of the Vl loop and part of said nucleotide sequence encoding at least 5 amino acids of the V2 loop from said nucleotide sequence encoding gpl20; c) mutating and/or exchanging and/or inserting and/or deleting at least one triplet encoding an amino acid in the remaining part of said nucleotide sequence; and d) allowing expression of said peptide from said nucleic acid. Preferably, at least one triplet that encodes an amino acid residue in the region corresponding to amino acid positions 114-210 of HXB2 is mutated and/or exchanged and/or inserted and/or deleted, so that at least one amino acid mutation in a region corresponding to amino acid positions 114-210 of HXB2 is generated. The amino acid positions are indicated in Figure 10.

As said above, preferably at least one mutation is induced that comprises a compensatory change resulting in improved folding and/or secretion of loop-deleted Env trimers. Most preferably, said at least one amino acid mutation results in improved replication of a virus comprising loop- deleted Env trimers with said at least one amino acid mutation, as compared to a virus comprising the same loop- deleted Env trimers without said at least one amino acid mutation. With a method of the invention, large-scale production of efficient immunogenic HIV peptides according to the invention has become possible.

Figure 10 depicts non-limiting examples of sequences encoding a gpl20 of different strains, namely of strains KNH1144, JR-FL, LAI, and HXB2. A person skilled in the art can of course easily determine sequences encoding gpl20 of other strains known in the art, such as YU2, SF162, ADA, BaL, DU151, JR-CSF, but also gpl20 based on consensus, ancestral, mosaic and/or other unnatural sequences. Any gpl20 sequence is suitable for introduction of at least one modification according to the invention, in order to obtain an Env peptide capable of eliciting an immune response against HIV.

By altering the nucleotide sequence of the native RNA, such variants can be generated. Such alteration can be made through elective synthesis of the RNA or by modification of the native RNA by, for example, site-specific or cassette mutagenesis. Of course, DNA encoding RNA can be used, where appropriate, for instance when large scale production of a peptide according to the invention is preferred in isolated and/or recombinant mammalian cells. Preferably, where portions of cDNA or genomic DNA require sequence modifications, site-specific primer directed mutagenesis is employed using techniques standard in the art. Other techniques to manipulate nucleotide sequences known in the art can of course also be applied to achieve said DNA and/or RNA alteration.

In a further aspect, the present invention provides replicable transfer vectors suitable for use in preparing a peptide according to the invention. These vectors may be constructed according to techniques well known in the art, or may be selected from cloning vectors available in the art, preferably said vector is a viral vector.

In a method according to the invention, large scale production is preferred. However, mutants can be improved for instance through virus evolution, making use of the error-prone nature of the reverse transcriptase enzyme, which allows for instance, the generation of a faster replicating variant from an initially poorly replicating virus.

In a preferred embodiment therefore, a method according to the invention is provided, wherein said allowing expression of said nucleic acid comprises expression of said peptide from said nucleic acid in a virus. The invention further provides the insight that virus evolution leads to nucleic acid changes that allow expression of improved envelope glycoprotein complex that for instance replicate better. In a preferred embodiment therefore, a method according to the invention is provided, wherein said allowing expression of said peptide from said nucleic acid comprises allowing and/or inducing virus evolution.

In the past, the individual Env subunits have proven less successful as vaccines, presumably because they do not resemble the functional oligomeric Env complex present on infectious virus particles.

In a preferred embodiment, therefore, the invention provides an oligomeric complex comprising at least 1, preferably at least 2, more preferably at least 3 peptide(s) according to the invention and/or comprising at least 1, preferably at least 2, more preferably at least 3 peptide(s) obtainable by a method according to the invention. Preferably, said complex further comprises at least 1, preferably at least 2, more preferably at least 3 gp41 molecule(s) of HIV or a functional analogue thereof.

HIV has evolved several strategies to limit the generation of neutralizing antibodies in vivo and to minimize their effect on its replication cycle. As said before, a prominent strategy is the shielding of conserved protein domains - for example the (co)receptor binding sites - by flexible variable loops that can easily be changed by the virus to escape from antibodies. Considerable efforts have therefore been made in the past to generate and characterize loop-deleted forms of Env. Initial functional studies have shown that deletion of V3 or V4 abrogated Env function and viral infectivity. Several constructs have been described lacking Vl or V2 that were compatible with Env function and viral replication, indicating that they are not required for function. However, most constructs with combined Vl and V2 deletions were non-functional or severely impaired in Env function.

Removal of variable domains from monomeric gpl20 has resulted in incremental improvement of immunogenicity. The inventors have incorporated such deletions into disulfide- stabilized gpl40 constructs. However, difficulties were encountered with protein expression and purification because of unusual biochemical properties of these constructs. Furthermore, it has been reported that deletion of the V1/V2 region from uncleaved JR-FL gpl40 trimers promotes aggregation. Thus, deletion of variable loops can cause problems in complex Env constructs that are not apparent in the context of monomeric gpl20.

By employing forced virus evolution to select for improved Env deletion variants the inventors for the first time obtained functionally improved Env variants lacking the entire V1/V2 domain. Compensatory changes in gpl20, but also in gp41 are identified below that improve folding and secretion of stable loop-deleted Env trimers and that benefit the generation of recombinant Env trimers for vaccine and structural studies. For the amino acid numbering reference is made to the alignment of gp 120 of different strains as depicted in Figure 10, whereas the variant numbers refer to the structural variants as depicted in Figure 1.

Based on the non-limiting examples provided by the invention, the following observations are made:

(i) The frequently used replacement of the V1/V2 sequences by GIy- Ala-Gly, leaving a few residue disulfide bonded loop, is not optimal.

Replacement of the first glycine with, for example, aspartic acid already provides a major improvement, (ii) The retention of the 126-196 disulfide bridge is not necessary: It can be replaced by an Ala- Ala linker as in mutant 2. This is particularly beneficial in Env constructs where novel disulfide bridges are introduced to stabilize gpl20 in a specific conformation or to stabilize the gpl20-gp41 interaction. In these situations, native disulfide bonds sometimes interfere with formation of newly introduced disulfide bonds and vice versa, and reduction of the number of native disulfide bridges improves protein folding, (iii) It is desirable to have an N-linked glycosylation site at position 197. Although most isolates in fact contain a glycosylation site at this position, some, including the often used JR-FL isolate, do not. If such isolates are used, introduction of this site is beneficial. The carbohydrate masks hydrophobic surface or otherwise assists protein folding, (iv) The hydrophobic surface at the Vl/V2-stem and base are further preferably reduced by substitutions in the Vl/V2-stem and bridging sheet. For example, the valines at positions 120 and 127 are preferably replaced by glutamic or aspartic acids, (v) Several distal changes have been observed that were beneficial, for instance changes in or around the V3 domain, changes in or around the CD4 binding site (CD4BS), and/or changes in gp41. Non-limiting examples of reversions leading to peptides especially useful in the invention are for instance listed in Table 1 and/or Figure 14.

In respect of the above, the invention thus provides in a preferred embodiment, a peptide and/or a method and/or a complex according to the invention, wherein said peptide comprises a deletion of at least 5 amino acids, preferably at least 10, more preferably at least 20, more preferably at least 40, most preferably at least 60 amino acids in the region corresponding to amino acid positions 120-204 of HXB2, wherein the amino acid positions are indicated in Figure 10. For other isolates, the corresponding gpl20 region is determined by conventional alignment with at least one sequence of Figure 10. Preferably, said deletion comprises at least 10, more preferably at least 20, even more preferably at least 40, most preferably at least 60 amino acids in the region comprising, or corresponding to said amino acid positions 120-204.

In another preferred embodiment, the invention provides a peptide and/or a method and/or a complex according to the invention, wherein said peptide comprises a deletion of at least 5 amino acids, preferably at least 10, more preferably at least 20, more preferably at least 40, more preferably at least 60, even more preferably at least 67, most preferably 69 amino acids in the region corresponding to amino acid positions 127-195 of HXB2, wherein the amino acid positions are indicated in Figure 10. In yet another preferred embodiment, a peptide and/or a method and/or a complex according to the invention is provided, wherein said peptide comprises a deletion of at least 5 amino acids in the region corresponding to amino acid positions 142 to 148 of HXB2 and/or a deletion of at least 5 amino acids, preferably at least 10, more preferably at least 20, more preferably at least 30, most preferably 36 amino acids in the region corresponding to amino acid positions 168 to 203 of HXB2, wherein the amino acid positions are indicated in Figure 10. In a more preferred embodiment, said at least 5 amino acids in said region comprising amino acids 168 to 203 comprise at least 10, more preferably at least 20, even more preferably at least 30, most preferably at least 36 amino acids in the region comprising, or corresponding to, amino acids 168 to 203. The above mentioned gpl20 peptides are particularly well capable of eliciting a HIV- specific immune reaction. Furthermore, a virus comprising these gpl20 peptides is still capable of infecting host cells, so that production of these viruses is possible.

In an even more preferred embodiment, the invention provides a peptide and/or a method and/or a complex according to the invention, wherein said peptide comprises a deletion of at least 5 amino acids, preferably at least 10, more preferably at least 20, more preferably 23, in the region corresponding to amino acid positions 133-155 of HXB2 and/or a deletion of at least 5 amino acids, preferably at least 10, more preferably at least 20, even more preferably at least 30, most preferably 36, in the region corresponding to amino acid positions 159-194 of HXB2, wherein the amino acid positions are indicated in Figure 10. In a more preferred embodiment, said at least 5 amino acids in said region comprising, or corresponding to, amino acids 133-155 comprise at least 10, more preferably at least 20, most preferably 23 amino acids in said region comprising, or corresponding to amino acids 133-155 and/or said at least 5 amino acids in the region comprising amino acids 159- 194 comprise at least 10, more preferably at least 20, even more preferably at least 30, most preferably 36 amino acids in the region comprising, or corresponding to, amino acids 159-194.

As said before, it is especially useful to delete one or more of the disulfide bonds in the gpl20 molecule involved in protein folding. In one preferred embodiment therefore, the invention provides a peptide and/or a method and/or a complex according to the invention, wherein said at least one amino acid exchange comprises an exchange of a cysteine at a position corresponding to position 126 and/or position 196 and/or position 131 and/or position 157 of HXB2 into another amino acid, preferably into another non- hydrofobic amino acids, more preferably into alanine, wherein the amino acid positions are indicated in Figure 10.

In one of their working examples the inventors have shown that a peptide useful in the invention is obtained for example if the cysteines at positions 126 and at position 196 are substituted by another non-hydrophobic amino acid, for instance alanine. In another working example they show that another peptide useful in the invention is obtained for example if the cysteines at position 131 and 196 are substituted by another non-hydrophobic amino acid, for instance alanine. Therefore, in yet another preferred embodiment, a peptide and/or a method and/or a complex according to the invention is provided, wherein said at least one amino acid exchange comprises an exchange of a cysteine at a position corresponding to position 126 and to position 196, or to position 131 and to position 196 of HXB2 into another amino acid, preferably into another non-hydrofobic amino acid, more preferably into alanine, wherein the amino acid positions are indicated in Figure 10.

As said previously, N-linked carbohydrates were frequently lost upon optimization of a peptide useful in the invention, namely at position 156, 234, 295, 301, 339 and 625.

In a preferred embodiment therefore, a peptide and/or a method and/or a complex according to the invention is provided, wherein said at least one amino acid exchange comprises loss of a glycosylation site at a position corresponding to amino acid position 156, 234, 295, 301 and/or 339 of HXB2, wherein the amino acid positions are indicated in Figure 10. In a more preferred embodiment, said at least one amino acid exchange comprises loss of a glycosylation site corresponding to amino acid position 156 of HXB2. As said before, the numbering of the amino acid positions is shown in Figure 10. For other HIV isolates, the corresponding amino acid positions are determined by alignment with at least one sequence of Figure 10. As used herein, a reference to an amino acid position therefore also encompasses the corresponding amino acid position in a different HIV strain.

With the term "loss of a glycosylation site" is meant a situation in which said glycosylation site is no longer capable of being glycosylated and/or in which said glycosylation site is no longer present. Inhibiting glycosylation is achieved in various ways. It is for instance possible to delete, substitute and/or insert amino acids near said glycosylation site, such that glycosylation is no longer possible or at least inhibited. A person skilled in the art is aware of the fact that N- glycosylation sites comprise in general a consensus sequence consisting of Asp-Xaa-Ser or Asp-Xaa-Thr, wherein Xaa can be any natural amino acid (except proline) or functional equivalent thereof, for instance a spacer that introduces a similar space between the first aspartate and the third amino acid (serine or threonine) in said above consensus amino acid sequence. Said loss of a glycosylation site can thus be achieved by deleting or exchanging asparagine and/or serine or threonine in said consensus sequence. Further said loss can be achieved by deletion of said natural amino acid or functional equivalent thereof in said consensus sequence, or by insertion of an amino acid and/or functional equivalent thereof in said consensus sequence such, that the new sequence no longer comprises a consensus sequence for glycosylation, and/or exchanging Xaa in said consensus sequence with a proline, leading to inhibition and/or abrogation of glycosylation at said site. In a preferred embodiment therefore, a peptide and/or a method and/or a complex according to the invention is provided, wherein said loss of a glycosylation site comprises a mutation in the N-glycosylation consensus sequence Asp-Xaa-Ser or Asp-Xaa-Thr, wherein Xaa is any natural amino acid except proline, such that the resulting sequence no longer comprises said consensus sequence.

As said before, the loss of a glycosylation site is especially useful in a peptide of the invention. On the other hand, the inventors have observed that retaining and/or inserting a glycosylation site can also be beneficial for improving a peptide, a complex, and/or a method according to the invention. This is especially true for the asparagine on position 197. Some of the HIV strains do not possess a glycosylation site at this position, such as strain WT JR-FL, others do. It has been observed that retaining or introducing a glycosylation site on or near position 197 is especially useful, for instance for correct folding of the Env protein. In one preferred embodiment therefore, a peptide and/or a method and/or a complex according to the invention is provided, wherein said at least one amino acid exchange comprises retaining or introducing a glycosylation site at a position corresponding to amino acid position 197 of HXB2, preferably retaining or introducing an asparagine at a position corresponding to amino acid position 197 of HXB2 and a serine/threonine at a position corresponding to amino acid position 199 of HXB2, wherein the amino acid positions are indicated in Figure 10. The inventors have further shown for several peptides that exemplify the above mentioned embodiments that they are especially useful for improving vaccine strategies for HIV. It is herewith stated that peptides comprising an amino acid sequence of a variant selected from the group consisting of variants 1, 2, 5, 6, 10, 11 and 12 as depicted in Figure 1 and/or peptides comprising an amino acid sequence of a variant selected from the group consisting of variants A — K as depicted in Figure 12, are preferred non- limiting examples of gpl20 peptides that fall within the scope of the invention. In non-limiting working examples, the inventors have shown that the above mentioned peptides are especially useful in the invention. In a preferred embodiment therefore, a peptide and/or a method and/or a complex according to the invention is provided, wherein said peptide comprises a variant selected from the group consisting of variants 1, 2, 5, 6, 10, 11 and 12 as depicted in Figure 1 and/or wherein said peptide comprises a variant selected from the group consisting of variants A - K as depicted in Figure 12. More preferably, said peptide comprises a variant selected from the group consisting of variants C, D, E, F, H, I, J and K as depicted in Figure 12. As shown in the Examples, variants C, D, E, F, H, I, J and K comprise compensatory changes which improve protein expression and/or virus replication. Furthermore, variants comprising an amino acid substitution chosen from the group consisting of D197N, G127S, E429K, V120K and V120E are preferred because these substitutions at least in part restore folding and/or secretion of loop- deleted Env trimers and/or replication of viruses comprising such loop-deleted Env trimers. As used herein, substitution D197N means that an aspartic acid at a position which corresponds to position 197 of HXB2 is replaced by an asparagine. Likewise, substitution G127S means that a glycine at a position which corresponds to position 127 of HXB2 is replaced by a serine. Substitution E429K means that a glutamic acid at a position which corresponds to position 429 of HXB2 is replaced by a lysine. Substitution V120K means that a valine at a position which corresponds to position 120 of HXB2 is replaced by a lysine. Furthermore, substitution V120E means that a valine at a position which corresponds to position 120 of HXB2 is replaced by a glutamic acid. The above mentioned amino acid positions are indicated in Figure 10. As stated before, a skilled person can easily establish amino acid positions of other HIV strains, such as for instance KNH1144, JR-FL, LAI, YU2, SF162, ADA, BaL, DU151 and JR-CSF, which correspond to the HXB2 amino acid positions depicted in Figure 10. Further provided is therefore a peptide and/or a method and/or a complex according to the invention, wherein said peptide comprises at least one amino acid substitution chosen from the group consisting of D197N, G127S, E429K, V120K and V120E. In yet another embodiment, a peptide and/or a method and/or a complex according to the invention is provided wherein said peptide comprises at least one amino acid substitution as depicted in Figure 14.

Now that the invention has provided the insight that a peptide according to the invention is especially useful for improving vaccine strategies for HIV, the invention further provides a nucleic acid sequence encoding a peptide according to the invention. In one embodiment therefore, the invention provides a nucleic acid sequence encoding a peptide according to the invention and/or encoding a peptide obtainable by a method according to the invention. In one preferred embodiment, said nucleic acid encodes a peptide comprising a variant selected from the group consisting of variants 1, 2, 5, 6, 10, 11 and 12 as depicted in Figure 1 and/or a peptide comprising a variant selected from the group consisting of variants A - K as depicted in Figure 12. In an even further preferred embodiment, the invention provides a nucleic acid sequence encoding a peptide comprising a variant selected from the group consisting of variants C, D, E, F, H, I, J and K as depicted in Figure 12 because said variants comprise compensatory changes, as described above. In yet another embodiment, the invention provides a nucleic acid sequence encoding a peptide variant according to the present invention comprising an amino acid substitution selected from the group consisting of D197N, G127S, E429K, V120K and V120E.

Now that the invention provides peptides, methods, complexes and nucleic acids according to the invention, in yet another embodiment, the invention provides a virus comprising a peptide according to the invention or obtainable by a method according to the invention and/or a virus comprising a complex and/or a nucleic acid sequence according to the invention. Such a virus is especially useful for preparing an immunogenic composition useful in the invention, as such a virus is still capable of reproduction. For an immunogenic composition of the invention, a peptide, a complex, and/or a nucleic acid according to the invention can also be used. In yet another embodiment, therefore, the invention provides an immunogenic composition comprising a peptide according to the invention or comprising a peptide obtainable by a method according to the invention, and/or comprising a complex, a nucleic acid sequence, and/or a virus according to the invention. In one embodiment, an immunogenic composition is provided which comprises at least one peptide according to the invention. Preferably, said composition comprises a complex of at least three peptides according to the invention, preferably together with at least three gp41 peptides. In a more preferred embodiment, said gp41 peptides have at least one amino acid substitution.

In another preferred embodiment, however, an immunogenic composition is provided which comprises a virus, which virus comprises at least one peptide according to the invention. Said peptide is preferably at least in part present on the surface of said virus, so that said peptide is exposed to an animal's immune response. Said virus preferably comprises an attenuated virus, so that the virus' capability of spreading upon administration to a subject is diminished as compared to a wild-type virus. In one embodiment, said virus is an attenuated HIV virus. Alternatively, said virus comprises another kind of viral vector, for instance a viral vector based on a virus such as but not limited to sindis virus, semliki like forest virus, canarypox virus, chicken pox virus, vaccina virus etc.

An immunogenic composition according to the invention is especially useful for developing a vaccine for use in preventing, treating and/or diminishing HIV infection. In a preferred embodiment therefore, an immunogenic composition according to the invention comprises a vaccine. An immunogenic composition according to the invention for use in at least in part preventing, treating and/or diminishing HIV infection is also provided.

An immunogenic composition according to the invention is preferably used for inducing or enhancing an immune response specific for HIV. A peptide of the invention, or a nucleic acid encoding said peptide, or a complex or a virus comprising said peptide is especially useful for the purpose of inducing or enhancing an immune response specific for HIV. The peptides according to the invention allow an animal's immune system to recognize at least one part, called epitope, of the HIV envelope glycoprotein that is shielded in a wild-type virus without the modifications of the invention. The immune response thus generated by a peptide of the invention allows for the induction of antibodies directed against said epitope. In one embodiment, said epitope comprises at least part of a conserved epitope of the gpl20 protein and/or at least part of a conserved epitope of the gp41 peptide. Preferably said epitope comprises the receptor binding site of the gpl20 protein. Antibodies directed against said at least part of said conserved epitope, for instance present on said receptor binding- site will, after binding to said epitope on a wild type HIV virus, at least partially inhibit a function of Env, for instance binding of said receptor binding- site to the CD4 receptor on T-cells, thereby for instance inhibiting entry of the virus into said T cell.

In another preferred embodiment, however, said epitope comprises another gpl20 epitope such as for instance a conformational mannose epitope in gpl20, or a membrane proximal region in gp41. Antibodies that are capable of inhibiting function of Env are called neutralizing antibodies, because they are able to neutralize the virus such that it is deficient in its capability of entering T cells and spread infection. With deficient is meant herein that the virus has a diminished capability of entering said T cell, for instance the virus is slowed down in entering the T cell or the virus is completely unable to enter the T cell. It is especially useful if said virus is deficient in such a way that the host is able to combat said virus and spread of infection is prevented, halted or slowed down.

In a preferred embodiment therefore, a peptide according to the invention or obtainable by a method according to the invention, and/or a complex, a nucleic acid sequence, a virus, and/or an immunogenic composition according to the invention for use in inducing or enhancing an immune response specific for HIV is provided by the invention. In a more preferred embodiment, said immune response comprises production of an antibody, preferably a neutralizing antibody. In an even more preferred embodiment, said antibody is specific for

HIV, preferably said antibody is specific for to a conserved amino acid sequence of the envelope glycoprotein complex (Env) of HIV, more preferably to the CD4 receptor binding-site of HIV.

Now that the invention has provided the insight that a peptide according to the invention or obtainable by a method according to the invention, and/or a complex, a nucleic acid sequence, a virus, and/or an immunogenic composition according to the invention is especially useful for preventing, treating and/or diminishing HIV infection and/or inducing and/or enhancing an immune response against HIV, in yet another embodiment, the invention provides the use of a peptide according to the invention, and/or use of a peptide obtainable by a method according to the invention, and/or use of a complex, a nucleic acid sequence, a virus, and/or an immunogenic composition according to the invention, for the preparation of a medicament or prophylactic agent for inducing or enhancing an immune response specific for human immunodeficiency virus (HIV). As said before, said peptide preferably comprises a variant selected from the group consisting of variants 1, 2, 5, 6, 10, 11 and 12 as depicted in Figure 1 and variants A — K as depicted in Figure 12. More preferably, said peptide comprises a variant selected from the group consisting of variants C and D and E and F and H and I and J and K as depicted in Figure 12 because said variants comprise compensatory changes. In yet another preferred embodiment, said peptide according to the present invention comprises an amino acid substitution selected from the group consisting of D197N, G127S, E429K, V120K and V120E.

The invention thus provides means and methods for improved vaccine strategies for HIV. The inventors have further shown that said means and methods are further improved by introducing a co- stimulatory molecule. It is for example possible to add a co- stimulatory molecule, capable of enhancing an immune response, in an immunogenic composition of the invention. It is also possible to introduce a co- stimulatory molecule in a complex according to the invention. Preferably said co-stimulatory molecule is covalently bound to said complex. The skilled artisan is aware of the many co-stimulatory molecules available in the art capable of inducing or enhancing an immune response, preferably an antibody response. Examples of such co- stimulatory molecules are: IL- 12, CD40L, GMCSF, etc. Of special interest is CD40L, because, similar to the envelope glycoprotein of HIV, CD40L consists of a trimeric complex. Furthermore, CD40L, also called CD40 ligand or CD 154, is able to bind to the CD40 receptor on immune cells and induces for instance antigen-presenting function of APCs such as DCs, B-cell growth, differentiation to antibody-secreting plasma cells and memory B cells, selection in germinal centers, isotype switching, production of pro-inflammatory cytokines such as IL- 12 and TNF-a, and generation of memory T Cells. With class switching is meant that a B cell is initiated to switch to producing a different class of antibodies, for instance from IgM to IgG. A person skilled in the art is well aware of the different immunoglobulin classes and their role in adaptive immunity. For instance it is known that IgM is induced early in an immune reaction, whereas IgG comes in later but is produced more quickly upon a second encounter with the same antigen. IgG is therefore associated with anamnestic responses, whereas IgM is associated with initial immune reaction. In a preferred embodiment therefore, a complex, a composition, and/or a virus according to the invention is provided, further comprising a co- stimulatory molecule capable of inducing or enhancing an immune response, preferably CD40L or a functional analogue thereof. In this respect, a functional analogue of CD40L is defined as a molecule that is able to stimulate CD40 receptors on B cells.

In a more preferred embodiment, said co-stimulatory molecule, preferably CD40L or a functional analogue thereof is covalently linked to said complex. Such covalent linking, for instance for CD40L, is for instance achieved by producing a fusion construct, comprising a gpl40 molecule

(consisting of a gpl20 and a gp41 molecule, preferably a modified gpl20 and/or a modified gp41 molecule of the invention), a trimerization motif and a CD40L molecule, wherein said gpl40 molecule and said trimerization motif are connected with a linker and said trimerization motif and said CD40L molecule are connected with another linker, preferably said first and said second linker are glycine-rich linkers, preferably with a length of between 5 and 15 amino acid.

In one embodiment, therefore, the invention provides a method for producing a complex comprising a modified envelope glycoprotein complex (Env) of HIV and a CD40L molecule capable of enhancing or inducing an immune response, said method comprising a) producing a fusion construct comprising a nucleotide sequence encoding a peptide according to the invention and a gp41 molecule, coupled with a first linker to a trimerization motif, and a nucleotide sequence encoding a monomeric CD40L molecule, coupled with a second linker to said trimerization motif,. b) allowing expression of said complex from said fusion construct. In a preferred embodiment, said first and/or said second linker is a glycine-rich linker, preferably said first and/or said second linker comprises between 5 and 15 amino acids. In another preferred embodiment, said allowing expression of said complex from said fusion construct comprises expression of said complex from said fusion construct in a virus. In a more preferred embodiment, said allowing expression of said complex from said fusion construct comprises allowing and/or inducing virus evolution in order to allow the generation of improved variants.

As such a co-stimulatory molecule, preferably CD40L or a functional analogue thereof is able to induce and/or enhance an immune response, in a preferred embodiment, the invention further provides a complex and/or a composition and/or a virus according to the invention, capable of inducing or enhancing an HIV-specific immune response, wherein said immune response comprises production of an antibody, preferably a neutralizing antibody, specific for HIV. In an even more preferred embodiment, said antibody is capable of specifically binding to a conserved amino acid sequence of the envelope glycoprotein complex (Env) of HIV, most preferably to the CD4 receptor binding- site of HIV.

The invention thus provides means and methods for inducing an improved antibody response against HIV. Such antibodies are thought to be especially useful in at least in part preventing or treating HIV infection, for instance when a subject is thought to be very recently infected or if an individual is at risk of getting infected. Use of antibodies for such a purpose is known under the term "passive vaccination". Passive vaccination is used under certain circumstances, sometimes in combination with active vaccination. The passive component of such a combination quickly counteracts the pathogen which has or may have entered the body, whereas the active vaccine counteracts subsequent infections. This concept is also especially useful in the invention. For instance, a person involved in a so called "prick or puncture accident" in a hospital setting may be first administered a passive vaccine, containing antibodies according to the invention specific for HIV, preferably neutralizing antibodies, and optionally thereafter be actively immunized with a peptide, a complex, virus, and/or an immunogenic composition according to the invention. In such a case, the passive immunization will counteract penetrated virus particles, thereby counteracting spread of infection within the host, whereas a subsequent active immunization will induce antibodies that counteract virus that were not neutralized by the passive vaccine, but also any future infections with the same or a similar virus. In another situation, it may be preferred to only use passive immuniziation, for instance if the host is immunocompromised and active immunization is either impossible or dangerous to the host. In another situation, only active immunization maybe preferred, for instance if it is unclear if and when an infection may occur and when it is useful to induce (protective) immunity in the host as a preventive measure.

In yet another embodiment, the invention provides a non-human animal comprising a peptide and/or a complex and/or a composition and/or a nucleic acid and/or a virus according to the invention. In one embodiment, said non-human animal is vaccinated with said peptide and/or complex and/or composition and/or nucleic acid and/or virus according to the invention. In yet another embodiment said non-human animal is a transgenic animal comprising a nucleic acid sequence encoding said peptide and/or complex and/or composition and/or virus according to the invention. Said nucleic acid sequence is preferably integrated into the animal's genome.

A non-human animal according to the invention preferably mounts a specific antibody response, wherein said antibody is preferably capable of specifically binding to wild-type HIV. Said antibodies are preferably harvested from said animal. In another embodiment, therefore, the invention provides an isolated or recombinant antibody and/or functional equivalent thereof, capable of specifically binding to an amino acid sequence of a peptide, and/or of a complex, according to the invention. Such amino acid sequence is for instance part of a linear epitope of an antibody, or forms a linear epitope of an antibody, said epitope typically having a length of between 3 and 15 amino acid residues. Alternatively, or additionally, such amino acid sequence is part of a conformational epitope.

Most preferably, said antibody is capable of specifically binding wild- type HIV. Preferably said antibody and/or functional equivalent thereof is for use as a medicament. In another preferred embodiment, said antibody and/or functional equivalent is for use in preventing, treating and/or diminishing HIV infection and/or for the preparation of a medicament for preventing, treating and/or diminishing HIV infection.

A functional equivalent of an antibody is defined herein as a part which has at least one same property as said antibody in kind, not necessarily in amount. Said functional equivalent is preferably capable of binding the same antigen as said antibody, albeit not necessarily to the same extent. A functional part of an antibody preferably comprises a single domain antibody, a single chain antibody, a Fab fragment or a F(ab')2 fragment. A functional equivalent of an antibody is defined as an antibody which has been altered such that at least one property - preferably an antigen-binding property - of the resulting compound is essentially the same in kind, not necessarily in amount. An equivalent is provided in many ways, for instance through conservative amino acid substitution, whereby an amino acid residue is substituted by another residue with generally similar properties (size, hydrophobicity, etc), such that the overall functioning is likely not to be seriously affected.

A person skilled in the art is well able to generate analogous compounds of an antibody. This is for instance done through screening of a peptide library. Such an analogue has essentially at least one same property as said antibody in kind, not necessarily in amount.

The invention further provides a method for treating, diminishing or preventing HIV infection in an animal, comprising administering an effective amount of a peptide according to the invention and/or obtainable by a method according to the invention, and/or a nucleic acid, and/or a virus, and/or an immunogenic composition according to the invention to an individual in need thereof.

The invention is further illustrated by the following non-limiting examples. The examples do not limit the scope of the invention in any way.

Examples

Example I Materials and Methods

Construction of loop deletion mutants (Figure 1)

Deletion variants 1,2, 8-12 and 14-17 were created by splice- overlap extension PCR. The downstream and upstream sequences of the sequences to be deleted were amplified in separate PCRs (PCR 1 and 2). The complete fragment was amplified in a third PCR using the combined products of the first two PCRs as template and using primers A (δ'-CAGATGCTAAAGCATATGATAC-S') and B (δ'-TTGTTCTCTTAATTTGCTAGCTATC -3'). The restriction sites for Ndel and Nhel are underlined. The products of the third PCRs were cloned into pRSl using Ndel and Nhel or Ndel and Stul.

The following primers were used in PCR 1 and 2. The nucleotides coding for the linker residues replacing the deleted sequences are in italics. For deletion variant 1: primers A plus C (5'- GGATACCTTTGGTGCTGCTGGCTTTAGGCT-3') and B plus D (5'- CCAAAGGTATCCTTTGAGC-S'); for variant 2 primers A plus E (5'- GACTGAGGTGTTTGCTGCGAGTGGGGTTAA-S') and B plus F (5'- AACACCTCAGTCATTACAC-3'), for 8 primers A plus G (5'- GGTGTTACAACTGCCGCGGCCAACACAGAGTGG-3') and B plus H (5'- AGTTGTAACACCTCAGTC- 3'); for variants 9-12 primers A plus I (5'- GGTGTTACAACTGCCGϋrYGYCAACACAGAGTGG-3') and B plus H; for 14 primers A plus J (5'-CTTTGGACAGGCGCCTGCGCCTACACATGGCTTTAGG- 3') and B plus K (δ'-GCCTGTCCAAAGGTATCC-S'); for 15 primers A plus L (5'- CCCTGGTCCCCTTGTATTGTTGTT- 3') and B plus M (5'- AGGGGACCAGGGAGAGCATTTGT-3'); for 16 primers A plus N (5'- GTTACAATGTGCTGTAACAAATGC- 3') and B plus O (5'- GCACATTGTAACATTAGTAGAGCA-3'); and for 17 primers A plus P (5'-

ATGTTACAATGTGCTGTAACAAATGCTCTCCCTGGTCCCCTTGTATTGTTG

TTGGG]-3') and B plus O.

V1/V2 deletion variants 3 and 4 were created previously and cloned into pRSl using the Ndel and Stul sites. Note that these mutants were originally created in a JR-FL SOS gpl40 background. Subcloning of these variants in LAI Env using Ndel and Stul resulted in the presence of a few JR- FL derived residues flanking the V1/V2 region: V87E, N92H, D99N, H105Q, S128T, K130N, T132K and N197D for mutant 3 and V87E, N92H, D99N, H105Q and N197D for mutant 4. Numbering of amino acids is based on the HXB2 sequence according to convention.

Deletion variants 5 and 6 were created by a single PCR amplification using an HXB2 Env template with primers Q (5'- ACTTGTGGGTCACAGTCTATTATGGGGTACC- 3' and R (5'- TCATTCTAGGCCTCAGTGCACTTTAAACTAAC-S'), and Q and S (5'-

TTCTTTCTAGGCCTTACCTCTTATGCTTGTGCTG- 3') respectively. The resulting PCR fragments which exclude the V1/V2 or V2 sequences, respectively, were cloned into pRSl using Ndel and Stul (restriction sites underlined). The use of HXB2 as a template for the PCR resulted in a few residues that differ from the LAI sequences (Fig. 1).

Cells and transfection

SupTl T cells and 293T cells were maintained in RPMI 1640 medium and Dulbecco's modified eagle's medium (DMEM), respectively, supplemented with 10% fetal calf serum (FCS), penicillin (100 U/ml) and streptomycin (100 μg/ml) as previously described. TZM-bl cells were maintained in DMEM medium containing 10% fetal bovine serum, Ix MEM and penicillin/streptomycin. SupTl and 293T cells were transfected by electroporation and Ca2(PO4)3 precipitation, respectively, as described elsewhere. Peripheral blood mononuclear cells (PBMCs were isolated from fresh buffy coats (Central Laboratory Blood Bank, Netherlands, Amsterdam) by standard Ficoll-Hypaque density centrifugation. PBMCs were frozen in multiple vials at a high concentration and, when required, thawed and activated with 5 μg/ml phytohemagglutinin and cultured in RPMI medium containing 10% FCS, penicillin (100 U/ml), streptomycin (100 μg/ml), and recombinant interleukin-2 (rIL-2) (100 units/ml). On day 4 of culture, the cells underwent CD4⁺ enrichment by incubating the PBMC with CD8 immunomagnetic beads and removing the CD8⁺ lymphocytes.

Viruses and infections

Virus produced in SupTl cells and virus from SupTl evolution cultures was stored at -80⁰C and the virus concentration was quantitated by capsid CA-p24 ELISA as described previously. These values were used to normalize the amount of virus in subsequent infection experiments. Infection experiments were performed with 40OxIO³ SupTl cells or 20OxIO³ CD4⁺ primary lymphocytes and 100 pg CA-p24 or 500 pg CA-p24 of virus, respectively, per well in a 96-well plate. Virus spread was measured for 14 days using CA-p24 ELISA.

Single cycle infection and neutralization

The TZM-bl reporter cell line stably expresses high levels of CD4 and HIV-I co-receptors CCR5 and CXCR4 and contains the luciferase and β-galactosidase genes under control of the HIV-I LTR promoter. The TZM-bl cell line was obtained through the NIH AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH (Dr. John C. Kappes, Dr. Xiaoyun Wu and Tranzyme Inc., Durham, NC). One day prior to infection, TZM-bl cells were plated on a 96-wells plate in DMEM medium containing 10% fetal bovine serum, Ix MEM and penicillin/streptomycin (both at 100 units/ml) and incubated at 37°C with 5% CO2. A fixed amount of virus (1 ng CA-p24) was pre-incubated for 30 min at room temperature with escalating concentrations of monoclonal antibodies. 2G12 and 4E10 were obtained from Hermann Katinger through the NIH AIDS Research and Reference Reagent Program; b6 and bl2 were donated by Dennis Burton (The Scripps Research Institute, La Jolla, CA); 17b was a gift from James Robinson (Tulane University, New Orleans, LA) and CD4-IgG2 was a gift from William Olson (Progenies

Pharmaceuticals Inc., Tarrytown, NY). This mixture was added to TZM-bl cells at 70-80% confluency (~17xlO³ cells per well) in the presence of 400 nM saquinavir (Roche, Basel, Switzerland) and 40 μg/ml DEAE in a total volume of 200 μl on a 96-well plate. Two days post-infection the medium was removed and cells were washed once with PBS and lysed in Reporter Lysis buffer (Promega, Madison, WI). Lucif erase activity was measured using the Luciferase Assay kit (Promega) and a Glomax luminometer according to the manufacturer's instructions (Turner BioSystems, Sunnyvale, CA). All infections were performed in duplicate and luciferase measurements were also performed in duplicate. Uninfected cells were used to correct for background luciferase activity. The infectivity of each mutant without inhibitor was set at 100%. Non-linear regression curves were determined and IC50 values were calculated using Prism software version 4.0c.

Virus evolution

Evolution experiments were essentially performed as described previously. 5 x 10⁶ SupTl cells were transfected with 1, 10 or 40 μg pLAI by electroporation (cultures A, B and C/D respectively). The cultures were inspected regularly for the emergence of revertant viruses, using CA-p24 ELISA and/or the appearance of syncytia as indicators of virus replication. Initially, we passaged the transfected SupTl cells. When we observed efficient virus replication we passaged the virus-containing cell-free supernatant onto fresh cells. Decreasing amounts of supernatant was passaged when cells were (almost) wasted due to infection by replicating virus. The intervals and volumes of cell free passage differed for each culture (indicated in Fig. 3). At regular intervals, cells and filtered supernatant were stored at -80⁰C for subsequent genotypic and phenotypic analysis and virus was quantitated by CA-p24 ELISA. When a putative revertant virus was identified, DNA was extracted from infected cells, and the complete proviral env sequences were PCR-amplified using primers 1 (δ'-ATAAGCTTAGCAGAAGACAGTGGCAATG-S') and 2 (5'- GCAAAATCCTTTCCAAGCCC- 3') and sequenced.

Folding assays

SDS-PAGE and Western blot

The Ndel and Stul fragments from amplified revertant env genes were cloned into the pPPI4 vector for expression of recombinant stabilized JR-FL gpl40 constructs SOS gpl40 and SOSIP gpl40. Soluble gpl40 was produced in transiently transfected 293T cells in the presence of co-expressed furin as previously described. Cell lysates were prepared in lysis buffer: 25 mM Tris- HCl pH7.8, 2 mM DTT, 2 mM CDTA, 10% glycerol, 1% Triton-XIOO). The cell extracts containing maturing gpl40 and culture supernatants containing secreted gpl40 were subjected to SDS-PAGE and Western blot analysis as described previously using the JR-FL V3 specific mouse monoclonal antibody PA-I (a gift from William Olson, Progenies Pharmaceuticals).

Results

Design of loop-deleted Env

Various variable loop deletion variants of Env have been generated by us and others for functional, structural and vaccine studies, but most of these constructs are slightly different and no comparative studies have been performed. It is a priori hard predict which deletions are preferable in terms of Env folding and function. We have constructed a set of loop deleted Env variants with different deletions in the V1/V2 and V3 region in the context of the CXCR4-using LAI isolate, which is very convenient for evolution experiments. Some of these deletions were of novel design, while others were based on published studies to provide a comparison (Fig. IA).

Variants 1 and 2 are of novel design. In contrast to most previously described V1/V2 deletion variants in which the disulfide bonds (between Cl 19 and C205 and/or C126 and C196) are maintained and the V1/V2 region replaced with a Gly-Ala-Gly linker, we replaced the respective cysteines with two adjoining alanines thus creating a continuous protein backbone (Fig. IA and IB). Variants 3 and 4 were derived and recloned from our previous studies on loop-deleted disulfide stabilized Env constructs. Note that these were JR-FL derived and part of the flanking regions between the Ndel and Stul restriction sites that were used for subcloning were also derived from JR-FL (see materials and methods section). We hypothesized that this sequence variation compared to the other constructs might result in different evolution routes. Variants 5 and 6 were designed to allow for evolution of an alternative disulfide bonded architecture of the V1/V2 stem. Variant 5 retained the cysteines at position 126 and 131, while their counterparts C157 and C196 were eliminated. We hypothesized that an alternative disulfide bridge could be formed between 126 and 131 to rearrange the V1/V2 stump. Mutant 6, lacking C196, contained an uneven number of cysteines. An uneven number of cysteines is usually disadvantageous, but we envisaged that this could possibly facilitate new evolution routes by allowing for the addition or removal of a cysteine, resulting in an alternative achitecture of the V1/V2 stem. In addition, mutant 6 contains a HXB2 Vl region which is 5 amino acids shorter than that of LAI. Some other amino acids in Vl also differ compared to wild-type (wt) LAI (Fig. 1).

Variant 8 is a copy of the variant described by Wyatt et al. that was used to crystallize the gpl20 core (Fig. IB). After prolonged culturing of this variant in a previous study by Cao et al., an evolved variant was identified with a change in the Gly-Ala-Gly linker region: Asp-Ala-Gly. We reproduced this mutant (variant 9). Based on the results of the study by Cao et al., we hypothesized that the Gly-Ala-Gly linker may not be optimal and we constructed additional variants with changes in the linker region to test their relative functionality and allow for diverse evolution pathways to improve Env function. We generated variants with the following linker residues: 10: GIy- Asp-Gly; 11: Asp-Asn-Gly and 12: Gly-Thr-Gly. Note that construct 11 contains an extra potential glycosylation site within the linker region. Variant 14 has also been described earlier.

Most mutants were constructed such that the bridging sheet between inner and outer domain which forms upon CD4 binding and which is part of the coreceptor binding domain, remained intact (Fig. IB). However variants 1 and 14 lack β2 and β3, while variants 5 and 6 lack β3.

We also constructed three variants with deletions in the V3 loop (variants 15-17). Variant 15 lacks 7 amino acids in the N-terminal part of the V3, while variant 16 lacks 10 amino acids at the C-terminal end. These deletions are combined in variant 17, in which the conserved tip sequences are retained.

Functional characterization of loop-deleted Env

To assess the activity of the loop-deleted Env variants we performed single cycle infection assays with the respective mutants. The variant viruses were produced in SupTl cells and used to infect TZM-bl reporter cells containing the luciferase gene under control of the LTR promoter. V1/V2 mutants 1, 3-6, 14 and all V3 mutants 15-17 did not exhibit any activity in these functional assays (Fig. 2 and results not shown). In contrast, V1/V2 variants 2, 9 and 11 remained relatively efficient in infecting the reporter cells, although not as efficient as wt Env. Variants 8, 10 and 12 displayed a low but reproducible level of infection.

Interestingly, V1/V2 variants 8-12, which are very similar in design with only minor changes in the linker replacing the V1/V2, showed considerably different activities in these infection experiments. Mutants 9 and 11 containing the linker Asp- Ala- GIy and Asp-Asn-Gly respectively, were more active than variants 8 (GIy- Ala-Gly), 10 (Gly-Asp-Gly) and 12 (Gly-Thr- GIy). Apparently, these subtle changes in the linker can have a considerable impact on Env activity. The activity of variant 2 shows that the traditional design of loop deletion, that is the retention of a disulfide bridge linked by a small flexible stretch of amino acids, is not necessary. The Cysl26-Cysl96 disulfide bridge is replaced by two adjoining alanines, thus forming a continuous protein backbone. This Cysl26-Cysl96 disulfide bond is required for virus replication in the context of wt virus, but apparently not anymore when the V1/V2 domain is deleted.

We also tested these viruses in spreading infections on SupTl T cells and primary CD4⁺ T cells (see below). The replication experiments in SupTl cells mirrored the single cycle experiments with some qualitative differences. Most of the mutants were not able to replicate in primary CD4⁺ cells, but some replication was observed for mutants 2, 9 and 11. Oxidative folding of Vl/V2-deleted Env

Evolution of Vl/V2-deleted Env We investigated whether the function of loop- deleted Env constructs could be rescued. For this we used spontaneous virus evolution, which is likely to select for compensatory second-site changes instead of loop repair by sequence insertion. SupTl cultures transfected with each of the molecular clones (three or four independent cultures per variant) were maintained for prolonged time (4/4 months) as described in the materials and methods section and monitored for the appearance of faster replicating variants by inspection by eye for the appearance of syncytia and CA-p24 ELISA. The initial CA-p24 production after bulk transfection of SupTl cells roughly mirrored the single cycle infection experiments of Fig. 2 (not shown). Viruses were passaged cell free when signs of active virus spread were apparent.

We never observed any replicating virus in the cultures of V1/V2 mutants 1 and 5 or the V3 mutants 15-17. Thus, these deletions are incompatible with residual Env function that would allow subsequent virus evolution. The V3 viruses were therefore not included in subsequent experiments. We observed evolution in 4/4 cultures of variant 3, 4/4 of variant 4 (of which two were subsequently lost during cell-free passage, see below), 3/4 of variant 6, and 1/4 of variant 14, indicating that although the deletions quite severely affect Env function, the virus is able to rescue this function by evolution. In some cases, we lost replicating viruses during cell free passage indicating that although Env function was sufficient for cell-cell spread, some of these variants encountered problems in direct virus-cell infection (variants 2, 4, 10 and 12). Of interest is that we observed profound differences between virus variants in the ability to form syncytia and the morphology of syncytia (not shown). These different properties, which also changed over the course of the evolution experiment, could not be correlated with CA-p24 production and replication kinetics, suggesting that differences in the mode of Env function underlie these phenomena.

Functional analysis of Vl/V2-deleted revertant Envs

To confirm that the faster replicating viruses had evolved, the mutant and revertant viruses were directly compared in an infection experiment. SupTl cells were infected with equal amounts of virus and virus spread was monitored by CA-p24 ELISA (Fig. 4A). Mutant 2 was able to replicate quite efficiently and no dramatic differences were found for the evolved variants 2A and 2D. Mutant 3 was a poor replicating virus and the viruses from 3 out of 4 cultures clearly showed an improvement (3B-D), while the virus from culture 3A did not show such an improvement. Mutant 4 was a very poorly replicating virus and both evolved variants were greatly improved, 4C appearing to be the best. Mutant 6 was also a very poorly replicating virus but all three evolved variants (6A- C) displayed w i-like virus spread. Mutant 14 was replication defective and only evolved variant 14B was able to replicate, although with a 4 day delay compared to wt. Mutants 8-12 all replicated efficiently. For some evolved variants (e.g. 9B, 1OB, HA, 12B, 12C) an improvement compared to the original mutant was apparent.

We also tested the V1/V2 mutants and evolved variants for replication in primary blood cells (Fig. 4B). Most mutants were unable to replicate in primary CD4⁺ cells, but variants 2, 9 and 11 displayed a low level of virus spread. We observed improved replication for some of the evolved variants (variants 6B, 9B, 1OB and 12C), although virus spread was still poor compared to the wt virus. Some variants lost the capacity to replicate in primary T cells (2A, 2D, HC), which may indicate specific adaptation to the SupTl T cell line in which the evolution experiment was performed.

To confirm that the evolved viruses had improved their Env function we also performed a single cycle infection assay with TZM-bl cells (Fig. 5). For most variants we clearly observed an improvement in infectivity in TZM-bl cells upon evolution (3A-D, 4C, 4D, 6A-C, 8B, 8C, 9B, 1OB and 14D). We again observed a diminished infectivity in some variants compared to the original variant (2A, 2D, 8A, 9A, 9C, 1 IA-C), pointing at SupTl specific adaptations. Thus, using virus evolution we were able to obtain several replication competent Env variants with large V1/V2 deletions.

Genotypic analysis of Vl/V2-deleted revertant Envs

We next investigated the unlikely scenario that the evolved virus variants had reintroduced sequences at the location of the V1/V2 deletion. The V1/V2 domain of provirus in revertant cultures after 4/4 months of evolution was PCR amplified and subjected to gel electrophoresis. No changes in the size of PCR products was observed compared to the input mutant viruses (Fig. 6). As expected, the virus cannot easily rebuild Vl/V2-sequences. To identify determinants that are responsible for the improvement of Env function, the complete env genes were PCR-amplified and sequenced. The resulting sequences represent the predominant variants in the viral quasispecies. The observed reversions are given in Table 1. We also performed "clonal" sequencing for some variants and these usually mirrored the population sequence. All cultures contained changes compared to the input mutant sequence, except for culture 14B. A selected set of mutant and revertant Env variants were pursued in follow-up experiments (see Example II).

Neutralization sensitivity of Vl/V2-deleted variants

To assess the neutralization sensitivity of Vl/V2-deleted mutants and revertants, we performed neutralization assays with a set of monoclonal antibodies (MAbs) to gpl20 and gp41. We choose to perform these experiments with wt, 2, 4C, 6B, 9, 9B, 1OB, 11 and HA. We selected this diverse set of viruses because they were able to efficiently infect TZM-bl cells, which were used for the neutralization experiments. Furthermore, most of these viruses also able to infect primary CD4⁺ T cells. We included the mutant-revertant pairs 9-9B and 11-1 IA to investigate whether the neutralization sensitivity changed upon evolution. The inhibition curves are shown in Fig. 7 and the respective 50% inhibitory concentrations (IC50) are given in table 2.

We first tested the neutralization sensitivity to the 4E10 MAb directed against the membrane proximal region in gp41. We hypothesized that the exposure of the 4E10 epitope would not be affected significantly by truncation of the V1/V2 domain. However, we found that all variants were more sensitive than the wt virus (IC50 ranging from 1.2 — 2.8 μg/ml versus ~10 μg/ml for wt). Apparently, deletion of the V1/V2 domain in gpl20 increases the accessibility of the membrane proximal domain in gpl41. We did not observe major differences between mutant viruses and evolved variants (compare 9-9B and 11-llA). The epitope for the glycan dependent 2G12 MAb is located on the outer face of gpl20. We observed that most viruses exhibited increased sensitivity to 2G12 (IC50 ranging from 0.080 - 0.22 μg/ml versus 6.1 μg/ml for wt), suggesting that the exposure of the epitope is increased upon deletion of the V1/V2 domain. As for 4E10, we did not observe major differences for the two mutant-revertant pairs. Revertant 1OB was resistant to 2G12 neutralization, consistent with the loss of the 295 glycan, which is part of the 2G12 epitope. Resistance was not complete, since even low 2G12 concentrations resulted in an infection inhibition of 25%. Possibly a 2G12- sensitive subpopulation was present within the viral quasispecies that had not acquired the T297I substitution yet.

Mutants 2, 9 and 11 were highly sensitive to neutralization by CD4- IgG2 used as a surrogate for CD4 (IC50 of 0.0055 - 0.0090 μg/ml) compared to the wt virus (IC50 of 0.58 μg/ml), confirming that the Vl/V2-domain is involved in limiting the accessibility of the CD4BS. Of the revertant viruses the 6B variant, which contains most of the Vl sequences, was more resistant to CD4 than the Vl/V2-deleted variants (IC50 of 0.034 μg/ml), but more sensitive than the wt virus. These results indicate that on the native trimer, both Vl and V2 are involved in shielding of the CD4BS. The evolved 9B and HA variants (IC50 of 0.16 and 0.015 μg/ml, respectively) were more resistant than the original mutants 9 and 11. Their affinities for CD4 may be lower, caused by the reversions located in or near the CD4BS (G458D, F382L, M434T: see discussion).

We next tested the sensitivity to the broadly neutralizing antibody bl2 directed to the CD4BS. All mutants were highly sensitive to bl2 neutralization (IC50 of 0.010 - 0.018 μg/ml for mutants and 0.77 μg/ml for wt), but interestingly, complete neutralization was not achieved even at high bl2 concentrations (~35% residual infectivity). We have repeatedly observed this phenomenon, but we do not have an adequate explanation. Most revertants were also highly sensitive to bl2 (IC50 of 0.0066 - 0.013 μg/ml), but could be inhibited completely. An exception was the 6B variant, which was similarly sensitive to bl2 as wt (IC50 of 0.37 μg/ml).

MAb b6 is derived from same phage library as bl2 and also targets the CD4BS, but it does not neutralize wt virus, presumably because its angle of binding to gpl20 is incompatible with binding to the Env trimer. We indeed observed that wt LAI was resistant to b6 neutralization. In contrast, we found that the V1/V2- deleted mutant viruses were sensitive to b6 neutralization, although b6 was less potent that bl2 against these viruses (IC50 of 0.072 - 0.39 μg/ml). The revertant viruses were equally sensitive to b6 neutralization (IC50 of 0.054 — 0.14 μg/ml). Only the 6B variant was quite resistant to b6 neutralization (IC50 2.13 μg/ml) although not as resistant as the wt virus, indicating that both Vl and V2 play a role in covering the b6 epitope on trimeric Env.

The 17b MAb is directed to an epitope overlapping with the coreceptor binding site. Creation and exposure of the epitope is induced by CD4 binding. The neutralizing potency of 17b is therefore limited. While the wt virus was resistant to 17b neutralization, the mutant viruses were sensitive to 17b (IC50 of 0.24 - 1.7 μg/ml), indicating that V1/V2 deletion increases exposure of the epitope. We observed that the evolved variants 9B, 1OB and HA were resistant to 17b neutralization. This may be explained by the acquisition of the V120E, P417T and M434T reversions located in 62, 619 and 621, respectively, of the four- stranded bridging sheet that forms the 17b epitope. Variant 6B, containing most of Vl, was also resistant to 17b neutralization.

Improvement of synthesis and secretion of soluble stabilized Env

Reversions selected during evolution experiments to were used to improve folding and secretion of soluble stabilized Env immunogens. For instance, selected deletion variants were cloned into an expression vector for SOS gpl40 based on the JR-FL isolate. The PCR fragments from different timepoints during evolution of the ΔV1/V2.6 variant (Fig. 6) were cloned into an SOS gpl40 vector and sequenced. Most clones contained the mutations identified in the population sequence at the respective timepoints (indicated in the labels of Fig. 8), but one clone of culture 6B contained an additional substitution (M104I; Fig 8). The resulting SOS gpl40 constructs were transiently expressed in 293T cells in the presence of furin overexpression. The cell lysates and supernatants were subjected to SDS-PAGE and Western blot to analyze the intracellular and secreted Env variants. Full length SOS gpl40 was expressed efficiently as reported previously. Expression of the SOS ΔV1/V2.6 variant was dramatically reduced. In sharp contrast, all four evolved variants were efficiently expressed and secreted in the culture supernatant. These results indicate that compensatory changes were selected in the virus evolution experiments improve the folding and secretion of stabilized gpl40. Example II

Evolution of VlV2-deleted viruses (Phase II)

Aim: identify compensatory changes that accommodate V1/V2 deletions.

We performed the evolution experiments in two phases:

Phase I: ~4% months of evolution, as described in Example I.

Phase II: An additional ~5 months of evolution, methodically similar to the study described to the phase I study, with one major exception: the evolved viruses from phase I were mixed in pairs or triples to allow for competition and recombination events. This mixing was repeated until only one culture remained (Fig. 11). This phase also served to establish which virus displayed the highest fitness. Note that this does not directly relate to which variant would be the best immunogen. On the contrary, the winning virus variant (6A) which is described above in Example I, contains most of the Vl resulting in partial shielding of important neutralization epitopes. Moreover, the viruses from the later stages of the Phase II study tend to display lower infectivity of TZM-bl cells implying that the acquired changes represent SupTl specific adaptations. Thus, during the later stages of evolution viruses evolved more and more towards a SupTl adapted phenotype. These viruses do therefore not comply with criteria 2 and 3 (see below). Nevertheless, this phase II study provided important functional data and yielded additional compensatory changes to the phase I study (see below).

Identification of compensatory changes

Evolved virus variants were sequenced as described above. The observed changes of the phase I study are described above. The amino acid changes observed in the phase II study are shown in Fig. 14. Selection and biochemical evaluation of evolved Vl/V2-Env trimers

A proof of principle for the assumption that evolved ΔV1 V2 variants result in better folding of recombinant Env proteins is provided in a previous example (Fig. 8). However, these particular variants were not selected for follow-up studies because most of the Vl is present. The presence of the Vl is undesirable for two reasons. First, the Vl may elicit unwanted strain- specific antibodies and, second, the remaining part of the Vl may shield neutralization epitopes (as we indeed showed by the neutralization experiments of Example I and in Fig. 7). Based on a list of 11 criteria we selected 11 variants for follow-up studies (see below, Figs. 12 and 14). Formulating these criteria we considered Env function (virus phenotype, e.g. broad cell tropism), exposure of neutralization targets (favourable virus neutralization), evolution pathways and the conclusions that drawn based on these evolution routes. Some of these criteria are overlapping, some are mutually exclusive. Selection criteria:

1. Virus showed good replication in SupTl cells (Fig. 4A).

2. Virus showed good infectivity in TZM-bl cells (2 and 5).

3. Virus showed some replication in primary cells (Fig. 4B). 4. Virus showed favourable neutralization profile (Fig. 7).

5. Recommendation 1: a hydrophilic residue replaces the glycine (G) at position 1 in the linker.

6. Recommendation 2: there is no disulfide bonded loop replacing the deleted sequences. 7. Recommendation 3: residue 197 is an asparagine (N).

8. Recommendation 4: the hydrophilicity of the surface of the V1/V2 stump is increased.

9. Recommendation 5: uncharacterized distal compensatory changes are present. 10. Construction is relatively easy (V1V2 deletion plus nearby reversions only) 11. The entire Vl is absent.

Selected variants Rationale for selection

A. ΔV1V2.2 mutant 2

B. ΔV1V2.4 mutant 4: control for C-F

C. ΔV1V2.4.D197N revertant 4D (phase I)

D. ΔV1V2.4.D197N.G127S revertant 4D plus replacement of first linker G

E. ΔV1V2.4.D197N.E429K revertant 4 (phase II)

F. ΔV1V2.4.D197N.G127S.E429K revertant 4 plus replacement of first linker G

G. ΔV1V2.8 mutant 8: control for H-K H. ΔV1V2.9 mutant 9

I. ΔV1V2.9.V120E revertant 9B (phase I) J. ΔV1V2.9.V120K revertant 89 (phase II) K. ΔV/V2.11 mutant 11

These variants are cloned in SOSIP gpl40, transiently expressed in 293T cells and analyzed biochemically for expression, stability and trimerization. Furthermore, to explore the antigenic surface of these variants, antibody probing studies are performed in order to select the variants that optimally expose neutralization targets. Based on these biochemical experiments a further selection of ~4 variants for analysis in immunization experiments is made.

Optimization of immunization protocol in rabbits using Env-CD40L fusion constructs. DNA vaccination protocols using plasmids expressing either stabilized gpl40 trimers or gpl40 trimer fused to CD40L (immunogens 1 and 2, Fig. 13) are carried out and tested in three immunization protocols (protocols 1-3, Fig. 13). We have chosen DNA immunization because of the ability to elicit Env specific T helper responses that can augment antibody responses. The effect of protein boosting is also evaluated. The rabbit sera are evaluated based on two assays: gpl20 ELISAs to obtain gpl20-specific titers, and neutralization assays to obtain information on the capacity of the immunogens to raise neutralizing antibodies. Initially neutralization against two virus strains is tested: LAI, a strain that is easily neutralized and enables us to quantify neutralizing activity, and JR-FL a notoriously neutralization resistant strain and homologous to the immunogen. Note that currently JR-FL SOSIP trimers are used as our favourite choice of Env. However, both the CD40L adjuvant as the use of evolved dVlV2 variants can be applied to other types of Env trimers and are thus independent of SOSIP trimer technology.

Evaluation of VlV2-deleted Env in rabbits.

The optimal immunization protocol from the previous section is used for evaluation of the ΔV1V2 constructs (immunogens 3A-K, Fig. 12). Based on our pilot experiments in mice, fusion to CD40L is expected to be optimal. The initial evaluation of the sera will be analysis of total gpl20-specifc antibody titers and neutralizing antibody titers. These analyses provide the main endpoint criteria for the invention: it is expected that the ΔV1V2 variants elicit neutralizing antibodies more efficiently than the full length Env trimer construct.

Example III

Improved expression of cleaved ΔV1V2 KNH1144 SOSIP.R6 trimers by compensatory changes obtained through evolution

In Example II we laid out a number of criteria to select "evolved" ΔV1V2 variants for follow up analysis (see also Table 3) and based on these criteria we proposed a number of variants including appropriate controls. Since we wish to produce recombinant soluble Env trimers based on the "evolved" ΔV1V2 variants, the next selection criteria is protein folding and expression. We thus created soluble stable recombinant trimer constructs based on variants A-K (for variants A-K see Figure 12 and Table 3). First, we generated stabilized S0SIP.R6 trimer based on the KNHl 144 isolate, because KNHl 144 S0SIP.R6 gpl40 forms very stable trimers facilitating our efforts to elucidate the atomic structure of Env trimers by X-ray crystallography.

(Of note, KNH1144 SOSIP. R6 appears less suitable for immunogenicity studies, so we used JR-FL based constructs for these studies (see below)). The KNHl 144 S0SIP.R6 ΔV1V2 A-K constructs were generated, expressed in 293T cells and analyzed by SDS-PAGE for protein expression levels (Fig. 15). We noted quite substantial differences in expression levels between the different variants. Strikingly, the accumulation of compensatory changes obtained from the evolution experiments improved protein expression levels considerably, proving that virus evolution of ΔV1V2 variants yielded compensatory changes that facilitate the generation of recombinant ΔV1V2 vaccine candidates. Hence, Env peptides comprising at least one amino acid substitution chosen from the group consisting of D197N, G127S, E429K, V120K and V120E are preferred.

Selection of three "evolved" ΔV1V2 variants for follow-up studies Based on our selection criteria as laid out in Example II combined with the KNHl 144 ΔV1V2 S0SIP.R6 protein expression levels (Fig. 15) we further narrowed our selection for follow up studies to three constructs: variant A: ΔV1V2.2; variant F: ΔV1V2.4.D197N.G127S.E429K; and variant J: ΔV1V2.9.V120K (Fig. 12). Note that variant A is not actually an "evolved" ΔV1V2 variant (it is of new design and comprises amino acid changes, but has no compensatory changes), and it is not among the best expressing proteins, but we nevertheless included it based on our previous criteria and because we wished a set of relatively diverse variants for analysis in immunogenicity experiments. Generation of "Evolved" JR-FL SOSIP.R6.IZ.His ΔV1V2 trimers

We constructed the three selected variants A, F and J in the context of JR-FL SOSIP.R6.IZ.His trimers (Fig. 13). The GCN4 based trimerization domain (IZ) affects Env precursor cleavage, but it improves trimerization and allows for the C-terminal addition of costimulatory molecules such as CD40L (see below). SDS-PAGE and western blot analysis revealed that the three ΔV1V2 JR-FL S0SIP.R6.IZ.His trimers were expressed efficiently in the culture supernatant of 293T cells (Fig. 16). Blue native PAGE analysis further showed that the three ΔV1V2 variants formed trimers as efficiently as the wt protein and this result was confirmed in size exclusion chromatography experiments (Fig. 17).

Antigenic profiles of "Evolved" JR-FL SOSIP.R6-IZ ΔV1V2 trimers

We proceeded with analyzing the interaction of antibodies with known specificities with the three selected ΔV1V2 constructs to probe their surface. A novel ELISA was employed in which we captured recombinant trimers onto Ni-NTA-coated solid phase using the trimerized C-terminal Histidine tag (Fig. 18).

First, we tested binding of CD4-IgG2 (a CD4 - Ig fusion construct) and bl2, a broadly neutralizing conformational antibody against the CD4 binding site (CD4BS; Fig. 18A). CD4 bound slightly better to the three ΔV1V2 variants, consistent with the ΔV1V2 viruses being more efficiently neutralizing by CD4- IgG2 (Table 2). We did not observe better binding for bl2 in contrast to the observed neutralization (Table 2). A number of other CD4BS antibodies (b6, 15e, F91, F105) mostly showed enhanced binding to the three ΔV1V2 variants (Fig. 18B). The enhanced binding of b6 was consistent with the enhanced neutralization of the ΔV1V2 viruses by b6 (Table 2). An exception was the lack of binding of F91 to variant J. Possibly, essential contact residues for F91 are missing in this variant.

The CD4 induced epitope (CD4i epitope) is formed and exposed after CD4 binding and the site overlaps with the binding site for the coreceptor, CXCR4 or CCR5. The binding of CD4i antibodies (48d, 17b, X5, 412d) to wt trimers is therefore enhanced in the presence of soluble CD4 (Fig. 18C). CD4i exposure is known to involve the V1V2 domain. We observed differential effects with our "evolved" ΔV1V2 variants (Fig. 18C). The binding of variants A and F to 48d and X5 roughly mirrored that of wt: inefficient binding in the absence of CD4, efficient binding in the presence of CD4. In contrast, variants A and F bound strongly to 17b even in the absence of CD4. 412d yielded intermediate results: variants A and F bound more efficiently to 412d in the absence of CD4 compared to wt, but their binding was still enhanced in the presence of CD4. Variant J bound poorly to all CD4i antibodies tested. This may be caused by the V120K substitution, which is in the epitope for these antibodies. Variant A was the most efficient binder to all CD4i antibodies indicating that the disulfide bonded loop that forms the V1V2 stump in the other two variants (Fig. 1&12) contributes to shielding of the CD4i epitopes. Surprisingly, the results reveal a differential effect of V1V2 deletion on the exposure of CD4i antibodies. This differential dependence of CD4i shielding by the V1V2 domain may originate in the fact that CD4 binding mediates two changes that contribute to formation and exposure of the CD4i epitopes respectively. First, CD4 binding causes the uniting of the two 2-stranded β- sheets β2-β3 and β20-β21 into the 4-stranded bridging sheet that forms the CD4i epitopes. Second, CD4 binding induces a repositioning of the Vl V2 domain. We hypothesize that 17b is not dependent on the first (i.e. it binds to only one of the two components), but is dependent on the latter, while 48d and X5 are more dependent on the first (i.e. they require the uniting of the bridging sheet). This is currently under investigation.

DC-SIGN is an important attachment receptor for the virus on for example dendritic cells and is involved in virus transmission from dendritic cells to T cells. It binds to oligomannose glycans on gpl20. We did not observe differences in DC-SIGN binding between the ΔV1V2 variants and wt, consistent with the notion that the oligomannose carobydrates that DC-SIGN interacts with are not located in the Vl V2 domain (Fig. 18D). In contrast, we did observe differential binding of the ΔV1V2 variants compared to wt using the broadly neutralizing antibody 2G12 which also binds to oligomannose glycans on gpl20, but in a more specific fashion than DC-SIGN does. The ΔV1V2 variants bound 2G12 more efficiently compared to wt, consistent with the enhanced 2G12 neutralization observed with ΔV1V2 viruses (Fig. 18D; Table 2). Similarly, the ΔV1V2 variants interacted more efficiently with antibodies to the V3 (39F and 19b; see Fig. 18D). Finally we tested a set of antibodies directed to the MPER-region and neighbouring cluster II in gp41 (2F5, 4E10, Z13el, D50). Again the antibodies appeared to interact more efficiently with the ΔV1V2 variants that the wt, although the differences were subtle (Fig. 18E).

In summary the probing results show that the global conformation of the constructs is unaltered. However, deletion of the V1V2 domain resulted in enhanced exposure of a large number of antibody epitopes resulting in enhanced immunogenicity of these epitopes and enhanced elicitation of neutralizing antibodies.

Efficient fusion of "Evolved" JR-FL ΔV1V2 trimers to the "cis- adjuvant" CD40L

In independent studies we found that JR-FL SOSIP.R6.IZ.His trimers fused to the golublar domain of mouse CD40L induced higher antibody titers in mice compared to the same construct without CD40L. The rationale of that study was to target the immunogen directly to dendritic cells and B cells, whilst at the same time activating these cells. We dubbed such costimulatory molecules fused to antigen "cis-adjuvants". We tested whether it was possible to fuse "evolved" JR-FL ΔV1V2 trimers to CD40L (in this case we used the rabbit CD40L sequence because we were planning rabbit immunization experiments; the rabbit CD40L was not known but we amplified it from rabbit PBMCs). We cloned the sequences encoding globular domain of rabbit CD40L downstream of wt and ΔV1V2 env sequences (see Fig. 13) and expressed the constructs in 293T cells. SDS-PAGE and western blot analysis revealed that the fusion constructs were expressed efficiently (Fig. 19), demonstrating that the "evolved" ΔV1V2 variants are suitable for use in a variety of recombinant vaccine constructs.

Induction of gpl20-specific antibodies by "Evolved" JR-FL ΔV1V2 trimers

To test immunogenicity of ΔV1V2 variants, we immunized rabbits according to the schedule in Fig. 13 with immunogens 1 (wt no CD40L), 2 (wt with CD40L) and 3A, 3F and 3 J ("evolved" ΔV1V2 variants A, F and J; see Fig. 13). Note that the experiment is ongoing and we only have preliminary data of the sera from week 6. Furthermore, the experiment will be extended for 6 weeks beyond the time line in Fig. 13: the rabbits will be vaccinated at week 14 with purified JR-FL SOSIP.R6 protein to boost the antibody responses. The final bleed will be at week 18. The development of anti-gpl20 responses was monitored by ELISA (Fig. 20). All three dVlV2 constructs as well as wt elicited gpl20-reactive antibodies. No significant differences were observed between the five groups, demonstrating that the "evolved" ΔV1V2 variants efficiently elicit antibodies against full length gpl20.

Elicitation of neutralizing antibodies by "Evolved" JR-FL dVlV2 trimers

We next tested virus neutralization. Because the week 6 sample is very early in the immunization scheme we did not expect very potent neutralization activity and we therefore selected the relatively easy to neutralize heterologous virus SF162 instead of the more robust (but homologous) JR-FL virus. Note that the SF162 virus does contain a full length V1V2 domain, hence, neutralization activity against a virus with a full length V1V2 domain is determined. For each rabbit we tested the sera at week 0 in addition to the sera of week 6 to account for any potential aspecific virus inhibition in the sera. At a 1:10 serum dilution we observed virus inhibition in a number of week 6 rabbit sera. When we compared the neutralization activity in the prebleed samples with the week 6 samples we noted that the difference was significant for variants F and J but not for wt and A. At a 1:30 serum dilution the difference between the neutralization by prebleed and week 6 sera was only significant for variant F. This demonstrates that variants according to the present invention with compensatory amino acid changes are indeed capable of eliciting a stronger neutralizing immune response as compared to wild type virus, even at this early stage.

A concern with major Env modifications like Vl V2 deletion is that neo- epitopes (i.e. the V1V2 stump) in such immunogens may induce antibodies that do not recognize the native, functional Env trimer and hence do not neutralize natural virus isolates. To monitor whether ΔV1V2 constructs elicited antibodies to neo-epitopes formed by the deletion of the V1V2 domain, we tested neutralization of the LAI ΔV1V2.9.V120K virus (variant J) by the week 6 rabbit sera. Although virus inhibition was observed in the sera (significant for variant J only), we did not observe significant differences between the various groups demonstrating that the ΔV1V2 constructs are not particularly prone to eliciting antibodies to neo-epitopes.

In summary, the constructs were immunogenic and elicited neutralizing antibodies although at low titers at this point. The data demonstrate that dVlV2 trimers are better immunogens than full length trimers. Tables

Table 1. Observed reversions in evolved ΔV1/V2 virus variants⁸

a Reversions that occur in independent cultures containing the same original virus are indicated in bold. Reversions that occur in multiple cultures containing different original viruses are highlighted (light grey). Identical reversions that occur in different original viruses in the 8-12 cluster are indicated in bold and highlighted (dark grey). We used the same code for different variants that result in loss of the same glycosylation site (N156K & S158F, T303A/K, N295Y & T297I, N234D & T236I). Mutations that result in the elimination of glycosylation sites are underlined and mutations that result in the acquisition of a glycosylation site are in italics. Mixed sequences and silent mutations were excluded. The dark grey fills represent cultures in which we did not find revertant viruses. The intermediate grey shading indicates cultures where replicating virus was observed at some point during the 4/4 months culturing, but which were lost during cell free passage. b The D197N was observed in early sequences (not shown), but the virus was subsequently lost during cell free passage.

Table 2. Neutralization sensitivity of ΔV1/V2 variants ^a gp41 glycan CD4BS CD4i

4E10 2G12 CD4 bl2 b6 17b

Wt >10 6.1 0.58 0.77 >10 >30

2 2.8 0.12 0.0090 0.018 0.39 1.7

9 2.7 0.13 0.0062 0.010 0.072 0.39

11 2.1 0.11 0.0055 0.017 0.14 0.24

4C 1.3 0.080 0.0070 0.0066 0.13 3.5

6B 2.6 0.22 0.034 0.37 2.13 >30

9B 1.9 0.081 0.16 0.013 0.16 >30

1OB 1.2 >10 0.0029 nd^b 0.054 25.8

HA 1.7 0.16 0.015 0.0077 0.083 >30

a IC50 values (μg/ml) were derived from the experiment in Fig. 6 as described in the materials and methods section. CD4-IgG2 was used as a surrogate for CD4. b nd, not determined Table 3. Fulfilment of selection criteria by virus variants

NA: not applicable ND: not determined

* B and G do not fulfil many of the criteria but they only serve as controls.

Figure Legends

Figure 1. Design of loop deletion variants. A. Schematic representation of the V1/V2 deletion variants used in this study. The variable loops are indicated in yellow. The deletions are indicated by either a blue line or by blue coloured residues, which replace the deleted sequences, β-strands 2 and 3, components of the conserved bridging sheet, are indicated in green. Cysteines and disulfide bonds are coloured in red. Note that the designation of disulfide bonds is based on studies with the wild-type protein. We do not know whether the designated disulfide bonds do in fact form in these variants. This is particularly questionable in mutants 5 and 6 where one or two wt cysteine pairs cannot be formed. In variant 5 an alternative and hypothetical disulfide bond between 126 and 131 is drawn. In variant 6 the native C131-C157 bond is drawn and C126 is left unpaired. B. Assumed 3D models of selected ΔV1/V2 variants. The upper panel provides perspectives on gpl20 as seen from CD4 (left) and the coreceptor (right; rotated over the y-axis by 90°). The rectangle in the upper right panel encloses the Vl/V2-stem and the bridging sheet. Colours are the same as in Fig. IA. The lower panels represent details of this area for the variants 1, 2 and 8 and an overlay of these variants (right lower panel, variant 1 (red); variant 2 (blue); variant 8 (white); disulfide bonds in yellow). The four β-strands that compose the bridging sheet and the local disulfide bonds are indicated. The LAI gpl20 core and variant cores were modeled by SWISS- MODEL (http://swissmodel.expasy.Org//SWISS-MODEL.html) using the HXB2 core (pdb accession code 1G9M,) and drawn using Viewer lite (Accelrys Inc.). The overlay in the lower right panel was prepared with Deepview/SWISS pdb Viewer (http://www.expasy.org/spdbv/) and rendered in Viewer lite. C. Schematic representation of the V3 deletion variants. Colours are as in Fig. IA. D. Rearrangement of the Vl/V2-stem in variant 6. The starting situation is in Fig. IA. Note that the drawn disulfide bond between residues C131 and C157 is purely speculative. However, in the wt protein these cysteines do form a disulfide bond. Left panel: hypothetical situation after the first substitution (C131Y) with a new non-native disulfide bond between C 126 and C 157, resulting in restoration of the Vl to its full length and formation of a pseudo- V2. Right panel: removal of N156 after prolonged culturing. Note that we observe the removal of the glycosylation site at N156 in two independent culture in two different substitutions: N156K (as indicated in the Figure) in culture 6A and S158F in culture 6B. The sequences were derived from sequencing clones at day 38 (6C) and day 99 (6A).

Figure 2. Functional analysis of deletion variants. TZM-bl reporter cells

(confluency of 70-80%) were infected with 1.0 ng of mutant or w t virus in the presence of SQV in a 96-well plate, and luciferase activity was measured after 48 h.

Figure 3. Oxidative folding of deletion variants. HeLa cells expressing wild- type gplδO or V1/V2 variants 1, 3 or 4 were pulse-labeled for 10 min and chased for the indicated times. Cells were lysed and Env proteins immunoprecipitated. Immunoprecipitates were deglycosylated and analyzed by reducing (A) and non-reducing (B) 7.5% SDS-PAGE. Shed gpl20 was immunoprecipitated from the culture media at later chase times (C). Folding intermediates (IT), the native form (NT), the reduced state with the signal peptide attached (Ru) or removed (Rc) and shed gpl20 (*) are indicated.

Figure 4. Replication of mutant and adapted viruses. A. 40OxIO³ SupTl cells were infected with 100 pg virus and replication was monitored for 18 days by CA-p24 ELISA. B. 20OxIO³ primary CD4⁺ T cells were infected with 500 pg virus and replication was monitored. The results are representative for three independent experiments using cells from different donors with each experiment. Figure 5. Functional analysis of adapted Envs. TZM-bl reporter cells were infected with 1.0 ng of mutant or w t virus in the presence of SQV, and luciferase activity was measured after 48 h.

Figure 6. No restoration of V1/V2 sequences. The V1/V2 domain and surrounding sequences from proviral DNA in evolution cultures were PCR- amplified and analyzed by gel electrophoresis. The length of the amplified fragments are 460 bp (wt), 253 bp (2), 304 bp (3), 265 bp (4), 364 bp (6), 268 bp (8-12) and 220 bp (14).

Figure 7. Neutralization sensitivity of mutant and adapted viruses. TZM-bl cells were infected with 1.0 ng virus as described in the legend of Fig. 2 and materials in methods section. Virus was preincubated with the indicated amount of monoclonal antibody for 30 min at RT prior to infection of reporter cells. The luciferase activity in the absence of antibody was set at 100%.

Figure 8. Substitutions improve the folding and secretion of stabilized gpl40 constructs. The ΔV1V2.6 deletion and compensatory changes identified in various evolution cultures were introduced in an expression vector for SOS gpl40. The variants were expressed in 293T cells and intracellular and secreted Env was analyzed by SDS-PAGE, BN-PAGE and western blot.

Figure 9. Surface analysis of variants 8, 9 and 9B. A. Locations of the mutations and substitutions (residues 120, 128 and 458) on the 3D structure of gpl20 (same view as in Fig. IB upper left panel). B. Relative Env function of variants 8, 9 and 9B compared to wt (based on the data in Fig. 5). C. Analysis of surface hydrophobicity. The upper panels present a similar view as in Fig. IB (upper right panel). The lower panels show gpl20 rotated over the z-axis by 180°. These perspectives provide good views on both sides of the V1/V2 stump. The surface associated with nonpolar residues is indicated in grey and the surface associated with polar residues in cyan. Mutations and substitutions are indicated. The LAI gpl20 core and variant cores were modelled by SWISS- MODEL and drawn using Viewerlite. D. Analysis of electrostatic surface potential. Electrostatic surface potentials were calculated and rendered using Deepview (red: acidic, blue: basic). The mutations and substitutions that are responsible for the changes in electrostatic surface potential are indicated. Note that we underestimated the polar surface of gpl20, since we only considered the surface associated with protein not with carbohydrate.

Figure 10. Alignment of the amino acid sequences encoding a gpl20 of strains JR-CSF, JR-FL, LAI, and HXB2.

Figure 11. Timeline of evolution and competition/recombination experiments. Phase I: three or four independent transfections (A-D) were performed for each virus variant to initiate independent evolution cultures. Initially only the cells were passaged, but when replicating viruses were identified these viruses were passaged cell free onto uninfected cells. Several cultures were stopped after 2/4 months since no replicating virus was present. Phase II: virus cultures were repeatedly mixed as indicated and continued.

Figure 12. Selected evolved V1/V2 deletion variants for follow-up studies. The variable loops are indicated in yellow. The residues replacing deleted sequences are coloured blue, β-strands 2 and 3, components of the conserved bridging sheet, are indicated in green. Cysteines and disulfide bonds are coloured in red. Note that the designation of disulfide bonds is based on studies with the wild-type protein. We do not know whether the designated disulfide bonds do in fact form in these variants. Changes compared to the original sequence are in black. Figure 13. Schematic representation of immunization schedule, protocols and immunogens.

Figure 14. Observed reversions in evolved ΔV1/V2 virus variants (phase II). Reversions that occurred in more than once in independent cultures containing the same original virus are indicated in red. Reversions that occur in multiple cultures containing different original viruses are represented in blue. Identical reversions that occur in different original viruses in the 8-12 cluster are indicated in green. We used the same color code for different variants that result in loss of the same glycosylation site (N156K & S158F, T303A/K, N295Y & T297I, N234D & T236I). Mutations that result in the elimination of glycosylation sites are underlined and mutations that result in the acquisition of a glycosylation site are in italics. Mixed sequences and silent mutations were excluded.

Figure 15. Improved expression of cleaved KNH1144 ΔV1V2 SOSIP.R6 trimers by compensatory changes. Reducing SDS-PAGE and western blot analysis of KNH1144 ΔV1V2 SOSIP. R6 gpl40 variants expressed transiently in 293T cells in the presence of furin.

Figure 16. Expression of "Evolved" JR-FL SOSIP.R6.IZ.His ΔV1V2 trimers. Reducing SDS-PAGE and western blot analysis of selected JR-FL ΔVlV2SOSIP.R6.IZ.His gpl40 variants expressed transiently in 293T cells.

Figure 17. Oligomerization of "Evolved" JR-FL SOSIP.R6.IZ.His ΔV1V2 trimers. (A) Blue native PAGE and western blot analysis of selected JR-FL SOSIP.R6.IZ.His ΔV1V2 variants expressed in 293T cells. Results from two independent transfections are shown. (B) Size exclusion analysis of wt and variant J (ΔV1V2.9.V120K) SOSIP.R6.IZ.His gpl40 trimers. Proteins produced in 293T cells were fractionated using a Superose-6 column. The fractions were analyzed by SDS-PAGE and western blot. The elution of standard proteins is indicated.

Figure 18. Antigenic profiles of "Evolved" JR-FL SOSIP.R6-IZ.His ΔV1V2 trimers. ELISA analysis of the binding of various monoclonal antibodies, CD4-IgG2 and DC-SIGN-Fc to wt JR-FL S0SIP.R6-IZ.His and JR- FL SOSIP.R6-IZ.His ΔV1V2 variants A, F and J. Equal amounts of the 4 proteins, transiently expressed in 293T cells, were immobilized onto Ni-NTA plates and ligands were titrated. (A) CD4-IgG2 and bl2 (CD4BS); (B) b6, 15e, F91 and F105 (CD4BS); (C) 48d, 17b, X5, 412d (CD4i); (D) DC-SIGN-Fc, 2G12 (oligomannose), 39F, 19b (V3); (E) 2F5, 4E10, Z13el (MPER), D50 (gp41 cluster II).

Figure 19. Efficient fusion of "Evolved" JR-FL ΔV1V2 trimers to the "cis-adjuvant" CD40L. Reducing SDS-PAGE analysis of gpl40 and gpl40- CD40L proteins secreted from transiently transfected 293T cells.

Figure 20. Induction of gpl20-specific antibodies by "Evolved" JR-FL ΔV1V2 trimers. gpl20-specific IgG midpoint binding titers in the day 0 and day 42 rabbit sera were measured by standard gpl20 ELISA.

Figure 21. Elicitation of neutralizing antibodies by "Evolved" JR-FL ΔV1V2 trimers. Inhibition of single cycle infection of TZM-bl cells by HIV- 1SFI62 (A) or HIV-1LAI ΔVIV2.9.VI2OK (B) was tested at sera dilutions of 1:10 and 1:30. Day 0 (prebleed) and d42 sera were compared side by side. * p<0.05 (one- tailed Mann- Whitney test).

Claims

1. A peptide comprising an amino acid sequence of a gpl20 molecule of HIV envelope glycoprotein complex (Env) or a functional analogue thereof, wherein at least 5 amino acids of the Vl loop and at least 5 amino acids of the V2 loop of said gpl20 molecule are absent, and wherein said peptide comprises at least one amino acid exchange and/or at least one amino acid insertion in the remainder of said amino acid sequence as compared to wild-type gpl20.

2. A peptide according to claim 1, wherein said peptide comprises at least one amino acid exchange and/or at least one amino acid insertion, as compared to wild-type gpl20, in the region corresponding to amino acid positions 114-210 of HXB2, wherein the amino acid positions are indicated in Figure 10.

3. Method for production of a peptide according to claim 1 or 2, said method comprising a) generating or providing a nucleotide sequence encoding a gpl20 molecule of HIV envelope glycoprotein complex (Env) or a functional analogue thereof; b) deleting part of said nucleotide sequence encoding at least 5 amino acids of the Vl loop and part of said nucleotide sequence encoding at least 5 amino acids of the V2 loop from said nucleotide sequence encoding gpl20; c) mutating and/or exchanging and/or inserting and/or deleting at least one triplet encoding an amino acid in the remaining part of said nucleotide sequence; and d) allowing expression of said peptide from said nucleic acid.

4. A method according to claim 3, comprising mutating and/or exchanging and/or inserting and/or deleting at least one triplet which encodes an amino acid residue in the region corresponding to amino acid positions 114- 210 of HXB2, wherein the amino acid positions are indicated in Figure 10.

5. An oligomeric complex comprising at least 1, preferably at least 2, more preferably at least 3 peptide(s) according to claim 1 or 2 and/or comprising at least 1, preferably at least 2, more preferably at least 3 peptide(s) obtainable by a method according to claim 3 or 4.

6. An oligomeric complex according to claim 5, further comprising at least 1, preferably at least 2, more preferably at least 3 gp41 molecule(s) of

HIV or a functional analogue thereof.

7. A peptide and/or a method and/or a complex according to any one of claims 1 to 6, wherein said peptide further comprises at least one amino acid deletion.

8. A peptide and/or a method and/or a complex according to any one of claims 1 to 7, wherein said peptide comprises a deletion of at least 5 amino acids, preferably at least 10, more preferably at least 20, more preferably at least 40, most preferably at least 60 amino acids in the region corresponding to amino acid positions 120-204 of HXB2, wherein the amino acid positions are indicated in Figure 10.

9. A peptide and/or a method and/or a complex according to any one of claims 1 to 8, wherein said peptide comprises a deletion of at least 5 amino acids, preferably at least 10, more preferably at least 20, more preferably at least 40, more preferably at least 60, even more preferably at least 67, most preferably 69 amino acids in the region corresponding to amino acid positions 127-195 of HXB2, wherein the amino acid positions are indicated in Figure 10.

10. A peptide and/or a method and/or a complex according to any one of claims 1 to 9, wherein said peptide comprises a deletion of at least 5 amino acids in the region corresponding to amino acid positions 142 to 148 of HXB2 and/or a deletion of at least 5 amino acids, preferably at least 10, more preferably at least 20, more preferably at least 30, most preferably 36 amino acids in the region corresponding to amino acid positions 168 to 203 of HXB2, wherein the amino acid positions are indicated in Figure 10.

11. A peptide and/or a method and/or a complex according to any one of claims 1 to 10, wherein said peptide comprises a deletion of at least 5 amino acids, preferably at least 10, more preferably at least 20, more preferably 23, in the region corresponding to amino acid positions 133-155 of HXB2 and/or a deletion of at least 5 amino acids, preferably at least 10, more preferably at least 20, even more preferably at least 30, most preferably 36, in the region corresponding to amino acid positions 159-194 of HXB2, wherein the amino acid positions are indicated in Figure 10.

12. A peptide and/or a method and/or a complex according to any one of claims 1 to 11, wherein said at least one amino acid exchange comprises an exchange of a cysteine at a position corresponding to position 126 and/or position 196 and/or position 131 and/or position 157 of HXB2 into another amino acid, preferably into another non-hydrofobic amino acids, more preferably into alanine, wherein the amino acid positions are indicated in Figure 10.

13. A peptide and/or a method and/or a complex according to claim 12, wherein said at least one amino acid exchange comprises an exchange of a cysteine at a position corresponding to position 126 and to position 196, or to position 131 and to position 196 of HXB2 into another amino acid, preferably into another non-hydrofobic amino acid, more preferably into alanine, wherein the amino acid positions are indicated in Figure 10.

14. A peptide and/or a method and/or a complex according to any one of claims 1 to 13, wherein said at least one amino acid exchange comprises loss of a glycosylation site at a position corresponding to amino acid position 156, 234, 295, 301 and/or 339 of HXB2, wherein the amino acid positions are indicated in Figure 10.

15. A peptide and/or a method and/or a complex according to claim 14, wherein said at least one amino acid exchange comprises loss of a glycosylation site at a position corresponding to position 156 of HXB2, wherein the amino acid positions are indicated in Figure 10.

16. A peptide and/or a method and/or a complex according to claim 14 or

15, wherein said loss of a glycosylation site comprises a mutation in the N- glycosylation consensus sequence Asp-Xaa-Ser or Asp-Xaa-Thr, wherein Xaa is any natural amino acid except proline, such that the resulting sequence no longer comprises said consensus sequence.

17. A peptide and/or a method and/or a complex according to any one of claims 1 to 16, wherein said at least one amino acid exchange comprises retaining or introducing a glycosylation site at a position corresponding to amino acid position 197 of HXB2, preferably retaining or introducing an asparagine at a position corresponding to amino acid position 197 of HXB2 and a serine/threonine at a position corresponding to amino acid position 199 of HXB2, wherein the amino acid positions are indicated in Figure 10.

18. A peptide and/or a method and/or a complex according to any one of claims 1 to 17, wherein said peptide comprises a variant selected from the group consisting of variants 1, 2, 5, 6, 10, 11 and 12 as depicted in Figure 1 and/or wherein said peptide comprises a variant selected from the group consisting of variants A - K as depicted in Figure 12.

19. A peptide and/or a method and/or a complex according to any one of claims 1 to 18, wherein said peptide comprises a variant selected from the group consisting of variant C and variant D and variant E and variant F and variant H and variant I and variant J and variant K as depicted in Figure 12.

20. A peptide and/or a method and/or a complex according to any one of claims 1 to 19, wherein said peptide comprises at least one amino acid substitution chosen from the group consisting of D197N, G127S, E429K, V120K and V120E.

21. A nucleic acid sequence encoding a peptide according to any one of claims 1, 2 and 7 to 20 and/or encoding a peptide obtainable by a method according to any one of claims 3, 4 and 7 to 20.

22. A virus comprising a peptide according to any one of claims 1, 2 and 7 to 20 or comprising a peptide obtainable by a method according to any one of claims 3, 4 and 7 to 20 and/or comprising a complex according to any one of claims 5 to 20 and/or comprising a nucleic acid sequence according to claim 21.

23. An immunogenic composition comprising a peptide according to any one of claims 1, 2 and 7 to 20 or obtainable by a method according to any one of claims 3, 4 and 7 to 20 and/or comprising a complex according to any one of claims 5 to 20 and/or comprising a nucleic acid sequence according to claim 21 and/or comprising a virus according to claim 22.

24. An immunogenic composition according to claim 23 which is a vaccine for use in preventing, treating and/or diminishing HIV infection.

25. A peptide according to any one of claims 1, 2 and 7 to 20 or obtainable by a method according to any one of claims 3, 4 and 7 to 20 and/or a complex according to any one of claims 5 to 20 and/or a nucleic acid sequence according to claim 21 and/or a virus according to claim 22 and/or an immunogenic composition according to claim 23 or 24 for use in inducing or enhancing an immune response specific for human immunodeficiency virus (HIV).

26. Use of peptide according to any one of claims 1, 2 and 7 to 20 or obtainable by a method according to any one of claims 3, 4 and 7 to 20 and/or a complex according to any one of claims 5 to 20 and/or a nucleic acid sequence according to claim 21 and/or a virus according to claim 22 and/or an immunogenic composition according to claim 23 or 24 for the preparation of a medicament or prophylactic agent for inducing or enhancing an immune response specific for human immunodeficiency virus (HIV).

27. A non-human animal comprising a peptide according to any one of claims 1, 2 and 7 to 20 or obtainable by a method according to any one of claims 3, 4 and 7 to 20 and/or comprising a complex according to any one of claims 5 to 20 and/or comprising a nucleic acid sequence according to claim 21 and/or comprising a virus according to claim 22 and/or comprising an immunogenic composition according to claim 23 or 24.

28. An antibody and/or functional equivalent thereof capable of specifically binding to an amino acid sequence of a peptide and/or a complex according to any one of claims 1, 2 and 5 to 20.

29. An antibody and/or functional equivalent thereof according to claim 28 for use in preventing, treating and/or diminishing HIV infection.

30. An antibody and/or functional equivalent thereof according to claim 28 or 29 for use as a medicament.