WO2010029527A1 - A method for predicting athletic performance potential - Google Patents

A method for predicting athletic performance potential Download PDF

Info

Publication number
WO2010029527A1
WO2010029527A1 PCT/IE2009/000062 IE2009000062W WO2010029527A1 WO 2010029527 A1 WO2010029527 A1 WO 2010029527A1 IE 2009000062 W IE2009000062 W IE 2009000062W WO 2010029527 A1 WO2010029527 A1 WO 2010029527A1
Authority
WO
WIPO (PCT)
Prior art keywords
elite
athletic performance
snp
assay
indicative
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IE2009/000062
Other languages
French (fr)
Inventor
Emmeline Hill
David Mchugh
Nick Orr
Jingjing Gu
Lisa Katz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University College Dublin
Original Assignee
University College Dublin
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to JP2011526627A priority Critical patent/JP5667057B2/en
Priority to AU2009290452A priority patent/AU2009290452B2/en
Priority to US13/063,715 priority patent/US8771943B2/en
Priority to NZ591711A priority patent/NZ591711A/en
Priority to EP09787418.4A priority patent/EP2352850B1/en
Application filed by University College Dublin filed Critical University College Dublin
Publication of WO2010029527A1 publication Critical patent/WO2010029527A1/en
Priority to US13/046,432 priority patent/US20110262915A1/en
Anticipated expiration legal-status Critical
Priority to US14/175,696 priority patent/US9249470B2/en
Priority to US14/951,183 priority patent/US20160215335A1/en
Priority to US16/552,545 priority patent/US20200115751A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/124Animal traits, i.e. production traits, including athletic performance or the like
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • the Thoroughbred horse industry is a multi-billion euro international industry involved in the breeding, training and racing of Thoroughbred horses. Often multi-million euro decisions are made on the purchase of individual animals with perceived racing potential.
  • the integration of genomics information into the Thoroughbred racing and breeding industries has huge potential for early 'talent identification'. Thoroughbreds are traditionally selected for racing and breeding based on pedigree information as well as numerous phenotypic characteristics. Early identification of genetic potential, by traditional or new means, is paramount to success. Within the industry the quest to find an 'edge' pushes those involved to constantly consider new methods and techniques. Therefore, genomics information has the potential to directly assist breeders and trainers to fine-tune often multi-million dollar decisions by providing previously inaccessible information.
  • Oxygen is an essential regulator of muscle function, influencing energy production, muscle contraction and removal of by-products. During exercise the requirement for energy is greatly limited by the availability of oxygen. Mammalian cells have evolved elaborate adaptive mechanisms to respond to low cellular oxygen environments (Taylor & Colgan 1999). In studies of human exercise, adaptation to such a hypoxic environment in trained skeletal muscle causes a shift in substrate selection to increased oxidation of carbohydrates and stimulates cells to improve conditions for oxygen transport and utilisation (Hoppeler & Vogt 2001).
  • “Athletic performance” as used herein includes racing such as competitive racing and equestrian sports such as racing, showjumping, eventing, dressage, endurance events, riding, hunting and the like.
  • the equestrian sports may be competitive sports.
  • the invention provides single nucleotide polymorphisms (SNPs) that are associated with elite athletic performance.
  • the invention provides a method of predicting the athletic performance of a subject comprising the step of assaying a biological sample from the subject for the presence of a single nucleotide polymorphism (SNP) in one or more of the genes listed in the appendices wherein the SNP has a significant association with athletic performance.
  • SNP single nucleotide polymorphism
  • the biological sample of the subject may be selected from the group comprising: blood, saliva, skeletal muscle, skin, semen, biopsy, bone marrow, soft tissue, internal organs and hair.
  • the SNP may be CKM l 5884567 (G/A).
  • the presence of an A allele may be indicative of elite athletic performance.
  • the presence of a homozygous AA genotype may be indicative of elite athletic performance.
  • the DNA may be genomic DNA.
  • an assay for use in determining athletic performance of a subject comprising means for detecting the presence or absence of a single nucleotide polymorphism (SNP) in the COX4I2 gene.
  • SNP single nucleotide polymorphism
  • the SNP may be EquCab 2.0 COX4I2-22676361 - C/T.
  • the presence of a homozygous TT genotype may be indicative of elite athletic performance.
  • the biological sample of the subject may be selected from the group comprising: blood, saliva, skeletal muscle, semen, biopsy, internal organ, skin, bone marrow (or any other biological tissue) and hair.
  • the subject may be from a competitive racing species.
  • the subject may be an equine.
  • the subject may be a Thoroughbred race horse.
  • Fig 9 is a graph showing the genotype frequency for the MSTN 66493737 (T/C) SNP for stallions with a Stamina Index 6 - 8f, 8- 10 f, 10- 12f; and
  • the COX4I2 gene contains a glucocorticoid receptor element (TGTT) which may be targeted to increase COX4-2 expression and therefore increase mitochondrial volume. Also, the COX4I2 gene contains a p53 tumor suppressor binding site (CATG). Recent studies have suggested that p53 may play a role in regulation of mitochondrial biogenesis and aerobic metabolism via COX (Matoba et al. 2006; Saleem et al. 2009).
  • the PDK4 gene promoter contains a binding site for the FOXOlA transcription factor, a key regulator of insulin signalling in liver and adipose tissue.
  • FOXOlA Single nucleotide polymorphisms in FOXOlA have been found to have a protective effect on T2DM development and related phenotypes in humans.
  • FOXOlA has also been found among positively selected genomic regions in Thoroughbred and its PDK4 promoter binding site sequence is conserved in horse.
  • the transcription factors FOXOl and SMAD have also been shown to be responsible for myostatin (MSTN) gene regulation and therefore play key roles in the regulation of muscle growth.
  • HIF- l ⁇ activates the transcription of genes encoding PDKl, LDHA, COX4-2 and LON and controls the switch from COX4-1 to COX4-2.
  • Thoroughbred muscle that is deprived of oxygen during intense exercise an enhanced response to reduced oxygen and the ability to generate ATP in the most efficient manner will provide a significant advantage to that individual.
  • Glucorticoid receptor elements (Glucocorticoid responsive and related elements) contain the recognition sequence (TGTT).
  • the COX4I2 gene contains one of these elements in Intron 2. Therefore glucocorticoid binding may stimulate increased gene expression leading to increased mitochondrial volume and therefore aerobic energy capacity.
  • the horse genome EquCab2 assembly is a Whole Genome Shotgun (WGS) assembly at 6.79x and was released in September 2007.
  • WGS Whole Genome Shotgun
  • a female Thoroughbred named "Twilight” was selected as the representative horse for genome sequencing.
  • the project coordination and genome sequencing and assembly is provided by the Broad Institute.
  • the N50 size is the length such that
  • KASPar competitive allele specific PCR
  • Taqman Applied Biosystems
  • the present invention identifies significant associations between SNPs and athletic performance phenotypes in a set of these genes including ACN9, ACSSl, ACTN2, ADHFEl, CKM, COX4I2, GSN, MSTN, PONl, PTGSl and PTPNl (see the appendices).
  • ACN9 ACN9, ACSSl, ACTN2, ADHFEl, CKM, COX4I2, GSN, MSTN, PONl, PTGSl and PTPNl
  • CKM, COX4I2, PDK4 and MSTN were investigated in detail.
  • SNPs in three of those genes are associated with elite (Group race winning) performance and a SNP in the MSTN gene is associated with elite sprint race performance.
  • the genotypic and dominant/recessive tests will only be conducted if there is a minimum number of observations per cell in the 2-by-3 table: by default, if at least one of the cells has a frequency less than 5, then the alternate tests are skipped (NA is written in the results file).
  • the Cochran-Armitage and allelic tests are performed in all cases. This threshold can be altered with the —cell option: plink —file mydata —model —cell 20
  • Table 7 Genotype frequencies in elite and non-elite Thoroughbred sub-populations for SNPs: PDK4 (PDK4 38973231); COX4I2 (COX4I2_22684390); CKM (CKM_15884567) and in elite sprinters and elite endurance Thoroughbreds for SNP: MSTN (MSTN_66493737).
  • the horse genome EquCab2 assembly is a Whole Genome Shotgun (WGS) assembly at 6.79x and was released in September 2007.
  • WGS Whole Genome Shotgun
  • a female Thoroughbred named "Twilight” was selected as the representative horse for genome sequencing.
  • the project coordination and genome sequencing and assembly is provided by the Broad Institute.
  • the N50 size is the length such that 50% of the assembled genome lies in blocks of the N50 size or longer.
  • the N50 size of the contigs is 112.38 kb, and the total length of all contigs is 2.43 Gb. When the gaps between contigs in scaffolds are included, the total span of the assembly is 2.68 Gb.
  • the horse EquCab2 was annotated using a standard Ensembl mammalian pipeline.
  • the invention provides a simple DNA based method (genotype test) for predicting the elite sprint race performance of a thoroughbred race horse based on the presence or absence of a SNP in one or more exercise response gene.
  • the exercise response gene may be one or more of the genes listed in the appendices.
  • the genotype test may be based on a SNP in one or more of the MSTN, ACN9, PTPNl, PONl, ADHFEl, or GSN genes. Details of some of the SNPs that may be used to predict the elite sprint race performance of a thoroughbred race horse are given in the appendices. It will be appreciated that the genotypic test may be based on a combination of any one or more of these SNPs.
  • Genomic DNA was extracted from either fresh whole blood or hair samples using a modified version of a standard phenol/chloroform method (Sambrook & Russell 2001). Thirteen pairs of overlapping PCR primers were designed to cover the entire MSTN genomic sequence using the PCR Suite extension to the Primer3 web-based primer design tool (Rozen & Skaletsky 2000; van Baren & Heutink 2004) (Table 13). Twenty-four unrelated Thoroughbred DNA samples were included in a re-sequencing panel to identify Thoroughbred-specific sequence variants. As such this study was powered to detect 95% of SNPs with MAF > 0.05 in the Thoroughbred population (Kruglyak & Nickerson 2001).
  • Quality control analyses included computation of sample allele frequency, percent missing genotypes and deviation from Hardy- Weinberg equilibrium.
  • the series of case- control association tests were performed for two loci (g.66493737C>T and g.66494218A>C).
  • Statistical significance was assessed using the Cochran-Armitage test for trend and an unconditioned genotypic model. Odds ratios and 95% CIs were calculated for the two most significant associations.
  • the linear regression model was used to evaluate quantitative trait association at locus g.66493737C>T using the phenotypes: best race distance and kg / cm ratio.
  • n 148 Thoroughbred horses.
  • MSTN sequence variants 148 Thoroughbred horses.
  • MSTN sequence polymorphisms displayed MAF ⁇ 0.05 in Thoroughbreds (Table 15) and were excluded from the association analyses.
  • Genotype trend effects were modeled by estimating the risk associated with a linear trend in magnitude of effect relative to the common homozygote, heterozygote, and rare homozygote genotype using the Cochran-Armitage test for the trend model.
  • Table 13 PCR primer details for SNP discovery in the equine myostatin (MSTN) gene
  • Table 16 Population summary including details of retrospective racecourse success for each cohort.
  • Table 17 a. Case-control association test results for a series of cohort comparisons for g.66493737C>T.
  • TBE elite Group race winning Thoroughbreds
  • TBO other non-winning Thoroughbreds
  • TBE > 8 f, TBE ⁇ 8 f and TBE ⁇ 7 f elite Group race winning Thoroughbreds that won their best (most valuable or highest grade) races over distances > 8 f, ⁇ 8 f and ⁇ 7 f.
  • Odds ratios were calculated for the two most significant results
  • b Best-fit model results for g.66493737C>T association with elite Group race winning performance over distances ⁇ 7 f .
  • MSTNSNP MSTN 66493737 O 1 ZC
  • the horse genome EquCab2 assembly is a Whole Genome Shotgun (WGS) assembly at 6.79x and was released in September 2007.
  • WGS Whole Genome Shotgun
  • a female Thoroughbred named "Twilight” was selected as 0 the representative horse for genome sequencing.
  • the project coordination and genome sequencing and assembly is provided by the Broad Institute.
  • the N50 size is the length such that 50% of the assembled genome lies in blocks of the N50 size or longer.
  • the N50 size of the contigs is 112.38 kb, and the total length of all contigs is 2.43 Gb. When the gaps between contigs in scaffolds are included, the total span of the assembly is 2.68 Gb.
  • the horse EquCab2 was annotated using a standard Ensembl mammalian pipeline.
  • P 0.0043
  • Table 25 below shows the mean best race distance for each genotype for four of the SNPs from Table 24 above.
  • the TT genotype has a mean best race distance of 10.54 furlongs (f)
  • the TC genotype has a mean best race distance of 9.087 f
  • the CC genotype has a mean best race distance of 6.167 f.
  • Overall the mean best race distance was 8.55 f.
  • a stallions potential can be promoted by:
  • the iPLEX® Gold assay based on multiplex PCR followed by a single base primer extension reaction. After the PCR, remaining nucleotides are deactivated by SAP treatment. The single base primer extension step is performed, and the primer extension products analyzed using MALDI TOF MS.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A method and assay for predicting athletic performance potential of a subject, such as a thoroughbred race horse, comprising the steps of assaying a biological sample from a subject for the presence of a single nucleotide polymorphism in one or more genes associated with athletic performance. The athletic performance genes may be selected from one or more of MSTN, COX4I2, PDK4, CKM and COX4I1.

Description

"A method for predicting athletic performance potential "
The invention relates to a method for predicting the athletic performance potential of a subject.
Introduction
The Thoroughbred horse industry is a multi-billion euro international industry involved in the breeding, training and racing of Thoroughbred horses. Often multi-million euro decisions are made on the purchase of individual animals with perceived racing potential. The integration of genomics information into the Thoroughbred racing and breeding industries has huge potential for early 'talent identification'. Thoroughbreds are traditionally selected for racing and breeding based on pedigree information as well as numerous phenotypic characteristics. Early identification of genetic potential, by traditional or new means, is paramount to success. Within the industry the quest to find an 'edge' pushes those involved to constantly consider new methods and techniques. Therefore, genomics information has the potential to directly assist breeders and trainers to fine-tune often multi-million dollar decisions by providing previously inaccessible information.
Oxygen is an essential regulator of muscle function, influencing energy production, muscle contraction and removal of by-products. During exercise the requirement for energy is greatly limited by the availability of oxygen. Mammalian cells have evolved elaborate adaptive mechanisms to respond to low cellular oxygen environments (Taylor & Colgan 1999). In studies of human exercise, adaptation to such a hypoxic environment in trained skeletal muscle causes a shift in substrate selection to increased oxidation of carbohydrates and stimulates cells to improve conditions for oxygen transport and utilisation (Hoppeler & Vogt 2001). In Thoroughbred horses, despite a number of structural and functional adaptations in the cardiovascular and respiratory systems that improve oxygen carrying capacity and delivery during high-intensity short-duration exercise, the oxygen transport system lags far behind peripheral demand reflected in the routine development of an exercise-induced arterial hypoxemia and hypercapnia (Dempsey & Wagner, 1999; Seaman, 1995). The Thoroughbred response is extreme in comparison to other animal species, including trained human athletes, reflecting the enormous requirement of the musculature for energy. Remarkably, even faced with a limited oxygen supply, Thoroughbreds remain elite athletes exquisitely adapted to extreme exercise. Thoroughbred horses excel in both sprint (<1 mile) and longer distance (>1 mile) races. The physiological requirements for these disciplines differ and are regulated by the partitioning of metabolic pathways. During the first 75 seconds of exercise at supramaximal intensities (105- 125% Vθ2max) horses experience an oxygen deficit because oxygen supply cannot meet the demand of exercising muscles (Dempsey & Wagner, 1999; Seaman, 1995). Despite this, it has been estimated that during sprint races (< 1000m) approximately 70% of the total energy will be supplied aerobically. Horses competing over longer distances and for longer duration (>75 seconds) reach steady-state VO2 and therefore are not oxygen deficient.
A range of approaches has been taken to investigate measurable associations with athletic performance phenotype in Thoroughbred racehorses including assessment of heart size (Young et al 2005), muscle fibre type (Rivero et al. 2007) musculoskeletal conformation (Love et al 2006), speed at maximum heart rate (Gramkow & Evans 2006), haematological (Revington 1983) and other physiological variables (Harkins et al 1993).
WO2006003436 describes the association between performance and gene variants encoded by the mitochondrial genome. However, mitochondrial DNA (mtDNA) haplotypes are inherited strictly from the maternal parent and therefore relate solely to female contributions to the phenotype. As there is a limited number of mtDNA haplotypes (n = 17) in the Thoroughbred population and just 10 females contribute to 74% of present maternal lineages (Cunningham et al 2002) it is unlikely that these haplotype variants have a significant effect as the favourable haplotypes would become 'fixed' quickly in a population where there is targeted selection for performance; in addition, the effective population size (of mtDNA variants) is one third of nuclear-encoded variants (Ballard and Dean 2001, Blier et al 2001, Das 2006, Meiklejohn et al 2007). Also, mtDNA haplotypes can be directly inferred from pedigree information.
It is an object of the invention to provide a method for predicting the athletic performance potential of a subject that overcomes some of these problems.
Statements of Invention
This invention provides DNA-based tests for detecting variation in nuclear-encoded genes. This approach is a superior to mitochondrial DNA (mtDNA) testing because variation in nuclear encoded genes reflects inheritance of favourable gene variants from all possible ancestors whereas mtDNA testing is restricted to female ancestry. The methods and assays described herein are performed ex vivo and can be considered to be ex vivo or in vitro methods and assays.
Any suitable biological sample which contains genetic material for example, blood, saliva, hair, skin, bone marrow, soft tissue, internal organs, biopsy sample, semen, skeletal muscle tissue and the like, may be used as a biological sample for the methods described herein. Blood and hair samples are particularly suitable as a biological sample.
"Athletic performance" as used herein includes racing such as competitive racing and equestrian sports such as racing, showjumping, eventing, dressage, endurance events, riding, hunting and the like. The equestrian sports may be competitive sports.
Competitive racing species include equines (horses), camels, dogs, elephants, hares, kangaroos, ostriches, pigeons, Homo sapiens and birds of prey such as hawks or falcons. The competitive racing species may be a Thoroughbred race horse or a showjumping horse.
By "primer" we mean a nucleic acid sequence containing between about 15 to about 40 for example between about 18 to about 25 contiguous nucleotides from a nucleic acid sequence of interest. The primer may be a forward (5' or 3') or reverse (3' to 5') primer or a primer designed on a complementary nucleic acid sequence to the sequence of interest. In the present invention, the sequence of interest is the genomic sequence of a gene associated with athletic performance, for example a gene listed in the appendices or one or more of the COX4I1, COX4I2, PDK4, CKM or MSTN genes. In one embodiment, the primer may comprise between about 15 to about 40 for example between about 18 to about 25 contiguous nucleotides from SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 31 or SEQ ID No. 32 or between about 15 to about 40 for example between about 18 to about 25 contiguous nucleotides from a complementary sequence to SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 31 or SEQ ID No. 32. By "complementary sequence" we mean a sequence that binds to the sequence of interest using conventional Watson-Crick base pairing i.e. adenine binds to thymine and cytosine binds to guanine.
The invention provides single nucleotide polymorphisms (SNPs) that are associated with elite athletic performance. The invention provides a method of predicting the athletic performance of a subject comprising the step of assaying a biological sample from the subject for the presence of a single nucleotide polymorphism (SNP) in one or more of the genes listed in the appendices wherein the SNP has a significant association with athletic performance.
According to the invention there is provided a method for predicting the athletic performance potential of a subject comprising the step of assaying a biological sample from a subject for the presence of a single nucleotide polymorphism (SNP) in one or more of the MSTN gene, COX4I2 gene, PDK4 gene, CKM gene or C0X4I1 gene.
The SNP may be MSTN_66493737 (T/C). The presence of a C allele is indicative of elite athletic performance. The presence of a homozygous CC genotype may indicative of elite athletic performance. The elite athletic performance may be elite sprinting performance
The SNP may be COX4I2_22684390 (C/T). The presence of a T allele may be indicative of elite athletic performance. The presence of a homozygous TT genotype may be indicative of elite athletic performance.
The SNP may be PDK4 38973231 (A/G). The presence of an A allele may be indicative of elite athletic performance. The presence of a homozygous AA genotype may be indicative of elite athletic performance.
The SNP may be CKM_15884567 (G/A). The presence of an A allele may be indicative of elite athletic performance. The presence of a homozygous AA genotype may be indicative of elite athletic performance.
The SNP may be COX4I1_32772871 (T/C). The presence of a T allele may be indicative of elite athletic performance. The presence of a homozygous TT genotype may be indicative of elite athletic performance.
The biological sample of the subject may be selected from the group comprising: blood, saliva, skeletal muscle, skin, semen, biopsy, bone marrow, soft tissue, internal organs and hair.
The subject may be from a competitive racing species. The subject may be an equine such as a Thoroughbred race horse. The invention further provides an assay for determining the athletic performance potential of a subject comprising the steps of:
- obtaining a sample;
- extracting or releasing DNA from the sample; and
- identifying a single nucleotide polymorphism (SNP) in a target sequence from a gene associated with athletic performance in the extracted or released DNA
wherein the athletic performance potential of a subject is associated with the SNP.
The gene associated with athletic performance may be selected from one or more of MSTN, COX4I2, PDK4, CKM or COX4I1.
The assay may comprise the step of:
- amplifying a target sequence from a gene associated with athletic performance in the extracted or released DNA
prior to the step of identifying a single nucleotide polymorphism.
The DNA may be genomic DNA
The invention further provides an assay for use in determining the athletic performance potential of a subject comprising means for detecting the presence of a single nucleotide polymorphism (SNP) in one or more of the MSTN gene, COX4I2 gene, PDK4 gene, CKM gene or COX4I1 gene.
The SNP may be MSTN 66493737 (T/C). The presence of a C allele is indicative of elite athletic performance. The presence of a homozygous CC genotype may indicative of elite athletic performance. The elite athletic performance may be elite sprinting performance. The SNP may be COX4I2_22684390 (C/T). The presence of a T allele may be indicative of elite athletic performance. The presence of a homozygous TT genotype may be indicative of elite athletic performance.
The SNP may be PDK4 38973231 (A/G). The presence of an A allele may be indicative of elite athletic performance. The presence of a homozygous AA genotype may be indicative of elite athletic performance.
The SNP may be CKM l 5884567 (G/A). The presence of an A allele may be indicative of elite athletic performance. The presence of a homozygous AA genotype may be indicative of elite athletic performance.
The SNP may be COX4I1 32772871 (T/C). The presence of a T allele may be indicative of elite athletic performance. The presence of a homozygous TT genotype may be indicative of elite athletic performance.
The invention also provides an assay for determining the athletic potential of a subject comprising the step of:
- obtaining a sample;
- extracting or releasing DNA from the sample;
- identifying the genotype of the MSTN_66493737 (T/C) SNP in the extracted or released DNA
wherein the presence of a C allele in the MSTN 66493737 (T/C) SNP is indicative of elite athletic performance.
The assay may comprise the step of:
- amplifying a target sequence encoding the MSTN 66493737 (T/C) SNP in the extracted or released DNA
prior to the step of identifying the genotype of the MSTN_66493737 (T/C) SNP. The presence of a homozygous CC genotype indicative of elite athletic performance.
The elite athletic performance may be elite sprinting performance.
The DNA may be genomic DNA.
The sample from the subject may be selected from the group comprising: blood, saliva, skeletal muscle skin, bone marrow, biopsy, soft tissue, semen, internal organ and hair.
The subject may be from a competitive racing species. The subject may be an equine such as a Thoroughbred race horse.
We have also shown that homozygous carriers of the T allele of the COX4I2 gene (EquCab2.0 22676361-C/T) single nucleotide polymorphism (SNP), i.e. those that have the polymorphism in both alleles of the COX4I2 gene, are statistically more likely to be elite sprinting racehorses compared to subjects that are heterozygous for the SNP. i.e. subjects that have the polymorphism in one of the alleles of the COX4I2 gene, or subjects that do not have the SNP in either allele of the COX4I2 gene.
We describe a method of predicting athletic performance of a subject comprising the step of assaying a biological sample from the subject for the presence or absence of a single nucleotide polymorphism (SNP) in the COX4I2 gene. The SNP may be EquCab 2.0 COX412-22676361 - C/T. The presence of a homozygous TT genotype may be indicative of elite athletic performance. The presence of a homozygous TT genotype may be indicative of elite aerobic performance. The presence of a homozygous TT genotype may be indicative of elite sprinting performance. The biological sample of the subject may be selected from the group comprising: blood, saliva, skeletal muscle, semen, biopsy, internal organ, skin, bone marrow (or any other biological tissue) and hair. The subject may be from a competitive racing species. The subject may be an equine. The subject may be a Thoroughbred race horse.
We also describe an assay for use in determining athletic performance of a subject comprising means for detecting the presence or absence of a single nucleotide polymorphism (SNP) in the COX4I2 gene. The SNP may be EquCab 2.0 COX4I2-22676361 - C/T. The presence of a homozygous TT genotype may be indicative of elite athletic performance. The biological sample of the subject may be selected from the group comprising: blood, saliva, skeletal muscle, semen, biopsy, internal organ, skin, bone marrow (or any other biological tissue) and hair. The subject may be from a competitive racing species. The subject may be an equine. The subject may be a Thoroughbred race horse.
Brief Description of the Drawings
The invention will be more clearly understood from the following description of an embodiment thereof, given by way of example only, with reference to the accompanying drawings, in which:-
Fig. 1 is a schematic of the partitioning of energy during exercise in horses;
Fig. 2 is a bar chart showing the distribution of COX412 22676361 (C/T) SNP genotypes in Thoroughbred subpopulations (TB E EN: elite performing Thoroughbreds over distances >8f; TBE SP: elite performing Thoroughbreds over distances <8f; TBO: other Thoroughbreds that have raced but have never won a race and have a handicap rating <
70) and in non-Thoroughbred horses (AH: Akhal-Teke; CON: Connemara Pony; TU: Tuva). Elite Thoroughbreds that have successfully competed over distances <8f have a significantly higher frequency of the TT genotype than other Thoroughbred sub- populations and non-Thoroughbreds;
Fig. 3 is a schematic showing the relationship between three of the main metabolic pathways contributing to energy production during exercise, the function of three genes CKM, COX4I2 and PDK4 associated with elite racing performance are shown;
Fig. 4 (A) to (D) are graphs showing the allele frequency distribution among elite
(hatched bar) and non-elite Thoroughbreds for CKM 22684390 (C/T) SNP (A), COX4I2 22684390 (C/T) SNP (B) and PDK4 38973231 (A/G) SNP (C) and among elite sprinters (hatched bar) and elite endurance Thoroughbreds for MSTN 66493737 (T/C) SNP (D);
Fig. 5 (A) to (D) are graphs showing the genotype frequency distributions among elite
(hatched bar) and non-elite Thoroughbreds for CKM 22684390 (C/T) SNP (A), COX4I2 22684390 (C/T) SNP (B) and PDK4 38973231 (A/G) SNP (C) and among elite sprinters (hatched bar) and elite endurance Thoroughbreds for MSTN 66493737 (T/C) SNP (D); - Si - Fig. 6 (A) to (C) are graphs showing the genotype frequency for best race distance for the MSTN 66493737 (T/C) SNP in which (A) shows the C/C genotype frequency; (B) shows the C/T genotype frequency; and (C) shows the T/T genotype frequency;
Fig. 7 is a graph showing the genotype frequency for best race distance for the MSTN
66493737 (T/C) SNP in which the best race distance for horses that had won their group race as a two-year-old was replaced with the average distance of their three-year-old races;
Fig. 8 is a graph showing the genotype frequency for the MSTN 66493737 (T/C) SNP in a non-thoroughbred population known for endurance exercise capabilities (Egyptian Arabian horse) and a thoroughbred population; and
Fig 9 is a graph showing the genotype frequency for the MSTN 66493737 (T/C) SNP for stallions with a Stamina Index 6 - 8f, 8- 10 f, 10- 12f; and
Fig 10 is a graph showing the relative expression of MSTN gene for the MSTN 66493737 (T/C) SNP C/C, C/T and T/T genotypes.
Detailed Description
Intense selection for elite racing performance in the Thoroughbred horse (Equus caballus) has resulted in a number of adaptive physiological phenotypes relevant to exercise, however the underlying molecular mechanisms responsible for these characteristics are not well understood.
Eivers et al (2009) investigated adaptive changes in mRNA expression in equine skeletal muscle for a panel of candidate exercise-response genes following a standardised incremental-step treadmill exercise test in eight unconditioned Thoroughbred horses. In the study, biopsy samples were obtained from the gluteus medius pre-exercise (T0), immediately post-exercise (Ti) and four hours post-exercise (T2). They detected significant (P < 0.05) fold differences relative to T0 in eight genes (CKM, COX4I1, COX4I2, PDK4, PPARGClA, PRKAAl, SLC2A1, and SLC2A4) at T2. By studying the relationships between mRNA and velocity at maximum heart rate (VHRmax) and peak post-exercise plasma lactate concentration ([La]Ti), they demonstrated significant (P < 0.05) associations with C0X4I1 and PPARCGlA at T2 and between [La]Ti and C0X4I1 at T0. In a follow-on study they investigated gene expression changes in a second cohort of horses after a ten month period of conditioning. They showed that in resting samples, the COX4I1 gene had a significant increase in abundance following conditioning and, after exercise in the conditioned cohort, significant fold differences were identified in COX4I2, PDK4 and PPARGClA at T2. They also detected significant relationships with VHRmax and [La]Ti for PPARGClA and C0X4I1.
The present invention relates to a previously unknown relationship between sequence variants (such as SNPs) in a number of candidate exercise response genes (listed in the appendices) and retrospective athletic performance (given as racecourse success i.e. Group winner or non-winner, handicap rating (RPR) and best race distance for Group winners) in Thoroughbred race horses. In some aspects, the invention relates to SNPs in the C0X4I1, COX4I2, PDK4, CKM and MSTN genes.
COX4I1 and COX4I2 Cytochrome C oxidase (COX) is a multi-subunit enzyme (Complex IV) that catalyzes the electron transfer from reduced cytochrome C to oxygen in mitochondrial respiration. COX is a dimer in which each monomer is made up of 13 subunits, three of which are encoded by the mitochondrial genome (COXl, 2 and 3). Nuclear encoded COX4 is responsible for the regulation and assembly of mitochondrially encoded subunits on the inner mitochondrial membrane (Fukuda et al. 2007). In human skeletal muscle, COX4 mRNA levels have been shown to be associated with mitochondrial volume and, by extension, VO2max. COX4 comprises two isoforms (COX4-1 and COX4-2) encoded by the C0X4I1 and COX4I2 genes that are differentially regulated in normoxic and hypoxic environments (Fukuda et al. 2007). In normal oxygen environments COX4I1 is preferentially transcribed. In limited oxygen environments HIF- 1 activates transcription of COX4I2 and the mitochondrial LON gene. As LON inhibits the expression of COX4I1, these control mechanisms result in increased COX4I2 transcription and protein synthesis and decreased COX4-1 availability. This mechanism has been postulated to be a strategy to maximise the efficiency of cellular respiration in limited oxygen environments (Fukuda et al. 2007).
The physiological requirements during a race differ depending on the energy demand and are regulated by the partitioning of metabolic pathways to provide energy in the most efficient manner. During the first 75 seconds of exercise at supramaximal intensities (105 - 125% Vθ2max) horses experience an oxygen deficit because oxygen supply cannot meet the demand of exercising muscles (Dempsey and Wagner 1999; Seaman et al. 1995). Over longer distances and for longer duration (> 75 seconds) horses reach steady-state VO2 and rely principally on aerobic metabolism. At the end of a race anaerobic demand increases as horses pass the 'lactate threshold'. During short distance races (< 1,000 m) approximately 70% of the total energy in the form of ATP, necessary for muscle contraction, is generated by aerobic metabolic pathways (Eaton et al. 1995). In Thoroughbred horses exercising at supramaximal intensities over short distances this hypoxic environment may trigger the well-conserved metabolic switch from COX4-1 to COX4-2 utilisation (Fukuda et al. 2007). This environmental regulation of COX4-2 may increase the efficiency of cellular respiration. COX4-2 may therefore be an important regulator of energy supply in the early stages of a race and towards the end of a race when oxygen is limited. As can be seen from Fig. 1, large amounts of energy are required while peripheral physiological systems (i.e. skeletal muscle) are operating in limited oxygen environments in the early stages of exercise and towards the end of a race. Generation of energy via COX4-2 may be important during both these stages.
It has been suggested that regulation of mitochondrial biogenesis may be mediated by glucocorticoid hormone (Weber et al 2002). The COX4I2 gene contains a glucocorticoid receptor element (TGTT) which may be targeted to increase COX4-2 expression and therefore increase mitochondrial volume. Also, the COX4I2 gene contains a p53 tumor suppressor binding site (CATG). Recent studies have suggested that p53 may play a role in regulation of mitochondrial biogenesis and aerobic metabolism via COX (Matoba et al. 2006; Saleem et al. 2009).
CKM
Creatine kinase (CK), also known as creatine phosphokinase (CPK) or phosphocreatine kinase, is an enzyme (EC 2.7.3.2) expressed by various tissue types. It catalyses the conversion of creatine and consumes adenosine triphosphate (ATP) to create phosphocreatine and adenosine diphosphate (ADP). In tissues that consume ATP rapidly, especially skeletal muscle, but also brain and smooth muscle, phosphocreatine serves as an energy reservoir for the rapid regeneration of ATP. Thus creatine kinase is an important enzyme in such tissues.
In most cells the CK enzyme consists of two subunits, which can be either B (brain type) or M (muscle type). There are, therefore, three different isoenzymes: CK-MM, CK-BB and CK-MB. The genes for these subunits are located on different chromosomes. In addition, there are two mitochondrial creatine kinases, the ubiquitous and sarcomeric form. The different types of CK isoenzymes are listed in Table 1.
Table 1 - Isoenzymes of creatine kinase
Figure imgf000014_0001
Isoenzyme patterns differ depending on tissue type. For example, CK-BB occurs mainly in brain tissues, and its levels rarely have any significance in skeletal muscle. Skeletal muscle expresses CK-MM (98%) and low levels of CK-MB (1%) whereas in contrast the myocardium (heart muscle) expresses CK-MM at about 70% and CK-MB at 25-30%.
The mitochondrial creatine kinase (CKm), which produces ATP from ADP by converting creatine phosphate to creatine, is present in the mitochondrial intermembrane space. Apart from the mitochondrial form, there are three forms present in the cytosol — CK3 (in times of acute need, produces ATP in the cytosol at the cost of creatine phosphate), CK0 (maintains critical concentration of creatine and creatine phosphate in the cytosol by coupling their phosphorylation and dephosphorylation respectively with ATP and ADP) and CKg (which couples direct phosphorylation of creatine to the glycolytic pathway.
The creatine kinase, muscle gene (CKM) encodes a muscle type isozyme of creatine kinase found exclusively in striated muscle. The encoded protein is involved in cellular energetics. During exercise CKM gene knockout mice show a lack of burst activity but maintain normal absolute muscle force (van Deursen et al. 1993). We have found that CKM gene transcripts are the most abundant transcripts in the Thoroughbred horse skeletal muscle transcriptome, supporting the pivotal role played by the CKM gene in exercise adaptation in the horse.
PDK4 The regulation of glucose utilisation is tightly controlled by the uptake of glucose by glucose transporters, the rate of glycolytic flux and the conversion of pyruvate to acetyl-CoA in mitochondria via the catalytic function of the pyruvate dehydrogenase complex (PDC). The critical rate limiting step in the oxidation of glucose is the regulation of assembly of the PDC which is controlled by pyruvate dehydrogenase kinase (PDK). PDK blocks the formation of the PDC resulting in the beta-oxidation of fatty acids to acetyl-CoA as the substrate for oxidative phosphorylation. Three genes (PDK2, PDK3 and PDK4) of the four genes that encode PDK isoforms are located in positively selected genomic regions in Thoroughbred (Gu et al 2009). The PDK4 gene promoter contains a binding site for the FOXOlA transcription factor, a key regulator of insulin signalling in liver and adipose tissue. Single nucleotide polymorphisms in FOXOlA have been found to have a protective effect on T2DM development and related phenotypes in humans. FOXOlA has also been found among positively selected genomic regions in Thoroughbred and its PDK4 promoter binding site sequence is conserved in horse. The transcription factors FOXOl and SMAD have also been shown to be responsible for myostatin (MSTN) gene regulation and therefore play key roles in the regulation of muscle growth.
In a genome scan for positive selection, Gu et al (2009) detected a region that deviated very significantly from neutral expectations in two independent statistical tests (Fsτ and Ewens- Watterson test). This region contained the PDK4 gene. PDK4 gene expression is co-ordinated by the transcriptional co-activator PGC- lα via ERRα (estrogen-related receptor alpha) binding. PGC- lα, encoded by the PPARGClA (peroxisome proliferator-activated receptor gamma, coactivator 1 alpha) gene, is a key regulator of energy metabolism that regulates insulin sensitivity by controlling glucose transport via SLC2A4 (solute carrier family 2 (facilitated glucose transporter), member 4; previously GLUT4) and drives the formation of oxidative muscle fibres and co-ordinates mitochondrial biogenesis via its interaction with nuclear encoded mitochondrial protein genes.
MSTN
Myostatin is also known as growth/differentiation factor 8 precursor (GDF-8). In several mammalian species (including cattle, sheep and dogs), the double muscling trait is caused by mutations in the myostatin (MSTN) gene. In dogs, MSTN gene mutations in racing whippets have been associated with the 'bully' phenotype and heterozygous individuals are significantly faster than individuals carrying the wild-type genotype (Mosher et al 2007). Mutations in the MSTN gene may be associated with athletic power. We have analysed a number of single nucleotide polymorphisms (SNPs) in genes associated with athletic performance and have developed a simple DNA based method of predicting the athletic performance potential of a subject based on the SNPs.
The invention will be more clearly understood from the following examples.
Examples
Subjects A Thoroughbred is a registered racehorse that can trace its ancestry to one of three foundation stallions and the approximately 30 foundation mares entered in The General Studbook, 1791 (Weatherby and Sons 1791). There are two types of Thoroughbred race: National Hunt races are run over hurdles or steeplechase fences over distances of up to 4.5 miles (7,200 m), while Flat races have no obstacles and are run over distances ranging from five furlongs (5/8 mile or 1 ,006 m) to 20 furlongs (4,024 m). The highest standard and most valuable elite Flat races are known as Group (Europe and Australasia) or Stakes races (North America). The most prestigious of these races include The Breeders' Cup races (United States), The Kentucky Derby (United States), The Epsom Derby (United Kingdom) et cetera.
Three hundred and fifty Group races are run in Europe (Britain, Ireland (incl. Northern Ireland), France, Germany, Italy) annually including 84 Group 1, 93 Group 2 and 173 Group 3 races. In the United Kingdom and Ireland 196 Group races are competed annually (43 Group 1, 50 Group 2 and 103 Group 3). Britain has the highest number of Group races (139) in Europe per annum, with 57% run over distances <1 mile (1609 meters) and 43% run over distances >1 mile. Australia has approximately 540-550 Group races per season from a total of almost 21,000 races and New Zealand hosts 78 Group races per season. After Group races, Listed races are the next highest grade of race.
Horses that compete over distances <1 mile are known as 'sprinters' whereas horses that compete over distances >1 mile are known as 'stayers'. Horses competing in 1 mile races ('milers' and 'middle distance') may be considered either sprinters or stayers and the way in which a race is executed by the rider often reflects the trainers perceived ability ('sprinter' or 'stayer') of the horse. The International Federation of Horseracing Authorities recognizes five race distance categories: Sprint (5-6.5 f, < 1,300 m), Mile (6.51-9.49 f, 1,301-1,900 m), Intermediate (9.5-10.5 f, 1,901-2,112 m), Long (10.51-13.5 f, 2,114-2,716 m) and Extended (> 13.51 f, > 2,717 m); S-M-I-L-E [Note: 1 furlong = 1/8 mile = 201.2 meters].
To minimise confounding effects of racing over obstacles only horses with performance records in Flat races were considered for inclusion in the study cohorts. In all cases pedigree information was used to control for genetic background by exclusion of samples sharing relatives within two generations. Also, overrepresentation of popular sires within the pedigrees was avoided where possible.
Samples from Thoroughbred horses were collected with informed owner's consent from racing, breeding and sales establishments in Ireland, Britain and New Zealand during 1997-2006. All horses were categorized based on retrospective racecourse performance records as "elite Thoroughbreds" (TBE) or "other Thoroughbreds" (TBO). Elite Thoroughbreds were flat race horses that had won at least one Group (Group 1, Group 2 or Group 3) race. Other Thoroughbreds were those that had competed on the racetrack but had never won a flat race or had a handicap rating (Racing Post Racing (RPR)) of less than 89.
Example 1 - COX4I2
During sprint exercise, energy in the form of ATP, necessary for muscle contraction, is generated principally by aerobic metabolic pathways (70% aerobic, 30% anaerobic) albeit in a limited oxygen environment. We suggest that this relative hypoxic environment triggers the well- conserved metabolic switch from COX4-1 to COX4-2 thereby increasing the efficiency of cellular respiration. COX4-2 is therefore an important regulator of energy supply during sprinting, but not necessarily in longer distance competitions where oxygen demands are met. This switch is mediated by the transcription factor HIF- lα in the cell that has been well- characterised as the master regulator of hypoxia-dependent gene expression (Semenza 1998). HIF- lα activates the transcription of genes encoding PDKl, LDHA, COX4-2 and LON and controls the switch from COX4-1 to COX4-2. In Thoroughbred muscle that is deprived of oxygen during intense exercise an enhanced response to reduced oxygen and the ability to generate ATP in the most efficient manner will provide a significant advantage to that individual.
Also, increased mitochondrial volume has been shown to be associated with higher aerobic capacity (Fluck 2006). Increased amount of glucocorticoid hormone has been shown to stimulate mitochondrial biogenesis, either by specifically targeting the mitochondrial genome or by an unknown mechanism (Weber et al 2002). Glucorticoid receptor elements (Glucocorticoid responsive and related elements) contain the recognition sequence (TGTT). The COX4I2 gene contains one of these elements in Intron 2. Therefore glucocorticoid binding may stimulate increased gene expression leading to increased mitochondrial volume and therefore aerobic energy capacity.
In some aspects, the present invention relates to a single nucleotide polymorphism (SNP) in COX4I2 that is significantly (P < 0.01) associated with elite sprinting performance. The significant association of the COX4I2 homozygous TT genotype (EquCab2.0 22676361 -C/T) in elite sprint race winners may be utilized in DNA-based tests of genetic potential for elite athletic performance in Thoroughbred horses.
Precise location of the COX4I2 gene (EquCab2.0 22676361-C/T) polymorphism The exact location of the COX4I2 polymorphism is on Equus caballus chromosome 22 at position 22676361 of the Horse Genome Sequence (Equus caballus Version .2.0) which can be viewed at www.broad.mit.edu/mammals/horse/. The COX4I2 polymorphism may be identified as EquCab2.0 COX4I2 22676361 (C/T) SNP.
The horse genome EquCab2 assembly is a Whole Genome Shotgun (WGS) assembly at 6.79x and was released in September 2007. A female Thoroughbred named "Twilight" was selected as the representative horse for genome sequencing. The project coordination and genome sequencing and assembly is provided by the Broad Institute. The N50 size is the length such that
50% of the assembled genome lies in blocks of the N50 size or longer. The N50 size of the contigs is 112.38 kb, and the total length of all contigs is 2.43 Gb. When the gaps between contigs in scaffolds are included, the total span of the assembly is 2.68 Gb. The horse EquCab2 was annotated using a standard Ensembl mammalian pipeline. Predictions from vertebrate mammals as well as horse proteins have been given priority over predictions from non-vertebrate mammals. The set of predictions has been compared to 1 : 1 homologues genes in human and mouse, and missing homologs in the horse annotation have been recovered using exonerate. Horse and human cDNAs have been used to add UTRs to protein based predictions. The final gene-set comprises 20,737 protein-coding genes, 2,863 identified as pseudogenes and 1,580 classified as retro-transposed genes.
Genotvping of the EquCab2.0 COY4/2-22676361-C/T polymorphism Genotyping of SNPs was conducted in a sample of Thoroughbreds (n = 149) comprising both elite (n = 79) and non-elite performers (« = 70). The elite performer group contained a subset of animals (n = 70) that competed preferentially in short distance (<1 mile; n = 34) and long distance (>1 mile; n = 36) races.
Genomic DNA was extracted from either fresh whole blood or hair samples. Blood samples were collected in 7 ml Vacutainer K3EDTA blood collection tubes (Becton Dickinson, Franklin Lakes, NJ). Hair samples with visible hair roots were collected in labelled, airtight zip-lock bags. Samples were stored at 40C prior to DNA extraction using a modified version of a standard phenol / chloroform method (Sambrook and Russell 2001). DNA concentrations for all samples were estimated using a NanoDrop ND- 1000 UV- Vis Spectrophotometer (NanoDrop Technologies, Wilmington, DE).
The flanking sequence and SNP (bold and square brackets) is as follows; (bases indicated in lower case indicate that the sequence read was not optimal for this region of the flanking sequence)
caagagtggagtgtgctccaagaactggaggctagcatgtagcagaggaggcagtagcagaggaggagaggttgatgggggagctgc atttggagagtctggcaggcaggaccttgaatgccaggctaaggagtttATTGGGAGGC AAGTGGGTGCTGAT AA AGGCTCAAGGATTCCATCAGGCTGTTCCCACAAAGACC[CZT]GGGCCACCTCAGGGC ACCATATCCCCATATCCAGGAGCCAGTTGTGTCCCAGAGAAAACAAGGGACTGGAC CTTGAGACTTGGCCAGTGTCCTTCACATCCTACCCTGTGCACGCCCCTGTTTGGCCTG TGGTGCAGAAGGCCCCTGGGAGACCTGAAGCAGAAGCTGCAGACCATTCCAGGTTA GTGTGGAGCCCCAGA (SEQ. ID No. 1)
Genotyping of the COX4I2 gene was performed by KBiosciences (www.kbioscience.co.uk) using either competitive allele specific PCR (KASPar) or Taqman (Applied Biosystems). KASPar is a proprietary in house homogeneous fluorescent genotyping system.
25 μL of total DNA was supplied to KBiosciences at a concentration of 15 ng/ μL in "v- bottomed" 96 well micro-titre plates. Also included were a number of samples for set-up and assay validation (n = 24) and blank (n = 1 per 96 well plate) samples to check for reproducibility and to control for errors in sample handling Genetic analysis study
Following genotyping, a genetic analysis was carried out on the subjects (n - 149) described above.
Individual dichotomous logistic regression models were fitted for each SNP. Genotype trend effects were modeled by estimating the risk associated with a linear trend in magnitude of effect relative to the common homozygote, heterozygote, and rare homozygote genotypes. P-values were determined from a likelihood ratio test statistic and approximated according to an asymptotic χ2 distribution with one degree of freedom. The best genetic model for significantly associated SNPs was determined by repeating the analysis with coding variables for additive, recessive and overdominant models.
Table 2 shows the EquCab2.0 COX4I2 _22676361 (C/T) SNP genotype frequencies amongst the subjects.
Figure imgf000020_0001
Wherein: Sp = sprinter
En = endurance (or 'stayer')
OR = Odds ration Lower = lower confidence interval upper = upper confirdence interval
Referring to Table 2 the EquCab2.0 COX4I2 2267 '6361 (C/T) SNP homozygote TT genotype is significantly associated with elite racing (sprinting) performance over distances < 8 furlongs (less than 1 mile) (P < 0.02) (Fig. 2) and this association is more pronounced over distances < 7f (P < 0.01).
Thoroughbred horses carrying the homozygote T allele (TT) of the COW/2 22676361 (C/T) SNP have a greater sprinting ability compared to Thoroughbred horses carrying the heterozygous T allele (TC) or to Thoroughbred horses that do not carry the T allele (CC). Therefore, the sprinting performance of a Thoroughbred horse can be predicted by testing a biological sample for the presence or absence of the homozygote T allele of the COY4/2 22676361 (C/T) SNP.
Example 2 - Genes associated with Thoroughbred racing performance
We investigated associations between 80 SNPs in the following genes: ACN9, ACSSl1 ACTAl, ACTN2, ADHFEl, GGPSl, GSN, MC3R, MTFRl, NDUFA8, PDK4, PONl, PTGSl, PTPNl, TNC, TOMM20, UGCG CKM, COX4I2, COX4I1, HIFlA, MYEF2, and PRKAAl (details of the SNPs are given in the appendices with racing performance in Thoroughbreds).
The present invention identifies significant associations between SNPs and athletic performance phenotypes in a set of these genes including ACN9, ACSSl, ACTN2, ADHFEl, CKM, COX4I2, GSN, MSTN, PONl, PTGSl and PTPNl (see the appendices). Because of the known gene expression response to exercise in equine skeletal muscle (Eivers et al 2009) and evidence for association with performance in dogs (Mosher et al 2008) and response to training, four of the genes (CKM, COX4I2, PDK4 and MSTN) that had a significant association with Thoroughbred racing performance were investigated in detail. SNPs in three of those genes (CKM, COX4I2 and PDK4) are associated with elite (Group race winning) performance and a SNP in the MSTN gene is associated with elite sprint race performance.
In this example, the following sample set was used:
Table 3 - Details of samples included in each subpopulation.
Figure imgf000022_0001
In which TB is Thoroughbred, TBE is Elite Group race winning Thoroughbred; and TBO is non- elite (i.e other non-winning) Thoroughbred. The TBE cohort was further subdivided into TBE sprinter (n = 39) and TBE endurance or 'stayer' (n = 32).
Genetic analysis study
Tests for association of SNPs with athletic performance were performed using the program
PLINK (http://pngu.mgh.harvard.edu/purcell/plink/ Purcell et al., 2007)
Standard case/control association analysis
To perform a standard case/control association analysis, the option: plink —file mydata -assoc was used, which generates a file plink.assoc containing the fields:
CHR Chromosome
SNP SNP ID
BP Physical position (base-pair)
Al Minor allele name (based on whole sample)
F_A Frequency of this allele in cases
F U Frequency of this allele in controls
A2 Major allele name
CHISQ Basic allelic test chi-square (ldf)
P Asymptotic p-value for this test
OR Estimated odds ratio (for Al)
Association analysis
It is possible to perform tests of association between a disease and a variant other than the basic allelic test (which compares frequencies of alleles in cases versus controls), by using the —model option. The tests offered here are (in addition to the basic allelic test):
• Cochran-Armitage trend test
Genotypic (2 df) test Dominant gene action (ldf) test
Recessive gene action (ldf) test
One advantage of the Cochran-Armitage test is that it does not assume Hardy- Weinberg equilibrium, as the individual, not the allele, is the unit of analysis (although the permutation- based empirical p-values from the basic allelic test also have this property). SNPs showing severe deviations from Hardy- Weinberg are often likely to be bad SNPs, or reflect stratification in the sample, however, and so are probably best excluded in many cases.
The genotypic test provides a general test of association in the 2-by-3 table of disease-by- genotype. The dominant and recessive models are tests for the minor allele (which is the minor allele can be found in the output of either the —assoc or the — freq commands. That is, if D is the minor allele (and d is the major allele):
Allelic: D versus d
Dominant: (DD, Dd) versus dd
Recessive: DD versus (Dd, dd)
Genotypic: DD versus Dd versus dd
As mentioned above, these tests are generated with option plink —file mydata —model which generates a file plink.model containing the following fields:
CHR Chromosome number
SNP SNP identifier TEST Type of test
AFF Genotypes/alleles in cases
UNAFF Genotypes/alleles in controls
CHISQ Chi-squated statistic
DF Degrees of freedom for test P Asymptotic p-value
Each SNP will feature on five rows of the output, corresponding to the five tests applied. The column TEST refers to either ALLELIC, TREND, GENO, DOM or REC, referring to the different types of test mentioned above. The genotypic or allelic counts are given for cases and controls separately. For recessive and dominant tests, the counts represent the genotypes, with two of the classes pooled.
These tests only consider diploid genotypes: that is, for the X chromosome males will be excluded even from the ALLELIC test. This way the same data are used for the five tests presented here. Note that, in contrast, the basic association commands (--assoc and —linear, etc) include single male X chromosomes, and so the results may differ.
The genotypic and dominant/recessive tests will only be conducted if there is a minimum number of observations per cell in the 2-by-3 table: by default, if at least one of the cells has a frequency less than 5, then the alternate tests are skipped (NA is written in the results file). The Cochran-Armitage and allelic tests are performed in all cases. This threshold can be altered with the —cell option: plink —file mydata —model —cell 20
Results of the association tests are provided in full in the appendices. A number of SNPs in the four genes PDK4, COX4I2, CKM and MSTN were investigated. For each gene we selected the SNP with the most significant association (P value) (Table 4) for the trait for further investigation. The 4 SNPs with greatest association with athletic performance were PDK4 38973231 - A/G, COX4I2 22684390 - C/T, CKM l 5884567 - G/A, and MSTN_ 66493737 - T/C. SNPs in PDK4, CKM and COX4I2 were associated with elite (Group race winning) performance and a SNP in MSTN was associated with elite sprinting performance in Thoroughbred racehorses. The best fit genotypic models were assigned based on the results in Table 5 below.
Table 4 - Results of SNP association tests for elite (Group winning) performance (PDK4, CKM and COX4I2) and elite sprinting performance (MSTN) in Thoroughbred racehorses. SNPs with the most significant association in each gene are shown here.
Figure imgf000024_0001
Figure imgf000025_0001
In which Al: allele 1; A2: Allele 2; F A(Al): frequency of allele 1 in elite TB (PDK4, CKM and COX4I2) and elite sprinters (MSTN); F_A(A2): frequency of allele 2 in elite TB (PDK4, CKM and COX4I2) and elite sprinters (MSTN); F U(Al): frequency of allele 1 in non-elite TB (PDK4, CKM and COX4I2) and elite endurance (MSTN); F_U(A2): frequency of allele 2 in non-elite TB (PDK4, CKM and COX4I2) and elite endurance (MSTN).
The SNPs that were chosen for further investigation were as follows:
PDK4_38973231 (A/G) COX4I2_22684390 (C/T) CKM l 5884567 (G/A) MSTN_ 66493737 (T/C)
Table 5 - Association test results for best-fit model
Figure imgf000025_0002
Figure imgf000026_0001
The best fit genotypic models were assigned based on the results in Table 5. The best model for association of the SNPs with athletic performance was concluded as follows: PDK4 - Allelic → A allele is preferred i.e. AA or AG
CKM- Allelic → A allele is preferred i.e. AA or AG
COX4I2 - Recessive — > T allele is preferred i.e. TT
MSTN - Genotypic → Genotype predicts distance category, (in the cohort used in this example, none of the 'stayers' were CC but 50% sprinters were CC)
The allele frequency distributions among Elite and Non-elite Thoroughbreds for CKM, COX4I2 and PDK4 and among Elite Sprinters and Elite Endurance for MSTN are shown in Fig. 4. Table 6 below shows the allele frequencies for the four SNPs in Thoroughbreds (TBE and TBO).
Table 6 - Allele frequencies for the four SNPs in Thoroughbreds (TBE and TBO)
Figure imgf000026_0002
In which MAF is Minor Allele Frequency and NCHROBS Number of Chromosomes analysed.
The genotype frequency distributions among Elite and Non-elite Thoroughbreds for the SNPs in CKM, COX4I2 and PDK4 and among Elite Sprinters and Elite Endurance for the SNP in MSTN. The results of this study are shown in Fig. 5 and Table 7 below.
Table 7 - Genotype frequencies in elite and non-elite Thoroughbred sub-populations for SNPs: PDK4 (PDK4 38973231); COX4I2 (COX4I2_22684390); CKM (CKM_15884567) and in elite sprinters and elite endurance Thoroughbreds for SNP: MSTN (MSTN_66493737).
Figure imgf000027_0001
Deviations from Hardy- Weinberg equilibrium (HWE) for the four SNPs in the sample cohort were investigated to determine departure from expected neutral genetic drift. Deviation from HWE may be an indicator of selection and may alter the expected distribution of genotypes in a population given the allele frequencies. This information is required to correctly assign genotype frequencies to enable the test for performance.
Table 8 - Tests for deviations from Hardy- Weinberg equilibrium in ALL (All TB); AFF (Elite and elite sprinters); UNAFF (non-elite and elite endurance).
Figure imgf000027_0002
Figure imgf000028_0001
Deviation from HWE was identified in COX4I2_ 22684390-C/T in the Elite Thoroughbred sub- population. Thus genotype frequencies may be adjusted in the test to account for the over- representation of the TT genotype among elite racehorses. Also, deviation from HWE was identified in MSTN_ 66493737-T/C in the elite endurance Thoroughbred cohort. Thus genotype frequencies may be adjusted in the test to account for the under-representation of the CC genotype among elite endurance racehorses.
Example 3 - A multi-gene prediction test for elite (Group race winning) performance in Thoroughbred horses
The present invention provides a simple DNA based method (genotypic test) for predicting the athletic performance of a thoroughbred race horse based on the presence or absence of a SNP in one or more exercise response gene. The exercise response gene may be one or more of the genes listed in the appendices. For example the genotypic test may be based on a SNP in one or more of the PDK4, CKM, COX4I2, COX4I1, MSTN, ACSSl, ACTN2 or PTGSl genes. Details of some of the SNPs that may be used to predict the athletic performance of a thoroughbred horse are given in the appendices. It will be appreciated that the genotypic test may be based on a combination of any one or more of these SNPs.
Referring to Fig. 3, the three main metabolic pathways contributing to energy production during exercise and the location in the pathways and the function of three genes (CKM, COX4I2 and
PDK4) associated with elite racing performance are shown. Using knowledge of known function, the knowledge that the genes are expressed in skeletal muscle in response to exercise and the results in Example 2 above, in this non-limiting example, we developed a simple DNA based genotypic test for predicting elite performance in Thoroughbred horses based on SNPs in the PDK4, COX4I2 and CKM genes.
COX4I2 SNP (COXAYl 22684390 (QJT) SNP)
This SNP is located on Chromosome 22 of Equus caballus at position 22,684,390 bp forward strand of the Horse Genome Sequence (Equus caballus Version 2.0) which can be viewed at www.broad.mit.edu/mammals/horse/.
The horse genome EquCab2 assembly is a Whole Genome Shotgun (WGS) assembly at 6.79x and was released in September 2007. A female Thoroughbred named "Twilight" was selected as the representative horse for genome sequencing. The project coordination and genome sequencing and assembly is provided by the Broad Institute. The N50 size is the length such that 50% of the assembled genome lies in blocks of the N50 size or longer. The N50 size of the contigs is 112.38 kb, and the total length of all contigs is 2.43 Gb. When the gaps between contigs in scaffolds are included, the total span of the assembly is 2.68 Gb. The horse EquCab2 was annotated using a standard Ensembl mammalian pipeline. Predictions from vertebrate mammals as well as horse proteins have been given priority over predictions from non-vertebrate mammals. The set of predictions was been compared to 1 : 1 homologues genes in human and mouse, and missing homologs in the horse annotation have been recovered using exonerate. Horse and human cDNAs have been used to add UTRs to protein based predictions. The final gene-set comprises 20,737 protein-coding genes, 2,863 identified as pseudogenes and 1,580 classified as retro-transposed genes.
Further details of the SNP are as follows: o SNP: COX4I2_22684390 (CIl) P = 0.03098 OR = 0.5778 o EquCab2.0 SNPJD: BIEC2-617568 o Genomic location of SNP: Intron 2 o Substitution type: Transition o The SNP disrupts a glucocorticoid response element (GRE) binding site (C/TGTT). The favourable allele (T) retains the site (TGTT), therefore enabling GRE binding and increasing expression of the gene. The less favourable allele (C) disrupts the site (CGTT), therefore disabling GRE binding and not increasing expression of the gene. Alternatively, the SNP disrupts a p53 tumor suppressor binding site (CACZTG). The favourable allele
(T) retains the site (CATG), therefore enabling p53 binding and contributing to mitochondrial biogenesis. The less favourable allele (C) disrupts the site (CACG) therefore disabling the p53 binding and not contributing to mitochondrial biogenesis.
The flanking sequence and SNP (bold and square brackets) is as follows:
GCTGGGCGATCCTGGGGACATAAAAGTGAATCACCTGGATGGTTCTTGCCCTCAGG
GTGCTCCCAGTCCAGTGGGGGAACCAACACAAGCCCAGATAACTGTAATATAGGAT ATGTGGCGAGGGTGAAGTGTGTTCAAGGGGCTGTGAGGACCCAAAGGAGAGAGAG ATGAAATCCTGGTGGGCCTTCCAGAGGAGGGCA[TZC]GTTCTAGTTGACCTTGAATG GTGAGGCTGAGGGTGCTGCCAGGTGGTGGGAACAGCATGGGTAAGGGTATGGGAGC GGAAGAGCATGGAGGGTCCTAGGCATCAGTAAGTGCTGTAGGGGAAGGAACAGAG AGAGGCGGTGAGGTGGCCAGGAAAGAAGGGGGCCTGACCCTGGGGAGCAGGAGGG ATGTGTGACTCCAA
(SEQ ID No. 2)
CKM SNP fCKM 15884567 (GZA) SNP) This SNP is located on Chromosome 10 of Equus caballus at position 15,884,567 bp of the Horse Genome Sequence (Equus caballus Version 2.0) which can be viewed at www.broad.mit.edu/mammalsZhorseZ.
The horse genome EquCab2 assembly is a Whole Genome Shotgun (WGS) assembly at 6.79x and was released in September 2007. A female Thoroughbred named "Twilight" was selected as the representative horse for genome sequencing. The project coordination and genome sequencing and assembly is provided by the Broad Institute. The N50 size is the length such that 50% of the assembled genome lies in blocks of the N50 size or longer. The N50 size of the contigs is 112.38 kb, and the total length of all contigs is 2.43 Gb. When the gaps between contigs in scaffolds are included, the total span of the assembly is 2.68 Gb. The horse EquCab2 was annotated using a standard Ensembl mammalian pipeline. Predictions from vertebrate mammals as well as horse proteins have been given priority over predictions from non-vertebrate mammals. The set of predictions was been compared to 1 : 1 homologues genes in human and mouse, and missing homologs in the horse annotation have been recovered using exonerate. Horse and human cDNAs have been used to add UTRs to protein based predictions. The final gene-set comprises 20,737 protein-coding genes, 2,863 identified as pseudogenes and 1,580 classified as retro-transposed genes.
Further details of the SNP are as follows: o SNP: CKM l 5884567 (G/A) P = 0.02066 OR = 0.4089 o EquCab2.0 SNPJD: BIEC2- 109575 o Genomic location of SNP: Intron 4 o Substitution type: Transition o The SNP disrupts an Interferon regulatory factor binding site (GCA/GA). The A allele retains the site (GCAA). The G allele disrupts the site (GCGA).
The flanking sequence and SNP (bold and square brackets) is as follows: CTGTCCCTAACAGACCTGGACCTTGGCCCCGTGGAGGTCCTAAAGGCRACTATACGC GATGTAAACCCAAATTCATGACATCCCCTGAAGCATGCTCTTCCCCTGTCTGCCCGG GTCCCCGGAACAGCCACCCCAAGTGCTCTCTCCCAAGTGGACTCTCCCTTCACACCC TGCCCCTCGCATCCAGTGCACCGGCAAGC[AZG]ACACTATCCCGGTGCCCACTCCAG AAAGTCAATGTCTCAGGAATCTGGGGAGCCATCAGTCAAAATTACTATCATACAGT ATATATAGGATTCGCATATATTCCTATGCATAATAATTATACGTTTTGTGGATAATA AATATATGTATATATGCATAATATTTACATAATATATACATATTTATATACATTTTAT ACATT
(SEQ ID No. 3)
PDK4 fPDK4 38973231 (PJG) SNP)
This SNP is located on Chromosome 4 oϊEquus caballus at position 38,973,231 bp of the Horse Genome Sequence (Equus caballus Version 2.0) which can be viewed at www.broad.mit.edu/mammals/horse/. The horse genome EquCab2 assembly is a Whole Genome Shotgun (WGS) assembly at 6.79x and was released in September 2007. A female Thoroughbred named "Twilight" was selected as the representative horse for genome sequencing. The project coordination and genome sequencing and assembly is provided by the Broad Institute. The N50 size is the length such that 50% of the assembled genome lies in blocks of the N50 size or longer. The N50 size of the contigs is 112.38 kb, and the total length of all contigs is 2.43 Gb. When the gaps between contigs in scaffolds are included, the total span of the assembly is 2.68 Gb. The horse EquCab2 was annotated using a standard Ensembl mammalian pipeline. Predictions from vertebrate mammals as well as horse proteins have been given priority over predictions from non- vertebrate mammals. The set of predictions was been compared to 1 : 1 homologues genes in human and mouse, and missing homologs in the horse annotation have been recovered using exonerate. Horse and human cDNAs have been used to add UTRs to protein based predictions. The final gene-set comprises 20,737 protein-coding genes, 2,863 identified as pseudogenes and 1,580 classified as retro-transposed genes.
Further details of the SNP are as follows: o SNP: PDK4 38973231 (AJG) P = 0.001676 OR = 2.2 o EquCab2.0 SNPJD: BIEC2-903605 o Genomic location of SNP: Intron 2 o Substitution type: Transition o The SNP is 4 bp upstream from a transcription factor (Two-handed zinc finger homeodomain transcription factors) binding site (ta/gtgtGTTTcaga).
The flanking sequence and SNP (bold and square brackets) is as follows: ACTTTAACCCTCAACTTTCTAACTTAAAATTTATGTTTAACTATTCCAGAGCAATATT CAGTTTTATTTGGCAAATGTTTTCATTTTTTATAGCAAAAGTATTTAGAAATTTTTAA GAAAGATTTCATATTTCTTTCTACTTCATTCATTCATGTGTGGGTAGAAGTCTCGAAA GCAGCAGTAAAGACTATGGATTGAAT[AZG]TGTGTTTCAGATTGTCATTGTTTAATGG GTATGGAATGCATATATTTCTTGAATCAATGAACAAAACGCTGTATAGTCAGCAGAT TAGGGTGAGGCTCTGGTGCATATCTGCTGCAGTGCATATCCTGGCTCTATTCTCTGA AAATCTGCTCTTGTGGGTCATCTACCCTCTCTAAGCTTMAGCACCCTTATTTGTTAAA
(SEQ ID No. 4) Risk prediction
The prediction of 'risk' for complex traits is greatly enhanced by testing multiple genes contributing to a trait, rather than relying on single gene SNPs (Yang et al 2003) if the additive genetic variance is small. However, single SNPs may be used where the effect is large (i.e. high 5 odds ratio). Based on subpopulation prediction using population allele frequencies (for SNPs in HWE) or observed genotype frequencies (for SNPs deviating from HWE) and Bayes Theorem we investigated the probability of being a member of one or other subpopulation (elite or non- elite) given a certain combination of genotypes for the sequence variants in the PDK4, CKM and COX4I2 genes. Results are provided in Table 9 below as a percentage chance of being a member 0 of each of the two subpopulations.
Table 9 - Predictive test for Elite racing ability using SNPs in the genes PDK4, CKM and COX4I2. (The genotype combinations are ranked by most to least favourable for racing ability)
Figure imgf000033_0001
Figure imgf000034_0001
In which for PDK4: AA represents genotype AA, AB represents genotype AG and BB represents genotype GG; for COX4I2: AA represents genotype CC, AB represents genotype CT, and BB represents genotype TT; and for CKM. AA represents genotype GG, AB represents genotype GA, and BB represents genotype AA.
From Table 9 it can be seen that the most favourable combination of genotypes at these three genes is AA, TT, AA for PDK4, COX4I2 and CKM respectively (82% chance of being an elite racehorse, 18% chance of being a non-elite) and the least favourable combination of genotypes at these three genes is GG, CC, GG for PDK4, COX4I2 and CKM respectively (3% chance of being an elite racehorse, 97% chance of being a non-elite).
The risk prediction test may be performed using one or more of the SNPs listed in the appendices.
Example 4 - Quantitative association of SNPs with handicap rating (RPR) Racing Post Ratings (RPR) are a handicap rating determined by a horse's overall performance in a given race with respect to the race level, field quality, weight carried and time of the race. RPR are not directly comparable to speed ratings, rather the rating is intended to represent the weight a horse would be required to carry in a handicap. For example, in races restricted to horses of the same age and sex, a horse with a Racing Post Rating of 120 would, in a handicap, carry three pounds more than a horse rated 117. In open races, sex and weight-for-age allowances are factored in. Thus, in a handicap, if a horse carrying 120 pounds defeats a horse carrying 128 pounds by a length, the horse carrying 128 pounds will generally receive a Racing Post Rating six or seven pounds higher than the horse who carried 120 pounds. Guideline values to help determine a good rating for winners of races in different divisions are given in Table 10 below.
Table 10 - Guideline RPR for winning horses
Figure imgf000035_0001
We examined whether there was a significant relationship between some of the SNPs that have shown a significant association with athletic performance and RPR in a quantitative association test analysis. Table 11 below shows three SNPs that are significantly associated with RPR.
Table 11 - SNPs having a significant association with RPR
Figure imgf000035_0002
Table 12 below shows the mean RPR for each genotype for the three significantly associated SNPs listed in Table 11 above.
Table 12 - Mean RPR for each genotype of the SNPs from Table 11
Figure imgf000035_0003
Figure imgf000036_0001
Referring to Table 12 above, at PDK4 38973231-(A/G) the AA genotype has a mean RPR of 99.95, the AG genotype has a mean RPR of 97.7 and the GG genotype has a mean RPR of 80.3. Therefore we conclude that the AA and AG genotypes are the favourable genotypes correlated with higher RPR. At COX4I1_32772871-(C/T) the TT genotype has a mean RPR of 100.6, the TC genotype has a mean RPR of 99.71 and the CC genotype has a mean RPR of 83.3. Therefore we conclude that the TT and TC genotypes are the favourable genotypes correlated with higher RPR.
C0X4U SNP (COX4I1 32772871 (C/T) SNP)
This SNP is located on Chromosome 3 oϊEquus caballus at position 32,772,871 bp of the Horse Genome Sequence (Equus caballus Version 2.0) which can be viewed at www.broad.mit.edu/mammals/horse/.
The horse genome EquCab2 assembly is a Whole Genome Shotgun (WGS) assembly at 6.79x and was released in September 2007. A female Thoroughbred named "Twilight" was selected as the representative horse for genome sequencing. The project coordination and genome sequencing and assembly is provided by the Broad Institute. The N50 size is the length such that 50% of the assembled genome lies in blocks of the N50 size or longer. The N50 size of the contigs is 112.38 kb, and the total length of all contigs is 2.43 Gb. When the gaps between contigs in scaffolds are included, the total span of the assembly is 2.68 Gb. The horse EquCab2 was annotated using a standard Ensembl mammalian pipeline. Predictions from vertebrate mammals as well as horse proteins have been given priority over predictions from non-vertebrate mammals. The set of predictions was been compared to 1 : 1 homologues genes in human and mouse, and missing homologs in the horse annotation have been recovered using exonerate. Horse and human cDNAs have been used to add UTRs to protein based predictions. The final gene-set comprises 20,737 protein-coding genes, 2,863 identified as pseudogenes and 1,580 classified as retro-transposed genes. Further details of the SNP are as follows:
o SNP: COX4I1_32772871 (C/T) EMPl = 0.009681 o EquCab2.0 SNPJD: BIEC2-816028 o Genomic location of SNP: Intron o Substitution type: Transition
The flanking sequence and SNP (bold and square brackets) is as follows in which M is A or C: TCAGGTCTCAGTCGCACCAGAGCTGGATGGAGCCAGCGCAGCTCCATCTCTCAGTGG CTGGGAGTGGGCTGCAGGGTGGTCCTCACACAAGATGGGCACCTCCCTCCTGGGCTC CATCCCAGGACTGTTTCCCAGGTTTGGGAAACTGGCTCGCATTAGCCGAGTGGCGTG AGCCGGAATMTGATTTACTCACAGTGCGC[TZC]GTGCTTGGTGGGGAACGACTTCCC TGCTTTGTACAGCACCCTGCGTTTCCAGTGGTGGTTTGTCTGGTCACTAGTCTTTTAT CAAGAGATAGTATAGTGAAGGTTAGGTCAAGGAAAAGGGAACTCTGACTTGTCAGA GGGCTGTTTGAACTGTATGGGGACTGCATCTCGATAACCAGGATTCTGGGTCTCCAG ACCCA
(SEQ ID No. 32)
In a quantitative association test analysis this SNP is significantly associated with RPR.
Example 5 - A gene prediction test for elite sprint race performance in Thoroughbred horses. Thoroughbred horses excel in both sprint (< 1,500 m ) and longer distance (> 1,800 m) races. Horses competing in middle distance races ('milers' and 'middle distance1) may be considered either 'sprinters' or 'stayers' and the way in which a race is executed by the rider often reflects the trainer's perceived sprinting and endurance ability of the horse. Within the industry horses may be described as sprinters based on their conformation and usually have a stockier and more muscular stature and are faster maturing. They usually race as 2 year olds and over shorter distances as 3 year olds. Individuals perceived to be longer distance animals may be referred to as 'backward' requiring more time to mature and running over longer distances as 3 year olds. In some regions (e.g. Australia) breeders attempt to breed only faster 'sprint' type horses.
In some aspects, the invention provides a simple DNA based method (genotype test) for predicting the elite sprint race performance of a thoroughbred race horse based on the presence or absence of a SNP in one or more exercise response gene. The exercise response gene may be one or more of the genes listed in the appendices. For example the genotype test may be based on a SNP in one or more of the MSTN, ACN9, PTPNl, PONl, ADHFEl, or GSN genes. Details of some of the SNPs that may be used to predict the elite sprint race performance of a thoroughbred race horse are given in the appendices. It will be appreciated that the genotypic test may be based on a combination of any one or more of these SNPs.
In this non-limiting example, we studied the MSTN gene.
Methods
Association sample
The International Federation of Horseracing Authorities recognizes five distance categories: Sprint (5-6.5 f, < 1,300 m), Mile (6.51-9.49 f, 1,301-1,900 m), Intermediate (9.5-10.5 f, 1,901- 2,112 m), Long (10.51-13.5 f, 2,114-2,716 m) and Extended (> 13.51 f, > 2,717 m) races (International Federation of Horseracing Authorities Classifications, www.horseracingintfed.com) [Note: 1 furlong = 1/8 mile = 201.2 meters]. For the case-control investigations we compared two cohorts: samples were subdivided into short (< 8 f and < 7 f ) and long (> 8 f) distance racing cohorts. To avoid animals with excessive consanguinity (within two generations) and over-representation of popular sires within the pedigrees, a set of Thoroughbred DNA samples {n = 148) was selected from a large DNA sample repository (n > 1 ,000) collected with informed owners' consent from Thoroughbred training, breeding and sales establishments in Ireland and New Zealand during 1998-2008.
Replication sample To minimize non-genetic influences on performance the findings were validated by genotyping elite (Group and Listed race winning) racehorse samples (n = 39) selected from a repository of DNA samples (n = 419) from horses trained by the same trainer in Ireland during 2004-2008. A subset (n = 142) of this repository was evaluated for genotypic trends with parameters of racecourse success in two-year-old racehorses. Race records were derived from three sources: European race records, The Racing Post on-line database (www.racingpost.co.uk); Australasian and South East Asian race records, Arion Pedigrees (www.arion.co.nz); and North American race records: Pedigree Online Thoroughbred database (www.pedigreequery.com). The replication samples had some sharing of relatives, accounted for in the analyses. DNA extraction, re-sequencing and genotyping
Genomic DNA was extracted from either fresh whole blood or hair samples using a modified version of a standard phenol/chloroform method (Sambrook & Russell 2001). Thirteen pairs of overlapping PCR primers were designed to cover the entire MSTN genomic sequence using the PCR Suite extension to the Primer3 web-based primer design tool (Rozen & Skaletsky 2000; van Baren & Heutink 2004) (Table 13). Twenty-four unrelated Thoroughbred DNA samples were included in a re-sequencing panel to identify Thoroughbred-specific sequence variants. As such this study was powered to detect 95% of SNPs with MAF > 0.05 in the Thoroughbred population (Kruglyak & Nickerson 2001). Bidirectional DNA sequencing of PCR products was outsourced to Macrogen Inc. (Seoul, Korea) and carried out using AB 3730x1 sequencers (Applied Biosystems, Foster City, CA). Sequence variants were detected by visual examination of sequences following alignment using Consed version 19.0 (090206) [Gordon et al 1998] Genotyping was carried out using Sequenom (San Diego, USA) iPlex technology at Sequenom facilities in San Diego, USA (Association samples) and Hamburg, Germany (Replication samples).
Statistical analyses
All statistical analyses, including tests of association were performed using PLINK Version 1.05
(Purcell et al 2007). Quality control analyses included computation of sample allele frequency, percent missing genotypes and deviation from Hardy- Weinberg equilibrium. The series of case- control association tests were performed for two loci (g.66493737C>T and g.66494218A>C). Statistical significance was assessed using the Cochran-Armitage test for trend and an unconditioned genotypic model. Odds ratios and 95% CIs were calculated for the two most significant associations. The linear regression model was used to evaluate quantitative trait association at locus g.66493737C>T using the phenotypes: best race distance and kg / cm ratio.
Results
Horses, in particular Thoroughbreds, have a very high muscle mass to body weight ratio (55%) compared to other mammalian species (30 - 40%) (Gunn 1987). Myostatin gene (MSTN) variants have previously been shown to contribute to muscle hypertrophy; therefore, sequence variation in the equine MSTN gene, which contains three exons and spans 6,172 bp on chromosome 18 (reverse strand nt 66489608 — 66495780, EquCab2.0) was investigated. To-date, no sequence variants have been reported in genomic MSTN sequence in Thoroughbred horses and no MSTN SNPs are documented in the EquCab2.0 SNP database. Novel sequence variants were identified by re-sequencing the equine MSTN gene in 24 unrelated Thoroughbred horses using 14 overlapping primer pairs (Table 13) spanning all three exons and 288 bp of the 5' upstream region. Although no exonic sequence variants were detected, six SNPs were detected in intron 1 of MSTN [nt 66492979— 66494807] (Table 14).
Population genetic diversity analyses suggest that selection for the region containing the MSTN gene has been strong in the Thoroughbred population. Thirteen microsatellite loci spanning equine chromosome 18 were genotyped in three populations of unrelated Thoroughbred (n = 106), Akhal-Teke (n = 18), Connemara (n = 17) and Tuva (n = 17) horses. In Thoroughbred, evaluation of linkage disequilibrium indicated conserved haplotypes encompassing the two loci in closest proximity to the MSTN gene: TKYlOl (nt.63528459) and TKY016 (nt.66838920). Among population differentiation (Fsr) was high at TKYO 16 (FST - 0.23), which was among the top 10% of (n = 394) genome-wide loci when ranked by FST (GU et al 2009). Interestingly, the highest FST score on chromosome 18 was for TKY303 (nt.31.1 Mb; Fsτ = 0.31), which is in close proximity to the ACVR2A gene encoding activin A receptor, type HA, a key signaling molecule for myostatin. The high FST at TKYOl 6, located 350 kb from MSTN, results from divergent allele frequency distributions among Thoroughbred and non-Thoroughbred populations and redistribution of Thoroughbred samples into distance cohorts (TBE < 8 f; n = 25 and TBE > 8 f n = 22) identified a significant difference (Pearson's chi-square test; χ2 = 5.809; df = 1; P = 0.0159) in allele 144 frequency (TBE < 8 f = 70%; TBE > 8 f = 45%).
To investigate associations between MSTN sequence variants and racing phenotypes we genotyped n = 148 Thoroughbred horses. Four of the six MSTN sequence polymorphisms displayed MAF < 0.05 in Thoroughbreds (Table 15) and were excluded from the association analyses. A series of population-based case-control investigations by separating the Thoroughbreds on the basis of retrospective racecourse performance into discrete cohorts containing unrelated animals (Table 16) was performed. Individual genotypes at the two SNPs used for the analyses (g.66493737C>T and g.66494218A>C) were not more common among elite Group race winning Thoroughbreds (Thoroughbred-elite, TBE) than horses that had never won a race (Thoroughbred-other, TBO) (Table 17). Also, no association was detected when handicap ratings, reflecting retrospective racing ability, were evaluated as a quantitative phenotype. However, considering the relative contribution of muscle power to sprint and longer distance racing, the elite Group race winning animals were subdivided into those that had won their best (most valuable or highest grade) race over distances < 8 f (« = 51) and those that had won their best race over distances > 8 f (« = 35) and found highly significant associations [Note: 1 furlong = 1/8 mile = 201.2 meters]. In Britain, of the 139 Group races per annum 57% are run over distances < 1 mile and 43% are run over distances > 1 mile. The elite performer cohort contained a subset of animals (n = 71) that competed preferentially in short distance (< 8 f, n = 39) and long distance (> 8 f n = 32) races.
For all analyses the significance of association was consistently higher for g.66493737C>T than g.66494218A>C and the linkage disequilibrium between these SNPs was relatively high (r2 = 0.50). Conditioning on each SNP using a logistic regression model identified an independent effect for g.66493737OT on g.66494218A>C (P = 0.0108) but not for g.66494218A>C on g.66493737OT (P = 0.7388) and therefore only the results for g.66493737OT were considered further. Among the two distance cohorts we found a highly significant (P = 3.70 x 10"5) association with g.66493737C>T and this association became marginally stronger (P = 1.88 x 10"5) when the short distance cohort was further subdivided into animals (n = 43) that had won their best race over distances < 7 f (Table 17a).
The C allele was twice as frequent in the short distance (< 7 f) than in the long distance (> 8 f) cohort (0.72 and 0.36 respectively) corresponding to an odds ratio of 4.54 (95% C.I. 2.23 — 9.23). When all Thoroughbreds were considered together the locus conformed to expected Hardy- Weinberg proportions (Table 18). However, there was a significant (P = 0.0018) deviation from HWE in the longer distance cohort, possibly due to selection at this locus. Conversely, the C/C genotype was the most common genotype among sprinters (< 7 f, > 51%). Genotype trend effects were modeled by estimating the risk associated with a linear trend in magnitude of effect relative to the common homozygote, heterozygote, and rare homozygote genotype using the Cochran-Armitage test for the trend model. The most parsimonious model was the genotypic model (P = 1.18 x 10"6) indicating that genotypes are predictive of racing distance (Table 17b).
Table 13: PCR primer details for SNP discovery in the equine myostatin (MSTN) gene
Figure imgf000041_0001
Figure imgf000042_0001
Table 14: Details of SNPs discovered in equine myostatin gene following resequencing in a panel of 24 unrelated Thoroughbred horses. None of these SNPs are among the SNPs in the EquCab2.0 SNP Map and have not been previously reported in any publically available literature.
Figure imgf000042_0002
MSTN_ 227 chrl8 66493525 T G Intron 1 MSTN_ 10 Transversion
MSTN_ 10. _284 chrl8 66493582 T G Intron 1 MSTN_ 10 Transversion
MSTN_ 10. 439 chrl8 66493737 T C Intron 1 MSTN_ 10 Transition
MSTN_ 10. _447 chrl8 66493745 A G Intron 1 MSTN^ 10 Transition
MSTN_ 10. 477 chrl8 66493775 A G Intron 1 MSTN_ 10 Transition
MSTN_ 11 404 chrl8 66494218 A C Intron 1 MSTN_ 11 Transversion
Table 15: Genotyping results for MSTN SNPs
Figure imgf000043_0001
Table 16: Population summary including details of retrospective racecourse success for each cohort.
Figure imgf000043_0002
Figure imgf000044_0001
Table 17: a. Case-control association test results for a series of cohort comparisons for g.66493737C>T. TBE: elite Group race winning Thoroughbreds; TBO: other non-winning Thoroughbreds; TBE > 8 f, TBE < 8 f and TBE < 7 f : elite Group race winning Thoroughbreds that won their best (most valuable or highest grade) races over distances > 8 f, < 8 f and < 7 f. In each case the frequency of the g.66493737-T allele is given. Odds ratios were calculated for the two most significant results, b. Best-fit model results for g.66493737C>T association with elite Group race winning performance over distances < 7 f .
Figure imgf000044_0002
0 Table 18 Hardy- Weinberg equilibrium test results for locus g.66493737C>T.
Figure imgf000044_0003
MSTNSNP (MSTN 66493737 O1ZC) SNP)
This SNP is located on Chromosome 18 of Equus caballus at position 66,490,208-66,495,180 5 reverse strand of the Horse Genome Sequence (Equus caballus Version 2.0) which can be viewed at www.broad.mit.edu/mammals/horse/.
The horse genome EquCab2 assembly is a Whole Genome Shotgun (WGS) assembly at 6.79x and was released in September 2007. A female Thoroughbred named "Twilight" was selected as 0 the representative horse for genome sequencing. The project coordination and genome sequencing and assembly is provided by the Broad Institute. The N50 size is the length such that 50% of the assembled genome lies in blocks of the N50 size or longer. The N50 size of the contigs is 112.38 kb, and the total length of all contigs is 2.43 Gb. When the gaps between contigs in scaffolds are included, the total span of the assembly is 2.68 Gb. The horse EquCab2 was annotated using a standard Ensembl mammalian pipeline. Predictions from vertebrate mammals as well as horse proteins have been given priority over predictions from non- vertebrate mammals. The set of predictions was been compared to 1 : 1 homologues genes in human and mouse, and missing homologs in the horse annotation have been recovered using exonerate. Horse and human cDNAs have been used to add UTRs to protein based predictions. The final gene-set comprises 20,737 protein-coding genes, 2,863 identified as pseudogenes and 1,580 classified as retro-transposed genes.
Further details of the SNP are as follows: o SNP: MSTN_66493737 (T/C) P = 1.88E-05 OR = 4.54 o EquCab2.0 SNP ID: not detected in EquCab2.0 database. No report of SNP in on-line bioinformatics resources. o In house SNPJD: MSTN-10_439 o Genomic location of SNP: Intron 1 o Substitution type: Transition
The flanking sequence and SNP (bold and square brackets) is as follows: AGCTAAGCAAGTAATTAGCACAAAAATTTGAATGTTATATTCAGGCTATCTCAAAAG TTAGAAAATACTGTCTTTAGAGCCAGGCTGTCATTGTGAGCAAAATCACTAGCAATT TCTTTTATTTTGGTTCCCCAAGATTGTTTATAAATAAGGTAAATCTACTCCAGGACTA TTTGATAGCAGAGTCATAAAGGAAAATTA[TZC]TTGGTGCATTATAACCTGATTACTT AATAAGGAGAACAATATTTTGAAACTGTTGTGTCCTGTTTAAAGTAGATAAAGCACT GGGTAAAGCAGGATCGCAGACACATGGCACAGAATCTTCCGTGTCATGCCTTCTCTG TGAAGGTGTCTGTCTCCCTTTCCTTGAGTGTAGTTATGAACTGACTGCAAAAAGAAT ATATG
(SEQ ID No. 31)
Considering best race distance (BRD) as a quantitative trait, we analyzed the data for the elite cohort using the distance (furlongs) of the highest grade or most valuable Group race won as the phenotype (n = 79). BRD was highly significantly associated (P = 4.85 x 10"8) with the g.66493737OT SNP (Table 19). This result was independently validated (P = 0.0047) in a cohort of 37 elite racehorses (n = 27 Group race winners and n = 10 Listed race winners) produced by the same trainer. For each genotype we determined the mean BRD (Table 20): C/C mean = 6.2 ±0.8 f; C/T mean = 9.1 ±2.4 f; and T/T mean = 10.5 ± 2.7 f. A distribution of the genotypes in two furlong increments is shown in Figs 6A to 6. It is important to note that a bias may be introduced to these distances as two-year-old Group races are limited to < 8 f in Ireland and the United Kingdom (there are only three Group races for two-year-olds in Europe > 8 f). Therefore we replaced BRD for horses that had won their only Group race as two-year-olds with the average distance of their three-year-old races (n = 73), which resulted in a marginal increase in the means for the three genotypes (C/C mean = 6.4 ±1.0 f; C/T mean = 9.7 ±2.0 f; and T/T mean = 10.9 ±2.4 f) and an increase in the significance of association (P = 5.45 x 10"9) (Fig. 7).
Eight National Hunt (races over obstacles and distances 16 - 36 f) racehorses were also genotyped for the g.66493737C>T SNP and the results support an association of the T allele with stamina (T/T, n = 7; and C/T, n = 1). Also, the genotype frequencies among a non- Thoroughbred population known for endurance exercise capabilities (n = 31, Egyptian Arabian horse) were considerably different to the Thoroughbred population (Fig. 8). Together these findings indicate that the C/C genotype is particularly suited to sprint racing.
In Thoroughbred breeding considerable weight is given to the contribution of the sire in the predicted best race distance of offspring. For breeding stallions a 'Stamina Index' (S.I.) is estimated as the average winning distance of all racing progeny. Therefore we investigated the distribution of genotypes for the n = 19 unrelated breeding stallions with S.I. in our sample (Fig.
9). All (100%) stallions with S.I. = 6 - 8 f had the C/C genotype; 83.3% and 75% stallions with
S.I. = 9 - 10 f and 10 - 12 f respectively were C/T; and 25% stallions with S.I. = 10 - 12 f were T/T. While the sample size is small there is a clear indication that g.66493737C>T genotypes are predictive of S.I. in breeding stallions (Fig. 9).
These data indicate that genotypic information at this locus may have practical applications in the Thoroughbred horse racing and breeding industry. To evaluate this further, two-year-old racing form for n = 142 horses-in-training with the same trainer during 2007 and 2008 (n = 63, 2007; n = 79, 2008) (Table 20a) was investigated. Consistently, for each parameter of racing success, C/C and C/T genotypes were more successful two-year-old racehorses than T/T animals (Table 20b). In terms of earnings, the greatest returns on training investment were for animals that were C/C or C/T; on average these horses earned 5.5-fold more than T/T horses. Even when individuals that had won > Sterlingf 100,000 (US$165,000) were excluded, on average C/C individuals earned 1.6-fold more than T/T individuals. The bulk of keeping and training expenses are not returned in prize money (72% Ireland, 78% United Kingdom for horses that have run in at least one race) [International Federation of Horseracing Authorities, www.horseracingintfed.com]; therefore, employing a strategy to train and race only C/C and C/T individuals as two-year-olds may be beneficial.
To eliminate potential confounding effects of shared sires, the racing successes of 41 half-sibs (progeny of a single sire) [C/T, n = 22; T/T, n = 19] (Table 20c) that were trained by the same trainer as two-year-olds was investigated. A significant genotype association with racing performance (Pearson's chi-square test: χ2 = 7.235; df = 1; P = 0.0071) was identified; five of the progeny were two-year-old Group race winners and all displayed the C/T genotype.
In many instances the goal of breeders is to breed a Derby winner. The Derby distance (12 f) predicts that individuals must have at least one copy of the T allele at g.66493737C>T. There were n = 7 Derby winners in our sample: C/T n = 6; and T/T n = 1. Furthermore, n = 51 progeny from a highly successful commercial breeding stallion that had won both the Epsom Derby and the Irish Derby were genotyped and had a S.I. = 11.3 f. Among the progeny just two genotypes (n = 29, C/T; and n = 22, T/T) were identified suggesting that this individual (while not genotyped here) is T/T (both the sire and dam were genotyped: sire: T/T; dam: C/T). We estimated the mean BRD for the genotypes in n = 9 of the stallion's progeny that had won Group races, further reinforcing the g.66493737C>T genotype trend (C/T: n = 6, mean BRD = 8 f ; T/T: n = 3, mean BRD = 10.7 f).
Similar to their human counterparts, sprint racing Thoroughbreds are generally more compact and muscular than horses suited to longer distance races. Therefore, to investigate whether MSTN genotypes influence body mass, mass (kg) and height at withers (cm) measurements that were taken during two two-year-old racing seasons for n = 97 (n = 37 males, n = 60 females) horses-in-training with the same trainer were used. Mass to height ratio displayed a significant (P = 0.0147) relationship with g.66493737OT genotype (2.94 kg/cm, C/C; 2.88 kg/cm, C/T; and 2.83 kg/cm, T/T). This association became stronger when males were considered independently (P = 0.0025) of females (P = 0.2272) [Table 21]. On average C/C males had 6.7% (i.e. 3.033 kg/cm versus 2.843 kg/cm) greater mass per cm than TVT males.
Table 19: Quantitative trait association tests and best race distance (BRD) means for a. association test sample; b. association test sample using mean three year old distances as phenotype (for two-year-olds that won their best race < 8 f) ; and c. replication sample.
Figure imgf000048_0001
Table 20: Parameters of two-year-old racing (Ireland and United Kingdom) success for n = 142 horses-in-training with the same trainer during 2007 and 2008. a. Two year old horses-in-training 2007 & 2008; b. two year old horses- in-training 2007 & 2008 comparing C/C and C/T versus T/T genotypes; c. Half-sib two year old horses-in-training sharing a single sire.
Figure imgf000049_0001
Table 21 Quantitative association test results for g.66493737OT with kg/cm ratio as phenotype
Figure imgf000050_0001
Risk prediction
Based on subpopulation prediction using population observed genotype frequencies and Bayes Theorem the probability of being a member of one or other subpopulation (elite sprinter or elite 0 endurance or 'stayer') given a certain genotype at the MSTN gene was investigated. Results are give in Table 22 and are provided as a percentage chance of being a member of each of the two subpopulations.
Table 22 - Predictive test for Elite Sprint racing ability 5
Figure imgf000050_0002
Figure imgf000051_0001
In which AA represents genotype TT, AB represents genotype CT, and BB represents genotype CC
From Table 22 it can be seen that subjects with the genotype CC in MSTN_66493737 (T/C) SNP have the greatest chance of being sprinters given that they are elite Thoroughbreds.
MSTN gene expression
MSTN mRNA expression in two independent real-time qRT-PCR assays (Table 23) has been investigated in resting skeletal muscle (gluteus medius) from biopsy samples that had been collected for n = 60 untrained yearlings (C/C, « = 15; C/T, n = 28; T/T, n = 17).
Table 23: Primer sequences for qRT-PCR assays for MSTN gene expression and TTN reference gene expression
Primer Name Target Gene Location Sequence
TTN_FOR Titin (TTN) Exon 357 gcatgacacaactggaaagc (SEQ ID No. 38)
TTN_REV Titin (TTN) Exon 357 aactttgccctcatcaatgc (SEQ ID No. 39)
MSTNl -2_FOR Myostatin (MSTN) Exon 1 tgacagcagtgatggctctt (SEQ ID No. 40)
MSTN1-2_REV Myostatin (MSTN) Exon 2 ttgggttttccttccacttg (SEQ ID No. 41)
MSTN2-3_FOR Myostatin (MSTN) Exon 2 ttcccaagaccaggagaaga (SEQ ID No. 42)
MSTN2-3 REV Myostatin (MSTN) Exon 3 cagcatcgagattctgtgga (SEQ ID No. 43)
We found a significant association with genotype for the MSTN 66493737 (T/C) SNP (P = 0.003559). The C/C genotype cohort had higher MSTN mRNA levels (654.3 ±354.3; 613.7 ±327.0) than either of the C/T (405.7 ± 234.1; 368.6 ± 213.6) and T/T (350.1 ± 185.5; 348.1 ± 167.2) cohorts (Fig. 10).
It was also found that MSTN gene expression is significantly down-regulated (-4.2-fold, P = 0.0043) following a period of training. In the Thoroughbred horse skeletal muscle transcriptome the greatest reduction in gene expression following a period of training is MSTN gene expression.
Quantitative association with best race distance It was examined whether there was a significant relationship between SNPs in the examined genes and best race distance (i.e. distance of the highest quality / most valuable Group race won) in a quantitative association test analysis using the subset of individuals that had won a Group race (i.e. TBE n = 86). Table 24 below shows the SNPs significantly associated with best race distance.
Table 24 - SNPs associated with best race distance
Figure imgf000052_0001
Table 25 below shows the mean best race distance for each genotype for four of the SNPs from Table 24 above.
Table 25 - Mean best race distance for each genotype
Figure imgf000052_0002
Figure imgf000053_0001
Wherein, at MSTN_66493737-(T/C) the TT genotype has a mean best race distance of 10.54 furlongs (f), the TC genotype has a mean best race distance of 9.087 f and the CC genotype has a mean best race distance of 6.167 f. Overall the mean best race distance was 8.55 f.
There are many practical applications for the genotypic test based on the MSTN genotype. These include:
1. Young stock (foals and yearlings) Informed selection and sales decisions can be made to:
• identify sprinters
• identify middle-distance / potential Derby winners with speed
• identify individuals with enhanced stamina
2. Horses-in-training
Operating costs can be reduced and racing strategy can be fine tuned by:
• identifying the most precocious two-year olds
• horses can be trained and raced for optimal racing distance
3. Broodmares
Breeding outcomes can be optimised by:
• focusing on optimal breeding mares
• selecting compatible stallions
4. Stallions
A stallions potential can be promoted by:
• predicting stamina index for young stallions (5 year advantage) • attracting compatible mares to enhance stallion profile
For example, for the MSTN-66493737 TIC SNP for foals, young stock and horses-in-training selection of individuals may be made for individuals most likely to perform well as two year olds (C/C and C/T) and against 'backward' individuals (industry terminology for less physically developed young Thoroughbreds) that may benefit from waiting to race until they are three years old (T/T). Breeding objectives may be more confidently met by selecting C/C individuals for short distance racing, C/T individuals for middle-distance racing and T/T individuals for racing requiring greater stamina. For stallion owners, prediction of a stallion's genetic stamina index at the outset of a stud career (five years are required to estimate S.I. from retrospective three year old progeny racing performance) will immediately enhance a young stallion's profile and promote their genetic potential to mare owners. This in turn will enable mare owners, with targeted breeding strategies, to better select stallions to achieve specific breeding objectives. To eliminate uncertainty from a mating outcome (unless both sire and dam are homozygous) it will be necessary to genotype the foal, enabling selection of individuals for a targeted breeding outcome.
Example 6 - Detecting SNPs SNPs may be determined by any SNP genotyping method including for example the following non limiting methods:
Sequenom Inc
The iPLEX® Gold assay based on multiplex PCR followed by a single base primer extension reaction. After the PCR, remaining nucleotides are deactivated by SAP treatment. The single base primer extension step is performed, and the primer extension products analyzed using MALDI TOF MS.
KBiosciences KBiosciences uses both its own novel form of competitive allele specific PCR system (KASPar) and Taqman™ chemistries for genotyping. KASPar assays are a proprietary in-house system developed to replace the previously used Amplifluor system.
Taaman assays TaqMan® SNP Genotyping Assays make it easy to perform SNP genotyping with the precision of TaqMan® reagent-based chemistry. TaqMan® Assays provide SNP detection capabilities. Also, the TaqMan® Sample-to-SNP™ Kit provides a streamlined protocol for performing TaqMan chemistry-based genotyping analysis from any sample with a single kit. The kit is comprised of two parts: the DNA Extract All Lysis Reagents and the TaqMan® GTXpress™ Master Mix. The DNA Extract All Lysis Reagents reduce prolonged procedures for the release of real-time PCR-ready DNA to a 5 minute protocol. They can process a wide variety of samples ranging from blood to buccal swabs. The TaqMan GTXpress Master Mix enables robust PCR amplification in less than 50 minutes.
Industrial application
The predictive tests described herein may be applied to select individuals with high or low genetic potential for racing success. These tests can be performed on an individual at any stage in the life cycle e.g. Day 1 (birth), prior to sales (i.e. yearlings, 2 year olds etc), during racing career (i.e. from 2 years old), during breeding (i.e. up to approx 25 years). Also, the tests may be applied to select appropriate stallion - mare matches for mating based on the genetic make-up of mare and stallion.
The invention is not limited to the embodiment hereinbefore described, with reference to the accompanying drawings, which may be varied in construction and detail.
References
Ballard J. W. & Dean M.D. (2001) The mitochondrial genome: mutation, selection and recombination. Curr Opin Genet Dev 11, 667-72.
Blier P.U., Dufresne F. & Burton R.S. (2001) Natural selection and the evolution of mtDNA- encoded peptides: evidence for intergenomic co-adaptation. Trends Genet 17, 400-6.
Bray MS, Hagberg JM, Perusse L, Rankinen T, Roth SM, Wolfarth B, Bouchard C. The human gene map for performance and health-related fitness phenotypes: the 2006-2007 update. Med Sci Sports Exerc. 2009 Jan;41(l):35-73.
Cunningham EP, Dooley JJ, Splan RK, Bradley DG. Microsatellite diversity, pedigree relatedness and the contributions of founder lineages to Thoroughbred horses. Anim Genet. 2001 Dec;32(6):360-4.
Das J. (2006) The role of mitochondrial respiration in physiological and evolutionary adaptation. Bioessays 28, 890-901.
Dempsey and Wagner 1999 Exercise-induced arterial hypoxemia. J Appl Physiol. 1999 Dec;87(6): 1997-2006. Review.PMID: 10601141
Suzanne S. Eivers, Beatrice A. McGivney, Rita G. Fonseca, David E. MacHugh, Katie Menson, Stephen D. Park, Jose-Luis L. Rivero, Cormac T. Taylor, Lisa M. Katz and Emmeline W. Hill* Exercise-induced skeletal muscle gene expression in unconditioned and conditioned Thoroughbred horses and associations with physiological variables. Physiological Genomics, In Preparation (2009)
Martin Fluck 2006 Functional, structural and molecular plasticity of mammalian skeletal muscle in response to exercise stimuli. The Journal of Experimental Biology 209, 2239-2248 Fukuda R, Zhang H, Kim JW, Shimoda L, Dang CV, Semenza GL.HIF-1 regulates cytochrome oxidase subunits to optimize efficiency of respiration in hypoxic cells.Cell. 2007 Apr 6;129(1):111-22.
Gordon D, Abajian C, Green P. Consed: a graphical tool for sequence finishing. Genome Res. 1998 Mar;8(3): 195-202.
Gramkow and Evans 2006 Gramkow HL, Evans DL. Correlation of race earnings with velocity at maximal heart rate during a field exercise test in Thoroughbred racehorses.Equine Vet J Suppl. 2006 Aug;(36): 118-22. PMID: 17402405
Gu J, Orr N, Park SD, Katz LM, Sulimova G, MacHugh DE, Hill EW. A genome scan for positive selection in thoroughbred horses. PLoS One. 2009 Jun 2;4(6):e5767.
Gunn HM. Muscle, bone and fat proportions and muscle distribution of thoroughbreds and quarter horses. In: Gillespie JR, Robinson NE eds. Equine exercise physiology 2. Davis, CA: ICEEP; 1987:253-264.
Harkins et al., 1993 Harkins JD, Hackett RP, Ducharme NG.Effect of furosemide on physiologic variables in exercising horses. Am J Vet Res. 1993 Dec;54(12):2104-9.PMID: 8116946
Hoppeler and Vogt, 2001 Muscle tissue adaptations to hypoxia. J Exp Biol. 2001 Sep;204(Pt 18):3133-9. Review.PMID: 1 1581327
Love S, Wyse CA, Stirk AJ, Stear MJ, Calver P, Voute LC, Mellor DJ. Prevalence, heritability and significance of musculoskeletal conformational traits in Thoroughbred yearlings. Equine Vet J. 2006 Nov;38(7):597-603.PMID: 17228572
Matoba S, Kang JG, Patino WD, Wragg A, Boehm M, Gavrilova O, Hurley PJ, Bunz F, Hwang PM. p53 regulates mitochondrial respiration. Science. 2006 Jun 16;312(5780): 1650-3. Epub 2006 May 25.
Meiklejohn CD., Montooth K.L. & Rand D. M. (2007) Positive and negative selection on the mitochondrial genome. Trends Genet 23, 259-63. Mosher DS, Quignon P, Bustamante CD, Sutter NB, Mellersh CS, Parker HG, Ostrander EA. A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLoS Genet. 2007 May 25;3(5):e79. Epub 2007 Apr 30
Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MAR, Bender D, Mailer J, Sklar P, de Bakker PIW, Daly MJ & Sham PC (2007) PLINK: a toolset for whole-genome association and population-based linkage analysis. American Journal of Human Genetics, 81.
Revington M. Haematology of the racing Thoroughbred in Australia 2: haematological values compared to performance.Equine Vet J. 1983 Apr;15(2):145-8.PMID: 6873047
Rivero JL, Ruz A, Marti-Korff S, Estepa JC, Aguilera-Tejero E, Werkman J, Sobotta M, Lindner
A. Effects of intensity and duration of exercise on muscular responses to training of Thoroughbred racehorses.J Appl Physiol. 2007 May;102(5):1871-82. Epub 2007 Jan 25.PMID:
17255370
Saleem A, Adhihetty PJ, Hood DA. Role of p53 in mitochondrial biogenesis and apoptosis in skeletal muscle. Physiol Genomics. 2009 Mar 3;37(l):58-66. Epub 2008 Dec 23.Links
Sambrook, J. and D. Russell (2001). Molecular Cloning; A Laboratory Manual, Cold Spring Harbor Laboratory.
Seaman J, Erickson BK, Kubo K, Hiraga A, Kai M, Yamaya Y, Wagner PD. Exercise induced ventilation/perfusion inequality in the horse.Equine Vet J. 1995 Mar;27(2):104-9.PMID: 7607141
Taylor CT, Colgan SP. Therapeutic targets for hypoxia-elicited pathways.Pharm Res. 1999 Oct;16(10): 1498-505. Review. PMID: 10554089
van Deursen et al. 1993 Skeletal muslces of mice deficient in muscle creatine kinase lack burst activity Cell 74: 621-631 Weber K, Briick P, Mikes Z, Kϋpper JH, Klingenspor M, Wiesner RJ. Glucocorticoid hormone stimulates mitochondrial biogenesis specifically in skeletal muscle. Endocrinology. 2002 Jan; 143(1): 177-84.
Yang Q, Khoury MJ, Botto L, Friedman JM, Flanders WD. Improving the prediction of complex diseases by testing for multiple disease-susceptibility genes. Am J Hum Genet. 2003 Mar;72(3):636-49. Epub 2003 Feb 14.
Young LE, Rogers K, Wood JL. Left ventricular size and systolic function in Thoroughbred racehorses and their relationships to race performance. J Appl Physiol. 2005 Oct;99(4): 1278-85. Epub 2005 May 26.PMID: 15920096
Appendix I: TBE (Elite) V TBO (non-winner) association test. SNPs raked by P value
Figure imgf000060_0001
Figure imgf000061_0001
Figure imgf000062_0001
Figure imgf000063_0001
Figure imgf000064_0001
Appendix II: TBE SP (elite sprinter) V TBE EN (elite stayer) association test. SNPs raked by P value
Figure imgf000065_0001
Figure imgf000066_0001
Figure imgf000067_0001
Figure imgf000068_0001
Figure imgf000069_0001
Appendix III; Significant associations between SNP and phenotype TBE - elite (Group race winning) Thoroughbred TBO - other (non-winning) Thoroughbred
TBE SP8 - elite (Group race winning) Thoroughbred that won best race over a distance <8f TBE SP7 - elite (Group race winning) Thoroughbred that won best race over a distance <7f TBE EN- elite (Group race winning) Thoroughbred that won best race over a distance >8f SNPs are given by GeneSymbol chromosomeposition(bp)
Figure imgf000070_0001
Appendix IV: Case control association test and best fit model for significantly associated SNPs
TBE V TBO (Case - control association test) P < 0.05
Figure imgf000071_0001
TBE V TBO Best-fit Model for significantly associated SNPs
Figure imgf000071_0002
Figure imgf000072_0001
Figure imgf000073_0001
TBE SP7 V TBE EN (Case - control association test) P < 0.05
Figure imgf000073_0002
TBE SP7 V TB EN Best-fit Model for significantly associated SNPs
Figure imgf000073_0003
Figure imgf000074_0001
TBE Best Race Distance Quantitative Trait Association
Figure imgf000074_0002
TBE Best Race Distance Means (where distances are furlongs) for significantly associated SNPs
Figure imgf000074_0003
Figure imgf000075_0001
Figure imgf000076_0001
Racing Post Handicap Rating (Best RPR) Quantitative Trait Association
Figure imgf000076_0002
Racing Post Handicap Rating (Best RPR) Means for significantly associated SNPs
Figure imgf000076_0003

Claims

Claims
1. A method for predicting the athletic performance potential of a subject comprising the step of assaying a biological sample from a subject for the presence of a single nucleotide polymorphism (SNP) in one or more of the MSTN gene, COX4I2 gene, PDK4 gene, CKM gene, or COX4I1 gene.
2. A method as claimed in claim 1 wherein the SNP is MSTN 66493737 (TIC).
3. A method as claimed in claim 2 wherein the presence of a C allele is indicative of elite athletic performance.
4. A method as claimed in claim 2 or 3 wherein the presence of a homozygous CC genotype is indicative of elite athletic performance.
5. A method as claimed in any of claims 2 to 4 wherein the elite athletic performance is elite sprinting performance
6. A method as claimed in any of claims 1 to 5 wherein the SNP is COX4I2 22684390 (C/T).
7. A method as claimed in claim 6 wherein the presence of a T allele is indicative of elite athletic performance.
8. A method as claimed in claim 6 or 7 wherein the presence of a homozygous TT genotype is indicative of elite athletic performance.
9. A method as claimed in any of claims 1 to 8 wherein the SNP is PDK4 38973231 (AJG).
10. A method as claimed in claim 9 wherein the presence of an A allele is indicative of elite athletic performance.
11. A method as claimed in claim 9 or 10 wherein the presence of a homozygous AA genotype is indicative of elite athletic performance.
12. A method as claimed in any of claims 1 tol 1 wherein the SNP is CKM 15884567 (G/A).
13. A method as claimed in claim 12 wherein the presence of an A allele is indicative of elite athletic performance.
14. A method as claimed in claim 12 or 13 wherein the presence of a homozygous AA genotype is indicative of elite athletic performance.
15. A method as claimed in any of claims 1 to 14 wherein the SNP is COX4I1 32772871 (T/C).
16. A method as claimed in claim 15 wherein the presence of a T allele is indicative of elite athletic performance.
17. A method as claimed in claim 15 or 16 wherein the presence of a homozygous TT genotype is indicative of elite athletic performance.
18. A method as claimed in any one of claims 1 to 17 wherein the biological sample of the subject is selected from the group comprising: blood, saliva, skeletal muscle, hair, semen, bone marrow, soft tissue, internal organ biopsy sample and skin.
19. A method as claimed in any one of claims 1 to 18 wherein the subject is from a competitive racing species.
20. A method as claimed in any one of claims 1 to 19 wherein the subject is an equine.
21. A method as claimed in any one of claims 1 to 20 wherein the subject is a Thoroughbred race horse.
22. An assay for determining the athletic performance potential of a subject comprising the steps of: obtaining a sample; - extracting or releasing DNA from the sample; and - identifying a single nucleotide polymorphism (SNP) target sequence from a gene associated with athletic performance in the extracted or released DNA
wherein the athletic performance potential of a subject is associated with the SNP.
23. An assay as claimed in claim 22 wherein the gene associated with athletic performance is selected from one or more of MSTN, COX4I2, PDK4, CKM or COX4I1.
24. An assay as claimed in claim 22 or 23 comprising the step of: - amplifying a target sequence from a gene associated with athletic performance in the extracted or released DNA
prior to the step of identifying a single nucleotide polymorphism.
25. An assay as claimed in any of claims 22 to 24 wherein the DNA is genomic DNA.
26. An assay for use in determining the athletic performance potential of a subject comprising means for detecting the presence of a single nucleotide polymorphism (SNP) in one or more of the MSTN gene, COX4I2 gene, PDK4 gene, CKM gene, or COX4I1 gene.
27. An assay as claimed in any of claims 22 to 26 wherein the SNP is MSTN 66493737 (T/C).
28. An assay as claimed in claim 27 wherein the presence of a C allele is indicative of elite athletic performance.
29. An assay as claimed in claim 27 or 28 wherein the presence of a homozygous CC genotype is indicative of elite athletic performance.
30. An assay as claimed in any of claims 27 to 29 wherein the elite athletic performance is elite sprinting performance
31. An assay as claimed in any of claims 22 to 30 wherein the SNP is COX4I2 22684390
(C/T).
32. An assay as claimed in claim 31 wherein the presence of a T allele is indicative of elite athletic performance.
33. An assay as claimed in claim 31 or 32 wherein the presence of a homozygous TT genotype is indicative of elite athletic performance.
34. An assay as claimed in any of claims 22 to 33 wherein the SNP is PDK4 38973231 (A/G).
35. An assay as claimed in claim 34 wherein the presence of an A allele is indicative of elite athletic performance.
36. An assay as claimed in claim 34 or 35 wherein the presence of a homozygous AA genotype is indicative of elite athletic performance.
37. An assay as claimed in any of claims 22 to 36 wherein the SNP is CKM l 5884567 (G/A).
38. An assay as claimed in claim 37 wherein the presence of an A allele is indicative of elite athletic performance.
39. An assay as claimed in claim 37 or 38 wherein the presence of a homozygous AA genotype is indicative of elite athletic performance.
40. An assay as claimed in any of claims 22 to 39 wherein the SNP is COX4I1 32772871 (T/C).
41. An assay as claimed in claim 40 wherein the presence of a T allele is indicative of elite athletic performance.
42. An assay as claimed in claim 41 or 42 wherein the presence of a homozygous TT genotype is indicative of elite athletic performance.
43. An assay for determining the athletic potential of a subject comprising the step of: - obtaining a sample; extracting or releasing DNA from the sample; and
- identifying the genotype of the MSTN 66493737 (T/C) SNP in the extracted or released DNA •
wherein the presence of a C allele in the MSTN_66493737 (T/C) SNP is indicative of elite athletic performance.
44. An assay as claimed in claim 43 comprising the step of:
- amplifying a target sequence encoding the MSTN 66493737 (T/C) SNP in the extracted or released DNA
prior to the step of identifying the genotype of the MSTN 66493737 (T/C) SNP.
45. An assay as claimed in claim 43 or 44 wherein the presence of a homozygous CC genotype is indicative of elite athletic performance.
46. An assay as claimed in any of claims 43 to 45 wherein the elite athletic performance is elite sprinting performance.
47. An assay as claimed in any of claims 43 to 46 wherein the DNA is genomic DNA.
48. An assay as claimed in any one of claims 22 to 47 wherein the subject is from a competitive racing species.
49. An assay as claimed in any one of claims 22 to 48 wherein the subject is an equine.
50. An assay as claimed in any one of claims 22 to 49 wherein the subject is a Thoroughbred race horse.
PCT/IE2009/000062 2008-09-11 2009-09-11 A method for predicting athletic performance potential Ceased WO2010029527A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
JP2011526627A JP5667057B2 (en) 2008-09-11 2009-09-11 Methods for predicting potential competitive performance
AU2009290452A AU2009290452B2 (en) 2008-09-11 2009-09-11 A method for predicting athletic performance potential
US13/063,715 US8771943B2 (en) 2008-09-11 2009-09-11 Method for predicting athletic performance potential
NZ591711A NZ591711A (en) 2008-09-11 2009-09-11 A method for predicting athletic performance potential
EP09787418.4A EP2352850B1 (en) 2008-09-11 2009-09-11 A method for predicting athletic performance potential
US13/046,432 US20110262915A1 (en) 2008-09-11 2011-03-11 Method for predicting the athletic performance potential of a subject
US14/175,696 US9249470B2 (en) 2008-09-11 2014-02-07 Method for predicting the athletic performance potential of a subject
US14/951,183 US20160215335A1 (en) 2008-09-11 2015-11-24 Method for predicting the athletic performance potential of a subject
US16/552,545 US20200115751A1 (en) 2008-09-11 2019-08-27 Method for predicting the athletic performance potential of a subject

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US13653308P 2008-09-11 2008-09-11
US61/136,533 2008-09-11
US21312509P 2009-05-08 2009-05-08
US61/213,125 2009-05-08

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/063,715 A-371-Of-International US8771943B2 (en) 2008-09-11 2009-09-11 Method for predicting athletic performance potential
US13/046,432 Continuation-In-Part US20110262915A1 (en) 2008-09-11 2011-03-11 Method for predicting the athletic performance potential of a subject

Publications (1)

Publication Number Publication Date
WO2010029527A1 true WO2010029527A1 (en) 2010-03-18

Family

ID=41336086

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IE2009/000062 Ceased WO2010029527A1 (en) 2008-09-11 2009-09-11 A method for predicting athletic performance potential

Country Status (7)

Country Link
US (1) US8771943B2 (en)
EP (1) EP2352850B1 (en)
JP (1) JP5667057B2 (en)
AU (1) AU2009290452B2 (en)
NZ (1) NZ591711A (en)
PT (1) PT2352850E (en)
WO (1) WO2010029527A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101887046A (en) * 2010-07-19 2010-11-17 高常青 Human serum myostatin detection method applied to screening athletes
WO2012150905A1 (en) * 2011-05-05 2012-11-08 Capilet Genetics Ab A method to predict the pattern of locomotion in horses
CN111979338A (en) * 2020-09-02 2020-11-24 刘学峰 Molecular biological method for breeding high-quality mutton sheep

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110262915A1 (en) * 2008-09-11 2011-10-27 Emmeline Hill Method for predicting the athletic performance potential of a subject
WO2016022614A1 (en) * 2014-08-04 2016-02-11 Lafayette Christa Method for evaluating health and genetic predisposition of animals
CN112176069B (en) * 2019-07-04 2023-07-04 深圳华大法医科技有限公司 Amplification system, primer, kit and application thereof for typing of Haemophilus parasuis and typing method
WO2021171591A1 (en) * 2020-02-28 2021-09-02 裕造 園生 Information processing method, information processing device, and program
US20240043926A1 (en) 2021-03-19 2024-02-08 The Regents Of The University Of California Biomarkers for conformation of riding traits in horses
EP4286534A1 (en) * 2022-05-31 2023-12-06 Plusvital Ltd. A method of determining the likelihood of a horse to race
CN115985459B (en) * 2022-11-22 2026-04-03 北京体育大学 A genome-wide method and device for predicting the effects of exercise on cardiorespiratory endurance.
JP7446402B1 (en) * 2022-12-23 2024-03-08 楽天グループ株式会社 Rating usage system, rating usage method, and rating usage program

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006003436A1 (en) 2004-07-02 2006-01-12 Thoroughbred Genetics Ltd Genetic analysis in racing animals
WO2008034177A1 (en) 2006-09-18 2008-03-27 The University Of Sydney Equine performance test
US20080187928A1 (en) * 2006-12-29 2008-08-07 The Salk Institute For Biological Studies Methods for enhancing exercise performance

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030092019A1 (en) * 2001-01-09 2003-05-15 Millennium Pharmaceuticals, Inc. Methods and compositions for diagnosing and treating neuropsychiatric disorders such as schizophrenia
US20110262915A1 (en) 2008-09-11 2011-10-27 Emmeline Hill Method for predicting the athletic performance potential of a subject

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006003436A1 (en) 2004-07-02 2006-01-12 Thoroughbred Genetics Ltd Genetic analysis in racing animals
WO2008034177A1 (en) 2006-09-18 2008-03-27 The University Of Sydney Equine performance test
US20080187928A1 (en) * 2006-12-29 2008-08-07 The Salk Institute For Biological Studies Methods for enhancing exercise performance

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
BURGOMASTER KIRSTEN A ET AL: "Divergent response of metabolite transport proteins in human skeletal muscle after sprint interval training and detraining.", AMERICAN JOURNAL OF PHYSIOLOGY. REGULATORY, INTEGRATIVE AND COMPARATIVE PHYSIOLOGY MAY 2007, vol. 292, no. 5, May 2007 (2007-05-01), pages R1970 - R1976, XP002558303, ISSN: 0363-6119 *
DANIEL G MACARTHUR ET AL: "Genes and human elite athletic performance", HUMAN GENETICS, SPRINGER, BERLIN, DE, vol. 116, no. 5, 1 April 2005 (2005-04-01), pages 331 - 339, XP019346093, ISSN: 1432-1203 *
DATABASE EMBL [online] 14 November 2006 (2006-11-14), XP002558308, retrieved from WWW.EBI.AC.UK Database accession no. AY840554 *
DATABASE SNP DB [online] NCBI; 12 August 2008 (2008-08-12), XP002558304, retrieved from WWW.NCBI.NLM.NIH.GOV Database accession no. rs69276449 *
DATABASE SNP DB [online] NCBI; 12 August 2008 (2008-08-12), XP002558305, retrieved from WWW.NCBI.NLM.NIH.GOV Database accession no. rs68819557 *
DATABASE SNP DB [online] NCBI; 12 August 2008 (2008-08-12), XP002558306, retrieved from WWW.NCBI.NLM.NIH.GOV Database accession no. rs69586789 *
DATABASE SNP DB [online] NCBI; 12 August 2008 (2008-08-12), XP002558307, retrieved from WWW.NCBI.NLM.NIH.GOV Database accession no. rs68518550 *
MOSHER DANA S ET AL: "A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs.", PLOS GENETICS 25 MAY 2007, vol. 3, no. 5, 25 May 2007 (2007-05-25), pages E79, XP002558302, ISSN: 1553-7404 *
PARK H B ET AL: "Molecular characterization and mutational screening of the PRKAG3 gene in the horse", CYTOGENETIC AND GENOME RESEARCH, ALLERTON PRESS, NEW YORK, NY, US, vol. 102, no. 1-4, 1 January 2003 (2003-01-01), pages 211 - 216, XP008053914, ISSN: 1424-8581 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101887046A (en) * 2010-07-19 2010-11-17 高常青 Human serum myostatin detection method applied to screening athletes
WO2012150905A1 (en) * 2011-05-05 2012-11-08 Capilet Genetics Ab A method to predict the pattern of locomotion in horses
EA027258B1 (en) * 2011-05-05 2017-07-31 Капилет Джинетикс Аб Method fo predicting the pattern of locomotion in a horse and use of said method for selection of a horse for breeding
US10378057B2 (en) 2011-05-05 2019-08-13 Capilet Genetics Ab Method to predict the pattern of locomotion in horses
CN111979338A (en) * 2020-09-02 2020-11-24 刘学峰 Molecular biological method for breeding high-quality mutton sheep

Also Published As

Publication number Publication date
JP2012501671A (en) 2012-01-26
PT2352850E (en) 2014-06-25
US20110223600A1 (en) 2011-09-15
AU2009290452A1 (en) 2010-03-18
AU2009290452B2 (en) 2015-01-29
EP2352850A1 (en) 2011-08-10
US8771943B2 (en) 2014-07-08
EP2352850B1 (en) 2014-03-19
JP5667057B2 (en) 2015-02-12
NZ591711A (en) 2012-11-30

Similar Documents

Publication Publication Date Title
AU2009290452B2 (en) A method for predicting athletic performance potential
Hill et al. Targets of selection in the Thoroughbred genome contain exercise‐relevant gene SNPs associated with elite racecourse performance
Metzger et al. Expression levels of LCORL are associated with body size in horses
US20200115751A1 (en) Method for predicting the athletic performance potential of a subject
Tozaki et al. A genome‐wide association study for racing performances in Thoroughbreds clarifies a candidate region near the MSTN gene
Hill et al. A sequence polymorphism in MSTN predicts sprinting ability and racing stamina in thoroughbred horses
Gu et al. Association of sequence variants in CKM (creatine kinase, muscle) and COX4I2 (cytochrome c oxidase, subunit 4, isoform 2) genes with racing performance in Thoroughbred horses
Schröder et al. A genome‐wide association study for quantitative trait loci of show‐jumping in Hanoverian warmblood horses
Hill et al. The contribution of myostatin (MSTN) and additional modifying genetic loci to race distance aptitude in Thoroughbred horses racing in different geographic regions
Lee et al. Use of a bovine genome array to identify new biological pathways for beef marbling in Hanwoo (Korean Cattle)
Proskura et al. Single nucleotide polymorphism in the LDHA gene as a potential marker for the racing performance of pigeons
Tozaki et al. A cohort study of racing performance in Japanese Thoroughbred racehorses using genome information on ECA18
CN115261485B (en) A molecular marker related to residual feed intake of local chickens and its application
US20030129630A1 (en) Genetic markers associated with desirable and undesirable traits in horses, methods of identifying and using such markers
Fernández et al. Copy number variants in a highly inbred I berian porcine strain
Farries et al. Analysis of genetic variation contributing to measured speed in Thoroughbreds identifies genomic regions involved in the transcriptional response to exercise
Shin et al. Multiple genes related to muscle identified through a joint analysis of a two-stage genome-wide association study for racing performance of 1,156 Thoroughbreds
Xu et al. Identification of single nucleotide polymorphisms (SNPs) associated with heat stress and milk production traits in Chinese holstein cows
Ropka-Molik et al. The use of the SLC16A1 gene as a potential marker to predict race performance in Arabian horses
Barrey Reviewe: Genetics and genomics in equine exercise physiology: an overview of the new applications of molecular biology as positive and negative markers of performance and health
IE20090696A1 (en) A method for predicting the athletic performance potential of a subject
Negro et al. Molecular diversity between two cohorts of six Spanish riding-horse breeds: impact of selection in Crossbred vs Purebred populations
Mengistie Origin of cattle breeds in East Africa and introduction to general breeding science: A–review
Schröder Athletic performance and conformation in Hanoverian warmblood horses-population genetic and genome-wide association analyses
US20240043926A1 (en) Biomarkers for conformation of riding traits in horses

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09787418

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2011526627

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2009290452

Country of ref document: AU

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 591711

Country of ref document: NZ

ENP Entry into the national phase

Ref document number: 2009290452

Country of ref document: AU

Date of ref document: 20090911

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2009787418

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 13063715

Country of ref document: US