WO2010020638A1

WO2010020638A1 - Polypeptides having xylanase activity and polynucleotides encoding same

Info

Publication number: WO2010020638A1
Application number: PCT/EP2009/060667
Authority: WO
Inventors: Tine Hoff; Carsten Sjoeholm; Kristian B. R. M. Krogh; Björn L. P. A. CASSLAND
Original assignee: Novozymes A/S
Priority date: 2008-08-18
Filing date: 2009-08-18
Publication date: 2010-02-25

Abstract

The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

Description

POLYPEPTIDES HAVING XYLANASE ACTIVITY AND POLYNUCLEOTIDES

ENCODING SAME

BACKGROUND OF THE INVENTION [0001] Xylan, a major component of plant hemicellulose, is a polymer of D-xylose linked by β-1, 4-xylosidic bonds. Xylan can be degraded to xylose and xylo-oligomers by acid or enzymatic hydrolysis. Enzymatic hydrolysis of xylan produces free sugars without the by-products formed with acid (e.g., furans) . [0002] Enzymes capable of degrading xylan and other plant cell wall polysaccharides are important for the food industry, primarily for baking and in fruit and vegetable processing such as fruit juice production or wine making, where their ability to catalyse the degradation of the backbone or side chains of the plant cell wall polysaccharide is utilized (Visser et al . , Xylans and Xylanases, Proceedings of an International Symposium, Wageningen, The Netherlands, Elsevier Science Publishers, 1992) . [0003] Other applications for xylanases are enzymatic breakdown of agricultural wastes for production of alcohol fuels, enzymatic treatment of animal feeds for hydrolysis of pentosans, manufacturing of dissolving pulps yielding cellulose, and bio-bleaching of wood pulp [Detroym R. W. In: Organic Chemicals from Biomass (CRC Press, Boca Raton, FIa., 1981) ; 19-41; Paice and Jurasek, J. Wood Chem. Technol. 4: 187-198; Pommier and Fuentes, 1989, Tappi Journal 187-191; Senior et al., 1988, Biotechnol. Letters 10: 907-9121] .

[0004] WO 92/17573 discloses a substantially pure xylanase derived from Humicola insolens and recombinant DNA encoding said xylanase for as a baking agent, a feed additive, and in the preparation of paper and pulp.

[0005] WO 92/01793 discloses a xylanase derived from Aspergillus tubigensis . It is mentioned, but not shown that related xylanases may be derived from other filamentous fungi, examples of which are Aspergillus, Disporotrichum, Penicillium, Neurospora, Fusarium and Trichoderma. The xylanases are stated to be useful in the preparation of bread or animal feed, in brewing and in reducing viscosity or improving filterability of cereal starch.

[0006] Shei et al . , 1985, Biotech, and Bioeng. Vol. XXVII, pp. 533-538, and Fournier et al., 1985, Biotech, and Bioeng. Vol. XXVII, pp. 539-546, describe purification and characterization of endoxylanases isolated from Aspergillus niger.

[0007] WO 91/19782 and EP 463 706 discloses xylanase derived from Aspergillus niger origin and the recombinant production thereof for use in baking, brewing, paper-making, and treatment of agricultural waste.

[0008] WO 03/012071 discloses nucleotide sequences of Aspergillus fumigatus xylanases. [0009] U.S. Patent Application Publication 2005/021548 teaches xylanases derived from Aspergillus fumigatus origin.

[0010] U.S. Patent Application Publication 2007/0224325 teaches xylanases derived from Paenibacillus pabuli origin. SUMMARY OF THE INVENTION [0011] One aspect of the present invention is directed to an isolated polypeptide having xylanase activity, selected from the group consisting of: (a) a polypeptide comprising an amino acid sequence having at least 93% identity to the mature polypeptide of SEQ ID NO:2; (b) a polypeptide encoded by a polynucleotide that hydridizes under high stringency conditions with (i) SEQ ID NO:1 or the mature polypeptide coding sequence thereof, (ii) the cDNA sequence contained in the mature polypeptide coding sequence of SEQ ID NO:1, or (iii) a full-length complementary strand of (i) or (ii) ; (c) a polynucleotide encoding a polypeptide having at least 93% identity to the mature polypeptide coding sequence of SEQ ID NO:2; and (d) a variant comprising a substitution, deletion and/or insertion of one or more amino acids of the mature polypeptide of SEQ ID NO: 2, wherein said variant has at least 93% sequence identity to the mature polypeptide sequence of SEQ ID NO: 2. [0012] Another aspect of the present invention is directed to a polynucleotide encoding the inventive polypeptides, and nucleic acid constructs, recombinant expression vectors, recombinant non-human hosts and methods of producing the polypeptides using the polynucleotides.

[0013] Further aspects of the present invention are directed to compositions for using the polypeptides in treating/bleaching pulp, producing xylose or xylo-oligosaccharides, as animal feed enhancing enzymes that improve digestability, in baking and in brewing, and compositions for these purposes.

[0014] The embodiment of Applicants' invention designated as SEQ ID NO: 2 is obtainable from Thermopolyspora sp. It was found to have 91% sequence identity with the known xylanase from Thermopolyspora flexuosa (UNIPROT : Q8GMV7) . The inventive polypeptides are believed to be highly thermophilic and exhibit a clear prebleaching or bleach boosting effect under conditions as described in the working example herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] FIG. IA is a graph showing release of 280nm absorbing materials after Thermopolyspora sp. xylanase treatment of unbleached hardwood kraft pulp for 2h at 65°C and pH 8.5. [0016] FIG. IB is a graph showing release of 237nm absorbing materials after Thermopolyspora sp. xylanase treatment of unbleached hardwood kraft pulp for 2h at 65°C and pH 8.5. [0017] FIG. 1C is a graph showing Kappa number after XQP- bleaching as a function of enzyme dosage. The Thermopolyspora sp. xylanase pretreatment was performed at 65°C and pH 8.5. DETAILED DESCRIPTION

[0018] The nucleotide sequence and deduced amino acid sequence of a polypeptide having xylanase activity are set forth herein as SEQ ID NOS : 1 and 2 respectively. The nucleotide sequence can be cloned (and the polypeptide can be isolated) from the microorganism strain Thermopolyspora sp. The 588-base pair nucleotide sequence of that cloned sequence, from 5' to 3' , is as follows :

CCCGGAGC CGCACACGCG GACACGACCA TCACCTCGAA CCAGACCGGC TACGACAACG GCTACTTCTA CTCGTTCTGG ACCGACGCGC CCGGCACGGT CTCCATGACC CTGTCGTCCG GCGGCAGCTA CAGCACCTCG TGGCGGAACA CCGGGAACTT CGTCGCGGGC AAGGGCTGGG CCACCGGCGG GCGCCGGACC GTCACCTACT CGGGCAGCTT CAACCCGTCC GGCAACGCCT ACCTGGCGCT CTACGGCTGG ACCAGGAACC CGCTCGTCGA GTACTACATC GTCGACAACT GGGGCACCTA CCGGCCCACC GGCACCTACA AGGGCACCGT CACCACCGAC GGCGGTACGT ACGACATCTA CGAGACCTGG CGGTACAACG CGCCCTCCAT CGAGGGCACC AGGACCTTCC AGCAGTTCTG GAGCGTGCGG CAGCAGAAGC GGACCGGCGG CACCATCACC GTCGGCAACC

ACTTCGACGC CTGGGCCCGG GCCGGCCTGA ACCTCGGCAG CCACGACTAC CAGATCCTGG

CGACCGAGGG CTACCAGAGC AGCGGCAGCT CCAACATCAC CATCGGCGGC (SEQ ID NO: 1) [0019] The deduced amino acid sequence encoded by SEQ ID

NO:1, from N-terminus to C-terminus, is as follows:

PGAAHADTTI TSNQTGYDNG YFYSFWTDAP GTVSMTLSSG GSYSTSWRNT GNFVAGKGWA

TGGRRTVTYS GSFNPSGNAY LALYGWTRNP LVEYYIVDNW GTYRPTGTYK GTVTTDGGTY

DIYETWRYNA PSIEGTRTFQ QFWSVRQQKR TGGTITVGNH F¹DAWARAGLN LGSHDYQILA TEGYQSSGSS NITIGG

(SEQ ID NO : 2 ) . Amino acid residues 1-6 define a native signal sequence. Amino acid residues 7-196 define the mature polypeptide (also referred to as the "mature polypeptide of SEQ ID NO: 2") . As disclosed herein, the signal sequence may be substituted depending on the choice of host for production of the polypeptide. Thus, referring to SEQ ID NO:1, nucleotides 1-18 encode an incomplete signal sequence, and nucleotides 19-588 encode the mature polypeptide. The melting temperature (Tm) of the mature polypeptide of SEQ ID NO:2 was tested at pH 5, 7 and 10. The respective Tm values were 86°C, 85°C and 76°C respectively. [0020] Definitions

[0021] Xylanase activity: The term "xylanase" is defined herein as a 1, 4-β-D-xylan-xylanohydrolase (E. C. 3.2.1.8) which catalyzes the endohydrolysis of 1 , 4-β-D-xylosidic linkages in xylans . For purposes of the present invention, xylanase activity is determined with 0.2% AZCL-arabinoxylan as substrate in 0.01% Triton X-IOO and 20OmM sodium phosphate buffer pH 6 at 37°C. One unit of xylanase activity is defined as 1.0 μmole of azurine produced per minute at 37°C, pH 6 from 0.2% AZCL-arabinoxylan as substrate in 20OmM sodium phosphate pH 6 buffer .

[0022] The polypeptides of the present invention have at least 20%, preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95%, and even most preferably at least 100% of the xylanase activity of the polypeptide consisting of the amino acid sequence shown as amino acids 7-196 of SEQ ID NO:2.

[0023] Isolated polypeptide: The term "isolated polypeptide" as used herein refers to a polypeptide which is at least 20% pure, preferably at least 40% pure, more preferably at least 60% pure, even more preferably at least 80% pure, most preferably at least 90% pure, and even most preferably at least 95% pure, as determined by SDS-PAGE. [0024] Substantially pure polypeptide : The term "substantially pure polypeptide" denotes herein a polypeptide preparation which contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, more preferably at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferably at most 0.5% by weight of other polypeptide material with which it is natively associated. It is, therefore, preferred that the substantially pure polypeptide is at least 92% pure, preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, even more preferably at least 99%, most preferably at least 99.5% pure, and even most preferably 100% pure by weight of the total polypeptide material present in the preparation. [0025] The polypeptides of the present invention are preferably in a substantially pure form. In particular, it is preferred that the polypeptides are in "essentially pure form", i.e., that the polypeptide preparation is essentially free of other polypeptide material with which it is natively associated. This can be accomplished, for example, by preparing the polypeptide by means of well-known recombinant methods or by classical purification methods.

[0026] Herein, the term "substantially pure polypeptide" is synonymous with the terms "isolated polypeptide" and "polypeptide in isolated form." [0027] Identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "identity".

[0028] For purposes of the present invention, the degree of identity between two amino acid sequences is determined by the Clustal method (Higgins, 1989, CABIOS 5: 151-153) using the LASERGENE™ MEGALIGN™ software (DNASTAR, Inc. , Madison, Wis . ) with an identity table and the following multiple alignment parameters: Gap penalty of 10 and gap length penalty of 10. Pairwise alignment parameters are Ktuple=l, gap penalty=3, windows=5, and diagonals=5.

[0029] For purposes of the present invention, the degree of identity between two nucleotide sequences is determined by the Wilbur-Lipman method (Wilbur and Lipman, 1983, Proceedings of the National Academy of Science USA 80:726-730 ) using the LASERGENE™ MEGALIGN™ software (DNASTAR, Inc. , Madison, Wis . ) with an identity table and the following multiple alignment parameters : Gap penalty of 10 and gap length penalty of 10. Pairwise alignment parameters are Ktuple=3, gap penalty=3, and windows=20.

[0030] Polypeptide fragment: The term "polypeptide fragment" is defined herein as a polypeptide having one or more amino acids deleted from the amino and/or carboxyl terminus of SEQ ID NO : 2 , or a homologous sequence thereof, wherein the fragment has xylanase activity. Polypeptide fragments having xylanase activity can be identified by testing a subsequence of the SEQ ID NO: 2 or homologous polypeptide to SEQ ID NO : 2 for xylanase activity. [0031] Subsequence: The term "subsequence" is defined herein as a nucleotide sequence having one or more nucleotides deleted from the 5 ' and/or 3 ' end of SEQ ID NO : 1 , or a homologous sequence thereof, wherein the subsequence encodes a polypeptide fragment having xylanase activity. [0032] I solated polynucleotide : The term " isolated polynucleotide" as used herein refers to a polynucleotide which is at least 20% pure, preferably at least 40% pure, more preferably at least 60% pure, even more preferably at least 80% pure, most preferably at least 90% pure, and even most preferably at least 95% pure, as determined by agarose electrophoresis .

[0033] Substantially pure polynucleotide : The term "substantially pure polynucleotide" as used herein refers to a polynucleotide preparation free of other extraneous or unwanted nucleotides and in a form suitable for use within genetically engineered protein production systems . Thus, a substantially pure polynucleotide contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, more preferably at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferably at most 0.5% by weight of other polynucleotide material with which it is natively associated. A substantially pure polynucleotide may, however, include naturally occurring 5' and 3 ' untranslated regions, such as promoters and terminators. It is preferred that the substantially pure polynucleotide is at least 90% pure, preferably at least 92% pure, more preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, even more preferably at least 98% pure, most preferably at least 99%, and even most preferably at least 99.5% pure by weight. The polynucleotides of the present invention are preferably in a substantially pure form. In particular, it is preferred that the polynucleotides disclosed herein are in "essentially pure form, " i.e., that the polynucleotide preparation is essentially free of other polynucleotide material with which it is natively a s s o c i ated . He re i n , the te rm " sub s t ant i a l l y pure polynucleotide" is synonymous with the terms "isolated polynucleotide" and "polynucleotide in isolated form. " The polynucleotides may be of genomic, cDNA, RNA, semi-synthetic, synthetic origin, or any combinations thereof.

[0034] cDNA: The term "cDNA" is defined herein as a DNA molecule which can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic cell. cDNA lacks intron sequences that are usually present in the corresponding genomic DNA. The initial, primary RNA transcript is a precursor to mRNA which is processed through a series of steps before appearing as mature spliced mRNA. These steps include the removal of intron sequences by a process called splicing. A cDNA derived from mRNA lacks, therefore, any intron sequences.

[0035] Nucleic acid construct: The term "nucleic acid construct" as used herein refers to a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or which is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature. The term nucleic acid construct is synonymous with the term "expression cassette" when the nucleic acid construct contains the control sequences required for expression of a coding sequence of the present invention. [0036] Control sequence: The term "control sequences" is defined herein to include all components, which are necessary or advantageous for the expression of a polynucleotide encoding a polypeptide of the present invention. Each control sequence may be native or foreign to the nucleotide sequence encoding the polypeptide or native or foreign to each other. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleotide sequence encoding a polypeptide . [0037] Operably linked: The term "operably linked" denotes herein a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of the polynucleotide sequence such that the control sequence directs the expression of the coding sequence of a polypeptide. [0038] Coding sequence: When used herein the term "coding sequence" means a nucleotide sequence, which directly specifies the amino acid sequence of its protein product. The boundaries of the coding sequence are generally determined by an open reading frame, which usually begins with the ATG start codon or alternative start codons such as GTG and TTG and ends with a stop codon such as TAA, TAG and TGA. The coding sequence may be a DNA, cDNA, or recombinant nucleotide sequence.

[0039] Expression: The term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion. [0040] Expression vector: The term "expression vector" is defined herein as a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide of the invention, and which is operably linked to additional nucleotides that provide for its expression. [0041] Host: The term "host", as used herein, includes any non-human organism or microorganism or part or cell thereof which is susceptible to transformation, t r an s f e c t i o n , transduction, and the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention.

[0042] Modification: The term "modification" means herein any chemical modification of the polypeptide consisting of amino acids 7 to 196 of SEQ ID NO:2, or a homologous sequence thereof, as well as genetic manipulation of the DNA encoding that polypeptide. The modification can be substitutions, deletions and/or insertions of one or more amino acids as well as replacements of one or more amino acid side chains. [0043] Artificial variant : When used herein, the term

"artificial variant" means a polypeptide having xylanase activity produced by an organism expressing a modified nucleotide sequence of SEQ ID NO: 1, or a homologous sequence thereof, or the mature coding region thereof . The modified nucleotide sequence is obtained through human intervention by modi f ication of the nucleotide sequence di sclosed in SEQ ID NO : 1 , or a homologous sequence thereof, or the mature coding region thereof. [0044] In a first aspect, the present invention relates to isolated polypeptides having an amino acid sequence which has a degree of identity to amino acids 7 to 196 of SEQ ID N0:2 (i.e., the mature polypeptide) of at least 93%, preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, even more preferably at least 98%, most preferably at least 99%, and even most preferably 100%, and wherein the isolated polypeptide has xylanase activity. [0045] In a preferred aspect, the homologous polypeptides have an amino acid sequence which differs from amino acids 7-196 of SEQ ID NO : 2 by 20 amino acids, preferably by 19 amino acids, more preferably by 18 amino acids, more preferably by 17 amino acids, more preferably by 16 amino acids, more preferably by 15 amino acids, more preferably by 14 amino acids, more preferably by 13 amino acids, more preferably by 12 amino acids, more preferably by 11 amino acids, more preferably by 10 amino acids, more preferably by 9 amino acids, more preferably by 8 amino acids, more preferably by 7 amino acids, more preferably by 6 amino acids, more preferably by 5 amino acids, more preferably by 4 amino acids, even more preferably by 3 amino acids, most preferably by 2 amino acids, and even most preferably by one amino acid, and wherein the homologous polypeptides have xylanase activity. [0046] A polypeptide of the present invention preferably comprises the amino acid sequence of SEQ ID NO : 2 or an allelic variant thereof; or a fragment thereof that has xylanase activity. In a preferred aspect, a polypeptide comprises the amino acid sequence of SEQ ID NO : 2. In another preferred aspect, a polypeptide comprises amino acids 7 to 196 of SEQ ID NO : 2 , or an allelic variant thereof; or a fragment thereof that has xylanase activity.

[0047] In a second aspect, the present invention relates to isolated polypeptides having xylanase activity which are encoded by polynucleotides which hybridize under very low stringency conditions, preferably low stringency conditions, more preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with (i) nucleotides 1-588 ( SEQ I D NO : 1 ) or nucleotides 19 to 588 of SEQ ID NO : 1 , (ii) the cDNA sequence contained in nucleotides 19 to 588 of SEQ ID NO : 1 (iii) a subsequence of (i) or (ii) , or (iv) a complementary strand of (i ) , ( ii) , or (iii ) (J. Sambrook, E . F . Fritsch, and T . Maniatis, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, N. Y. ) . [0048] The nucleotide sequence o f SEQ I D NO : 1 , o r a subsequence thereof, as well as the amino acid sequence of SEQ ID NO : 2 , or a fragment thereof, may be used to design a nucleic acid probe to identify and clone DNA encoding polypeptides having xylanase activity from strains of different genera or species according to methods well known in the art. In particular, such probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein . Such probes can be considerably shorter than the entire sequence, but should be at least 14, preferably at least 25, more preferably at least 35, and most preferably at least 70 nucleotides in length. It is preferred, however, that the nucleic acid probe is at least 100 nucleotides in length. For example, the nucleic acid probe may be at least 200 nucleotides, preferably at least 300 nucleotides, more preferably at least 400 nucleotides, or most preferably at least 500 nucleotides in length. Both DNA and RNA probes can be used. The probes are typically labeled for detecting the corresponding gene (for example, with ³²P, ³H, ³⁵S, biotin, or avidin) . Such probes are encompassed by the present invention.

[0049] A genomic DNA or cDNA library prepared from such other organisms may, therefore, be screened for DNA which hybridizes with the probes described above and which encodes a polypeptide having xylanase activity. Genomic or other DNA from such other organisms may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier material. In order to identify a clone or DNA which is homologous with SEQ ID NO : 1 , or a subsequence thereof, the carrier material is used in a Southern blot. [0050] For purposes of the present invention, hybridization indicates that the nucleotide sequence hybridizes to a labeled nucleic acid probe corresponding to the nucleotide sequence shown in SEQ ID NO : 1, the cDNA sequence contained in SEQ ID NO:1, its complementary strand, or a subsequence thereof, under very low to very high stringency conditions. Molecules to which the nucleic acid probe hybridizes under these conditions can be detected using X-ray film.

[0051] In a preferred embodiment, the nucleic acid probe is a nucleic acid sequence which encodes the polypeptide of SEQ ID NO : 2 , or a subsequence thereof. In another preferred embodiment, the nucleic acid probe is SEQ ID NO:1. In another preferred embodiment, the nucleic acid probe is the mature polypeptide coding region of SEQ ID NO:1. [0052] For long probes of at least 100 nucleotides in length, very low to very high stringency conditions are defined as prehybridization and hybridization at 42°C in 5x SSPE, 0.3% SDS, 200μg/ml sheared and denatured salmon sperm DNA, and either 25% formamide for very low and low stringencies, 35% formamide for medium and medium-high stringencies, or 50% formamide for high and very high stringencies, following standard Southern blotting procedures for 12 to 24 hours optimally.

[0053] For long probes of at least 100 nucleotides in length, the carrier material is finally washed three times each for 15 minutes using 2x SSC, 0.2% SDS preferably at least at 45°C (very low stringency), more preferably at least at 50⁰C (low stringency) , more preferably at least at 55°C (medium stringency) , more preferably at least at 60⁰C (medium-high stringency) , even more preferably at least at 65°C (high stringency), and most preferably at least at 70⁰C (very high stringency) .

[0054] For short probes which are about 15 nucleotides to about 70 nucleotides in length, stringency conditions are defined as pr ehybr idi z a t i on , hybridization, and washing post-hybridization at about 5°C to about 10⁰C below the calculated T_m using the calculation according to Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48:1390) in 0.9 M NaCl, 0.09 M Tris-HCl pH 7.6, 6 mM EDTA, 0.5% NP-40, Ix Denhardt ' s solution, 1 mM sodium pyrophosphate, ImM sodium monobasic phosphate, 0. ImM ATP, and 0.2mg of yeast RNA per ml following standard Southern blotting procedures for 12 to 24 hours optimally. [0055] For short probes which are about 15 nucleotides to about 70 nucleotides in length, the carrier material is washed once in 6x SCC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6x SSC at 5°C to 10⁰C below the calculated T_m. [0056] In a third aspect, the present invention relates to artificial variants comprising a conservative substitution, deletion, and/or insertion of one or more amino acids of SEQ ID NO : 2 , or a homologous sequence thereof; or the mature polypeptide thereof. Preferably, amino acid changes are of a minor nature, that is conservative amino acid substitutions or insertions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of one to about 30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to about 20-25 residues; or a small extension that facilitates purification by changing net charge or another function, such as a poly-hi s t idine tract, an antigenic epitope or a binding domain.

[0057] Examples of conservative substitutions are within the group of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid) , polar amino acids (glutamine and asparagine) , hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine) . Amino acid substitutions which do not generally alter specific activity are known in the art and are described, for example, by H. Neurath and R. L. Hill, 1979, In: The Proteins, Academic Press, New York. The most commonly occurring exchanges are Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, and Asp/Gly. [0058] In addit ion to the 20 s tandard amino acids , non-standard amino acids (such as 4-hydroxyproline, 6-N-methyl lysine, 2-aminoisobutyric acid, isovaline, and α-methyl serine) may be substituted for amino acid residues of a wild-type polypeptide. A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, and unnatural amino acids may be substituted for amino acid residues . "Unnatural amino acids" have been modified after protein synthesis, and/or have a chemical structure in their side chain (s) different from that of the standard amino acids . Unnatural amino acids can be chemically synthesized, and preferably, are commercially available, and include pipecolic acid, thiazolidine carboxylic acid, dehydroproline, 3- and 4-methylproline, and 3, 3-dimethylproline . [0059] Alternatively, the amino acid changes are of such a nature that the physico-chemical properties of the polypeptides are altered. For example, amino acid changes may improve the thermal stability of the polypeptide, alter the substrate specificity, change the pH optimum, and the like. [0060] Essential amino acids in the parent polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085) . In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological activity (i.e. , xylanase activity) to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al . , 1996, J. Biol. Chem. 271:4699-4708. The active site of the enzyme or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance , crystallography, electron diffraction, or pho toaf f ini ty labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al . , 1992, Science 255: 306-312; Smith et al. , 1992, J. MoI. Biol. 224: 899-904; Wlodaver et al . , 1992, FEBS Lett. 309: 59-64. The identities of essential amino acids can also be inferred from analysis of identities with polypeptides which are related to a polypeptide according to the invention .

[0061] Single or multiple amino acid substitutions can be made and tested us ing known methods o f mutagenes i s , recombination, and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proc. Nat. Acad. Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al. , 1991, Biochem. 30 : 10832-10837; U.S. Patent 5,223, 409; WO 92/06204 ) , and region-directed mutagenesis (Derbyshire et al. , 1986, Gene 46: 145; Ner et al. , 1988, DNA 7: 127) . [0062] Mut agenes i s / shuf f 1 ing methods can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides expressed by host cells

(Ness et al. , 1999, Nature Biotechnology 17: 893-896) .

Mutagenized DNA molecules that encode active polypeptides can be recovered from the host cells and rapidly sequenced using standard methods in the art . These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide of interest, and can be applied to polypeptides of unknown structure. [0063] The total number of amino acid substitutions , deletions and/or insertions is 20 , preferably 19 , more preferably 18, more preferably 17, more preferably 16, more preferably 15, more preferably 14, more preferably 13, more preferably 12, more preferably 11, more preferably 10, more preferably 9, more preferably 8, more preferably 7 , more preferably 6, more preferably 5, more preferably 4, even more preferably 3, most preferably 2, and even most preferably 1 amino acid substitution, deletion or insertion relative to amino acids 7-196 of SEQ ID N0:2, and wherein the resultant variant polypeptide has xylanase activity.

[0064] Sources of Polypeptides Having Xylanase Activity [0065] A polypeptide of the present invention may be obtained from microorganisms of any genus. For purposes of the present invention, the term "obtained from" as used herein in connection with a given source shall mean that the polypeptide encoded by a nucleotide sequence is produced by the source or by a strain in which the nucleotide sequence from the source has been inserted. In a preferred aspect, the polypeptide obtained from a given source is secreted extracellularly .

[0066] A polypeptide of the present invention may be a bacterial polypeptide. For example, the polypeptide may be a gram positive bacterial polypeptide such as a Bacillus polypeptide, e.g., a Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis, or Bacillus thuringiensis polypeptide; or a Streptomyces polypeptide, e.g., a Streptomyces lividans or Streptomyces murinus polypeptide; or a gram negative bacterial polypeptide, e.g., an E. coli or a Pseudomonas sp. polypeptide. [0067] A polypeptide of the present invention may also be a fungal polypeptide, and more preferably a yeast polypeptide such as a Candida, K 1 u y ve r o my c e s , Pichia, S a c ch a r omy c e s , Schizosaccharomyces, or Yarrowia polypeptide; or more preferably a filamentous fungal polypeptide such as an Acremonium, Aspergillus, Aureobasidium, Cryptococcus , Fi libas idium, Fusarium, Humicola, Magnaporthe, Mucor, My ce 1 i oph thor a , Ne o c a 11 ima s t i x , Neurospora, Pae c i 1 omy ce s , Penicillium, Piromyces, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, or Trichoderma polypeptide.

[0068] In a preferred aspect, the polypeptide is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, o r Saccharomyces oviformis polypeptide having xylanase activity. [0069] In another preferred aspect, the polypeptide is an Aspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride polypeptide. [0070] In a more preferred embodiment, the polypeptide is an Thermopolyspora sp . polypeptide, e.g., the polypeptide with the amino acid sequence of SEQ ID NO: 2.

[0071] It will be understood that for the aforementioned species the invention encompasses both the perfect and imperfect states, and other taxonomic equivalents, e.g., anamorphs, regardless of the species name by which they are known. Those skilled in the art will readily recognize the identity of appropriate equivalents.

[0072] Strains of these species are readily accessible to the public in a number of culture collections, such as the American Type Culture Collection (ATCC) , Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM), Centraalbureau Voor Schimmelcultures (CBS), and Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL) . [0073] Furthermore, such polypeptides may be identified and obtained from other sources including microorganisms isolated from nature (e.g., soil, composts, water, etc.) using the above-mentioned probes. Techniques for isolating microorganisms from natural habitats are well known in the art . The polynucleotide may then be obtained by similarly screening a genomic or cDNA library of such a microorganism. Once a polynucleotide sequence encoding a polypeptide has been detected with the probe (s) , the polynucleotide can be isolated or cloned by utilizing techniques which are well known to those of ordinary skill in the art (see, e.g., Sambrook, et al . , 1989, supra) . [0074] Polypeptides of the present invention also include fused polypeptides or cleavable fusion polypeptides in which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide or fragment thereof . A fused polypeptide is produced by fusing a nucleotide sequence (or a portion thereof) encoding another polypeptide to a nucleotide sequence (or a portion thereof) of the present invention. Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences encoding the polypeptides so that they are in frame and that expression of the fused polypeptide is under control of the same promoter (s) and terminator. [0075] Polynucleotides

[0076] The present invention also relates to isolated polynucleotides having a nucleotide sequence which encode a polypeptide of the present invention. [0077] In a preferred aspect, the nucleic acid sequence is set forth in SEQ ID NO : 1. In another preferred aspect, the nucleic acid sequence is the mature polypeptide coding region of SEQ ID NO:1, i.e. , the sequence containing nucleotides 19-588. The present invention also encompasses nucleic acid sequences which encode a polypeptide having the amino acid sequence of SEQ ID NO : 2 or the mature polypeptide thereof, but which differ from SEQ ID NO : 1 by virtue of the degeneracy of the genetic code. The present invention also relates to subsequences of SEQ ID NO : 1 which encode fragments of SEQ ID NO: 2 that have xylanase activity. [0078] The present invention also relates to mutant polynucleotides comprising at least one mutation in the mature polypeptide coding sequence of SEQ ID NO : 1 , in which the mutant nucleotide sequence encodes a polypeptide which consists of amino acids 7 to 196 of SEQ ID N0:2, or an artificial variant of SEQ ID N0:2 (or the mature polypeptide sequence thereof) , as that term is used herein. [0079] The techniques used to isolate or clone a polynucleotide encoding a polypeptide are known in the art and include isolation from genomic DNA, preparation from cDNA, or a combination thereof. The cloning of the polynucleotides of the present invention from such genomic DNA can be effected, e.g., by using the well known polymerase chain reaction (PCR) or antibody screening of expression libraries to detect cloned DNA fragments with shared structural features. See, e.g., Innis et al . , 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Other nucleic acid amplification procedures such as ligase chain reaction (LCR) , ligated activated transcription (LAT) and nucleotide sequence-based amplification (NASBA) may be used. The polynucleotides may be cloned from Actinomura rubrobrunea, or another or related organism and thus, for example, may be an allelic or species variant of the polypeptide encoding region of the nucleotide sequence.

[0080] The present invention also relates to polynucleotides having nucleotide sequences which have a degree of identity to SEQ ID NO : 1 or the mature polypeptide coding sequence of SEQ ID NO:1 (i.e., nucleotides 19 to 588 of SEQ ID NO:1), such that it encodes a polypeptide having 93, 94, 95, 96, 97, 98, 99, or 100% identity with SEQ ID NO:2 (or amino acids 7-196 thereof), and which encodes an active polypeptide having xylanase activity. [0081] Modification of a nucleotide sequence encoding a polypeptide of the present invention may be necessary for the synthesis of polypeptides substantially similar to the polypeptide. The term "substantially similar" to the polypeptide refers to non-naturally occurring forms of the polypeptide. These polypeptides may differ in some engineered way from the polypeptide isolated from its native source, e.g., artificial variants that differ in specific activity, thermostability, pH optimum, or the like. The variant sequence may be constructed on the basis of the nucleotide sequence presented as the polypeptide encoding region of SEQ ID N0:l, e.g., a subsequence thereof, and/or by introduction of nucleotide substitutions which do not give rise to another amino acid sequence of the polypeptide encoded by the nucleotide sequence, but which correspond to the codon usage of the host organism intended for production of the enzyme, or by introduction of nucleotide substitutions which may give rise to a different amino acid sequence. For a general description of nucleotide substitution, see, e.g., Ford, et al . , 1991, Protein Expression and Purification 2: 95-107.

[0082] It will be apparent to those skilled in the art that such substitutions can be made outside the regions critical to the function of the molecule and still result in an active polypeptide. Amino acid residues essential to the activity of the polypeptide encoded by an isolated polynucleotide of the invention, and therefore preferably not subject to substitution, may be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis

(see, e.g., Cunningham and Wells, 1989, Science 244: 1081-1085) . In the latter technique, mutations are introduced at every positively charged residue in the molecule, and the resultant mutant molecules are tested for xylanase activity to identify amino acid residues that are critical to the activity of the molecule. Sites of substrate-enzyme interaction can also be determined by analysis of the three-dimensional structure as determined by such techniques as nuclear magnetic resonance analysis, crystallography or photoaffinity labelling (see, e.g., de Vos et al . , 1992, Science 255: 306-312; Smith et al . , 1992, Journal of Molecular Biology 224: 899-904; Wlodaver et al . , 1992, FEBS Letters 309: 59-64) .

[0083] The present invention also relates to isolated polynucleotides encoding a polypeptide of the present invention, which hybridize under very low stringency conditions, preferably low stringency conditions, more preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with (i) nucleotides 1-588 or 19 to 588 of SEQ ID N0:l, (ii) the cDNA sequence contained in nucleotides 19 to 588 of SEQ ID NO : 1 , or (iii) a complementary strand of (i) or (ii) ; or allelic variants and subsequences thereof (Sambrook et al . , 1989, supra), as defined herein.

[0084] The present invention also relates to isolated polynucleotides obtained by (a) hybridizing a population of DNAs under very low, low, medium, medium-high, high, or very high stringency conditions with (i) nucleotides 1-588 or 19 to 588 of SEQ ID NO : 1 , (ii) the cDNA sequence contained in nucleotides 19 to 588 of SEQ ID NO : 1 , or (iii) a complementary strand of (i) or (ii) ; and (b) isolating the hybridizing polynucleotides, which encode a polypeptide having xylanase activity. [0085] Nucleic Acid Constructs [0086] The present invention also relates to nucleic acid constructs comprising an isolated polynucleotide of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences. [0087] An isolated polynucleotide encoding a polypeptide of the present invention may be manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the polynucleotide sequence prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotide sequences utilizing recombinant DNA methods are well known in the art.

[0088] The control sequence may be an appropriate promoter sequence, a nucleotide sequence which is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention. The promoter sequence contains transcriptional control sequences which mediate the expression of the polypeptide. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. [0089] Examples of suitable promoters for directing the transcription of the nucleic acid constructs of the present invention, especially in a bacterial host cell , are the promoters obtained from the E. coli lac operon, Streptomyces coelicolor agarase gene (dagA) , Bacillus subtilis levansucrase gene (sacB) , Bacillus licheniformis α-amylase gene (amyL) , Bacillus stearothermophilus maltogenic amylase gene (amyM) , Bacillus amyloliquefaciens α-amylase gene (amyQ) , Bacillus licheniformis penicillinase gene (penP) , Bacillus subtilis xylA and xylB genes, and prokaryotic β-lactamase gene (Villa-Kamarof f et al . , 1978, Proceedings of the National Academy of Sciences USA 75:3727-3731) , as well as the tac promoter (DeBoer et al . , 1983, Proceedings of the National Academy of Sciences USA 80:21-25) . Further promoters are described in "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242 : 74-94; and in Sambrook et al . , 1989, supra.

[0090] Examples of suitable promoters for directing the transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral α-amylase, Aspergillus niger acid stable α-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA) , Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase, Fusarium venenatum amyloglucosidase (WO 00/56900) , Fusarium venenatum Daria (WO 00/56900) , Fusarium venenatum Quinn (WO 00/56900) , Fusarium oxysporum trypsin-like protease (WO 96/00787) , Trichoderma reesei β-glucosidase, Trichoderma reesei cellobiohydrolase 1, Trichoderma reesei cellobiohydrolase 11, Trichoderma reesei endoglucanase 1, Trichoderma reesei endoglucanase 11, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase IV, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase 1, Trichoderma reesei xylanase 11, Trichoderma reesei β-xylosidase, as well as the NA2-tpi promoter (a hybrid of the promoters from the genes for Aspergillus niger neutral α-amylase and Aspergillus oryzae triose phosphate isomerase) ; and mutant, truncated, and hybrid promoters thereof.

[0091] In a yeast host, useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-I) , Saccharomyces cerevisiae galactokinase (GALl) , Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADHl, ADH2/GAP) , Saccharomyces cerevisiae triose phosphate isomerase (TPl), Saccharomyces cerevisiae metallothionine (CUPl), and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful promoters for yeast host cells are described by Romanos et al . , 1992, Yeast 8: 423-488. [0092] The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention. [0093] Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Aspergillus niger α-glucosidase, and Fusarium oxysporum trypsin-like protease. [0094] Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYCl), and Saccharomyces cerevisiae glyceraldehyde-3-phosphat e dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.

[0095] The control sequence may also be a suitable leader sequence, a non-translated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any leader sequence that is functional in the host cell of choice may be used in the present invention .

[0096] Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.

[0097] Suitable leaders for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-I) , Saccharomyces cerevisiae 3-pho sphogl y cerate kinase, Saccharomyces cerevisiae α-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP) .

[0098] The control sequence may also be a polyadenylat ion sequence, a sequence operably linked to the 3' terminus of the nucleotide sequence and which, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA . Any po 1 yadenyl a t i on sequence which is functional in the host cell of choice may be used in the present invention . [0099] Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Fusarium oxysporum trypsin-like protease, and Aspergillus niger α-glucosidase . [0100] Useful polyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995, Molecular Cellular Biology 15: 5983-5990.

[0101] The control sequence may also be a signal peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide into the cellular secretory pathway. The 5' end of the coding sequence of the nucleotide sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region which encodes the secreted polypeptide. Alternatively, the 5' end of the coding sequence may contain a signal peptide coding region which is foreign to the coding sequence. The foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region. Alternatively, the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to enhance secretion of the polypeptide. However, any signal peptide coding region which directs the expressed polypeptide into the secretory pathway of a host cell of choice, i.e., secreted into a culture medium, may be used in the present invention . [0102] Effective signal peptide coding regions for bacterial host cells are the signal peptide coding regions obtained from the genes for Bacillus NCIB 11837 maltogenic amylase, Bacillus stearothermophilus α-amylase, Bacillus licheniformis subtilisin, Bacillus licheniformis β-lactamase, Bacillus stearothermophilus neutral proteases (nprT, nprS, nprM) , and Bacillus subtilis prsA. Further signal peptides are described by Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.

[0103] Effective signal peptide coding regions for filamentous fungal host cells are the signal peptide coding regions obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Rhizomucor miehei aspartic proteinase, Humicola insolens cellulase, Humicola insolens endoglucanase V, and Humicola lanuginosa lipase. [0104] In one aspect, the signal peptide coding region is nucleotides 1 to 18 of SEQ ID NO:1 which encode amino acids 1 to 6 of SEQ ID NO:2.

[0105] Useful signal peptides for yeast host cells are obtained from the genes for Saccharomyces cerevisiae α-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding regions are described by Romanos et al . , 1992, supra .

[0106] The control sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide. The resultant polypeptide is known as a proenzyme or propolypept ide (or a zymogen in some cases) . A propolypept ide is generally inactive and can be converted to a mature active polypeptide by catalytic or a u t o c a t a 1 y t i c cleavage of the propeptide from the propolypeptide . The propeptide coding region may be obtained from the genes for Bacillus subtilis alkaline protease (aprE) , Bacillus subtilis neutral protease (nprT) , Saccharomyces cerevisiae α-factor, Rhizomucor miehei aspartic proteinase, and Myceliophthora thermophila laccase (WO 95/33836) . [0107] Where both signal peptide and propeptide regions are present at the amino terminus of a polypeptide, the propeptide region is positioned next to the amino terminus of a polypeptide and the signal peptide region is positioned next to the amino terminus of the propeptide region. [0108] It may also be desirable to add regulatory sequences which allow the regulation of the expression of the polypeptide relative to the growth of the host cell. Examples of regulatory systems are those which cause the expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Regulatory systems in prokaryotic systems include the lac, tac, and trp operator systems. In yeast, the ADH2 system or GALL system may be used. In filamentous fungi, the TAKA α-amylase promoter, Aspergillus niger glucoamylase promoter, and Aspergillus oryzae glucoamylase promoter may be used as regulatory sequences. Other examples of regulatory sequences are those which allow for gene amplification. In eukaryotic systems, these include the dihydrofolate reductase gene which is amplified in the presence of methotrexate, and the me t al Io thi onein genes which are amplified with heavy metals. In these cases, the nucleotide sequence encoding the polypeptide would be operably linked with the regulatory sequence. [0109] Expression Vectors

[0110] The present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter, and transcriptional and translational stop signals. The various nucleic acids and control sequences described herein may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to allow for insertion or substitution of the nucleotide sequence encoding the polypeptide at such sites . Alternatively, a nucleotide sequence of the present invention may be expressed by inserting the nucleotide sequence or a nucleic acid construct comprising the sequence into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.

[0111] The recombinant expression vector may be any vector

(e.g., a plasmid or virus) which can be conveniently subjected to recombinant DNA procedures and can bring about expression of the nucleotide sequence . The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vectors may be linear or closed circular plasmids. [0112] The vector may be an autonomously replicating vector, i.e., a vector which exists as an extra-chromosomal entity, the replication of which is independent of chromosomal replication, e.g. , a plasmid, an extra-chromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome ( s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used. [0113] The vectors of the present invention preferably contain one or more selectable markers which permit easy selection of transformed, transfected, transduced, or the like cells . A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.

[0114] Examples of bacterial selectable markers are the dal genes from Bacillus subtilis or Bacillus licheniformis , or markers which confer antibiotic resistance such as ampicillin, kanamycin, chloramphenicol, or tetracycline resistance. Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRPl, and URA3. Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase) , argB (ornithine carbamoyltransferase) , bar (phosphinothricin acetyltransferase) , hph (hygromycin phosphotransferase) , niaD (nitrate reductase) , pyrG (orotidine- 5 ' -phosphate decarboxylase), sC (sulfate adenyltransferase) , and trpC (anthranilate synthase), as well as equivalents thereof. Preferred for use in an Aspergillus cell are the amdS and pyrG genes of Aspergillus nidulans or Aspergillus oryzae and the bar gene of Streptomyces hygroscopicus . [0115] The vectors of the present invention preferably contain an element (s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.

[0116] For integration into the host cell genome, the vector may rely on the polynucleotide sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional nucleotide sequences for directing integration by homologous recombination into the genome of the host cell at a precise location (s) in the chromosome ( s ) . To increase the likelihood of integration at a precise location, the integrational elements should preferably contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, preferably 400 to 10,000 base pairs, and most preferably 800 to 10,000 base pairs, which have a high degree of identity with the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding nucleotide sequences. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination . [0117] For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. The origin of replication may be any plasmid replicator-mediating autonomous replication which functions in a cell. The term "origin of replication" or "plasmid replicator" is defined herein as a nucleotide sequence that enables a plasmid or vector to replicate in vivo. [0118] Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184 permitting replication in E. coli, and pUBHO, pE194, pTA1060, and pAMβl permitting replication in Bacillus. [0119] Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARSl, ARS4, the combination of ARSl and CEN3, and the combination of ARS4 and CEN6.

[0120] Examples of origins of replication useful in a filamentous fungal cell are AMAl and ANSI (Gems et al . , 1991, Gene 98: 61-67; Cullen et al . , 1987, Nucleic Acids Research 15: 9163-9175; WO 00/24883) . Isolation of the AMAl gene and construction of plasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883. [0121] More than one copy of a polynucleotide of the present invention may be inserted into the host cell to increase production of the gene product. An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.

[0122] The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e.g., Sambrook et al., 1989, supra) . [ 0123 ] Ho s t s

[0124] The present invention also relates to recombinant non-human hosts or parts thereof such as cells, comprising a polynucleotide of the present invention, which are advantageously used in the recombinant production of the polypeptides. A vector comprising a polynucleotide of the present invention is introduced into a host cell so that the vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host (e.g., cell) will to a large extent depend upon the gene encoding the polypeptide and its source. [0125] The host may be a unicellular microorganism, e.g., a prokaryote, or a non-unicellular microorganism, e.g. , a eukaryote .

[0126] Useful unicellular microorganisms are bacterial cells such as gram positive bacteria including, but not limited to, a Bacillus cell, e.g., Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis; or a Streptomyces cell, e.g., Streptomyces lividans and Streptomyces murinus, or gram negative bacteria such as E. coli and Pseudomonas sp. In a preferred aspect, the bacterial host cell is a Bacillus lentus, Bacillus licheniformis, Bacillus stearothermophilus, or Bacillus subtilis cell. In another preferred aspect, the Bacillus cell is an alkalophilic Bacillus.

[0127] The introduction of a vector into a bacterial host cell may, for instance, be effected by protoplast transformation (see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), using competent cells (see, e.g., Young and Spizizen, 1961, Journal of Bacteriology 81: 823-829, or Dubnau and Davidoff -Abel son , 1971, Journal of Molecular Biology 56:

209-221) , electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751) , or conjugation (see, e.g. , Koehler and Thorne, 1987, Journal of Bacteriology 169: 5771-5278) . [0128] The host may also be a eukaryote, such as a mammalian, insect, plant, or fungal cell.

[0129] In one embodiment, the host cell is a fungal cell .

"Fungi" as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota (as defined by Hawksworth et al . , In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK) as well as the Oomycota (as cited in Hawksworth et al. , 1995, supra, page 171 ) and all mitosporic fungi (Hawksworth et al. , 1995, supra) . [0130] In another embodiment, the fungal host cell is a yeast cell . "Yeast" as used herein includes ascosporogenous yeast (Endomycetales ) , basidiosporogenous yeast, and yeast belonging to the Fungi Imperfect i ( B 1 a s t omy c e t e s ) . S ince the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, F. A. , Passmore, S. M. , and Davenport, R. R. , eds, Soc. App . Bacterid . Symposium Series No. 9, 1980) . [0131] In another embodiment, the yeast host cell is a Candida, Hansenula, Kluyveromyces , Pichia, Saccharomyces , Schizosaccharomyces, or Yarrowia cell.

[0132] In another embodiment, the yeast host cell is a

Saccharomyces carlsbergensis, Saccharomyces cerevisiae,

Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, o r

Saccharomyces oviformis cell. In another most preferred aspect, the yeast host cell is a Kluyveromyces lactis cell. In another most preferred aspect, the yeast host cell is a Yarrowia lipolytica cell. [0133] In another embodiment, the fungal host cell is a filamentous fungal cell. "Filamentous fungi" include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al . , 1995, supra) . The filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic . In contrast , vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative . [0134] In another embodiment, the filamentous fungal host cell is an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis , Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, My ce 1 i oph thor a , Neoca 11 ima s t i x , Neurospora, Pae c i 1 omy ce s , Penicillium, Phanerochaete , Phlebia, Piromyces, Pleurotus, Schi zophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.

[0135] In another embodiment, the filamentous fungal host cell is an Aspergillus awamori, Aspergillus fumigatus , Aspergillus foetidus , Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or Aspergillus oryzae cell . In another most preferred aspect, the filamentous fungal host cell is a Fusarium bactridioides , Fusarium cerealis , Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides , Fusari um s ulph ure um , Fusari um t orul os um , Fusari um trichothecioides , or Fusarium venenatum cell . In another most preferred aspect , the f ilamentous fungal host cell is a Bjerkandera adusta, Ceriporiops is aneirina , Cer iporiops is aneirina , Ceriporiopsis caregiea , Ceriporiopsis gilvescens , Ceriporiopsis pannocinta , Ceriporiopsis rivulosa , Ceriporiopsis subrufa, Ceriporiopsis subvermispora , Coprinus cinereus , Coriolus hirsutus , Humicola insolens , Humicola lanuginosa, Mucor miehei, Myceliophthora thermophi Ia , Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata , Pleurotus eryngii , Thielavia terrestris , Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii , Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.

[0136] Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238 023 and Yelton et al . , 1984, Proceedings of the National Academy of Sciences USA 81: 1470-1474. Suitable methods for transforming Fusarium species are described by Malardier et al. , 1989, Gene 78 : 147-156, and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J. N. and Simon, M. I. , editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983, Journal of Bacteriology 153: 163; and Hinnen et al., 1978, Proceedings of the National Academy of Sciences USA 75: 1920. [0137] Methods of Production

[0138] The present invention also relates to methods for producing a polypeptide of the present invention, comprising:

(a) cultivating a cell, which in its wild-type form is capable of producing the polypeptide, under conditions conducive for production of the polypeptide ; and (b) recovering the polypeptide. Preferably, t h e c e l l i s o f t h e g e n u s

Thermopolyspora and more preferably Thermopolyspora sp. [0139] The present invention also relates to methods for producing a polypeptide of the present invention, comprising:

(a) cultivating a host cell under conditions conducive for production of the polypeptide ; and (b) recovering the polypeptide .

[0140] The present invention also relates to methods for producing a polypeptide of the present invention, comprising: (a) cultivating a host cell under conditions conducive for production of the polypeptide, wherein the host cell comprises SEQ ID NO : 1 , a nucleotide sequence encoding the mature polypeptide of SEQ ID N0:2 (e.g., nucleotides 19-588 of SEQ ID NO : 1 or a degenerate sequence) with or without an accompanying nucleotide sequence encoding signal sequence, or a nucleotide sequence which is a subsequence of the mature coding region of SEQ ID N0: 2 encoding a polypeptide having xylanase activity, or a nucleotide sequence having at least one mutation in the mature polypeptide coding region of SEQ ID N0: l (wherein the mutant sequence encodes SEQ ID NO : 2 or the mature polypeptide coding sequence thereof, or a polypeptide having at least 93% identity to SEQ ID NO : 2 or the mature polypeptide sequence thereof and which has xylanase activity) , and (b) recovering the polypeptide. [0141] In the production methods of the present invention, the cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods well known in the art. For example, the cell may be cultivated by shake flask cultivation, and small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g. , in catalogues of the American Type Culture Collection) . If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted into the medium, it can be recovered from cell lysates.

[0142] The polypeptides may be detected using methods known in the art that are specific for the polypeptides . These detection methods may include use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the polypeptide as described herein. [0143] The resulting polypeptide may be recovered using methods known in the art. For example, the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, cent ri fugat ion , filtration, extraction, spray-drying, evaporation, or precipitation. [0144] The polypeptides of the present invention may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, J. -C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989) to obtain substantially pure polypeptides . [0145] Plants [0146] The present invention also relates to a transgenic plant, plant part, or plant cell which has been transformed with a nucleotide sequence encoding a polypeptide having xylanase activity of the present invention so as to express and produce the polypeptide in recoverable quantities. The polypeptide may be recovered from the plant or plant part. Alternatively, the plant or plant part containing the recombinant polypeptide may be used as such for improving the quality of a food or feed, e.g., improving nutritional value, palatability, and rheological properties, or to destroy an antinutritive factor. [0147] The transgenic plant can be dicotyledonous (a dicot) or monocotyledonous (a monocot) . Examples of monocot plants are grasses, such as meadow grass (blue grass, Poa) , forage grass such as Festuca, Lolium, temperate grass, such as Agrostis, and cereals, e.g., wheat, oats, rye, barley, rice, sorghum, and maize (corn) . [0148] Examples of dicot plants are tobacco, legumes, such as lupins, potato, sugar beet, pea, bean and soybean, and cruciferous plants (family Brassicaceae) , such as cauliflower, rape seed, and the closely related model organism Arabidopsis thaliana .

[0149] Examples of plant parts are stem, callus, leaves, root, fruits, seeds, and tubers as well as the individual tissues comprising these parts, e.g. , epidermis, mesophyll, parenchyme, vascular tissues, meristems . Specific plant cell compartments, such as chloroplast s , apoplasts, mitochondria, vacuoles, peroxisomes and cytoplasm are also considered to be a plant part. Furthermore, any plant cell including a protoplast, whatever the tissue origin, is considered to be a plant part. Likewise, plant parts such as specific tissues and cells isolated to facilitate the utilisation of the invention are also considered plant parts, e.g. , embryos, endosperms, aleurone and seeds coats. [0150] Also included within the scope of the present invention are the progeny of such plants, plant parts, and plant cells .

[0151] The transgenic plant or plant cell expressing a polypeptide of the present invention may be constructed in accordance with methods known in the art. In short, the plant or plant cell is constructed by incorporating one or more expression constructs encoding a polypeptide of the present invention into the plant host genome or chloroplast genome and propagating the resulting modified plant or plant cell into a transgenic plant or plant cell.

[0152] The expression construct is conveniently a nucleic acid construct which comprises a polynucleotide encoding a polypeptide of the present invention operably linked with appropriate regulatory sequences required for expression of the nucleotide sequence in the plant or plant part of choice . Furthermore, the expression construct may comprise a selectable marker useful for identifying host cells into which the expression construct has been integrated and DNA sequences necessary for introduction of the construct into the plant in question (the latter depends on the DNA introduction method to be used) . [0153] The choice of regulatory sequences, such as promoter and terminator sequences, and optionally signal or transit sequences is determined, for example, on the basis of when, where, and how the polypeptide is desired to be expressed. For instance, the expression of the gene encoding a polypeptide of the present invention may be constitutive or inducible, or may be developmental, stage or tissue specific, and the gene product may be targeted to a specific tissue or plant part such as seeds or leaves. Regulatory sequences are, for example, described by Tague et al . , 1988, Plant Physiology 86: 506.

[0154] For constitutive expression, the 35S-CaMV, the maize ubiquitin 1, and the rice actin 1 promoter may be used (Franck et al., 1980, Cell 21: 285-294, Christensen et al . , 1992, Plant Mo. Biol. 18: 675-689; Zhang et al . , 1991, Plant Cell 3: 1155-1165) . Organ-specific promoters may be, for example, a promoter from storage sink tissues such as seeds, potato tubers, and fruits (Edwards & Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303), or from metabolic sink tissues such as meristems (Ito et al., 1994, Plant MoI. Biol. 24: 863-878), a seed specific promoter such as the glutelin, prolamin, globulin, or albumin promoter from rice (Wu et al., 1998, Plant and Cell Physiology 39: 885-889), a Vicia faba promoter from the legumin B4 and the unknown seed protein gene from Vicia faba (Conrad et al., 1998, Journal of Plant Physiology 152: 708-711) , a promoter from a seed oil body protein (Chen et al., 1998, Plant and Cell Physiology 39: 935-941), the storage protein napA promoter from Brassica napus, or any other seed specific promoter known in the art, e.g., as described in WO 91/14772. Furthermore, the promoter may be a leaf specific promoter such as the rbcs promoter from rice or tomato (Kyozuka et al., 1993, Plant Physiology 102: 991-1000, the chlorella virus adenine methyltransferase gene promoter (Mitra and Higgins, 1994, Plant Molecular Biology 26: 85-93), or the aldP gene promoter from rice (Kagaya et al., 1995, Molecular and General Genetics 248: 668-674), or a wound inducible promoter such as the potato pin2 promoter (Xu et al., 1993, Plant Molecular Biology 22: 573-588) . Likewise, the promoter may inducible by abiotic treatments such as temperature, drought, or alterations in salinity or induced by exogenously applied substances that activate the promoter, e.g., ethanol, oestrogens, plant hormones such as ethylene, abscisic acid, and gibberellic acid, and heavy metals.

[0155] A promoter enhancer element may also be used to achieve higher expression of a polypeptide of the present invention in the plant. For instance, the promoter enhancer element may be an intron which is placed between the promoter and the nucleotide sequence encoding a polypeptide of the present invention. For instance, Xu et al . , 1993, supra, disclose the use of the first intron of the rice actin 1 gene to enhance expression. [0156] The selectable marker gene and any other parts of the expression construct may be chosen from those available in the art.

[0157] The nucleic acid construct is incorporated into the plant genome according to conventional techniques known in the art, including Agrobacterium-medi a t ed transformation, virus-mediated transformation, microinj ection, particle bombardment, biolistic transformation, and elect roporat ion

(Gasser et al . , 1990 , Science 244 : 1293; Potrykus, 1990 ,

Bio/Technology 8: 535; Shimamoto et al . , 1989, Nature 338: 274) .

[0158] Presently, Agrobacterium tumefaciens-mediated gene transfer is the method of choice for generating transgenic dicots (for a review, see Hooykas and Schilperoort , 1992, Plant Molecular Biology 19: 15-38) and can also be used for transforming monocots, although other transformation methods are often used for these plants . Presently, the method of choice for generating transgenic monocots is particle bombardment (microscopic gold or tungsten particles coated with the transforming DNA) of embryonic calli or developing embryos (Christou, 1992, Plant Journal 2: 275-281; Shimamoto, 1994, Current Opinion Biotechnology 5: 158-162; Vasil et al. , 1992, Bio/Technology 10: 667-674 ) . An alternative method for transformation of monocots is based on protoplast transformation as described by Omirulleh et al . , 1993, Plant Molecular Biology 21: 415-428.

[0159] Following transformation, the transf ormant s having incorporated the expression construct are selected and regenerated into whole plants according to methods well-known in the art. Often the transformation procedure is designed for the selective elimination of selection genes either during regeneration or in the following generations by using, for example, co-transformation with two separate T-DNA constructs or site specific excision of the selection gene by a specific recombinase .

[0160] A polypeptide having xylanase activity of the present invention may be used in several applications to degrade or convert a xylan-containing material by treating the material with an effective amount of the polypeptide (see, for example, WO 2002/18561) .

[0161] The polypeptides may be used in methods for the treatment of pulp according to U.S. Patent 5, 658, 765. [0162] The polypeptides may also be used in processes for producing xylose or xylo-o 1 igo s acchar ide according to U.S. Patent 5, 658, 765.

[0163] The polypeptides may also be used as feed enhancing enzymes that improve feed digestibility to increase the e f f i c i e n c y o f i t s u t i l i z a t i o n a c c o r d i n g t o U.S. Patent 6,245, 546. Animal feed are disclosed therein.

[0164] The polypeptides may also be used in baking according to U.S. Patent 5, 693, 518. Agents commonly used in baking are disclosed therein. [0165] The polypeptides may further be used in brewing according to WO 2002/24926. Agents commonly used in brewing are disclosed therein.

[0166] In a preferred embodiment, the polypeptides are used to treat paper and pulp. The process preferably comprises the step of contacting pulp with an isolated xylanase of the present invention in an effective amount to improve the brightness of the pulp. The method of the present invention for treating pulp is applicable to a wide range of pulp, such as kraft pulp, sulfite pulp, semi-chemical pulp, groundwood pulp, refiner groundwood pulp, thermo-mechanical pulp, mechanical pulp, etc. By applying the pulp treatment method of the present invention to these pulps, the amount of lignin remained in pulp can be reduced to attain the effects such as enhancement of the brightness of pulps, improvement of the quality, and decrease of the amount of a bleaching or pulping agent such as a chemical bleaching agent . The pulp treatment method of the present invention may also be applied to the bleaching steps of these pulps by oxygen or chemical bleaching, prior to or after the bleaching .

[0167] Following the pulp treatment using the xylanases of the present invention, an extraction may also be carried out to effectively remove the lignin dissolved or susceptible to be dissolved out of the pulp . The extraction may be performed using, e.g. , sodium hydroxide. Typical conditions for the extraction are set forth to have a pulp concentration of 0.3 to 20%, a sodium hydroxide concentration of 0.5 to 5% based on the weight of dry pulp, a temperature range of 40 to 80⁰C, and a time period for 30 minutes to 3 hours, preferably for 1 to 2 hours .

[0168] After pulp is treated according to the method of the present invention, a chemical bleaching agent may also be used to further enhance the brightness of the pulp. In this case, even if the amount of the chemical bleaching agent is greatly decreased as compared to the case of bleaching pulp only with the chemical bleaching agent, a better brightness can be obtained. [0169] In another preferred embodiment, the xylanase is used in preparing dough based products. In baking, xylanase enzymes added to a baking agent such as flour impart favorable characteristics to the dough and to the dough based product, such as, e.g., increased loaf volume and better textural characteristics (e.g., break and shred quality and crumb quality) . The dough based products may include, e.g., corn and flour dough based products, such as, e.g., bread, rolls, muffins, tortillas, and cakes. [0170] In an embodiment, the method comprises treating dough with a xylanase of the present invention, and preparing a dough based product from the xylanase treated dough. The xylanase may be added to dough ingredients, dough additives or the dough (all considered baking agents for purposes of the present invention) in an effective amount to improve the dough and dough based product .

[0171] Example I

[0172] E x p r e s s i o n o f t h e x y l a n a s e g e n e f r o m Thermopolyspora sp. in Bacillus subtilis

[0173] A linear integration vector-system was used for the expression cloning of the gene. The linear integration construct was a PCR fusion product made by fusion of the gene between two Bacillus subtilis homologous chromosomal regions along with a strong promoter and a chloramphenicol resistance marker. The fusion was made by SOE PCR (Horton, R. M., Hunt, H. D., Ho, S.N., Pullen, J. K. and Pease, L. R. (1989) Engineering hybrid genes without the use of restriction enzymes, gene splicing by overlap extension Gene 77: 61-68) . The SOE PCR method is also described in patent application WO 2003095658) . The gene was expressed under the control of a triple promoter system (as described in WO 99/43835) , consisting of the promoters from Bacillus licheniformis α-amylase gene (amyL) , Bacillus amyloliquefaciens α-amylase gene (amyQ) , and the Bacillus thuringiensis cryIIIA promoter including stabilizing sequence. The gene coding for chloramphenicol acetyl-transferase was used as marker. (See, e.g., Diderichsen, B . ; Poulsen, G . B . ; Joergensen, S . T . ; A useful cloning vector for Bacillus subtilis. Plasmid 30:312 (1993)) . The final gene construct was integrated on the Bacillus chromosome by homologous recombination into the pectate lyase locus. [0174] Chromosomal DNA of Thermopolyspora sp. was isolated by QIAmp Tissue Kit (Qiagen, Hilden, Germany) . First, three (3) fragments were PCR amplified: the gene fragment with specific primers pTH167-f (SEQ ID NO:3) and pTH167-r (SEQ ID NO:4) on genomic DNA from T. thermohydrosulfuricus. The upstream flanking fragment was amplified with the primers 260558 (SEQ ID NO:5) and iMB1361Uni2 (SEQ ID NO: 6) and the downstream flanking fragment was amplified with the primers 260559 (SEQ ID NO:7) and oth435 (SEQ ID NO : 8 ) from genomic DNA of the strain iMB1361 (described in WO 2003095658) . [0175] The gene fragment was amplified using a proofreading polymerase (Phusion™ High-Fidelity DNA Polymerase, (New England Biolabs, Inc.)) . The two flanking DNA fragments were amplified with "Expand High Fidelity PCR System" (Roche-Applied-Science) . The PCR reactions were made according to standard procedures (following the manufacturer's recommendations) . The PCR conditions were as follows: 94°C for 2 min followed by 10 cycles of (94°C for 15 sec, 50⁰C for 45 sec, 68°C for 4 min) followed by 20 cycles of (94°C for 15 sec, 50⁰C for 45 sec, 68°C for 4 min (+20 sec. extension pr cycle) ) and ending with one cycle at 68°C for 10 min. [0176] Primers used: pTH167-f: 5' GCTTTTAGTTCATCGATCGCATCGGCTgacacgaccatcacctcgaac 3' (SEQ ID NO:3) pTH167-r: 5'GGGCCAAGGCCGGTTTTTTATGTTTTAGCCGCCGATGGTGATGTTG 3' (SEQ ID NO:4)

260558: 5' gagtatcgccagtaaggggcg 3' (SEQ ID NO: 5) iMB1361Uni2: 5' agccgatgcgatcgatgaacta 3' (SEQ ID NO: 6) 260559: 5' gcagccctaaaatcgcataaagc 3' (SEQ ID NO:7) oth435: 5' taaaacataaaaaaccggccttggc 3' (SEQ ID NO: 8) [0177] The three (3) resulting fragments were mixed in equal molar ratios and a new PCR reaction were run under the following conditions: initial 2 min. at 94°C, followed by 10 cycles of

(94°C for 15 sec, 50⁰C for 45 sec, 68°C for 5 min.), 10 cycles of (94°C for 15 sec, 50⁰C for 45 sec, 68°C for 8 min.), 15 cycles of (94°C for 15 sec, 50⁰C for 45 sec, 68°C for 8 min. in addition 20 sec. extra pr cycle) . After the first cycle the two end primers 260558 (SEQ ID NO:5) and 260559 (SEQ ID NO:7) was added (20 pmol of each) . Two μl of the PCR product were transformed into Bacillus subtilis and t rans f ormant s was selected on LB-plates containing chloramphenicol (6μg/ml medium) . A clone containing the construct without mutations leading to amino acid changes was selected for fermentation in liquid media. [0178] Fermentation

[0179] The clone was streaked on an LB-agar plate with 6 micro g/ml chloramphenicol from -80⁰C stock, and grown overnight at 37 °C. The colonies were transferred to 100ml PS-I media supplemented with 6 micro g/ml chloramphenicol in a 500ml shaking flask. The culture was shaken at 30⁰C at 275rpm for 2 days. The cells were spun down and the enzyme purified from the supernatant.

[0180] Example II

[0181] The prebleaching ability of xylanases is typically analysed by measuring the kappa number which is a measure of the pulp fiber's lignin content (Viikari, et al . , FEMS. Microbiol. Rev. 13:335-350 (1994)) . The removal of lignin after xylanase pre-t r e a t me n t o f pu l p c a n a l s o b e a n a l y s e d spectrophotometrically at 280nm (Rixon, et al . , Appl . Microbiol. Biotechnol. 46:514-520 (1996); Baraznenok, et al . , Enzy. Microbial. Technol. 25:651-659 (1999)) . A previous report demonstrates that the liberation of material absorbing at 237nm correlates well with pulp brightness after bleaching (Elegir, et al., Enz. Microbial. Technol. 17:954-959 (1995)) . In the present study, we evaluated the bleach boosting effect of a preferred embodiment of the present invention, namely the xylanase obtained from Thermopolyspora sp, and which has the mature coding sequence containing amino acid residues 7-196 of SEQ ID NO:2, at 65°C and pH 8.5 (the results of which are shown in Figs. IA-C) . As can be seen in Fig. IA and Fig. IB, Thermopolyspora sp. xylanase treatment of hardwood kraft pulp led to the release of UV-absorbing materials. After the enzymatic treatment the hardwood was bleached in a QP-sequence (Q = Chelator and P = Hydrogen peroxide) . The kappa numbers of the bleached pulp were determined and the results are shown in Fig. 1C. At the lowest dosage ( 6mg xylanase/kg dry pulp), the Thermopolyspora sp. xylanase reduced the kappa number by about 0.7 unit (Fig. 1C) . At 30mg xylanase/kg dry pulp, the kappa number was decreased by approximately 1.1 units (Fig. 1C) . The results show that the Thermopolyspora sp. xylanase has the ability to prebleach hardwood kraft pulp. [0182] EXPERIMENTAL CONDITIONS [0183] Enzymes and Pulp [0184] Purified heterologous Thermopolyspora sp. xylanase was used in this study. The unbleached hardwood kraft pulp that was used in the study was supplied by S0DRA, Sweden. [0185] Enzyme prebleaching [0186] The conditions for the xylanase treatment: 10% pulp consistency, treatment for 2h and at 65°C at pH 8.5. The xylanase prebleaching was carried out in BA 6040 standard stomacher bags (Seward) . The amount of pulp was 8g pulp (dry pulp) /bag. The reference pulp was treated in the same way but without the enzyme addition. [0187] The Thermopolyspora sp. xylanase was added at two different enzyme dosages, 6mg EP/kg DW pulp and 30mg EP/kg DW pulp. After the xylanase treatment, samples of the filtrates were collected for analysis. The water in the pulp was removed by filtration through a Buchner funnel. [0188] Analysis of filtrates after enzymatic bleaching

[0189] Ch r o mo ph o r e r e l e a s e w a s de t e rm i n e d spectrophotometrically . Chromophore released by enzyme treatment was analysed spectrophotometrically at two wavelengths 237 and 280nm. In order to measure the material absorbing at 280nm and 237nm, the filtrate was diluted using deionized water to give an absorbance ranging from approximately 1.0 to 1.5. [0190] EDTA treatment

[0191] Conditions for the EDTA treatment were 10% consistency, pH 6-7, 2kg/ton pulp (dry pulp) EDTA, 70⁰C for 1 h. The amount of pulp was 8g (dry pulp) /bag. [0192] Hydrogen peroxide bleaching

[0193] The conditions for hydrogen peroxide bleaching were: 10% consistency, 0.1% (on DM) MgSO₄, 1.33% (on DM) NaOH, 1.5% (on DM) H₂O₂ at 90⁰C for 2.5h. Pulp samples (8g dry pulp) were bleached in BA 6040 standard stomacher bags (Seward) . After the bleaching, the hydrogen peroxide was removed from the pulp samples on a Buchner funnel. The samples were then washed thoroughly. After the washing, the pulp samples were resuspended in water to a consistency of 0.4%. The pH of the pulp was adjusted with H₂SO₄ (to pH 2) . After 20 min. the pulp was drained using a Buchner funnel and washed with deionized water. The pulp pad was air-dried overnight.

[0194] As shown in FIGS. IA and B, hardwood kraft pulp treated with 6mg Thermopolyspora sp. xylanase liberated 237 and 280nm absorbing materials. [0195] Kappa number [0196] After the xylanase-, EDTA- and the hydrogen peroxide-treatment the kappa numbers were determined. Kappa number was determined on approximately 0.5 to Ig pulp samples using a scaled-down version of the Technical Association of the Pulp and Paper Industry (TAPPI) standard method T236. KAPPA number is defined as the number of milliliters of 2OmM potassium permanganate solution that is consumed by Ig moisture free pulp under specified conditions (results corrected for 50% consumption of the permanganate added) . As shown in FIG. 1C, the xylanase of the present invention has a clear ability to prebleach hardwood kraft pulp.

[0197] All publications cited in the specification, both patent publications and non-patent publications are indicative of the level of skill of those skilled in the art to which this invention pertains. All these publications are herein incorporated by reference to the same extent as if each individual publication were specifically and individually indicated as being incorporated by reference. [0198] Baking trials

Bread was baked according to the straight dough method

Process flow straight dough procedure :

Recipe Dough % on flour basis

Ascorbic acid to be optimized for each flour (40 ppm in this trial) Yeast 4 Salt 1.5 Sugar 1.5

Water to be optimized for each flour (56% in this trial)

Wheat flour 100 (Pelicaan Meneba flour) + Enzyme

Procedure 1. Scaling of ingredients, addition of yeast, ascorbic acid and enzyme

2. Temperature adjustment, scaling and addition of water into mixer bowl

3. Addition of flour into mixer bowl 4. Mixing: 3 min at setting 1 and 7 min at setting 2 using a Diosna spiral mixer

5. The dough is taken from the mixer bowl and the temperature is determined, the dough parameters are determined (dough evaluation after mixing) and the dough is molded on the molder

6. The dough is given 20 min bench-time under plastic cover and the second dough evaluation is performed (dough parameters after bench-time)

7. The dough is scaled for roll maker plate (1500g/30 rolls) and bread (350g/bread) and molding there after

8. The molded dough is given 15 min bench-time covered in plastic

9. The dough for rolls is formed to a ~34cm round plate and put on a roll maker plate and rolls are formed in a rounder. a. The rolls are transferred to a silicone covered baking sheet . b. The dough for bread are shaped in a sheeter and transferred to pans which are put in baking sheet 10. The bread and rolls are proofed at 32°C, 86% RH. a. The proofing time for rolls is 45 min. b. The proofing time for bread are 55 min 11. The bread is baked at 230⁰C with steam a. The rolls are baked for 22 min (damper opens after 12 min in order to let out the steam from the oven) b. The bread is baked for 35 min (damper opens after 12 min in order to let out the steam from the oven)

12. The bread is taken out of the pans after baking and put on a baking sheet

13. The bread and rolls are allowed to cool down

14. The bread and rolls are evaluated regarding volume, ascorbic acid factor, crust and crumb

The enzyme tested, Thermopolyspora sp. xylanase, was dosed at 1.0 mg protein enzyme/kg flour. Bread with no enzyme was used as a control, and the commercial xylanase product BAKEZYME HSP6000 (available from DSM NV) at 30 ppm was also tested.

The dough stickiness, which is a sensory evaluation performed by an experienced baker where the control dough without enzyme is given the character 5 and the other doughs are judged compared to the control on a scale from 0 to 10 where 0 is little stickiness and 10 is very sticky.

The volume of rolls and bread was determined through rape seed displacement. The specific volume index was calculated according to Equation 1 :

Equation 1:

Specific volume index=specific volume of bread with enzyme (in ml/g) /specific volume of bread without enzyme (in ml/g)

The average specific volume of two control doughs was set to 100%. The specific volumes of the enzyme treated bread are average of double samples.

Results obtained The effect of the xylanase on dough parameters can be found in Table 1. The effect on roll and bread volume can be seen in Table 2 and Table 3. The Thermopolyspora sp. xylanase is able to increase the specific volume index at a dosage of 1.0 mg protein enzyme/kg flour, without excessive dough stickiness, compared to the control. Compared to the commercial product BAKEZYME HSP6000, Thermopolyspora sp . xylanase is able to obtain a similar specific volume index for rolls.

Table 1: Dough stickiness after floor time for enzyme treated doughs

Table 2: Specific volume index (%) with enzyme treated rolls

Table 3: Specific volume index (%) with enzyme treated bread

[0199] Although the invention herein has been described with reference to particular embodiments, it is to be understood that these embodiments are merely illustrative of the principles and applications of the present invention. It is therefore to be understood that numerous modifications may be made to the illustrative embodiments and that other arrangements may be devised without departing from the spirit and scope of the present invention as defined by the appended claims.

Claims

1. An isolated polypeptide having xylanase activity, selected from the group consisting of: (a) a polypeptide comprising an amino acid sequence having at least 93% identity to the mature polypeptide of SEQ ID NO: 2;

(b) a polypeptide encoded by a polynucleotide that hydridizes under high stringency conditions with (i) SEQ ID NO : 1 or the mature polypeptide coding sequence thereof, (ii) the cDNA sequence contained in the mature polypeptide coding sequence of SEQ ID NO : 1 , or (iii) a full-length complementary strand of (i) or (ii) ;

(c) a polypeptide encoded by a polynucleotide, wherein the polypeptide comprises an amino acid sequence having at least 93% identity to the mature polypeptide coding sequence of SEQ ID NO: 2; and

(d) a variant comprising a substitution, deletion and/or insertion of one or more amino acids of the mature polypeptide of SEQ ID NO: 2, wherein said variant has at least 93% sequence identity to the mature polypeptide sequence of SEQ ID NO: 2.

2. The polypeptide of claim 1, comprising an amino acid sequence having at least 95% identity to the mature polypeptide of SEQ ID NO:2.

3. The polypeptide of claim 1, comprising an amino acid sequence having at least 97% identity to the mature polypeptide of SEQ ID NO:2.

4. The polypeptide of claim 1, comprising or consisting of the amino acid sequence of SEQ ID NO: 2, or a fragment thereof having xylanase activity.

5. The polypeptide of claim 1, comprising or consisting of the mature polypeptide of SEQ ID NO: 2.

6. The polypeptide of claim 1, which is encoded by a polynucleotide comprising or consisting of the nucleotide sequence of SEQ ID NO:1, or a subsequence thereof encoding a fragment of the polypeptide having xylanase activity.

7. The polypeptide of claim 1, which is encoded by a polynucleotide comprising or consisting of the nucleotide sequence of SEQ ID N0:l.

8. The polypeptide of claim 1, which is obtainable from Thermopolyspora sp.

9. An isolated polynucleotide comprising a nucleotide sequence that encodes the polypeptide of any of claims 1-8.

10. The isolated polynucleotide of claim 9, which comprises or consists of the nucleotide sequence of SEQ ID NO:1, or a subsequence thereof encoding a fragment having xylanase activity.

11. A nucleic acid construct comprising the polynucleotide sequence of claim 9 operably linked to at least control sequence that directs expression of the polynucleotide in an expression host cell.

12. A recombinant expression vector comprising the nucleic acid construct of claim 11.

13. A non-human recombinant host comprising the nucleic acid construct of claim 11.

14. The recombinant host of claim 13, which is a bacterium.

15. The recombinant host of claim 13, which is a plant, or part thereof .

16. The recombinant host of claim 15, wherein the plant part is a protoplast.

17. A method of producing a protein, comprising: (a) cultivating the recombinant non-human host of claim 12 under conditions conducive for production of the polypeptide encoded by the polynucleotide; and (b) recovering the polypeptide.

18. A composition comprising the polypeptide of any of claims 1-8 and a bleaching or pulping agent.

19. An animal feed composition comprising the polypeptide of any of claims 1-8.

20. A composition comprising the polypeptide of any of claims 1-8 and a baking agent.

21. A composition comprising the polypeptide of any of claims 1-8 and a brewing agent.