WO2010015264A1 - L-asparaginase provenant d'helicobacter pylori - Google Patents

L-asparaginase provenant d'helicobacter pylori Download PDF

Info

Publication number
WO2010015264A1
WO2010015264A1 PCT/EP2008/006469 EP2008006469W WO2010015264A1 WO 2010015264 A1 WO2010015264 A1 WO 2010015264A1 EP 2008006469 W EP2008006469 W EP 2008006469W WO 2010015264 A1 WO2010015264 A1 WO 2010015264A1
Authority
WO
WIPO (PCT)
Prior art keywords
asparaginase
helicobacter pylori
food
ccug
enzyme
Prior art date
Application number
PCT/EP2008/006469
Other languages
English (en)
Inventor
Claudia Scotti
Giovanna Valentini
Donata Cappelletti
Maria Valentina Pasquetto
Simona Stivala
Laurent Roberto Chiarelli
Original Assignee
Universita' Degli Studi Di Pavia
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universita' Degli Studi Di Pavia filed Critical Universita' Degli Studi Di Pavia
Priority to PCT/EP2008/006469 priority Critical patent/WO2010015264A1/fr
Publication of WO2010015264A1 publication Critical patent/WO2010015264A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/80—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
    • C12N9/82—Asparaginase (3.5.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/01—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amides (3.5.1)
    • C12Y305/01001—Asparaginase (3.5.1.1)

Definitions

  • the present invention concerns the recombinant form of L-asparaginase from Helicobacter pylori CCUG 17874; in particular, the relevant gene has been cloned, the corresponding enzyme expressed and then characterised. Antibodies against the L-asparaginase of the invention have been produced.
  • said enzyme as a potential therapeutic agent, as a reagent in a diagnostic assay and as a food additive is also disclosed.
  • L-asparaginases (EC 3.5.1.1) are amidohydrolases that primarily catalyse the conversion of L-asparagine to L-aspartate and ammonia.
  • a minority of L-asparaginases also referred to as glutaminases-asparaginases (EC 3.5.1.38), are enzymes capable of transforming either L- asparagine or L- glutamine into their corresponding acids with comparable efficiency.
  • L- asparaginases play a central role in the metabolism of several species, the aspartate being either transaminated to oxaloacetate, an intermediate in the tricarboxylic acid cycle, or converted into fumarate during the urea cycle.
  • L-asparaginases are present in bacteria, plants, animal tissues and in the serum of certain rodents (El-Bessoumy et a/., 2004), and an asparaginase-like protein of human spermatozoa has been recently reported (Bush et a/., 2002).
  • Bacterial L-asparaginases which are preferentially active towards L-asparagine are in turn subdivided into two groups according to their affinity towards L-asparagine and to their cellular localisation.
  • Type I L-asparaginases are cytoplasmic, display high Km values vs. L-asparagine and are also active towards L-glutamine.
  • Type Il L-asparaginases are periplasmic, exhibit low Km values vs. L-asparagine, and have low-to-negligible activity towards L-glutamine.
  • Bacterial L- asparaginases are known to exhibit a hyperbolic response to L-asparagine (Mickalska and Jaskolski, 2006; Sanches et a/., 2007).
  • L-asparaginase I from Escherichia coli E. coli
  • displays positive cooperativity towards L-asparagine and is allosterically regulated by the substrate itself Yamamoto et al., 2007.
  • L-asparaginase from different bacterial sources have been extensively studied (Lubkowski et al., 1996; Miller et al., 1993; Swain et al., 1993; Yao et al., 2005; Yun et al., 2007). In their highly conserved architecture, they are 140-150 kDa homotetramers built up by identical subunits of 300 to 350 amino acid residues. The tetrameric structure can be more accurately described as a dimer of intimate dimers (Swain et al., 1993), with each subunit consisting of two alf a/beta domains, a larger N-terminal domain and a smaller C-terminal domain, connected by a structured linker region.
  • E. coli L-asparaginase (Dodson and Wlodawer, 1998; Sanches ef al., 2007).
  • Some L-asparaginases from bacterial sources display anti-leukemic activity, and type Il E. coli L-asparaginase and the related enzyme from Erwinia chrysanthemi (E.
  • chrysanthemi are currently in clinical use as effective drugs in the treatment of acute lymphoblastic leukemia (ALL) and other lymphoid malignancies.
  • ALL acute lymphoblastic leukemia
  • the anti-tumour activity is primarily attributed to the reduction of L-asparagine in blood.
  • the depletion of L-asparagine selectively inhibits the proliferation of malignant cells that, in contrast to normal cells, are dependent on an exogenous source of this amino acid for survival because of a decreased or absent asparagine synthetase activity (Keating et al., 1993; Moola et al., 1994).
  • asparagine is known to react with reducing sugars contained in starch-based foods during processing like baking of frying or heating above 120° C and is thus responsible for the production of acrylamide as a product of a Maillard reaction (see, for instance, ZyzakD. , J. Agric. Food Chem. 2003, 51 , 4782-4787 or Mottram et al. Nature, 419:448, 2002).
  • Concerns about dietary exposure to acrylamide had arisen as a result of studies conducted in Sweden in 2002, which showed that high levels of acrylamide were formed during the frying or baking of a variety of foods.
  • JECFA Joint FAO/WHO Expert Committee on Food Additives
  • L-asparaginases which would be more stable and resistant to pH changes and high temperature, possibly being also more selective toward asparagine than glutamine, thus leading to less side effects and allowing to be used for improved therapeutic and diagnostic purposes or even as a food additive.
  • new antigens to be used as reagents to diagnose patients with a suspect of ongoing or previous infections sustained by Helicobacter pylori, while anti-asparaginase antibodies might be useful in research investigations focused on the pathogenicity role of this enzyme.
  • L-asparaginase from Helicobacter pylori CCUG 17874 is particularly advantageous with respect to other known asparaginases. In fact, it has unexpectedly shown a significant specificity toward asparagine rather than versus glutamine, with respect to other known asparaginase. Again, L-asparaginase from Helicobacter pylori CCUG 17874 proved to be more stable both to wide pH changes and to high temperature.
  • the gene encoding the L-asparaginase from H. pylori CCUG 17874 of the present invention has been cloned and sequenced. Further, a vector comprising said gene has been transformed into E. coli in order to produce suitable quantities of the recombinant enzyme, which has then been purified and characterized.
  • recombinant L- asparaginase from Helicobacter pylori CCUG 17874 have been produced and purified.
  • the recombinant protein has also been used for developing an immunological diagnostic assays, whose preliminary data show that it can be more sensitive compared to the commercially available diagnostic assays in detecting patients affected by Helicobacter pylori.
  • the recombinant L-asparaginase from Helicobacter pylori CCUG 17874 of the invention may advantageously be used also as a food additive in order to convert L-asparagine present in starch-based foods to L-aspartate and ammonia, thus reducing the amount of acrylamide formed during food processing.
  • said nucleic acid sequence is a deoxyribonucleic acid
  • DNA sequence is the one coding for the amino acid sequence of Seq. ID n. 2.
  • a second object is represented by a transformation vector comprising the nucleotide sequence of Seq. ID n. 1.
  • a third object of the invention is represented by an expression host comprising the transformation vector of the invention.
  • a fourth object of the invention is represented by a method for producing recombinant L-asparaginase from Helicobacter pylori CCUG 17874.
  • the present invention also concerns a method for the preparation of antibodies against the recombinant L- asparaginase of the invention.
  • 17874 is another embodiment of the invention.
  • a further additional embodiment of the invention is represented by the use of the recombinant L-asparaginase from Helicobacter pylori CCUG 17874 as a medicament and, in particular, as an anti-cancer medicament.
  • a pharmaceutical preparation comprising the recombinant L-asparaginase from Helicobacter pylori CCUG 17874 of the invention is a still additional embodiment of the present invention.
  • the use of said pharmaceutical preparation for the treatment of cancer, acute lymphatic leukemia (ALL) and other diseases is comprised within the present invention as well.
  • the present invention encompasses the nucleic acid molecule of Seq. ID n. 1 encoding L-asparaginase from H. pylori CCUG 17874 having the amino acidic sequence of Seq. ID n. 2.
  • said nucleotide sequences may be a sequence of deoxyribonucleic acid (DNA), complementary DNA (cDNA), ribonucleic acid (RNA), ESTs, chromosomes or genes, both sense and anti-sense, single-stranded or double-stranded or, where applicable, their complementary sequences using the Watson-Crick base pairing, or any sequence hybridizing under stringent conditions, i.e.
  • the nucleic acid molecule is a DNA sequence coding for the amino acidic sequence of Seq. ID n. 2.
  • sequences which, due to the degeneracy of the genetic code, encode the same amino acidic sequence of Seq. ID n. 2, that is to say that more than one nucleotide sequence may encode the same amino acidic sequence of Seq. ID n . 2 as a result of one or more silent mutations.
  • the present invention also encompasses homologous sequences to that of Seq. ID n. 1.
  • "Homology degree" between two nucleotide sequences is defined as the percentage of nucleotides occupying the same position when the sequences are aligned. Alignment may be performed according to various algorithms or programs, such as, for instance, FASTA, BLAST, BLOUSM62 or ENTREZ. An homology of 100% means that the sequences are identical.
  • the nucleotide sequences of the invention are identical to the nucleotide sequence of Seq. ID n. 1.
  • the nucleotide sequences of the invention have a variable homology to the sequence of Seq. ID n.1.
  • homologous sequences to those of Seq. ID n. 2, wherein the degree of homology as defined above applies as well.
  • the amino acidic sequences of the invention are identical to the amino acidic sequence of Seq. ID n. 2.
  • the amino acidic sequences of the invention have a variable homology to the sequence of Seq. ID n. 2.
  • basic amino acids such as: lysine, histidine and arginine
  • acidic amino acids such as: aspartic acid, glutamic acid and their amide derivatives asparagine and glutamine
  • non- polar amino acids such as alanine, valine, leucine, isoleucine, proline, phenylalanine, metionine, tryptophan and uncharged amino acids, such as glycine, asparagine, glutamine, cysteine, serine, threonine and tyrosine.
  • the present invention also encompasses the nucleotidic sequences due to both natural and non-natural mutations, leading to a mutant enzyme, wherein natural mutations are spontaneous events and artificial mutations are introduced.
  • a mutant enzyme is an enzyme that has been produced by a mutant organism, i.e. one which is expressing a mutant gene.
  • a mutant gene (other than one containing only silent mutations) means a gene encoding an enzyme having an amino acid sequence which has been derived directly or indirectly, and which is different in one or more locations from the sequence of a corresponding parent enzyme, being the product of the corresponding unaltered gene.
  • a silent mutation in a gene results in the same amino acid sequence of the enzyme being encoded by that gene.
  • Random mutagenesis is a widespread tool used in molecular biology to create mutated enzymes. For instance, an enzyme with increased activity toward its substrate or higher specificity for a substrate with respect to another one, may result from mutagenesis experiments.
  • error prone PCR is a random mutagenesis technique for introducing amino acid substitutions in proteins.
  • mutations are deliberately produced into a gene during PCR through the use of error prone DNA polymerases, whose rate of error, together with the number of duplications, defines the mutation frequency, and/or by modifying some reaction conditions, such as temperature, buffer and magnesium ions concentration.
  • the mutated PCR products are then cloned into an expression vector and the resulting library of mutant enzymes is screened for defined changes in the protein activity.
  • the present invention concerns an expression vector comprising the nucleotide sequences of Seq. ID n. 1 or any nucleotide sequences as per the first object of the present invention.
  • Suitable vectors may be the plasmids, which are circular and double- stranded extra-chromosomal DNA molecules separate from the chromosomal DNA and capable of replicating independently of the chromosomal DNA.
  • Other suitable vectors may be, for instance, lambda phage with lysogeny genes deleted, cosmids, bacterial artificial chromosomes or yeast artificial chromosomes.
  • the expression vector is a plasmid and, more preferably, it is the pCR2.1-TOPO cloning vector (Invitrogen) or pET101 , which have been used for cloning and for subcloning, respectively.
  • an expression vector may comprise other sequences, which, according to the type of expression vector used, may be a control sequence, a termination sequence, a promoter sequence, a ribosome binding sequence, all of which are operably linked to the sequence encoding the L-asparaginase of the invention, that is to say that they are into functional relationship with each other.
  • the relevant nucleic acid molecule may be also integrated into the host chromosome. An expression vector is then transferred into a suitable host for expressing the product it encodes.
  • Transfection and transformation may be carried out according to well known methods in the art, such as, for instance, heat-shock, electroporation, lipofectamine or with the use of bacteriophages or by calcium phosphate (F. L. Graham and A. J. van der Eb).
  • a host comprising the nucleotide sequence of Seq. ID n. 1 therefore, represents a third object of the invention.
  • Suitable expression host may be procariotic cells, such as Escherichia coli, bacilli such as Bacillus subtilis, Enterobacteriaceae, such as Salmonella typhimurium or Serratia marcesans or various Pseudomonas spp.
  • Yeast cell may be used as well and may be the common bakery-yeast Saccharomyces cerevisiae or Pichia pastoris.
  • the expression host is a procariotic cell and more preferably it is Escherichia coli BL21(DE3).
  • the present invention also relates to antibodies against the L-asparaginase from H. pylori CCUG 17874 of the invention.
  • antibodies include polyclonal or monoclonal antibodies, i.e. antibodies obtained from a population of substantially homogeneous antibodies directed against a single determinant on the antigen, and they may be monoclonal antibodies of any types, such as, for instance, IgG, IgA, IgD, IgM and IgE, as well as any fragments thereof, such as Fab fragments, F(ab') 2 , Fab' and single chain antibodies (scFv).
  • monoclonal antibodies i.e. antibodies obtained from a population of substantially homogeneous antibodies directed against a single determinant on the antigen
  • monoclonal antibodies of any types such as, for instance, IgG, IgA, IgD, IgM and IgE, as well as any fragments thereof, such as Fab fragments, F(ab') 2 , Fab' and single chain antibodies (scFv).
  • the antibodies are monoclonal IgM antibodies.
  • a process for the preparation of the recombinant IgM monoclonal antibodies of the invention includes the step of immunizing mice with a suitable amount of the L-asparaginase of the invention, i.e. an amount capable of eliciting an immune response and, hence, the production of antibodies against said antigen; suitable amounts may be, for instance, from 10 to 100 ⁇ g of recombinant H. pylori CCUG 17874 L-asparaginase.
  • Immunization is performed according to methods known in the field of the invention and may include one or more administrations (boosts) of the antigen to the mice, which administrations are performed after some times one from each other; for instance, a first immunization may be followed by the second one after some weeks, such as three or four weeks.
  • boosts administrations
  • immunization may be made with a starting boost of 30 ⁇ g followed by two boosts of 20 ⁇ g each 4 weeks from the previous one.
  • the skilled person in the art will be able to optimize the immunization protocol in order to enhance the quantity of antibodies which may be harvested.
  • Immunized mice are then sacrificed and their spleens harvested in order to recover B cells, which are further fused for immortalization with myeloma cells, such as, for instance, with NSO mouse myeloma cells.
  • Antibodies producing cells are then selected with an ELISA assay using the recombinant L-asparaginase of the invention as a coating antigen.
  • the selected clones are expanded for allowing the production of the antibodies, which are separated from the cells by a centrifugation and chromatographic step, for instance, by using a Protein A Sepharose column.
  • the present invention discloses a method for the detection in a sample of the presence of IgM and IgG antibodies against the L-asparaginase from Helicobacter pylori CCUG 17874 of the invention.
  • said method may be an immunologic assay, such as ELISA.
  • the method therefore, includes the step of coating an ELISA plate with the L-asparaginase of the invention, which is the antigen.
  • the assay is performed on a serum sample, i.e. the liquid fraction that can be separated from clotted blood
  • the above assay may be usefully carried out as a diagnostic tool to detect whether in a patient's serum sample there are present specific antibodies, in particular, IgG and/or IgM antibodies against the L-asparaginase from Helicobacter pylori CCUG 17874.
  • the detection of IgM antibodies in patients' serum can easily be performed replacing a peroxidase conjugated anti-human IgG antibody with a peroxidase conjugated anti-human IgM antibody.
  • the McNemar's test which is a statistical tool well known in the biosciences for the analysis of experimental results, has been used for the interpretation of the results obtained both when a commercial diagnostic method (Diamedix) and a method according to the present invention using the L-asparaginase from Helicobacter pylori CCUG 17874 have been performed. It came out that the proportion of positives detected by the L- asparaginase of the invention used as a single antigen is similar to that detected by the Diamedix kit.
  • the L-asparaginase from Helicobacter pylori CCUG 17874 might allow the identification of a 25% portion of the patients negative at the Diamedix kit, indicating that this enzyme might provide an antigen for an improved kit for detecting the patients who have come in contact with the bacterium and that would nevertheless be classified as false negatives according to the commercial kits which typically detect the Cag and Vac antigens. Accordingly, a diagnostic kit comprising the L-asparaginase from Helicobacter pylori CCUG 17874 immobilised onto a plate, represents a further object of the invention.
  • L-asparaginase may also be used as a medicament for the treatment of cancer.
  • ALL acute lymphatic leukemia
  • other ones may be malignant hematologic diseases such as other lymphoma types, leukemia, or myeloma, or non-malignant diseases such as autoimmune diseases (rheumatoid arthritis, Systemic Lupus Erythematosus), and even AIDS.
  • malignant hematologic diseases such as other lymphoma types, leukemia, or myeloma
  • non-malignant diseases such as autoimmune diseases (rheumatoid arthritis, Systemic Lupus Erythematosus), and even AIDS.
  • the pharmaceutical preparation comprising the L-asparaginase from
  • Helicobacter pylori CCUG 17874 represents another object of the present invention.
  • Said preparation also includes suitable stabilizers, preservatives and other pharmaceutically and physiologically acceptable eccipients as well known to the skilled person in the art.
  • the L-asparaginase from Helicobacter pylori CCUG 17874 can be used as a food additive in order to reduce the amount of acrylamide formed from the reaction between asparagine and reducing sugars contained in foods and, especially, in starch-based foods.
  • Starch-based foods include, for instance, potato chips, French fries, potato crisps or croquettes, cereals such as rye, corn, maize, barley, rice or oats containing products or wheat based products, which are largely consumed.
  • Other food products may be represented by coffee, cocoa, nuts, vegetables such as, for example, asparagus or fruits such as, for instance, bananas.
  • a method for reducing the production of acrylamide due to food processing, and especially during the processing of starch-based foods comprises the steps of applying the L-asparaginase from
  • foods may be those listed before, while processing includes, for instance, baking, frying, boiling or roasting or any other processing which is carried out at 120 0 C or even above.
  • the enzyme is applied to foods, for instance, by contacting the enzyme with foods or through the immersion of the foods in a solution containing the L-asparaginase for some times before processing, i.e. before frying, roasting, boiling or heating, in order to allow the L-asparaginase of the invention to act and reduce the quantity of asparagine in food.
  • the time required to inactivate the acrylamide producing amino acid, i.e. asparagine can be reduced compared to the other known enzymes.
  • Fig. 1 Represents the amino acid sequence alignment of L-asparaginase from different strains of H. pylori: from top to bottom: strain CCUG 17874, J99, HPAG1 and HP26695. Dashes indicate the highly conserved regions, dots and colons the sequence differences. The asterisks (*) indicate the first catalytic triad, the ⁇ symbol indicates the second catalytic triad (Sanches et al., 2007). Both of them are absolutely conserved throughout the strains. The figure was prepared with Clustalw.
  • Fig. 2 Shows the amino acid sequence alignments of L-asparaginases from different bacterial sources.
  • the sequence of H. pylori CCUG 17874 L-asparaginase (top) is aligned with the homologous proteins from different species whose structures are deposited in the PDB database. From top to bottom: W. succinogenes (PDB code: 1WSA); E. coli (PDB code: 1 NNS); Pseudomonas 7A (PDB code: 1DJP); A. glutaminasificans (PDB code: 1AGX); E. chrysanthemi (PDB code: 1O7J).
  • Fig. 3 Shows the SDS-PAGE and analytical gel filtration chromatography of recombinant H. pylori CCUG 17874 L-asparaginase.
  • A SDS-PAGE of the recombinant enzyme purified by affinity chromatography on a Ni ⁇ + - Sepharose column. 1.5 ⁇ g of recombinant H. pylori L-asparaginase (lane 2) were run in parallel with prestained precision plus molecular mass markers (Biorad, lane 1) on a 12% SDS gel and stained with Coomassie Blue R-250.
  • B Elution profile of L-asparaginase from a Superdex 200 10/300 GL column.
  • Fig. 4 Represents the steady state kinetics of recombinant H. pylori CCUG 17874 L-asparaginase as a function of L-asparagine or L-glutamine concentrations.
  • A Steady state kinetics of L-asparaginase using L- asparagine (•) or L-glutamine ( ⁇ ). All experiments were performed at 37°C according to the method of Balcao (Balcao et a/., 2001 ). The kinetic vs. L- asparagine is better highlighted in the inset.
  • B Hill plot of data represented in panel (A).
  • Fig. 5 Shows the effect of pH on the activity of L-asparaginase.
  • 0.1 M buffers were used like the following: glycine-HCI (pH range 1-2); citric acid (3-4.5); sodium acetate (3-5.5); MES (5.5-6.5); PIPES (6-7); HEPES (7-8); tricine (8-8.5); sodium phosphate and sodium bicarbonate (9.5-10.5).
  • the activity was assayed at 37°C using L-asparagine (•) or L-glutamine ( ⁇ ) as a substrate. The points are the average of at least three independent determinations. Standard Deviation is not shown for a better figure clarity.
  • Fig. 6 Shows the thermal inactivation of recombinant H.
  • Fig. 7 It is a cartoon representation of the active site and flexible lid loop of the calculated model of H. pylori L-asparaginase and of five L- asparaginase structures: E. coli (PDB code: 1 NNS), Pseudomonas 7A (PDB code: 1DJP), E.
  • chrysanthemi (PDB code: 1O7J), A. glutaminasificans (PDB code: 1AGX), W. succinogenes (PDB code: 1WSA).
  • Residue numbering according to H. pylori sequence (see Fig. 1 and Fig. 2).
  • Fig. 8 Represents a Western blot performed with an anti-asparaginase antibody on the subcellular fractions of H.
  • pylori CCUG 17874 From left to right: lane 1 : pre-lytic fraction; lane 2: periplasmic fraction; lane 3 and 4: soluble and insoluble spheroplast fractions, respectively. The same protein amounts (100 ⁇ g) were loaded in each lane. Molecular mass markers (kDa) are indicated.
  • Fig. 9 Shows the cell viability based on MTT reduction of several cell lines exposed to variable concentrations of recombinant H. pylori CCUG 17874 (a) and E. coli L-asparaginase (£>), expressed relative to the cell viability of the respective control (100%). The points represent the mean ⁇ SD (n > 3).
  • Fig. 10 shows the average and SD of the antibody titres detected in patients by the Diamedix kit and using L-asparaginase as an antigen.
  • Fig. 11 Shows the scatter plot of the antibody titres detected by the Diamedix kit and L-asparaginase as an antigen. It shows a scatter chart of the antibody titres obtained with the Diamedix kit (positive samples: black diamonds; negative samples: grey triangles) and the titres of the same samples, split into the same two groups, obtained towards L-asparaginase (positive at kit: empty squares; negative at kit: black squares).
  • Fig. 10 shows the average and SD of the antibody titres detected in patients by the Diamedix kit and using L-asparaginase as an antigen.
  • Fig. 11 Shows the scatter plot of the antibody titres detected by the Diamedix kit and L-asparaginase as an antigen. It shows a scatter chart of the antibody titres obtained with the Diamedix kit (positive samples: black diamonds;
  • the H. pylori CCUG 17874 strain obtained from the Culture Collection of the University Goteborg was stored at -80 0 C in 20% glycerol. After thawing, bacteria were grown on Columbia Agar plates containing 10% sheep blood, Skirrow antibiotic supplement (10 mg T 1 vancomycin, 1250 i.u.
  • the microaerobic atmosphere was composed by 20% CO 2 , 20% H 2 , 60% N 2 and 100% moisture.
  • bacteria were subcultured in Brucella medium (Difco) with 5% Foetal Bovine Serum (FBS, Life Tecnologies), Skirrow and Vitox, at 120 rpm, 37°C, in a thermostatic shaker under microaerophilic conditions for 24-36 h.
  • FBS Brucella medium
  • FBS Foetal Bovine Serum
  • Skirrow and Vitox at 120 rpm, 37°C
  • the culture optical density at 600 nm reached a value of 0.5 AU
  • bacteria from 5 ml culture were harvested by centrifugation (8000 g, 4°C, 10 min) and used for DNA extraction.
  • ansB gene cloning and construction of recombinant plasmids H. pylori DNA was isolated from bacterial cells by using the Dneasy tissue kit (QIAgen).
  • the DNA encoding the putative L-asparaginase was amplified by polymerase chain reaction (PCR) using primers designed according to the sequence of the ansB gene of the H. pylori HP26695 (GenBank accession code: NC_000915), corresponding to nucleotides 777473-776481 of the minus strand of the chromosomal DNA (locus tag HP0723).
  • the forward primer was 5'- GGCTCATGCCATGGCTCAAAATTTACCCACCATTGC and included an Nco I site (underlined).
  • the reverse primer was 5 1 - CATCCGCTCGAGTCATCAATACTCTTCAAACATTTCTTGG and included a Xho I site (underlined). Cycling conditions included a denaturation step at 94°C for 2 min, and 30 cycles of 94°C for 30 sec, 55°C for 30 sec, and 68 0 C for 1 min.
  • the PCR product was A-tailed with Taq polymerase and cloned into the pCR2.1-TOPO cloning vector (Invitrogen).
  • the insert was checked by digestion with Xho I and Nco I enzymes (New England Biolabs) and by sequencing (MWG).
  • the recombinant plasmid containing the ansB gene of H. pylori CCUG was designated pDC1.
  • the ansB gene carried by pDC1 was amplified by PCR using cycling conditions similar to the previous ones, except for the annealing temperature (65°C), and subcloned into the pET101 vector using the Directional TOPO Expression Kit (Invitrogen).
  • the oligonucleotides used for PCR were the following: 5'- CACCATGCATCATCACCATCACCATGACGATGACGATAAGGCTCAAA ATTTACCCACCATTGCTTT as forward primer (primer C) and primer B (see above), as reverse primer.
  • Primer C included a 6xHis tag nucleotide sequence, an enterokinase recognition sequence, and an overlapping CACC sequence suited for TOPO cloning in the pET101 vector.
  • the insert was checked by sequencing and the expression vector containing the desired ansB gene was named pDC2.
  • E. coli BL21 (DE3) cells transformed with pDC2 were grown at 37 0 C in 1 I 2xTY medium (AppliChem) containing carbenicillin (100 ⁇ g ml "1 ).
  • I 2xTY medium AppliChem
  • carbenicillin 100 ⁇ g ml "1 .
  • IPTG ⁇ -D-thiogalactopyranoside
  • cells were resuspended in 50 ml of 60 mM Tris-HCI pH 7.5, 100 mM NaCI (buffer A), 0.1 mM phenylmethanesulfonyl fluoride (PMFS, Sigma-Aldrich), sonicated 3 times for 1 min at 75 Watts with an Omniruptor sonicator (OMNI international) and centrifuged.
  • the supernatant was filter-sterilised (Millex GP 1 Millipore) and loaded onto a 1 ml Ni 2+ -Sepharose column (GE Healthcare) pre-equilibrated with buffer A.
  • the column was washed with 60 mM imidazole in buffer A, and elution was performed with 20 ml of a 60 to 150 mM imidazole gradient in buffer A. Protein fractions were analysed by 12% sodium-dodecyl-sulphate polyacrilamide gel electrophoresis (SDS-PAGE). Fractions containing the desired protein were pooled, concentrated, and dialysed against buffer A. The enzyme was stored at 4°C where it was stable for weeks.
  • the purified protein was subjected to gel filtration chromatography on a Superdex 200 10/300 GL column (GE Healthcare) equilibrated in buffer A.
  • a total of 200 ⁇ l of purified enzyme (1 mg ml "1 ) was applied to the column on a Pharmacia- LKB FPLC system (GE Healthcare) and eluted with the equilibration buffer at 0.5 ml min "1 .
  • the following proteins were used: lentil lectin (49 kDa), bovine serum albumin (66 kDa), E.
  • coli L- asparaginase 140 kDa
  • alcohol dehydrogenase 150 kDa
  • ⁇ -amylase 200 kDa
  • apoferritin 443 kDa
  • thyroglobulin 669 kDa
  • Protein concentration was determined by the Micro BCATM Protein Assay Kit (Pierce), using bovine serum albumin (BSA) as a standard.
  • Enzyme Assay L-asparaginase activity was measured by a colorimetric method according to Wriston and Yellin (Wriston and Yellin, 1973), using a Diode array 8452A spectrophotometer (Hewlett Packard). The method was based on a stopped assay which used Nessler's reagent to determine the amount of ammonia produced during the enzymatic hydrolysis.
  • the reaction mixture contained 100 mM 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES) pH 7.5 and 50 mM L-asparagine in a final volume of 200 ⁇ l.
  • HEPES 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid
  • the reaction was started by adding the enzyme solution (1 ⁇ g), carried out at 37 0 C for 10 min and stopped by addition of 50 ⁇ l of 20% trichloroacetic acid solution (TCA).
  • TCA trichloroacetic acid solution
  • the ammonia produced was coupled with Nessler's reagent, and was quantitatively determined using a standard curve prepared with known concentrations of ammonium sulphate.
  • the activity was expressed in Units (U), with one unit of L-asparaginase (U) defined as the amount of enzyme catalysing the production of 1 ⁇ mol of ammonia per min at 37 0 C.
  • the enzyme activity was determined in a Jasco V-550 UV ⁇ /IS spectrophotometer (Jasco-Europe, Cremella, Italy) at 37 0 C by means of a coupled assay with glutamate dehydrogenase, according to Balcao (Balcao et al., 2001 ), with minor modifications.
  • the standard reaction mixture contained 50 mM HEPES, pH 7.5, 1 mM ⁇ -ketoglutarate, 20 U glutamate dehydrogenase, 0.2 mM NADH, and variable concentrations of L-asparagine or L-glutamine, in a final volume of 1 ml.
  • the reaction was started by adding the enzyme solution (5 ⁇ g) and the activity expressed as Units, with one unit being the amount of enzyme catalysing the oxidation of 1 mmol NADH/min under the above conditions.
  • the enzyme activity was assayed at least at 10 different concentrations of substrates. All measurements were performed in triplicate.
  • the plot of Lineweaver-Burk was used to determine V max and K m values.
  • the Hill plot was used to determine the apparent S 0.5 and ⁇ H values.
  • the kinetic parameters were determined with the Enzyme Kinetic Module 1.1 (Sigma Plot, SPSS Inc.). kca t or turnover number is the number of catalytic events per sec per active site. K m is the substrate concentration at which the reaction velocity is half maximal.
  • S0.5 is used for reactions displaying sigmoidal kinetics and is defined as K m . k ca /So . 5 is a measure of how efficiently an enzyme converts substrate to product at low substrate concentrations.
  • Hill coefficient ( ⁇ H) is an empirical parameter related to the degree of cooperativity; values larger than unity indicate positive cooperativity among ligand binding sites.
  • Thermal stability (the ability of an enzyme to withstand incubation at a given temperature) was measured by incubating the enzyme (100 ⁇ g/mL) at given temperatures in 50 mM Hepes pH 7.5. Serum bovine albumin was added to maintain the protein final concentration at 1 mg ml "1 . Samples were removed at intervals, briefly chilled on ice and assayed as described above. The relative activity was calculated as the percentage of activity of the enzyme before the incubation. t 1/2 is the time required by the enzyme to lose 50% of its activity at a given temperature; T 50 is the incubation temperature at which the enzyme loses 50% of its activity in 10 min.
  • the models produced by Esypred and Geno3D based on the structures of the L-asparaginases from W. succinogenes and E. coli, turned out to be the most suitable for representing H. pylori enzyme because of their high similarity at the N-terminus.
  • the former model and the crystallographic structure of the tetrameric E. coli L-asparaginase in complex with aspartate (PDB code: 1 NNS) were used to rebuild the homotetramer in Swissprot.
  • the energy of the initial tetrameric model was minimized by the conjugate gradients method implemented in CNS (Brunger et al., 1998; Pai et al., 2006) and then subjected to structure idealisation using REFMAC (Winn et al., 2001) to obtain a model with ideal stereochemical parameters (i.e. absence of outliers in the Ramachandran plot), as assessed by PROCHECK (Laskowski et al., 1993). Model quality was then evaluated by PROSA 2003 (Sippl, 1993). Visual inspection of the model was carried out using the program O (Jones et al., 1991 ) and figures were prepared using the software Chimera (Pettersen et al., 2004).
  • a 6-month-old mouse (C57/B) was immunised with 30 ⁇ g recombinant H. pylori CCUG 17874 L-asparaginase + Complete Freunds Adjuvant (Pierce), followed by two boosts with 20 ⁇ g enzyme + Incomplete Freunds Adjuvant (Pierce), each 4 weeks from the previous one.
  • Antibody titre was analysed by direct ELISA using recombinant L-asparaginase as antigen.
  • the mouse was euthanised and the spleen harvested. B cells were recovered from the spleen, counted and fused with an equal number of NSO mouse myeloma cells.
  • the anti-asparaginase antibody was subjected to biotinylation with the FluoReporter Mini-Biotin-XX Protein Labeling Kit (Molecular Probes, Invitrogen).
  • the biotinylated antibody was then used in western blotting analysis to detect L-asparaginase in the H. pylori CCUG 17874 subcellular fractions.
  • proteins from different fractions and molecular weight markers were separated by a 12% SDS-PAGE in reducing conditions and transferred onto a polyvinylidene difluoride membrane (Millipore).
  • the membrane was blocked with 5% (w/v) milk powder in PBS containing 0.05% Tween (PBS- T) and incubated with the mouse monoclonal biotinylated anti- Asparaginase antibody in PBS-T, 1 % BSA for 1 h.
  • the H. pylori CCUG 17874 cell pellet obtained by centrifugation from a 50 ml bacterial culture was washed in 10 ml PBS, resuspended in 1.5 ml of 10 mM Tris HCI pH 7.6, 20% sucrose and after a 5 min incubation on ice mixed with 50 ⁇ l of 0.5 M EDTA 1 pH 8.0.
  • the supernatant containing proteins leaked out of the cells or located at or near the cell surface was collected (fraction 1 or pre-lytic), whereas the cells were converted into spheroplasts by osmotic shock, shifting them to a medium of low osmotic strength. Briefly, the cell pellet was resuspended in 1 ml cold water, vortexed, incubated on ice for 10 min, and centrifuged.
  • the supernatant containing the periplasmic fraction was collected (fraction 2), whereas the pellet containing the spheroplasts was resuspended in 500 ⁇ l 1 M Tris HCI, pH 7.6, vortexed, incubated on ice for 30 min and centrifuged.
  • the supernatant corresponding to the spheroplast soluble fraction was recovered (fraction 3), and the pellet containing the spheroplast insoluble fraction was resuspended in 500 ⁇ l 50 mM Tris HCI, pH 8.0, 2 mM EDTA, 0.1 mM DTT, 5% (v/v) glycerol, (fraction 4).
  • coli type Il L-asparaginase (Sigma) for 24 h.
  • cell survival was determined by MTT assay (Mosmann, 1983).
  • 10 ⁇ l of a 5 mg ml "1 solution of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) in PBS were added to each well, and, after 2 h incubation at 37 0 C and subsequent centrifugation, 100 ⁇ l DMSO were added to lyse the cells and solubilise the formazan crystals (reduced MTT) produced by the mitocondrial dehydrogenase activity.
  • MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide
  • the relevant DNA fragment was amplified by PCR using primers designed according to the sequence of the ansB gene of the H. pylori strain HP26695 (Genbank accession code: NC_000915), annotated as probable L-asparaginase by sequence similarity (locus tag: HP0723).
  • the PCR product was inserted into the pCR2.1-TOPO vector, thus generating the pDC1 construct, and sequenced.
  • the cloned gene consisted of 993 bp, corresponding to a protein of 330 amino acid residues.
  • the nucleotide resulted identical in 4 clones obtained from independent PCR amplifications (Fig. 1 ). This sequence was compared with those encompassing the ansB gene of three different H. pylori strains, i.e., HP26695, J99 and HPAG1 (Genbank accession codes: NC_000915, NC_000921 , and NC_008086, respectively). An identity of 92.00% was consistently found. The deduced amino acid sequence of this DNA fragment was then aligned with those of the above mentioned H.
  • pylori strains Genbank accession codes: NP_207517, NP_223379 and YP_627449, respectively
  • the full-length amino acid sequence was aligned with those of bacterial L-asparaginases whose structures have been deposited in the PDB database (Fig. 2), i.e., Wolinella succinogenes ⁇ W. succinogenes), E. coli, Pseudomonas 7A, E. chrysanthemi and Acinetobacter glutaminasificans (A.
  • the H. pylori CCUG 17874 ansB gene endowed with the nucleotide sequence for an N-terminal 6xHis tag was subcloned into the pET101/D-TOPO vector (see Materials and Methods).
  • the resulting recombinant expression vector, designated pDC2 was used to transform E. coli BL21(DE3) cells.
  • the highest level of soluble protein was gained on induction with IPTG at a final concentration of 1.5 mM at 20 0 C for 7 h.
  • the expressed protein was purified to homogeneity by affinity chromatography on a Ni 2+ -Sepharose column.
  • the elution of the protein from the column was performed using a 60 to 150 mM imidazole gradient.
  • the purity of the enzyme preparation was evaluated on a 12% SDS- PAGE. A single band was observed on the gel, corresponding to a molecular mass of approximately 37 kDa (Fig. 3a). This value was in good agreement with that predicted from the amino acid sequence for the recombinant protein (36,915.93 Da).
  • the protein yield resulted to be about 1 ⁇ 0.2 mg per litre of culture.
  • the enzyme activity was linear with the protein concentration, and the specific activity was 31.2 U mg "1 .
  • the enzyme was also active towards L-glutamine, although with a much lower catalytic efficiency (see below, Kinetic Properties, 1d)). Removal of the 6xHis tag by incubation with enterokinase did not significantly affect activity (data not shown).
  • the recombinant protein proved to be a tetramer of identical subunits.
  • the enzyme displayed molecular characteristics similar to most known bacterial asparaginases (Sanches ef a/., 2007).
  • Results are means ⁇ SE for 3 determinations from 3 different preparations
  • the enzyme activity as a function of pH was measured at saturating concentrations of L-asparagine or L-glutamine, using the method based on Nessler's reagent (Wriston and YeIHn, 1973) and/or the method of Balcao (Balcao et a/., 2001 ; Fig. 5).
  • the latter method could not be applied to assays performed at pH lower than 7, the glutamate dehydrogenase used as coupled enzyme being inactive at acidic pH values.
  • the pH-rate profile approximated a bell-shaped curve, with a maximum activity at a pH value of 7.5 and a lack of activity below pH 5.
  • a model of H. pylori CCUG 17874 L-asparaginase was built by homology modelling (see Materials and Method).
  • PROSA 2003 Z- score calculated for the energy minimised and idealised homotetrameric model, was -9.15, indicating a model of good quality (Sippl, 1993).
  • Fig. 7 depicts the model of the active site of H. pylori L-asparaginase overlapped on 5 known L-asparaginase structures (Sanches et a/., 2007). All the residues of the two catalytic triads of the generated model perfectly overlap onto those of the known structures, except for Glu289.
  • H. pylori CCUG 17874 prepared as reported under Experimental procedures were subjected to western blotting analysis to localise L-asparaginase.
  • a monoclonal antibody specifically raised towards H. pylori CCUG 17874 L-asparaginase allowed us to evidence two L-asparaginase forms with different molecular masses in all the three subcellular fractions analysed, that is the periplasmic and the spheroplast soluble and insoluble fractions (Fig. 8, lanes 2, 3 and 4).
  • the higher molecular mass form (approximately 39 kDa) was less represented (40%) than the lower one (about 37 kDa, 60%).
  • the difference between the two molecular masses (2 kDa) agrees with the approximate one calculated for the cleavable signal sequence predicted both by the program SignalP 3.0 (Bendtsen et al., 2004) and PSORTb (Gardy et a/., 2005).
  • the pre-lytic fraction seemed to include, although less represented, only the 37 kDa-form (Fig.
  • AGS derived from gastric adenocarcinoma
  • MKN28 derived from a human gastric tubular adenocarcinoma and showing moderate gastric-type differentiation
  • MKN7 derived from a well-differentiated tubular adenocarcinoma
  • MKN74 originating from a moderately differentiated tubular adenocarcinoma.
  • Leukemic cells HL60 and MOLT-4) and normal human diploid embryonic fibroblasts (HDF) were also tested.
  • the serum of each patient was analysed for diagnostic purposes using the commercial kit by Diamedix. The remaining serum was then transferred to the Laboratory of General Pathology of the Department of Experimental Medicine of the University of Pavia, where both repetition of the commercial test, to check serum preservation during shipping, and an ELISA test using recombinant L-asparaginase from H. pylori as an antigen were performed.
  • the experimental procedures are detailed below.
  • the H. pylori IgG Enzyme Immunoassay Test kit by Diamedix an immunoenzymatic assay with recombinant antigens to detect IgG against H. pylori in human serum and plasma, was used.
  • the microplate included in the kit is coated with bacterial antigens produced in recombinant form, among which CagA and VacA.
  • the samples and standard were prepared for calibration diluting them 1 :100 in 1 ml sample diluent.
  • the pre-coated microplate was removed from the pressure-sealed bag and 100 ⁇ l of samples and standards were pipetted in each well of the microplate.
  • the microplate was incubated at 37°C for 1 h. Then, the wells were emptied completely and washed 4 times with 300 ⁇ l washing solution, removing all the solution between one washing step and the next and tapping over a paper towel after the last wash. 100 ⁇ l of peroxidase conjugated antibody were pipetted in each well and, after sealing, the microplate was incubated at 37°C for 30 min. After washing like described above, 100 ⁇ l substrate were added to each well and left to incubate far from direct sunlight at room temperature for 30 min. The reaction was stopped with 100 ⁇ l stop solution. The reading was performed at 450 nm in a microplate reader (Biorad) within 60 min of stopping the reaction and using air as blank.
  • Biorad microplate reader
  • Quality control samples have been used, in particular: a negative control, with an absorbance lower than or equal to 0.150; a difference between the cutoff control and the negative control higher than or equal to 0.050 and a similar difference between the positive control and the cutoff control higher than or equal to 0.300.
  • a negative control with an absorbance lower than or equal to 0.150
  • a difference between the cutoff control and the negative control higher than or equal to 0.050 and a similar difference between the positive control and the cutoff control higher than or equal to 0.300.
  • U/ml (sample absorbance/absorbance cutoff) x 20
  • the results are interpreted like the following: The test is positive if >24 U/ml The test is negative if ⁇ 20 U/ml The test is borderline if comprised between 20 and 24 U/ml
  • the test has the following performance characteristics: Specificity: 98%
  • a 96-well plate (Pierce) was coated with recombinant H. pylori L- asparaginase by incubating each well with 100 ⁇ l protein, produced like described in the previous sections and resuspended at the concentration of 50 ⁇ g/ml in PBS. The incubation was performed in a humid chamber at 4°C for 16 h, after which the solution was removed and the wells washed 4 times with 300 ⁇ l washing buffer.
  • Detection of IgM antibodies in patients' serum can easily be performed replacing a peroxidase conjugated anti-human IgG antibody with a peroxidase conjugated anti-human IgM antibody.
  • Table 4 summarises the data concerning the antibody titres for different patients 1 groups (positive, negative and borderline), while Fig. 10 illustrates the relevant averages and Standard Deviation.
  • the antibody titre detected by the Diamedix kit is on average higher than that detected by the assay using recombinant L-asparaginase.
  • Table 5 reports the data used for the calculation of McNemar Chi Square Test to compare the results based on L-asparaginase with those based on the Diamedix kit.
  • the McNemar Chi Square Test value is 0.227, showing that proportions of positive results for the two ELISA tests were not significantly different and indicating an essential equivalence between them.
  • the sensitivity of the test was 0.63 and its specificity 0.50, with an efficacy of 54,17%.
  • the predictive value was 0.38.
  • the preliminary data here illustrated also suggest that L-asparaginase might allow the identification of a 25% portion of the patients negative at the Diamedix kit, indicating that the new antigen represents a valuable contribution to the improvement of the kit sensitivity.
  • a suitable amount of the L-asparaginase from Helicobacter pylori CCUG 17874 of the invention is dispersed in a solution.
  • the starch-based food is immersed in said solution for a suitable period of time; after that it is removed from the solution, dried and processed at a temperature above 120 0 C.
  • the amount of acrylamide produced can be measured by GS- chromatography and is expected to be lower than the amount of acrylamide produced in cases wherein L-asparaginase is not .
  • Biotechnol 10 5-24. Combet, C, Jambon, M., Deleage, G., and Geourjon, C. (2002) Geno3D: automatic comparative molecular modelling of protein.
  • Chrysanthemi 3937 cloning, expression and characterization. J Biotechnol 127: 657-669.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

La présente invention porte sur une nouvelle L-asparaginase provenant d'Helicobacter pylori. L'enzyme recombinante clonée à partir d'Escherichia coli a été isolée, purifiée et caractérisée. Elle peut être utilisée en tant que nouvel outil thérapeutique et de diagnostic. L'invention porte en outre sur son application en tant qu'additif alimentaire.
PCT/EP2008/006469 2008-08-06 2008-08-06 L-asparaginase provenant d'helicobacter pylori WO2010015264A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/EP2008/006469 WO2010015264A1 (fr) 2008-08-06 2008-08-06 L-asparaginase provenant d'helicobacter pylori

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/EP2008/006469 WO2010015264A1 (fr) 2008-08-06 2008-08-06 L-asparaginase provenant d'helicobacter pylori

Publications (1)

Publication Number Publication Date
WO2010015264A1 true WO2010015264A1 (fr) 2010-02-11

Family

ID=40524504

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2008/006469 WO2010015264A1 (fr) 2008-08-06 2008-08-06 L-asparaginase provenant d'helicobacter pylori

Country Status (1)

Country Link
WO (1) WO2010015264A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012075173A3 (fr) * 2010-12-01 2013-01-03 Board Of Regents The University Of Texas System Compositions et procédé de désimmunisation de protéines
WO2015103681A1 (fr) 2014-01-10 2015-07-16 Coppe/Ufrj, Instituto Alberto Luiz Coimbra De Pós-Graduação E Pesquisa De Engenharria L-asparaginase recombinante de zymomonas

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
CAPPELLETTI DONATA ET AL: "Helicobacter pylori L-asparaginase: A promising chemotherapeutic agent", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 377, no. 4, December 2008 (2008-12-01), pages 1222 - 1226, XP002524700, ISSN: 0006-291X *
DATABASE UniProt 30 May 2000 (2000-05-30), TOMB J ET AL: "L.asparaginase", XP002524701, retrieved from EBI Database accession no. 025424 *
DHAVALA PRATHUSHA ET AL: "Expression, purification and crystallization of Helicobacter pylori L-asparaginase", ACTA CRYSTALLOGRAPHICA SECTION F STRUCTURAL BIOLOGY AND CRYSTALLIZATION COMMUNICATIONS, vol. 64, no. Part 8, 31 July 2008 (2008-07-31), pages 740 - 742, XP002524694, ISSN: 1744-3091(print) 1744-3091(ele *
EL-BESSOUMY ASHRAF A ET AL: "Production, isolation, and purification of L-asparaginase from Pseudomonas aeruginosa 50071 using solid-state fermentation.", JOURNAL OF BIOCHEMISTRY AND MOLECULAR BIOLOGY 31 JUL 2004, vol. 37, no. 4, 31 July 2004 (2004-07-31), pages 387 - 393, XP002524697, ISSN: 1225-8687 *
JULYA KRASOTKINA ET AL: "One-step purification and kinetic properties of the recombinant L-Asparaginase from Erwinia carotovora", BIOTECHNOLOGY AND APPLIED BIOCHEMISTRY, vol. 39, no. Pt2, April 2004 (2004-04-01), England, pages 215 - 221, XP008105564 *
M. SANCHES ET AL: "structure, substrate complexation and reaction mechanism of bacterial asparaginases", CURRENT CHEMICAL BIOLOGY, vol. 1, 2007, pages 75 - 86, XP002524699 *
SUBHA MANNA ET AL: "Purification, characterization and antitumor activity of L-Asparaginase isolated from Pseudomonas stutzeri MB-405", CURRENT MICROBIOLOGY, vol. 30, 1995, pages 291 - 298, XP008105549 *
TOMB JEAN-F ET AL: "The complete genome sequence of the gastric pathogen Helicobacter pylori", NATURE (LONDON), vol. 388, no. 6642, 1997, pages 539 - 547, XP002524698, ISSN: 0028-0836 *
TOSA T ET AL: "L-asparaginase from Proteus vulgaris. Purification, crystallization, and enzymic properties.", BIOCHEMISTRY 18 JAN 1972, vol. 11, no. 2, 18 January 1972 (1972-01-18), pages 217 - 222, XP002524695, ISSN: 0006-2960 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012075173A3 (fr) * 2010-12-01 2013-01-03 Board Of Regents The University Of Texas System Compositions et procédé de désimmunisation de protéines
WO2015103681A1 (fr) 2014-01-10 2015-07-16 Coppe/Ufrj, Instituto Alberto Luiz Coimbra De Pós-Graduação E Pesquisa De Engenharria L-asparaginase recombinante de zymomonas

Similar Documents

Publication Publication Date Title
Zuo et al. Reduction of acrylamide level through blanching with treatment by an extremely thermostable L-asparaginase during French fries processing
Cappelletti et al. Helicobacter pyloril-asparaginase: a promising chemotherapeutic agent
Kawazoe et al. Crystal structure of human D‐amino acid oxidase: context‐dependent variability of the backbone conformation of the VAAGL hydrophobic stretch located at the si‐face of the flavin ring
Skouloubris et al. The AmiE aliphatic amidase and AmiF formamidase of Helicobacter pylori: natural evolution of two enzyme paralogues
Brown et al. Functional and structural characterization of four glutaminases from Escherichia coli and Bacillus subtilis
Böth et al. Peptidoglycan remodeling in Mycobacterium tuberculosis: comparison of structures and catalytic activities of RipA and RipB
Safary et al. Highly efficient novel recombinant L-asparaginase with no glutaminase activity from a new halo-thermotolerant Bacillus strain
Gu et al. Structural basis of enzymatic activity for the ferulic acid decarboxylase (FADase) from Enterobacter sp. Px6-4
EP2351837B1 (fr) Procédé de conception d une enzyme mutante, procédé de préparation de l enzyme mutante, et enzyme mutante
Pokrovskaya et al. Identification of functional regions in the Rhodospirillum rubrum L-asparaginase by site-directed mutagenesis
Moreno-Enríquez et al. Biochemical characterization of recombinant L-asparaginase (AnsA) from Rhizobium etli, a member of an increasing rhizobial-type family of L-asparaginases
Berger et al. Methionine regeneration and aminotransferases in Bacillus subtilis, Bacillus cereus, and Bacillus anthracis
Huang et al. Crystal structure and functional analysis of the glutaminyl cyclase from Xanthomonas campestris
Xu et al. Crystal structure of bile salt hydrolase from Lactobacillus salivarius
Ohtaki et al. Structure and characterization of amidase from Rhodococcus sp. N-771: insight into the molecular mechanism of substrate recognition
Bhattacharya et al. Interaction analysis of TcrX/Y two component system from Mycobacterium tuberculosis
Asojo et al. Structural and biochemical analyses of alanine racemase from the multidrug-resistant Clostridium difficile strain 630
Singh et al. Gene cloning, expression and homology modeling of hemolysin gene from Aeromonas hydrophila
EP2058394B1 (fr) Procede de conception d'enzyme mutee, son procede de preparation et enzyme mutee
Štefanić et al. Structural characterization of purine nucleoside phosphorylase from human pathogen Helicobacter pylori
Yu et al. Characterization of a novel allergen, a major IgE-binding protein from Aspergillus flavus, as an alkaline serine protease
WO2010015264A1 (fr) L-asparaginase provenant d'helicobacter pylori
Di Fraia et al. NADP+‐dependent glutamate dehydrogenase in the Antarctic psychrotolerant bacterium Psychrobacter sp. TAD1: Characterization, protein and DNA sequence, and relationship to other glutamate dehydrogenases
Sodolescu et al. Structural and functional insight into serine hydroxymethyltransferase from Helicobacter pylori
Wu et al. Enzymatic characterization and crystal structure analysis of the d‐alanine‐d‐alanine ligase from Helicobacter pylori

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08801524

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08801524

Country of ref document: EP

Kind code of ref document: A1