WO2010019034A1

WO2010019034A1 - Use of carvacrol for treating inflammatory diseases

Info

Publication number: WO2010019034A1
Application number: PCT/NL2009/050487
Authority: WO
Inventors: Willem Van Eden; Ruurd Van Der Zee; Lotte Wieten
Original assignee: Universiteit Utrecht Holding B.V.
Priority date: 2008-08-11
Filing date: 2009-08-11
Publication date: 2010-02-18

Abstract

The invention relates to a method for treating an inflammatory condition, autoimmune disease, or a disease associated with ageing, which comprises administering to a subject an effective amount of carvacrol. The invention further provides for a method for inducing early protective immunity, said method comprising the step of administering carvacrol as a vaccine adjuvant.

Description

Use of carvacrol for treating inflammatory diseases

Field

The present invention relates to a method of treating or preventing a chronic inflammatory disease, said method comprising the step of administering to a subject in need thereof an effective amount of carvacrol.

Background

Heat shock proteins (Hsp) are intracellular proteins categorized in multiple Hsp families based on their molecular weight (e.g. Hsp70 is a heat shock protein with a molecular weight of 70 kDa). Upregulation of Hsp upon various forms of stress is a typical feature of most Hsp and is important for both their protective intracellular role and their immuno regulatory potential. However, during ageing Hsp inducibility decreases and altered Hsp function has been reported to be associated with several diseases including immune dysfunctions. Lately, impaired stress-responsiveness has been shown in PBMC obtained from type I diabetes patients at disease manifestation (Burkart, Germaschewski et al. 2008). Earlier, this was also found in a study in diabetes prone BB rats (Bellmann, Hui et al. 1997). Stress responsiveness is important for induction, maintenance and during inflammation the activation of Hsp-specific regulatory T cell response. Decreased expression of Hsp upon stress may cause failure of Hsp-specific regulation and consequently increase the risk for development of chronic inflammatory diseases. The important protective capacity of treatment with exogenous Hsp60 or Hsp70 via oral or nasal or i.p. vaccination has been demonstrated extensively in experimental models of various inflammatory diseases (van Eden, van der Zee et al. 2005).

Many compounds have been tested for their effect, either by induction or co-induction, on Hsp expression. Hsp inducing compounds have been described to upregulate Hsp expression without an additional stress stimulus. In contrast, compounds that co -induce Hsp expression do not influence Hsp expression unless a bona fide stress signal is provided. In the search for non-toxic Hsp inducing compounds several herbal medicine or seasoning derived compounds have been found to co-induce Hsp expression (Wieten, Broere et al. 2007). Recently, carvacrol has been reported to increase Hsp60 expression in prokaryotic cells (Burt, van der Zee et al. 2007). Carvacrol is one of the main components of essential oils derived from the herbs oregano and thyme and the anti-bactericidal effects of carvacrol have been studied extensively. Furthermore, mixtures of oils containing carvacrol have been used in growth retarded pigs and the anti- inflammatory capacity of carvacrol has been described in a rodent colitis model. However, the effect of carvacrol on antigen-specific T cell responses has not been addressed before.

For Hsp mediated immune regulation, Hsp-specific regulatory T cells have been shown to be important. Up till now, targeting this regulatory response has been done by exogenous Hsp treatment, as indicated hereinbefore. Administration of mycobacterial Hsp or Hsp-derived peptides has been reported to suppress inflammation in multiple rodent models of inflammatory disease by induction or enhanced activation of a set of Hsp-specific regulatory T cells. The presence of those T cells, specific for self-Hsp, has been described in several studies. During inflammation, upregulation of endogenous Hsp, locally at the site of inflammation, may lead to full activation of Hsp-specific regulatory T cells followed by suppression of inflammation. Thus, induction of Hsp upon stress is important for induction, maintenance and activation of the Hsp-specific regulatory T cell response.

Summary of the Invention

The present applicants have explored the immunomodulatory potential of boosting the endogenous stress response with carvacrol. In vitro, carvacrol was shown to be a very potent co-inducer of Hsp70 in multiple mammalian cell types, i.e. it boosted the Hsp70 expression only if additionally a bona fide stress signal was present (e.g. heat shock). Additionally, carvacrol- induced upregulation of Hsp70 increased the activation of Hsp70-specific T cells in both in vitro and in vivo models. Moreover, oral carvacrol treatment suppressed proteoglycan-induced arthritis ("PGIA") in a T cell dependent manner.

The invention relates to a method for treating an inflammatory condition such as an autoimmune disease, said method comprising the step of administering to a subject in need thereof a therapeutically effective amount of carvacrol. Moreover, the invention is directed to a method for treating a disease associated with ageing, said method comprising the step of administering to a subject in need thereof a therapeutically effective amount of carvacrol.

In a further aspect, the invention is concerned with a method for inducing early protective immunity, said method comprising the step of administering carvacrol as a vaccine adjuvant.

Description of Figures and Drawings

Figure 1 shows that carvacrol is a co-inducer of Hsp70 expression in mammalian APC. To study the effect of carvacrol on mammalian APCs, primary BMDC and RAW macrophages were incubated with or without the indicated concentration of carvacrol or with vehicle (ethanol at a final concentration of 0.2%) followed by FACS analysis of intracellular Hsp70 expression. (A) Overnight incubation at 37⁰C with carvacrol did not influence the expression of Hsp70 as compared to unstimulated or vehicle incubated cells. (B) To address the co-inducing capacity of carvacrol cells were in incubated for two hours as mentioned in figure IA, followed by one hour heat shock at 42.5⁰C and overnight recovery at 37⁰C. Carvacrol concentration dependently co-induced the expression of Hsp70 in BMDC and RAW cells. Histograms are representative for at least four independent experiments. (C-D) The Hsp70 (co-)inducing capacity of carvacrol in human PBMCs was tested as described in figure IA-B. In PBMC obtained from healthy donors (C) or RA patients (D) carvacrol enhanced the expression of Hsp70 after heat stress only. Data are expressed, per individual donor, as mean fluorescence intensity (MFI) of the Hsp70 positive population.

Figure 2 demonstrates that carvacrol increased the expression of Hsp70 mRNA in Peyer's patches. The effect of in vivo carvacrol treatment with 2, 10, 50 or 200 mg/kg carvacrol in 100 μl olive oil or vehicle (olive oil) on day -6, -4 and -1 was studied in cells and tissues obtained on day 0. (A) Flow cytometric analysis of Hsp70 expression showed that Hsp70 was not detectable in cells isolated from spleen, mLN or liver isolated after treatment with 2, 10, 50 or 200 mg/kg carvacrol or vehicle only. All histograms are representative of 4 mice per treatment group. Quantitative RT-PCR was performed on snap frozen Peyer's patches. (B) Carvacrol treatment dose dependently increased Hsp70 mRNA expression in Peyer's patches (pooled per animal, 4 mice per group). Data are expressed relative to HPRT (+SEM).

Figure 3 shows that carvacrol treatment suppresses proteoglycan induced arthritis and increases CD4⁺CD25⁺ Foxp3⁺ T cells. Carvacrol (50mg/kg) in 100 μl olive oil or vehicle (olive oil) treatment was done i.g. on day -8, -6, -4 and -1 followed by arthritis induction on day 0 and day 21. Carvacrol treatment (A) delayed the onset of arthritis and decreased arthritis severity and (B) maximum arthritis score compared to controls (* p<0,05; Student t-test). (C) By ELISA, PG-specific IgGl and IgG2a levels were determined in sera obtained at day 41. Carvacrol did not have an effect on PG-specific IgGl and IgG2a production. (D) flow cytometry showed that carvacrol treatment, as compared to vehicle treatment, increased the percentage of CD4 CD25⁺ Foxp3⁺ T cells in the spleen (p<0,05; Student t-test). Data are depicted as percentage CD4⁺CD25⁺ Foxp3⁺ cells of total spleen cells. Data are expressed as mean (+ SEM), n=7 mice per treatment group. A-C are representative for two independent experiments.

Figure 4 demonstrates that carvacrol treatment can boost the Hsp70-specific immune response. Mice were i.g. treated with Carvacrol (50 mg/kg) in 100 μl olive oil or olive oil only, on day -8, -6, -4 and -1 followed by immunization with mycobacterial Hsp70 or OVA on day 0 and 14. (A) Antigen-specific T cell proliferation was determined on day 28 by detection of [3H] Thymidine incorporation. Restimulation, of primed cells with antigen, only increased proliferation to the antigen used for immunization in all groups. Furthermore, carvacrol treatment enhanced Hsp70- (p<0,05; Anova with Bonferoni correction) but not OVA-specific proliferation. Data are expressed as mean (+SEM), n=5 per group. (B) For in vitro analysis of the effect of carvacrol treatment of APC on Hsp70-specific T cell activation, spleen cells were incubated with or without carvacrol for two hours followed by one hour heat shock at 42.5⁰C and three hours recovery at 37⁰C. Differentially treated APC were cultured with an Hsp70-derived peptide specific T cell hybridoma for 24 hours. HS treatment of APC increased hybridoma proliferation, detected as increased [3H] Thymidine incorporation. This effect was augmented upon incubation with carvacrol before HS. (C) Such effects were not seen with a control hybridoma (5/4E8) which is specific for a proteoglycan derived peptide. Data are expressed as mean CPM (+SD) and are representative of three independent experiments.

Figure 5 illustrates that adoptive transfer of T cells from carvacrol treated donor mice suppresses arthritis. Five donor mice received carvacrol (50mg/kg) in 100 μl olive oil or olive oil only, i.g. on day -8, -6, -4 and -1. On day 7 spleen and mLN cells were isolated and 5*10⁶ CD3⁺ mLN cells were i.v. transferred to naϊve recipient mice. Subsequently, in recipient mice arthritis was induced on day 8 and day 29. (A) Carvacrol treatment of donor mice did not change the percentage of CD4 CD25⁺ Foxp3⁺ cells in the spleen but increased the percentage of CD4 CD25⁺ Foxp3⁺ cells in the mLN. Data are expressed as mean (+SEM) percentage positive cells of total spleen cells or as percentage of positive cells of CD3⁺ mLN cells. mLN were pooled per treatment group. (B) Adoptive transfer of T cells from mLN of carvacrol treated donor mice decreased the incidence and delayed the onset of arthritis, and (C) decreased severity of arthritis. Data are expressed as mean (+SEM), n=7 per group.

Figure 6 shows the effect of carvacrol on Hsp70 and HSFl promoter activity. To study the effect of carvacrol on Hsp70 and HSFl promoter activity triplicates of HL-I cells (atrial myocytes, developed from adult mouse atria) containing an Hsp70 promoter- luciferase (a) or an HSFl promoter- luciferase (b) construct were treated with 0.ImM carvacrol or a vehicle (0.2% ethanol) as control. Two hours after treatment these cells and medium controls were heat shocked for one hour at 43.5°C. Sixteen hours later Steady-Glo reagent (promega) was added according to the protocol and light units of the luciferase were measured. Data are expressed relative to untreated cells that were kept at 37 ⁰C.

Figure 7 shows the effect of carvacrol on Hsp40 promoter activity. To test whether carvacrol enhances Hsp70 expression in stressed cells, we turned to arsenite as a stressor and 023 cells carrying a luciferase reporter gene driven by the DNAJBl (Hsp40) promoter. In line with the Hsp70 data obtained by flow cytometry we found that carvacrol dose dependently enhanced the luciferase activity induced by arsenite exposure. For carvacrol to act at least some stress is needed: no effect is seen at 2.5 mM arsenite while at 5 mM arsenite the luciferase signal is doubled with the highest concentrations of carvacrol tested. These data suggest that carvacrol does not sensitize the cells to stress but just amplifies the response to stress (Wieten, van der Zee et al. 2009).

Figure 8 shows that carvacrol-disodiumphosphate (the phosphate conjugated metabolite of carvacrol) is a co-inducer of Hsp70 expression in mammalian antigen presenting cells (APC). To study the effect of the carvacrol derivative on mammalian APC, primary murine bone marrow derived dendritic cells (BMDC) were incubated with or without the indicated concentration of carvacrol-disodiumphosphate or with vehicle (ethanol at a final concentration of 0.2%) followed by FACS analysis of intracellular Hsp70 expression. Overnight incubation at 37⁰C with carvacrol-disodiumphosphate did not influence the expression of Hsp70 as compared to vehicle incubated cells. To address the co-inducing capacity of carvacrol-disodiumphosphate cells were in incubated for two hours with carvacrol-disodiumphosphate, followed by one hour heat shock at 42.5⁰C and overnight recovery at 37⁰C. Carvacrol-disodiumphosphate co- induced concentration dependently the expression of Hsp70 in BMDC. Histograms are representative for at least 2 independent experiments.

Detailed Description of the invention The present inventors have found that boosting the endogenous stress response with carvacrol or derivatives thereof, a newly identified co-inducer of Hsp70, protect against development of chronic inflammatory disease by amplification of the Hsp70-specific regulatory T cell response.

In the present application, instead of using exogenous Hsp, for the first time the endogenous stress response was targeted by oral carvacrol treatment and the result on chronic inflammation was studied in the Proteogly can-Induced Arthritis (hereinafter also referred to as "PGIA") model. Recently, mycobacterial (Mt) Hsp70 immunization has been shown to decrease arthritis symptoms in this model (L. Wieten et al., submitted for publication). Also, carvacrol application effectively delayed the onset of arthritis and suppressed severity of arthritis. However, it did not influence the levels of PG-specific IgGl and IgG2a, antibodies that have been described to be important for the induction of PGIA (Giant, Finnegan et al. 2003) . Therefore, this demonstrated that carvacrol did not interfere with arthritis induction but rather with disease progression. Given that carvacrol treated mice had increased percentages of CD4 CD25 Foxp3⁺ cells and that expression of Foxp3 is associated with regulatory T cells (Fontenot, Gavin et al. 2003; Ono, Yaguchi et al. 2007), carvacrol induced protection might include the induction or activation of regulatory T cells. To prove this, T cells were transferred to naϊve recipient mice followed by induction of arthritis demonstrating that transfer of T cells isolated from carvacrol treated donor mice suppressed arthritis almost as powerful as treatment with carvacrol itself. In agreement with this, protection by exogenous Hsp has been shown to depend on regulatory T cells (Tanaka, Kimura et al. 1999; Wendling, Paul et al. 2000) and lately oral Hsp60 administration increased the percentage of CD4 CD25 Foxp3⁺ cells (van Puijvelde, van Es et al. 2007). Although the experiment proved that the protective capacity of carvacrol could be transferred with T cells, it did not automatically imply that carvacrol changed the Hsp70-specifc T cell response. Unfortunately, this response and consequently the influence of carvacrol on Hsp70-specifϊc T cells, were below detection limit in the arthritis experiments (data not shown). However, after boosting this response by immunization with Hsp70, carvacrol treatment specifically amplified the Hsp70-specific T cell response.

Thus, the present invention relates to a method for treating or preventing an inflammatory condition, said method comprising the step of administering to a subject in need thereof an effective amount of carvacrol or a derivative thereof. The present invention also relates to the use of carvacrol or derivatives thereof in the manufacture of a medicament for treating or preventing an inflammatory condition.

Inflammatory disease refers to any disease where tissue or cell damage or tissue or cell disfunction is caused by the activity of the immune system in the form of plasma/humoral mediators or lymphoid (white blood) cells In the acute phase, inflammation is characterized by the signs of pain, heat, redness, swelling, and loss of function. Histologically, inflammation involves a complex series of events, including dilatation of arterioles, capillaries, and venules, with increased permeability and blood flow; exudation of fluids, including plasma proteins; and leukocyte migration into the site of inflammation. Non- limiting examples of inflammatory conditions include asthma, autoimmune diseases, chronic inflammation, chronic prostatitis, glomerulonephritis, hypersensitivities, inflammatory bowel disease, pelvic inflammatory disease, reperfusion injury, rheumatoid arthritis, transplant rejection, vasculitis, and the like.

The present invention is equally applicable to derivatives of carvacrol. The term

"derivatives of carvacrol" refers to conjugated metabolites of carvacrol, including, but not limited to, the conjugated phosphate metabolite of carvacrol (disodium carvacrol- phosphate; 5-isopropyl-2-methylphenyl disodium phosphate), the conjugated sulphate metabolite of carvacrol, or the conjugated glucuronide metabolite of carvacrol. As such, wherever the present specification refers to use of carvacrol in the present invention, it also refers to derivatives of carvacrol as set forth above.

The term "effective amount" as used herein means that the amount used is effective to reduce or prevent inflammation in a subject. The effective amount may e.g. be determined by monitoring which dose leads to such reduction, e.g. in a phase I/II study.

In an embodiment, the inflammatory condition is a chronic inflammatory disease, preferably an autoimmune disease, and preferably one wherein stress responses are impaired. Non- limiting examples of autoimmune diseases are coeliac disease, diabetes mellittus type 1 (non-insulin dependent diabetes mellitus), Graves' disease, Lupus erythematosus, multiple sclerosis, rheumatoid arthritis (hereinafter also referred to as "RA"), vasculitis, and the like. Preferably, the autoimmune disease is selected from RA, type I diabetes and multiple sclerosis.

It is known that the capacity to upregulate stress proteins is increasingly impaired with ageing (Rao, Watson et al. 1999; Njemini, Abeele et al. 2002). Thus, in a further embodiment the invention relates to a method for treating or preventing a disease associated with ageing, e.g. rheumatoid arthritis or atherosclerosis, said method comprising the step of administering to a subject in need thereof an effective amount of carvacrol. The present invention also pertains to the use of carvacrol or derivatives thereof in the manufacture of a medicament for treating or preventing a disease associated with ageing, e.g. rheumatoid arthritis or atherosclerosis. Since the induction of regulatory T cells is also helpful for induction of early protective immunity in viral infection (Lund, Hsing et al. 2008), carvacrol or derivative thereof can also be used as an adjuvant for vaccination. Thus, the present invention also relates to a method for inducing early protective immunity, said method comprising the step of administering carvacrol or a derivative thereof as a vaccine adjuvant. Carvacrol or derivative thereof may be used in compositions for vaccination with both virus and bacterial vaccines. Thus, the present invention also provides for the use of carvacrol or derivatives thereof in the manufacture of a composition for inducing early protective immunity.

Given its oily composition carvacrol may also be used as an adjuvant for inducing regulatory T cell responses to other antigens. This may be used for the induction of regulatory T cells to autoantigens. E.g., central nervous system antigens, such as MOG, alfa-B-crystallin and MBP, can be administered in carvacrol as a treatment for MS. Cartilage antigens, collagen type II, human proteoglycans (PG), and other RA associated antigens such as fϊlaggrin and citrullinated proteins, in carvacrol may be used as a treatment for RA. Hsp60 and oxidized LDL may be administered in carvacrol for treatment of atherosclerosis. Hsp70 in carvacrol may be administered for all inflammatory diseases which are characterized by an inflammation-induced cellular stress response. Hsp60, insulin or GAD in carvacrol could be used for the treatment of type I diabetes. Allergens, DerPl, pollen, etc. may be used in carvacrol for the treatment of allergies and asthma. Since the main mode of action of carvacrol is the induction of HSP peptide recognizing T cells, compounds that enhance MHC presentation of endogenous (Hsp) peptides to T cells can be given in combination with carvacrol or derivative thereof. In such a manner e.g. rapamycin in combination with carvacrol is expected to be a very effective inductor of T cell regulation.

Carvacrol is a natural food component and has shown its effects through the mucosal (oral) administration route. Therefore the preferred route of administration is mucosal or oral. For producing an adjuvant effect on the induction of regulatory T cells with specificity for auto-antigens or allergens carvacol may be administered either orally or parenterally (as a vaccine). The in vivo half- life of carvacrol is short and carvacrol is excreted rapidly by the kidney. In addition, the presence of some food components interfere with the activity, e.g. bioavailability, of carvacrol. To circumvent these, carvacrol may be incorporated into delivery systems, e.g. slow release delivery systems to have a prolonged efficacy at lower concentrations. Such delivery systems may e.g. be liposomes or polymeric particles.

The present inventors have established that the effect of carvacrol is mediated through the activation of regulatory T cells. Therefore, carvacrol may advantageously be targeted to the immune system and preferably to areas where T cell priming occurs such as dendritic cells (DCs). Thus, in an embodiment carvacrol may be targeted to DCs with the help of delivery systems that allow DC-SIGN targeting, DEC205 targeting, mannose receptor targeting, etcetera. Alternatively, carvacrol may be targeted to lymph nodes or spleen using delivery systems that are equipped with antibodies directed against lymphoid organ specific adhesion molecules, chemokines and chemokine receptor.

For mucosal routes the delivery systems not only have to fulfil the properties required for successful parenteral vaccination, but also have to be able to remain sufficiently long at the mucosal surface to be taken up by M cells, via which they can be transported to DCs, or alternatively can be directly taken up by extensions of local DCs present at the site. Furthermore, depending on the mucosal delivery route, the systems have to meet specific requirements. For instance, pulmonary delivery requires powders or nebulised suspensions with a size range in the low micrometer range.

Chitosan and derivatives thereof (e.g., N-trimethyl chitosan, TMC) have been extensively used as carrier for nasal, pulmonary and oral vaccine delivery. Because of their mucoadhesive character, chitosan-based particles permit residence times at mucosal sites long enough to allow subsequent uptake by M cells. Moreover, it has been demonstrated that a variety of compounds can be non-covalently incorporated in chitosan-based nano- and microparticles. Alternatively, carrier systems already developed for parenteral delivery can be coated (physically or chemically) with mucoadhesive chitosan-based polymers, which can additionally be derivatised with targeting ligands.

It was found that carvacrol needs to be administered in a dose of at least 2 mg/kg two to three times per week in order to accomplish upregulation of Hsp70 in the Peyer's Patches of the gut. Such dose is considerably higher than the dose hitherto recommended.

Carvacrol has a mode of action which is similar to antigen specific immuno-therapies aimed at the induction of antigen specific mucosal tolerance. Mucosal tolerance induction is not effective at the time of severe and progressed inflammation. Therefore, carvacrol or derivative thereof is preferably used as an adjunct therapy together with other disease modifying therapeutic drugs, such as biologicals. In RA this would e.g. be a lowered dose of anti-TNFα together with carvacrol or derivative thereof. Alternatively, carvacrol or a derivative thereof can be active in an early stage of disease, when inflammatory damage has not progressed very far. Alternatively, carvacrol or a derivative thereof can be used as a so-called post-biologic. When, e.g. in the case of RA, TNFα administration is stopped, carvacrol or a derivative thereof can be used afterwards to maintain the control of disease for a much longer period of time, due to a much superior safety profile. In such case, carvacrol or a derivative thereof is used for maintenance therapy.

Carvacrol or derivative thereof will preferably be administered orally with a frequency of 2-3 times a week. It is expected that a permanent low maintenance dose needs to be used after disease remission in order to maintain the active stress protein directed T cell regulation.

It will be clear that the description and drawings are included to illustrate some embodiments of the invention, and not to limit the scope of protection. Starting from this disclosure, many more embodiments will be evident to a skilled person which are within the scope of protection and the essence of this invention and which are obvious combinations of prior art techniques and the disclosure of this patent. Hereinafter the invention will be illustrated further by means of non- limiting examples.

Examples

Materials and Methods

Cell-culture

All primary cells of mouse origin and cell lines were routinely cultured in Iscove's Modified Dulbecco's Medium (IMDM) with glutamax (Invitrogen, Breda, the Netherlands) supplemented with 10% FCS (Bodinco B.V., Alkmaar, the Netherlands), 100 units/ml penicillin/ 100 μg/ml streptomycin (Gibco BRL, Gaithersburg, MD USA), and 50μM 2-mercaptoethanol in a humidified 5% CO₂ atmosphere at 37⁰C. RAW 264.7 and A20 were purchased from the American Type Culture Collection in Manassas, VA, USA. Bone marrow derived dendritic cells (BMDC) were isolated from the bone marrow of 9-12 week old Balb/c mice and cultured for 7 days in the presence of lOng/ml GM-CSF (CytoCen, Utrecht, The Netherlands) as described (Lutz,

Kukutsch et al. 1999). On day 8 BMDC were used in in vitro assays. Freshly isolated human PBMC were obtained by ficol (Pharmacia, Upsalla, Sweden) density gradient centrifuge of heparinised blood. Subsequently, culture of the isolated cells and in vitro assays were performed in RPMI 1640 (Invitrogen) supplemented with 2 mM/L glutamine (Gibco BRL), 100 U/ml penicillin and 100 μg/ml streptomycin and 10% AB-positive heat-inactivated human serum (Sanquin Blood Bank, Utrecht, the Netherlands).

In vitro carvacrol treatment For in vitro carvacrol treatment cells were incubated at indicated concentrations carvacrol (Sigma, Zwijndrecht, the Netherlands). Ethanol was used as solvent for carvacrol, thus control incubation was done with or without ethanol. Final ethanol concentration in control or carvacrol cultures did not exceed 0.2%. To test the inducer capacity of carvacrol, control or carvacrol incubation was done overnight at 37⁰C. To address the co-inducer ability, control or carvacrol incubation was done for 2 hours at 37⁰C followed by one hour HS treatment in a water bath at 42.5⁰C. After HS cells were allowed to recover at 37⁰C overnight. Next, the effect of carvacrol on Hsp70 protein expression was measured by flow cytometry analysis. Mice and in vivo carvacrol or vehicle treatment

Female BALB/c mice, purchased from Charles River (Maastricht, The Netherlands), were housed and fed under standard conditions. Experiments were approved by the Animal Experiment Committee of Utrecht University (Utrecht, the Netherlands). Carvacrol application was performed by intragastric gavage (i.g.) of carvacrol, at indicated concentrations solved in 100 μl of the vehicle olive oil (Albert Hein, the Netherlands) whereas control mice received 100 μl olive oil. Oral treatment was done on day -8, -6, -4 and -1 followed on day 0 by either induction of arthritis, Hsp70 or OVA immunization or on day 7 of the isolation of mLN CD3+ T cells for adoptive transfer as described below. To study direct effects of carvacrol application, intragastric treatment was carried out on day -6, -4 and -1. On day 0, upon sacrifice of the mice, Hsp70 protein and mRNA expression was studied.

Induction and assessment of arthritis

Arthritis was induced in 16-26 week old mice (per independent experiment mice were the same age) with human PG using a standard immunization protocol as described (Giant and Mikecz 2004; Hanyecz, Berlo et al. 2004) . In brief, 300 μg PG protein, prepared as described previously (Berlo, Guichelaar et al. 2006), was given by intraperitoneal injection (i.p.) with 2 mg of DDA (Sigma) emulsified in 200 μl PBS on day 0 and 21. After the second PG immunization the paws of mice were examined in a blinded fashion 3 times a week to record arthritic changes of the joints. The onset and severity of arthritis were determined using a visual scoring system based on swelling and redness of paws as described (Giant and Mikecz 2004; Hanyecz, Berlo et al. 2004).

Hsp70 or OVA immunization

In 9-12 week old mice carvacrol treatment was done as mentioned earlier. HSP70 or OVA immunization was done on day 0 and day 14 by i.p. immunization with 100 μg recombinant HSP70 of Mycobacterium tuberculosis (Mt), (LiONEX Diagnostics & Therapeutics (GmbH, Braunschweig, Germany), or 100 μg ovalbumin gradeV (OVA) (Sigma) in 10 mg/ml DDA emulsified in 200 μl PBS. To avoid interference of LPS contamination with Hsp70 treatment, Hsp70 containing less than 2.1 EU/mg LPS was used. On day 28 mice were sacrificed for subsequent analysis of Hsp70- and OVA specific T and B cell responses.

Adoptive T cell transfer 9-12 week old donor mice were carvacrol or vehicle treated as described above on day- 8, -6, -4 and -1. On day 7 CD3⁺ T cells from mLN cells were isolated and enriched by negative selection with Dynalbeads (Dynal) according to manufactures protocol. The following mAb's, as hybridoma supernatants were used; anti-B220 (RA3-6B2), anti- CD 1 Ib (Ml/70) and anti-MHC classll (M5/114), resulting in a cell suspension containing at least 90% CD3 cells. Cells from either 5 carvacrol of vehicle treated mice were pooled and used as donor population. 5*10⁶ donor cells were intra venous (i.v.) transferred to naϊve recipient mice on day 7 followed by arthritis induction in the recipient mice on day 8 and day 29 as described before.

Flow cytometric analysis of surface marker, Foxp3 and Hsp70 expression

Analysis of surface expression of CD4, and CD25 expression, on spleen and LN cells from arthritic or donor mice, was done by staining single cell suspensions with anti- CD4-fluorescein isothiocyanate (RM4-5) and anti-CD25-allophycocyanin (PC61) monoclonal antibodies (BD Pharmingen, Breda, the Netherlands) in PBS 2% FCS. Additionally, FoxP3 staining was carried out with a Foxp3-r-phycoerythrin (clone FJK- 16S) staining kit according to manufactures protocol (eBiosciences, San Diego, USA). For analysis intracellular Hsp70 expression, cultured cells, cell lines or freshly isolated cells from various organs, were fixed and permeabilized for 20 minutes with cytofic/cytoperm dilutent (BD), washed and then incubated with either anti-Hsp70 fluorescein isothiocyanate (SPA810, Stressgen) or the corresponding isotype control in perm wash solution supplement with 2% normal mouse serum to avoid aspecific binding. For final analysis of fluorescence a FACS-Calibur (BD Pharmingen) was used.

Analysis of PG-specific serum antibody production PG-specific serum antibody levels were determined by ELISA as described previously (Hanyecz, Berlo et al. 2004). Briefly, 96 well plates (Corning B.V. Live Sciences, Schiphol Rijk, the Netherlands) were coated by overnight incubation with 100 μl PG at 5 μg/ml in coating buffer (0.1M NaHCOs, Na₂CO₃ pH 9.6). Free binding sites were blocked with blocking buffer, Roche blocking reagents for ELISA (Roche Diagnostics, Alkmaar, the Netherlands) followed by incubation with sera at increasing dilutions and subsequently peroxidase-conjugated anti-IgGl or -IgG2a (BD Pharmingen) in blocking buffer. PG-specifϊc antibody levels were calculated as OD relative to the OD measured for the corresponding isotypes of a standard of pooled sera from arthritic mice.

Measurement of antigen-specific T cell responses

Single-cell suspensions of spleens were cultured in triplicates in 96-well flat bottom plates (Corning B.V.) at 2 x 10⁵ cells per well, in the presence or absence of HSP70 (10 μg/ml) or OVA (10 μg/ml). After 72 hours, cells were pulsed overnight with [³H]- thymidine (0.4 μCi per well; Amersham Biosciences Europe GmbH, Roosendaal, the Netherlands), harvested and ³H uptake was measured by liquid scintillation counting (Microbeta, Perkin-Elmer Inc., Boston, MA, USA).

Generation and testing ofmClb-specific hybridoma

Spleen cells from mice, immunized twice with 25 μg mClb peptide mixed with 1 mg DDA emulsified in PBS, were isolated and restimulated with 4 μg/ml mClb in X-vivo- 15 medium (Biohitaker) with glutamax and p/s for 48 hours. Then, viable cells were isolated using LympolyteM (Cedarlane Laboratories, Westbury, NY) and cultured for 48 hours in conditioned medium, IMDM supplemented with 10% FCS 2mM L- glutamine, 100 units/ml penicillin, 100 Dg/ml streptomycin and 5 x 10-5M 2-ME and 10% Con A-activated rat spleen supernatant as a source of T cell growth factors. Subsequently, spleen cells were fused with the fusion partner BW5147 as described previously (Kappler, Skidmore et al. 1981). By FACS Vantage (BD) fused cells were seeded into 96 wells plates at one cell per well followed by analysis of mClb specificity of the different obtained clones. For this hybridoma's (2*104 per well) were cultured with APCs (A20 B lymphoma cells, 2*104 per well; ATCC) in 96 wells flat bottom plates for 24 hours with or without peptides at indicated concentrations. Moreover, to test specificity to endogenous Hsp70, APC were heat shock for one hour in a water bath at 42.5 ⁰C leading to upregulation of inducible Hsp70. APCs were allowed to recover for 2-3 hours at 37 ⁰C and after that used as APC. Detection of hybridoma activation was performed by analysis of proliferation as described above for antigen specific T cells. In addition, supernatant was harvested and IL-2 production upon hybridoma activation was assayed by detection of proliferation of the 11-2 responder line CTLL- 16 (ATCC) cultured at 1*104 CTLL- 16 cells in the presence of hybridoma supernatants. The 5/4E8 hybridoma, specific for PG70-84, a proteoglycan- derived peptide, was used as control.

Example 1. The effect of carvacrol on Hsp70 expression in mammalian antigen presenting cells

Recently, carvacrol has been described to upregulate Hsp60 expression in prokaryotic cells. However, the effect of carvacrol on Hsp expression in eukaryotic cells has not been reported earlier. Some known (co-)inducers of Hsp, like geranyl geranyl acetone (GGA), have been reported to either induce or co-induce Hsp70 expression depending on the cell type. The effect of carvacrol on Hsp70 expression was determined by flow cytometry in multiple eukaryotic cell types. First, primary bone marrow derived dendritic cells (BMDC) and RAW macrophages were incubated overnight at 37⁰C with carvacrol followed by analysis of Hsp70 expression. Control cells were incubated with 0.2% ethanol (used as solvent for carvacrol) or left untreated. In both cell types incubation at 37⁰C with carvacrol, at a concentration of O.lmM or 0.2mM did not increase the expression of inducible Hsp70 as compared to unstimulated or vehicle treated control cells (Fig. IA). Carvacrol treatment at 0.2mM did not have an effect on cell viability. However, incubation at a concentration of 0.5mM or higher diminished the viability of the cells (data not shown). Next, the co-inducing capacity of carvacrol was tested. Therefore, cells were incubated with carvacrol, vehicle or left untreated for two hours followed by a one hour heat shock at 42.5⁰C in a water bath. After addition of stress, carvacrol concentration dependently increased Hsp70 expression in BMDC and RAW cells as compared to untreated or ethanol incubated heat shocked cells (Fig. IB). This was also observed in primary spleen cells and in a mouse colon epithelial cell line (data not shown). To address the Hsp70 (co-)inducing capacity of carvacrol on human cells, PBMC were incubated with carvacrol at increasing concentrations carvacrol or vehicle with or without extra stress (heat shock) as described in figure IA- B. It appeared that carvacrol only co-induced Hsp70 expression when additionally were exposed to heat stress. In line with the data obtained in mouse cells, carvacrol co- induced the expression of Hsp70 in human PBMCs isolated from the blood of healthy controls (Fig. 1C). Then, the (co-)inducing capacity of carvacrol in PBMCs obtained from three R.A. patients was studied. Also, in PBMC from RA patients incubation with carvacrol co-induced Hsp70 expression (Fig ID). This showed that in multiple cell types, both primary and cell-lines, carvacrol treatment increased Hsp70 expression but only in combination with a bona fide stress stimulus thereby demonstrating that carvacrol is a potent co-inducer of Hsp70 expression.

Example 2. The effect of carvacrol treatment on in vivo Hsp70 expression

To study the effect of carvacrol treatment on in vivo Hsp70 expression, mice were i.g treated with carvacrol, either 2, 10, 50 or 200 mg/kg carvacrol or with vehicle alone on day -6, -4 and -1. On day 0, mice were sacrificed and Hsp70 protein and mRNA expression were determined. In agreement with the in vitro data at 37⁰C, no Hsp70 protein expression was detected, in cells isolated from the spleen, the mLN and the liver of vehicle treated mice, as compared to the isotype control (Fig. 2A). Furthermore, expression of Hsp70 was not increased by treatment with carvacrol at any of the above mentioned doses (data not shown). Next, by quantitative RT-PCR Hsp70 mRNA expression was studied in cells isolated from mLN and spleen and in snap frozen liver tissue and Peyer's patches. Similar to the protein expression, no Hsp70 mRNA was below detection limit in spleen and mLN cells (data not shown). Furthermore, Hsp70 mRNA was present in liver tissue but no obvious effect of carvacrol treatment was observed (data not shown). Remarkably, in Peyer's patches Hsp70 mRNA expression was dose dependently increased upon carvacrol treatment (Fig. 2B). This suggests that, also in vivo, carvacrol might act as a co-inducer of Hsp70. The upregulation of Hsp70 mRNA in the Peyer's patches could reflect local stress. However, macroscopic inspection of the gut at dθ, d7 or d28 after carvacrol or vehicle treatment, did not reveal obvious differences between vehicle and carvacrol treated mice.

Example 3. The immuno modulatory capacity of carvacrol

To study the immuno modulatory capacity of carvacrol on development of chronic inflammatory disease, PGIA was induced by two times injection with PG in DDA on day 0 and day 21. Carvacrol was given i.g on day -8, -6, -4 and -1 at 50 mg/kg in lOOμl vehicle whereas control mice received lOOμl vehicle. Treatment with carvacrol delayed the onset and reduced severity of arthritis (Fig 3A) and after onset it decreased the maximum arthritis score (Fig. 3B). Moreover, carvacrol treatment obviously improved the general condition of the mice as visually observed by increased activity and less weight loss (data not shown). Since the PG-specifϊc B cell response and especially PG- specifϊc IgG2a, have been shown to be important in the PGIA model (Kaplan, Valdez et al. 2002; Giant, Finnegan et al. 2003), the effect of carvacrol treatment on PG- specific IgGl and IgG2a levels was determined in serum of the mice at day 41. Carvacrol treatment did not influence PG-specifϊc IgGl or IgG2a production (Fig. 3C). Similar results were obtained in sera isolated on day 36 or 55 (data not shown). This showed that carvacrol treatment did not interfere with disease induction by immunization with PG, but rather with disease progression. Since Treg's might be important for this, the effect of carvacrol treatment on the regulatory CD4⁺CD25⁺ Foxp3⁺ T cell population was studied by flow cytometric analysis of spleen cells isolated at day 41 after arthritis induction. Carvacrol treatment increased the percentage of CD4⁺CD25 Foxp3⁺ cells as compared to vehicle treatment (Fig 3D). As Foxp3 is predominantly expressed on Treg's this could be the result of induction or increased activation of Treg's upon carvacrol treatment. In summary this shows that carvacrol delayed the onset and decreased severity of arthritis and increased regulatory T cell markers.

Example 4. Effect of carvacrol treatment on the Hsp70-specifϊc immune response

To study if upregulation of Hsp70 after oral carvacrol treatment could specifically have an effect on the Hsp70-specific T and B cell response mice were treated with carvacrol (50 mg/kg) or vehicle, i.g on day -8, -6, -4 and -1 followed by i.p. immunization on day 0 and 14 with Hsp70 or OVA. At day 28 spleen cells were isolated and proliferation after either Hsp70 or OVA restimulation was measured by detection of [³H] thymidine incorporation. As expected, Hsp70-specifϊc proliferation was observed in both groups immunized with Hsp70 but not in groups immunized with OVA and vice versa (Fig. 4A). Accordingly, a T cell response specific for the antigen used for immunization was present. Remarkably, Hsp70-specific proliferation, in Hsp70-immunized mice, was much stronger in carvacrol treated mice as compared to vehicle treated mice. This was not observed for OVA-specific proliferation in the OVA immunized groups. In addition, the effect of carvacrol treatment on the Hsp70- and OVA-specific B cell response was studied by Hsp70- or OVA-specific IgG ELISA. In agreement with the T cell response, Hsp70- specific IgG was detectable in Hsp70 but not in OVA immunized mice and vice versa and production of Hsp70- but not OVA-specific IgG was slightly increased in carvacrol treated mice as compared to control mice (data not shown). This shows that carvacrol treatment can specifically boost the Hsp70-specific immune response. This was also observed in an in vitro system. Primary spleen cells, incubated for two hours with or without 0.2mM carvacrol followed by one hour HS at 42.5⁰C and three hour recovery, were used as APC to activate T cell hybridomas specific for a Hsp70-derived peptide (Fig. 4B). Culturing the hybridoma with HS APC increased the activation, as detected by elevated proliferation, compared to APC kept at 37⁰C (Fig. 4B). Interestingly, incubation of the APC with carvacrol, before HS, enhanced the effect of HS treatment alone. Thus in line with increased Hsp70 expression, carvacrol treatment of APC specifically increased the activation of Hsp70-specifc T cell hybridomas but not of hybridomas specific for non-Hsp antigens, like the PG-specific control hybridoma (5/4E8, see Fig. 4C). In summary the data show enhanced Hsp70- specifc T cell activation upon in vivo and in vitro carvacrol treatment.

Example 5. Effect of adoptively transferred T cells from carvacrol treated donor mice on arthritis

To investigate if suppression of arthritis by oral carvacrol treatment was T cell mediated; an adoptive transfer experiment was performed. Therefore, donor mice were treated with 50mg/kg carvacrol or vehicle i.g. on day -8, -6, -4 and -1. On day 7 CD3⁺ T cells were isolated from the mesenteric lymph nodes and 5*10⁶ cells, from either carvacrol or vehicle treated mice, were i.v. transferred to naϊve recipient mice followed by induction of arthritis in recipient mice on day 8 and 29. First, the effect of carvacrol treatment on the donor Treg population was studied in CD3⁺ cells from the mLN, thus the transferred population, and in donor spleen cells. Carvacrol did not influence the percentage of CD4 CD25⁺ Foxp3⁺ cells in the spleen as compared to vehicle treatment. However, it increased the percentage CD4⁺CD25⁺ Foxp3⁺ cells in the cells isolated from the mLN (Fig. 5A). Next, disease development in the recipient mice was studied. Like carvacrol treatment itself, adoptive transfer of T cells from carvacrol treated donor mice delayed the onset of arthritis in the acceptor mice as compared to T cells isolated from vehicle treated donor mice. Furthermore, it decreased arthritis severity (Fig. 5B) and maximum arthritis scores (Fig. 5C) and finally proved that carvacrol protective effects were T mediated.

Example 6. Carvacrol induces Hsp70 and HSFl promoter activity To study the effect of carvacrol on Hsp70 and HSFl promoter activity triplicates of HL-I cells (atrial myocytes, developed from adult mouse atria) containing an Hsp70 promoter- luciferase (a) or an HSFl promoter- lucif erase (b) construct were treated with O.lmM carvacrol or a vehicle as control. Two hours after treatment these cells and medium controls were heat shocked for one hour at 43.5°C. Sixteen hours later Steady- GIo reagent (promega) was added according to the protocol and light units of the luciferase were measured. Data are expressed relative to untreated cells that were kept at 37 ⁰C (Figure 6).

From these data it can be seen that although heat shock (with vehicle) by itself caused a minor stimulation of the luciferase reporter system, in combination with carvacrol this stimulation was much enhanced. As we are looking in these reporter cell- lines at HSP70 and HSFl promoter activation, we herewith demonstrated that carvacrol co- stimulates the genuine cellular stress response.

Example 7. Carvacrol induces Hsp40 promoter activity

Construction of stable DNAJBl-luc-023 cell line.

A fragment containing the sequence from -500 to +41 of the human DNAJBl (Hsp40) gene w a s a m p l i fi e d fr o m g e n o m i c D N A u s i n g t h e p r i m e r s aagtcgaccagacacaggttaggtagttcgtcc and accatggcccctcctgcggcccgccga and cloned Sall/Ncol in the Xhol and Ncol sites of pGL3basic (Promega). The Nhel/BamHI fragment of DNAJB 1-luc was cotransfected with a TK-hygromycin construct into 023 cells. Stable transfectants were selected and single clones were tested for inducible expression of luciferase. DNAJB l-Luc-023 cells were kept in culture at 37 ⁰C in DMEM containing 10% FBS, p/s and 1 mg ml^"1 hygromycin (Roche Diagnostics). For the DNAJBl -luciferase assay, DNAJB l-Luc-023 cells were seeded at 5*10⁴ cells per well into 96-well white μClear-plates (Greiner Bio-One) and cultured at 37 ⁰C in DMEM containing 10% FBS and p/s without hygromycin. On the next day, arsenite and carvacrol were added to the indicated concentrations. After 16 hours overnight incubation, luminescence was measured with the Promega Steady-Glo Luciferase Assay System and counted on a 6-detector Wallac 1450 MicroBeta liquid scintillation counter. Data are expressed as 10⁶ counts per minute (10⁶ cpm). To test whether carvacrol sensitizes cells to stress or enhances Hsp70 expression in stressed cells, we turned to arsenite as a stressor and 023 cells carrying a luciferase reporter gene driven by the DNAJBl (Hsp40) promoter. Arsenite was chosen because it is experimentally easier to control the level of stress by adjusting the concentration of arsenite than by changing the severity of a heat shock; a luciferase reporter system was selected because it is more quantitative than the experimental systems used above; the DNAJBl promoter was selected as we found that the DNAJBl mRNA level is more sensitive to inhibition of HSF-I than the level of Hsp70 mRNA (manuscript in prep.). In line with the Hsp70 data obtained by flow cytometry we found that carvacrol dose dependently enhanced the luciferase activity induced by arsenite exposure (Figure 7). For carvacrol to act at least some stress is needed: no effect is seen at 2.5 mM arsenite while at 5 mM arsenite the luciferase signal is doubled with the highest concentrations of carvacrol tested. These data suggest that carvacrol does not sensitize the cells to stress but enhances the response to stress (Wieten, van der Zee et al. 2009).

Example 8. Carvacrol-disodiumphosphate is a co-inducer of Hsp70 expression To study the effect of the carvacrol derivative on mammalian APC, primary murine bone marrow derived dendritic cells (BMDC) were incubated with or without the indicated concentration of carvacrol-disodiumphosphate or with vehicle (ethanol at a final concentration of 0.2%) followed by FACS analysis of intracellular Hsp70 expression. Overnight incubation at 37⁰C with carvacrol-disodiumphosphate did not influence the expression of Hsp70 as compared to vehicle incubated cells. To address the co-inducing capacity of carvacrol-disodiumphosphate cells were in incubated for two hours with carvacrol-disodiumphosphate, followed by one hour heat shock at 42.5⁰C and overnight recovery at 37⁰C. Carvacrol-disodiumphosphate co-induced concentration dependently the expression of Hsp70 in BMDC (Figure 8).

References

Bellmann, K., L. Hui, et al. (1997). "Low stress response enhances vulnerability of islet cells in diabetes-prone BB rats." Diabetes 46(2): 232-6. Berlo, S. E., T. Guichelaar, et al. (2006). "Increased arthritis susceptibility in cartilage proteoglycan-specific T cell receptor-transgenic mice." Arthritis Rheum 54(8): 2423-33.

Burkart, V., L. Germaschewski, et al. (2008). "Deficient heat shock protein 70 response to stress in leukocytes at onset of type 1 diabetes." Biochem Biophys Res

Commun 369(2): 421-5.

Burt, S. A., R. van der Zee, et al. (2007). "Carvacrol induces heat shock protein 60 and inhibits synthesis of flagellin in Escherichia coli O157:H7." Appl Environ Microbiol 73(14): 4484-90. Fontenot, J. D., M. A. Gavin, et al. (2003). "Foxp3 programs the development and function of CD4+CD25+ regulatory T cells." Nat Immunol 4(4): 330-6. Giant, T. T., A. Finnegan, et al. (2003). "Proteoglycan-induced arthritis: immune regulation, cellular mechanisms, and genetics." Crit Rev Immunol 23(3): 199- 250. Giant, T. T. and K. Mikecz (2004). "Proteoglycan aggrecan-induced arthritis: a murine autoimmune model of rheumatoid arthritis." Methods MoI Med 102: 313-38. Hanyecz, A., S. E. Berlo, et al. (2004). "Achievement of a synergistic adjuvant effect on arthritis induction by activation of innate immunity and forcing the immune response toward the ThI phenotype." Arthritis Rheum 50(5): 1665-76. Kaplan, C, J. C. Valdez, et al. (2002). "ThI and Th2 cytokines regulate proteoglycan- specific autoantibody isotypes and arthritis." Arthritis Res 4(1): 54-8. Kappler, J. W., B. Skidmore, et al. (1981). "Antigen-inducible, H-2-restricted, interleukin-2-producing T cell hybridomas. Lack of independent antigen and H- 2 recognition." J Exp Med 153(5): 1198-214. Lund, J. M., L. Hsing, et al. (2008). "Coordination of early protective immunity to viral infection by regulatory T cells." Science 320(5880): 1220-4.

Lutz, M. B., N. Kukutsch, et al. (1999). "An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow." J Immunol Methods 223(1): 77-92. Njemini, R., M. V. Abeele, et al. (2002). "Age-related decrease in the inducibility of heat-shock protein 70 in human peripheral blood mononuclear cells." J Clin Immunol 22(4): 195-205. Ono, M., H. Yaguchi, et al. (2007). "Foxp3 controls regulatory T-cell function by interacting with AMLl/Runxl." Nature 446(7136): 685-9. Rao, D. V., K. Watson, et al. (1999). "Age-related attenuation in the expression of the major heat shock proteins in human peripheral lymphocytes." Mech Ageing Dev 107(1): 105-18.

Tanaka, S., Y. Kimura, et al. (1999). "Activation of T cells recognizing an epitope of heat-shock protein 70 can protect against rat adjuvant arthritis." J Immunol 163(10): 5560-5. van Eden, W., R. van der Zee, et al. (2005). "Heat-shock proteins induce T-cell regulation of chronic inflammation." Nat Rev Immunol 5(4): 318-30. van Puijvelde, G. H., T. van Es, et al. (2007). "Induction of oral tolerance to HSP60 or an HSP60-peptide activates T cell regulation and reduces atherosclerosis." Arterioscler Thromb Vase Biol 27(12): 2677-83.

Wendling, U., L. Paul, et al. (2000). "A conserved mycobacterial heat shock protein (^nsP) 70 sequence prevents adjuvant arthritis upon nasal administration and induces IL-10-producing T cells that cross-react with the mammalian self-hsp70 homologue." J Immunol 164(5): 2711-7. Wieten, L., F. Broere, et al. (2007). "Cell stress induced HSP are targets of regulatory T cells: a role for HSP inducing compounds as anti- inflammatory immuno- modulators?" FEBS Lett 581(19): 3716-22.

Wieten, L., R. van der Zee, et al. (2009). " Hsp70 expression and induction as a readout for detection of immune modulatory components in food" Cell Stress and Chaperones 2009 May 27. [Epub ahead of print].

Claims

1. Method for treating or preventing an inflammatory condition, said method comprising the step of administering to a subject in need thereof a therapeutically effective amount of carvacrol or a derivative thereof.

2. Method according to claim 1, wherein said inflammatory condition is a chronic inflammatory condition.

3. Method according to claim 2, wherein the chronic inflammatory condition is an autoimmune disease.

4. Method according to claim 3, wherein the autoimmune disease is one wherein stress responses are impaired.

5. Method according to claim 4, wherein the autoimmune disease is selected from rheumatoid arthritis, type I diabetes and multiple sclerosis.

6. Method for treating or preventing a disease associated with ageing, said method comprising the step of administering to a subject in need thereof a therapeutically effective amount of carvacrol or a derivative thereof.

7. Method according to claim 6, wherein the disease associated with ageing is selected from rheumatoid arthritis and atherosclerosis.

8. Method according to any of the preceding claims, wherein the carvacrol or derivative thereof is administered in a dose of at least 2 mg/kg.

9. Method according to claim 8, wherein the carvacrol or derivative thereof is administered orally.

10. Method according to claim 8 or 9, wherein the carvacrol or derivative thereof is administered at least twice per week.

11. Method according to any of the preceding claims, wherein the carvacrol or derivative thereof is administered as an adjunct therapy together with one or more further therapeutic agent.

12. Method according to any of the preceding claims, wherein carvacrol or derivative thereof is administered in an early stage of disease.

13. Method according to any of the preceding claims, wherein carvacrol or derivative thereof is used for maintenance therapy.

14. Method for inducing early protective immunity, said method comprising the step of administering carvacrol or a derivate thereof as a vaccine adjuvant.

15. Method according to any of the preceding claims, wherein carvacrol or derivative thereof is administered as a co-inducer of endogenous Hsp70.

16. Method according to any of the preceding claims, wherein carvacrol or derivative thereof is administered as a co-inducer of endogenous Hsp70 in antigen presenting cells.

17. Method according to any of the preceding claims, wherein carvacrol or derivative thereof is administered to amplify Hsp70-specifϊc regulatory T cell response in vivo.