WO2010034479A1 - Protective e. coli strains for reducing the salmonella typhimurium pathogen load in the intestines - Google Patents
Protective e. coli strains for reducing the salmonella typhimurium pathogen load in the intestines Download PDFInfo
- Publication number
- WO2010034479A1 WO2010034479A1 PCT/EP2009/006871 EP2009006871W WO2010034479A1 WO 2010034479 A1 WO2010034479 A1 WO 2010034479A1 EP 2009006871 W EP2009006871 W EP 2009006871W WO 2010034479 A1 WO2010034479 A1 WO 2010034479A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- colicin
- coli
- strain
- protein
- salmonella
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- C07K14/245—Escherichia (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/185—Escherichia
Definitions
- the present invention relates to novel bacterial strains, compositions comprising the same, methods of treating or preventing gastrointestinal disorders in vertebrate, and using such strains in probiotic treatment of gastrointestinal disorders, such as diarrhea.
- colonization resistance Most mucosal surfaces of the mammalian body are colonized by microbial communities ("microbiota”). A Particularly high density of commensal microbiota is present the intestine. Commensal microbial colonization shields the intestines from infection with bacterial pathogens, said effect being called "colonization resistance”.
- the Escherichia coli strain Nissle 1917 is one of the best-studied probiotic strains. It is commercially available from ARDEYPHARM GmbH, Herdecke, Germany, under the trademark 'Mutaflor'. This particular E. coli strain was isolated in 1917 by Alfred Nissle based on its potential to protect from infectious gastroenteritis. The Nissle 1917 strain has been shown to combine efficient intestinal survival and colonization with the lack of virulence. This makes it a safe and effective candidate in the treatment of chronic inflammatory bowel diseases as well as diarrheal diseases in young children.
- E. coli Nissle 1917 strain reduces the severity of the disease symptoms and duration. However, it cannot completely block the disease. Therefore, new probiotic strains with superior protective properties are needed.
- an E. coli strain a composition comprising said E. coli strain, and a method of treating or preventing a gastrointestinal disorder in vertebrates, particularly mammals, as given in the independent claims.
- Advantageous embodiments of the invention are given in the dependent claims.
- genetically mod- ified probiotic E. coli cells comprising at least one first genetic modification introducing an exogenous protein and/or enhancing enzymatic activity of an endogenous protein, the first genetic modification resulting in an enhanced level of biosynthesis of at least one colicin immunity protein or precursors thereof compared to the respective wild type cell.
- modified probiotic E. coli cells wherein the colicin immunity protein is selected from a group comprising: colicin A, colicin B, colicin D, colicin Ia, colicin Ib, colicin K, colicin M, colicin N, colicin E1 , colicin E2, colicin E4, colicin E5, colicin E6, colicin E7, colicin E8, colicin E9 and colicin S4 immunity protein preferably from a group con- sisting of: colicin Ia, colicin E1 , colicin E2, colicin B, colicin M, colicin K and colicin S4 immunity protein.
- colicin immunity protein is selected from a group comprising: colicin A, colicin B, colicin D, colicin Ia, colicin Ib, colicin K, colicin M, colicin N, colicin E1 , colicin E2, colicin E4, colicin E5, colicin
- the probiotic cells comprise plas- mids configured to express a gene encoding said colicin immunity protein.
- genes encoding colicin resistance can be introduced into the ge- nome of the cells as transgene.
- the plasmid is configured to express a gene encoding said colicin immunity protein and the corresponding coli- cin protein.
- an isolated E. coli strain which is designated 8178. It corresponds to International Deposition No: DSM21844.
- probiotic compositions comprising an effective amount of E. coli strain 8178 and/or of enhanced genetically modified probiotic E. coli cells comprising at least one first genetic modification introducing an exogenous protein and/or enhancing enzymatic activity of an endogenous protein, the first genetic modification resulting in an enhanced level of biosynthesis of at least one colicin immunity protein compared to the respective wild type cell.
- composition according to the invention is a food product, a food additive or supplement, an animal feed additive or supplement, a pharmaceutical preparation or a biotherapeutic composition.
- the composition according to the invention is formulated for oral delivery.
- the bacterial strain is provided in a lyophilized form.
- the above mentioned composition is used for treating or preventing a gastrointestinal disorder in vertebrates, particularly mammals.
- Said gastrointestinal disorder may be for example Salmonel- Ia enterica induced acute diarrhea, chronic enteric Salmonellosis, and Typhoid fever (chronic carrier state).
- the above mentioned composition is used for the manufacture of a medicament for treating or preventing a ga- strointestinal disorder in vertebrates, particularly mammals.
- Said gastrointestinal disorder may be Salmonella enterica induced acute diarrhea, chronic enteric Salmonellosis, and Typhoid fever (chronic carrier state).
- a method of treating or preventing a gastrointestinal disorder in vertebrates, particularly mammals comprising the administration to a subject in need thereof an therapeutically effective amount of the above mentioned E. coli cells or E. coli strain 8178 or a composition as described above, comprising an effective amount of said E. coli cells or the E. coli strain 8178.
- Said gastrointestinal disorder may be Salmonella enterica induced acute diarrhea, chronic enteric SaI- monellosis, and Typhoid fever (chronic carrier state).
- the bacteria, the bacterial strain or the composition is administered orally.
- the bacterial strain is provided in a lyophilized form.
- the administration is effected at a concentration of said bacterial strain between 10 5 and 10 9 viable cells per dose.
- a method for enhancing colonization resistance properties in E. coli strains comprising the steps of:
- a plasmid configured to express a gene encoding at least one colicin immunity protein, preferably selected from: colicin A, colicin B, colicin D, colicin Ia, colicin Ib, colicin K, colicin M, colicin N, co- licin E1 , colicin E2, colicin E4, colicin E5, colicin E6, colicin E7, colicin E8, colicin E9 and colicin S4, and
- Described herein is the isolation of strains of E. coli according to the present invention for use as probiotic treatments for the prevention of Salmonella enteri- ca S. typhimurium diarrhea.
- One of these E. coli strains was isolated from
- E. coli strain 8178 was isolated from mouse and termed strain 8178. Said strain has been deposited at Deutsche Sammlung von Mikroorga- nismen und Zellkulturen (DSMZ), Braunschweig, Germany, and was assigned Deposition No. DSM21844. E. coli strain 8178 was assigned to ECOR group B2.
- E. coli strain 8178 was able to grow, but could not to diminish S. typhimurium levels in streptomycin-treated mice.
- the experimental data therefore show that the newly isolated E. coli strain 8178 is a more effective agent than E. coli Nissle 1917 for treating diarrheal diseases in vertebrates, particularly in mammalian organisms including humans.
- E. coli strains with high colonization percentage was isolated from mouse (strain 8178), and was tested for its competition with wild type strain S. typhimurium SL1344 in the intestinal lumen, and compared to coli strain Nissle 1917.
- mice were treated with streptomycin (20 mg i.g.) and infected 24 h later, with S. typhimurium strain SL1344 (5x10 7 cfu i.g., streptomycin-resistant), as a control group, (2) with a 1 :1 mixture of S. typhimurium wild type strain SL1344 and streptomycin-resistant E. coli Nissle 1917 (a total of 5x10 7 cfu i.g.), (3) with a 1 :1 mixture of S. typhimurium wild type strain SL1344 and streptomycin-sensitive E. coli strain 8178 (a total of 5x10 7 cfu i.g.).
- Fecal bacterial loads at day 1 post infection were determined by plating on respective MacConkey-agar plates. Mice were sacrificed at day 4 p.i. and caec- al bacterial loads were determined by plating on respective MacConkey-agar plates with or without streptomycin. The results are shown in Figure 2, (a) for day 1 post infection, and (b) for day 4 post infection, on a logarithmical scale.
- E. coli strain 8178 significantly reduces wild type S. typhimuhum colonization in the infected inflamed gut lumen at day 4 post infection.
- S. typhimurium levels in the intestine were not significantly decreased by E. coli Nissle 1917 within the same time ;
- the de- termined S. typhimuhum densities in the caecal content were significantly lower in E. coli strain 8178-coinfected mice than in the control group (S. typhimurium infection only).
- the E. coli Nissle 1917 strain was able to grow, but could not to diminish S. typhimurium levels in streptomycin-treated mice.
- E. coli strain 8178 is thus a more effective agent than Nissle 1917 for treating diarrheal diseases in mammalian organisms as it has enhanced colonization resistance properties and is therefore a better competitor against S. typhimurium. Furthermore it can be concluded that E. coli strain is also a more effective probiotic agent for preventing diarrheal diseases.
- a cosmid library containing partially digested genomic DNA of E.coli 8178 was constructed.
- As host vector for the library pM1423 was used which is based on the cosmid vector Supercosi (Stratagene) but contains an origin of transfer (oriT) that enabled mobilization of the cosmid between different E.coli strains by conjugation with a helper strain.
- oriT sequence of pGP704 was amplified by PCR using primer sequences: OriTfwd: CCCAAGCTTTTTTGTCCGGTGTTGGGTTG (Sequ. ID. No. 5) and OriTrev: CCCAAGC ⁇ AGCCGACCAGGCTTTCCACGC(Sequ. ID. No. 6) and cloned into the Hindlll site of SuperCos 1 (Stratagene).
- Genomic DNA was isolated from E. coli 8178 by standard methods. The preparation of the pM1423 vector for ligation reaction with genomic DNA fragment of E. coli 8178 was executed as indicated in the Cold Spring Harbor protocol (Sambrook et al., 1989). 20 ⁇ g of pM1423 DNA was digested with 5OU Xbal in a volume of 200 ⁇ I and incubated over night at 37 ° C. The digested cosmid was extracted once with phenol/chloroform and once with chloroform, precipitated with 100% ethanol/0.3M sodium acetate, washed in a solution of 70% ethanol, and dissolved in 18O u I ddH 2 O. The digest was analyzed by 1% agarose gel electrophoresis.
- the BamHI treated DNA was extracted precipitated, washed and the DNA pellet was dissolved in 15 ⁇ I ddH2O.
- the Xbal and BamHI digested cosmid was ana- lyzed by 1% agarose gel electrophoresis.
- the ligation reaction was performed as indicated in the SuperCosi cosmid vector kit protocol (Stratagene).
- the amount of digested chromosomal #8178 and SuperCos 1 DNA was measured; SuperCos 1 : 127ng/ u l and #8178 chromosomal DNA: 746ng/ ⁇ l.
- the ligation was done using the following components: 2.5 ⁇ g partially digested #8178 genomic DNA [CIAP], 1.0 ⁇ g SuperCos i DNA [Xbal, CIAP, BamHI], 2.0 ⁇ I of 10x ligase buffer, 2.0 ⁇ I 1OmM rATP,1.0 ⁇ I T4 DNA ligase and water was added to a final volume of 20 ⁇ I. Afterwards the ligation reactions were incubated over night at 16°C. The ligation was then packaged in lambda phage using the Stra- tagene Gigapack® III XL Packaging Extract according to the manufacturer's instructions.
- Cosmids were transferred from the host strain E. coli XLIblue MR to E. coli Nis- sle 1917 by conjugation.
- mice By way of infection experiments it was screened for cosmids that contain genes conferring competitive properties to E. coli Nissle 1917 against S. typhimurium in the gut. Streptomycin-treated mice were co-infected with a 1 :1 mixture of S. typhimurium SL1344 and E. coli Nissle 1917 (+cosmid-library) (in total 10_7 cfu).
- pB944-4 This clone was termed pB944-4.
- pB944-4 was re-transformed into E. coli Nissle 1917 and it was verified that it confers competitive properties against S. typhimurium in a co-infection experiment ( Figure 3).
- the sequence of the insert of pB944-4 derived from 8178 was determined and found to be 35,657 kbp. To narrow further down the genes responsible for the competitive property a subscreen of pB944-4 was performed. DNA of pB944-4 was partially digested with Bsp143l and fragments between 1 and 3 kbp were ligated into BamH ⁇ digested pBluescript (Stratagene). The resulting plasmid library was transformed into E. coli Nissle 1917. Streptomycin-treated mice with a 1 :1 mixture of S. typhimurium SL1344 and E. coli Nissle 1917 (+plasmid library) (in total 10_7 cfu) were co-infected. 4 days post infection plasmid-bearing E. coli Nissle 1917 clones were isolated from intestinal content and the cosmids were analyzed by restriction enzyme analysis and it was found that in 3 mice one plasmid clone was enriched.
- the enriched clone was termed pC831-2. It contains a 1 ,177 kbp long insert. The sequence is homologous to the gene for colicin IB immunity protein (Ko- nisky and Richards, 1970; Varley and Boulnois, 1984). In Figure 4 the Plasmid map of pC831-2 is shown. pC831-2 has pSK Bluescript (Stratagene) as backbone and contains a 1 ,177 kbp long insert (arrow between MCS).
- the se- quence is homologous to the gene for promoter and coding sequence of colicin Ib immunity protein (cii) and the c-terminal part of colicin Ib (marked as Colicin IB in Figure 4), which is non-functional.
- Colicins are proteinous toxins produced by and toxic for bacteria of the Entero- bacteriaceae family (Kerr et al., 2002). They can be encoded on colicinogenic plasmids that bear the genetic determinants for colicin synthesis, immunity and sometimes also release. The gene for colicin Ib production and the respective immunity protein are also present in S. typhimurium strain SL1344. The colicin Ib immunity protein inserts into the bacterial membrane and protects the producer against being killed by its own colicin. Experimental results
- E. coli Nissle pB944-4 out-competes S. typhimurium wild-type.
- E. coli triangles
- Salmonella (dots) colonization density in cecal content at day 4 pi. was determined (Log10 cfu/gram).
- Complementation of ECN with cosmid pB944-4, containing a 35kbp fragment of 8178 DNA confers out-competing phenotype. The dotted line indicates the detection limit.
- E. coli Nissle 1917 ECN competes significantly better against the colicin-deficient S. typhimurium mutant. The dotted line indicates again the detection limit.
- the genes for colicin Ib production and immunity are encoded on a conjugative 86kb plasmid in S. typhimurium SL1344 ('plasmid M'). Plasmid Il was tagged in S. typhimurium SL1344 with an antibiotic resistance marker (S. typhimurium M992; plasmid M::aphT) and streptomycin-treated mice were co-infected with E. coli Nissle 1917 and M992 (1 :1 by gavage). After 4 days post infection E. coli Nissle 1917 harboring plasmid Il that was in vivo transferred by conjugation from S. typhimurium M992 was detected. The resulting E. coli Nissle 1917 strain (plasmid Wv.aphJ) was now resistant to colicin IB as it contained now the genes for colicin Ib synthesis and immunity and showed improved competitiveness against S. typhimurium SL1344.
- Plasmid Il was tagged in S
- Colicin production by Salmonella enterica strains or serovars is an important factor for competition against commensal E. coli strains. It has been shown above, that the efficacy of E. coli Nissle 1917 against S. typhimurium SL1344 can be significantly improved by the introduction of a plasmid expressing the gene for colicin Ib immunity protein by enhancing colonization resistance properties in said E. coli strain.
- colicins can be designed that express immunity proteins for other colicins.
- colicins are for example: colicin A, colicin B, colicin D, colicin Ia, colicin Ib, colicin K, colicin M, colicin N, colicin E1 , colicin E2, colicin E4, colicin E5, colicin E6, colicin E7, colicin E8, colicin E9 and colicin S4.
- Immunity proteins for colicin Ia, colicin E1 , colicin E2, colicin B, colicin M, colicin K and colicin S4 are encoded by the enclosed Sequences Sequ ID Nos. 1 to 4.
- Said sequences were cloned into pSK Bluescript and afterwards introduced into E. coli, preferably into E. coli Nissle.
- the microorganism identified under T above was accompanied by
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- General Engineering & Computer Science (AREA)
- Tropical Medicine & Parasitology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Genetically modified probiotic E. coli strains and methods for producing such E. coli strains comprising at least one first genetic modification introducing an exogenous protein and/or enhancing enzymatic activity of an endogenous protein, the first genetic modification resulting in an enhanced level of biosynthesis of at least one colicin immunity protein or precursors are provided. Also provided is an E. coli strain, which is designated 8178. Said strain corresponds to International Deposition No: DS M21844. A probiotic composition comprising an effective amount of said novel E. coli strains is used for treating or preventing a gastrointestinal disorder in vertebrates, particularly mammals. Said gastrointestinal disorder may be Salmonella enterica induced acute diarrhea, chronic enteric Salmonellosis, and Typhoid fever (chronic carrier state). In an advantageous embodiment the composition according to the invention is a food product, a food additive or supplement, an animal feed additive or supplement, a pharmaceutical preparation or a biotherapeutic composition.
Description
Protective E. coli Strains for Reducing the Salmonella Typhimurium Pathogen Load in the Intestines
Field of the Invention
The present invention relates to novel bacterial strains, compositions comprising the same, methods of treating or preventing gastrointestinal disorders in vertebrate, and using such strains in probiotic treatment of gastrointestinal disorders, such as diarrhea.
State of the art
Most mucosal surfaces of the mammalian body are colonized by microbial communities ("microbiota"). A Particularly high density of commensal microbiota is present the intestine. Commensal microbial colonization shields the intestines from infection with bacterial pathogens, said effect being called "colonization resistance".
The virulence strategies allowing enteropathogenic bacteria to successfully compete with the microbiota and to overcome colonization resistance are poorly understood. In a recent study looking at the manipulation of the intestinal microbiota by the enteropathogenic bacterium Salmonella enterica subspecies 1 Se- rovar Typhimurium (S. typhimurium) in a mouse colitis model, it was found that an inflammatory host response induced by S. typhimurium was necessary and sufficient for the pathogen to overcome colonization resistance, changing both microbiota composition and suppressing its growth (Barbel Stecher et al., "Salmonella enterica Serovar Typhimurium exploits inflammation to compete with
the intestinal microbiota", PLoS Biology, vol. 5, 2007, pp. 2177-2187). The disclosure of the above mentioned reference is incorporated herein by reference in its entirety.
The Escherichia coli strain Nissle 1917 is one of the best-studied probiotic strains. It is commercially available from ARDEYPHARM GmbH, Herdecke, Germany, under the trademark 'Mutaflor'. This particular E. coli strain was isolated in 1917 by Alfred Nissle based on its potential to protect from infectious gastroenteritis. The Nissle 1917 strain has been shown to combine efficient intestinal survival and colonization with the lack of virulence. This makes it a safe and effective candidate in the treatment of chronic inflammatory bowel diseases as well as diarrheal diseases in young children.
E. coli Nissle 1917 strain reduces the severity of the disease symptoms and duration. However, it cannot completely block the disease. Therefore, new probiotic strains with superior protective properties are needed.
Objects of the Invention
An object of the invention is to provide alternative and enhanced probiotic E. coli strains with increased colonization resistance properties. Another object of the invention is to provide an advantageous method of treating or preventing a gastrointestinal disorder in vertebrates, particularly mammals.
These and other objects are achieved by an E. coli strain, a composition comprising said E. coli strain, and a method of treating or preventing a gastrointestinal disorder in vertebrates, particularly mammals, as given in the independent
claims. Advantageous embodiments of the invention are given in the dependent claims.
Summary of the invention
According to a first aspect of the invention, there are provided genetically mod- ified probiotic E. coli cells comprising at least one first genetic modification introducing an exogenous protein and/or enhancing enzymatic activity of an endogenous protein, the first genetic modification resulting in an enhanced level of biosynthesis of at least one colicin immunity protein or precursors thereof compared to the respective wild type cell.
According to a second aspect of the invention, there are provided modified probiotic E. coli cells, wherein the colicin immunity protein is selected from a group comprising: colicin A, colicin B, colicin D, colicin Ia, colicin Ib, colicin K, colicin M, colicin N, colicin E1 , colicin E2, colicin E4, colicin E5, colicin E6, colicin E7, colicin E8, colicin E9 and colicin S4 immunity protein preferably from a group con- sisting of: colicin Ia, colicin E1 , colicin E2, colicin B, colicin M, colicin K and colicin S4 immunity protein.
According to a third aspect of the invention, the probiotic cells comprise plas- mids configured to express a gene encoding said colicin immunity protein. Alternatively genes encoding colicin resistance can be introduced into the ge- nome of the cells as transgene.
According to a fourth aspect of the invention the plasmid is configured to express a gene encoding said colicin immunity protein and the corresponding coli- cin protein.
According to a further aspect of the invention, there is provided an isolated E. coli strain, which is designated 8178. It corresponds to International Deposition No: DSM21844.
According to a further aspect of the invention, there are provided probiotic compositions comprising an effective amount of E. coli strain 8178 and/or of enhanced genetically modified probiotic E. coli cells comprising at least one first genetic modification introducing an exogenous protein and/or enhancing enzymatic activity of an endogenous protein, the first genetic modification resulting in an enhanced level of biosynthesis of at least one colicin immunity protein compared to the respective wild type cell.
In an advantageous embodiment the composition according to the invention is a food product, a food additive or supplement, an animal feed additive or supplement, a pharmaceutical preparation or a biotherapeutic composition. Preferably the composition according to the invention is formulated for oral delivery. In another advantageous embodiment of the composition according to the invention the bacterial strain is provided in a lyophilized form.
According to a further aspect of the invention the above mentioned composition is used for treating or preventing a gastrointestinal disorder in vertebrates, particularly mammals. Said gastrointestinal disorder may be for example Salmonel-
Ia enterica induced acute diarrhea, chronic enteric Salmonellosis, and Typhoid fever (chronic carrier state).
According to a fourth aspect of the invention the above mentioned composition is used for the manufacture of a medicament for treating or preventing a ga- strointestinal disorder in vertebrates, particularly mammals. Said gastrointestinal disorder may be Salmonella enterica induced acute diarrhea, chronic enteric Salmonellosis, and Typhoid fever (chronic carrier state).
According to a further aspect of the invention, there is provided a method of treating or preventing a gastrointestinal disorder in vertebrates, particularly mammals, the method comprising the administration to a subject in need thereof an therapeutically effective amount of the above mentioned E. coli cells or E. coli strain 8178 or a composition as described above, comprising an effective amount of said E. coli cells or the E. coli strain 8178. Said gastrointestinal disorder may be Salmonella enterica induced acute diarrhea, chronic enteric SaI- monellosis, and Typhoid fever (chronic carrier state).
In an advantageous embodiment of the method according to the invention the bacteria, the bacterial strain or the composition is administered orally. In another advantageous embodiment of the method according to the invention the bacterial strain is provided in a lyophilized form.
Preferably the administration is effected at a concentration of said bacterial strain between 105 and 109 viable cells per dose.
According to a further aspect of the invention, there is provided a method for enhancing colonization resistance properties in E. coli strains comprising the steps of:
i) selection of a colicin-producing Salmonella spp. strain or serovar (short for serovarietas), preferably human pathogenic Salmonella ty- phimuήum or Salmonella enteritidis strains,
ii) co-infection of said colicin-producing Salmonella with at least one E. coli strain, preferably a E. coli strain Nissle 1917,
iii) in vivo transfer of a plasmid encoding for at least a colicin immunity protein from the Salmonella strain to the E. coli strain, and
iv) isolation of co-infected E. coli strains carrying the plasmid encoding for at least a colicin immunity protein.
According to a further aspect of the invention, there is provided a method for enhancing colonization resistance properties in E. coli strains comprising the steps of:
i) producing a plasmid configured to express a gene encoding at least one colicin immunity protein, preferably selected from: colicin A, colicin B, colicin D, colicin Ia, colicin Ib, colicin K, colicin M, colicin N, co- licin E1 , colicin E2, colicin E4, colicin E5, colicin E6, colicin E7, colicin E8, colicin E9 and colicin S4, and
ii) in vivo or in vitro transfer of said plasmid into an E. coli strain.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. All publications mentioned hereunder are incorporated herein by reference.
Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described.
I. E. co// strain 8178
Described herein is the isolation of strains of E. coli according to the present invention for use as probiotic treatments for the prevention of Salmonella enteri- ca S. typhimurium diarrhea. One of these E. coli strains was isolated from
Mouse and designated as 8178 (corresponding to International Deposition No.
DSM21844) It has to be noted that the above identified strain may be used alone or in combination, and may also be combined with other treatments known in the art.
Using a mouse model for acute S. typhimurium induced diarrhea (Hapfelmeier and Hardt, TiM 2005; Stecher and Hardt TiM 2008) it was observed that some E coli strains, being low frequency members of the normal gut flora, grow up to high densities specifically in cases of severe gut inflammation. This phenome- non has been evident in 10-30% of all mouse experiments.
One such competing E. coli strain was isolated from mouse and termed strain 8178. Said strain has been deposited at Deutsche Sammlung von Mikroorga-
nismen und Zellkulturen (DSMZ), Braunschweig, Germany, and was assigned Deposition No. DSM21844. E. coli strain 8178 was assigned to ECOR group B2.
The competition of E. coli strain 8178 as well as E. coli strain Nissle 1917 with wild type strain S. typhimuήum SL1344 in the intestinal lumen was specifically tested in the above mentioned S. typhimurium diarrhea mouse model. It was found that E. coli strain 8178 can significantly reduce wild type S. typhimurium colonization in the infected inflamed gut lumen at day 4 post infection. In contrast, S. typhimurium levels in the intestine were not significantly decreased by Nissle 1917 within the same time. S. typhimurium densities in the caecal con- tent were significantly lower in strain 8178-coinfected mice than in control mice. Similarly, the E. coli Nissle 1917 strain was able to grow, but could not to diminish S. typhimurium levels in streptomycin-treated mice.
The experimental data therefore show that the newly isolated E. coli strain 8178 is a more effective agent than E. coli Nissle 1917 for treating diarrheal diseases in vertebrates, particularly in mammalian organisms including humans.
Experimental results
It was observed that after S. typhimurium infection of streptomycin-treated mice (mouse model for acute S. typhimurium induced diarrhea, Barthel, 2003 #1300) certain E. coli strains, being low frequency members of the normal gut flora, grow up to high densities.
Intestinal contents of infected mice were plated on MacConkey-agar plates (selective culture media for enterobacteriaceae) without antibiotics, on which E. coli
colonies ("red colonies") and Salmonella colonies ("white colonies") can be distinguished. Figure 1 shows the percentage of "red colonies" in relation to Salmonella colonies for a selection of streptomycin-treated mice infected with wt S. typhimuhum, at day 1 and 4 after infection. As is evident in a considerable number of experiments (10-30% of all mouse experiments) the percentage of E. coli colonization in relation to S. typhimuhum colonization in the intestines on day 4 after infection reaches up to 80 %.
One of the E. coli strains with high colonization percentage was isolated from mouse (strain 8178), and was tested for its competition with wild type strain S. typhimurium SL1344 in the intestinal lumen, and compared to coli strain Nissle 1917.
Animals: All aspects of animal procedures were approved by the responsible local authorities and performed according to the Swiss legal requirements. Sex and age matched specified pathogen free (SPF) C57BI/6 mice were held under barrier conditions at the rodent center (RCHCI, ETH Hόnggerberg, Wolfgang- Pauli-Str. 10, CH-8093 Zurich) of the Swiss Federal Institute of Technology Zurich.
Infection: Mice were treated with streptomycin (20 mg i.g.) and infected 24 h later, with S. typhimurium strain SL1344 (5x107 cfu i.g., streptomycin-resistant), as a control group, (2) with a 1 :1 mixture of S. typhimurium wild type strain SL1344 and streptomycin-resistant E. coli Nissle 1917 (a total of 5x107 cfu i.g.), (3) with a 1 :1 mixture of S. typhimurium wild type strain SL1344 and streptomycin-sensitive E. coli strain 8178 (a total of 5x107 cfu i.g.).
Fecal bacterial loads at day 1 post infection (p.i.) were determined by plating on respective MacConkey-agar plates. Mice were sacrificed at day 4 p.i. and caec- al bacterial loads were determined by plating on respective MacConkey-agar plates with or without streptomycin. The results are shown in Figure 2, (a) for day 1 post infection, and (b) for day 4 post infection, on a logarithmical scale.
The experimental results clearly show that E. coli strain 8178 significantly reduces wild type S. typhimuhum colonization in the infected inflamed gut lumen at day 4 post infection. In contrast, S. typhimurium levels in the intestine were not significantly decreased by E. coli Nissle 1917 within the same time; The de- termined S. typhimuhum densities in the caecal content were significantly lower in E. coli strain 8178-coinfected mice than in the control group (S. typhimurium infection only). Similarly, the E. coli Nissle 1917 strain was able to grow, but could not to diminish S. typhimurium levels in streptomycin-treated mice.
E. coli strain 8178 is thus a more effective agent than Nissle 1917 for treating diarrheal diseases in mammalian organisms as it has enhanced colonization resistance properties and is therefore a better competitor against S. typhimurium. Furthermore it can be concluded that E. coli strain is also a more effective probiotic agent for preventing diarrheal diseases.
II. Screen for genes of 8178 that enhance its colonization resistance properties
A screen was conducted for genes that are present in E. coli 8178 and make - after transfer into E. coli Nissle 1917 - this probiotic strain a better competitor against S. typhimurium. A cosmid library containing partially digested genomic
DNA of E.coli 8178 was constructed. As host vector for the library pM1423 was used which is based on the cosmid vector Supercosi (Stratagene) but contains an origin of transfer (oriT) that enabled mobilization of the cosmid between different E.coli strains by conjugation with a helper strain. The library having a complexity of 1000 individual cosmids was transferred into E. coli Nissle 1917.
For construction of plasmid pM1423 the oriT sequence of pGP704 was amplified by PCR using primer sequences: OriTfwd: CCCAAGCTTTTTTGTCCGGTGTTGGGTTG (Sequ. ID. No. 5) and OriTrev: CCCAAGCπAGCCGACCAGGCTTTCCACGC(Sequ. ID. No. 6) and cloned into the Hindlll site of SuperCos 1 (Stratagene).
Genomic DNA was isolated from E. coli 8178 by standard methods. The preparation of the pM1423 vector for ligation reaction with genomic DNA fragment of E. coli 8178 was executed as indicated in the Cold Spring Harbor protocol (Sambrook et al., 1989). 20 μ g of pM1423 DNA was digested with 5OU Xbal in a volume of 200 μ I and incubated over night at 37 ° C. The digested cosmid was extracted once with phenol/chloroform and once with chloroform, precipitated with 100% ethanol/0.3M sodium acetate, washed in a solution of 70% ethanol, and dissolved in 18O u I ddH2O. The digest was analyzed by 1% agarose gel electrophoresis. To the 18O u I pM1423 [Xbal], 20 μ I 10x dephosphory- lation buffer and 0.1 Unit of Alkaline phosphatase (AP) was added and incubated for 30min at 37 ° C. An additional aliquot (0.1 U) of AP was added, incubated again for 30min at 37 ° C and then the AP was inactivated at 65° C for 30min. The cosmid was extracted, precipitated, washed and dissolved in 180 μ I ddH2O as indicated above. To the pM1423 [Xbal, CIAP] DNA, 20 μ I 10x BamHI restriction buffer and 4OU BamHI were added, incubated over night at 37 ° C. The BamHI treated DNA was extracted precipitated, washed and the DNA pellet was dissolved in 15 μ I ddH2O. The Xbal and BamHI digested cosmid was ana-
lyzed by 1% agarose gel electrophoresis. The ligation reaction was performed as indicated in the SuperCosi cosmid vector kit protocol (Stratagene). The amount of digested chromosomal #8178 and SuperCos 1 DNA was measured; SuperCos 1 : 127ng/ u l and #8178 chromosomal DNA: 746ng/ μ l. The ligation was done using the following components: 2.5 μ g partially digested #8178 genomic DNA [CIAP], 1.0 μ g SuperCos i DNA [Xbal, CIAP, BamHI], 2.0 μ I of 10x ligase buffer, 2.0 μ I 1OmM rATP,1.0 μ I T4 DNA ligase and water was added to a final volume of 20 μ I. Afterwards the ligation reactions were incubated over night at 16°C. The ligation was then packaged in lambda phage using the Stra- tagene Gigapack® III XL Packaging Extract according to the manufacturer's instructions.
Cosmids were transferred from the host strain E. coli XLIblue MR to E. coli Nis- sle 1917 by conjugation.
By way of infection experiments it was screened for cosmids that contain genes conferring competitive properties to E. coli Nissle 1917 against S. typhimurium in the gut. Streptomycin-treated mice were co-infected with a 1 :1 mixture of S. typhimurium SL1344 and E. coli Nissle 1917 (+cosmid-library) (in total 10_7 cfu).
4 days post infection cosmid-bearing E. coli Nissle 1917 clones were isolated from intestinal content. When analyzing the cosmids by restriction enzyme analysis it was found that in 2/3 of the mice one cosmid clone was enriched.
This clone was termed pB944-4. pB944-4 was re-transformed into E. coli Nissle 1917 and it was verified that it confers competitive properties against S. typhimurium in a co-infection experiment (Figure 3).
The sequence of the insert of pB944-4 derived from 8178 was determined and found to be 35,657 kbp. To narrow further down the genes responsible for the
competitive property a subscreen of pB944-4 was performed. DNA of pB944-4 was partially digested with Bsp143l and fragments between 1 and 3 kbp were ligated into BamH\ digested pBluescript (Stratagene). The resulting plasmid library was transformed into E. coli Nissle 1917. Streptomycin-treated mice with a 1 :1 mixture of S. typhimurium SL1344 and E. coli Nissle 1917 (+plasmid library) (in total 10_7 cfu) were co-infected. 4 days post infection plasmid-bearing E. coli Nissle 1917 clones were isolated from intestinal content and the cosmids were analyzed by restriction enzyme analysis and it was found that in 3 mice one plasmid clone was enriched.
The enriched clone was termed pC831-2. It contains a 1 ,177 kbp long insert. The sequence is homologous to the gene for colicin IB immunity protein (Ko- nisky and Richards, 1970; Varley and Boulnois, 1984). In Figure 4 the Plasmid map of pC831-2 is shown. pC831-2 has pSK Bluescript (Stratagene) as backbone and contains a 1 ,177 kbp long insert (arrow between MCS). The se- quence is homologous to the gene for promoter and coding sequence of colicin Ib immunity protein (cii) and the c-terminal part of colicin Ib (marked as Colicin IB in Figure 4), which is non-functional.
Colicins are proteinous toxins produced by and toxic for bacteria of the Entero- bacteriaceae family (Kerr et al., 2002). They can be encoded on colicinogenic plasmids that bear the genetic determinants for colicin synthesis, immunity and sometimes also release. The gene for colicin Ib production and the respective immunity protein are also present in S. typhimurium strain SL1344. The colicin Ib immunity protein inserts into the bacterial membrane and protects the producer against being killed by its own colicin.
Experimental results
It was shown that colicin Ib production by S. typhimurium SL1344 inhibits E. coli Nissle 1917 in co-infection experiments in the gut. However, E. coli Nissle 1917 competed better against S. typhimurium SL1344 deficient for colicin production (ΔcollB IR).
It is shown in Figure 3 that E. coli Nissle pB944-4 out-competes S. typhimurium wild-type. Ampicillin-treated mice (n=5; 25mg i.g.) were co-infected with S. typhimurium wild type (S. typhimurium pWKS30) and E. coli Nissle 1917 (ECN pM1423 or pB944-4 (total of 5x10:7; 1:1). E. coli (triangles) and Salmonella (dots) colonization density in cecal content at day 4 pi. was determined (Log10 cfu/gram). Complementation of ECN with cosmid pB944-4, containing a 35kbp fragment of 8178 DNA confers out-competing phenotype. The dotted line indicates the detection limit.
Furthermore, it was shown that pC831-2 improves the fitness of E. coli Nissle 1917 as it renders it resistant against colicin Ib. In Figure 5 it is shown that Colicin Ib plays a major role in competition between S. typhimurium SL1344 and E. coli Nissle 1917. In the experiments according to Figure 5A Ampicillin-treated mice (n=5; 25mg i.g.) were co-infected with S. typhimurium wild type (S. typhimurium pWKS30) and E. coli Nissle 1917 ECN pSK or pC831-2 (total of 5x10:7; 1 :1). E. coli (blue) and Salmonella (red) colonization density in cecal content at day 4 pi. was determined (Log10 cfu/gram). Complementation of ECN with plasmid pC831-2, encoding the colicin Ib (collB) immunity protein improves the fitness of E. coli Nissle 1917 in competition against S. typhimurium. In the experiments shown in Figure 5B Streptomycin-treated mice (n=5; 25mg i.g.) were
co-infected with S. typhimurium wild type or colicin Ib (collB) deficient mutant M990 and E. coli Nissle 1917 ECN (total of 5x10:7; 1 :1). E. coli (blue) and Salmonella (red) colonization density in cecal content at day 4 pi. was determined (Log10 cfu/gram). E. coli Nissle 1917 ECN competes significantly better against the colicin-deficient S. typhimurium mutant. The dotted line indicates again the detection limit.
III. Improvement of probiotic E. coli Nissle by natural in vivo selection against S. typhimurium SL1344
The genes for colicin Ib production and immunity are encoded on a conjugative 86kb plasmid in S. typhimurium SL1344 ('plasmid M'). Plasmid Il was tagged in S. typhimurium SL1344 with an antibiotic resistance marker (S. typhimurium M992; plasmid M::aphT) and streptomycin-treated mice were co-infected with E. coli Nissle 1917 and M992 (1 :1 by gavage). After 4 days post infection E. coli Nissle 1917 harboring plasmid Il that was in vivo transferred by conjugation from S. typhimurium M992 was detected. The resulting E. coli Nissle 1917 strain (plasmid Wv.aphJ) was now resistant to colicin IB as it contained now the genes for colicin Ib synthesis and immunity and showed improved competitiveness against S. typhimurium SL1344.
This in vivo selection can be done analogically with any other colicin-producing Salmonella enterica serovars to improve the fitness of a probiotic E. coli strain. With this strategy, E. coli Nissle 1917 with higher efficacy against predominant epidemic Salmonella enterica strains can be produced 'naturally' without in vitro genetic manipulation.
IV. Improvement of probiotic E.coli Nissle by rational design
Colicin production by Salmonella enterica strains or serovars is an important factor for competition against commensal E. coli strains. It has been shown above, that the efficacy of E. coli Nissle 1917 against S. typhimurium SL1344 can be significantly improved by the introduction of a plasmid expressing the gene for colicin Ib immunity protein by enhancing colonization resistance properties in said E. coli strain.
Based on the disclosure above, plasmids can be designed that express immunity proteins for other colicins. Such colicins are for example: colicin A, colicin B, colicin D, colicin Ia, colicin Ib, colicin K, colicin M, colicin N, colicin E1 , colicin E2, colicin E4, colicin E5, colicin E6, colicin E7, colicin E8, colicin E9 and colicin S4. Immunity proteins for colicin Ia, colicin E1 , colicin E2, colicin B, colicin M, colicin K and colicin S4 are encoded by the enclosed Sequences Sequ ID Nos. 1 to 4.
Said sequences were cloned into pSK Bluescript and afterwards introduced into E. coli, preferably into E. coli Nissle.
Experimental data shows that the immunity proteins for said colicins can lead to improved efficacy of such enhanced strain against infections with Salmonella strains or serovars that produce the respective type of colicin.
References
Kerr, B., Riley, M.A., Feldman, M.W., and Bohannan, B.J. (2002). Local dispersal promotes biodiversity in a real-life game of rock-paper-scissors. Nature 418, 171-174.
Konisky, J., and Richards, F. M. (1970). Characterization of colicin Ia and colicin Ib. Purification and some physical properties. J Biol Chem 245, 2972-2978.
Varley, J. M., and Boulnois, G.J. (1984). Analysis of a cloned colicin Ib gene: complete nucleotide sequence and implications for regulation of expression. Nucleic acids research 12, 6727-6739.
BUDAPEST TREATY ON THE INTERNATIONAL
RECOGNITION OF THE DEPOSIT OF MICROORGANISMS
INTERNATIONAL FORM
ETH Zurich
Institute of Microbiology
Wolfgang-Pauli-Str. 10 RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7 1 by the 8093 Zurich INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page SWITZERLAND
I IDENTIFICATION OF THE MICROORGANISM
Identification reference given by the DEPOSITOR Accession number given by the INTERNATIONAL DEPOSITARY AUTHORITY
Isolate 8178
DSM 21844
π SCIENTIFIC DESCRIPTION AND/OR PROPOSED TAXONOMIC DESIGNAΉON
The microorganism identified under T above was accompanied by
( ) a scientific descπption
( x ) a proposed taxonomic designation
(Mark witfi a cross where applicable)
in RECEiPT AND ACCEPTANCE
This International Depositary Authority accepts the microorganism identified under I above, which was received by it on 2008-09- 17 (Date of the original deposit)'
TV RECEIPT OF REQUEST FOR CONVERSION
The microorganism identified under I above was received by this International Depositary Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion) v INTERNATIONAL DEPOSITARY AUTHORΠΎ
Name DSMZ-DEUTSCHE SAMMLUNG VON Signature(s) of person(s) having the power to represent the
MKROORGANISMEN UND ZELLKULTUREN GmbH International Depositary Authority or of authorized official(s)
Address Inhoffenstr 7 B
D-38124 Braunschweig
(/> US C 6»
Date 2008-09-19
1 Where Rule 6 4 (d) applies, such date is the date on which the status of international depositary authority was acquired Form DSMZ-BP/4 (sole page) 08/2006
BUDAPEST TREATY ON THE INTERNATIONAL
FOR THE PURPOSES OF PATENT PROCEDURE
INTERNATIONAL FORM
ETH Zurich
Institute of Microbiology
Wolfgang-Pauli-Str. 10
VIABHJTY STATEMENT 8093 Zurich issued pursuant to Rule 102 by the INTERNATIONAL DEPOSITARY AUTHORITY SWITZERLAND identified at the bottom of this page
I DEPOSITOR π IDENTIFICATION OF THE MICROORGANISM
Name ETH Zurich Accession number given by the
Institute of Microbiology INTERNATIONAL DEPOSITARY AUTHORITY Address Wolfgang-Pauh-Str 10
DSM 21844 8093 Zurich SWITZERLAND Date of the deposit or the transfer'
2008-09-17 m VIABILITY STATEMENT
The viability of the microorganism identified under Ef above was tested on 2008-09- 17 On that date, the said microorganism was
( jς)3 viable
( )3 no longer viable rv CONDITIONS UNDER WHICH THE VIABILITY TEST HAS BEEN PERFORMED4
V INTERNATIONAL DEPOSITARY AUTHORITY
Name DSMZ-DEUTSCHE SAMMLUNG VON Signature(s) of person(s) having the power to represent the
MKROORGANISMEN UND ZELLKULTUREN GmbH International Depositary Authority or of authorized official(s)
Address Inhoffenstr 7 B
D-38124 Braunschweig I/. CJcώ>
Date 2008-09-19
1 Indicate the date of oπginal deposit or, where a new deposit or a transfer has been made, the most recent relevant date (date of the new deposit or date of the transfer) 1 In the cases referred to in Rule 10 2(a) (n) and (in), refer to the most recent viability test
3 Mark with a cross the applicable box
4 Fill in if the information has been requested and if the results of the test were negative
Form DSMZ-BP/9 (sole page) 08/2006
Claims
1. Genetically modified probiotic E. coli cells comprising at least one first genetic modification introducing an exogenous protein and/or enhancing en- zymatic activity of an endogenous protein, the first genetic modification resulting in an enhanced level of biosynthesis of at least one colicin immunity protein compared to the respective wild type cell.
2. Genetically modified probiotic E. coli cells according to claim 1 , wherein the colicin immunity protein is selected from a group comprising: colicin A, colicin B1 colicin D, colicin Ia, colicin Ib, colicin K, colicin M, colicin N, colicin E1 , colicin E2, colicin E4, colicin E5, colicin E6, colicin E7, colicin E8, colicin E9 and colicin S4 immunity protein preferably from a group consisting of: colicin Ia, colicin E1 , colicin E2, colicin B, colicin M1 colicin K and colicin S4 immunity protein.
3. Genetically modified probiotic E. coli cells according to claim 1 or 2, wherein the cells express a genomically encoded transgene encoding said colicin immunity protein or comprise plasmids configured to express a gene encoding said colicin immunity protein.
4. Genetically modified probiotic E. coli cells according to claim 3, wherein the plasmid is configured to express a gene encoding said colicin immunity protein and the corresponding colicin protein.
5. A strain of bacteria having all the identifying characteristics of E. coli strain 8178 (International Deposition No: DSM21844).
6. A composition comprising an effective amount of probiotic E. coli according to one of claims 1 to 5.
7. A composition according to claim 6, the composition being a food product, a food additive or supplement, an animal feed additive or supplement, a pharmaceutical preparation or a biotherapeutic composition.
8. A composition according to claim 6 or 7 for treating or preventing a gastrointestinal disorder in vertebrates, particularly mammals.
9. The composition according to claim 8, wherein the gastrointestinal disorder is selected from the group consisting of Salmonella enterica induced acute diarrhea, chronic enteric Salmonellosis, and Typhoid fever (chronic carrier state).
10. A use of a composition according to any of claims 6 to 9 for the manufacture of a medicament for treating or preventing a gastrointestinal disorder in vertebrates, particularly mammals.
11. The use according to claim 10, wherein the gastrointestinal disorder is selected from the group consisting of Salmonella enterica induced acute diarrhea, chronic enteric Salmonellosis, and Typhoid fever (chronic carrier state).
12. A method of treating or preventing a gastrointestinal disorder in verte- brates, particularly mammals, the method comprising the administration to a subject in need thereof an therapeutically effective amount of bacteria according to any of claims 1 to 5 or a composition according to any of claims 6 to 9.
13. The method according to claim 12, wherein said administration is effected at a concentration of said bacterial strain between 105 and 108 viable cells viable cells in one dose.
14. A method for enhancing colonization resistance properties in E. coli strains comprising the steps of: i) selection of a colicin-producing Salmonella strain or serovar, preferably Salmonella typhimurium or Salmonella enteri- tidis strains, ii) co-infection of said colicin-producing Salmonella with at least one E. coli strain, preferably a E. coli strain Nissle 1917, iii) in vivo transfer of a plasmid encoding for at least a colicin immunity protein from the Salmonella strain or serovar to the E. coli strain, iv) isolation of co- infected E. coli strains carrying the plasmid encoding for at least a colicin immunity protein.
15. A method for enhancing colonization resistance properties in E. coli strains comprising the steps of: i) producing a plasmid configured to express a gene encoding at least one colicin immunity protein, preferably selected from: colicin A, colicin B, colicin D, colicin Ia, colicin Ib, colicin K, colicin M, colicin N, colicin E1 , colicin E2, colicin E4, colicin E5, colicin E6, colicin E7, colicin E8, colicin E9 and colicin S4 ii) in vivo or in vitro transfer of said plasmid into an E. coli strain.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP08016660 | 2008-09-23 | ||
| EP08016660.6 | 2008-09-23 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2010034479A1 true WO2010034479A1 (en) | 2010-04-01 |
Family
ID=41566052
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2009/006871 Ceased WO2010034479A1 (en) | 2008-09-23 | 2009-09-23 | Protective e. coli strains for reducing the salmonella typhimurium pathogen load in the intestines |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2010034479A1 (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012122472A1 (en) * | 2011-03-09 | 2012-09-13 | Northwestern University | Compositions and methods for treatment of pain |
| WO2013023982A1 (en) | 2011-08-12 | 2013-02-21 | Westfaelische Wilhelms-Universitaet Muenster | Novel compounds for the treatment of inflammatory bowel disease |
| WO2013035906A1 (en) * | 2011-09-09 | 2013-03-14 | 주식회사 인트론바이오테크놀로지 | Method for preventing and treating salmonella typhimurium infection |
| WO2016008971A1 (en) | 2014-07-16 | 2016-01-21 | Westfälische Wilhelms-Universität Münster | miRNA 320a AS BIOMARKER FOR INFLAMMATORY BOWEL DISEASE |
| CN107751545A (en) * | 2016-08-15 | 2018-03-06 | 薛富盛 | Use of colicin or microorganism capable of expressing colicin for preparing meat enhancing agent |
| WO2019006246A1 (en) * | 2017-06-30 | 2019-01-03 | The Rockefeller University | Human microbiota derived n-acyl amides for the treatment of human disease |
| WO2019209640A1 (en) * | 2018-04-25 | 2019-10-31 | Icahn School Of Medicine At Mount Sinai | Isolated bacterial strain for inducing proliferation or accumulation of regulatory t-cells |
| CN110527655A (en) * | 2019-07-15 | 2019-12-03 | 江苏省家禽科学研究所 | A kind of duck source Escherichia coli probiotics strain and its screening preparation method and purposes |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007124588A2 (en) * | 2006-05-01 | 2007-11-08 | University Of Manitoba | Colicinogenic strains of e. coli and use thereof for treatment of k88+-associated diarrhea |
-
2009
- 2009-09-23 WO PCT/EP2009/006871 patent/WO2010034479A1/en not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007124588A2 (en) * | 2006-05-01 | 2007-11-08 | University Of Manitoba | Colicinogenic strains of e. coli and use thereof for treatment of k88+-associated diarrhea |
Non-Patent Citations (5)
| Title |
|---|
| BRICKMAN T J ET AL: "Colicins B and Ia as novel counterselective agents in interspecies conjugal DNA transfers from colicin-sensitive Escherichia coli donors to other Gram-negative recipient species", GENE, ELSEVIER, AMSTERDAM, NL, vol. 178, no. 1, 31 October 1996 (1996-10-31), pages 39 - 42, XP004043336, ISSN: 0378-1119 * |
| O'BRIEN G J ET AL: "Colicin 24, a New Plasmid-Borne Colicin from a Uropathogenic Strain of Escherichia coli", PLASMID, NEW YORK,NY, US, vol. 31, no. 3, 1 May 1994 (1994-05-01), pages 288 - 296, XP024799067, ISSN: 0147-619X, [retrieved on 19940501] * |
| SHANAFELT A B ET AL: "Cloning and overexpression of the colicin E1 immunity gene", PLASMID, NEW YORK,NY, US, vol. 17, no. 3, 1 May 1987 (1987-05-01), pages 261 - 264, XP024799717, ISSN: 0147-619X, [retrieved on 19870501] * |
| STECHER BAERBEL ET AL: "Salmonella enterica serovar typhimurium exploits inflammation to compete with the intestinal microbiota", PLOS BIOLOGY, vol. 5, no. 10, October 2007 (2007-10-01), pages 2177 - 2189, XP009128684, ISSN: 1544-9173(print) 1545-7885(ele * |
| STECHER ET AL: "The role of microbiota in infectious disease", TRENDS IN MICROBIOLOGY, ELSEVIER SCIENCE LTD., KIDLINGTON, GB, vol. 16, no. 3, 14 February 2008 (2008-02-14), pages 107 - 114, XP022509717, ISSN: 0966-842X * |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012122472A1 (en) * | 2011-03-09 | 2012-09-13 | Northwestern University | Compositions and methods for treatment of pain |
| US9968642B2 (en) | 2011-03-09 | 2018-05-15 | Northwestern University | Compositions and methods for treatment of pain |
| WO2013023982A1 (en) | 2011-08-12 | 2013-02-21 | Westfaelische Wilhelms-Universitaet Muenster | Novel compounds for the treatment of inflammatory bowel disease |
| JP2014525749A (en) * | 2011-08-12 | 2014-10-02 | ヴェストファーレン ヴィルヘルム−ウニヴェルジテート ミュンスター | Novel compounds for the treatment of inflammatory bowel disease |
| WO2013035906A1 (en) * | 2011-09-09 | 2013-03-14 | 주식회사 인트론바이오테크놀로지 | Method for preventing and treating salmonella typhimurium infection |
| US9402873B2 (en) | 2011-09-09 | 2016-08-02 | Intron Biotechnology, Inc. | Method for preventing and treating Salmonella Typhimurium infection |
| US10240203B2 (en) | 2014-07-16 | 2019-03-26 | Westfaelische Wilhelms-Universitaet Muenster | miRNA 320a as biomarker for inflammatory bowel disease |
| WO2016008971A1 (en) | 2014-07-16 | 2016-01-21 | Westfälische Wilhelms-Universität Münster | miRNA 320a AS BIOMARKER FOR INFLAMMATORY BOWEL DISEASE |
| CN107751545A (en) * | 2016-08-15 | 2018-03-06 | 薛富盛 | Use of colicin or microorganism capable of expressing colicin for preparing meat enhancing agent |
| PH12017000228A1 (en) * | 2016-08-15 | 2019-03-04 | Univ Nat Chung Hsing | Use of colicin ib and microorganism expressing colicin ib for preparation of meat-growth agent |
| WO2019006246A1 (en) * | 2017-06-30 | 2019-01-03 | The Rockefeller University | Human microbiota derived n-acyl amides for the treatment of human disease |
| WO2019209640A1 (en) * | 2018-04-25 | 2019-10-31 | Icahn School Of Medicine At Mount Sinai | Isolated bacterial strain for inducing proliferation or accumulation of regulatory t-cells |
| CN110527655A (en) * | 2019-07-15 | 2019-12-03 | 江苏省家禽科学研究所 | A kind of duck source Escherichia coli probiotics strain and its screening preparation method and purposes |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2010034479A1 (en) | Protective e. coli strains for reducing the salmonella typhimurium pathogen load in the intestines | |
| SG176308A1 (en) | Novel strains of helicobacter pylori and uses thereof | |
| CN110621776A (en) | Novel enterococcus faecium phage end-FAP-4 and application thereof in inhibiting proliferation of enterococcus faecium | |
| US12011466B2 (en) | Modified Escherichia coli strain Nissle and treatment of gastrointestinal disorder | |
| KR100988771B1 (en) | Novel Lysine Proteins with Enterococcus and Streptococcus Specific Killing Capacity | |
| EP2424974B1 (en) | Mutants of francisella tularensis and uses thereof | |
| Amund et al. | Assessing the effects of exposure to environmental stress on some functional properties of Bifidobacterium animalis ssp. lactis | |
| IE913912A1 (en) | Avirulent microbes and uses therefor: salmonella typhi | |
| CN102304484A (en) | New strain of pseudoalteromonas flavipulchra and use thereof | |
| WO2007148363A1 (en) | Salmonella enterica strains of reduced pathogenicity, method for their preparation and uses thereof | |
| KR102683896B1 (en) | Expression Vector for Secreting GM-CSF and Anticancer Recombinant Microbials Transformed thereby | |
| CA2567106A1 (en) | Self-containing lactobacillus strain | |
| Lu et al. | The role of aroA and ppk1 in Aeromonas veronii pathogenicity and the efficacy evaluation of mutant strain AV-ΔaroA/ppk1 as a live attenuated vaccine | |
| JP7836794B2 (en) | Genetically modified living bacteria and methods for constructing them | |
| KR20230088715A (en) | Engineered probiotics for the expression of fiber synthase in the intestine | |
| Steidler et al. | In situ delivery of therapeutic proteins by recombinant Lactococcus lactis | |
| US20250236838A1 (en) | E. coli nissle strain with improved transformation efficiency | |
| WO2010062982A1 (en) | Tumor-targeting co2-resistant salmonella | |
| Zhou et al. | Listeria monocytogenes forms bacterial microcompartments to enhance its resistance of enterolysin a in Enterococcus faecium B1 under gastrointestinal conditions | |
| Xu et al. | The Mannose Phosphotransferase System in Enterococcus lactis Is Essential for Gastrointestinal Colonization | |
| KR101797276B1 (en) | Multiple mutated Salmonella Typhimurium and vaccine composition for prevention of food poisoning | |
| Goh | Genetic characterization of fructooligosaccharides metabolism by Lactobacillus paracasei 1195 | |
| Vezina | Development of Lactobacillus agilis La3 as a live vector for the delivery of vaccine antigens to the gastrointestinal tract of chickens | |
| Gobert et al. | H. pylori arginase reguiates NO production by macrophages | |
| Kwon et al. | Emergence of acquired-multidrug resistant Helicobacter pylori among clinical isolates |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09778672 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 09778672 Country of ref document: EP Kind code of ref document: A1 |

