WO2010015040A1

WO2010015040A1 - Therapy and prevention of tdp-43 proteinopathy

Info

Publication number: WO2010015040A1
Application number: PCT/AU2009/001017
Authority: WO
Inventors: Peter Schofield; John Kwok; Agnes Luty; Carol Dobson-Stone
Original assignee: Powmri Ltd
Priority date: 2008-08-07
Filing date: 2009-08-07
Publication date: 2010-02-11

Abstract

The present invention provides methods for the therapy and prevention of TDP-43 proteinopathies and for the treatment of neuronal cells having elevated cytoplasmic TDP-43 comprising administration of one or more modulators of OPRS1 activity and/or level and/or expression sufficient to reduce, inhibit, prevent or delay cytoplasmic sequestration and/or cytoplasmic accumulation of TDP-43 protein in neuroglia and/or neuronal cells. The present invention also provides methods of identifying, isolating and formulating modulators of OPRS1 activity and/or level and/or expression for use in the preparation of a compositions for the treatment or prevention of a TDP-43 proteinopathy or for reducing cytoplasmic sequestration and/or cytoplasmic accumulation of TDP-43 protein in a neuronal cell having cytoplasmic elevated TDP-43 level.

Description

THERAPY AND PREVENTION OF TDP-43 PROTEINOP ATHY

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority from USSN 61/087,076 filed on August 7, 2008 entire contents of which are hereby incorporated by reference.

FIELD OF THE INVENTION

The present invention relates to the field of therapy and prophylaxis of neuronal degeneration and/or neurodegenerative disease associated with progressive degeneration of neurons and/or neuronal cell death in the brain and nervous system.

BACKGROUND OF THE INVENTION 1. Description of the related art

1.1 Nervous system degeneration

Nervous system degeneration is any loss, deterioration or impairment to one or more neuroglia and/or neurons of any morphology or functionality, including: (i) one or more unipolar neurons wherein the cell body comprises a single extension that gives rise to both dendritic and axonal branches e.g., dorsal root ganglia, granule cells of the olfactory bulb or hippocampus including the excitatory neurons of the dentate gyrus that project into the CA3 field of the hippocampus; (ii) one or more bipolar neurons wherein there is an extension at each end of the cell body e.g., retinal bipolar cells and cells of the cochlear and vestibular ganglia; (iii) one or more multipolar neurons wherein there are multiple extensions of the cell body e.g., central neurons (i.e., neurons of the central nervous system) that may be found in the cerebral cortex, nuclei of the brainstem or spinal cord, pyramidal cells (such as in the CAl and C A3 regions of the hippocampus and dentate gyrus), basal dendrites and apical dendrites of the cerebral cortex, and Perkinje cells of the cerebellum, glomerular neurons, and lateral geniculate nucleus, and in nuclei of the thalamus or cerebellum; (iv) one or more Golgi Type I neurons having long axons that connect to different parts of the nervous system; (v) one or more Golgi Type II neurons e.g., microneurons, having short axons that terminate in the vicinity of the cell body e.g., periglomerular cells of the olfactory bulb, or lacking obvious axons e.g., amacrine cells of the retina, and similar cell types in other parts of the central nervous system e.g., granule cells of the olfactory bulb, which may function as small inhibitory neurons; (vi) one or more central neurons e.g., having dendrites extending equally in all directions away from the cell body; (vii) one or more glial cells e.g., macroglial cells such as astrocytes, oligodendrocytes, glioblasts, pituicytes, Mϋller cells, Bergmann glial cells and/or microglial cells of the brain parenchyma, spinal cord; (viii) one or more ependymal cells e.g., lining the internal cavities of the brain or spinal cord; (ix) one or more capsular cells e.g., surrounding the cell bodies of the brain or spinal cord; (x) one or more Schwann cells ensheathing one or more axons; (xi) one or more teloglial cells ensheathing one or more motor neurons; (xii) one or more lemmal cells surrounding one or more sensory capsules; (xiii) one or more supporting cells e.g., of the sensory epithelia.

It is apparent from the preceding description that nervous system degeneration may occur in the central nervous system, including the brain and spinal cord surrounded by and including the pial envelope. The brain includes (i) rhombencephalon comprising inter alia medulla oblongata, pons and cerebellum; (ii) mesencephalon; and (iii) prosencephalon comprising inter alia the cerebrum, thalamus and hypothalamus. The spinal cord occupies the cranial two-thirds of the vertebral canal and extends from the level of the cranial border of the atlas to the caudal border of the first or second lumbar vertebra.

Nervous system degeneration may also occur in peripheral nerve fibres. By "peripheral" is meant external to the pial envelope covering the central nervous system albeit through which the peripheral nerves and central nerves are continuous. This includes the cerebrospinal and autonomic nervous systems e.g., cranial nerves and spinal nerves, and their associated ganglia containing nerve cell somata, associated neuroglia, and cellular and connective tissue elements ensheathing the nerves and ganglia. Moreover, nervous system degeneration may comprise neuronal degeneration or degeneration of the neuroglia or degeneration of the ependyma.

Nervous system degeneration may be a consequence of damage, trauma, aging, disease, or glutamate excess in any part of the central nervous system and/or peripheral nervous system. Because most neurons in mammals are post-mitotic, they are at risk for irreversible damage. For example, some neocortical and hippocampal neuronal loss during aging can be seen in individuals in the absence of trauma, e.g., stroke-related trauma causing such neuronal loss. Some neurons, such as human basal forebrain cholinergic neurons, show hypertrophy during normal aging.

1.2 Neurodegenerative disease

Neurodegenerative diseases are a group of disorders characterized by changes in neuronal function, leading in the majority of cases to loss of neuron function and cell death. As genetic and molecular studies of neurodegenerative diseases have progressed, there has been recognition of shared features across many of such diseases. Virtually all neurodegenerative diseases involve abnormal processing of neuronal proteins. For example, an increasing number of neurodegenerative cognitive and motor diseases are associated with cytoplasmic aggregates of transactivation response element (TAR)-DNA binding protein (TDP-43), e.g., frontotemporal lobar degeneration (FTLD), motor neuron disease (MND), amyotrophic lateral sclerosis (ALS), Lewy Body (LB) diseases such as Lewy Body Parkinson's Disease, dementia with LB disorder, or Alzheimer's Disease (AD). TDP-43 is a nuclear protein implicated in exon splicing and transcription regulation, leading to the new designation "TDP-43 proteinopathy" wherein the TDP-43 nuclear protein aggregates in the cytoplasm of affected neural cells, possibly as insoluble inclusions, and/or abnormally phosphorylated and/or abnormally ubiquitinated. Without being bound by any theory or mode of action, such TDP-43 aggregates or inclusions may be toxic to the cells e.g., by sequestering a functional nuclear protein in the nucleus. Exemplary TDP-43 pro tenopathies include e.g., frontotemporal lobar degeneration with ubiquitin-positive, tau-negative inclusions (i.e., FTLD-U), amyotrophic lateral sclerosis (ALS), motor neurone disease (MND), Parkinson's disease (PD), Guam parkinsonism-dementia, and Lewy body-related disease e.g., as Lewy Body Parkinson's Disease, dementia with LB disorder, or Alzheimer's Disease (AD). Occasional cytoplasmic TDP-43 staining of neural cells has also been noted in neurofibrillary tangles, corticobasal degeneration, and Pick's disease.

1.3 Dementia One of the most common forms of neurodegenerative disease is dementia. Dementia is characterized by more rapid progressive decline of cognitive function in a subject than is expected to occur as a result of normal aging. Generally, dementia is caused by neurological damage, disease and/or degeneration. As discussed further, below, dementia is generally observed in elderly subjects (i.e., 65 years of age or older). In this respect, in USA approximately 4 million to 5 million people suffer from a form of dementia. Based on the growth rate of the population aged 65 and beyond in industrialized countries over the past century, it is anticipated that, over the next generations, the proportion of elderly citizens will double, and, with this, the proportion of persons suffering from dementia.

Notwithstanding that dementia usually occurs in subjects over the age of 65, early onset, or presenile dementia, is observed in subjects under the age of 65. In this respect, a Health Retirement Study conducted in USA by Institute for Social Research at the University of Michigan found that approximately 480,000 subjects in USA suffered from some form of presenile dementia. Presenile dementia is generally caused by diseases, such as, for example, a TDP-43 proteinopathy selected from Alzheimer's disease, Parkinson's disease, frontotemporal lobar degeneration, or dementia with Lewy bodies. In presenile dementia, the onset of detectable cognitive symptoms occurs before the age of 65. The most common and most studied forms of dementia are Alzheimer's disease and frontotemporal dementia/frontotemporal lobar degeneration (FTLD/FTLD; Neary et al, Neurology 51: 1546-1554, 1998). Currently, it is estimated that there are 4.5 million cases of Alzheimer's disease in the US alone and that between about 12% and about 16% of patients with degenerative dementia. It is estimated that in the period from 2001 to 2010 an additional 1.5 million Alzheimer's disease cases is diagnosed in the US, while currently there are approximately 480 new cases of Parkinson's disease per million people per year diagnosed. Alzheimer's disease alone is the third most expensive disease in the United States, costing approximately US$100 billion each year for therapy and/or care of sufferers.

1.4 Frontotemporal lobar degeneration

Frontotemporal lobar degeneration (FTLD) is the third most common neurodegenerative disease resulting in dementia (FTLD) after Alzheimer's disease and dementia with Lewy bodies. Pathologically, FTLD is characterized by degeneration of neurons in the superficial frontal cortex and anterior temporal lobes. FTLD is a pathologically heterogeneous disorder but can be categorized into two main groups: cases with tau-positive pathology known as tauopathies, and the more frequent cases with ubiquitin-immunoreactive inclusions known as FTLD-U. TDP-43 was recently identified as a major protein component of the ubiquitin inclusions. A phosphorylated C-terminal fragment of TDP-43 and high molecular-mass ubiquitinated aggregates are enriched in FTLD-U and MND brains and mutations in the TDP-43 gene have been reported in familial and sporadic MND.

Patients suffering from FTLD generally develop several clinical presentations characterized by changes and personality and behavior, including a decline in manners and social skills representative of frontotemporal degeneration, and language disorders of expression (progressive aphasia) and comprehension (semantic dementia) (Neary et al, supra). However, in some cases amnesia is the presenting feature of FTLD (Graham et al, Brain, 128: 597-605, 2005). Approximately 40% of cases of FTLD are familial, indicating a significant genetic contribution to this disease (Rosso et al, Brain, 126: 2016-2022, 2003). Causal mutations were first identified in FTLD with Parkinsonism in the gene encoding microtubule associated protein tau (MAPT) on Chromosome 17 (Hutton et al, Nature, 393: 702-705, 1998). More recently, mutations in the progranulin (PGN) gene on chromosome 17 have also been identified (Baker et al., Nature, 442: 916-919, 2006). Mutations in the charged vesicular body protein 2 (CHMP2B) gene on Chromosome 3 have been associated with the rare form of TDP -43 negative FTLD-U (Skibinski et al, Nature Genetics, 37: 806-808, 2005). Mutations in the Valosin Containing Protein (VCP) gene have also been reported in a rare form of FTLD which includes inclusion body myopathy and Paget disease of the bone (Watt et al, Nature Genetics, 36: 377- 381, 2004). However, these mutations do not account for the majority of familial cases of frontotemporal dementia, and are rarely observed in sporadic frontotemporal dementia (Houlden et al Ann Neurol, 46:243-$, 1999).

7.5 Motor neuron disease

Motor neuron disease is generally characterized by degeneration of the upper and/or motor neurons. Motor neuron diseases are a class of diseases including amyotrophic lateral sclerosis (ALS), spinal muscular atrophy and spinal and bulbar muscular atrophy (SBMA, or Kennedy's disease). The most common form of motor neuron disease is ALS, which is characterized by degeneration of the upper and lower motor neurons, leading to progressive muscle atrophy and wasting, weakness and spasticity. Ultimately, ALS patients suffer from profound global paralysis and often die prematurely as a result of respiratory failure.

Approximately 10% of motor neuron cases have a positive family history (Strong et al, Can. J. Neurol, set, 18: 45-58, 1991). Mutations and polymorphisms associated with and/or causative of motor neuron disease have been identified in several genes, e.g., superoxide dismutase (SODl) gene on chromosome 21q22 (Rosen et al, Nature, 362: 59-62, 1993), dynactin (DCTNl) on Chromosome 2ρl3 (Nishimura et al, Am. J. Hum. Genet., 75: 822-831, 2004), and vesicle trafficking protein (VAPB) on chromosome 20ql3 (PuIs et al, Nat. Genet, 33: 455-456, 2003).. Linkage to chromosomes 15ql5- q22, 18q and 16q, have also been reported.

1.6 Alzheimer's disease Alzheimer's disease is a complex multigenic neurological disorder characterized by progressive impairments in memory, behavior, language, and visio-spatial skills, ending ultimately in death. Hallmark pathologies of Alzheimer's disease include granulovascular neuronal degeneration, extracellular neuritic plaques with β-amyloid deposits, intracellular neurofibrillary tangles and neurofibrillary degeneration, synaptic loss, and extensive neuronal cell death. It is now known that these histopathologic lesions of Alzheimer's disease correlate with the dementia observed in many elderly people.

Genetic studies of subjects with a family history of Alzheimer's disease indicate that mutations in genes, such as, for example, amyloid precursor protein, presenillin-1 or presenillin-2 cause early onset forms of this disease. However, these forms of Alzheimer's disease represent less than 5% of total cases of the disease.

Studies to identify polymorphisms and alleles that confer susceptibility to Alzheimer's disease have identified a large number of polymorphisms and mutations (reviewed in

Rocchi et al., Brain Res. Bull., 61: 1-24, 2003). The most widely studied of these is the ε4 isoform of the apolipoprotein E gene. A number studies have shown an association between apolipoprotein E ε4 (ApoE-ε4) and late onset familial and sporadic forms of

Alzheimer's disease (for example, Corder et al, Science 261: 261-263, 1993). However, less than 50% of non-familial Alzheimer's disease sufferers are carriers of the

ApoE-ε4 isoform (Corder et al, Science 261: 261-263, 1993).

1.7 Clinical overlap

There is overlap of symptoms between Alzheimer's, MND and FTLD. Of great significance was the recent discovery that TDP-43 is the main component of the ubiquitin-positive Tau and α-synuclein-negative inclusion bodies found in both MND and in FTLD with or without MND symptoms. This suggests a close etiological relationship between the two disorders. In addition, about 25% of FTLD cases have deposits of diffuse Aβ-positive plaques, a pathology that is consistent with AD.

1.8 Chromosome 9 locus for FTLD/MND neurodegeneration

Several genome-wide scans of pedigrees comprising affected individuals with FTLD and/or MND have identified regions within chromosome 9pl3.2-q22 associated with this complex of disorders. This locus also overlaps with one identified for late-onset Alzheimer's disease (Pericak-Vance MA et al. Exp Gerontol 35:1343-52 (2000)), highlighting the need to identify the gene that is involved in the pathogenesis of multiple neurodegenerative phenotypes.

1.9 Current therapies There is currently no FDA-approved medication indicated for FTLD treatment, and Riluzole, the only drug approved for MND treatment, yields a mere 3 -month increase in survival when taken for 18 months (Goodall EF and Morrison KE, Expert Rev MoI Med 8:1-22 (2006)). Approved AD treatments include acetylcholine esterase inhibitors (e.g., donepezil hydrochloride), which stabilise the neurotransmitter acetylcholine in the synaptic cleft, and the NMDA receptor antagonist, memantine, which counteracts the deleterious effects of high brain concentrations of glutamate (Gotz J et al. Med J Aust 185:381-4 (2006)). However, these treatments are symptomatic and not curative treatments.

Based on the discussion herein it is clear that there is a need for the identification of new targets and new drugs to diagnose and/or treat and/or prevent nervous system degeneration such as in the case of progressive nervous system degeneration associated with neurodegenerative disease e.g., Dementia, FTLD, MND, ALS, and Alzheimer's Disease. 2. General

The following publications provide conventional techniques of molecular biology. Such procedures are described, for example, in the following texts that are incorporated by reference: (i) Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual,

Cold Spring Harbor Laboratories, New York, Second Edition (1989), whole of VoIs I, II, and III; (ii) DNA Cloning: A Practical Approach, VoIs. I and II (D. N. Glover, ed.,

1985), IRL Press, Oxford, whole of text; (iii) Oligonucleotide Synthesis: A Practical Approach (M. J. Gait, ed., 1984)

IRL Press, Oxford, whole of text, and particularly the papers therein by Gait, ppl-22; Atkinson et al, pp35-81; Sproat et al, pp 83-115; and Wu et al., pp 135-151;

(iv) Nucleic Acid Hybridization: A Practical Approach (B. D. Hames & S. J. Higgins, eds., 1985) IRL Press, Oxford, whole of text;

(v) Perbal, B., A Practical Guide to Molecular Cloning (1984);

(vi) Methods In Enzymology (S. Colowick and N. Kaplan, eds., Academic

Press, Inc.), whole of series;

(vii) J.F. Ramalho Ortigao, "The Chemistry of Peptide Synthesis" In: Knowledge database of Access to Virtual Laboratory website

(Interactiva, Germany); (viii) Sakakibara, D., Teichman, J., Lien, E. Land Fenichel, R.L. (1976).

Biochem. Biophys. Res. Commun. 73 336-342 (ix) Meπifield, R.B. (1963). J. Am. Chem. Soc. 85, 2149-2154. (x) Handbook of Experimental Immunology, VoIs. I-IV (D. M. Weir and C.

C. Blackwell, eds., 1986, Blackwell Scientific Publications). SUMMARY OF THE INVENTION /. Introduction

In summary, the present invention provides diagnostic and prognostic processes for TDP -43 proteinopathy e.g., dementia and/or FTLD and/or MND and/or ALS and/or Alzheimer's Disease, such as incipient or early-stage or early-onset disease(s), wherein one or more mutations in OPRSl or nucleic acid encoding OPRSl or a variant OPRSl nucleic acid or protein is detected. The invention also provides therapeutic and prophylactic processes for treatment and/or prevention of TDP-43 proteinopathy e.g., dementia and/or FTLD and/or MND and/or ALS and/or Alzheimer's Disease, such as incipient or early-stage or early-onset disease(s), wherein the level of at least one OPRSl mRNA variant or protein isoform is reduced using an OPRSl inhibitory molecule. Optionally, the invention also provides methods for reducing amyloidogenesis e.g., by reducing gamma secretase activity, in a TDP-43 proteinopathy e.g., AD of FTLD, wherein the level of at least one OPRSl mRNA variant or protein isoform is reduced using an OPRSl inhibitory molecule. The present invention also provides methods for reducing a level of cytoplasmic TDP-43 in a neural cell and/or neuroglia using an OPRSl inhibitory molecule. The present invention also provides for the use of an OPRSl inhibitory compound in the manufacture of a medicament for treatment or prevention of TDP-43 proteinopathy, and optionally for reducing amyloidogenesis in a TDP-43 proteinopathy. The present invention also provides for the use of an OPRSl inhibitory compound in the manufacture of a medicament for reducing a level of cytoplasmic TDP-43 in a neural cell and/or neuroglia. The present invention also provides for the use of an OPRSl inhibitory compound in the manufacture of a medicament for reducing a level of gamma secretase activity in a neural cell and/or neuroglia.

In work leading up to the present invention the inventors sought to identify targets for the diagnosis and/or prognosis of nervous system degeneration and disease(s) associated therewith e.g., dementia and/or FTLD and/or MND and/or ALS and/or Alzheimer's Disease. The degeneration or disease may be, incipient. The inventors also sought to develop therapies for the treatment and/or prophylaxis of such nervous system degeneration and associated disease(s) e.g., in their incipient stage(s), using accepted models of these neurodegenerative diseases.

As exemplified herein, the inventors identified several mutations and/or polymorphisms within the opioid receptor sigma 1 (OPRSl) gene of subjects suffering from neurodegenerative disease, e.g., incipient or early-onset Alzheimer's disease or frontotemporal lobar dementia (FTLD) or motor neuron disease. For example, the inventors identified allelic variants within the 3 '-untranslated region (3'-UTR) of the OPRSl gene in subjects suffering from dementia that are not detected in healthy control subjects, wherein the allelic variants are associated with enhanced expression of an OPRSl gene in subjects suffering from neurodegenerative disease e.g., by virtue of enhanced mRNA stability and/or enhanced translation and/or enhanced steady state protein level.

An OPRSl gene is understood to include the coding region of a OPRSl protein (e.g., codons required to encode an isozyme of OPRSl) in addition to intervening intron sequence(s) and regulatory region(s) that control the expression of said gene, e.g., a promoter or fragment thereof and/or a 5' untranslated region and/or a 3' untranslated region.

For the purposes of nomenclature, an OPRSl gene comprises a sequence at least about 80% identical to the sequence set forth in SEQ ID NO: 13 and/or a sequence encoding a nucleic acid comprising a sequence at least about 80% identical to the sequence set forth in SEQ ID NO: 5. In another example, an OPRSl gene comprises a sequence at least about 85% identical to the sequence set forth in SEQ ID NO: 13 or at least about 90% to the sequence set forth in SEQ ID NO: 13 or at least about 95% identical to the to the sequence set forth in SEQ ID NO: 13. Alternatively, or in addition, an OPRSl gene comprises a sequence that encodes a sequence at least about 85% identical or at least about 90% identical or at least about 95% identical to the sequence set forth in SEQ ID NO: 5. A human OPRSl gene may comprise a nucleotide sequence set forth in SEQ ID NO: 13 and/or be capable of encoding a sequence set forth in SEQ ID NO: 5.

In one example, the inventors found that mutations in the 3'UTR of OPRSl significantly increased gene expression in transfected neuronal cells as well as in lymphocytes of mutation carriers. At least five such mutations were found associated with and/or causative of motor neuron disease; at least five such mutations were found associated with and/or causative of early onset dementia; at least four such mutations were found associated with and/or causative of FTLD; and/or at least one such mutation was found associated with and/or causative of early onset Alzheimer's disease. The associations between these mutations and disease are not necessarily exclusive and e.g., the same mutation(s) may associated with and/or causative of more than one neurodegenerative disease e.g., dementia and/or FTLD and/or MND and/or ALS and/or Alzheimer's Disease.

In another example, the inventors found that nucleotide changes in intron(s) of the OPRSl gene alter splicing of mRNA encoded there from, and reduce levels of normally spliced OPRS 1 mRNA. One exemplary nucleotide change is within intron 2 of the OPRSl gene, and within the binding site of two splicing factors, hnSNPF/H and SC35 in the OPRSl transcript.

In another example, a nucleotide substitution and a nucleotide insertion in the OPRSl promoter region is associated with increased expression of OPRSl.

In still other examples, the inventors identified mutations in patients suffering from a neurodegenerative disease, e.g., early onset Alzheimer's disease. An exemplary mutation that results in an alanine to valine substitution at amino acid position 4 of the encoded OPRSl protein is associated with increased levels of gamma-secretase, an amyloidogenic pathway protein that cleaves β-amyloid protein to thereby form the Aβ peptide that accumulates in plaques in subjects suffering from Alzheimer's disease and/or FTLD. The numerous associations identified by the present inventors indicate that mutations and/or polymorphisms within the OPRSl gene e.g., within the 5'-UTR such as in the promoter region or upstream thereof and/or within an intron sequence and/or within the 3'-UTR and/or within a coding sequence or exon are diagnostic of nervous system degeneration and/or associated disease(s) e.g., dementia and/or FTLD and/or MND and/or ALS and/or Alzheimer's Disease, such as incipient or early-stage or early-onset disease(s). These associations also indicate that mutations and/or polymorphisms within the OPRSl gene e.g., within the 5'-UTR such as in the promoter region or upstream thereof and/or within an intron sequence and/or within the 3'-UTR and/or within a coding sequence or exon are prognostic of a risk of nervous system degeneration or associated disease(s) e.g., dementia and/or FTLD and/or MND and/or ALS and/or Alzheimer's Disease developing in a subject.

Accordingly, one example of the present invention provides diagnosis of modified OPRSl activity and/or expression e.g., associated with nervous system degeneration e.g., neuronal degeneration and/or degeneration of neuroglia such as occurs in neurodegenerative disease and/or aging and/or trauma and/or damage and/or glutamate excess. The present invention also provides diagnosis of modified OPRSl activity and/or expression e.g., associated with one or more neurodegenerative diseases characterized by TDP-43 proteinopathy e.g., dementia and/or FTLD and/or MND and/or ALS and/or Alzheimer's Disease. The present invention also provides diagnosis of modified OPRSl activity and/or expression e.g., associated with cytoplasmic TDP- 43 inclusions. The present invention also provides diagnosis and/or prognosis of one or more neurodegenerative diseases characterized by TDP-43 proteinopathy and/or cytoplasmic TDP-43 inclusions e.g., dementia and/or FTLD and/or MND and/or ALS and/or Alzheimer's Disease, wherein the presence of one or more mutations and/or polymorphisms within an OPRSl gene associated with the one or more neurodegenerative diseases is detected in a sample obtained from a subject. It is understood by those skilled in diagnostics that processes for detection of one or more mutations and/or polymorphisms generally employ a detectable probe to bind to an analyte being detected thereby transforming both the probe and analyte to a complexed state capable of being detected e.g., by virtue of a reporter molecule bound to the probe and/or by virtue of a newly-synthesized product being formed as a direct consequence of complex formation. For example, a nucleic acid probe comprising a PCR primer is employed to bind nucleic acid comprising one or more mutations or polymorphisms thereby forming a nucleic acid duplex which is then detected by amplification, and optionally characterized further by sequence analysis or restriction enzyme digestion etc. In another example, a nucleic acid probe comprising a labeled hybridization probe is employed to bind nucleic acid comprising one or more mutations or polymorphisms to thereby form a nucleic acid duplex which is then detected by detecting the label bound to the complex via the hybridization probe. In another example, a probe comprising an antibody or antigen-binding fragment thereof is employed to bind protein encoded by nucleic acid comprising one or more mutations or polymorphisms (wherein the protein also comprises the one or more mutations or polymorphisms, or is encoded specifically as a consequence of the one or more mutations or polymorphisms being present in a corresponding gene e.g., in the case of a splice variant) to form an antigen-antibody complex which is then detected e.g., by virtue of the presence of a label being bound to the antibody or fragment, or using a secondary antibody, optionally labeled, to detect the antibody moiety of the antigen- antibody complex. In such a transformative process, a computer program performed on a machine may be employed to further transform patient data pertaining to a level of complex formed into a diagnostic test result as to the presence or absence of neurodegeneration or associated disease(s) e.g., early-stage or early-onset disease(s), and/or a likelihood of predisposition towards development of neurodegeneration or associated disease(s) e.g., early-stage or early-onset disease(s). Accordingly, in a further example, a "detection" in the context of a diagnostic or prognostic process includes one or more active transformation steps capable of producing or changing a substance employed in the test. Also exemplified herein, the inventors have also shown that OPRSl ligands, such as the antagonists haloperidol and AC915 or a salt, solvate or hydrate thereof, reduce cytoplasmic accumulation of TDP-43 in neural cells, thereby providing a means for regulating the formation and/or density of TDP-43 inclusion bodies in the cytoplasm e.g., of neuronal cells and/or neuroglia. By reducing OPRSl activity and/or expression using one or more OPRSl ligands, especially antagonists or inverse agonists of OPRSl, the present invention provides the means for treatment and/or prophylaxis of one or more TDP-43 proteinopathies including one or more neurodegenerative diseases e.g., dementia and/or FTLD and/or MND and/or ALS and/or Alzheimer's Disease, such as incipient or early-stage or early-onset disease(s).

OPRSl ligands, including the agonist opripramol and/or the antagonist haloperidol or AC915 reduce gamma secretase activity in neural cells, indicating that OPRSl ligands also reduce amyloidogenesis in a sub-class of TDP-43 proteinopathies characterized by amyloid deposition e.g., AD and FTLD. Accordingly, by reducing OPRSl activity and/or expression using one or more OPRSl ligands, especially antagonists or inverse agonists of OPRSl, the present invention also provides the means for treatment and/or prophylaxis of amyloidogenesis in one or more TDP-43 proteinopathies characterized by amyloid deposits in neural cells e.g., FTLD and/or Alzheimer's Disease.

The present invention also provides therapy and/or prophylaxis of one or more neurodegenerative diseases characterized by TDP-43 proteinopathy and/or cytoplasmic TDP-43 inclusions e.g., dementia and/or FTLD and/or MND and/or ALS and/or Alzheimer's Disease, wherein one or more OPRSl ligands is administered to a subject for a time and under conditions sufficient to modulate the level of TDP-43 inclusions in a subject.

The present invention also provides modulation of OPRS 1 activity and/or expression in neural cells using one or more OPRSl ligands that modulate the level of TDP-43 inclusions in the cytoplasm or their formation or accumulation. Another example of the present invention provides modulation of OPRSl activity and/or expression using one or more OPRSl ligands for therapy and/or prophylaxis of nervous system degeneration e.g., neuronal degeneration and/or degeneration of neuroglia such as occurs in aging and/or trauma and/or damage and/or glutamate excess.

It is understood by those skilled in therapeutics and preventive medicine that therapeutic and prophylactic processes wherein a modulator of a biological molecule or step or process is administered to a subject will generally transform the target biological molecule or step or process e.g., by changing a level of the molecule or flux through a step or process or changing the physical composition of the molecule such as by complexing with it, thereby producing a further transformation in symptoms of a subject being treated. Such therapeutic and prophylactic processes may also be performed with the aid of a machine e.g., syringe or other injection device, dialysis machine, etc.

The scope of the invention is apparent from the following summary of specific examples and/or detailed description of preferred examples and/or the accompanying claims.

2. Specific examples of the invention

One example of the present invention provides a method of treatment of a TDP -43 proteinopathy comprising administering to a subject an amount of a composition comprising a modulator of OPRSl activity and/or level and/or expression for a time and under conditions sufficient to reduce, inhibit, prevent or delay cytoplasmic sequestration and/or cytoplasmic accumulation of TDP -43 protein in neuroglia and/or neuronal cells, thereby treating the TDP-43 proteinopathy in the subject. The TDP-43 proteinopathy may be incipient or progressive.

Another example of the present invention provides a method of preventing a TDP-43 proteinopathy in a subject at risk thereof, said method comprising administering an amount of a composition comprising a modulator of OPRSl activity and/or level and/or expression for a time and under conditions sufficient to inhibit, prevent or delay cytoplasmic sequestration of TDP -43 protein in neuroglia and/or neuronal cells and/or to inhibit, prevent or delay an increase in level of TDP-43 protein in cytoplasmic inclusion bodies of neuroglia and/or neuronal cells, thereby preventing the TDP-43 proteinopathy in the subject. A subject for preventive therapy will generally not exhibit any disease symptom, however may have a family history of the disease and/or be at risk of developing a progressive TDP-43 proteinopathy.

In a related example, the present invention clearly encompasses therapeutic and prophylactic treatment of nervous system degeneration. For example, the present invention provides a method of therapy of nervous system degeneration in a subject diagnosed previously with nervous system degeneration, said method comprising administering an amount of a composition comprising a modulator of OPRS 1 activity and/or level and/or expression for a time and under conditions sufficient to reduce cytoplasmic sequestration of TDP-43 protein in neuroglia and/or neuronal cells and/or the level of TDP-43 protein in cytoplasmic inclusion bodies of neuroglia and/or neuronal cells and/or to inhibit, prevent delay further cytoplasmic sequestration of TDP-43 protein in neuroglia and/or neuronal cells, thereby treating degeneration of neuroglia and/or neurons. The nervous system degeneration may be incipient or early- stage or early-onset nervous system degeneration. Alternatively, or in addition, the nervous system degeneration may be progressive nervous system degeneration, e.g., in the case of a progressive neurodegenerative disease.

In a further related example, the present invention also provides a method of preventing nervous system degeneration in a subject at risk of developing nervous system degeneration, said method comprising administering an amount of a composition comprising a modulator of OPRSl activity and/or level and/or expression for a time and under conditions sufficient to inhibit, prevent or delay cytoplasmic sequestration of TDP-43 protein in neuroglia and/or neuronal cells and/or to inhibit, prevent or delay an increase in level of TDP-43 protein in cytoplasmic inclusion bodies of neuroglia and/or neuronal cells, thereby preventing degeneration of neuroglia and/or neurons. As with therapeutic regimes, the nervous system degeneration may be incipient and/or progressive nervous system degeneration, e.g., in the case of a progressive neurodegenerative disease.

In one example, cytoplasmic sequestration of TDP-43 is reduced e.g., in the case of therapeutic treatment of early stage, mid-stage or late-stage nervous system degeneration in a subject previously diagnosed with a nervous system degeneration. The invention is not to be limited by the degree of reduction in cytoplasmic sequestration of TDP-43, and the invention may produce a steady state level of TDP-43 of less than about 90% or 80% or 70% or 60% or 50% of a level of cytoplasmic TDP- 43 before treatment or in the absence of treatment.

As used herein, the terms "inhibit" and "prevent" are not to be construed as necessarily indicating 100% inhibition or prevention of cytoplasmic sequestration of TDP-43 in neuroglia and/or neurons in a prophylactic context for preventing nervous system degeneration in a subject at risk. Nor do the terms "inhibit" and "prevent" necessarily indicate 100% inhibition or prevention of cytoplasmic sequestration of TDP-43 in neuroglia and/or neurons of a subject diagnosed previously with nervous system degeneration. A partial inhibition or partial prevention e.g., as determined by a reduction in a steady state level of cytoplasmic TDP-43 of at least about 10% or 20% or 30% or 40% or 50% compared to the level of cytoplasmic TDP-43 before treatment or in the absence of treatment is clearly encompassed by the terms "inhibit" and "prevent". In a therapeutic context, such a partial inhibition or partial prevention of further cytoplasmic sequestration of TDP-43 in neuroglia and/or neurons of a previously- diagnosed subject is encompassed by the present invention.

Similarly, the term "delay" shall not be taken to mean indefinite delay in cytoplasmic sequestration of TDP-43 in neuroglia and/or neurons at risk of nervous system degeneration or diagnosed previously with nervous system degeneration. As used herein, the term "cytoplasmic sequestration" is taken to mean the cytoplasmic localization, aggregation or accumulation of any TDP-43 protein or variant thereof e.g., a phosphorylated, ubiquitinated or fragments variant e.g., mediated by OPRSl expression and/or activity. Cytoplasmic sequestration also includes an increase in the rate of deposition of TDP-43 protein or variant. Cytoplasmic localization is understood to be conferred by any one or more of a number of mechanisms including translocation from another cellular compartment, e.g., the nucleus.

As is known to the skilled artisan, the "cytoplasm" includes the protoplasm of a cell excluding the nucleus and includes, but is not limited to the cytosol and other cytoplasmic structures, e.g., inclusion bodies.

As used herein, the term "cytoplasmic inclusion body" or similar term shall be taken to mean an abnormal structure that is detectable in cytoplasm comprising TDP-43 protein or variant thereof.

In performing the method of the present invention, the modulator may reduce, inhibit or delay OPRSl activity and/or level and/or expression, thereby reducing, inhibiting, preventing or delaying cytoplasmic sequestration of TDP-43 and/or reducing the level of TDP-43 in cytoplasm or cytoplasmic inclusion bodies of neuroglia and/or neuronal cells.

In one example, the administered composition is suitable for reducing degeneration of neuroglia and/or neurons of the central nervous system, e.g., in the brain, such as in the hippocampus (e.g., CAl and/or CA3 regions), dentate gyrus, frontal neocortex, temporal neocortex, or brain parenchyma and combinations thereof. In a preferred example, the composition reduces degeneration of astrocytes and/or neurons in one or more of hippocampus (e.g., CAl), dentate gyrus and brain parenchyma.

In another example, the administered composition is suitable for reducing degeneration of neuroglia and/or neurons of the peripheral nervous system. In another example, the administered composition is suitable for reducing degeneration of neuroglia, e.g., glial cells such as astrocytes, oligodendrocytes, glioblasts, pituicytes, Mύller cells, Bergmann glial cells or microglial cells and combinations thereof.

In another example, the administered composition is suitable for reducing degeneration of neurons comprising neuronal cells.

There are various modes of administering a composition in accordance with the method of the present invention for the purposes of therapy or prophylaxis of nervous system degeneration. In one example, the composition is administered orally e.g., as capsules, soft gels, or tablets; powders or granules; solutions or suspensions in aqueous or nonaqueous liquids; edible foams or whips; or oil-in-water liquid emulsions or water-in-oil liquid emulsions, hi another example, the composition is administered by injection or infusion e.g., intravenous, intraperitoneal, intracerebral, subcutaneous, intramuscular, intraocular, intraarterial, intracerebrospinal, intralesional injection. In another example, the composition is administered by inhalation e.g., intranasally or by pulmonary spray. For example, the agent can be solubilized and loaded into a suitable dispenser for administration (e.g., an atomizer, nebulizer or pressurized aerosol dispenser).

In these examples of therapeutic and preventive intervention, the composition may be administered orally, parenterally e.g., by injection, or intranasally e.g., by inhalation. The composition may also be administered topically e.g., by means of a transdermal patch. The composition will generally be formulated with a suitable excipient, carrier or diluent for administration to a subject e.g., using an alcohol-containing solution or detergent-containing solution to enhance solubility of the active agent i.e., the OPRSl modulator. A suitable detergent is a non-ionic detergent. A suitable alcohol ethanol, isopropanol or butanol.

Preferred modes of administration permit or facilitate the composition to cross the blood-brain barrier in the case of treatment of central nervous system degeneration. Alternatively, in the case of treatment of peripheral nervous system degeneration, the ability to cross the blood-brain barrier is less significant.

In these examples of therapeutic and preventive intervention, the method may additionally comprise disrupting or perforating the blood-brain barrier to thereby permit the composition to cross the blood brain barrier and then administering the composition e.g., in the case of a composition that is not readily able to cross the blood brain barrier when administered at a remote location from the central nervous system. In one example, a focused ultrasound is applied to a region of the blood brain barrier, to thereby permit a composition to cross the blood brain barrier and then administering the composition e.g., by injection or infusion. Preferably, such disruption or perforation of the blood-brain barrier is temporary and for a minimum time and sufficient for administration of the composition to occur.

As used herein, the term "modulator of OPRSl activity and/or level and/or expression" means any composition that increases or reduces OPRSl protein activity, increases or reduces downstream signaling from OPRSl, increases or reduces steady state OPRSl protein level or synthesis or turnover, increases or reduces a level of mRNA encoding OPRSl, increases or reduces turnover of mRNA encoding OPRSl, or increases or reduces the transcription rate of mRNA encoding OPRS 1.

In one example, downstream signaling includes modulation of ion channel activity, cytoskeletal proteins such as ankyrin, intracellular calcium levels, or sphingolipid levels and/or compartmentalization/transport of ER-synthesized lipids.

In one example, a modulator of OPRSl activity and/or level and/or expression comprises a ligand of OPRSl e.g., a small molecule or antibody that binds to the receptor. The ligand may be selective for sigma-1 receptors e.g., OPRSl, or it may be non-selective i.e., binding to opioid receptors such as sigma-2 or sigma-3 receptors and to OPRSl. A modulator of OPRSl, including a ligand of the receptor, may a small molecule having the effect of an inverse agonist or antagonist of the receptor. An "inverse agonist" is an agent that binds to the same OPRSl binding-site as an agonist of the receptor and exerts an opposite pharmacological effect to the agonist. An "antagonist" is an agent that binds to and/or has affinity for OPRSl, however does not provoke a biological response itself upon binding to OPRSl, but blocks or dampens an agonist- mediated response. For example, an antagonist may inhibit an interaction between an agonist or inverse agonist and OPRSl.

In these examples of therapeutic and preventive intervention, the composition may comprise a modulator of OPRSl activity that reduces activity of at least one isoform of OPRSl in neuroglia and/or neuronal cells. For example, the modulator of OPRSl activity comprises an inverse agonist of OPRSl activity. Alternatively, the modulator of OPRSl activity comprises an antagonist of OPRSl activity. An inverse agonist or antagonist may be a small molecule e.g., selected from 9-[3-(c/s-3,5-dimethyl-l- piperazinyl)propyl]carbazole (rimcazole), N-[2-(3 ,4-Dichlorophenyl)ethyl]-N-methyl- 2-(dimethylamino)ethylamine (BD-1047), l-[2-(3,4-Dichlorophenyl)ethyl]-4- methylpiperazine (BD-1063), (4-Fluorophenyl)-4-(5-fluoro-2-pyrimidinyl)- 1 - piperazinebutanol (BMY-14802), (iV,Λr-dipropyl-2-[4-methoxy-3-(2- phenylethoxy)phenyl]-ethylamine (NE- 100), N-(2-(3,4-dichlorophenyl)acetoxy)- ethylpyrrolidine (AC915), 4-[4-(4-chlorophenyl)-4-hydroxypiperidino]-4'- fluorobutyrophenone (haloperidol), combinations thereof, and salts, solvates, hydrates, analogs and derivatives having inverse agonist or antagonist activity toward OPRSl . In another example, the small molecule is selected from AC915 and haloperidol, a combination thereof, and salts, solvates, hydrates, analogs and derivatives having inverse agonist or antagonist activity toward OPRSl. Haloperidol decanoate or a salt, solvate or hydrate thereof may be used e.g., by virtue of having a longer half-life than haloperidol. Exemplary salts include e.g., chloride, bromide and oxalate salts, including monochlorohydrates, dichlorohydrates, monobromohydrates and dibromohydrates of these compounds. In another example, an inverse agonist or antagonist of OPRSl is selected from AC915 and haloperidol, combinations thereof, and salts, solvates, hydrates, analogs and derivatives having antagonist activity toward OPRS 1.

In another example, an inverse agonist or antagonist of OPRS 1 is haloperidol or an analog thereof e.g., haloperidol decanoate i.e., 4-(4-chlorophenyl)-l-l[4-(4- fluorophenyl)-4-oxobutyl]-4 piperidinyl decanoate or a salt, solvate or hydrate thereof.

In another example, an inverse agonist or antagonist of OPRSl is AC915 or an analog thereof e.g., AC915 oxalate, or a salt, solvate or hydrate thereof.

In another example, an inverse agonist or antagonist of OPRSl is 9-[3-(cw-3,5- dimethyl-l-piperazinyl)propyl]carbazole (i.e., rimcazole) or an analog thereof e.g., 9- [3-(cw-3,5-dimethyl-4-methyl-l-piperazinyl)-propyl]carbazole (SH 1-73) or 3,6- dibromo-9-[3-(c/-?-3,5-dimethyl-l-piperazinyl)-propyl]carbazole (SH 1-76) or [3-(cis- 3,5-dimethyl-4-[3-phenylpropyl]-l-piperazinyl)-propyl]diphenylamine (SH 3-24), or 9-[3-(c/5'-3,5-dimethyl-4-[3-phenylpropyl]-l-piperazinyl)-propyl]carbazole (SH 3-28), or a salt, solvate or hydrate thereof.

In another example, an inverse agonist or antagonist of OPRS 1 is (4-Fluorophenyl)-4- (5-fluoro-2-pyrimidinyl)-l-piperazinebutanol (BMY- 14802) or a salt, solvate or hydrate thereof.

In another example, an inverse agonist or antagonist of OPRSl is N,iV-dipropyl-2-[4- methoxy-3-(2-phenylethoxy)phenyl]-ethylamine (NE-100) or a salt, solvate or hydrate thereof.

In another example, an inverse agonist or antagonist of OPRSl is l-[2-(3,4- Dichlorophenyl)ethyl]-4-methylpiperazine (BD-1063) or a salt, solvate or hydrate thereof. Alternatively, an inverse agonist or antagonist of OPRSl may be an antibody that binds to OPRSl and inhibits the receptor.

Alternatively, an inverse agonist or antagonist of OPRSl may be neurosteroid e.g., progesterone, or fragments thereof that retain the ability to bind to OPRS 1 without eliciting any functional signaling from the receptor. For example, such binding may be non-competitive thereby blocking the receptor from binding a natural ligand or an agonist of the receptor.

Alternatively, an inverse agonist or antagonist of OPRSl may be a peptide mimetic of a ligand of OPRSl having the ability to bind to OPRSl and inhibit or prevent binding of a natural ligand or agonist.

Alternatively, an inverse agonist or antagonist of OPRSl may be a dominant negative mutant of a protein ligand of OPRSl having the ability to bind to OPRSl and inhibit or prevent binding of the natural protein ligand or agonist.

In another example, the composition comprises a modulator of OPRSl expression that reduces the expression of at least one OPRSl mRNA variant in neuroglia and/or neuronal cells e.g., comprising siRNA, RNAi or miRNA. In one example, siRNA, RNAi or miRNA comprises a sequence complementary to a region spanning about 21 to 23 contiguous base pairs of a 3'-untranslated region (3'-UTR) of mRNA encoding at least one OPRSl mRNA variant in neuroglia and/or neuronal cells, thereby reducing the expression of OPRSl in said neuroglia and/or neuronal cells. It is apparent from the Sequence Listing provided herein that the 3'-UTR of the OPRSl gene comprises a nucleotide sequence as represented by nucleotide position 744 to 1655 of SEQ ID NO: 5 including any allelic variant thereof e.g., a sequence having a mutation or polymorphism at position 772 and/or position 788 and/or position 793 and/or position 797 ofSEQ ID NO: 5. In another examples, a modulator of OPRSl activity and/or level and/or expression comprises a non-ligand peptide, protein, antibody, nucleic acid or small molecule.

In another example, a modulator of OPRSl activity and/or level and/or expression comprises an agonist or partial agonist of OPRSl activity and/or level and/or expression. As used herein, the term "agonist" shall be taken to refer to an agent that binds and activates OPRSl at full efficacy. A "partial agonist" is an agent binds and activates OPRSl at a sub-maximum activity level.

In one example, an OPRSl agonist is selected from cocaine, diacetylmorphine, PCP, fluvoxamine, methamphetamine, dextromethorphan, berberine, 4-PPBP, dextromethorphan, BD-1008 i.e., N-[2-(3,4-Dichlorophenyl)ethyl]-N-methyl-2-(l- pyrrolidinyl)ethylamine, dimethyltryptamine, dimemorfan, ditolylguanidine, L- 687,384, noscapine, opipramol, pentoxyverine, PRE-084 i.e., 2-(4-morpholinethyl)-l- phenyl cyclohexanecarboxylate, ( 1 -(3 ,4-dimethoxyphenethyl)-4-(3 -phenylpropyl) piperazine (SA 4503), l'-[4-[l-(4-fluorophenyl)-lH-indole-3-yl]-l-butyl]- spiro[isobenzo-furan-l(3H),4'-piperidine] (siramesine), a (+)-benzomorphan such as (+)-pentazocin or (+)N-allyl-normetazocine, caramiphen, scopolamine, igmesine, and salts, solvates, hydrates, analogs and derivatives having agonist activity toward OPRSl. Exemplary salts include e.g., chloride, bromide and oxalate salts, including monochlorohydrates, dichlorohydrates, monobromohydrates and dibromohydrates of these compounds.

Alternatively, an agonist of OPRSl may be an antibody that binds to OPRSl and activates the receptor.

In therapy and prevention of TDP-43 proteinopathy, it is preferred to employ an inhibitory molecule for the purpose of reducing TDP-43 sequestration and/or accumulation in the cytoplasm of neural cells and/or neuroglia. This is because elevated OPRSl is associated with elevated cytoplasmic TDP-43 in such pathologies. In yet another example, the method comprises administering a composition comprising an antagonist or inverse agonist of OPRSl activity and/or level and/or expression for a time and under conditions sufficient to reduce TDP-43 sequestration in the cytoplasm or prevent increased TDP-43 sequestration in the cytoplasm, and administering a composition comprising an agonist or partial agonist of OPRSl activity and/or level and/or expression for a time and under conditions sufficient to enhance TDP-43 sequestration in the cytoplasm, thereby regulating the level of TDP-43 sequestration in the cytoplasm within a defined limit or level. In accordance with this example, the composition comprising agonist or partial agonist, and the composition comprising an antagonist or inverse agonist may be administered at different times to an individual being monitored for TDP-43 sequestration in the cytoplasm and/or cytoplasmic accumulation and/or formation of cytoplasmic TDP-43 inclusion bodies.

These therapeutic and preventive interventions are suitable for treatment or prevention of any TDP-43 proteinopathy, including e.g., frontotemporal lobar degeneration (FTLD), amyotrophic lateral sclerosis (ALS), motor neurone disease (MND), Parkinson's disease (PD), Guam parkinsonism-dementia, or a Lewy body-related disease such as Alzheimer's disease (AD).

The therapeutic or preventive intervention of a Lewy-Body disease in accordance with the invention may also comprise administering the composition for a time and under conditions sufficient to reduce gamma-secretase activity in neuroglia and/or neuronal cells, thereby reducing the formation and/or level of amyloid deposits in Lewy Bodies of neuronal cells and/or neuroglia. Alternatively, or in addition, such intervention may also comprise administering the composition for a time and under conditions sufficient to reduce Lewy Body formation or level in Lewy Bodies of neuronal cells and/or neuroglia. Any diagnostic method for detecting Lewy Body levels in cells may be employed for such purposes. In one example, homogeneous staining of dense cored amyloid plaques is performed. In another example, positron emission tomography (PET) imaging is performed to determine Lewy Body level in the subject's neuroglia and/or neuronal cells. PET imaging is performed by injecting a radiolabeled tracer e.g., an antibody that binds to Lewy Bodies and detecting a complex formed between the tracer and the Lewy Bodies using a PET scanner. A computer program converts the data to a test result.

It will be apparent from this disclosure that the present invention may also be employed for therapy and prevention of any neurodegenerative disease characterized by neuroglia and/or neuronal cell death. The neuronal cell death observed in a neurodegenerative disease is often preceded by neuronal dysfunction, sometimes by several years. Accordingly, the term "neurodegenerative disease" includes a disease or disorder that is characterized by neuronal dysfunction and eventually neuronal cell death. Often neurodegenerative diseases are also characterized by increased gliosis (e.g., astrocytosis or microgliosis) in the region/s of neuronal death. Cellular events observed in a neurodegenerative disease often manifest as a behavioral change (e.g., deterioration of thinking and/or memory) and/or a movement change (e.g., tremor, ataxia, postural change and/or rigidity).

Exemplary neurodegenerative diseases characterized by neuroglia and/or neuronal cell death include FTLD, Alzheimer's disease, amyotrophic lateral sclerosis, ataxia (e.g., spinocerebellar ataxia or Friedreich's Ataxia), Creutzfeldt-Jakob Disease, a polyglutamine disease (e.g., Huntington's disease or spinal bulbar muscular atrophy), Hallervorden-Spatz disease, idiopathic torsion disease, Lewy Body disease, multiple system atrophy, neuroanthocytosis syndrome, olivopontocerebellar atrophy, Parkinson's disease, Pelizaeus-Merzbacher disease, Pick's disease, progressive supranuclear palsy, syringomyelia, torticollis, spinal muscular atophy, a trinucleotide repeat disease (e.g., Fragile X Syndrome), and a dementia.

As used herein, the term "dementia" shall be taken to mean a disease or condition characterized by chronic loss of mental capacity, particularly progressive deterioration of thinking and/or memory and/or behavior and/or personality and/or motor function, and may also be associated with psychological symptoms such as depression and apathy. In this respect, dementia is not caused by, for example, a stroke, an infection or a head trauma. Examples of dementia include, for example, an Alzheimer's disease, vascular dementia, dementia with Lewy bodies and frontotemporal lobar dementia, amongst others.

In another example, the method of the present invention treats presenile dementia. In this respect, the term "presenile dementia" is understood in the art to mean a dementia characterized by the onset of clinically detectable symptoms before a subject is 65 years of age.

In another example, the dementia is an Alzheimer's disease or FTLD. By "an Alzheimer's disease" is meant a neurological disorder characterized by progressive impairments in memory, behavior, language and/or visuospatial or visiospatial skills. Pathologically, an Alzheimer's disease is characterized by neuronal loss, gliosis, neurofibrillary tangles, senile plaques, Hirano bodies, granulovacuolar degeneration of neurons, amyloid angiopathy and/or acetylcholine deficiency. The term "an Alzheimer's disease" shall be taken to include early onset Alzheimer's disease (e.g., with an onset of detectable symptoms occurring before a subject is 65 years of age) or a late onset Alzheimer's disease (e.g., with an onset later then, or in, the sixth decade of life). In one example, the Alzheimer's disease is an early onset Alzheimer's disease.

For example, the Alzheimer's disease is a plaque predominant Alzheimer's disease. As used herein, the term "plaque predominant Alzheimer's disease" shall be taken to mean a variant form of Alzheimer's disease characterized by numerous senile plaques in the relative absence of neurofibrillary tangles.

In another example, the disease is a motor neuron disease. As used herein, the term "motor neuron disease" shall be taken to mean a disease characterized by dysfunction and/or death of motor neurons, e.g., upper motor neurons and/or lower motor neurons. Generally, a motor neuron disease presents as muscle weakness and atrophy, with the weakness often presenting in the limbs and/or as difficulty swallowing. As motor neuron disease progresses an affected subject often develops difficulty walking and lifting objects, and eventually difficulty breathing. Exemplary motor neuron diseases include amyotrophic lateral sclerosis (ALS) and spinal muscular atrophy (SMA). Preferably, the motor neuron disease is ALS.

In performing these therapeutic or preventive interventions, it is also possible to monitor the success of therapy e.g., by determining a level of TDP-43 protein in the cytoplasm of neuroglia and/or neuronal cells of the subject wherein a reduced level thereof indicates effective therapy or prevention of the TDP-43 proteinopathy. Any diagnostic method for detecting TDP-43 levels in cells may be employed for such purposes. In one example, immunohistochemistry employing an antibody to bind to TDP-43 is performed to determine the level of TDP-43 in the cytoplasm of the treated subject e.g., relative to a level in the subject before treatment commenced, or relative to a level in a healthy subject or a subject suffering from a TDP-43 proteinopathy. A ratio of cytoplasmic TDP-43 to nuclear TSP-43 may also be determined. In another example, positron emission tomography (PET) imaging is performed to determine cytoplasmic TSP-43 level in the subject's neuroglia and/or neuronal cells. PET imaging is performed by injecting a radiolabeled tracer e.g., an antibody that binds to TDP-43 and detecting a complex formed between the tracer and TDP-43 using a PET scanner. A computer program converts the data to a test result.

Another example of the present invention provides a method of reducing, inhibiting, preventing or delaying cytoplasmic sequestration and/or cytoplasmic accumulation of TDP-43 protein in a neuronal cell having cytoplasmic TDP-43 level indicative of a TDP-43 proteinopathy, said method comprising administering to the neuronal cell an amount of a composition comprising a modulator of OPRS 1 activity and/or level and/or expression for a time and under conditions sufficient to reduce activity of at least one isoform of OPRSl or reduce expression of at least one OPRSl mRNA variant in the neuronal cells. The method may further comprise determining a level of TDP-43 protein in the cytoplasm of the neuronal cell wherein a reduced level of cytoplasmic TDP-43 in the neuronal cell following administration of the modulator compared to a level of cytoplasmic TDP-43 indicative of a TDP-43 proteinopathy indicates that the modulator has reduced, inhibited, prevented or delayed sequestration and/or cytoplasmic accumulation of TDP-43 protein in the neuronal cell. As described herein above, standard diagnostic methods may be employed for determining cytoplasmic TDP-43 levels in neuroglia and/or neuronal cells. The composition employed in this method may comprise a modulator as described according to any example hereof e.g., a modulator of OPRSl activity that reduces activity of at least one isoform of OPRSl in the neuronal cell or a modulator of OPRSl expression that reduces the expression of at least one OPRSl mRNA variant in the neuronal cell.

This method of treating neuronal cells may further comprise administering the composition for a time and under conditions sufficient to reduce gamma-secretase activity in the neuronal cell, thereby reducing the formation and/or level of amyloid deposits in Lewy Bodies of the neuronal cell. Alternatively, or in addition, the method may further comprise administering the composition for a time and under conditions sufficient to reduce Lewy Body formation or level in Lewy Bodies of the neuronal cell.

In another example, the present invention provides for use of a modulator of OPRSl activity and/or level and/or expression as described according to any example hereof in the preparation of a medicament for the treatment or prevention of a TDP-43 proteinopathy in a subject.

In another example, the present invention provides for use of a modulator of OPRSl activity and/or level and/or expression as described according to any example hereof in the preparation of a composition for reducing, inhibiting, preventing or delaying cytoplasmic sequestration and/or cytoplasmic accumulation of TDP-43 protein in a neuronal cell having cytoplasmic TDP-43 level indicative of a TDP-43 proteinopathy.

A medicament prepared in accordance with the present invention may be formulated for oral administration to a subject or for administration to a subject by injection or for administration to a subject by inhalation. Formulations for other modes of administration are not excluded. As with other examples of the invention, the range of TDP-43 proteinopathies for which the medicament may be employed are selected e.g., from frontotemporal lobar degeneration (FTLD), amyotrophic lateral sclerosis (ALS), motor neurone disease (MND), Parkinson's disease (PD), Guam parkinsonism-dementia, and a Lewy body- related disease such as Alzheimer's disease (AD).

The medicament may also be formulated such that the level of active agent i.e., OPRSl modulator is additionally suitable for reducing the formation and/or level of amyloid deposits in Lewy Bodies in neuronal cells and/or neuroglia of the subject and/or for reducing gamma secretase activity in neuronal cells and/or neuroglia of the subject.

The present invention also extends to an isolated modulator of OPRSl activity and/or level and/or expression or a pharmaceutical composition comprising said modulator for use in a method to treat or prevent a TDP-43 proteinopathy in a subject. The range of modulatory compounds included for use in a method to treat or prevent a TDP-43 proteinopathy in a subject, and the range of TDP-43 proteinopathies for which the modulator or pharmaceutical composition is suitable are described herein. Efficacy of treatment or prevention is also determined as described according to any relevant example hereof.

The present invention also extends to an isolated modulator of OPRSl activity and/or level and/or expression for use in reducing, inhibiting, preventing or delaying cytoplasmic sequestration and/or cytoplasmic accumulation of TDP-43 protein in a neuronal cell having cytoplasmic TDP-43 level indicative of a TDP-43 proteinopathy. The range of suitable modulatory compounds for use in reducing, inhibiting, preventing or delaying cytoplasmic sequestration and/or cytoplasmic accumulation of TDP-43 protein in neuronal cells are described herein. Efficacy of treatment is also determined as described according to any relevant example hereof. Another example of the present invention provides a method of identifying a compound for the treatment or prophylaxis of a TDP-43 proteinopathy, said method comprising selecting a modulator that inhibits and/or reduces OPRSl activity and/or level and/or expression wherein said modulator additionally reduces sequestration and/or accumulation of TDP-43 in the cytoplasm of the neuroglia and/or neuronal cells, thereby identifying a compound for the treatment or prophylaxis of a TDP-43 proteinopathy. For example, the method may further comprise e.g., as a first step, determining sequestration and/or accumulation of TDP-43 in the cytoplasm of the neuroglia and/or neuronal cells in the presence and absence of the modulator. Alternatively, or in addition, the method may further comprise e.g., as a first step, providing the modulator to the neuroglia and/or neuronal cells. Alternatively, or in addition, the method may further comprise e.g., as a first step, obtaining the modulator.

In a related example, the present invention also provides a method for screening a library of compounds or a mixture of compounds for identifying or isolating a compound for the treatment or prophylaxis of nervous system degeneration, said method comprising:

(i) obtaining a mixture of compounds or a library comprising compounds capable of inhibiting or reducing preventing or delaying cytoplasmic sequestration of TDP- 43 protein in neuroglia and/or neuronal cells;

(ii) administering the compound at (i) to neuroglia and/or neuronal cells; (iii) determining the ability of said mixture or a plurality of compounds at (ii) to reduce, inhibit, prevent or delay cytoplasmic sequestration of TDP-43 protein in neuroglia and/or neuronal cells; and (iv) selecting a compound from the mixture or plurality of compounds that reduces, inhibits, prevents or delays cytoplasmic sequestration of TDP-43 protein in neuroglia and/or neuronal cells, thereby identifying or isolating a compound for the treatment of nervous system degeneration. In the foregoing examples of methods for identifying or isolating therapeutic/prophylactic compounds, it is preferred that the compound is suitable for treatment of neurodegenerative disease. In another example, the compound is suitable for treatment of TDP -43 proteinopathy.

Also in accordance with the foregoing examples, determination of the ability of the compound to reduce, inhibit, delay or prevent cytoplasmic sequestration of TDP-43 protein in neuroglia and/or neuronal cells may comprise comparing the level of cytoplasmic sequestration of TDP-43 protein in neuroglia and/or neuronal cells at (iii) to the level of cytoplasmic sequestration of TDP-43 in neuroglia and/or neuronal cells to which the compound or mixture or plurality of compounds has not been administered

Another example of the present invention provides a process for isolating a composition for the treatment or prophylaxis of a TDP-43 proteinopathy, said process comprising performing a method according to any example hereof to thereby identify a compound for the treatment or prophylaxis of a TDP-43 proteinopathy and isolating the identified modulator e.g., from a mixture of compounds or a library of compounds. A mixture of compounds may comprise a natural product that modulates OPRSl e.g., in a plant or tissue extract thereof, in an animal tissue or extract thereof, or a mixture may comprise a synthetic modulator of OPRSl e.g., in a mixture of other synthetic or natural compounds not having OPRSl modulatory activity.

In the case of a library of compounds displayed separately wherein each compound is substantially pure prior to performance of the method, such isolation results in the separation of the compound from other compounds in the library that do not have the requisite activity. In this case, the term "separating" extends to determining the activity of one library component relative to another library component and selecting a compound having the desired activity.

The term "separation" in this context refers to the use of any chemical or biochemical purification process known in the art to fractionate the mixture of plurality of compounds coupled with assaying the fractions produced for activity with respect to, reducing, inhibiting, preventing or delaying cytoplasmic sequestration of TDP-43 protein in neuroglia and/or neuronal cells and selecting fractions having one ore more of said activities.

The term "separation" in this context also refers to a process comprising iterated use of any chemical or biochemical purification process known in the art to partially or completely purify a compound from a mixture of plurality of compounds and assaying the fractions produced in each iteration of the process for activity with respect to, reducing, inhibiting, preventing or delaying cytoplasmic sequestration of TDP-43 protein in neuroglia and/or neuronal cells, and selecting at each iteration one or more fractions having one or more of said activities. A process may be repeated for n iterations wherein n is sufficient number of iterations to reach a desired purity of the compound e.g., 50% or 60% or 70% or 80% or 90% or 95% or 99%. e.g., wherein n is an integer from zero to about ten. As is known to the skilled artisan, such iterations do not require iteration of precisely the same purification processes and more generally utilize different processes or purification conditions for each iteration.

The foregoing examples of methods and processes for identifying or isolating therapeutic/prophylactic compounds may additionally comprise: (v) optionally, determining the structure of the compound; (vi) optionally, providing the name or structure of the compound; and (vii) providing the compound.

It is to be understood that an identified or isolated compound in substantially pure form i.e., free from contaminants that might cause adverse side effects or contraindications or antagonize the activity of the active compound, can be formulated into a medicament suitable for treatment and/or prophylaxis of nervous system degeneration or nervous system degeneration. The present invention clearly extends to the direct product of any method of identification or isolation of a therapeutic compound described herein. Accordingly, another example of the present invention provides a composition for the treatment or prophylaxis of a TDP -43 proteinopathy wherein said composition comprises a modulator isolated by the process according to any example hereof.

Another example of the present invention provides a process for producing a composition for the treatment or prophylaxis of a TDP-43 proteinopathy, said process comprising performing a method according to any example hereof to thereby identify a compound for the treatment or prophylaxis of a TDP-43 proteinopathy and synthesizing the identified modulator. Standard chemical syntheses are employed.

Another example of the present invention provides a process for producing a composition for the treatment or prophylaxis of a TDP-43 proteinopathy, said method comprising performing a method according to any example hereof to thereby identify a compound for the treatment or prophylaxis of a TDP-43 proteinopathy and formulating the identified modulator for administration to a subject suffering from a TDP-43 proteinopathy or at risk of suffering from a TDP-43 proteinopathy.

The present invention also provides a method for producing a formulation for treatment or prevention of a TDP-43 proteinopathy said method comprising mixing or otherwise combining:

(a) a composition comprising a modulator of OPRSl activity and/or level and/or expression in an amount sufficient to reduce or prevent cytoplasmic sequestration of TDP-43 protein in neuronal cells to thereby reduce or prevent degeneration of neurons comprising the neuronal cells; and

(b) a suitable carrier or excipient.

The present invention also provides a method of treatment or prophylaxis comprising: (i) identifying a subject suffering from nervous system degeneration e.g., associated with neurodegenerative disease and/or TDP-43 proteinopathy and/or at risk of developing nervous system degeneration e.g., associated with a risk of developing neurodegenerative disease and/or TDP-43 proteinopathy; (ii) obtaining a formulation according to any embodiment as described herein; and (iii) administering said formulation to said subject.

The present invention further provides treatment or prophylaxis comprising:

(i) identifying a subject suffering from nervous system degeneration e.g., associated with neurodegenerative disease and/or TDP-43 proteinopathy and/or at risk of developing nervous system degeneration e.g., associated with a risk of developing neurodegenerative disease and/or TDP-43 proteinopathy; (ii) recommending a formulation according to any embodiment as described herein to the subject.

The present invention also provides a method of treatment or prophylaxis comprising administering a formulation according to any embodiment as described herein to a subject previously identified as suffering from nervous system degeneration e.g., associated with neurodegenerative disease and/or TDP-43 proteinopathy and/or at risk of developing nervous system degeneration e.g., associated with a risk of developing neurodegenerative disease and/or TDP-43 proteinopathy.

The present invention also provides a method of treatment or prophylaxis comprising recommending a formulation according to any embodiment as described herein to a subject previously identified as suffering from nervous system degeneration e.g., associated with neurodegenerative disease and/or TDP-43 proteinopathy and/or at risk of developing nervous system degeneration e.g., associated with a risk of developing neurodegenerative disease and/or TDP-43 proteinopathy.

In one example, a method according to any example hereof for treatment or prophylaxis additionally comprises determining that a subject suffers from or is predisposed to or has an increased risk of developing nervous system degeneration. Such a determination is based on, for example, family history or a physiological assay or a neurological assay or a molecular assay. In one example, the administration or recommendation of a therapeutic for the treatment of the nervous system degeneration is based upon the diagnosis of the degeneration or the diagnosis of a predisposition to the degeneration.

The present invention also provides a method for predicting the response of a subject to treatment with a composition for the treatment or prophylaxis of a nervous system degeneration and/or a neurodegenerative disease and/or TDP-43 proteinopathy, said method comprising detecting a marker within an OPRS-I gene or an expression product thereof that is associated with response of a subject to treatment with a composition for the treatment or prophylaxis of a neurodegenerative disease and/or TDP-43 proteinopathy, wherein detection of said marker is indicative of the response of the subject to treatment with said composition.

The present invention provides a method for diagnosing TDP-43 proteinopathy in a subject or determining the predisposition of a subject to developing TDP-43 proteinopathy or determining an increased risk of a subject developing TDP-43 proteinopathy, the method comprising detecting in a sample from the subject a marker linked to chromosome 9p21-9q21 of the human genome, wherein detection of said marker is indicative of TDP-43 proteinopathy or a predisposition to TDP-43 proteinopathy or an increased risk of a subject developing TDP-43 proteinopathy.

Preferably, the marker is linked to map position 9p21.1-9p21.2.

In one example, the marker linked to map position 9p21-9q21 is located between or comprises the microsatellite markers designated D9S161 (SEQ ID NO: 1) and D9S175 (SEQ ID NO: 2). For example, the marker linked to map position 9p21-9q21 of the human genome is located between or comprises the microsatellite markers designated D9S161 (SEQ ID NO: 1) and D9S273 (SEQ ID NO: 3). For example, the marker linked to map position 9p21-9q21 of the human genome is linked to and/or comprises the microsatellite marker designated D9S1817 (SEQ ID NO: 4) and/or D9S163 (SEQ ID NO: 14) and/or D9S1845 (SEQ ID NO: 15) and/or D9S1118 (SEQ ID NO: 16) and/or D9S319 (SEQ ID NO: 17). Preferably, the marker linked to map position 9p21- 9q21 of the human genome is linked to and/or comprises the microsatellite marker designated D9S319 (SEQ ID NO: 17)

As used herein, the terms "linked" and "map to" shall be taken to refer to a sufficient proximity between a marker and nucleic acid comprising all or part of map position 9p21-9q21 of the human genome or an expression product thereof to permit said linked nucleic acid to be useful for diagnosing TDP-43 proteinopathy in a subject or a predisposition to TDP-43 proteinopathy or an increased risk of developing TDP-43 proteinopathy . Those skilled in the art is aware that for linked nucleic acid to be used in this manner, it must be sufficiently close to map position 9p21 so as to be in linkage or for there to be a low recombination frequency between the linked nucleic acid and map position 9p21-9q21. Preferably, the linked nucleic acid and the locus are less than about 25cM apart, more preferably less than about lOcM apart, even more preferably less than about 5cM apart, still more preferably less than about 3cM apart and still more preferably less than about 1 cM apart.

The present invention also provides a method for diagnosing TDP-43 proteinopathy in a subject or determining the predisposition of a subject to developing TDP-43 proteinopathy or determining an increased risk of a subject developing TDP-43 proteinopathy, the method comprising detecting in a sample from the subject a marker within an opioid receptor sigma 1 (OPRSl) gene or an expression product thereof that is associated with or linked or causative of TDP-43 proteinopathy , wherein detection of said marker is indicative of TDP-43 proteinopathy or a predisposition to TDP-43 proteinopathy or an increased risk of developing a TDP-43 proteinopathy.

In one example, a marker associated with and/or causative of TDP-43 proteinopathy occurs within an OPRSl genomic gene. A genomic gene of OPRSl shall be understood to include the coding region of a OPRSl protein (e.g., codons required to encode any isozyme of OPRSl) in addition to intervening intron sequences in addition to regulatory regions that control the expression of said gene, e.g., a promoter or fragment thereof and/or a 5¹ untranslated region and/or a 3' untranslated region.

Preferably, the TDP-43 proteinopathy is a dementia, presenile dementia, Alzheimer's disease or FTLD, including early onset of any one of said diseases or conditions. For example, the Alzheimer's disease is a plaque predominant Alzheimer's disease. In another example, the TDP-43 proteinopathy is a motor neuron disease e.g., amyotrophic lateral sclerosis (ALS) or spinal muscular atrophy (SMA).

As used herein, the term "marker" shall be taken to mean a nucleic acid that comprises a nucleotide sequence associated with and/or causative of TDP-43 proteinopathy and/or a nucleotide sequence that occurs in a subject suffering from TDP-43 proteinopathy but does not occur in a subject that does not suffer from TDP-43 proteinopathy.

Alternatively, or in addition, the marker is linked to a polymorphism or nucleotide change in a genome wherein said polymorphism or nucleotide change is associated with TDP-43 proteinopathy. For example, a marker occurs within any region of an OPRSl genomic gene, including an exon or an intron or a promoter region or an enhancer region or a 3' untranslated region.

In those methods described herein according to any embodiment comprising detecting a marker in a region of a genome that is transcribed or that controls transcription, the term "marker" shall also be taken to mean an expression product of a gene or an allele of OPRSl that is associated with TDP-43 proteinopathy. For example, the marker comprises or is within a pre-mRNA molecule, a 5'capped mRNA, a polyadenylated mRNA and/or a mature or processed mRNA.

In those methods described herein according to any embodiment comprising detecting a marker in a region of a genome encoding a polypeptide, those skilled in the art will appreciate that the term "marker" also means a peptide, polypeptide or protein that comprises an amino acid sequence encoded by an allele of an OPRSl gene that is associated with or linked to or causative of TDP-43 proteinopathy .

As used herein, the term "associated with TDP-43 proteinopathy " shall be taken to mean that the detection of a marker is significantly correlated with the development of TDP-43 proteinopathy in a subject or that the absence of a marker is significantly correlated with the development of TDP-43 proteinopathy . For example, a marker occurs in a subject or is detectable in a subject that suffers from TDP-43 proteinopathy and does not occur in a subject or is not detectable in a subject that does not suffer from neurodegenerative disease. Alternatively, or in addition, detection of a marker associated with TDP-43 proteinopathy is significantly correlated with the development of TDP-43 proteinopathy in a subject or that the absence of a marker is significantly correlated with the development of neurodegenerative disease. For example, in the case of a marker that is positively associated with a disease is a polymorphism the detection of that marker is associated with the development of neurodegenerative disease. As used herein, the term "polymorphism" shall be taken to mean a difference in the nucleotide sequence of a specific site or region of the genome of a subject that occurs in a population of individuals, wherein one form of the polymorphism is associated with TDP-43 proteinopathy . Exemplary polymorphisms include a simple sequence repeat or microsatellite marker, e.g. in which the length of the marker varies between individuals in a population or a simple nucleotide polymorphism. The skilled artisan will understand that a simple nucleotide polymorphism is a small change (e.g., an insertion, a deletion, a transition or a transversion) that occurs in a genome of a population of subjects. For example, a simple nucleotide polymorphism comprises or consists of an insertion or deletion or transversion of one, or two or three or five, or ten or twenty nucleotides in the genome of a subject. Preferably, the polymorphism is a single nucleotide polymorphism (SNP). In one example, a polymorphism is significantly correlated with the development of TDP-43 proteinopathy in a plurality of subjects e.g., the polymorphism is significantly correlated with the development of TDP-43 proteinopathy in a plurality of unrelated subjects. Whilst the present invention contemplates any marker in an OPRS-I nucleic acid or polypeptide, it is preferred that the marker comprises or consists of a mutation within an OPRS-I gene or expression product. By "mutation" is meant a permanent, transmissible change in nucleotide sequence of the genome of a subject and optionally, an expression product thereof that alters the level of expression or activity of native OPRSl polypeptide thereby causing TDP-43 proteinopathy . Examples of mutations include an insertion of one or more new nucleotides or deletion of one or more nucleotides or substitute of one or more existing nucleotides with different nucleotides. Such a mutation may also lead to a change in the amino acid of an OPRSl polypeptide, e.g., altering the activity of an OPRSl polypeptide. A "mutation" is a difference in the sequence of an OPRSl gene or an expression product thereof in a subject that suffers from TDP-43 proteinopathy and that does not occur in a subject that does not suffer from TDP-43 proteinopathy , for example, in a population of individuals that do not suffer from TDP-43 proteinopathy .

As used herein, the term "predisposition to neurodegenerative disease" shall be taken to mean that a subject comprising a marker detected by a method as described herein according to any embodiment is susceptible to developing TDP-43 proteinopathy or is more likely to develop TDP-43 proteinopathy than a normal individual or a normal population of individuals. In this regard, a marker that is indicative of a predisposition to TDP-43 proteinopathy may itself cause the disease or disorder or, alternatively, be correlated with the development of TDP-43 proteinopathy .

For example, a marker comprises an adenine at a position corresponding to nucleotide position 80 of SEQ ID NO: 5. Alternatively, or in addition, a marker comprises a thymine at a position corresponding to nucleotide position 85 of SEQ ID NO: 5.

Alternatively, or in addition a marker comprises an adenine at a position corresponding to nucleotide position 626 of SEQ ID NO: 5. Alternatively, or in addition, a marker comprises a thymine at position 772 of SEQ ID NO: 5. Alternatively, or in addition, a marker comprises a thymine at position 788 of SEQ ID NO: 5. Alternatively, or in addition, a marker comprises adenine at position 793 of SEQ ID NO: 5. Alternatively, or in addition, a marker comprises a thymine at position 797 of SEQ ID NO: 5. Alternatively, or in addition, a marker comprises a guanine at a position corresponding to nucleotide position 700 of SEQ ID NO: 9. Alternatively, or in addition, a marker comprises a guanine at a position corresponding to position 2080 of SEQ ID NO: 13. Alternatively, or in addition, a marker comprises an adenine at a position corresponding to position 2080 of SEQ ID NO: 13. Alternatively, or in addition, a marker comprises a cytosine at a position corresponding to position 2085 of SEQ ID NO: 13. Alternatively, or in addition, a marker comprises a thymine at a position corresponding to position 2085 of SEQ ID NO: 13. Alternatively, or in addition, a marker comprises a guanine at a position corresponding to position 2583 of SEQ ID NO: 13. Alternatively, or in addition, a marker comprises a thymine at a position corresponding to position 2583 of SEQ ID NO: 13. Alternatively, or in addition, a marker comprises a cytosine at a position corresponding to position 4020 of SEQ ID NO: 13. Alternatively, or in addition, a marker comprises a thymine at a position corresponding to position 4020 of SEQ ID NO: 13. Alternatively, or in addition, a marker comprises a guanine at a position corresponding to position 4191 of SEQ ID NO: 13. Alternatively, or in addition, a marker comprises a thymine at a position corresponding to position 4191 of SEQ ID NO: 13. Equivalent markers between SEQ ID NO: 5 and SEQ ID NO: 13 are apparent from the Sequence Listing provided herein.

In one example, a marker comprises an adenine at a position corresponding to position 2080 of SEQ ID NO: 13. Alternatively, or in addition, a marker comprises a thymine at a position corresponding to position 2085 of SEQ ID NO: 13. Alternatively, or in addition, a marker comprises a thymine at a position corresponding to position 2583 of SEQ ID NO: 13. Alternatively, or in addition, a marker comprises a thymine at a position corresponding to position 4020 of SEQ ID NO: 13. Alternatively, or in addition, a marker comprises a thymine at a position corresponding to position 4182 of SEQ ID NO: 13. Alternatively, or in addition, a marker comprises a thymine at a position corresponding to position 4191 of SEQ ID NO: 13. Alternatively, or in addition, a marker is associated with or causes alternative splicing of an OPRSl mRNA. As used herein, the term "alternative splicing" shall be taken to mean the insertion or removal of one or more exons into/from an OPRSl mRNA. Accordingly, an alternatively spliced OPRSl mRNA comprises additional exon(s), or lack exon(s) e.g., nucleotides, compared to the sequence of an OPRSl cDNA set forth in SEQ ID NO: 5. In one embodiment, the presence of a marker that is associated with alternative splicing of an OPRSl mRNA is correlated with modulated levels of alternatively spliced OPRSl mRNA. For example, the marker occurs within a binding site of a splicing factor, such as, for example, hnSNPF/H and/or SC35, thereby modulating the level of splicing of an OPRSl transcript. Accordingly, the level of a specific splice form of OPRSl is increased or decreased when the marker is present and is useful for detecting a marker associated with a disease or disorder. Exemplary markers associated with and/or causative of alternative splicing of an OPRSl transcript comprises a thymine at a position corresponding to nucleotide position 2583 of SEQ ID NO: 13 or adenine at a position corresponding to nucleotide position 2576 of SEQ ID NO: 13 or an adenine at a position corresponding to nucleotide position 2254 of SEQ ID NO: 13, or an adenine at a position corresponding to nucleotide position 2255 of SEQ ID NO: 13, or an adenine at a position corresponding to nucleotide position 2257 of SEQ ID NO: 13, or an adenine at a position corresponding to nucleotide position 2792 of SEQ ID NO: 13. These markers are also associated with a reduced level of a native OPRSl expression product, e.g., a reduced level of a transcript comprising a sequence set forth in SEQ ID NO: 5.

In another example, a marker is associated with increased expression of an OPRSl transcript. For example, the marker comprises a thymine at a position corresponding to nucleotide position 4191 of SEQ ID NO: 13 or an adenine at a position corresponding to nucleotide position 4187 of SEQ ID NO: 13, or a thymine at position 4182 of SEQ ID NO: 13.

Alternatively, or in addition, a marker comprises a valine at a position corresponding to amino acid position 4 of SEQ ID NO: 6. Alternatively, or in addition, a marker comprises a valine at a position corresponding to amino acid position 184 of SEQ ID NO: 3.

In one example, a method described herein is for diagnosis/prognosis of a TDP-43 proteinopathy consisting of presenile dementia. Preferably, such a method detects any one or more markers selected from the group consisting of an adenine at a position corresponding to position 2080 of SEQ ID NO: 13 or position 80 of SEQ ID NO: 5, a valine at apposition corresponding to amino acid residue 4 of SEQ ID NO: 6, a thymine at a position corresponding to position 2085 of SEQ ID NO: 13 or position 85 of SEQ ID NO: 5, a thymine at a position corresponding to position 2583 of SEQ ID NO: 13, a thymine at a position corresponding to nucleotide position 4020 of SEQ ID NO: 13 or position 626 of SEQ ID NO: 5, or a thymine at position 772 of SEQ ID NO: 5, or a thymine at position 788 of SEQ ID NO: 5, or adenine at position 793 of SEQ ID NO: 5 or a thymine at position 797 of SEQ ID NO: 5 or a thymine at a position corresponding to position 4191 of SEQ ID NO: 13, a guanine at a position corresponding to nucleotide position 30 of SEQ ID NO: 5 or nucleotide position 2030 of SEQ ID NO: 13, a cytosine at a position corresponding to nucleotide position 545 of SEQ ID NO: 5 or nucleotide position 3939 of SEQ ID NO: 13, and an adenine at a position corresponding to nucleotide position 4187 of SEQ ID NO: 13 and an adenine at a position corresponding to nucleotide position 729 of SEQ ID NO: 13.

In one example, a method described herein is for diagnosis/prognosis of a TDP-43 proteinopathy consisting of motor neuron disease. For example, a suitable marker comprises cytosine at a position corresponding to nucleotide position 2070 of SEQ ID NO: 13 or an adenine at a position corresponding to nucleotide position 2254 of SEQ ID NO: 13, or an adenine at a position corresponding to nucleotide position 2255 of SEQ ID NO: 13, or an adenine at a position corresponding to nucleotide position 2257 of SEQ ID NO: 13, or an adenine at a position corresponding to nucleotide position 2792 of SEQ ID NO: 13, a thymine at nucleotide position 141 of SEQ ID NO: 5. In another example, the marker comprises a serine at a position corresponding to amino acid residue 23 of SEQ ID NO: 6. Markers are preferably detected by hybridizing a nucleic acid probe comprising the sequence of the marker to a marker linked to nucleic acid in a sample from a subject under moderate to high stringency hybridization conditions and detecting the hybridization using a detection means, wherein hybridization of the probe to the sample nucleic acid indicates that the subject suffers from TDP-43 proteinopathy or a has a predisposition to TDP-43 proteinopathy or has an increased risk of developing TDP-43 proteinopathy . For example, the detection means is a nucleic acid hybridization or amplification reaction, such as, for example, a polymerase chain reaction (PCR).

Not only is such a method useful for, for example, detecting a specific polymorphism or mutation in a sample from a subject, but also for detecting a marker in an expression product of an OPRSl gene, for example, an alternate splice form of an OPRSl transcript. In this respect, the method of the invention as described herein according to any embodiment comprises detecting a modified level of an alternate splice form encoded by an OPRSl gene.

At least two of the mutations identified by the present inventors are also associated with modified expression of OPRSl . Accordingly, a subject at risk of developing TDP- 43 proteinopathy or that suffers from TDP-43 proteinopathy may equally be determined by detecting a modified level of an OPRSl expression product in a sample from the subject. In one example, such a method comprises detecting a reduced level of an OPRSl expression product, hi another example, such a method comprises detecting an enhanced level of an OPRSl expression product. Suitable methods for determining the level of an OPRSl expression product is apparent to the skilled person and includes PCR or a variant thereof or an immunoassay, such as is listed above. For example, an enhanced or reduced level of an OPRSl transcript is detected by performing a process comprising:

(i) determining the level of the OPRSl transcript in a sample from the subject;

(ii) determining the level of the OPRSl transcript in a suitable control sample, wherein an enhanced or reduced level of the OPRSl transcript at (i) compared to (ii) is indicative of TDP-43 proteinopathy or a predisposition to TDP-43 proteinopathy or an increased risk of developing TDP-43 proteinopathy .

Alternatively, the marker is within an OPRSl polypeptide. Such a marker is detected, for example, by contacting a biological sample derived from a subject with an antibody or ligand capable of specifically binding to said marker for a time and under conditions sufficient for an antibody/ligand complex to form or a ligand/ligand complex to form and then detecting the complex wherein detection of the complex indicates that the subject being tested suffers from TDP-43 proteinopathy or a has a predisposition to TDP-43 proteinopathy or has an increased risk of developing TDP-43 proteinopathy . A suitable method for detecting the complex is apparent to the skilled person and includes, for example, an enzyme-linked immunosorbent assay (ELISA), a fluorescence-linked immunosorbent assay (FLISA) an enzyme immunoassay (EIA) or a radioimmunoassay (RIA) .

For example, the OPRSl polypeptide is encoded by an alternatively spliced OPRSl transcript and/or comprises a valine at a position corresponding to amino acid residue 4 of SEQ ID NO: 6.

In one example of the invention, detecting an enhanced or reduced level of the OPRSl polypeptide comprises performing a process comprising:

(i) determining the level of the OPRSl polypeptide in a sample from the subject; (ii) determining the level of the OPRSl polypeptide in a suitable control sample, wherein an enhanced or reduced level of the OPRSl polypeptide at (i) compared to

(ii) is indicative of TDP-43 proteinopathy or a predisposition to TDP-43 proteinopathy or an increased risk of developing TDP-43 proteinopathy .

A suitable control sample is apparent to the skilled artisan and includes: (i) a sample from a normal subject; (ii) a sample from a healthy subject;

(iii) a data set comprising measurements of the level of hybridization or complex i in samples from a plurality of normal subjects; and (iv) a data set comprising measurements of the level of hybridization or complex i in samples from a plurality of healthy subjects.

The biological sample used in a method described herein according to any embodiment comprises a nucleated cell and/or an extract thereof. Preferably, the sample is selected from the group consisting of whole blood, serum, plasma, peripheral blood mononuclear cells (PBMC), a buffy coat fraction, saliva, urine, a buccal cell and a skin cell.

As is apparent to the skilled artisan based on the description herein, the size of a sample will depend upon the detection means used. For example, an assay, such as, for example, PCR may be performed using a sample comprising a single cell or an extract thereof, although greater numbers of cells are preferred. Alternative forms of nucleic acid detection may require significantly more cells than a single cell. Furthermore, protein-based assays require sufficient cells to provide sufficient protein for an antigen based assay.

In one example, the sample has been derived or isolated or obtained previously from the subject.

In one example, the method of the invention described herein according to any embodiment is performed using genomic DNA obtained from a sample from a subject, e.g., obtained from a blood sample from a subject. Alternatively, or in addition, the method described herein according to any embodiment is performed using mRNA or cDNA derived from the biological sample. Alternatively, or in addition, the method described herein according to any embodiment is performed using protein derived from the biological sample. In one example, the method described herein according to any embodiment is performed as a part of a multi-analyte detection method to determine the predisposition of a subject to TDP-43 proteinopathy or to diagnose TDP-43 proteinopathy . For example, such a multi-analyte method detects two or more nucleic acid markers that are associated with TDP-43 proteinopathy , for example, two or more markers described herein according to any embodiment. Alternatively, or in addition, a multi-analyte method detects one or more nucleic acid markers associated with TDP-43 proteinopathy as described herein according to any embodiment and one or more other markers associated with TDP-43 proteinopathy . The combination of nucleic acid- based and protein-based detection methods is contemplated by the present invention.

In one example of the invention, the method described herein according to any embodiment additionally comprises determining an association between the marker and TDP-43 proteinopathy . Suitable methods for determining an association between a marker and a disease or disorder are known in the art.

The methods of the present invention are also useful for determining a subject that is a carrier of a marker that is associated with and/or linked to TDP-43 proteinopathy. Such an assay is useful, for example, for determining the likelihood, or susceptibility of a child of the subject being tested to develop TDP-43 proteinopathy .

The present inventors have also determined at least one marker that occurs in subjects suffering from Alzheimer's disease. Accordingly, the present invention also provides a method for diagnosing a particular form of TDP-43 proteinopathy or determining a predisposition of a subject to developing a particular form of TDP-43 proteinopathy or determining a risk of a subject developing TDP-43 proteinopathy . For example, the particular form of TDP-43 proteinopathy is Alzheimer's disease or FTLD or motor neuron disease. For example, the methods described herein according to any embodiment apply mutatis mutandis to diagnosing Alzheimer's disease or FTLD or motor neuron disease or determining the predisposition of a subject to developing Alzheimer's disease or FTLD or motor neuron disease or determining the risk of a subject developing Alzheimer's disease or FTLD or motor neuron disease.

In one example, a method as described herein according to any embodiment additionally comprises determining TDP -43 proteinopathy that a subject suffers from or is predisposed to or has an increased risk of developing. Such a determination is based on, for example, family history or a physiological assay or a neurological assay or a molecular assay.

The diagnostic method of the present invention is also useful in a method of treatment. For example, the present invention provides a method of treatment or prophylaxis of TDP-43 proteinopathy , said method comprising: (i) performing a method described herein for diagnosing TDP-43 proteinopathy or a predisposition thereto; and (ii) administering or recommending a therapeutic or prophylactic compound for the treatment of the TDP-43 proteinopathy .

Alternatively, the present invention provides a method of treatment or prophylaxis of

TDP-43 proteinopathy , said method comprising: (i) obtaining results of a method described herein according to any embodiment indicating that a subject suffers from TDP-43 proteinopathy or has a predisposition to

TDP-43 proteinopathy ; and

(ii) administering or recommending a therapeutic or prophylactic compound for the treatment of the TDP-43 proteinopathy

In one embodiment, the administration or recommendation of a therapeutic for the treatment of the TDP-43 proteinopathy is based upon the diagnosis of the disease or the diagnosis of a predisposition to the disease.

The present invention also provides a method for predicting the response of a subject to treatment with a composition for the treatment or prophylaxis of TDP-43 proteinopathy , said method comprising detecting a marker within an OPRS-I gene or an expression product thereof that is associated with response of a subject to treatment with a composition for the treatment or prophylaxis of TDP-43 proteinopathy , wherein detection of said marker is indicative of the response of the subject to treatment with said composition.

In one example, the method detects a marker associated with a subject that will respond to treatment. As used herein, the term "respond to treatment" shall be taken to mean that the symptoms of TDP-43 proteinopathy in a subject are reduced or ameliorated as a result of treatment with a therapeutic compound.

Alternatively, a marker is associated with a subject that will not respond to treatment. As is apparent to the skilled artisan from the preceding paragraph, the term "will not respond to treatment" means that TDP-43 proteinopathy or one or more symptoms of TDP-43 proteinopathy in a subject are unlikely to be reduced or ameliorated as a result of treatment with a therapeutic compound. For example, in a significant proportion of the population carrying a marker as described herein according to any embodiment, treatment with a therapeutic compound will not result in therapeutic benefit to the subject in the treatment of TDP-43 proteinopathy or one or more symptoms thereof. Proceeding on this basis, the term "will not respond to treatment" may be used interchangeably with the term "is unlikely to respond to treatment".

In one example, the present invention provides nucleic acid comprising a sequence set forth in SEQ ID NO: 5, wherein the sequence comprises an adenine at a position corresponding to nucleotide position 80 of SEQ ID NO: 5 and/or a thymine at a position corresponding to position 85 of SEQ ID NO: 5 and/or an adenine at a position corresponding to nucleotide position 626 of SEQ ID NO: 5. Alternatively, or in addition, a marker comprises a thymine at position 772 of SEQ ID NO: 5. Alternatively, or in addition, a marker comprises a thymine at position 788 of SEQ ID NO: 5. Alternatively, or in addition, a marker comprises adenine at position 793 of SEQ ID NO: 5. Alternatively, or in addition, a marker comprises a thymine at position 797 of SEQ ID NO: 5. Alternatively, or in addition, the present invention provides a nucleic acid comprising a sequence set forth in SEQ ID NO: 13, wherein the sequence comprises a an adenine at a position corresponding to position 2080 of SEQ ID NO: 13 and/or a thymine at a position corresponding to position 2085 of SEQ ID NO: 13 and/or a thymine at a position corresponding to position 2583 of SEQ ID NO: 13 and/or a thymine at a position corresponding to position 4020 of SEQ ID NO: 13 and/or a thymine at a position corresponding to position 4182 of SEQ ID NO: 13 thymine at a position corresponding to position 4191 of SEQ ID NO: 13 and/or an adenine at a position corresponding to position 4187 of SEQ ID NO: 13 and/or an adenine at a position corresponding to nucleotide position 2254 of SEQ ID NO: 13, and/or an adenine at a position corresponding to nucleotide position 2255 of SEQ ID NO: 13, and/or an adenine at a position corresponding to nucleotide position 2257 of SEQ ID NO: 13, and/or an adenine at a position corresponding to nucleotide position 2792 of SEQ ID NO: 13 and/or a thymine at nucleotide position 141 of SEQ ID NO: 5.

The present invention also provides an isolated nucleic acid, e.g., a probe or primer, capable of preferentially or specifically hybridizing to or annealing to a nucleic acid described in the previous paragraph. For example, the probe or primer comprises a sequence selected from the group consisting of: (i) a sequence of at least about 15 to 20 nucleotides of SEQ ID NO: 5, wherein the sequence comprises an adenine at a position corresponding to nucleotide position 80 of SEQ ID NO: 5 and/or a thymine at a position corresponding to position 85 of SEQ ID NO: 5 and/or an adenine at a position corresponding to nucleotide position 626 of SEQ ID NO: 5 and/or a thymine at position 772 of SEQ ID NO: 5 and/or a thymine at position 788 of SEQ ID NO: 5 and/or adenine at position 793 of SEQ ID NO: 5 and/or a thymine at position 797 of SEQ ID NO: 5;

(ii) a sequence of at least about 15 to 20 nucleotides of SEQ ID NO: 13, wherein the sequence comprises an adenine at a position corresponding to position 2080 of SEQ ID NO: 13 and/or a thymine at a position corresponding to position 2085 of SEQ ID NO: 13 and/or a thymine at a position corresponding to position 2583 of SEQ ID NO: 13 and/or a thymine at a position corresponding to position 4020 of SEQ ID NO: 13 and/or a thymine at a position corresponding to position 4191 of SEQ ID NO: 13 and/or an adenine at a position corresponding to position 4187 of SEQ ID NO: 13 and/or an adenine at a position corresponding to nucleotide position 2254 of SEQ ID NO: 13, and/or an adenine at a position corresponding to nucleotide position 2255 of SEQ ID NO: 13, and/or an adenine at a position corresponding to nucleotide position 2257 of SEQ ID NO: 13, and/or an adenine at a position corresponding to nucleotide position 2792 of SEQ ID NO: 13, and/or a thymine at nucleotide position 141 of SEQ ID NO: 5; and (iii) the complement of any one of (i) to (iv).

By "preferentially" means that the probe or primer is used under conditions under which a target polynucleotide hybridizes to the probe or primer at a level significantly above background. The background hybridization may occur because of other polynucleotides present, for example, in the cDNA or genomic DNA library being screening or other cDNA or gDNA in a sample being screened. Background implies a level of signal generated by interaction between the probe and a non-target nucleic acid which is less than 10 fold, preferably less than 100 fold as intense as the specific interaction observed with the target nucleic acid. The intensity of interaction are measured, for example, by radiolabeling the probe, e.g. with ³²P. Preferably, a probe or primer that preferentially anneals or hybridizes to a sequence described supra, hybridizes or anneals to the target sequence to a greater level or degree than it does to another sequence, e.g., an allelic variant of a sequence set forth in SEQ ID NO: 5, 7, 8 or 13.

By "specifically" is meant that a probe or primer hybridizes or anneals to a target sequence and does not detectably anneal or hybridize to another target sequence, e.g., an allelic variant of a sequence set forth in SEQ ID NO: 5, 7, 8 or 13.

The present invention also provides an isolated protein comprising a sequence set forth in SEQ ID NO: 6 wherein the sequence comprises a valine at a position corresponding to position 4 of SEQ ID NO: 6. The present invention also provides an isolated antibody or antigen binding fragment thereof capable of preferentially or specifically binding to a polypeptide comprising a sequence set forth in SEQ ID NO: 6 wherein the sequence comprises a valine at a position corresponding to position 4 of SEQ ID NO: 6 or a serine at a position corresponding to position 23 of SEQ ID NO: 6. For example, the antibody or fragment thereof binds to an epitope of OPRSl polypeptide comprising a sequence comprising at least about five consecutive amino acids of SEQ ID NO: 6 wherein the sequence comprises a valine at a position corresponding to position 4 of SEQ ID NO: 6 or a serine at a position corresponding to position 23 of SEQ ID NO: 6. The terms "preferentially" and "specifically" are to be given the same meaning mutatis mutandis in respect of antibodies as they are in respect of probes and primers.

Given the tight association of the human OPRS-I gene to TDP-43 proteinopathy, and the provision of a plurality of markers in OPRS-I associated with TDP-43 proteinopathy , the present invention further provides methods for identifying new markers in an OPRS-I gene or expression product associated with TDP-43 proteinopathy . For example, the present invention provides a method for identifying a marker in an OPRS-I gene or expression product that is associated with TDP-43 proteinopathy , said method comprising: (i) identifying a polymorphism or allele or mutation within an OPRS-I gene or expression product thereof;

(ii) analyzing a panel of subjects to determine those that suffer from TDP-43 proteinopathy , wherein not all members of the panel comprise the polymorphism or allele or mutation; and (iii) determining the variation in the development of the TDP-43 proteinopathy wherein said variation indicates that the polymorphism or allele or mutation is associated with the TDP-43 proteinopathy or a subject's predisposition to the TDP-43 proteinopathy.

The present invention also provides a method of identifying a marker associated with TDP-43 proteinopathy comprising identifying a marker that is linked to chromosome position 9p21, e.g. 9p21.1-9p21.2 of the human genome, wherein said marker is present in an individual suffering from TDP-43 proteinopathy and said marker is not present in a suitable control subject. For example, the method described supra comprising identifying a polymorphism or allele or mutation within an OPRSl gene shall be taken to apply mutatis mutandis to identifying a polymorphism or allele or mutation linked to chromosome position 9p21 of the human genome.

2. Definitions

This specification contains nucleotide and amino acid sequence information prepared using Patentln Version 3.3, presented herein after the claims. Each nucleotide sequence is identified in the sequence listing by the numeric indicator <210> followed by the sequence identifier (e.g. <210>l, <210>2, <210>3, etc). The length and type of sequence (DNA, protein (PRT), etc), and source organism for each nucleotide sequence, are indicated by information provided in the numeric indicator fields <211>, <212> and <213>, respectively. Nucleotide sequences referred to in the specification are defined by the term "SEQ ID NO:" followed by the sequence identifier (e.g. SEQ ID NO: 1 refers to the sequence in the sequence listing designated as <400>l).

The designations of nucleobases herein are those recommended by the IUPAC-IUB Biochemical Nomenclature Commission, wherein A represents adenine, C represents cytosine, G represents guanine, T represents thymine, Y represents a pyrimidine residue, R represents a purine residue, M represents adenine or cytosine, K represents guanine or thymine, S represents guanine or cytosine, W represents adenine or thymine,

H represents a nucleobase other than guanine, B represents a nucleobase other than adenine, V represents a nucleobase other than thymine, D represents a nucleobase other than cytosine and N represents any nucleobase.

It is to be understood that a reference herein to any one or more of the nucleobases adenine, guanine, uracil, thymine or cytosine encompasses the corresponding ribonucleosides adenosine, guanosine, uridine or cytidine and/or the corresponding deoxyribonucleosides deoxyadenosine, deoxyguanosine, deoxyuridine, thymidine, or deoxycytidine, and the ribonucleotide and deoxyribnucleotide monophosphates, diphosphates and triphosphates derived there from.

As used herein the term "derived from" shall be taken to indicate that a specified integer may be obtained from a particular source albeit not necessarily directly from that source.

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", is understood to imply the inclusion of a stated step or element or integer or group of steps or elements or integers but not the exclusion of any other step or element or integer or group of elements or integers.

Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.

Each embodiment described herein is to be applied mutatis mutandis to each and every other embodiment unless specifically stated otherwise.

Each embodiment described herein with respect to the diagnosis of dementia and/or determining the predisposition of a subject to dementia shall be taken to apply mutatis mutandis to the diagnosis of presenile dementia and/or determining the predisposition of a subject to presenile dementia.

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.

The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the invention, as described herein.

BRIEF DESCRIPTION OF THE DRAWINGS Figure IA is a pedigree diagram showing affection status and disease haplotype of the early onset dementia family 14. Squares indicate males and circles females; filled arrow indicates proband; black symbols, show individuals clinically diagnosed with dementia, either AD or FTLD; diagonal stripes, individuals diagnosed with MND; and combined black and diagonal stripes, individuals diagnosed with FTLD-MND. A diagonal line marks deceased subjects. Individual 1:1, lived until his 80s, but was thought to have had some personality changes.

Figure IB shows left-portion of the same pedigree as in Figure IA with microsatellite markers shown for pedigree members 1:1-2, 11:1-2, 111:1-7, IV: 1, and the specific alleles present are indicated. Alleles in parentheses are inferred. X indicates upper and lower recombination breakpoints which define the minimal disease haplotype, shown in a solid bar.

Figure 1C shows the right-portions of the same pedigree as in Figure IA with microsatellite markers shown for pedigree members 1:1-2, 11:3-8, 111:8-13, and the specific alleles present are indicated. Alleles in parentheses are inferred. X indicates upper and lower recombination breakpoints which define the minimal disease haplotype, shown in a solid bar.

Figure 2 is a DNA sequence electropherogram showing the sequence of nucleotide changes observed in subjects suffering from a neurodegenerative disease. Nucleotide changes are represented by the vertical arrows. A common polymorphism is indicated by the asterisk (*).

Figure 3 is a graphical representation showing the level of expression of the luciferase gene in SK-N-MC cells or SK-N-SH cells when placed under control of either the G723T mutation (Australian mutation) or G719A mutation (Polish mutation).

Figure 4A shows a copy of a photographic representation showing of electrophoresis of exon trap products on a 2% agarose gel. Exon trapping was performed in HEK293 cells (left hand panel) and SK-N-MC (right hand panel), transfected with the pSPL3 vector containing wild type OPRSl sequence (wt), pSPL3 vector comprising OPRSl mutation IVS2+31OT (IVS+31) or pSPL3 vector comprising OPRSl mutation IVS2+24C>A (IVS+24).

Figure 4B is a graphical representation showing results of semi-quantitative analysis of exon trap products isolated from HEK-293 cells (left hand panel) and SK-N-MC cells (right-hand panel). Mean values ± standard error of the mean obtained from four separate transfections. Pairwise Student's t test comparisons were performed between the wild-type (white) and mutant IVS2+31OT (black) or mutant IVS2+24OA (grey) exon trap products. Statistical significance is indicated (* = p<0.05).

Figure 5 is a copy of a graphical representation showing the level of gamma secretase activity in cells expressing wild-type OPRSl (pcDNA-FLAG-OPRSl (wt)) and mutant OPRSl (Ala4Val; pcDNA-FLAG-OPRSl (Ala4Val)), in SK-N-MC cells (light grey bars) and SK-N-SH cells (dark grey bars).

Figure 6 is a graphical representation showing age-dependent effect of disease status on OPRSl expression. OPRSl cDNA levels in lymphoblastoid cell lines were assessed by quantitative real-time PCR and were calculated relative to the housekeeping gene SDHA. Expression levels were plotted against age at sample donation for 5 patients (grey squares) and 10 controls (black triangles). Figure 7 is a graphical representation showing a correlation (r² = 0.852, p = 0.006) between OPRSl transcript levels and the relative amount of TDP-43 protein in the cytoplasm as expressed as a ratio of TDP-43 in cytoplasmic versus nuclear fraction. Increased OPRSl expression as is observed in subjects suffering from neurodegenerative disease is correlated with increased cytoplasmic TDP-43 levels, providing another marker of neurodegenerative disease.

Figure 8 is a graphical representation showing the level of TPD-43 localized to the nucleus compared to the cytoplasm of cells when various forms of OPRSl are overexpressed. White bars represent results in SK-N-MC cells and shaded bars represent results from SK-N-SH cells. Overexpression (i.e., increased levels of OPRSl as seen in some subjects suffering from neurodegenerative disease) results in increased levels of TDP-43 in the cytoplasm of cells, a marker of neurodegenerative disease.

Figure 9 A is a schematic representation of position of mutations in the OPRSl gene relative to exons and introns. The schematic shows that the OPRSl gene comprises 4 coding exons, with translation start and stop sites indicated by open arrows. The position of nucleotide changes detected in patients with dementia are indicated by black arrows.

Figure 9B is a DNA sequence electropherogram showing the position of the three 3'UTR mutations (down pointing arrows) observed in subjects suffering from a neurodegenerative disease compared with a normal individual.

Figure 9C is a graphical representation of the quantification of mRNA transcript stability comprising the C.672*47G>A and C.672*51G>T mutations within the 3'UTR of OPRSl. Chimaeric luciferase reporter constructs comprising the OPRSl promoter sequence, the luciferase cDNA and the entire OPRSl 3'UTR sequence were transfected into human neuroblastoma SK-N-MC (hatched) and SK-N-SH (black) cells. Mean and standard error of mean bars from n = 5 separate experiments. Significance of < 0.05 (*) and < 0.005 (**) are indicated.

Figure 10 is a graphical representation of regression analyisis of OPRSl transcript levels and age of individual for OPRSl 3'UTR C.672*51 G > T mutation carriers (squares) and unaffected controls (circles). OPRSl cDNA levels in lymphoblastoid cell lines were assessed by quantitative real-time PCR and were calculated relative to the housekeeping gene SDHA. The regression indicates that age and affection status were significant predictors of OPRSl expression.

Figure 11 is a copy of a photograph of OPRS 1 immunopositive staining in control tissue showing the granule cells of the dentate gyrus (a) and in CAl neurons of the hippocampus (c). Insets in A and C show normal nuclear TDP -43 staining, (b) In a FTLD-MND pedigree member (111:2), the granule cells show intense OPRSl immunoreactivity in the cytoplasm and the nucleus. Inset shows a TDP-43 positive cytoplasmic inclusion, (d) CAl neurons immunopositive for OPRSl. Inset shows diffuse TDP-43 positive staining in the cytoplasm. OPRSl immunopositive nuclei in other affected pedigree members 111:2 (e) and 111:3 (f).

Figure 12 is a copy of a photograph showing Western blot analysis of brain tissue demonstrating increased OPRSl (sigma-1) expression but equal TDP-43 expression in OPRSl mutation carriers (C.672*51 G > T) compared with neuropathologically confirmed normal controls. High molecular weight proteins are indicated (*).

Figure 13 is a copy of a photograph showing Western blot analysis of brain tissue demonstrating increased Sigma-1 expression and altered TDP-43 aggregation in an OPRSl mutation (C.672*51 G > T) carrier (patient 1) compared with a patient with AD neuropathology (patient 2). High molecular weight proteins are indicated (*).

Figure 14 is a copy of a photograph of a Western blot showing that constitutive expression of wildtype OPRSl cDNA in neuronal cell lines resulted in increased levels of OPRSl protein.

Figure 15A is a copy of a photograph showing Western blot analysis of TDP-43 protein levels in subcellular fractions (cytoplasmic and nuclear protein fractions) of transfected cells over-expressing OPRSl cDNAs in two human neuroblastoma cell. Expression constructs of the full length wildtype OPRSl cDNA under the control of the constitutive CMV promoter were transfected into either SK-N-MC (left panel) or SK- N-SH cells (right panel). Lower panel is a graphical representation of chemiluminescent band intensities that were quantified and the levels of cytoplasmic TDP-43 (Cyto-TDP) were expressed as a ratio of cytoplasmic versus nuclear TDP-43 (Nuc-TDP). Mean and standard error of mean bars from n = 5 separate experiments. Significance of p < 0.05 (*) is indicated.

Figure 15B is a copy of a photograph showing fluorescence microscopy of a SK-N-SH cell (white arrow) over-expressing a FLAG-tagged version of OPRSl (green), compared with non-FLAG expressing cells (arrow heads). OPRSl transfected cells show higher levels of TDP-43 (red) in the cytoplasm in contrast with untransfected cells (arrow heads) that had a predominantly nuclear staining of TDP-43. The presence of nuclei are indicated with DAPI stain (blue).

Figure 15C is a graphical representation of linear regression analyisis of endogenous OPRSl transcript levels and cytoplasmic TDP-43 levels (normalised against nuclear TDP-43 levels) which show a significant correlation (p = 0.025) between over- expression of OPRSl and movement of TDP-43 from the nucleus to the cytoplasm.

Figure 15D is a copy of a photograph of a Western blot showing the effect of OPRSl ligands on TDP-43 subcellular localization (upper panels). TDP-43 protein levels in subcellular fractions of cells exposed to three concentrations of opipramol (agonist), AC915 (antagonist) and haloperidol (antagonist) is shown. Lower panels is a graphical representation of chemiluminescent band intensities that were quantified and the levels of cytoplasmic TDP-43 (Cyto-TDP) are expressed as a ratio of cytoplasmic versus nuclear TDP-43 (Nuc-TDP). Mean and standard error of mean bars from 5 separate experiments. Significance of p < 0.05 (*) is indicated.

Figure 16 is a copy of a photograph showing fluoresence microscopy of transfected SK-N-SH cells (white arrows) over-expressing a FLAG-tagged version of OPRSl (green) show higher levels of TDP-43 (red) in the cytoplasm compared with untransfected cells which had a predominantly nuclear staining of TDP-43. Nuclei were stained with DAPI (blue).

Figure 17 is a copy of a photograph showing Western blot analysis of OPRSl expression in SK-N-MC cells, demonstrating that cells transfected with Stealth RNAis directed against the OPRSl gene show reduced OPRSl expression.

Figure 18A is a graphical representation of the effect of Opipramol on gamma- secretase activity using cellular transfection and luciferase assays. Data were normalized to untreated cells over three order of magnitude dilutions.

Figure 18B is a graphical representation of the effect of AC915 on gamma-secretase activity using cellular transfection and luciferase assays. Data were normalized to untreated cells over three order of magnitude dilutions.

DETAILED DESCRIPTION OF THE PREFERRED EXAMPLES 1. Modulators of OPRSl

The present invention contemplates that any modulator of OPRSl activity and/or level and/or expression may be used in the compositions and/or formulations described herein in the method of the invention. The compositions as described herein according to any embodiment may comprise any one or more modulator of OPRSl and are readily derived from the scope of modulators of OPRSl described herein. It is apparent to the skilled artisan based on the disclosure herein that the present invention also extends to the use of ligands of the Sigma- 1 receptor (OPRSl) to modulate OPRSl function including its activity, and/or expression and/or level.

As used herein the term "ligand" shall be taken in its broadest context to include any chemical compound, polynucleotide, peptide, protein, antibody, lipid, carbohydrate, small molecule, natural product, polymer, etc. that is capable of selectively binding, whether covalently or not, to one or more specific sites on an OPRSl polypeptide. The ligand may bind to its target via any means including hydrophobic interactions, hydrogen bonding, electrostatic interactions, van der Waals interactions, pi stacking, covalent bonding, or magnetic interactions amongst others. It is particularly preferred that a ligand is able to specifically bind to a specific site of an OPRSl polypeptide, e.g. at a site leading to activation or inactivation of OPRSl.

As described herein according to any embodiment, the ligand may be an agonsit, partial agonist, antagonist, or inverse agonist.

1.1. Small molecule modulators

Methods for modulating OPRSl activity and/or level and/or expression include the use of a small molecule that preferentially or specifically binds to a target polypeptide, e.g. OPRSl, a down-stream target in the OPRSl pathway, or any protein or molecule known to regulate the level, activity, or expression of OPRSl according to any embodiment described herein.

It is apparent that any small molecule known in the art to be a ligand of OPRSl may be used in the method of the invention described herein according to any embodiment. Known ligands include but are not limited to cocaine, a (+)-benzomorphan such as (+)- pentazocin and (+)N-allyl-normetazocine, BMY- 14802, caramiphen, a 1,4- (diphenylalkyl) piperazine derivative such as, SA4503 (l-(3,4-dimethoxyphenethyl)-4- (3-phenylρropyl) piperazine; US. Pat. No. 5, 736,546), a piperadine derivative, such as siramesine and others as disclosed in U.S. Pat. No. 5, 665,725, a dimethylcarbamic acid 2,3-bis-dimethylcarbamoyloxy-6-[4-(4-ethyl-piperazin-yl)-butyryl]-phenyl ester and a derivative thereof, scopolamine, igmesine, AC915 (N-(2-(3,4-dichlorophenyl)acetoxy)- ethylpyrrolidine) haloperidol, and opipramol. Preferably, the small molecule is selected from the group consisting of haloperidol, opipramol and AC915. As exemplified herein, AC915 and haloperidol are OPRSl antagonists or inverse agonists, and opipramol in an OPRS 1 agonist or partial agonist.

A suitable small molecule modulator may be identified from a library of small molecules according to any embodiment as described herein. Techniques for synthesizing small organic compounds will vary considerably depending upon the compound, however such methods is well known to those skilled in the art. In one embodiment, informatics is used to select suitable chemical building blocks from known compounds, for producing a combinatorial library. For example, QSAR (Quantitative Structure Activity Relationship) modeling approach uses linear regressions or regression trees of compound structures to determine suitability. The software of the Chemical Computing Group, Inc. (Montreal, Canada) uses high- throughput screening experimental data on active as well as inactive compounds, to create a probabilistic QSAR model, which is subsequently used to select lead compounds. The Binary QSAR method is based upon three characteristic properties of compounds that form a "descriptor" of the likelihood that a particular compound will or will not perform a required function: partial charge, molar refractivity (bonding interactions), and logP (lipophilicity of molecule). Each atom has a surface area in the molecule and it has these three properties associated with it. All atoms of a compound having a partial charge in a certain range are determined and the surface areas (Van der Walls Surface Area descriptor) are summed. The binary QSAR models are then used to make activity models or ADMET models, which are used to build a combinatorial library. Accordingly, lead compounds identified in initial screens, can be used to expand the list of compounds being screened to thereby identify highly active compounds. 1.2 Antibody modulators and fragments thereof

Methods for modulating OPRSl activity and/or level and/or expression include the use of an antibody or an active fragment thereof that preferentially or specifically binds to a target polypeptide, e.g. OPRSl, a down-stream target in the OPRSl pathway, or any protein or molecule known to regulate the level, activity, or expression of OPRSl according to any embodiment described herein.

The present invention also includes an antibody-based OPRSl modulator and/or uses thereof for the treatment and/or prophylaxis of neuronal degeneration and neurodenerative diseases. For example, an antibody or antibody-based modulator of OPRSl is used in the preparation of a medicament for the treatment or prophylaxis of

As used herein, the term "antibody" refers to intact monoclonal or polyclonal antibodies, immunoglobulin (IgA, IgD, IgG, IgM, IgE) fractions, humanized antibodies, or recombinant single chain antibodies, as well as fragments thereof, such as, for example Fab, F(ab)2, and Fv fragments.

Antibodies are prepared by any of a variety of techniques known to those of ordinary skill in the art, and described, for example in, Harlow and Lane (In: Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988). In one such technique, an immunogen comprising the antigenic polypeptide is initially injected into any one of a wide variety of animals (e.g., mice, rats, rabbits, sheep, humans, dogs, pigs, chickens and goats). The immunogen is derived from a natural source, produced by recombinant expression means, or artificially generated, such as by chemical synthesis (e.g., BOC chemistry or FMOC chemistry). For example, any epitope of OPRS-I as set forth in SEQ ID NO: 5, serves as the immunogen.

A peptide, polypeptide or protein is joined to a carrier protein, such as bovine serum albumin or keyhole limpet hemocyanin. The immunogen and optionally a carrier for the protein is injected into the animal host, preferably according to a predetermined schedule incorporating one or more booster immunizations, and blood collected from said the animals periodically. Optionally, the immunogen is injected in the presence of an adjuvant, such as, for example Freund's complete or incomplete adjuvant, lysolecithin and dinitrophenol to enhance the subject's immune response to the immunogen. Monoclonal or polyclonal antibodies specific for the polypeptide are then purified from blood isolated from an animal by, for example, affinity chromatography using the polypeptide coupled to a suitable solid support.

Monoclonal antibodies specific for the antigenic polypeptide of interest are prepared, for example, using the technique of Kohler and Milstein, Eur. J. Immunol. 5:511-519, 1976, and improvements thereto. Briefly, these methods involve the preparation of immortal cell lines capable of producing antibodies having the desired specificity (i.e., reactivity with the polypeptide of interest). Such cell lines are produced, for example, from spleen cells obtained from an animal immunized as described supra. The spleen cells are immortalized by, for example, fusion with a myeloma cell fusion partner, preferably one that is syngenic with the immunized animal. A variety of fusion techniques are known in the art, for example, the spleen cells and myeloma cells are combined with a nonionic detergent or electrofused and then grown in a selective medium that supports the growth of hybrid cells, but not myeloma cells. A preferred selection technique uses HAT (hypoxanthine, aminopterin, and thymine) selection. After a sufficient time, usually about 1 to 2 weeks, colonies of hybrids are observed. Single colonies are selected and growth media in which the cells have been grown is tested for the presence of an antibody having binding activity against the polypeptide (immunogen). Hybridomas having high reactivity and specificity are preferred.

Monoclonal antibodies are isolated from the supernatants of growing hybridoma colonies using methods such as, for example, affinity purification as described supra.

Various techniques are also known for enhancing antibody yield, such as injection of the hybridoma cell line into the peritoneal cavity of a suitable vertebrate host, such as a mouse. Monoclonal antibodies are then harvested from the ascites fluid or the blood of such an animal subject. Contaminants are removed from the antibodies by conventional techniques, such as chromatography, gel filtration, precipitation, and/or extraction. The marker associated with neurodegeneration of this invention may be used in the purification process in, for example, an affinity chromatography step.

It is preferable that an immunogen used in the production of an antibody is one which is sufficiently antigenic to stimulate the production of antibodies that will bind to the immunogen and is preferably, a high titer antibody. In one embodiment, an immunogen is an entire protein.

In another embodiment, an immunogen consists of a peptide representing a fragment of a polypeptide, for example a region of an OPRSl polypeptide that is alternatively spliced or an epitope of OPRS-I comprising a sequence of at least 5 to 6 amino acids of the OPRSl polypeptide as set forth in SEQ ID NO: 5. Preferably an antibody raised to such an immunogen also recognizes the full-length protein from which the immunogen was derived, such as, for example, in its native state or having native conformation.

Alternatively, or in addition, an antibody raised against a peptide immunogen recognizes the full-length protein from which the immunogen was derived when the protein is denatured. By "denatured" is meant that conformational epitopes of the protein are disrupted under conditions that retain linear B cell epitopes of the protein. As is known to a skilled artisan linear epitopes and conformational epitopes may overlap.

Alternatively, a monoclonal antibody capable of binding to a form of an OPRSl polypeptide or a fragment thereof is produced using a method such as, for example, a human B-cell hybridoma technique (Kozbar et al, Immunol. Today 4:12, 1983), a EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al Monoclonal Antibodies in Cancer Therapy, 1985 Allen R. Bliss, Inc., pages 77-96), or screening of combinatorial antibody libraries (Huse et al, Science 246:1215, 1989). The methods described supra are also suitable for production of an antibody or antibody binding fragment as described herein according to any embodiment.

Alternatively, an antibody modulator or fragment thereof is identified from a library of antibodies or fragments thereof using a method known in the art.

1.3 Peptide modulators and derivatives thereof

Methods for modulating OPRS 1 activity and/or level and/or expression include the use of a peptide or fragment thereof that preferentially or specifically binds to a target polypeptide, e.g. OPRSl, a down-stream target in the OPRSl pathway, or any protein or molecule known to regulate the level, activity, or expression of OPRSl according to any embodiment described herein.

For example, an peptide modulator or fragment thereof is identified from a library of peptides or fragments thereof using a method known in the art.

1.3.1 Peptide transduction domains

To facilitate peptide entry into a cell, the peptide may be conjugated to (e.g., expressed as a fusion with) a protein transduction domain. As used herein, the term "protein transduction domain" shall be taken to mean a peptide or protein that is capable of enhancing, increasing or assisting penetration or uptake of a compound conjugated to the protein transduction domain into a cell either in vitro or in vivo. Those skilled in the art is aware that synthetic or recombinant peptides can be delivered into cells through association with a protein transduction domain such as the TAT sequence from HIV or the Penetratin sequence derived from the Antennapaedia homeodomain protein (see, for example, Temsamani and Vidal, Drug Discovery Today 9: 1012-1019, 2004, for review). Additional suitable protein transduction domains are described, for example, in Zhao and Weisledder Medicinal Research Reviews, 24: 1-12, 2004 and Wagstaff and Jans, Current Medicinal Chemistry, 13: 1371-1387, 2006. 1.3.2 Linkers

Each of the components of a peptide modulator described herein may optionally be separated by a linker that facilitates the independent folding of each of said components. A suitable linker is apparent to the skilled artisan. For example, it is often unfavorable to have a linker sequence with high propensity to adopt α-helix or β- strand structures, which could limit the flexibility of the protein and consequently its functional activity. Rather, a more desirable linker is a sequence with a preference to adopt extended conformation. In practice, most currently designed linker sequences have a high content of glycine residues that force the linker to adopt loop conformation. Glycine is generally used in designed linkers because the absence of a β-carbon permits the polypeptide backbone to access dihedral angles that are energetically forbidden for other amino acids.

Preferably, the linker is hydrophilic, i.e. the residues in the linker are hydrophilic.

Linkers comprising glycine and/or serine have a high freedom degree for linking of two proteins, i.e., they enable the fused proteins to fold and produce functional proteins. Robinson and Sauer Proc. Natl. Acad. ScL 95: 5929-5934, 1998 found that it is the composition of a linker peptide that is important for stability and folding of a fusion protein rather than a specific sequence.

1.3.3 Peptide derivatives

The present invention also encompasses a derivative of a peptide modulator of OPRS 1. As used herein the term "derivative" shall be taken to mean a peptide that is derived from an inhibitory peptide as described herein e.g., a fragment or processed form of the peptide. The term "derivative" also encompasses fusion proteins comprising a peptide of the invention. For example, the fusion protein comprises a label, such as, for example, an epitope, e.g., a FLAG epitope or a V5 epitope or an HA epitope. For example, the epitope is a FLAG epitope. Such a tag is useful for, for example, purifying the fusion protein. The term "derivative" also encompasses a derivatized peptide, such as, for example, a peptide modified to contain one or more-chemical moieties other than an amino acid. The chemical moiety may be linked covalently to the peptide e.g., via an amino terminal amino acid residue, a carboxy terminal amino acid residue, or at an internal amino acid residue. Such modifications include the addition of a protective or capping group on a reactive moiety in the peptide, addition of a detectable label, and other changes that do not adversely destroy the activity of the peptide compound.

1.3.4 Peptide analogs In another example of the invention, an OPRSl modulator is a peptide analog. As used herein, the term "analog" shall be taken to mean a peptide that is modified to comprise one or more naturally-occurring and/or non-naturally-occurring amino acids, provided that the peptide analog is capable of modulating OPRSl activity and/or expression and/or level. For example, the term "analog" encompasses an inhibitory peptide comprising one or more conservative amino acid changes. The term "analog" also encompasses a peptide comprising, for example, one or more D-amino acids. Such an analog has the characteristic of, for example, protease resistance.

Suitable peptide analogs include, for example, a peptide comprising one or more conservative amino acid substitutions. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

It also is contemplated that other sterically similar compounds may be formulated to mimic the key portions of the peptide structure. Such compounds, which may be termed peptidomimetics, may be used in the same manner as an OPRS peptide modulator. The generation of such an analog may be achieved by the techniques of modeling and chemical design known to those of skill in the art. It is understood that all such sterically similar peptide analogs fall within the scope of the present invention.

An example of an analog of a peptide of the invention comprises one or more non- naturally occurring amino acids or amino acid analogs. For example, a peptide modulator as described herein comprises one or more naturally occurring non- genetically encoded L-amino acids, synthetic L-amino acids or D-enantiomers of an amino acid. For example, the peptide comprises only D-amino acids. For example, the analog comprises one or more residues selected from the group consisting of: hydroxyproline, β-alanine, 2,3-diaminopropionic acid, α-aminoisobutyric acid, N- methylglycine (sarcosine), ornithine, citrulline, t-butylalanine, t-butylglycine, N- methylisoleucine, phenylglycine, cyclohexylalanine, norleucine, naphthylalanine, pyridylananine 3-benzothienyl alanine 4-chlorophenylalanine, 2-fluorophenylalanine, 3-fluorophenylalanine, 4-fluorophenylalanine, penicillamine, 1,2,3,4-tetrahydro-tic isoquinoline-3-carboxylic acid β-2-thienylalanine, methionine sulfoxide, homoarginine, N-acetyl lysine, 2,4-diamino butyric acid, p-aminophenylalanine , N-methylvaline, homocysteine, homoserine, ε-amino hexanoic acid, δ-amino valeric acid, 2,3- diaminobutyric acid and mixtures thereof.

Other amino acid residues that are useful for making the peptides and peptide analogs described herein can be found, e.g., in Fasman, 1989, CRC Practical Handbook of Biochemistry and Molecular Biology, CRC Press, Inc., and the references cited therein.

The present invention additionally encompasses an isostere of a peptide described herein. The term "isostere" as used herein is intended to include a chemical structure that can be substituted for a second chemical structure because the steric conformation of the first structure fits a binding site specific for the second structure. The term specifically includes peptide back-bone modifications (i.e., amide bond mimetics) known to those skilled in the art. Such modifications include modifications of the ₍

71

amide nitrogen, the α-carbon, amide carbonyl, complete replacement of the amide bond, extensions, deletions or backbone crosslinks. Several peptide backbone modifications are known, including ψ[CH₂S], ψ[CH₂NH], ψ[CSNH₂], ψ[NHCO], ψ[COCH₂], and ψ[(E) or (Z) CH=CH]. In the nomenclature used above, ψ indicates the absence of an amide bond. The structure that replaces the amide group is specified within the brackets.

Other modifications include, for example, an N-alkyl (or aryl) substitution (ψ [CONR]), or backbone crosslinking to construct lactams and other cyclic structures. Other derivatives of the modulator compounds of the invention include C-terminal hydroxymethyl derivatives, O-modified derivatives (e.g., C-terminal hydroxymethyl benzyl ether), N-terminally modified derivatives including substituted amides such as alkylamides and hydrazides.

In another example, a peptide analog is ' a retro-peptide analog (see, for example, Goodma.n et ai, Accounts of Chemical Research, 72:1-7, 1979). A retro-peptide analog comprises a reversed amino acid sequence of a peptide modulator described herein.

In a further example, an analog of a peptide described herein is a retro-inverso peptide (as described, for example, in SeIa and Zisman, FASEB J. 11:449, 1997). Evolution has ensured the almost exclusive occurrence of L-amino acids in naturally occurring proteins. As a consequence, virtually all proteases cleave peptide bonds between adjacent L-amino acids. Accordingly, artificial proteins or peptides composed of D- amino acids are preferably resistant to proteolytic breakdown. Retro-inverso peptide analogs are isomers of linear peptides in which the direction of the amino acid sequence is reversed (retro) and the chirality, D- or L-, of one or more amino acids therein is inverted (inverso) e.g., using D-amino acids rather than L-amino acids, e.g.,

Jameson et al, Nature, 368, 744-746 (1994); Brady et al., Nature, 368, 692-693

(1994). The net result of combining D-enantiomers and reverse synthesis is that the positions of carbonyl and amino groups in each amide bond are exchanged, while the position of the side-chain groups at each alpha carbon is preserved. An advantage of retro-inverso peptides is their enhanced activity in vivo due to improved resistance to proteolytic degradation, i.e., the peptide has enhanced stability, (e.g., Chorev et al, Trends Biotech. 73, 438-445, 1995).

Retro-inverso peptide analogs may be complete or partial. Complete retro-inverso peptides are those in which a complete sequence of a peptide descried herein is reversed and the chirality of each amino acid in a sequence is inverted, other than glycine, because glycine does not have a chiral analog. Partial retro-inverso peptide analogs are those in which only some of the peptide bonds are reversed and the chirality of only those amino acid residues in the reversed portion is inverted. For example, one or two or three or four or five or six or seven or eight or nine or ten or eleven or twelve or thirteen or fourteen or fifteen or sixteen or seventeen or eighteen or nineteen or twenty or twenty one or twenty two or twenty three or twenty four or twenty five or twenty six or twenty seven or twenty eight or twenty nine or thirty or thirty one or thirty two or thirty three or thirty four or thirty five or thirty six or thirty seven or thirty eight amino acid residues are D-amino acids. Peptide modulators of the invention encompasses both partial and complete retro-inverso peptide analogs.

1.4 Nucleic acid modulators Methods for modulating OPRSl activity and/or level and/or expression include the use of nucleic acid that preferentially or specifically modulates OPRSl activity and/or level and/or expression. For example, the nucleic acid modulates OPRSl activity by increases or reduces increases or reduces a level of mRNA encoding OPRSl, increases or reduces turnover of mRNA encoding OPRSl, or increases or reduces the transcription rate of mRNA encoding OPRSl, or increases or reduces the level and/or expression of downstream signaling molecules from OPRSl, which directly or indirectly increases or reduces steady state OPRSl protein level or synthesis or turnover.

For example, the modulator comprises nucleic acid such as, for example, an antisense nucleic acid, micro RNA (miRNA), peptide nucleic acid (PNA), ribozyme, or small interfering RNA (siRNA), short hairpin RNA (shRNA) which is complementary, in whole or in part, to a target molecule comprising a sense strand, and can hybridize with a target molecule, e.g., OPRSl encoding mRNA. Antisense nucleic acid, miRNA, ribozymes small interfering RNAs or short hairpin RNAs may be produced by standard techniques known to the skilled artisan, based upon the sequences disclosed herein.

As exemplified herein, commercially available siRNA may be used. Also exemplified herein miRNAs known in the art may be used.

To facilitate cellular uptake, a nucleic acid modulator may be linked or conjugated to any known protein transduction domains known in the art. Suitable methods for linking or conjugating a nucleic acid to a protein transduction domain is apparent to the skilled artisan and/or described in, for example, International Application No. PCT/US93/07833.

Alternatively, a nucleic acid modulator is identified from a library of nucleic acids using a method known in the art.

1.6 Assays to identify and isolate therapeutic and prophylactic compounds In an additional or alternative embodiment of the invention, a compound library or mixture is screened by one or more of the following assays to isolate there from a compound modulator of OPRSl. This may require repeated screening to eventually purify the compound free or substantially free of contaminants.

It is to be understood that the following assays can be utilized in separately or collectively and in any order determined empirically to identify or isolate the desired product at a level of purity and having an activity ascribed to it suitable for use in the methods of the invention. The activity and purity of the compounds determined by these assays make the compound suitable of formulations e.g., oral, injectable and/or inhalable medicaments for treatment and/or prophylaxis. The present invention encompasses the use of any in silico or in vitro analytical method and/or industrial process for carrying the screening methods described herein into a pilot scale production or industrial scale production of a compound identified in such screens. This invention also provides information for such production method(s). Accordingly, the present invention also provides a process for identifying or determining a compound supra, said method comprising: (i) performing a method as described herein according to any embodiment to thereby identify a compound;

(ii) optionally, determining the amount of the compound; (iii) optionally, determining the structure of the compound; and

(iv) providing the compound or the name or structure of the compound such as, for example, in a paper form, machine-readable form, or computer-readable form.

As used herein, the term "providing the compound" shall be taken to include any chemical or recombinant synthetic means for producing said compound (with or without derivitization) or alternatively, the provision of a compound that has been previously synthesized by any person or means.

In one example, the compound or the name or structure of the compound is provided with an indication as to its use e.g., as determined by a screen described herein.

The present invention additionally provides a process for producing a compound supra, said method comprising: a process for identifying or determining a compound or modulator supra, said method comprising:

(i) performing a method as described herein according to any embodiment to thereby identify or determine a compound;

(ii) optionally, determining the amount of the compound;

(iii) optionally, determining the structure of the compound; (iv) optionally, providing the name or structure of the compound such as, for example, in a paper form, machine-readable form, or computer-readable form; and (v) providing the compound.

The present invention also provides a method of manufacturing a compound identified by a screening method described herein according to any embodiment for use in medicine comprising:

(i) performing a method as described herein according to any embodiment to thereby identify or determine a compound; and

(ii) using the compound in the manufacture of a therapeutic for use in medicine.

In one example, the method comprises the additional step of isolating the compound. Alternatively, a compound is identified and is produced for use in the manufacture of a r cvoMmTmpmouinnHd f fnorr i uicspe i inn m mpeHdiirc>iinnpe.

2 Formulations

While it is possible for the modulators of the present invention to be administered as the modulator per se, it is preferred to present the modulator in the form of a pharmaceutical formulation.

A compound of the invention as described herein according to any embodiment is formulated for therapy or prophylaxis with a carrier or excipient e.g., suitable for inhalation or injection.

Formulation of a pharmaceutical compound will vary according to the route of administration selected (e.g., solution, emulsion, capsule). For solutions or emulsions, suitable carriers include, for example, aqueous or alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles can include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils, for instance. Intravenous vehicles can include various additives, preservatives, or fluid, nutrient or electrolyte replenishers and the like (See, generally, Remington's Pharmaceutical Sciences, 17th Edition, Mack Publishing Co., Pa., 1985). For inhalation, the agent can be solubilized and loaded into a suitable dispenser for administration (e.g., an atomizer, nebulizer or pressurized aerosol dispenser).

Pharmaceutical formulations can be adapted for administration by any appropriate route, for example by the oral (including buccal or sublingual), rectal, nasal, topical (including buccal, sublingual or transferal), vaginal or parenteral (including subcutaneous, intramuscular, intravenous or intradermal) route. Such formulations can be prepared by any method known in the art of pharmacy, for example by bringing into association the active ingredient with the carrier(s), diluent(s) or excipient(s).

To prepare such pharmaceutical formulations, one or more compounds of the present invention is/are mixed with a pharmaceutically acceptable carrier or excipient for example, by mixing with physiologically acceptable carriers, excipients, or stabilizers in the form of, e.g., lyophilized powders, slurries, aqueous solutions, or suspensions

(see, e.g., Hardman, et al. (2001) Goodman and Gilman's The Pharmacological Basis of

Therapeutics, McGraw-Hill, New York, N.Y.; Gennaro (2000) Remington: The Science and Practice of Pharmacy, Lippincott, Williams, and Wilkins, New York,

N.Y.; Avis, et al. (eds.) (1993) Pharmaceutical Dosage Forms: Parenteral Medications,

Marcel Dekker, NY; Lieberman, et al. (eds.) (1990) Pharmaceutical Dosage Forms:

Tablets, Marcel Dekker, NY; Lieberman, et al. (eds.) (1990) Pharmaceutical Dosage

Forms: Disperse Systems, Marcel Dekker, NY; Weiner and Kotkoskie (2000) Excipient Toxicity and Safety, Marcel Dekker, Inc., New York, N.Y.).

As is apparent to a skilled artisan, a compound that is active in vivo is particularly preferred. A compound that is active in a human subject is even more preferred. Accordingly, when manufacturing a compound that is useful for the treatment of a disease it is preferable to ensure that any components added to the formulation do not inhibit or modify the activity of the active compound. Pharmaceutical formulations may be presented in unit dose forms containing a predetermined amount of active ingredient per unit dose. Such a unit may contain for example 1 μg to 10 ug, such as 0.01 mg to 1000 mg, or 0.1 mg to 250 mg, of a compound of Structural Formula I, Structural Formula II, Structural Formula III or Structural Formula IV, depending on the condition being treated, the route of administration and the age, weight and condition of the patient.

2.1 Oral formulations Pharmaceutical formulations adapted for oral administration may be presented as discrete units such as capsules, soft gels, or tablets; powders or granules; solutions or suspensions in aqueous or non-aqueous liquids; edible foams or whips; or oil-in-water liquid emulsions or water-in-oil liquid emulsions.

2.1.2 Granular tablets and capsules

In one example, the oral formulation comprises an intragranular phase comprising an effective amount of a modulator or compound of the present invention and at least one carbohydrate alcohol and an aqueous binder. The pharmaceutical formulation may be substantially lactose-free. Preferred carbohydrate alcohols for such formulations are selected from the group consisting of mannitol, maltitol, sorbitol, lactitol, erythritol and xylitol. Preferably, the carbohydrate alcohol is present at a concentration of about 15% to about 90%. A preferred aqueous binder is selected from the group consisting of hydroxypropyl cellulose, hydroxypropyl methylcellulose, carboxymethyl cellulose sodium, polyvinyl pyrrolidones, starches, gelatins and povidones. A binder is generally present in the range of from about 1% to about 15%. The intragranular phase can also comprise one or more diluents, such as, for example, a diluent selected from the group consisting of microcrystalline cellulose, powdered cellulose, calcium phosphate- dibasic, calcium sulfate, dextrates, dextrins, alginates and dextrose excipients. Such diluents are also present in the range of about 15% to about 90%. The intragranular phase can also comprise one or more disintegrants, such as, for example, a disintegrant selected from the group consisting of a low substituted hydroxypropyl cellulose, carboxymethyl cellulose, calcium carboxymethylcellulose, sodium carboxymethyl cellulose, sodium starch glycollate, crospovidone, croscarmellose sodium, starch, crystalline cellulose, hydroxypropyl starch, and partially pregelatinized starch. A disintegrant is generally present in the range of from about 5% to about 20%. Such a formulation can also comprise one or more lubricants such as, for example, a lubricant selected from the group consisting of talc, magnesium stearate, stearic acid, hydrogenated vegetable oils, glyceryl behenate, polyethylene glycols and derivatives thereof, sodium lauryl sulphate and sodium stearyl fumarate. A lubricant is generally present in the range of from about 0.5% to about 5%. Such formulations are made into a tablet, capsule, or soft gel e.g., by a process comprising mixing a modulator or compound of the invention and at least one carbohydrate alcohol to form a dry blend, wet granulating the dry blend with an aqueous binder so as to obtain an intragranular phase, and further formulating the resulting intragranular phase so as to provide the formulation. Typically, tablet or capsules is prepared to contain an appropriate unit dosage e.g., from 0.001 mg to 1000 mg.

A liquid or semi-solid pharmaceutical formulation for oral administration e.g., a hard gel or soft gel capsule, may be prepared comprising: (a) a first carrier component comprising from about 10% to about 99.99% by weight of a modulator or compound of the present invention;

(b) an optional second carrier component comprising, when present, up to about 70% by weight of said modulator or compound;

(c) an optional emulsifying/solubilizing component comprising, when present, from about 0.01 % to about 30% by weight of said modulator or compound;

(d) an optional anti-crystallization/solubilizing component comprising, when present, from about 0.01% to about 30% by weight of said modulator or compound; and

(e) an active pharmacological agent comprising from about 0.01% to about 80% of said modulator or compound in anhydrous crystal form. The first carrier component and optional second carrier component generally comprise, independently, one or more of lauroyl macrogol glycerides, caprylocaproyl macrogolglycerides, stearoyl macrogol glycerides, linoleoyl macrogol glycerides, oleoyl macrogol glycerides, polyalkylene glycol, polyethylene glycol, polypropylene glycol, polyoxyethylene-polyoxypropylene copolymer, fatty alcohol, polyoxyethylene fatty alcohol ether, fatty acid, polyethoxylated fatty acid ester, propylene glycol fatty acid ester, fatty ester, glycerides of fatty acid, polyoxyethylene-glycerol fatty ester, polyoxypropylene-glycerol fatty ester, polyglycolized glycerides, polyglycerol fatty acid ester, sorbitan ester, polyethoxylated sorbitan ester, polyethoxylated cholesterol, polyethoxylated castor oil, polyethoxylated sterol, lecithin, glycerol, sorbic acid, sorbitol, or polyethoxylated vegetable oil.

The emulsifying/solubilizing component generally comprises one or more of metallic alkyl sulfate, quaternary ammonium compounds, salts of fatty acids, sulfosuccinates, taurates, amino acids, lauroyl macrogol glycerides, caprylocaproyl macrogolglycerides, stearoyl macrogol glycerides, linoleoyl macrogol glycerides, oleoyl macrogol glycerides, polyalkylene glycol, polyethylene glycol, polypropylene glycol, polyoxyethylene-polyoxypropylene copolymer, polyoxyethylene fatty alcohol ether, fatty acid, polyethoxylated fatty acid ester, propylene glycol fatty acid ester, polyoxyethylene-glycerol fatty ester, polyglycolized glycerides, polyglycerol fatty acid ester, sorbitan ester, polyethoxylated sorbitan ester, polyethoxylated cholesterol, polyethoxylated castor oil, polyethoxylated sterol, lecithin, or polyethoxylated vegetable oil.

The anti-crystallization/solubilizing component, when present, generally comprises one or more of metallic alkyl sulfate, polyvinylpyrrolidone, lauroyl macrogol glycerides, caprylocaproyl macrogolglycerides, stearoyl macrogol glycerides, linoleoyl macrogol glycerides, oleoyl macrogol glycerides, polyalkylene glycol, polyethylene glycol, polypropylene glycol, polyoxyethylene-polyoxypropylene copolymer, fatty alcohol, polyoxyethylene fatty alcohol ether, fatty acid, polyethoxylated fatty acid ester, propylene glycol fatty acid ester, fatty ester, glycerides of fatty acid, polyoxyethylene- glycerol fatty ester, polyglycolized glycerides, polyglycerol fatty acid ester, sorbitan ester, polyethoxylated sorbitan ester, polyethoxylated cholesterol, polyethoxylated castor oil, polyethoxylated sterol, lecithin, or polyethoxylated vegetable oil.

2.1.4 Bioadhesive polymeric formulations

Particularly preferred formulations for oral delivery of a modulator or compound of the invention account for its relative lipophilicity and ready absorption by the lining of the stomach and/or the intestine. By appropriate formulation of the compounds, their levels in body fluids such as plasma and urine can be enhanced, relative to their deposition in adipose tissues.

For example, a modulator or compound of the invention is formulated with a hydrophobic polymer, preferably a bioadhesive polymer and optionally encapsulated in or dispersed throughout a microparticle or nanoparticle. The bioadhesive polymer improves gastrointestinal retention via adherence of the formulation to the walls of the gastrointestinal tract. Suitable bioadhesive polymers include polylactic acid, polystyrene, poly(bis carboxy phenoxy propane-co-sebacic anhydride) (20:80) (poly (CCP:SA)), alginate (freshly prepared); and poly(fumaric anhydride-co-sebacic anhydride (20:80) (poly (FA:SA)), types A (containing sudan red dye) and B (undyed). Other high-adhesion polymers include p(FA:SA) (50:50) and non-water-soluble polyacrylates and polyacrylamides. Preferred bioadhesive polymers are typically hydrophobic enough to be non-water-soluble, but contain a sufficient amount of exposed surface carboxyl groups to promote adhesion e.g., non-water-soluble polyacrylates and polymethacrylates; polymers of hydroxy acids, such as polylactide and polyglycolide; polyanhydrides; polyorthoesters; blends comprising these polymers; and copolymers comprising the monomers of these polymers. Preferred biopolymers are bioerodable, with preferred molecular weights ranging from 1000 to 15,000 kDa, and most preferably 2000 to 5000 Da. Polyanhydrides e.g., polyadipic anhydride Cp(AA)"), polyfumaric anhydride, polysebacic anhydride, polymaleic anhydride, polymalic anhydride, polyphthalic anhydride, polyisophthalic anhydride, polyaspartic anhydride, polyterephthalic anhydride, polyisophthalic anhydride, poly carboxyphenoxypropane anhydride and copolymers with other polyanhydrides at different mole ratios, are particularly preferred.

Blends of hydrophilic polymers and bioadhesive hydrophobic polymers can also be employed. Suitable hydrophilic polymers include e.g., hydroxypropylmethylcellulose, hydroxypropylcellulose, carboxymethylcellulose, polyvinylalcohols, polyvinylpyrollidones, and polyethylene glycols.

Other mucoadhesive polymers include DOPA-maleic anhydride co polymer, isopthalic anhydride polymer, DOPA-methacrylate polymers, DOPA-cellulosic based polymers, and DOPA-acrylic acid polymers.

Excipients will typically be included in the dosage form e.g., to improve bioadhesion. Suitable excipients include solvents, co-solvents, emulsifϊers, plasticizers, surfactants, thickeners, pH modifiers, emollients, antioxidants, and chelating agents, wetting agents, and water absorbing agents. The formulation may also include one or more additives, for example, dyes, colored pigments, pearlescent agents, deodorizers, and odor maskers.

The modulator or compound may optionally be encapsulated or molecularly dispersed in polymers to reduce particle size and increase dissolution. The polymers may include polyesters such as poly(lactic acid) or P(LA), polycaprylactone, polylactide- coglycolide or P(LGA), poly hydroxybutyrate poly β-malic acid); polyanhydrides such as poly(adipic)anhydride or P(AA), poly(fumaric-co-sebacic)anhydride or P(FA: SA), poly(sebacic)anhydride or P(SA); cellulosic polymers such as ethylcellulose, cellulose acetate, cellulose acetate phthalate, etc; acrylate and methacrylate polymers such as Eudragit RS 100, RL 100, ElOO PO, L1OO-55, LlOO, SlOO (distributed by Rohm America) or other polymers commonly used for encapsulation for pharmaceutical purposes and known to those skilled in the art. Also suitable are hydrophobic polymers such as polyimides. Blending or copolymerization sufficient to provide a certain amount of hydrophilic character can be useful to improve wettability of the materials. For example, about 5% to about 20% of monomers may be hydrophilic monomers. Hydrophilic polymers such as hydroxylpropylcellulose (HPC), hydroxpropylmethylcellulose (HPMC), carboxymethylcellulose (CMC) are commonly used for this purpose.

The formulation may be an "immediate release" formulation that releases at least 85% (wt/wt) of the active modulator or compound derivative within 60 minutes in vitro. Alternatively, the formulation is a "controlled release" formulation that releases drug more slowly than an immediate release formulation i.e., it takes longer than 60 minutes to release at least 85% (wt/wt) of the drug in vitro. To extend the time period for release, the ratio of modulator or compound to polymer can be increased. Increased relative drug concentration is believed to have the effect of increasing the effective compound domain size within the polymer matrix thereby slowing dissolution. In the case of a polymer matrix containing certain types of hydrophobic polymers, the polymer will act as a mucoadhesive material and increase the retention time of the active compound in the gastrointestinal tract. Increased drug dissolution rates combined with the mucoadhesive properties of the polymer matrix increase uptake of the active compound and reduce differences found in the fed and fasted states for the compounds.

The oral formulations may be prepared using a pharmaceutically acceptable carrier composed of materials that are considered safe and effective and may be administered to an individual without causing undesirable biological side effects or unwanted interactions. Exemplary carrier include diluents, binders, lubricants, disintegrants, stabilizers, surfactants, colorants, and fillers.

Diluents or fillers increase the bulk of a solid dosage form so that a practical size is provided for compression of tablets or formation of beads and granules. Suitable diluents include, but are not limited to dicalcium phosphate dihydrate, calcium sulfate, lactose, sucrose, mannitol, sorbitol, cellulose, microcrystalline cellulose, kaolin, sodium chloride, dry starch, hydrolyzed starches, pregelatinized starch, silicone dioxide, titanium oxide, magnesium aluminum silicate and powdered sugar.

Dispersants include phosphate-buffered saline (PBS), saline, glucose, sodium lauryl sulfate (SLS), polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), and hydroxypropylmethylcellulose (HPMC).

Binders may impart cohesive qualities to a solid dosage formulation, and thus ensure that a tablet, bead or granule remains intact after the formation of the dosage forms. Suitable binder materials include, but are not limited to, starch, pregelatinized starch, gelatin, sugars (including sucrose, glucose, dextrose, lactose and sorbitol), polyethylene glycol, waxes, natural and synthetic gums such as acacia, tragacanth, sodium alginate, cellulose, including hydroxypropylmethylcellulose ("HPMC"), microcrystalline cellulose ("MCC"), hydroxypropylcellulose, ethylcellulose, and veegum, and synthetic polymers such as acrylic acid and methacrylic acid copolymers, methacrylic acid copolymers, methyl methacrylate copolymers, aminoalkyl methacrylate copolymers, polyacrylic acid/polymethacrylic acid and polyvinylpyrrolidone (PVP).

Lubricants may facilitate tablet manufacture. Examples of suitable lubricants include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, glycerol behenate, polyethylene glycol, talc, and mineral oil.

Disintegrants may facilitate dosage form disintegration after administration, and generally include, but are not limited to, starch, sodium starch glycolate, sodium carboxymethyl starch, sodium carboxymethylcellulose, hydroxypropyl cellulose, pregelatinized starch, clays, cellulose, alginine, gums or cross linked polymers, such as cross-linked PVP.

Stabilizers may inhibit or retard drug decomposition reactions which include, by way of example, oxidative reactions. Surfactants may be anionic, cationic, amphoteric or nonionic surface active agents. Suitable anionic surfactants include, but are not limited to, those containing carboxylate, sulfonate and sulfate ions. Examples of anionic surfactants include sodium, potassium, ammonium of long chain alkyl sulfonates and alkyl aryl sulfonates such as sodium dodecylbenzene sulfonate; dialkyl sodium sulfosuccinates, such as sodium dodecylbenzene sulfonate; dialkyl sodium sulfosuccinates, such as sodium bis- (2-ethylthioxyl)-sulfosuccinate; and alkyl sulfates such as sodium lauryl sulfate. Cationic surfactants include, but are not limited to, quaternary ammonium compounds such as benzalkonium chloride, benzethonium chloride, cetrimonium bromide, stearyl dimethylbenzyl ammonium chloride, polyoxyethylene and coconut amine. Examples of nonionic surfactants include ethylene glycol monostearate, propylene glycol myristate, glyceryl monostearate, glyceryl stearate, polyglyceryl-4-oleate, sorbitan acylate, sucrose acylate, PEG- 150 laurate, PEG-OO monolaurate, polyoxyethylene monolaurate, polysorbates, polyoxyethylene octylphenylether, PEG- 1000 cetyl ether, polyoxyethylene tridecyl ether, polypropylene glycol butyl ether, stearoyl monoisopropanolamide, and polyoxyethylene hydrogenated tallow amide. Examples of amphoteric surfactants include sodium N-dodecyl-β-alanine, sodium N-lauryl- β- iminodipropionate, myristoamphoacetate, lauryl betaine and lauryl sulfobetaine.

If desired, the tablets, beads, granules, or particles may also contain minor amount of nontoxic auxiliary substances such as wetting or emulsifying agents, dyes, pH buffering agents, or preservatives.

2.1.5 Inhalable formulations Pharmaceutical formulations adapted for administration by inhalation include fine particle dusts or mists which may be generated by means of various types of metered dose pressurized aerosols, nebulizers or insufflators.

Spray compositions may, for example, be formulated as aerosols delivered from pressurized packs, such as a metered dose inhaler, with the use of a suitable liquified propellant. Capsules and cartridges for use in an inhaler or insufflator, for example gelatine, may be formulated containing a powder mix for inhalation of a compound of the invention and a suitable powder base such as lactose or starch.

Aerosol formulations are preferably arranged so that each metered dose or "puff of aerosol contains about .001 μg to about 2000 μg of modulator or compound of the invention.

Pharmaceutical formulations adapted for nasal administration wherein the carrier is a solid include a coarse powder having a particle size for example in the range 20 to 500 microns which is administered in the manner in which snuff is taken, i.e. by rapid inhalation through the nasal passage from a container of the powder held close to the nose. Suitable formulations wherein the carrier is a liquid, for administration as a nasal spray or as nasal drops, include aqueous or oil solutions of the active ingredient.

The overall daily dose and the metered dose delivered by capsules and cartridges in an inhaler or insufflator will generally be double those with aerosol formulations.

2.1.6 Injectable formulations

Pharmaceutical formulations adapted for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain the antioxidants as well as buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example sealed ampules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets. Formulation of a modulator or compound of the present invention in an intravenous lipid emulsion or a surfactant micelle or polymeric micelle (see., e.g., Jones et al, Eur. J. Pharmaceutics Biopharmaceutics 48, 101-111, 1999; Torchilin J. Clin, release 73, 137-172, 2001; both of which are incorporated herein by reference) is particularly preferred.

Sustained release injectable formulations are produced e.g., by encapsulating the modulator or compound in porous microparticles which comprise a pharmaceutical agent and a matrix material having a volume average diameter between about 1 μm and 150 μm, e.g., between about 5 μm and 25 μm diameter. In one embodiment, the porous microparticles have an average porosity between about 5% and 90% by volume. In one embodiment, the porous microparticles further comprise one or more surfactants, such as a phospholipid. The microparticles may be dispersed in a pharmaceutically acceptable aqueous or non-aqueous vehicle for injection. Suitable matrix materials for such formulations comprise a biocompatible synthetic polymer, a lipid, a hydrophobic molecule, or a combination thereof. For example, the synthetic polymer can comprise, for example, a polymer selected from the group consisting of poly(hydroxy acids) such as poly(lactic acid), poly(glycolic acid), and poly(lactic acid-co-glycolic acid), poly(lactide), poly(glycolide), poly(lactide-co-glycolide), polyanhydrides, polyorthoesters, polyamides, polycarbonates, polyalkylenes such as polyethylene and polypropylene, polyalkylene glycols such as poly(ethylene glycol), polyalkylene oxides such as poly(ethylene oxide), polyalkylene terepthalates such as poly(ethylene terephthalate), polyvinyl alcohols, polyvinyl ethers, polyvinyl esters, polyvinyl halides such as poly( vinyl chloride), polyvinylpyrrolidone, polysiloxanes, poly(vinyl alcohols), poly(vinyl acetate), polystyrene, polyurethanes and co-polymers thereof, derivativized celluloses such as alkyl cellulose, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, nitro celluloses, methyl cellulose, ethyl cellulose, hydroxypropyl cellulose, hydroxy-propyl methyl cellulose, hydroxybutyl methyl cellulose, cellulose acetate, cellulose propionate, cellulose acetate butyrate, cellulose acetate phthalate, carboxylethyl cellulose, cellulose triacetate, and cellulose sulphate sodium salt (jointly referred to herein as "synthetic celluloses"), polymers of acrylic acid, methacrylic acid or copolymers or derivatives thereof including esters, poly(methyl methacrylate), poly(ethyl methacrylate), poly(butylmethacrylate), poly(isobutyl methacrylate), poly(hexylmethacrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), and poly(octadecyl acrylate) (jointly referred to herein as "polyacrylic acids"), poly(butyric acid), poly(valeric acid), and poly(lactide-co- caprolactone), copolymers, derivatives and blends thereof. In a preferred embodiment, the synthetic polymer comprises a poly(lactic acid), a poly(glycolic acid), a poly(lactic- co-glycolic acid), or a poly(lactide-co-glycolide).

3. Dosage and administration

Selecting an administration regimen for a therapeutic composition depends on several factors, including the serum or tissue turnover rate of the entity, the level of symptoms, the immunogenicity of the entity, and the accessibility of the target cells in the biological matrix. Preferably, an administration regimen maximizes the amount of therapeutic compound delivered to the patient consistent with an acceptable level of side effects. Accordingly, the amount of composition delivered depends in part on the particular entity and the severity of the condition being treated.

A compound can be provided, for example, by continuous infusion, or by doses at intervals of, e.g., one day, one week, or 1-7 times per week. Doses of a composition may be provided intravenously, subcutaneously, topically, orally, nasally, rectally, intramuscular, intracerebrally, or by inhalation. A preferred dose protocol is one involving the maximal dose or dose frequency that avoids significant undesirable side effects. A total weekly dose depends on the type and activity of the compound being used. For example, such a dose is at least about 0.05 μg/kg body weight, or at least about 0.2 μg/kg, or at least about 0.5 μg/kg, or at least about 1 μg/kg, or at least about 10 μg/kg, or at least about 100 μg/kg, or at least about 0.2 mg/kg, or at least about 1.0 mg/kg, or at least about 2.0 mg/kg, or at least about 10 mg/kg, or at least about 25 mg/kg, or at least about 50 mg/kg (see, e.g., Yang, et al. New Engl. J. Med. 349:427- 434, 2003; or Herold, et al. New Engl. J. Med. 346:1692-1698, 2002. An effective amount of a compound for a particular patient may vary depending on factors such as the condition being treated, the overall health of the patient, the method route and dose of administration and the severity of side affects, see, e.g., Maynard, et al. (1996) A Handbook of SOPs for Good Clinical Practice, Interpharm Press, Boca Raton, FIa.; or Dent (2001) Good Laboratory and Good Clinical Practice, Urch Publ., London, UK.

Determination of the appropriate dose is made by a clinician, e.g., using parameters or factors known or suspected in the art to affect treatment or predicted to affect treatment. Generally, the dose begins with an amount somewhat less than the optimum dose and is increased by small increments thereafter until the desired or optimum effect is achieved relative to any negative side effects. Important diagnostic measures include those of symptoms of the disease and/or disorder being treated. Preferably, a compound that is used is derived from or adapted for use in the same species as the subject targeted for treatment, thereby minimizing a humoral response to the reagent.

An effective amount of therapeutic will decrease disease symptoms, for example, as described supra, typically by at least about 10%; usually by at least about 20%; preferably at least about 30%; more preferably at least about 40%, and more preferably by at least about 50%.

The route of administration is preferably by, e.g., oral, injection or infusion by intravenous, intraperitoneal, intracerebral, intramuscular, intraocular, intraarterial, intracerebrospinal, intralesional, or pulmonary routes, or by sustained release systems or an implant (see, e.g., Sidman et al. Biopolymers 22:547-556, 1983; Langer, et al. J. Biomed. Mater. Res. 15:167-277, 1981; Langer Chem. Tech. 12:98-105, 1982; Epstein, et al. Proc. Natl. Acad. Sci. USA 82:3688-3692, 1985; Hwang, et al. Proc. Natl. Acad. Sci. USA 77:4030-4034, 1980; U.S. Pat. Nos. 6,350,466 and 6,316,024).

The pharmaceutical formulation of the present invention will generally contain sufficient modulator to reduce,inhibit, prevent or delay cytoplasmic sequestration of TDP-43 protein in neuroglia and/or neurongal cells and/or level of TDP-43 protein in inclusion bodies fo neuroglia and/or neuronal cells. This is determined by any assay as described and/or exemplified herein.

4. Markers associated with a disease or disorder In one example of the present invention, a marker associated with and/or causative of a nervous system degeneration e.g., neurodegenerative disease such as TDP -43 proteinopathy, is a nucleic acid marker. Preferably, the marker comprises or consists of a nucleotide sequence at least about 80% identical to at least about 20 contiguous nucleotides, more preferably at least about 30 contiguous nucleotides, of a sequence selected from the group consisting of:

(i) a sequence selected from the group consisting of SEQ ID NO: 1-5, 7, 8 and 13; (ii) a sequence capable of encoding an amino acid sequence at least 80% homologous to the sequence set forth in SEQ ID NO: 6; and (iii) a sequence complementary to a sequence set forth in (i) or (ii).

Such a nucleic acid marker may be or comprise, for example, a polymorphism, an insertion into an OPRSl gene or transcript thereof, a deletion from an OPRSl gene or transcript thereof, a transcript of an OPRSl gene or a fragment thereof or an alternatively spliced transcript of an OPRSl or a fragment thereof.

In one example of the invention a marker comprises a polymorphism or more preferably a mutation associated with and/or causative of alternative splicing of an OPRSl mRNA.

In one example, the presence of a polymorphism or mutation associated with alternative splicing of an OPRSl mRNA is correlated with modulated levels of alternatively spliced OPRSl mRNA, e.g., increased levels of a mRNA lacking nucleic acid compared to SEQ ID NO: 5 and/or reduced levels of a mRNA comprising a sequence set forth in SEQ ID NO: 5. Preferably, the marker comprises a sequence comprising a thymine at a position corresponding to nucleotide position 2583 of SEQ ID NO: 13 or an adenine at a position corresponding to nucleotide position 2576 of SEQ ID NO: 13. In another example a marker associated with and/or causative of alternatively splicing in an OPRSl expression produce, e.g., transcript, comprises an adenine at a position corresponding to nucleotide position 2254 of SEQ ID NO: 13, or an adenine at a position corresponding to nucleotide position 2255 of SEQ ID NO: 13, or an adenine at a position corresponding to nucleotide position 2257 of SEQ ID NO: 13, or an adenine at a position corresponding to nucleotide position 2792 of SEQ ID NO: 13. The level of a specific splice form of OPRSl mRNA is increased or decreased when the polymorphism is present and is useful for detecting a marker associated with a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,.

The present inventors have additionally shown association of a nucleotide variation in the OPRSl gene that increases expression of OPRSl and the development of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,. Accordingly, in another embodiment of the invention, the marker comprises a polymorphism or mutation that increases expression of an OPRSl expression product compared to the level of expression of an OPRSl expression product expressed from a gene that does not comprise the polymorphism or mutation. Preferably, the marker comprises a sequence comprising a thymine at a position corresponding to nucleotide position 4191 of SEQ ID NO: 13 and/or an adenine at a position corresponding to nucleotide position 4187 of SEQ ID NO: 13

In another example, the marker is in an OPRSl polypeptide. Preferably, the marker comprises a sequence comprising a valine at a position corresponding to amino acid residue 4 of SEQ ID NO: 6.

In one embodiment, the method of the invention comprises detecting or determining the presence of a plurality of markers associated with a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,. 6. Nucleic acid detection methods

As is apparent to the skilled artisan a probe or primer capable of specifically detecting a marker that is associated with and/or causative of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, is any probe or primer that is capable of specifically hybridizing to the region of the genome that comprises said marker, or an expression product thereof. Accordingly, a nucleic acid marker is preferably at least about 8 nucleotides in length (for example, for detection using a locked nucleic acid (LNA) probe). To provide more specific hybridization, a marker is preferably at least about 15 nucleotides in length or more preferably at least 20 to 30 nucleotides in length. Such markers are particularly amenable to detection by nucleic acid hybridization-based detection means assays, such as, for example any known format of PCR or ligase chain reaction.

hi one embodiment, a preferred probe or primer comprises, consists of or is within a nucleic acid comprising a nucleotide sequence at least about 80% identical to at least

20 nucleotides of a sequence selected from the group consisting of:

(i) a sequence at least about 80% homologous to a sequence selected from the group consisting of SEQ ID NO: 1-5, 7, 8 and 13;

(ii) a sequence capable of encoding an amino acid sequence at least 80% homologous to the sequence set forth in SEQ ID NO: 6; and

(iii) a sequence complementary to a sequence set forth in (i) or (ii).

Generally, a method for detecting a nucleic acid marker comprises hybridizing an oligonucleotide to the marker linked to nucleic acid in a sample from a subject under moderate to high stringency conditions and detecting hybridization of the oligonucleotide using a detection means, such as for example, an amplification reaction or a hybridization reaction.

For the purposes of defining the level of stringency to be used in these diagnostic assays, a low stringency is defined herein as being a hybridization and/or a wash carried out in 6 x SSC buffer, 0.1% (w/v) SDS at 28⁰C, or equivalent conditions. A moderate stringency is defined herein as being a hybridization and/or washing carried out in 2 x SSC buffer, 0.1% (w/v) SDS at a temperature in the range 45°C to 65°C, or equivalent conditions. A high stringency is defined herein as being a hybridization and/or wash carried out in 0.1 x SSC buffer, 0.1% (w/v) SDS, or lower salt concentration, and at a temperature of at least 65°C, or equivalent conditions. Reference herein to a particular level of stringency encompasses equivalent conditions using wash/hybridization solutions other than SSC known to those skilled in the art.

Generally, the stringency is increased by reducing the concentration of SSC buffer, and/or increasing the concentration of SDS and/or increasing the temperature of the hybridization and/or wash. Those skilled in the art is aware that the conditions for hybridization and/or wash may vary depending upon the nature of the hybridization matrix used to support the sample DNA, and/or the type of hybridization probe used.

In another embodiment, stringency is determined based upon the temperature at which a probe or primer dissociates from a target sequence (i.e., the probe or primers melting temperature or Tm). Such a temperature may be determined using, for example, an equation or by empirical means. Several methods for the determination of the Tm of a nucleic acid are known in the art. For example the Wallace Rule determines the G + C and the T + A concentrations in the oligonucleotide and uses this information to calculate a theoretical Tm (Wallace et al, Nucleic Acids Res. 6, 3543, 1979). Alternative methods, such as, for example, the nearest neighbour method are known in the art, and described, for example, in Howley, et al, J. Biol. Chem. 254, 4876, Santa Lucia, Proc. Natl. Acad. ScL USA, 95: 1460-1465, 1995 or Bresslauer et al, Proc. Natl. Acad. ScL USA, 83: 3746-3750, 1986. A temperature that is similar to (e.g., within 5⁰C or within 1O⁰C) or equal to the proposed denaturing temperature of a probe or primer is considered to be high stringency. Medium stringency is to be considered to be within 1O⁰C to 2O⁰C or 1O⁰C to 15⁰C of the calculated Tm of the probe or primer. 6.1 Probe/primer design and production

As is apparent to the skilled artisan, the specific probe or primer used in an assay of the present invention will depend upon the assay format used. Clearly, a probe or primer that is capable of preferentially or specifically hybridizing or annealing to or detecting the marker of interest is preferred. Methods for designing probes and/or primers for, for example, PCR or hybridization are known in the art and described, for example, in Dieffenbach and Dveksler (Eds) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratories, NY, 1995). Furthermore, several software packages are publicly available that design optimal probes and/or primers for a variety of assays, e.g. Primer 3 available from the Center for Genome Research, Cambridge, MA, USA. Probes and/or primers useful for detection of a marker associated with a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, are assessed to determine those that do not form hairpins, self-prime or form primer dimers (e.g. with another probe or primer used in a detection assay).

Furthermore, a probe or primer (or the sequence thereof) is assessed to determine the temperature at which it denatures from a target nucleic acid (i.e. the melting temperature of the probe or primer, or Tm). Methods of determining Tm are known in the art and described, for example, in Santa Lucia, Proc. Natl. Acad. Sci. USA, 95: 1460-1465, 1995 or Bresslauer et al, Proc. Natl. Acad. Sci. USA, 83: 3746-3750, 1986.

A primer or probe useful for detecting a SNP or mutation in an allele specific PCR assay or a ligase chain reaction assay is designed such that the 3' terminal nucleotide hybridizes to the site of the SNP or mutation. The 3' terminal nucleotide may be any of the nucleotides known to be present at the site of the SNP or mutation. When complementary nucleotides occur in the probe or primer and at the site of the polymorphism the 3' end of the probe or primer hybridizes completely to the marker of interest and facilitates amplification, for example, PCR amplification or ligation to another nucleic acid. Accordingly, a probe or primer that completely hybridizes to the target nucleic acid produces a positive result in an assay. In another embodiment, a primer useful for a primer extension reaction is designed such that it preferentially o specifically hybridizes to a region adjacent to a specific nucleotide of interest, e.g. a SNP or mutation.

Whilst the specific hybridization of a probe or primer may be estimated by determining the degree of homology of the probe or primer to any nucleic acid using software, such as, for example, BLAST, the specificity of a probe or primer can only be determined empirically using methods known in the art.

A locked nucleic acid (LNA) or protein-nucleic acid (PNA) probe or a molecular beacon useful, for example, for detection of a SNP or mutation or microsatellite by hybridization is at least about 8 to 12 nucleotides in length. Preferably, the nucleic acid, or derivative thereof, that hybridizes to the site of the SNP or mutation or microsatellite is positioned at approximately the centre of the probe, thereby facilitating selective hybridization and accurate detection.

Methods for producing/synthesizing a probe or primer of the present invention are known in the art. For example, oligonucleotide synthesis is described, in Gait (Ed) (In: Oligonucleotide Synthesis: A Practical Approach, IRL Press, Oxford, 1984). For example, a probe or primer may be obtained by biological synthesis (eg. by digestion of a nucleic acid with a restriction endonuclease) or by chemical synthesis. For short sequences (up to about 100 nucleotides) chemical synthesis is preferable.

For longer sequences standard replication methods employed in molecular biology are useful, such as, for example, the use of Ml 3 for single stranded DNA as described by J. Messing (1983) Methods Enzymol, 101, 20-78.

Other methods for oligonucleotide synthesis include, for example, phosphotriester and phosphodiester methods (Narang, et al. Meth. Enzymol 68: 90, 1979) and synthesis on a support (Beaucage, et al Tetrahedron Letters 22: 1859-1862, 1981) as well as phosphoramidate technique, Caruthers, M. H., et a\., "Methods in Enzymology," Vol. 154, pp. 287-314 (1988), and others described in "Synthesis and Applications of DNA and RNA," S. A. Narang, editor, Academic Press, New York, 1987, and the references contained therein.

LNA synthesis is described, for example, in Nielsen et al, J. Chem. Soc. Perkin Trans., 1: 3423, 1997; Singh and Wengel, Chem. Commun. 1247, 1998. While, PNA synthesis is described, for example, in Egholm et al, Am. Chem. Soc, 114: 1895, 1992; Egholm et al, Nature, 365: 566, 1993; and Oram et al, Nucl. Acids Res., 21: 5332, 1993.

hi one embodiment, the probe or primer comprises one or more detectable markers. For example, the probe or primer comprises a fluorescent label such as, for example, fluorescein (FITC), 5,6-carboxymethyl fluorescein, Texas red, nitrobenz-2-oxa-l,3- diazol-4-yl (NBD), coumarin, dansyl chloride, rhodamine, 4'-6-diamidino-2- phenylinodole (DAPI), and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7, fluorescein (5-carboxyfluorescein-N-hydroxysuccinimide ester), rhodamine (5,6- tetramethyl rhodamine). The absorption and emission maxima, respectively, for these fluors are: FITC (490 nm; 520 nm), Cy3 (554 nm; 568 nm), Cy3.5 (581 ran; 588 nm), Cy5 (652 nm: 672 nm), Cy5.5 (682 nm; 703 nm) and Cy7 (755 nm; 778 nm).

Alternatively, the probe or primer is labeled with, for example, a fluorescent semiconductor nanocrystal (as described, for example, in US 6,306,610), a radiolabel or an enzyme (e.g. horseradish peroxidase (HRP), alkaline phosphatase (AP) or β- galactosidase).

Such detectable labels facilitate the detection of a probe or primer, for example, the hybridization of the probe or primer or an amplification product produced using the probe or primer. Methods for producing such a labeled probe or primer are known in the art. Furthermore, commercial sources for the production of a labeled probe or primer is known to the skilled artisan, e.g., Sigma-Genosys, Sydney, Australia. The present invention additionally contemplates the use a probe or primer as described herein in the manufacture of a diagnostic reagent for diagnosing or determining a predisposition to a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,.

6.2 Detection methods

Methods for detecting nucleic acids are known in the art and include for example, hybridization based assays, amplification based assays and restriction endonuclease based assays. For example, a change in the sequence of a region of the genome or an expression product thereof, such as, for example, an insertion, a deletion, a transversion, a transition, alternative splicing or a change in the preference of or occurrence of a splice form of a gene is detected using a method, such as, polymerase chain reaction (PCR) strand displacement amplification, ligase chain reaction, cycling probe technology or a DNA microarray chip amongst others.

Methods of PCR are known in the art and described, for example, in Dieffenbach (Ed) and Dveksler (Ed) {In: PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratories, NY, 1995). Generally, for PCR two non-complementary nucleic acid primer molecules comprising at least about 20 nucleotides in length, and more preferably at least 30 nucleotides in length are hybridized to different strands of a nucleic acid template molecule, and specific nucleic acid molecule copies of the template are amplified enzymatically. PCR products may be detected using electrophoresis and detection with a detectable marker that binds nucleic acids. Alternatively, one or more of the oligonucleotides are labeled with a detectable marker (e.g. a fluorophore) and the amplification product detected using, for example, a lightcycler (Perkin Elmer, Wellesley, MA, USA). Clearly, the present invention also encompasses quantitative forms of PCR, such as, for example, Taqman assays.

Strand displacement amplification (SDA) utilizes oligonucleotides, a DNA polymerase and a restriction endonuclease to amplify a target sequence. The oligonucleotides are hybridized to a target nucleic acid and the polymerase used to produce a copy of this region. The duplexes of copied nucleic acid and target nucleic acid are then nicked with an endonuclease that specifically recognizes a sequence at the beginning of the copied nucleic acid. The DNA polymerase recognizes the nicked DNA and produces another copy of the target region at the same time displacing the previously generated nucleic acid. The advantage of SDA is that it occurs in an isothermal format, thereby facilitating high-throughput automated analysis.

Ligase chain reaction (described in EU 320,308 and US 4,883,750) uses at least two oligonucleotides that bind to a target nucleic acid in such a way that they are adjacent. A ligase enzyme is then used to link the oligonucleotides. Using thermocycling the ligated oligonucleotides then become a target for further oligonucleotides. The ligated fragments are then detected, for example, using electrophoresis, or MALDI-TOF. Alternatively, or in addition, one or more of the probes is labeled with a detectable marker, thereby facilitating rapid detection.

Cycling Probe Technology uses chimeric synthetic probe that comprises DNA-RNA- DNA that is capable of hybridizing to a target sequence. Upon hybridization to a target sequence the RNA-DNA duplex formed is a target for RNase H thereby cleaving the probe. The cleaved probe is then detected using, for example, electrophoresis or MALDI-TOF.

In a preferred embodiment, a marker that is associated with and/or causative of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, occurs within a protein coding region of a genomic gene (e.g. an OPRSl gene) and is detectable in mRNA encoded by that gene. For example, such a marker may be an alternate splice- form of a mRNA encoded by a genomic gene (e.g. a splice form not observed in a normal and/or healthy subject, or, alternatively, an increase or decrease in the level of a splice form in a subject that carries the marker). Such a marker may be detected using, for example, reverse-transcriptase PCR (RT-PCR), transcription - mediated amplification (TMA) or nucleic acid sequence based amplification (NASBA), although any mRNA or cDNA based hybridization and/or amplification protocol is clearly amenable to the instant invention.

Methods of RT-PCR are known in the art and described, for example, in Dieffenbach (Ed) and Dveksler (Ed) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratories, NY, 1995).

Methods of TMA or self-sustained sequence replication (3SR) use two or more oligonucleotides that flank a target sequence, a RNA polymerase, RNase H and a reverse transcriptase. One oligonucleotide (that also comprises a RNA polymerase binding site) hybridizes to an RNA molecule that comprises the target sequence and the reverse transcriptase produces cDNA copy of this region. RNase H is used to digest the RNA in the RNA-DNA complex, and the second oligonucleotide used to produce a copy of the cDNA. The RNA polymerase is then used to produce a RNA copy of the cDNA, and the process repeated.

NASBA systems rely on the simultaneous activity of three enzymes (a reverse transcriptase, RNase H and RNA polymerase) to selectively amplify target mRNA sequences. The mRNA template is transcribed to cDNA by reverse transcription using an oligonucleotide that hybridizes to the target sequence and comprises a RNA polymerase binding site at its 5' end. The template RNA is digested with RNase H and double stranded DNA is synthesized. The RNA polymerase then produces multiple RNA copies of the cDNA and the process is repeated.

Clearly, the hybridization to and/or amplification of a marker associated with a nervous system degeneration e.g., neurodegenerative disease such as TDP -43 proteinopathy, using any of these methods is detectable using, for example, electrophoresis and/or mass spectrometry. In this regard, one or more of the probes/primers and/or one or more of the nucleotides used in an amplification reactions may be labeled with a detectable marker to facilitate rapid detection of a marker, for example, marker as described supra, e.g., a fluorescent label (e.g. Cy5 or Cy3) or a radioisotope (e.g. ³²P). Alternatively, amplification of a nucleic acid may be continuously monitored using a melting curve analysis method, such as that described in, for example, US 6,174,670.

In a one exemplified form of the invention, a marker associated with a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, comprises a single nucleotide change. Methods of detecting single nucleotide changes are known in the art, and reviewed, for example, in Landegren et al, Genome Research 8: 769- 776, 1998.

For example, a single nucleotide changes that introduces or alters a sequence that is a recognition sequence for a restriction endonuclease is detected by digesting DNA with the endonuclease and detecting the fragment of interest using, for example, Southern blotting (described in Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987) and Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001)). Alternatively, a nucleic acid amplification method described supra, is used to amplify the region surrounding the single nucleotide changes. The amplification product is then incubated with the endonuclease and any resulting fragments detected, for example, by electrophoresis, MALDI-TOF or PCR.

The direct analysis of the sequence of polymorphisms of the present invention can be accomplished using either the dideoxy chain termination method or the Maxam-Gilbert method (see Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd Ed., CSHP, New York 1989); Zyskind et al, Recombinant DNA Laboratory Manual, (Acad. Press, 1988)).

Alternatively, a single nucleotide change is detected using single stranded conformational polymorphism (SSCP) analysis. SSCP analysis relies upon the formation of secondary structures in nucleic acids and the sequence dependent nature of these secondary structures. In one form of this analysis an amplification method, such as, for example, a method described supra, is used to amplify a nucleic acid that comprises a single nucleotide change. The amplified nucleic acids are then denatured, cooled and analyzed using, for example, non-denaturing polyarcrylamide gel electrophoresis, mass spectrometry, or liquid chromatography (e.g. HPLC or dHPLC). Regions that comprise different sequences form different secondary structures, and as a consequence migrate at different rates through, for example, a gel and/or a charged field. Clearly, a detectable marker may be incorporated into a probe/primer useful in SSCP analysis to facilitate rapid marker detection.

Alternatively, any nucleotide changes are detected using, for example, mass spectrometry or capillary electrophoresis. For example, amplified products of a region of DNA comprising a single nucleotide change from a test sample are mixed with amplified products from a normal/healthy individual. The products are denatured and allowed to reanneal. Clearly those samples that comprise a different nucleotide at the position of the single nucleotide change will not completely anneal to a nucleic acid molecule from a normal/healthy individual thereby changing the charge and/or conformation of the nucleic acid, when compared to a completely annealed nucleic acid. Such incorrect base pairing is detectable using, for example, mass spectrometry.

Mass spectrometry is also useful for detecting the molecular weight of a short amplified product, wherein a nucleotide change causes a change in molecular weight of the nucleic acid molecule (such a method is described, for example, in US 6,574,700).

Allele specific PCR (as described, for example, In Liu et al, Genome Research, 7: 389- 398, 1997) is also useful for determining the presence of one or other allele of a single nucleotide change. An oligonucleotide is designed, in which the most 3' base of the oligonucleotide hybridizes with the single nucleotide change. During a PCR reaction, if the 3' end of the oligonucleotide does not hybridize to a target sequence, little or no

PCR product is produced, indicating that a base other than that present in the oligonucleotide is present at the site of single nucleotide change in the sample. PCR products are then detected using, for example, gel or capillary electrophoresis or mass spectrometry.

Primer extension methods (described, for example, in Dieffenbach (Ed) and Dveksler (Ed) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratories, NY, 1995)) are also useful for the detection of a single nucleotide change. An oligonucleotide that hybridizes to the region of a nucleic acid adjacent to the single nucleotide change. This oligonucleotide is then used in a primer extension protocol with a polymerase and a free nucleotide diphosphate that corresponds to either or any of the possible bases that occur at the single nucleotide change. Preferably the nucleotide-diphosphate is labeled with a detectable marker (e.g. a flurophore). Following primer extension, unbound labeled nucleotide diphosphates are removed, e.g. using size exclusion chromatography or electrophoresis, or hydrolyzed, using for example, alkaline phosphatase, and the incorporation of the labeled nucleotide into the oligonucleotide is detected, indicating the base that is present at the site of the single nucleotide change. Alternatively, or in addition, as exemplified herein primer extension products are detected using mass spectrometry (e.g. MALDI-TOF).

Clearly, the present invention extends to high-throughput forms primer extension analysis, such as, for example, minisequencing (Sy Vamen et al, Genomics 9: 341-

342, 1995). In such a method, a probe or primer (or multiple probes or primers) are immobilized on a solid support (e.g. a glass slide). A biological sample comprising nucleic acid is then brought into direct contact with the probe/s or primer/s, and a primer extension protocol performed with each of the free nucleotide bases labeled with a different detectable marker. The nucleotide present at a single nucleotide change or a number of single nucleotide changes is then determined by determining the detectable marker bound to each probe and/or primer.

Fluorescently labeled locked nucleic acid (LNA) molecules or fluorescently labeled protein-nucleic acid (PNA) molecules are useful for the detection of SNPs (as described in Simeonov and Nikiforov, Nucleic Acids Research, 30(17): 1-5, 2002). LNA and PNA molecules bind, with high affinity, to nucleic acid, in particular, DNA. Flurophores (in particular, rhodomine or hexachlorofluorescein) conjugated to the LNA or PNA probe fluoresce at a significantly greater level upon hybridization of the probe to target nucleic acid. However, the level of increase of fluorescence is not enhanced to the same level when even a single nucleotide mismatch occurs. Accordingly, the degree of fluorescence detected in a sample is indicative of the presence of a mismatch between the LNA or PNA probe and the target nucleic acid, such as, in the presence of a SNP. Preferably, fluorescently labeled LNA or PNA technology is used to detect a single base change in a nucleic acid that has been previously amplified using, for example, an amplification method described supra.

As is apparent to the skilled artisan, LNA or PNA detection technology is amenable to a high-throughput detection of one or more markers immobilizing an LNA or PNA probe to a solid support, as described in Orum et al, Clin. Chem. 45: 1898-1905, 1999.

Similarly, Molecular Beacons are useful for detecting single nucleotide changes directly in a sample or in an amplified product (see, for example, Mhlang and Malmberg, Methods 25: 463-471, 2001). Molecular beacons are single stranded nucleic acid molecules with a stem-and-loop structure. The loop structure is complementary to the region surrounding the single nucleotide change of interest. The stem structure is formed by annealing two "arms," complementary to each other, that are on either side of the probe (loop). A fluorescent moiety is bound to one arm and a quenching moiety to the other arm that suppresses any detectable fluorescence when the molecular beacon is not bound to a target sequence. Upon binding of the loop region to its target nucleic acid the arms are separated and fluorescence is detectable. However, even a single base mismatch significantly alters the level of fluorescence detected in a sample. Accordingly, the presence or absence of a particular base at the site of a single nucleotide change is determined by the level of fluorescence detected.

A single nucleotide change can also be identified by hybridization to nucleic acid arrays, an example of which is described in WO 95/11995. WO 95/11995 also describes subarrays that are optimized for detection of a variant form of a precharacterized polymorphism. Such a subarray contains probes designed to be complementary to a second reference sequence, which is an allelic variant of the first reference sequence. The second group of probes is designed by the same principles, except that the probes exhibit complementarity to the second reference sequence. The inclusion of a second group (or further groups) can be particularly useful for analyzing short subsequences of the primary reference sequence in which multiple mutations are expected to occur within a short distance commensurate with the length of the probes (e.g., two or more mutations within 9 to 21 bases).

Clearly the present invention encompasses other methods of detecting a single nucleotide change that is within an OPRSl gene and associated with a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,, such as, for example, SNP microarrays (available from Affymetrix, or described, for example, in US 6,468,743 or Hacia et al, Nature Genetics, 14: 441, 1996), Taqman assays (as described in Livak et al, Nature Genetics, 9: 341-342, 1995), solid phase minisequencing (as described in Syvamen et al, Genomics, IS: 1008-1017, 1992), minisequencing with FRET (as described in Chen and Kwok , Nucleic Acids Res. 25: 347-353, 1997) or pyrominisequencing (as reviewed in Landegren et al., Genome Res.,

In a preferred embodiment, a single nucleotide change in an OPRSl gene or an expression product thereof that is associated with a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, is detected using a Taqman assay essentially as described by Corder et al, Science, 261: 921-923.

7. Protein detection methods

7.1 Ligands and antibodies

It is apparent to the skilled artisan based on the disclosure herein that the present invention also extends to detection of a marker in a polypeptide, e.g., a polypeptide encoded by an alternatively spliced OPRSl mRNA or an OPRSl polypeptide comprising a sequence comprising a valine at a position corresponding to amino acid residue 4 of SEQ ID NO: 6. Methods for detecting such polypeptides generally make use of a ligand or antibody that preferentially or specifically binds to the target polypeptide. As used herein the term "ligand" shall be taken in its broadest context to include any chemical compound, polynucleotide, peptide, protein, lipid, carbohydrate, small molecule, natural product, polymer, etc. that is capable of selectively binding, whether covalently or not, to one or more specific sites on an OPRSl polypeptide. The ligand may bind to its target via any means including hydrophobic interactions, hydrogen bonding, electrostatic interactions, van der Waals interactions, pi stacking, covalent bonding, or magnetic interactions amongst others. It is particularly preferred that a ligand is able to specifically bind to a specific form of an OPRSl polypeptide, e.g. an OPRSl polypeptide that comprises a valine at a position corresponding amino acid position 4 of SEQ ID NO: 6.

Antibodies are prepared by any of a variety of techniques known to those of ordinary skill in the art, and described, for example in, Harlow and Lane (In: Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988). In one such technique, an immunogen comprising the antigenic polypeptide is initially injected into any one of a wide variety of animals (e.g., mice, rats, rabbits, sheep, humans, dogs, pigs, chickens and goats). The immunogen is derived from a natural source, produced by recombinant expression means, or artificially generated, such as by chemical synthesis (e.g., BOC chemistry or FMOC chemistry). In one example, an epitope of OPRS-I comprising a valine at a position corresponding to amino acid residue 4 of SEQ ID NO: 6 serves as the immunogen. A peptide, polypeptide or protein is joined to a carrier protein, such as bovine serum albumin or keyhole limpet hemocyanin. The immunogen and optionally a carrier for the protein is injected into the animal host, preferably according to a predetermined schedule incorporating one or more booster immunizations, and blood collected from said the animals periodically. Optionally, the immunogen is injected in the presence of an adjuvant, such as, for example Freund's complete or incomplete adjuvant, lysolecithin and dinitrophenol to enhance the subject's immune response to the immunogen. Monoclonal or polyclonal antibodies specific for the polypeptide are then purified from blood isolated from an animal by, for example, affinity chromatography using the polypeptide coupled to a suitable solid support.

Monoclonal antibodies specific for the antigenic polypeptide of interest are prepared, for example, using the technique of Kohler and Milstein, Eur. J. Immunol. 6:511-519, 1976, and improvements thereto. Briefly, these methods involve the preparation of immortal cell lines capable of producing antibodies having the desired specificity (i.e., reactivity with the polypeptide of interest). Such cell lines are produced, for example, from spleen cells obtained from an animal immunized as described supra. The spleen cells are immortalized by, for example, fusion with a myeloma cell fusion partner, preferably one that is syngenic with the immunized animal. A variety of fusion techniques are known in the art, for example, the spleen cells and myeloma cells are combined with a nonionic detergent or electrofused and then grown in a selective medium that supports the growth of hybrid cells, but not myeloma cells. A preferred selection technique uses HAT (hypoxanthine, aminopterin, and thymine) selection. After a sufficient time, usually about 1 to 2 weeks, colonies of hybrids are observed. Single colonies are selected and growth media in which the cells have been grown is tested for the presence of an antibody having binding activity against the polypeptide (immunogen). Hybridomas having high reactivity and specificity are preferred.

Monoclonal antibodies are isolated from the supernatants of growing hybridoma colonies using methods such as, for example, affinity purification as described supra. Various techniques are also known for enhancing antibody yield, such as injection of the hybridoma cell line into the peritoneal cavity of a suitable vertebrate host, such as a mouse. Monoclonal antibodies are then harvested from the ascites fluid or the blood of such an animal subject. Contaminants are removed from the antibodies by conventional techniques, such as chromatography, gel filtration, precipitation, and/or extraction. The marker associated with neurodegeneration of this invention may be used in the purification process in, for example, an affinity chromatography step.

In another embodiment, an immunogen consists of a peptide representing a fragment of a polypeptide, for example a region of an OPRSl polypeptide that is alternatively spliced or an epitope of OPRS-I comprising a valine at a position corresponding to amino acid residue 4 of SEQ ID NO: 6. Preferably an antibody raised to such an immunogen also recognizes the full-length protein from which the immunogen was derived, such as, for example, in its native state or having native conformation.

Alternatively, a monoclonal antibody capable of binding to a form of an OPRSl polypeptide or a fragment thereof is produced using a method such as, for example, a human B-cell hybridoma technique (Kozbar et ah, Immunol. Today 4:12, 1983), a

EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al. Monoclonal Antibodies in Cancer Therapy, 1985 Allen R. Bliss, Inc., pages 77-96), or screening of combinatorial antibody libraries (Huse et al, Science 246:1215, 1989).

Such an antibody is then particularly useful in detecting the presence of a marker of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,.

The methods described supra are also suitable for production of an antibody or antibody binding fragment as described herein according to any embodiment.

7.2 Detection methods

In one embodiment, the method of the invention detects the presence of a marker in a polypeptide, aid marker being associated or causative of with a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,.

An amount, level or presence of a polypeptide is determined using any of a variety of techniques known to the skilled artisan such as, for example, a technique selected from the group consisting of, immunohistochemistry, immunofluorescence, an immunoblot, a Western blot, a dot blot, an enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), enzyme immunoassay, fluorescence resonance energy transfer (FRET), matrix-assisted laser desorption/ionization time of flight (MALDI- TOF), electrospray ionization (ESI), mass spectrometry (including tandem mass spectrometry, e.g. LC MS/MS), biosensor technology, evanescent fiber-optics technology or protein chip technology.

In one example, an assay used to determine the amount or level of a protein is a semiquantitative assay. In another example, an assay used to determine the amount or level of a protein in a quantitative assay.

Preferably, an amount of antibody or ligand bound to a marker of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, in an OPRSl polypeptide is determined using an immunoassay. Preferably, using an assay selected from the group consisting of, immunohistochemistry, immunofluorescence, enzyme linked immunosorbent assay (ELISA), fluorescence linked immunosorbent assay (FLISA) Western blotting, RIA, a biosensor assay, a protein chip assay, a mass spectrometry assay, a fluorescence resonance energy transfer assay and an immunostaining assay (e.g. immunofluorescence).

Standard solid-phase ELISA or FLISA formats are particularly useful in determining the concentration of a protein from a variety of samples.

In one form such an assay involves immobilizing a biological sample onto a solid matrix, such as, for example a polystyrene or polycarbonate microwell or dipstick, a membrane, or a glass support (e.g. a glass slide). An antibody that specifically binds to a marker of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, in an OPRSl polypeptide is brought into direct contact with the immobilized biological sample, and forms a direct bond with any of its target protein present in said sample. This antibody is generally labeled with a detectable reporter molecule, such as for example, a fluorescent label (e.g. FITC or Texas Red) or a fluorescent semiconductor nanocrystal (as described in US 6,306,610) in the case of a FLISA or an enzyme (e.g. horseradish peroxidase (HRP), alkaline phosphatase (AP) or β-galactosidase) in the case of an ELISA, or alternatively a suitably labeled secondary antibody is used that binds to the first antibody. Following washing to remove any unbound antibody, the label is detected either directly, in the case of a fluorescent label, or through the addition of a substrate, such as for example hydrogen peroxide, TMB, or toluidine, or 5-bromo-4-chloro-3-indol-beta-D-galaotopyranoside (x-gal) in the case of an enzymatic label.

Such ELISA or FLISA based systems are suitable for quantification of the amount of a protein in a sample, by calibrating the detection system against known amounts of a protein standard to which the antibody binds, such as for example, an isolated and/or recombinant OPRSl polypeptide or immunogenic fragment thereof or epitope thereof. In another form, an ELISA comprises immobilizing an antibody or ligand that specifically binds a marker of a disease or disorder within an OPRSl polypeptide on a solid matrix, such as, for example, a membrane, a polystyrene or polycarbonate microwell, a polystyrene or polycarbonate dipstick or a glass support. A sample is then brought into physical relation with said antibody, and said marker within an OPRSl polypeptide is bound or 'captured'. The bound protein is then detected using a labeled antibody. For example, if the marker is captured from a human sample, a labeled anti- human OPRSl antibody that binds to an epitope that is distinct from the first (capture) antibody is used to detect the captured protein. Alternatively, a third labeled antibody can be used that binds the second (detecting) antibody.

It is apparent to the skilled person that the assay formats described herein are amenable to high throughput formats, such as, for example automation of screening processes or a microarray format as described in Mendoza et al., Biotechniques 27(4): 778-788, 1999. Furthermore, variations of the above-described assay is apparent to those skilled in the art, such as, for example, a competitive ELISA.

Alternatively, the presence of a marker of a disease or disorder within an OPRSl polypeptide is detected using a radioimmunoassay (RIA). The basic principle of the assay is the use of a radiolabeled antibody or antigen to detect antibody-antigen interactions. An antibody or ligand that specifically binds to the marker within an

OPRSl polypeptide is bound to a solid support and a sample brought into direct contact with said antibody. To detect the level of bound antigen, an isolated and/or recombinant form of the antigen is radiolabeled and brought into contact with the same antibody. Following washing, the level of bound radioactivity is detected. As any antigen in the biological sample inhibits binding of the radiolabeled antigen the level of radioactivity detected is inversely proportional to the level of antigen in the sample.

Such an assay may be quantitated by using a standard curve using increasing known concentrations of the isolated antigen. As is apparent to the skilled artisan, such an assay may be modified to use any reporter molecule, such as, for example, an enzyme or a fluorescent molecule, in place of a radioactive label.

In another embodiment, Western blotting is used to determine the level of a marker within an OPRSl polypeptide in a sample. In such an assay protein from a sample is separated using sodium doedecyl sulphate polyacrylamide gel electrophoresis (SDS- PAGE) using techniques known in the art and described in, for example, Scopes {In: Protein Purification: Principles and Practice, Third Edition, Springer Verlag, 1994). Separated proteins are then transferred to a solid support, such as, for example, a membrane (e.g., a PVDF membrane), using methods known in the art, for example, electrotransfer. This membrane is then blocked and probed with a labeled antibody or ligand that specifically binds to a marker of a nervous system degeneration e.g., neurodegenerative disease such as TDP -43 proteinopathy, within an OPRSl. Alternatively, a labeled secondary, or even tertiary, antibody or ligand is used to detect the binding of a specific primary antibody. The level of label is then determined using an assay appropriate for the label used. An appropriate assay is apparent to the skilled artisan.

For example, the level or presence a marker of a disease or disorder within an OPRSl polypeptide is determined using methods known in the art, such as, for example, densitometry. In one example, the intensity of a protein band or spot is normalized against the total amount of protein loaded on a SDS-PAGE gel using methods known in the art. Alternatively, the level of the marker detected is normalized against the level of a control/reference protein. Such control proteins are known in the art, and include, for example, actin, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), β2 microglobulin, hydroxy-methylbilane synthase, hypoxanthine phosphoribosyl- transferase 1 (HPRT), ribosomal protein Ll 3c, succinate dehydrogenase complex subunit A and TATA box binding protein (TBP). In an alternative embodiment, a marker of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, within an OPRSl polypeptide is detected within a cell, using methods known in the art, such as, for example, immunohistochemistry or immunofluorescence. For example, a cell or tissue section that is to be analyzed to determine the presence of a marker of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, within an OPRSl polypeptide is fixed to stabilize and protect both the cell and the proteins contained within the cell. Preferably, the method of fixation does not disrupt or destroy the antigenicity of the marker, thus rendering it undetectable. Methods of fixing a cell are known in the art and include for example, treatment with paraformaldehyde, treatment with alcohol, treatment with acetone, treatment with methanol, treatment with Bouin's fixative and treatment with glutaraldehyde. Following fixation a cell is incubated with a ligand or antibody capable of binding the marker. The ligand or antibody is, for example, labeled with a detectable marker, such as, for example, a fluorescent label (e.g. FITC or Texas Red), a fluorescent semiconductor nanocrystal (as described in US 6,306,610) or an enzyme (e.g. horseradish peroxidase (HRP)), alkaline phosphatase (AP) or β-galactosidase. Alternatively, a second labeled antibody that binds to the first antibody is used to detect the first antibody. Following washing to remove any unbound antibody, the level of the bound to said labeled antibody is detected using the relevant detection means. Means for detecting a fluorescent label will vary depending upon the type of label used and is apparent to the skilled artisan. Such a method is also useful for detecting subcellular localization of a TDP-43 polypeptide.

Optionally, a method of detecting a marker of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, within an OPRSl polypeptide using immunofluorescence or immunohistochemistry will comprise additional steps such as, for example, cell permeabilization (using, for example, n- octyl-βD-glucopyranoside, deoxycholate, a non-ionic detergent such as Triton X-IOO NP -40, low concentrations of ionic detergents, such as, for example SDS or saponin) and/or antigen retrieval (using, for example, heat). Methods using immunofluorescence are preferable, as they are quantitative or at least semi-quantitative. Methods of quantitating the degree of fluorescence of a stained cell are known in the art and described, for example, in Immunohistochemistry (Cuello, 1984 John Wiley and Sons, ASIN 0471900524).

Biosensor devices generally employ an electrode surface in combination with current or impedance measuring elements to be integrated into a device in combination with the assay substrate (such as that described in U.S. Patent No. 5,567,301). An antibody/ligand that specifically binds to a marker of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, within an OPRSl polypeptide is preferably incorporated onto the surface of a biosensor device and a biological sample contacted to said device. A change in the detected current or impedance by the biosensor device indicates protein binding to said antibody. Some forms of biosensors known in the art also rely on surface plasmon resonance to detect protein interactions, whereby a change in the surface plasmon resonance surface of reflection is indicative of a protein binding to a ligand or antibody (U.S. Patent No. 5,485,277 and 5,492,840).

Biosensors are of particular use in high throughput analysis due to the ease of adapting such systems to micro- or nano-scales. Furthermore, such systems are conveniently adapted to incorporate several detection reagents, allowing for multiplexing of diagnostic reagents in a single biosensor unit. This permits the simultaneous detection of several proteins or peptides in a small amount of body fluids.

Evanescent biosensors are also preferred as they do not require the pretreatment of a biological sample prior to detection of a protein of interest. An evanescent biosensor generally relies upon light of a predetermined wavelength interacting with a fluorescent molecule, such as for example, a fluorescent antibody attached near the probe's surface, to emit fluorescence at a different wavelength upon binding of the target polypeptide to the antibody or ligand. Micro- or nano-cantilever biosensors are also preferred as they do not require the use of a detectable label. A cantilever biosensor utilizes a ligand and/or antibody capable of specifically detecting the analyte of interest that is bound to the surface of a deflectable arm of a micro- or nano-cantilever. Upon binding of the analyte of interest (e.g. a marker within an OPRSl polypeptide) the deflectable arm of the cantilever is deflected in a vertical direction (i.e. upwards or downwards). The change in the deflection of the deflectable arm is then detected by any of a variety of methods, such as, for example, atomic force microscopy, a change in oscillation of the deflectable arm or a change in pizoresistivity. Exemplary micro-cantilever sensors are described in USSN 20030010097.

To produce protein chips, the proteins, peptides, polypeptides, antibodies or ligands that are able to bind specific antibodies or proteins of interest are bound to a solid support such as for example glass, polycarbonate, polytetrafluoroethylene, polystyrene, silicon oxide, metal or silicon nitride. This immobilization is either direct (e.g. by covalent linkage, such as, for example, Schiff s base formation, disulfide linkage, or amide or urea bond formation) or indirect. Methods of generating a protein chip are known in the art and are described in for example U.S. Patent Application No. 20020136821, 20020192654, 20020102617 and U.S. Patent No. 6,391,625. To bind a protein to a solid support it is often necessary to treat the solid support so as to create chemically reactive groups on the surface, such as, for example, with an aldehyde- containing silane reagent. Alternatively, an antibody or ligand may be captured on a microfabricated polyacrylamide gel pad and accelerated into the gel using microelectrophoresis as described in, Arenkov et al. Anal. Biochem. 275:123-131, 2000.

A protein chip may comprise only one protein, ligand or antibody, and be used to screen one or more patient samples for the presence of one polypeptide of interest. Such a chip may also be used to simultaneously screen an array of patient samples for a polypeptide of interest. Preferably, a protein sample to be analyzed using a protein chip is attached to a reporter molecule, such as, for example, a fluorescent molecule, a radioactive molecule, an enzyme, or an antibody that is detectable using methods known in the art. Accordingly, by contacting a protein chip with a labeled sample and subsequent washing to remove any unbound proteins the presence of a bound protein is detected using methods known in the art, such as, for example, using a DNA microarray reader.

Alternatively, biomolecular interaction analysis-mass spectrometry (BIA-MS) is used to rapidly detect and characterize a protein present in complex biological samples at the low- to sub-fmole level (Nelson et al. Electrophoresis 21: 1155-1163, 2000). One technique useful in the analysis of a protein chip is surface enhanced laser desorption/ionization-time of flight-mass spectrometry (SELDI-TOF-MS) technology to characterize a protein bound to the protein chip. Alternatively, the protein chip is analyzed using ESI as described in U.S. Patent Application 20020139751.

As is apparent from the preceding discussion, it is particularly preferred to employ a detection system that is antibody or ligand based as such assays are amenable to the detection of a marker of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, within an OPRSl polypeptide. Immunoassay formats are even more particularly preferred.

8. Detection of an enhanced or reduced level of an OPRSl transcript

The present inventors have also shown that nucleotide changes, e.g., mutations in an OPRSl gene are associated with increased expression or reduced expression of a transcript of the OPRSl gene in a subject suffering from a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,. Accordingly, in one embodiment, a marker that is associated with a disease or disorder is detected by detecting an enhanced or reduced level of an OPRSl transcript in a sample from a subject, wherein said enhanced or reduced level of the OPRSl transcript is indicative of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, and/or a predisposition to a nervous system degeneration e.g., neurodegenerative disease such as TDP -43 proteinopathy, and/or an increased risk of a subject developing a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,.

In one example, the method comprises detecting an enhanced or reduced level of a native OPRSl transcript, e.g., comprising a sequence set forth in SEQ ID NO: 5 wherein the nucleotide at position 80 is a guanine and the nucleotide at position 85 is cytosine and the nucleotide at position 626 is cytosine. Alternatively, the method comprises detecting an enhanced level of an alternatively spliced OPRSl transcript.

Methods for detecting a transcript of an OPRSl gene are described supra and are to be taken to apply mutatis mutandis to the present embodiment of the invention. For example, the level of an OPRSl transcript is determined by performing a process comprising hybridizing a nucleic acid probe that selectively hybridizes to an OPRSl transcript to nucleic acid in a sample from a subject under moderate to high stringency hybridization conditions and detecting the hybridization using a detection means, wherein the level of hybridization of the probe to the sample nucleic acid is indicative of the level of the OPRSl transcript in the sample.

In one embodiment, an enhanced or reduced level of an OPRSl transcript is detected by performing a process comprising:

(i) determining the level of the OPRSl transcript in a sample from a subject; (ii) comparing the level at (i) to the level in a suitable control sample, wherein an enhanced or reduced level of the OPRSl transcript at (i) compared to (ii) is indicative of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, and/or a predisposition to a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, and/or an increased risk of developing a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,. A suitable control sample is described herein. 9. Detection of an enhanced or reduced level of an OPRSl polypeptide The present inventors have also demonstrated that the level of expression of an OPRSl polypeptide is associated with development of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,.

Accordingly, in one example, a marker associated with a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, is detected by detecting an enhanced or reduced level of an OPRSl polypeptide in a sample from a subject, wherein said enhanced or reduced level of the OPRSl polypeptide is indicative of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, and/or a predisposition to a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, and/or an increased risk of developing a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,.

In one example, the method comprises detecting an enhanced or reduced level of a native OPRSl polypeptide, e.g., comprising a sequence set forth in SEQ ID NO: 6 wherein the amino acid at position 4 is an alanine. Alternatively, the method comprises detecting an enhanced level of an OPRSl polypeptide encoded by an alternatively spliced OPRSl transcript.

Methods for determining the level of expression of a polypeptide are described supra and are to be taken to apply mutatis mutandis to the present aspect of the invention. For example, the level of the OPRSl polypeptide is detected by performing a process comprising contacting a biological sample from a subject with an antibody or ligand capable of preferentially or specifically binding to the OPRS 1 polypeptide for a time and under conditions sufficient for an antibody/ligand or ligand-ligand complex to form and then detecting the complex wherein the level of the complex is indicative of the level of the OPRSl polypeptide in the subject. Preferably, a method for detecting or determining an enhanced or reduced level of an OPRSl polypeptide in a sample comprises performing a process comprising: (i) determining the level of the OPRSl polypeptide in the sample; (ii) comparing the level of OPRSl polypeptide at (i) to the level of OPRSl polypeptide in a suitable control sample, wherein an enhanced or reduced level of the OPRSl polypeptide at (i) compared to (ii) is indicative of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, and/or a predisposition to a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, and/or an increased risk of developing a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,. A suitable control sample is apparent to the skilled artisan and/or is described herein.

10. Monitoring the efficacy of treatment The methods described herein are also to be taken to apply mutatis mutandis to a method for monitoring the efficacy of treatment of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,.

In one embodiment, the present invention provides a method for monitoring the efficacy of treatment of a subject undergoing treatment for a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,, said method comprising:

(i) determining the level of expression of an OPRS 1 expression product in a sample from a subject suffering from a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, and receiving treatment therefor; and (ii) determining the level of expression of the OPRSl expression product in a suitable control sample, wherein a similar level of expression of the OPRSl expression product at (i) compared to (ii) indicates that the treatment is effective for the treatment of the disease or disorder. In this respect, a suitable control sample is a sample from a normal and/or healthy subject and/or a database comprising information concerning the level of expression of the OPRSl expression product in a plurality of normal and/or healthy subjects.

11. Biological samples

As embodiments of the present invention are based upon detection of a marker in genomic DNA any cell or sample that comprises genomic DNA is useful for determining a disease or disorder and/or a predisposition to a disease or disorder. Preferably, the cell or sample is derived from a human. Preferably, comprises a nucleated cell.

Preferred biological samples include, for example, whole blood, serum, plasma, peripheral blood mononuclear cells (PBMC), a buffy coat fraction, saliva, urine, a buccal cell, urine, fecal material, sweat or a skin cell.

In a preferred embodiment, a biological sample comprises a white blood cell, more preferably, a lymphocyte cell.

Furthermore, as OPRSl is widely expressed, any cell or sample comprising a cell may be used to determine a subject's predisposition to a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, or to diagnose the disease on the basis of detecting an OPRS 1 expression product provided that the cell expresses OPRSl.

Alternatively, the biological sample is a cell isolated using a method selected from the group consisting of amniocentesis, chorionic villus sampling, fetal blood sampling (e.g. cordocentesis or percutaneous umbilical blood sampling) and other fetal tissue sampling (e.g. fetal skin biopsy). Such biological samples are useful for determining the predisposition of a developing embryo to a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,. As is apparent to the skilled artisan, the size of a biological sample will depend upon the detection means used. For example, an assay, such as, for example, PCR or single nucleotide primer extension may be performed on a sample comprising a single cell, although greater numbers of cells are preferred. Alternative forms of nucleic acid detection may require significantly more cells than a single cell. Furthermore, protein- based assays require sufficient cells to provide sufficient protein for an antigen based assay.

Preferably, the biological sample has been derived or isolated or obtained previously from the subject. Accordingly, the present invention also provides an ex vivo method. In one embodiment, the method of the invention additionally comprises isolating, obtaining or providing the biological sample.

In one embodiment, the method is performed using an extract from a biological sample, such as, for example, genomic DNA, mRNA, cDNA or protein.

As the present invention also includes detection of a marker in a OPRSl gene that is associated with a disease or disorder in a cell (e.g. using immunofluorescence), the term "biological sample"" also includes samples that comprise a cell or a plurality of cells, whether processed for analysis or not.

As is apparent from the preceding description, such an assay may require the use of a suitable control, e.g. a normal individual or a typical population, e.g., for quantification.

As used herein, the term "normal individual" shall be taken to mean that the subject is selected on the basis that they do not comprise or express a marker that comprises, consists of or is within an OPRSl gene or expression product thereof and that is associated with a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,, nor do they suffer from a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,. For example, the normal subject has not been diagnosed with any form of nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,, using, for example, clinical analysis. For example, a subject may be tested for a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, using a neuropsychological test (e.g. a Wechsler Adult Intelligence Scale test, MDRS or GDS), an EEG, a CAT scan or a MRI scan.

Alternatively, or in addition, a suitable control sample is a control data set comprising measurements of the marker being assayed for a typical population of subjects known not to suffer from a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,. Preferably the subject is not at risk of developing such a disease, and, in particular, the subject does not have a family history of the disease.

In the present context, the term "typical population" with respect to subjects known not to suffer from a disease or disorder and/or comprise or express a marker of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, shall be taken to refer to a population or sample of subjects tested using, for example, known methods for diagnosing the nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, and determined not to suffer from the disease and/or tested to determine the presence or absence of a marker of the disease, wherein said subjects are representative of the spectrum of normal and/or healthy subjects or subjects known not to suffer from the disease.

Given that many diseases are quantitative traits, a subject may suffer from the disease and not comprise or express a marker of the disease described herein. Alternatively, a subject may not suffer from the disease, yet comprise or express a marker of as described herein. However, a suitable control sample for the instant invention is a sample derived from a subject that does not suffer from the disease and does not comprise or express a marker of the disease (e.g., as described herein). In one embodiment, a reference sample is not included in an assay. Instead, a suitable reference sample is derived from an established data set previously generated from a typical population. Data derived from processing, analyzing and/or assaying a test sample is then compared to data obtained for the sample population.

Data obtained from a sufficiently large number of reference samples so as to be representative of a population allows the generation of a data set for determining the average level of a particular parameter. Accordingly, the amount of an expression product that is diagnostic of a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, or a predisposition to a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, can be determined for any population of individuals, and for any sample derived from said individual, for subsequent comparison to levels of the expression product determined for a sample being assayed. Where such normalized data sets are relied upon, internal controls are preferably included in each assay conducted to control for variation.

12. Methods for determining a marker associated with nervous system degeneration In one embodiment, the method of the invention additionally comprises determining an association between a marker in an OPRSl gene or expression product and a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,.

Furthermore, given the tight association of the human OPRSl gene to a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,, and the provision of several markers associated with a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,, the present invention further provides methods for identifying new markers for a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,.

Accordingly, the present invention additionally provides a method for identifying a marker that is associated with a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,, said method comprising: (i) identifying a polymorphism or allele or mutation within an OPRSl gene or an expression product thereof;

(ii) analyzing a panel of subjects to determine those that suffer from a nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,, wherein not all members of the panel comprise the polymorphism or allele or mutation; and

(iii) determining the variation in the development of the nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy, wherein said variation indicates that the polymorphism or allele or mutation is associated with a subject's predisposition to the nervous system degeneration e.g., neurodegenerative disease such as TDP-43 proteinopathy,.

Methods for determining the association between a marker and a disease, disorder and/or a phenotype are known in the art and reviewed, for example, in King (Ed) Rotter (Ed) and Motulski (Ed), The Genetic Basis of Common Disease, Oxford University Press, 2nd Edition, ISBN 0195125827, and Miller and Cronin (Eds), Genetic Polymorphisms and Susceptibility to Disease, Taylor and Francis, 1st Edition, ISBN 0748408223.

Generally, determining an association between a marker (e.g. a polymorphism and/or allele and/or a splice form and/or a mutation) and a disease, disorder or phenotype involves comparing the frequency of a polymorphism, allele, splice form or mutation at a specific locus between a sample of unrelated affected individuals (i.e., they comprise the phenotype of interest and/or suffer from the disease/disorder of interest) and an appropriate control that is representative of the allelic distribution in the normal population.

Several methods are useful for determining an association between a marker and a disease, disorder and/or phenotype of interest. However, any such study should consider several parameters to avoid difficulties, such as, for example, population stratification, that may produce false positive results. Population stratification occurs when there are multiple subgroups with different allele frequencies present within a population. The different underlying allele frequencies in the sampled subgroups may be independent of the disease, disorder and/or phenotype within each group, and, as a consequence, may produce erroneous conclusions of linkage disequilibrium or association.

Generally, problems of population stratification are avoided by using appropriate control samples. For example, case-comparison based design may be used in which a comparison between a group of unrelated probands with the disease, disorder and/or phenotype and a group of control (comparison) individuals who are unrelated to each other or to the probands, but who have been matched to the proband group on relevant variable (other than affection status) that may influence genotype (e.g. sex, ethnicity and/or age).

Alternatively, controls are screened to exclude those subjects that have a personal history of the disease, disorder and/or phenotype of interest (and/or a family history of the disease, disorder and/or phenotype of interest). Such a "supernormal" control group is representative of the allele distribution of individuals unaffected by a disease, disorder and/or phenotype of interest.

Alternatively, a family-based association method may be used, in which non- transmitted alleles of the parents of a singly, ascertained proband are used as a random sample of alleles from which the proband was sampled. Such non-transmitted alleles are used to construct a matched control sample.

One extension of a family-based association method, the transmission disequilibrium test (TDT) uses a McNemar statistic to test for excess transmission of a marker allele to affected individuals above that expected by chance (Spielman et al, Am. J. Hum. Genet., 52: 506-516, 1993). Essentially, TDT considers parents who are heterozygous for an allele and/or polymorphism and/or splice variant associated with a disease, disorder or phenotype and evaluates the frequency with which the allele and/or polymorphism and/or splice variant or its alternate is transmitted to affected offspring. By only studying heterozygous parental genotypes TDT provides a test of association between linked loci and, as a consequence, avoids false associations between unlinked loci in the presence of population stratification.

The TDT method has been further refined to account for, for example multiallelic markers (Sham and Curtis Ann. Hum. Genet., 59: lll-llβ, 1995), multiple siblings in a family (Spielman and Ewens Am. J. Hum. Genet., 52:450-458, 1998), missing parental data (Curtis, Ann. Hum. Genet., 61: 319-333, 1997) and quantitative traits (Allison, Am. J. Hum. Genet., 60: 676-690, 1997 and Martin et al., Am. J. Hum. Genet., 67: 146-154, 2000).

In general, analysis of association is a test to detect non-random distribution of one or more alleles and/or polymorphisms and/or splice variants within subjects affected by a disease/disorder and/or phenotype of interest. The comparison between the test population and a suitable control population is made under the null hypothesis assumption that the locus to which the alleles and/or polymorphisms are linked has no influence on phenotype, and from this a nominal p-value is produced. For analysis of a biallelic polymorphism or mutation (e.g. a SNP) using a case control study, a chi- square analysis (or equivalent test) of a 2 x 2 contingency table (for analysis of alleles) or a 3 x 2 contingency table (for analysis of genotypes) is used.

For analysis using a family-based association study, marker data from members of the family of each proband are used to estimate the expected null distributions and an appropriate statistical test performed that compares observed data with that expected under the null hypothesis.

Another method useful in the analysis of association of a marker with a disease, disorder and/or phenotype is the genomic control method (Devlin and Roeder,

Biometrics, 55: 997-1004, 1999). For a case-control analysis of candidate allele/polymorphism the genetic control method computes chi-square test statistics for both null and candidate loci. The variability and/or magnitude of the test statistics observed for the null loci are increased if population stratification and/or unmeasured genetic relationships among the subjects exist. This data is then used to derive a multiplier that is used to adjust the critical value for significance test for candidate loci. In this manner, genetic control permits analysis of stratified case-control data without an increased rate of false positives.

A structured association approach (Pritchard et al, Am. J. Hum. Genet, 67: 170-181, 2000) uses marker loci unlinked to a candidate marker to infer subpopulation membership. Latent class analysis is used to control for the effect of population substructure. Essentially, null loci are used to estimate the number of subpopulations and the probability of a subject's membership to each subpopulation. This method is then capable of accounting for a change in allele/polymorphism frequency as a result of population substructure.

Alternatively, or in addition, should a particular gene or gene product be likely to be involved in a disease, disorder or phenotype of interest a Bayesian statistical approach may be used to determine the significance of an association between an allele and/or polymorphism of that gene and the disease, disorder or phenotype of interest. Such an approach takes account of the prior probability that the locus under examination is involved in the disease, disorder or phenotype of interest (e.g., Morris et al, Am. J. Hum. Genet., 67: 155-169, 2001).

Publicly available software is used to determine an association between an allele and/or polymorphism and/or a splice form and a disease or disorder or a predisposition to a disease or disorder. Such software include, for example, the following: (i) Analysis of Complex Traits (ACT), which includes methods for multivariate analysis of complex traits. ACT is based on the research reported in Amos, et al, Ann. Hum. Genet. 50:143-160, 1996 and Amos, Am.J.Hum.Genet., 54:535-

543, 1994; (ii) ADMIXMAP, a general-purpose program for modeling admixture using marker genotypes and trait data of individuals from an admixed population;, useful for estimate individual and population level admixture, test for a relationship between disease risk and individual admixture in case-control, cross-sectional or cohort studies, localize genes underlying ethnic differences in disease risk by admixture mapping and control for population structure (variation in individual admixture) in genetic association studies so as to eliminate associations with unlinked genes;

(iii) ANALYZE, an accessory program for the LINKAGE program that facilitates both parametric and non-parametric tests for association;

(iii) BAMA (Bayesian analysis of multilocus association), useful for selecting a trait- associated subset of markers among many candidates; and

(iv) CLUMP, a Monte Carlo method for assessing significance of a case-control association study with multi-allelic marker; (v) ET-TDT (evolutionary tree - transmission disequilibrium test) and ETTDT (extended transmission disequilibrium test), extensions of the TDT test; and

(vi) FBAT (family based association test), useful for testing for association/linkage between disease phenotypes and haplotypes by utilizing family-based controls

Preferably, a marker that is determined using any of the methods described supra is within an OPRSl gene or expression product and is associated with a nervous system degeneration e.g., neurodegenerative disease such as TDP -43 proteinopathy,.

The present invention is described further in the following non-limiting examples:

EXAMPLE 1

Identification of a FTLD locus on Chromosome 9

This example demonstrates linkage between a 3OcM region on chromosome 9 of the human genome i.e., between map position 9p21 and map position 9q21 and TDP-43 proteinopathy e.g., the FTLD-MND phenotype in humans, as determined in a genome- wide scan. 1.1 Materials and Methods

1.1.1 Patient cohort

An Australian family of Anglo-Celtic origin where eleven family members were affected with FTLD-MND was identified (Figure 1). Over three generations, five family members (11:2, 111:3, 111:5, 111:7, IV: 1) presented with symptoms consistent with the behavioral variant of FTLD, with histopathologic confirmation in one (111:3). Another two family members (111:8, 111:12) presented with progressive bulbar and limb weakness consistent with MND, with histopathologic confirmation in one (111:12). Two family members presented with a combination of FTLD and MND features (11:5, 111:6). One family member presented with an amnestic picture clinically but was also found to have positive TDP-43 immunostaining on autopsy (111:2). One other family member presented with early-onset dementia (11:7) and had a son with MND (111:12). Of the eleven affected family members, two also developed paranoid delusions in their middle age, at the beginning of their illness (111:6 and 111:8). Age of onset ranged from 43-68 and age of death 46-75.

1.1.2 Determination of neuropathology

The brains of patients 111:2, 111:3 and 111:12 and the spinal cord of patient 111:12 were obtained at the time of autopsy with consent. The entire brain for 111:3, the left hemi- brain and spinal cord for 111:12, and the left hemi-brain for 111:2 were fixed in 15% buffered formalin for at least 2 weeks. For each case routine neuropathological assessment, including immunohistochemistry screening, was performed at the time of autopsy and reviewed and standardized for the present study. After routine macroscopic assessment of the fixed tissue, blocks were excised from the frontal, parietal, occipital and limbic cortices, hippocampus, basal ganglia, thalamus, hypothalamus, midbrain, pons, medulla oblongata and cerebellum. For patient 111:12, blocks of various spinal cord segments were also excised. All tissue blocks were paraffin-embedded, cut at 7 microns on a microtome, and mounted onto salinized slides. Routine stains included haemotoxylin and eosin (H & E), myelin and silver (Bielschowsky) stains. For all cases, retrospective review of standardized immunoperoxidase slides using antibodies for tau (MN1020, PIERCE, USA, diluted l :10,000/cresyl violet), ubiquitin (Z0458, DAKO, Denmark, diluted l:200/cresyl violet), Aβ and α-synuclein (610787, Pharmigen, USA, diluted l :200/cresyl violet) were undertaken as previously described (Halliday et al, Acta Neuropthol, 90: 68-75 1995). To determine final diagnoses all cases were screened using current diagnostic criteria for AD (Hyman and Trojanowski, J. Neuropathol. Exp. Neurol, 56: 1095-1097 1997), dementia with Lewy bodies (McKeith et al, Neurology, 65: 1863-1872 2005), FTLD (Cairns et al, Acta Neuropathol, 114: 5-22 2007), MND (Brooks, J. Neurol. ScL, 124 Suppl: 96-107, 1994), and other neurodegenerative syndromes including corticobasal degeneration (Dickson et al, J. Neuropthol Exp. Neurol, 61: 935-946, 2002), progressive supranuclear palsy (Hauw et al, Neurology, 44: 2015-2019, 1994) and vascular dementia (Nagata et al, J. Neurol. ScI, 257: 44-48, 2007).

1.1.3 Genetic Studies

After written informed consent was obtained, blood was collected from 16 family members (7 of whom are affected) and DNA extracted. Direct DNA sequencing of the coding regions and 50 base pairs of flanking intronic sequences was performed to screen the known dementia and MND genes (APP, PSENl, PSEN2, MAPT, VCP, PGRN, IFT74, CHMP2B and SODl).

Simulation analysis using SIMLINK version 4.12, was carried out to evaluate the power of the pedigree to detect linkage (Ploughman and Boehnke, Am. J. Hum. Genet., 44: 543-551, 1989). The estimated maximum logarithm-of-odds (LOD) score was based on 1000 simulations for a single marker with three alleles and equal allele frequencies where all clinical variants were assumed affected.

A lOcM genome- wide scan was performed on DNA from 16 individuals by the Australian Genome Research Facility (AGRF) with microsatellite markers from the AB 1-400 set (ABI Prism Linkage Mapping Set, version 2.5, MD- 10). Parametric pair- wise and multipoint LOD scores were calculated using the MLINK and LINKMAP computer programs in the LINKAGE 5.2 package. Autosomal dominant inheritance was assumed with age dependent penetrance, a phenocopy rate of 0.005, a disease gene frequency of 0.001 and allele frequencies derived from a normal Australian population. Seven liability classes were established based on pedigree data with 1% penetrance - age <25 years, 8% - between 26 and 34 years, 22% - between 35 and 44 years, 46% - between 45 and 54 years, 71% - between 55 and 64 years, 91% - between 65 and 74 years, and 95% - age > 75 years. Individuals were assigned a liability class based on age-of-onset for affected cases and age at last consultation for asymptomatic cases. High-resolution fine mapping was performed using microsatellite markers with an average heterozygosity of 0.79 and spaced no further apart than 2 cM. Markers were selected from the Marshfield Medical Research Foundation genetic framework map.

Primers were fluorescently labeled with FAM and PCR was carried out according to standard protocols. The amplified products were run on the Applied Biosystems 3730 DNA Analyser at the Ramaciotti Centre, University of New South Wales and analyzed using ABI software (Genotyper 2.5 and GeneScan 3.1, Applied Biosystems). Markers with a high rate of discrepancy were removed from the analysis. Haplotypes were constructed using Merlin (Version 2.01), double checked manually, and displayed using HaploPainter V.029.5 (Thiele and Nurnberg, 2005). The haplotype of individual 111:5 was inferred from their spouse and offspring.

1.2 Results

1.2.1 Mutation Screen of Pedigree Members

DNA from the proband (111:3), 111:6, 111:12 and 111:1 was subjected to DNA sequence analysis of the coding regions and flanking intronic sequences for the known dementia and MND genes. No mutations were detected in the known dementia genes, namely APP, PSENl, PSEN2, MAPT, PGRN, VCP, CHMP2B or the IFT74 gene. SODl was also negative for mutations in individuals 111:8 and 111:12.

1.2.2 Linkage of Causative locus to Chromosome 9p

The theoretical maximal two-point LOD score that could be obtained from the family 14 pedigree (Figure 1) is 3.17 according to the power calculations using SIMLINK, with an average expected LOD score of 1.23. A genome- wide linkage analysis using the 400 ABI Linkage Mapping Set II markers was undertaken on 16 pedigree members, some of whom are not included in the pedigree diagram for ethical reasons. Seven individuals were classed as affected and one was classified as unknown as she had psychosis, a possible FTLD prodromal feature.

All available microsatellite data for 22 autosomes was uploaded into the Vincent database (Garvan Institute of Medical Research, Sydney, Australia) and files were generated to enable statistical analysis using the LINKAGE package (MLINK and LINKMAP). Linkage analysis was carried out where a single genetic locus was considered causal for all clinical variants.

Over the entire genome, the only region with a two-point LOD score greater than the established cut-off of 2.0 for suggestive linkage was located on chromosome 9. MarkerD9S161 (9p21.3) gave a maximum LOD score of 2.57. Three adjacent markers also had positive LOD scores with the closest marker D9S1817 having a maximum LOD score of 0.99. The highest LOD score on a chromosome other than 9 was 1.40 on 3pl4.3. Otherwise all other LOD scores were all consistently negative or nonsignificant and were used to exclude other reported MND linked loci, namely 2pl3, 15ql5-q22, 18q, 16q, and 20ql 3. These results indicate pedigree linkage to the chromosome 9p FTLD-MND locus.

The candidate chromosome 9p region was subjected to high resolution fine mapping with 8 additional markers (D9S259, D9S169, D9S319, D9S1118, D9S304, D9S1845, D9S1805, D9S163) surrounding D9S161 and D9S1817 and the data were re-analyzed using MLINK. This resulted in a significant two-point LOD score of 3.25 at marker D9S319. To confirm this linkage and to identify the 95% confidence interval, parametric multipoint linkage analysis was carried out with markers D9S259, D9S169, D9S161, D9S319, D9S1118, D9S1845, D9S1817, D9S163, D9S273, D9S175 and D9S167. A peak multipoint LOD score of 3.79 at marker D9S319 was attained. The 95% confidence interval, as defined by the Zmax-1 score, identified a 12 cM region with markers D9S169 and D9S273 bordering this region. To further evaluate the reliability of the detected linkage, and to determine recombination breakpoints, haplotypes were constructed using Merlin (Figure 1). Recombination breakpoints were defined by two affected individuals. The telomeric boundary was marked by a recombination event seen in individual 11:2 between markers D9S169 and D9S161. The centromeric boundary was defined by a single cross-over in individual 111:8. However, the exact recombination breakpoint could not be determined as markers D9S1118 and D9S304 are both homozygous for the '2' allele and could not be excluded from the disease haplotype. A cross-over was therefore deduced between markers D9S304 and D9S1845. All affected individuals share an identical haplotype consisting of 4 consecutive markers (D9S161-D9S319-D9S1118- D9S304) spanning a 9.6 cM region corresponding to a physical distance of 5.9 Mb.

The minimal disease region described supra was defined by a recombination event in individual 11:2 (between markers D9S169 and D9S161) and a centromeric recombination in individual 111:8 (between markers D9S304 and D9S1845). This region contains 14 known genes as listed by the UCSC Bioinformatics page [http://genome.ucsc.edu], consisting of C9orfl 1 (ACR formation associated factor), MOBKL2B, IFNK, c9orf72, LINGO2, ACOl, DDX58, TOPORS, NDUFB6, TAFlL, APTX, DNAJAl, SMUl, and B4GALT1. The coding and non-coding exonic sequence and flanking intronic regions of 11 of the candidate genes (excluding TAFlL, SMUl and B4GALT1) were screened by direct sequencing of PCR products amplified from genomic template. After screening MOBKL2B, LINGO2, ACOl, and DDX58, 11 known polymorphisms (MOBKL2B: rs34959338, rsl2379154; LINGO2: rs2383768, rsl3296489, rsl0968460; ACOl: rs34319839, rs3780473, rs35370505, rsl2985; DDX58: rs3739674, rslO813831) and one novel nucleotide substitution was detected (CGT to CAT) Arg71His in DDX58. These were used to create an informative SNP haplotype to further fine map the centromeric recombination breakpoint, moving it to between D9S1118 and D9S304. This left 4 known genes (IFNK, LINGO2, MOBKL2B, C9orfl 1 (ACR formation associated factor)), and a hypothetical protein C9orf72. The coding and non-coding exonic sequence, and flanking intronic regions, of each of these 5 candidate genes were screened by direct sequencing of PCR products amplified from genomic template. In addition, we analysed three of the five genes/transcripts by RT-PCR and agarose gel electrophoresis of lymphocyte and brain transcripts. The exceptions were C9orfl 1 , which had been annotated to have testes- specific expression (UCSC Bioinformatics site), and LINGO2, whose coding sequence is encompassed within a large 3' exon (UCSC Bioinformatics site). No coding mutations were detected in the candidate genes. No altered splicing or small-scale deletions were detected by RT-PCR of the transcripts of candidate genes. These results indicate that 111:8 is a phenocopy (i.e. the phenotype arises by means other than the inheritance of a familial gene mutation) and that the centromeric recombination breakpoint defined by individual 111:8 (between D9S1118 and D9S304) is incorrect.

Re-analysis of the data were then undertaken excluding 111:8, under an autosomal dominant model with 5 liability classes using the program LINKAGE and allele frequencies derived from a cohort of normal Australian individuals. Only a single region achieved a significant two-point LOD score of 3.24 for the marker D9S1817. A revised minimal disease region therefore comprises the markers D9S161 to D9S175 and spans 3OcM on chromosomal region 9p21-9q21, which overlaps all the previous reported FTLD/MND linkage regions for chromosome 9.

EXAMPLE 2 Identification of markers in the opioid receptor sigma 1 (OPRSl) gene as markers of neurodegenerative disease This example demonstrates that mutations or polymorphisms within the OPRSl gene are diagnostic of TDP-43 proteinopathy e.g., neurodegenerative disease such as presenile dementia and/or advanced dementia, by virtue of co-segregating with disease phenotype. In this example, polymorphisms in the 5'-untranslated region and/or intron sequence(s) and/or exon sequence(s), and/or within the 3 '-untranslated region, of the OPRSl gene is/are shown to be diagnostic of TDP-43 proteinopathy e.g., neurodegenerative disease such as pre-senile dementia and/or advanced dementia. 2.1 Methods

Thirty (30) genes within the revised candidate region identified in Example 1 were analyzed to determine whether or not those genes included polymorphisms or mutations associated with dementia. Those genes included UBE2R2, DNAJAl, PAX5, CNTNAP3, GDA, DNAIl, CNTFR, DCNT3, ILIIRA, GALT, CCLl 9, CCL21, CCL27, ARIDSC, TLNl, MOBKL2B, HINT2, AQPi, UBAPl, ALDHlBl, PLAA, IFNK, P23, UNIQ470, UBAP2, TOPORS, NDUFB6, APTX, BAGl and OPRSl.

2.2 Results Polymorphisms were detected in several candidate genes. However, the opioid receptor sigma 1 (OPRSl) gene had a non-polymorphic nucleotide change that co- segregated with the disease phenotype in Family 14 (Figure 9).

A G to T nucleotide change in the 3' untranslated region of OPRSl (672*51G>T) was detected in the Family 14 pedigree (Figure 9). The OPRSl 672*51G>T change segregates with the disease haplotype in EOAD14. The 672*51G>T sequence change was not detected in a cohort of 169 elderly normal controls (from the Sydney Older Person Study SOPS cohort) indicating that it is a mutation associated with and/or causative of dementia.

In silico analysis of the OPRSl 3'UTR indicated that the 672*51G>T substitution is located within a conserved region of the OPRSl transcript and is predicted to disrupt a putative stem loop structure in the transcript.

Following from this analysis DNA from subjects suffering from neurodegenerative disease was screened to identify mutations and /or polymorphisms within the OPRSl gene that segregate with neurodegenerative disease. These subjects were from a cohort of 106 Australian early-onset presenile dementia patients, 27 patients with familial FTLD that were negative for MAPT and PGRN mutations, 123 subjects affected with a neurodegenerative disease from the Sydney Older Person Study (SOPS) cohort, and two cohorts from Poland comprising 160 familial cases of dementia that were negative for mutations in the APP gene, PSENl gene, PSEN2 gene or MAPT gene. As shown in Figure 9 and in Table 1, four (4) additional mutations were detected in the presenile dementia cohort (a synonymous nucleotide substitution at codon position 2 (CAG to CAA; corresponding to position 2080 of SEQ ID NO: 13 or position 80 of SEQ ID NO: 5), a missense mutation resulting in a change at amino acid 4 of the OPRSl protein from alanine to valine (this mutation is a C to T mutation occurring at a position corresponding to position 2085 of SEQ ID NO: 13 or position 85 of SEQ ID NO: 5), a G to T change at position +31 in intron 2 (IVS2+31G>T) (at a position corresponding to position 25783 of SEQ ID NO: 13), a synonymous nucleotide substitution at codon 184 (TTC to TTT; this mutation occurs at a position corresponding to 4020 of SEQ ID NO: 13 or position 626 of SEQ ID NO: 5) in addition to the 3' untranslated region mutation at nucleotide position 672*51 (G to T at a position corresponding to position 4191 of SEQ ID NO: 13) found in family 14. A 3'UTR mutation (672*26OT; corresponding to nucleotide position 4166 of SEQ ID NO: 13) was detected in a FTLD patient. An intronic mutation comprising a C to A change at position +24 of intron 2 (IVS2+24C>A; corresponding to nucleotide position 2576 of SEQ ID NO: 13) was detected in an individual suffering from late-onset dementia in the SOPS cohort. An additional mutation in the 3' UTR mutation at position 672*42 (G to T; at a position corresponding to nucleotide position 4182 of SEQ ID NO: 13; corresponding position 788 of SEQ ID 5) was detected in an individual suffering from neurodegenerative disease in the SOPS cohort. Four additional nucleotide changes were identified in the Polish cohorts, in particular, a nucleotide substitution (C to G) in the 5' UTR at position -45 (corresponding to nucleotide position 30 of SEQ ID NO: 5 or nucleotide position 2030 of SEQ ID NO: 13), an intronic mutation (T to A) in intron 3 at nucleotide position +17 (IVS3+17T>A) (this mutation occurs at a position corresponding to nucleotide position 2792 of SEQ ID NO: 13), a synonymous nucleotide substitution at codon position 157 (GGT to GGC) (this mutation occurs at a position corresponding to nucleotide position 545 of SEQ ID NO: 5 or nucleotide position 3939 of SEQ ID NO: 13), and another 3' UTR mutation at position 672*47 (G to A; at a position corresponding to nucleotide position 4187 of SEQ ID NO: 13). A cohort of 76 motor neuron disease families was then screened and 5 nucleotide changes detected, all located near exon 1. These mutations include the amino acid substitution Threonine to Serine at residue 23 in transmembrane domain 1 (corresponding to nucleotide position 141 of SEQ ID NO: 5 or nucleotide position 2141 of SEQ ID NO: 13). Three substitutions were detected in intron 1, comprising IVS1+29C>A (this mutation occurs at a position corresponding to nucleotide position 2254 of SEQ ID NO: 13), IVSl+30G>A (this mutation occurs at a position corresponding to nucleotide position 2255 of SEQ ID NO: 13), and IVSl +32OA (this mutation occurs at a position corresponding to nucleotide position 2257 of SEQ ID NO: 13). The fifth mutation was located in the 5'UTR (-6G>C; corresponding to nucleotide position 2070 of SEQ ID NO: 13).

TABLE l Mutations detected in the OPRSl gene

EXAMPLE 3 An OPRSl mutation affects OPRSl mRNA levels

This example supplements Example 2 demonstrating that mutations or polymorphisms within the OPRSl gene are diagnostic of TDP-43 proteinopathy e.g., neurodegenerative disease such as pre-senile dementia and/or advanced dementia, by demonstrating that mutations in untranslated region of the OPRSl gene lead to increased expression and steady-state transcript levels in neural cells. This example, also provides support for reducing expression of specific OPRSl mRNA transcript(s) and/or reducing activity or level of OPRSl protein level or activity in the treatment or prevention of TDP-43 proteinopathy e.g., neurodegenerative disease such as pre-senile dementia and/or advanced dementia.

3.1 Materials and Methods

A 1223 bp promoter fragment was PCR-amplified from the OPRSl gene using the oligonucleotides CTGGGGAGTAGGACCATTGTTTC (SEQ ID NO: 9) and TATCTCTTCGCGCTGGAAGACG (SEQ ID NO: 10) and subcloned into a pGL3 vector containing the luciferase reporter gene. Consequently, a 1104 bp genomic fragment was amplified corresponding to the entire 3 '-untranslated region of the OPRSl gene using the oligonucleotides ACTGTCTTCAGCACCCAGGACT (SEQ ID NO: 11) and ACCATGAATCACACAGCAAGAG (SEQ ID NO: 12). Genomic DNA from subjects suffering from dementia and comprising the 672*51G>T mutant allele or from normal subjects was used as a template. Wild type and mutant alleles (672*51G>T) were subcloned into a modified pGL3 vector containing the wildtype OPRSl promoter. The 672*47G>A mutation was introduced into the luciferase reporter construct with the wildtype OPRSl promoter and wildtype 3'UTR by site-directed mutagenesis.

Each recombinant vector was transfected into human neuroblastoma SK-N-MC or SK- N-SH cells using Lipofectamine 2000 reagent according to manufacturer's instructions (Invitrogen). The cells were lysed after 48 hours and the levels of luciferase activity were assessed using the Readi-Glo reagent according to manufacturer's instructions (Promega).

3.2 Results

As shown in Figure 9c, both mutations increased luciferase expression in SK-N-MC cells and in SK-N-SH cells. Comparative results are shown in Table 2. TABLE 2 Luciferase expression levels.

EXAMPLE 4

A mutation in Intron 2 of OPRSl modulates splicing

This example supplements Example 2 demonstrating that mutations or polymorphisms within the OPRSl gene are diagnostic of TDP-43 proteinopathy e.g., neurodegenerative disease such as pre-senile dementia and/or advanced dementia, by demonstrating that mutations in intron(s) of the OPRSl gene e.g., intron 2 lead to increased neural cell expression of a splice variant of OPRSl associated with disease, and significantly reduce the level of wild-type OPRSl mRNA in neural cells. This example, also provides support for reducing expression of at least one OPRSl mRNA transcript(s) and/or reducing activity or level of OPRSl protein level or activity in the treatment or prevention of TDP-43 proteinopathy e.g., neurodegenerative disease such as pre-senile dementia and/or advanced dementia.

4.1 Methods

A 658bp PCR product comprising exon 2 and 3 of the OPRSl gene was amplified from genomic DNA using the primers OPRSIExonTrapF (5'- GGAGCCTAGGGTTCCGAAG-3'; SEQ ID NO: 20) and OPRSIExonTrapR (5'- CAACCAATCACCTGTGGCTTATG-3'; SEQ ID NO: 21). Genomic DNA from subjects suffering from dementia and comprising the IVS2+31 or IVS2+24 mutant alleles or from normal subjects was used as a template. Wild type and mutant alleles (IVS2+31OT or IVS2+24C>A) were subcloned into the exon trap vector pSPL3 (Gibco BRL, CA). Each recombinant vector was transfected into the human neuroblastoma cell line, SK-N-MC (ATCC HTB 10) or human embryonic kidney 293 cells (ATCC CRL 1573) using Lipofectamine 2000 (Invitrogen). Cells were left for 48 hours before total RNA was extracted and the exon trap products detected by RT-PCR essentially as described previously in Stanford et al Brain; 123: 880-893, 2000.

4.2 Results

As shown in Figures 4A and 4B both IVS2+24C>A and IVS2+31G>T increase the level of alternative splicing of OPRSl, and significantly reduce the level of correctly spliced OPRSl mRNA. Accordingly, these results provide additional markers for diagnosing a neurodegenerative disease or determining a predisposition to a neurodegenerative disease or predicting an increased risk of developing a neurodegenerative disease, e.g., by virtue of detecting a reduced level of wild type OPRS 1 and/or by detecting an increased level of or the presence of alternatively spliced OPRSl.

EXAMPLE 5

OPRSl mutations increase gamma-secretase activity This example supplements Example 2 demonstrating that mutations or polymorphisms within the OPRSl gene are diagnostic of TDP-43 proteinopathy, by demonstrating that mutations in exon(s) of the OPRSl gene e.g., exon 1, lead to increased neural cell expression of an OPRSl isoform associated with disease. This example, also provides support for therapy of neurodegeneration characterized by TDP-43 proteinopathy wherein the therapy comprises reducing expression of at least one OPRSl mRNA transcript and/or reducing activity or level of OPRSl protein level or activity, by virtue of showing that elevated OPRSl activity or level or expression is correlated with elevated gamma secretase activity. Accordingly, this example provides support for the use of OPRSl modulators to treat or prevent amyloidogenic symptoms of a TDP-43 proteinopathy e.g., AD or FTLD. 5.1 Methods

The presence of a FLAG motif at the amino-terminal end of the OPRSl protein was introduced using the primers OPRSl -FLAGF (5'-

AAAAGCTTATGGATTACAAGGATGACGACGATAAGCAGTGGGCCGTGGGC- 3'; SEQ ID NO: 18) and OPRS1-FLAGR (5'-

AGGATCCTGGTGGGGAGGAGGTGGGAA-S'; SEQ ID NO: 19) to generate the pCDNA-FLAG-OPRSl(wt) plasmid. Site-directed mutagenesis was used to add either the rs 1800866 polymorphism or the Ala4Val mutation into the pCDNA-FLAG- OPRSl(wt) plasmid, to generate the pCDNA-FLAG-OPRSl(rs 1800866) and pCDNA- FLAG-OPRS 1 (Ala4Val) plasmid respectively.

Gamma-secretase activity was measured using a luciferase reporter assay essentially as described in Karlstrom et al. Journal of Biological Chemistry, 277: 6763-6766 2002. Briefly, two reporter constructs (MHlOO and C99-GVP plasmids) are co-transfected with the OPRSl expression constructs into the human neuroblastoma cell line, SK-N- MC (ATCC HTB 10) or into SK-N-SH cells (ATCC HTB 11) using Lipofectamine 2000 (Invitrogen). The cells were lysed after 48 hours and the levels of luciferase activity were assayed using the Readi-Glo reagent according to manufacturer's instructions (Promega).

5.2 Results

As shown in Figure 5, the level of gamma secretase activity was significantly increased in cells expressing the Ala4Val mutation compared to cells overexpressing native OPRSl. The level of gamma secretase activity was comparable to that detected in cells expressing the presenillin 1 Δexon 9 mutation, which is known to increase gamma- secretase activity in subjects suffering from AD. These data support utility of OPRSl in the diagnosis and therapy and prevention of amyloidogenesis in TDP-43 proteinopathies such as AD and FTLD. EXAMPLE 6

Effect of OPRSl mutations on Tau phosphorylation

This example determines the effect of OPRSl mutations e.g., that elevate OPRSl expression and/or activity and/or level in neurodegenerative conditions such as TDP-43 proteinopathies, on the level of phosphorylated Tau protein and/or phosphorylation rate of Tau protein.

6.1 Materials and Methods

6.1.1 Construction of expression constructs Nucleic acid comprising each of the mutations identified in OPRSl that are transcribed and expressed as identified in Example 3 are amplified by PCR using lymphocyte cDNA. Each PCR product is subcloned into the mammalian expression vector pCDNA3.1 (Invitrogen). Additionally, a vector is produced comprising an OPRSl cDNA placed under control of an OPRSl promoter and mutant OPRSl 3' untranslated region.

As a control, a vector is produced comprising an OPRSl cDNA placed under control of an OPRSl promoter and wild-type OPRSl 3' untranslated region.

COS-7 cells are then transfected with the gene constructs.

6.1.2 Detection of Tau species

Transfected cells are lysed in Ix Lysis buffer (5OmM Tris.HCl (pH 7.4), 15OmM NaCl, ImM PMSF, IX complete cocktail protease inhibitor (Boehringer Mannheim) and 0.05% Triton X-100. Approximately 2-25μg of total protein is used to assay for total Tau or Tau phosphorylated at serine residue 396 using the Human Tau or Human Tau [pS396] ELISA kit respectively (Biosource International, CA, USA).

The ability of each form of OPRSl to phosphorylate Tau at a serine residue 396 (Tau [pSer396]) is examined. COS-7 cells are transfected with each cDNA and endogenous

Tau phosphorylation is measured by ELISA. For example, the level of Tau phosphorylation is determined in cells comprising each of the mutations descried herein relative to control cells. Mutations associated with increased Tau phosphorylation, a characteristic of Alzheimer's disease are then identified.

EXAMPLE 7

Effect of OPRSl agonists on Tau phosphorylation

This example determines the effect of OPRSl agonists e.g., that mimic the elevated OPRSl activity detected in neurodegenerative conditions such as TDP-43 proteinopathies, on the level of phosphorylated Tau protein and/or phosphorylation rate of Tau protein.

7.1 Production of cells expressing specific OPRSl isoforms

COS-7 cells are plated onto 12 well plates at concentration of IX 10⁵ cells/ well and allowed to recover for 24 hours. Each well is transfected with each of the vectors described in Example 5 using Lipofectamine 2000. After 48 hours, growth media are removed and cells exposed to pregnenolone sulphate or SA4503 (l-(3,4- dimethoxyphenethyl)-4-(3-phenylpropyl)piperazine dihydro-chloride) (Senda et al, Eur. J. Pharmacol, 315: 1-10, 1996) or 2-(4-morpholinethyl)l- phenylcyclohexanecarboxylate (Marrazzo et al., NeuroReport 16: 1223-1226, 2005) serially diluted in growth medium. Media are removed, cells lysed in situ, and the level of endogenous Tau [pS396] phosphorylation measured as described above.

To gain biologically relevant insights into the actions of OPRSl agonists in dementia, the ability of various OPRSl agonists to inhibit phosphorylation of endogenous Tau protein is examined in living COS-7 cells that express mutant forms of OPRSl.

EXAMPLE 8 OPRSl gene expression in subjects suffering from neurodegeneration and carrying the

3' UTR G723T mutation This example supplements Examples 2 and 5 hereof, by demonstrating correlation between the level of at least one OPRSl mRNA transcript and disease state in vivo. Accordingly, this example provides support for the diagnosis of TDP-43 proteinopathy by determining modified expression of OPRSl, and for the use of OPRSl modulators to treat or prevent a TDP-43 proteinopathy e.g., a neurodegenerative disease such as AD or pre-senile dementia or advanced dementia.

8.1 Method

Total RNA was extracted from immortalized lymphocytes and reversed transcribed using a poly-dT primer. OPRSl transcript levels were determined by SYBR green chemistry quantitative PCR using primer OPRSl-RTF (5'- ACCATCATCTCTGGCACCTT-S'; SEQ ID NO: 22) and OPRSl-RTR (5'- CTCCACCATCCATGTGTTTG-3'; SEQ ID NO: 23). Transcript levels between samples were normalized using primers that amplify the house-keeping gene, succinate dehydrogenase complex, subunit A (SDHA) essentially as described in Vandesompele et al. Genome Biology 3, 2002. As shown in Figure 10, the endogenous OPRSl gene was over-expressed by approximately 2-fold in lymphocytes from 672*51G>T mutation carriers when compared to mutation-negative, neurologically normal controls from the same family. As OPRSl expression has been reported to increase with age, we performed regression analysis using age, sex and disease status as predicting variables.

8.2 Results

This analysis indicated that both age (p = 0.005) and disease status (p = 0.014) were significant predictors of OPRSl transcript levels.

EXAMPLE 9 Increase in OPRSl transcript levels is correlated with increased levels of the TAR DNA binding protein - 43 (TDP-43) in the cytoplasm of lymphocyte cell lines from 3 'UTR

672*51G>T mutation carriers.

This example demonstrates a positive correlation between the level of at least one

OPRSl mRNA transcript and TDP-43 level in vivo. Accordingly, this example provides support for the diagnosis of TDP-43 proteinopathy by determining modified expression of OPRSl, and for the use of OPRSl modulators to treat or prevent a TDP- 43 proteinopathy e.g., a neurodegenerative disease such as AD or pre-senile dementia or advanced dementia.

9.1 Methods In one approach, paraffin-embedded 7 micron sections of the superior frontal cortex and hippocampus, as well as spinal cord sections for individual 111:12 (Example 1), were obtained from the South Australian Brain Bank. TDP-43 protein was visualized following microwave antigen retrieval (sections were boiled for 3min in 0.2M citrate buffer, pH 6.0) using commercially available antibody (BC001487, PTG, USA, diluted 1:500), peroxidase visualization and counterstaining with 0.5% cresyl violet. The location of the abnormal TDP-43 -immunoreactive protein deposits within layer II neurons of the frontal cortex and hippocampal granule cells was identified as either cytoplasmic, intranuclear or neuritic. These features were used to classify the cases into histological subtypes according to Sampathu et al. Am. J. Pathol. 169: 1343-1352, 2006. Similar immunohistochemical methods were used to identify α-internexin- positive inclusions using commercially available antibody (32-3600, ZYMED Laboratories, USA, diluted 1 :50) and counterstaining with 0.5% cresyl violet.

In another approach, cytoplasmic and nuclear subcellular fractions were isolated sequentially from lymphocyte cell lines using the Proteoextract Subcellular Proteome

Extraction Kit (Calbiochem, La Jolla, CA, USA) according to manufacturer's instructions. Approximately lOμg of protein lysates were heated to 95⁰C for 10 minutes prior to electrophoresis on a 7.5% SDS-PAGE gel and then transferred to a nitrocellulose membrane (Trans-blot transfer medium, Biorad, CA). A rabbit polyclonal antibody (Proteintech Group Inc, Chicago, IL, USA) was used to detect the

TDP-43 protein. Densities of chemiluminescence bands were quantified using the

Biorad Chemidoc system.

9.2 Results Results show a strong correlation between OPRSl transcript levels and the relative amount of TDP-43 protein in the cytoplasm as expressed as a ratio of TDP-43 in cytoplasmic versus nuclear fraction. Densities of chemiluminescence bands were quantified using the Biorad Chemidoc system. As shown in Figure 15C, there is a strong correlation (r2 = 0.852, p = 0.006) between OPRSl transcript levels and the relative amount of TDP-43 protein in the cytoplasm as expressed as a ratio of TDP-43 in cytoplasmic versus nuclear fraction.

EXAMPLE 10 Overexpression of OPRSl cDNAs increases the level of the TAR DNA binding protein

(TDP-43) in the cytoplasm of two transfected neuronal cell lines This example supplements Example 9 hereof, by demonstrating a positive correlation between the level of at least one OPRSl mRNA transcript and TDP-43 level in the cytoplasm of neural cells in situ. Accordingly, this example provides support for the diagnosis of TDP-43 proteinopathy by determining modified expression of OPRSl, and for the use of OPRSl modulators to treat or prevent a TDP-43 proteinopathy e.g., a neurodegenerative disease such as AD or pre-senile dementia or advanced dementia.

10.1 Methods

A full-length wild-type OPRSl cDNA was constructed by RT-PCR of lymphocyte

RNA using the primers OPRSl-RTF (5'- AAAAGCTTATGCAGTGGGCCGTGGGC- 3'; SEQ ID NO: 24) and OPRSl-RTR (5'-

AGGATCCTGGTGGGGAGGAGGTGGGAA-S'; SEQ ID NO: 25), and sub-cloned into the expression vector pCDNA3.1 (Invitrogen) to generate the pCDNA-OPRSl(wt) plasmid. The presence of the Ala4Val mutation was introduced into the OPRSl expression construct by site-directed mutagenesis to generate the pCDNA- OPRS l(Ala4 VaI) plasmid. The presence of a FLAG motif at the amino-terminal end of the OPRSl protein was introduced using the primers OPRS !-FLAGF and OPRSl- FLAGR to generate the pCDNA-FLAG-OPRSl(wt) plasmid: OPRSl -FLAGF: 5'-AAAAGCTTATGGATTACAAGGATGACGACGATAAGCAGTGGGCCGTGGGC-S' (SEQ ID NO: 26);

OPRSl-FLAGR^'-AGGATCCTGGTGGGGAGGAGGTGGGAA-S' (SEQ ID NO: 27). Each recombinant vector was transfected into the human neuroblastoma cell line, SK- N-MC (ATCC HTB 10) and SK-N-SH cells (ATCC HTB 11) using Lipofectamine 2000 (Invitrogen). Cells were left for 48 hours prior to western blot analyses of TDP-43 protein levels. Cytoplasmic and nuclear subcellular fractions were isolated sequentially from transfected cells using the Proteoextract Subcellular Proteome Extraction Kit (Calbiochem, La Jolla, CA, USA) according to manufacturer's instructions. Approximately 10μg of protein lysates were heated to 95⁰C for 10 minutes prior to electrophoresis on a 7.5% SDS-PAGE gel and then transferred to a nitrocellulose membrane (Trans-blot transfer medium, Biorad, CA).

A rabbit polyclonal antibody (Proteintech Group Inc, Chicago, IL, USA) was used to detect the TDP-43 protein. Densities of chemiluminescence bands were quantified using the Biorad Chemidoc system. 10.2 Results As shown in Figure 8, the over-expression of the wildtype OPRSl cDNA in transfected cells significantly increase (1.3 to 1.5 fold, p = 0.019, Student's t test) the level of TDP- 43 in the cytoplasm compared to cells transfected with the control LacZ vector.

EXAMPLE I l Preparation of a monoclonal antibody that recognizes an OPRS Ala4Val mutant polypeptide

This example demonstrates production methods for diagnostic or therapeutic antibodies that bind to at least one OPRSl isoform associated with TDP-43 proteinopathy. Accordingly, this example provides support for the diagnosis of TDP-43 proteinopathy by determining modified expression of OPRSl, and for the use of OPRSl modulators to treat or prevent a TDP-43 proteinopathy e.g., a neurodegenerative disease such as AD or pre-senile dementia or advanced dementia.

11.1 Methods A monoclonal antibody that specifically binds to an epitope of OPRSl comprising the Ala4Val mutation is produced using methods known in the art. Briefly, a peptide antigen that corresponds to the region of OPRSl comprising the Ala4Val mutation is synthesized essentially using the methods described in Bodanszky, M. (1984) Principles of Peptide Synthesis, Springer- Verlag, Heidelberg and Bodanszky, M. & Bodanszky, A. (1984) The Practice of Peptide Synthesis, Springer-Verlag, Heidelberg.

Peptides are purified using HPLC and purity assessed by amino acid analysis.

Female BalB/c mice are immunized with a purified form of the peptide. Initially mice are sensitized by intraperitoneal injection of Hunter's Titermax adjuvant (CytRx Corp., Norcross, GA,). Three boosts of the peptide are administered at 2, 5.5 and 6.5 months post initial sensitization. The first of these boosts is a subcutaneous injection while the remaining are administered by intraperitoneal injection. The final boost is administered 3 days prior to fusion.

The splenocytes of one of the immunized BALB/c mice is fused to X63-Ag8.653 mouse myeloma cells using PEG 1500. Following exposure to the PEG 1500 cells are incubated at 37⁰C for 1 hour in heat inactivated fetal bovine serum. Fused cells are then transferred to RPMI 1640 medium and incubated overnight at 37⁰C with 10% CO₂. The following day cells are plated using RPMI 1640 media that has been supplemented with macrophage culture supernatants.

Two weeks after fusion, hybridoma cells are screened for antibody production by solid phase ELISA assay. Standard microtitre plates are coated with recombinant OPRSl Ala4Val in a carbonate based buffer. Plates are then blocked with BSA, washed and then the test samples (i.e. supernatant from the fused cells) is added, in addition to control samples, (i.e. supernatant from an unfused cell). Antigen-antibody binding is detected by incubating the plates with goat-anti-mouse HRP conjugate (Jackson ImmunoResearch Laboratories) and ABTS peroxidase substrate system (Vector Laboratories, Burlingame, Ca 94010, USA). Absorbance is read on an automatic plate reader at a wavelength of 405 nm. Any colonies that are identified as positive by these screens continue to be grown and screened for several further weeks. Stable colonies are then isolated and stored at 8O⁰C.

Positive stable hybridomas are then cloned by growing in culture for a short period of time and diluting the cells to a final concentration of 0.1 cells/well of a 96 well tissue culture plate. These clones are then screened using the previously described assay. This procedure is then repeated in order to ensure the purity of the clone.

Four different dilutions, 5 cells/well, 2 cells/well, 1 cell/well, 0.5 cells/well of the primary clone are prepared in 96-wells microtiter plates to start the secondary cloning. Cells are diluted in IMDM tissue culture media containing the following additives: 20% fetal bovine serum (FBS), 2 mM L-glutamine, 100 units/ml of penicillin, 100 μg/ml of streptomycin, 1% GMS-S, 0.075% NaHCO₃. To determine clones that secrete anti-human OPRSl antibody, supernatants from individual wells of the 0.2 cells/well microtiter plate are withdrawn after two weeks of growth and tested for the presence of antibody by ELISA assay as described above.

All positive clones are then adapted and expanded in RPMI media containing the following additives: 10% FBS, 2 mM L-glutamine, 100 units/ml of penicillin, 100 μg/ml of streptomycin, 1% GMS-S, 0.075% NaHCO₃, and 0.013 mg/ml of oxalaacetic acid. A specific antibody is purified by Protein A affinity chromatography from the supernatant of cell culture.

The titer of the antibodies produced using this method are determined using the Easy Titer kit available from Pierce (Rockford, II, USA). This kit utilizes beads that specifically bind mouse antibodies, and following binding of such an antibody these beads aggregate and no longer absorb light to the same degree as unassociated beads. Accordingly, the amount of an antibody in the supernatant of a hybridoma is assessed by comparing the OD measurement obtained from this sample to the amount detected in a standard, such as for example mouse IgG. The specificity of the monoclonal antibody is determined using a Western blot. The antibody is utilized in standard immunoassay platforms as described herein, for diagnostic and/or therapeutic purposes.

EXAMPLE 12

Determining the level of OPRSl Ala4Val in a biological sample This example supplements Example 11 hereof, by demonstrating immunoassay methods for diagnosis of a TDP-43 proteinopathy that would employ antibodies that bind to at least one OPRSl isoform associated with the TDP-43 proteinopathy.

A monoclonal antibody that binds to the OPRSl Ala4Val mutant as described in Example 11 is used in the production of a two-site ELISA to determine the level of mutant OPRSl in a biological sample.

12.1 Methods

A polyclonal antibody that binds to OPRS 1 is adsorbed to a microtitre plate at 20⁰C for 16 hours. Plates are then washed and blocked for 1 hour. Recombinant OPRSl Ala4Val is serially diluted, added to wells of the microtitre plate and incubated for 1 hour. Alternatively, sera from normal control subjects and patients suffering from FTLD is diluted serially in PBS and added to wells comprising the antibody. The monoclonal antibody described in Example 11 is conjugated to horseradish peroxidase (HERP) using a HRP conjugation kit (Alpha Diagnostics International, Inc., San Antonio, TX, USA) and, following washing of the microtitre plates, the HRP conjugated monoclonal antibody is added to each well of the plate and incubated. Plates are then washed and ABTS (Sigma Aldrich, Sydney, Australia) is added to each well. Reactions are stopped after approximately 20 minutes and absorbance values measured at 415 nm.

In one example, the sample absorbance detected for negative controls (no OPRSl Ala4Val or normal subject patient sera) is subtracted from the sample absorbance for diseased patient sera, to thereby determine enhanced antibody-OPRSl Ala4Val complex formation for diseased patients relative to normal controls.

In another example, the ELISA plate does not include negative control sera, and a computer program is employed to subtract an expected absorbance value calculated for a normal population from the sample absorbance for diseased patient sera, to thereby determine enhanced antibody-OPRSl Ala4Val complex formation for diseased patients relative to normal controls.

In another example, a computer program is employed to convert the absorbance data to OPRSl Ala4Val protein level by comparison to a standard curve correlating absorbance level to protein level. For example, this conversion is performed using absorbance data from which the absorbance detected for negative controls or an expected absorbance value calculated for a normal population has been subtracted. Alternatively, this conversion is performed directly on raw absorbance data. When the conversion is performed directly on raw absorbance data for patient samples, it is possible to employ a computer to perform the same data conversion e.g., separately or simultaneously on raw absorbance data for negative controls or expected absorbance values for a normal population, and then subtract the calculated OPRSl Ala4Val protein level for patient samples from the calculated OPRSl Ala4Val protein level for negative controls or the normal population. It is also possible for a computer program to store an expected OPRSl Ala4Val protein level for a normal subject and, optionally, an expected OPRSl Ala4Val protein level for a diseased subject and to compare the OPRSl Ala4Val protein level for a subject being tested to that/those stored levels, in making a diagnosis.

12.2 Results

Immunoassay data will indicate that sera of patients suffering from the TDP-43 proteinopathy have elevated level of OPRSl Ala4Val compared to normal patient control subjects. EXAMPLE 13

Cosegregation of mutations in OPRSl with TDP-43 proteinopathy This example supplements Example 2 by expanding the co-segregation of mutations in OPRSl with TDP-43 proteinopathy.

13.1 Materials and Methods

13.1.1 Consent and ethics approval

Written informed consent was obtained from appropriate legal guardians for blood donation for genetic studies, and for brain donation. Tissue was obtained from the South Australian Brain Bank and matched controls from the Prince of Wales Medical Research Institute Tissue Resource Centre. All studies were approved by the relevant institutional ethics committees.

13.1.2 FTLD and Familial Presenile Dementia Cohorts The Australian familial FTLD cohort comprise 27 pedigrees selected on the basis of a positive family history with at least one affected first degree relative within each pedigree (Stanford, P.M. et al. J. Neurol. 251 : 1098-1104 (2004)). Of these, six pedigrees are classified as autosomal dominant with multiple relatives over two or more generations. Probands were tested according to current diagnostic criteria for FTLD (see for example, McKhann, G.M., et al. Arch. Neurol. 58: 1803-1809 (2001); and Morris, H.R. et al. Arch. Neurol. 58: 1813-1816 (2001)). All probands were negative for MAPT and PGRN mutations. Two independent Polish presenile dementia cohorts comprised 160 familial cases. Cases were known to be negative for APP, PSENl, PSEN2 and MAPT mutations (Zekanowski, C. et al. Dement. Geriatr. Cogn. Disord. 16:126-131 (2003); Zekanowski, C. et al. Exp. Neurol. 184: 991-996 (2003)).

13.1.3 Statistics

Mean differences in quantitative measures were compared with the use of two-tailed Student's t test. Regression analyses were performed using Intercooled Stata 8.0 for Windows (Stata Corporation 2003) to take into account individual data of age and affection status. Mean and standard error of the mean are given for all variables. 13.1.4 Mutation Screen of Candidate Genes

Intronic polymerase chain reaction (PCR) primers were designed to amplify each non- coding and coding exon, as well as flanking intronic sequence of the candidate genes UBE2R2, DNAJAl, PAX5, CNTNAP3, GDA, DNAIl, CNTFR, DCNT3. ILIIRA, GALT, CCLl 9, CCL21, CCL27, ARID3C, TLNl, MOBKL2B, HINT2, AQP3, UBAPl, ALDHlBl, PLAA, IFNK, P23, UNIQ470, UBAP2, TOPORS, NDUFB6, APTX, BAGl and OPRSl using the ExonPrimer program accessed using the UCSC Genome Bioinformatics Site (primer sequences available on request). PCR products amplified from genomic templates were sequenced using BigDye Chemistry and 3730 DNA Analyzer (Applied Biosystems).

13.2 Results

The inventors demonstrated linkage with the highest LOD score (LOD 3.24, multipoint LOD 3.41) for the marker D9S1817 on chromosome 9p in a single multi-generational FTLD-MND pedigree (family 14) with typical TDP-43-immunopositive inclusions (data not shown). 30 candidate genes were examined within the candidate disease region (D9S169 to D9S1845) selected on the basis of their possible involvement in neurodegeneration. Only the opioid receptor sigma 1 (OPRSl) gene had a non- polymorphic nucleotide change, a G to T nucleotide change (c.672*51G>T; residue 797 of SEQ ID NO:5; residue 4191 of SEQ ID NO:13)) in the 3' untranslated region (3'UTR), that co-segregated with the disease phenotype in family 14 (Figure 9a and 9b). The c.672*51G>T (residue 797 of SEQ ID NO: 5; residue 4191 of SEQ ID NO:13) change was not previously in a SNP database, or detected in a cohort of 169 elderly normal controls or in 124 individuals with sporadic late-onset dementia obtained from the Sydney Older Person Study (SOPS; Waite, L.M. et al. Med. J. Aus. 167: 429-32 (1997)) .

The Australian cohort of FTLD probands comprising 27 pedigrees that were negative for MAPT and PGRN mutations, and the two independent Polish dementia cohorts comprising 160 familial cases that were negative for APP, PSENl, PSEN2 and MAPT mutations described above (see 13.1.2) were screened. A mutation in the 3'UTR (c.672*26OT, i.e., residue 772 of SEQ ID NO: 5; residue 4166 of SEQ ID NO: 13) was identified in another Australian pedigree with FTLD. Three other mutations were identified from the Polish cohorts comprising an intronic mutation (T to A) in intron 3 at nucleotide position +17 (c.IVS3 +17T>A, i.e., residue 2792 of SEQ ID NO: 13), a synonymous nucleotide substitution at codon position 157 (c.471T>C, i.e., residue 545 of SEQ ID NO: 5; residue 3939 in SEQ ID NO: 13), and another 3' UTR mutation at position 47 (c.672*47G>A, i.e., residue 793 of SEQ ID NO: 5; residue 4187 of SEQ ID NO: 13) (Figure 9, Table 3). None of the mutations were found in the SOPS cohort. A 5'UTR (-45 C to G, i.e., residue 30 in SEQ ID NO: 5; residue 2030 in SEQ ID NO: 13) mutation that was found in probands of two Polish pedigrees as well as in three late- onset dementia patients from the SOPS cohort, suggesting that this may be a common risk polymorphism. In silico analyses suggest that the intronic and synonymous mutation may alter the correct splicing of cognate exons (Table 3). The frequency of OPRSl mutations was estimated to be to be between 2% (Polish cohorts) to 4% (Australian cohorts) in familial presenile dementia patients, comparable to the mutation frequency of Amyloid Precursor Protein gene mutations previously found in familial AD e.g., by Chapman, P.F. et al. Trends Genet. 17:254-61 (2001).

TABLE 3 Summary of putative mutations identified in familial FTLD and AD pedigrees

1. Mutations are described according to the nomenclature recommended by the Human Genome Variation Society (Lee, V.M., Wang, J. & Trojanowski, J.Q. Methods Enzymol. 309: 81-89 (1999).

2. Nucleotide and amino acids are numbered according to the cDNA sequence of OPRSl isoform 1 (Genbank accession number NM_005866.2) with the adenine of the initiation codon assigned position 1.

3. Detailed clinical description of Australian and Polish FTLD pedigrees are found in supplementary data 1 and 2.

EXAMPLE 14

Effect of mutations in OPRSl on transcript stability

This example supplements Example 8 hereof, by demonstrating correlation between the level and stability of at least one OPRSl mRNA transcript and disease state in vivo. Accordingly, this example provides support for the diagnosis of TDP -43 proteinopathy by determining modified expression of OPRSl, and for the use of OPRSl modulators to treat or prevent a TDP-43 proteinopathy e.g., a neurodegenerative disease such as AD or pre-senile dementia or advanced dementia.

14.1 Materials and Methods

14.1.1 Lucif erase Reporter Assay A 1223 bp promoter fragment was PCR amplified from the OPRSl gene using the oligonucleotides OPRSl-PromF (5'-CTGGGGAGTAGGACCATTGTTTC-S') and OPRSl-PromR (5'-TATCTCTTCGCGCTGGAAGACG-S') and subcloned into a pGL3 vector containing the luciferase reporter gene. A 1104 bp genomic fragment was amplified corresponding to the entire 3 '-untranslated region of the OPRSl gene using the oligonucleotides OPRS1-3UTRF (5'-ACTGTCTTCAGCACCCAGGACT-S') and OPRS1-3UTRR - (5'-ACCATGAATCACACAGCAAGAG-S'). Genomic DNA from subjects with FTLD-MND and the G723T mutant allele or from normal subjects was used as a template. Wild type and mutant alleles (c.672*51G>T) were subcloned into a modified pGL3 vector containing the wildtype OPRSl promoter. The presence of the c.672*47G>A mutation was introduced into the luciferase reporter construct with the wildtype OPRSl promoter and wildtype 3'UTR by site-directed mutagenesis (Stratagene). Each recombinant vector was transfected into human neuroblastoma SK- N-MC (ATCC HTB 10) or SK-N-SH (ATCC HTB 11) cells using Lipofectamine 2000 reagent according to manufacturer's instructions (Invitrogen). Cells were lysed after 48 hours and luciferase activity were assayed using the Readi-Glo reagent according to manufacturer's instructions (Promega). 14.1.2 Quantification of OPRSl transcript levels

Total RNA was extracted from immortalised lymphocytes and reverse transcribed using a poly-dT primer. OPRSl transcript levels were determined by SYBR green chemistry quantitative PCR using OPRSl-RTF (5 '-ACC ATC ATCTCTGGC ACCTT- 3') and OPRSl-RTR (5'-CTCCACCATCCATGTGTTTG-S ') primers. Transcript levels between samples were normalised using primers that amplify the housekeeping gene, succinate dehydrogenase complex, subunit A (SDHA).

14.2 Results

The OPRSl 3'UTR mutations as identified in Examples 2 and 13 are located within a highly conserved region which may alter the stability of the transcript. Accordingly, stability of transcripts was tested using a transfection method expressing luciferase constructs. Chimeric luciferase reporter vectors in which the entire OPRSl 3'UTR was placed downstream of the luciferase gene. Luciferase activity from lysates of transfected SK-N-MC and SK-N-SH cells provided a measure of the stability of the chimaeric transcripts. Both the c.672*51G>T and c.672*47G>A mutations significantly increased luciferase activity by 1.2 (p = 0.020, Student T Test) and 1.8 fold (p = 0.004, Student T Test) respectively (Figure 9c). Moreover, quantitative realtime PCR showed that the endogenous OPRSl gene was over-expressed by approximately 2-fold in lymphocytes from c.672*51G>T mutation carriers when compared to mutation-negative, neurologically-normal controls from the same family (Figure 10).

As OPRSl expression has been reported to increase with age regression analysis using sex, age and affection status as predicting variables was performed on the data. This analysis indicated that both age (p = 0.005) and affection status (p = 0.014) were significant predictors of OPRSl transcript levels (Figure 10). EXAMPLE 15

Enhanced expression ofTDP-43 and OPRSl inpatients carrying OPRSl mutations This example supplements Example 9 hereof, demonstrating a positive correlation between the level of at least one OPRSl mRNA transcript and TDP-43 level in vivo. Accordingly, this example provides support for the diagnosis of TDP-43 proteinopathy by determining modified expression of OPRSl, and for the use of OPRSl modulators to treat or prevent a TDP-43 proteinopathy e.g., a neurodegenerative disease such as AD or pre-senile dementia or advanced dementia.

15.1 Materials and Methods

15.1.1 Brain Tissue Analyses

Immunohistochemistry was performed on paraffin-embedded 7 micron sections of the superior frontal cortex and hippocampus. TDP-43 protein was visualised following microwave antigen retrieval (sections boiled for 3 min in 0.2 M citrate buffer, pH 6.0) using TDP-43 antibody diluted 1:500, peroxidase visualisation and counterstaining with 0.5% cresyl violet as described previously, e.g., Yan, J. et al. Neurology 67: 186-b (2006). Similar antigen retrieval and immunohistochemical methods were used to identify OPRSl using sc-22948 antibody. Specificity of the reaction was confirmed by omitting the primary antibodies. For Western blot analyses two extraction methods were used. Crude total brain protein was extracted from 250-500mg of frontal cortex using known methods, e.g., Stanford, P.M. et al. Brain 126: 814-826 (2003). Protein lysates were then concentrated 10 fold by centrifugation through Microcon filters (YM- 10, Millipore, USA). Additional sequential brain protein extractions were carried out to compare two patients with different severities of TDP43 positive inclusions. In brief, gray and white matter was extracted at 5 ml/g (v/w) with low-salt buffer (10 mmol/L Tris, pH 7.5, 5 mmol/L ethylenediamine tetraacetic acid, 1 mmol/L dithiothreitol, 10% sucrose, and a cocktail of protease inhibitors), high-salt Triton X buffer (low-salt buffer, 1% Triton X-IOO, and 0.5 mol/L NaCl), myelin floatation buffer (Triton X buffer containing 30% sucrose), and sarkosyl buffer (low-salt buffer, 1% N-lauroyl- sarcosine, and 0.5 mol/L NaCl). The detergent-insoluble materials were extracted in 0.25 ml/g urea buffer (7 mol/L urea, 2 mol/L thiourea, 4% 3-[(3-cholamidopropyl) dimethylammonio]-l-propanesulfonate, and 30 mmol/L Tris, pH 8.5). Specific proteins were visualised using commercially available antibodies for TDP -43 (BCOO 1487, PTG, USA, diluted 1:2000) and OPRSl (Sigma-1) (ab53852, Abeam, Cambridge, UK, diluted 1:500 or sc-22948, Santa Cruz Biotechnology, USA, diluted 1:200) and enhanced chemiluminescence according to manufacturers instructions (Supersignal West Pico Chemiluminescent Substrate, Thermo Scientific, USA).

15.1.2 Western blot of brain tissue samples Controls were age-matched to the affected individuals. Brain tissue was homogenised and soluble proteins were isolated using extraction buffer A (0.75 M NaCl, 100 mM 2- (N-morpholino) ethanesulfonic acid, 1 mM EGTA, 0.5 mM MgSO, 2 mM dithriothreitol at pH 6.8, supplemented with protease inhibitors). Specific proteins were visualised using commercially available antibodies for β-actin (ab6276, Abeam, Cambridge, UK, diluted 1 :5000), TDP43 (BC001487, PTG, USA, diluted 1:2000) and Sigma-1 (ab53852, Abeam, Cambridge, UK, diluted 1 :500) and enhanced chemiluminescence according to manufacturers instructions (Supersignal West Pico Chemiluminescent Substrate, Thermo Scientific, Rockford IL, USA).

Sequential brain protein extractions were carried out to compare two patients with different levels of neuropathologically confirmed TDP-positive inclusions (Figure 13).

Buffer 1 = low-salt buffer (10 mmol/L Tris, pH 7.5, 5 mmol/L ethylenediamine tetraacetic acid, 1 mmol/L dithiothreitol, 10% sucrose, and a cocktailof protease inhibitors), Buffer 2 = high-salt Triton X buffer (low-salt buffer, l%Triton X-100, and

0.5 mol/L NaCl), Buffer 3 = sarkosyl buffer (low-salt buffer, 1% iV-lauroyl-sarcosine, and 0.5 mol/L NaCl). The detergent-insoluble materials wereextracted in Buffer 4 (0.25 ml/g urea buffer (7 mol/L urea, 2 mol/L thiourea, 4% 3-[(3-cholamidopropyl) dimethylammonio]-l-propanesulfonate, and 30 mmol/L Tris,4 pH 8.5)). Specific proteins were visualised using commercially available antibodies for phosphorylated

Tau (AT8,Pierce Endogen, IL, USA, diluted 1:2000), β-actin (ab6276, Abeam, Cambridge, UK, diluted 1:5000), TDP43 (BC001487, PTG, USA, diluted 1:2000) and

Sigma-1 (sc-22948, Santa Cruz Biotechnology, USA, diluted 1:200) and enhancedchemiluminescence according to manufacturer's instructions (Supersignal West Pico Chemiluminescent Substrate).

15.2 Results

Histopathology of TDP-43 and OPRSl gene product (Sigma- 1) in three previously detailed cases from family 14 and three age-matched controls without neurologic or psychiatric features or other significant histopathology were compared. In control brain tissue, OPRSl was localized on membranes within the cytoplasm of most neurons and astrocytes (Figure 11) as well as on the myelin of oligodendroglia (not shown), consistent with previous studies in mouse brain. Assessment of the two cases with hippocampal pathology [111:2, 111:3] revealed a similar intracellular distribution in unaffected regions (Figure 11). In regions with significant neuronal degeneration (CAl and dentate gyrus), OPRSl appeared to be located within the nucleus of some remaining neurons and some neurons had diffuse TDP-43 cytoplasmic immunoreactivity (Figure 11).

Western immunoblotting of total proteins showed no difference in monomelic TDP-43 protein levels from the brain extracts of OPRSl mutation carriers compared with normal controls (Figure 12). However, there was a 2.2-fold increase in a high molecular weight TDP-43 species in affected individuals compared to controls (Figure 12), with this species occurring mainly within the insoluble urea-fraction (Figure 13), similar to reported FTLD-U cases. OPRSl occurs mainly as a high molecular weight complex (-100 kDa), with the monomeric form (31 kDa) accounting for less than 5% of total OPRSl protein. A mean 2.3 fold increase in total OPRSl levels in the mutation carriers compared with normal controls (Figure 12), was observed in agreement with the lymphocyte gene expression data. EXAMPLE 16

Positive correlation between cytoplasmic TDP-43 expression and OPRSl expression This example supplements Example 10 hereof, by demonstrating a positive correlation between the level of at least one OPRSl mRNA transcript and TDP-43 level in the cytoplasm of neural cells in situ. Accordingly, this example provides support for the diagnosis of TDP-43 proteinopathy by determining modified expression of OPRSl, and for the use of OPRSl modulators to treat or prevent a TDP-43 proteinopathy e.g., a neurodegenerative disease such as AD or pre-senile dementia or advanced dementia.

16.1 Materials and Methods

16.1.1 OPRSl Expression Constructs

A full-length wildtype OPRSl cDNA was constructed by RT-PCR of lymphocyte RNA using the primers OPRSl-F (5'- AAAAGCTTATGCAGTGGGCCGTGGGC-3') and OPRSl-R (5'-AGGATCCTGGTGGGGAGGAGGTGGGAA-S'), and subcloned into the expression vector pCDNA3.1 (Invitrogen) to generate the pCDNA-OPRSl(wt) plasmid. The presence of a FLAG motif at the amino-terminal end of the OPRSl protein was introduced using the primers OPRSl -FLAGF (5'- AAAAGCTTATGGATTACAAGGATGACGACGATAAGCAGTGGGCCGTGGGC- 3') and OPRS1-FLAGR (5'-AGGATCCTGGTGGGGAGGAGGTGGGAA-S') to generate the pCDNA-FLAG-OPRS 1 (wt) plasmid.

16.1.2 Subcellular Localization of TDP-43 by Western Blotting or Immunofluoresence Each recombinant vector was transfected into SK-N-MC and SK-N-SH cells using Lipofectamine 2000 (Invitrogen). Cells were left for 48 hours prior to Western blot analyses of TDP-43 protein levels or immunofluoresence microscopy. Cytoplasmic and nuclear subcellular fractions were isolated sequentially from transfected cells using the Proteoextract Subcellular Proteome Extraction Kit (Calbiochem, La Jolla, CA, USA) according to the manufacturer's instructions. Lysates containing approximately 20 μg of protein were heated to 95⁰C for 10 minutes prior to electrophoresis on a 10% SDS- PAGE gel and transferred to a nitrocellulose membrane (Trans-blot transfer medium, Biorad, CA). Densities of chemiluminescence bands were quantified using the Biorad Chemidoc system. A rabbit polyclonal antibody (BC001487, PTG, USA, diluted 1:2000) was used to detect the TDP-43 protein. A mouse monoclonal anti-FLAG antibody (F3165, Sigma- Aldrich, Germany, diluted 1:1000) was used to detect the FLAG-tagged OPRSl protein.

16.2 Results

Constitutive expression of wildtype OPRSl cDNA in neuronal cell lines resulted in increased levels of OPRSl protein (Figure 14). Measuring the levels of TDP-43 in the cytoplasmic and nuclear subcellular fractions of these transfected cells by Western blot analysis showed significantly increased expression of TDP-43 in the cytoplasm (1.3-1.5 fold, p = 0.005 - 0.023, Student T Test) relative to control transfections (Figure 15a). These results were verified by immunohistochemistry of transfected SK-N-SH cells using a FLAG-tagged OPRSl cDNA expression construct (Figure 15b and Figure 13). In untransfected cells, TPD-43 was mainly confined to the nuclei. However, in cells over-expressing the exogenous FLAG-tagged OPRSl cDNA (green fluorescence), the TDP-43 staining had dispersed from the nucleus into the cytoplasm, consistent with the Western blot analysis of subcellular fractions (Figure 15b and Figure 16). The effect of endogenous OPRSl expression on TDP-43 cytoplasmic localization in lymphocytes from affected individuals of family 14 was also examined. We observed that higher OPRSl transcript levels were positively correlated (r² = 0.852, p = 0.013) with increased levels of cytoplasmic TDP-43 (Figure 15c).

EXAMPLE 17

Modulation of TDP-43 localization using OPRSl modulators This example demonstrates the efficacy of OPRSl modulatory compounds such as OPRS 1 antagonists, in reducing cytoplasmic accumulation of TDP-43 in neural cells. Accordingly, this example provides support for the use of OPRSl modulators e.g., one or more antagonist compounds in the treatment and/or prevention of a TDP-43 proteinopathy e.g., a neurodegenerative disease such as ALS, AD or pre-senile dementia or advanced dementia. 17.1 Materials and Methods

To determine whether OPRSl ligands that are small molecules can mimic the effect of altered expression of OPRSl on TDP-43 subcellular localization, AC915 (N-(2-(3,4- dichlorophenyl)acetoxy)-ethylpyrrolidine (specific OPRSl antagonist; Maeda, D. Y. et al. Bioorg. Med. Chem. Lett. 10: 17-18 (2000)), haloperidol (OPRSl antagonist; Chaki, S. et al. Eur. J. Pharmacol. 251 : R1-R2 (1994)), and opipramol (specific OPRSl inverse agonist; Holoubek, G. & Muller, J Neural Transm. 110: 1169-1179 (2003) were used in subcellular localization assays as per Example 16 (Figure 15d).

Commercially available OPRSl ligands AC915 (A 3595), opipramol (O 5889) and haloperidol (H 1512) were obtained from Sigma- Aldrich (St Louis, MA).

SK-N-MC cells were treated with different concentrations of OPRSl ligands for 48 hours prior to Western blot analyses of TDP-43 protein levels. As sigma ligands are known to typically have biphasic dose-response curves, three concentrations were used in these experiments.

Cytoplasmic and nuclear subcellular fractions were isolated sequentially from transfected cells using the Proteoextract Subcellular Proteome Extraction Kit (Calbiochem, La Jolla, CA, USA) according to the manufacturers instructions. Lysates containing approximately 20 μg of protein lysates were heated to 95⁰C for 10 minutes prior to electrophoresis on a 10% SDS-PAGE gel and then transferred to a nitrocellulose membrane (Trans-blot transfer medium, Biorad, CA). A rabbit polyclonal antibody (Proteintech Group Inc, Chicago, IL, USA) was used to detect the TDP-43 protein. Densities of chemiluminescence bands were quantified using the Biorad Chemidoc system.

17.2 Results

Both AC915 and opipramol had an optimal concentration for maximal effect on TDP- 43 localization, wherein 5OnM AC915 (OPRSl antagonist) significantly decreased

(1.5-fold, p = 0.038, Student T test) the level of cytoplasmic TDP-43 in neural cells, and 15nM opipramol (OPRSl agonist) increased (1.5-fold, p = 0.020, Student T Test) the relative level of cytoplasmic TDP-43. A 10-fold increase or decrease in the concentration of either OPRS 1 ligand completely or partially abrogated these effects (Figure 15d), consistent with a biphasic response to OPRSl ligands.

The OPRSl antagonist, haloperidol, was found to be the most effective ligand in modulating the sub-cellular localization of TDP-43 (Figure 14 d), where all three dosage points (2.4nM, 24nM and 24OnM) significantly decreased (1.6 to 2 fold, p = 0.007 to p = 0.001, Student T Test) the level of cytoplasmic TDP-43.

These data support the use of OPRSl antagonists to reduce cytoplasmic TDP-43 level in the therapy or prevention of TDP-43 proteinopathy.

EXAMPLE 18

Use of OPRSl RNAi to decrease OPRSl expression This example demonstrates the efficacy of OPRSl modulatory compounds comprising nucleic acid inhibitors to reduce OPRSl gene expression in neural cells as determined at the nucleic acid and/or protein level. Accordingly, this example provides support for the use of OPRSl modulators e.g., RNAi or siRNA in the treatment and/or prevention of a TDP-43 proteinopathy e.g., a neurodegenerative disease such as ALS, AD or pre- senile dementia or advanced dementia.

18.1 Materials and Methods

SK-N-MC cells were plated at 3 X 10⁵ cells per well in 6 well plates and left to grow for 24 hours. A Stealth RNAi oligonucleotide (HSS 145544, Invitrogen) was used to knock-down OPRSl gene expression. High GC negative RNAi control (12935-400, Invitrogen) or OPRSl -specific RNAi (Invitrogen) (60 fmol) was transfected into the neural cells using Lipofectamine reagent according to manufacturer's instructions. Cells were incubated for 48 hours and then Western Blotting was performed to determine OPRSl expression. OPRSl protein was detected using a rabbit polyclonal clonal raised against the C-terminal region of rat OPRSl (1/500 dilution, Ab5382, Abeam). 18.2 Results

OPRSl RNAi knocked-down expression of endogenous OPRSl. Western blot analysis shows that OPRSl protein levels were decreased by -75% compared to cells transfected with control SiRNA (Figure 17). In view of the correlation between OPRSl expression and cytoplasmic TDP-43 protein accumulation, these data indicate utility of RNAi in reducing TDP-43 cytoplasmic accumulation in neural cells e.g. in therapy and/or prevention of TDP-43 proteinopathy.

EXAMPLE 19

Use of OPRSl RNAi to alter subcellular localization of TDP-43

This example supplements Example 18, and demonstrates the efficacy of OPRSl modulatory compounds comprising nucleic acid inhibitors to reduce cytoplasmic sequestration and accumulation of TDP-43 in neural cells. Accordingly, this example provides further support for the use of OPRSl modulators e.g., nucleic acid such as RNAi, siRNA or miRNA reducing TDP-43 cytoplasmic accumulation in neural cells e.g., in the treatment and/or prevention of a TDP-43 proteinopathy e.g., a neurodegenerative disease such as ALS, AD or pre-senile dementia or advanced dementia.

19.1 Methods

SK-N-MC and SK-N-SH cells were plated at 1 X 10^s cells per well in 24 well plates and left to grow for 24 hours. A Stealth RNAi oligonucleotide (HSS 145544, Invitrogen) was used to knock-down OPRSl gene expression. Either 3 microlitre of High GC negative RNAi control (12935-400, Invitrogen) or OPRSl RNAi (20pmol/ml stock) were transfected into cells using Lipofectamine reagent according to manufacturer's instructions. The cells were sequentially lysed using the Proteoextract Subcellular Proteome Extraction Kit (Calbiochem, La Jolla, CA, USA) according to the manufacturer's instructions after 48 hours and the relative levels of TDP-43 protein were measured using western blotting. 19.2 Results

The OPRSl SIRNA significantly decreased cytoplasmic TDP-43 in neuronal cell lines

(Table 4).

TABLE 4

* Values were obtained from pooled data from both cell lines (n = 10 transfections).

EXAMPLE 20

Use of OPRSl RNAi to decrease gamma-secretase activity This example demonstrates the efficacy of OPRSl modulatory compounds comprising nucleic acid inhibitors in reducing gamma secretase activity in neural cells. Accordingly, this example provides further support for the use of OPRSl modulators e.g., nucleic acid such as RNAi, siRNA or miRNA in the treatment and/or prevention of a TDP-43 proteinopathy, especially by reducing amyloidogenesis involving gamma secretase-catalyzed cleavage of β-amyloid protein e.g., in AD or FTLD.

20.1 Methods

SK-N-MC or SK-N-SH cells were plated at 1 X 10⁵ cells per well in 24 well plates and left to grow for 24 hours. A Stealth RNAi oligonucleotide (HSS 145544, Invitrogen) was used to knock-down OPRSl gene expression. High GC negative RNAi control (12935-400, Invitrogen) or OPRSl -specific RNAi (Invitrogen) (60 ftnol) was transfected into the neural cells, in combination with 1 mg of C99-GVP and MHlOO constructs encoding detectable substrates of endogenous gamma-secretase (see Karlstrom H et al. Journal of Biological Chemistry, 277, p 6763-6766 (2002)), were transfected into cells using Lipofectamine reagent according to manufacturer's instructions. The cells were lysed after 48 hours and the levels of luciferase activity were assayed using the Readi-Glo reagent according to manufacturer's instructions (Promega). 20.2 Results

The OPRSl RNAi significantly decreased gamma-secretase activity in both neuronal cell lines (Table 5), as detected by reduced luciferase activity in cells co-transfected with RNAi and gamma-secretase substrate-encoding reporter constructs.

TABLE 5

Values were obtained from n = 3 transfections. Statistical significance of mean gamma- secretase levels were determined by unpaired Student's T test (** = p < 0.005, *** = p < 0.0005).

These data indicate that RNAi targeting OPRSl expression is useful for reducing gamma secretase activity in TDP-43 proteinopathies such as AD.

EXAMPLE 21 Use of OPRSl ligands to modify gamma-secretase activity

This example demonstrates the efficacy of OPRSl modulatory compounds comprising small molecule OPRSl ligands in reducing gamma secretase activity in neural cells. Accordingly, this example provides further support for the use of OPRSl modulators e.g., nucleic acid such as RNAi, siRNA or miRNA in the treatment and/or prevention of a TDP-43 proteinopathy, especially by reducing amyloidogenesis involving gamma secretase-catalyzed cleavage of β-amyloid protein e.g., in AD or FTLD.

21.1 Methods

SK-N-MC and SK-N-SH cells were plated onto 96 well plates at a density of 3 X 10⁴ cells /well and transfected with 0.1 mg of both the C99-GVP and MHlOO reporter constructs as described in Karlstrom et al. Journal of Biological Chemistry, 277: 6763- 6766 2002, using Lipofectamine reagent according to manufacturer's instructions. After 24 hours, serial dilutions of two OPRSl ligands, AC915 (N-(2-(3,4- dichlorophenyl)acetoxy)-ethylpyrrolidine (specific OPRSl antagonist)), and opipramol (specific OPRSl agonist) were added to the cells. The cells were lysed after a further 24 hours and the levels of luciferase activity was assayed using the Readi-Glo reagent according to manufacturer's instructions (Promega).

21.2 Results

Both opipramol and AC915 had similar effects on gamma-secretase activity as untreated cells over three order of magnitude dilutions of each ligand, ie both had a negligible effect on gamma-secretase activity (Table 6 and Figure 18 a&b).

TABLE 6

These data suggest utility for OPRSl agonists and/or antagonists in reducing amyloidogenesis in neural cells. In the therapy of TDP-43 proteinopathy generally, use of an OPRSl antagonist is preferred, because of the beneficial reduction in cytoplasmic accumulation of TDP-43 protein and inclusion bodies achieved using such compounds, in addition to their efficacy in reducing gamma secretase activity. EXAMPLE 22

Investigation of the effect ofmicroRNAs upon OPRSl expression This example supplements Example 18 hereof in demonstrating the efficacy of OPRSl modulatory compounds comprising nucleic acid inhibitors to reduce OPRSl gene expression in neural cells. Accordingly, this example provides support for the use of OPRSl modulators e.g., miRNA in the treatment and/or prevention of a TDP-43 proteinopathy e.g., a neurodegenerative disease such as ALS, AD or pre-senile dementia or advanced dementia.

22.1 Methods

SK-N-MC cells were co-transfected with cDNA constructs encoding either wild-type or the 672*47 'A or 672*51T mutations in the OPRSl 3'UTR cloned downstream of a luciferase reporter gene, plus an miRNA mimic, inhibitor or negative control (Applied Biosystems). The relative levels of luciferase activity in cell lysates were determined by measuring chemiluminescence with an established laboratory assay using the Dual- Luciferase Assay system (Promega) in the FluoStar Optima plate reader (BMG Labtech).

22.2 Results MicroRNAs (miRNAs) are small, non-coding regulatory RNAs that recognise the 3' untranslated region (3'UTR) of specific messenger RNA (mRNA) populations through complementary base-pairing that appear to function in translational processing, inhibition and termination, thus regulating gene expression. Using multiple search engines for candidate miRNA-binding sites (microRNA.org, miRBase Target Database, RegRNA) revealed that OPRSl 3'UTR mutations 672*47G>A and 672*51G>T fall within predicted binding sites for a cluster of miRNAs. The miRanda miRNA target detection software was used to calculate free energy of the binding for miRNAs in wild-type and mutant OPRSl 3'UTR (Table 7). Hsa-miR-147b has a large predicted free energy of binding (>20 kcal/mol) and introduction of the 672*51G>T mutation is predicted to reduce this binding. Addition of 16 nM microRNA led to reduced expression in neural cells from constructs containing OPRSl 3'UTR but no reduction in expression from a construct lacking this sequence. The reduction in expression was 1.4-fold smaller in a mutant (672*5 IT) construct than in wild type. These data indicate that the 672*51G>T act by reducing microRNA binding to OPRSl 3'UTR, consistent with our in silico analyses of the 3'UTR sequence (Table 7).

TABLE 7

Predicted free energy of miRNA - OPRSl 3'UTR binding (kcal/mol)* miRNA Wild type 672*47G>A 672*51G>T hsa-miR-346 -31.94 -32.69 -31.94 hsa-miR-147b -23.91 -23.91 (below threshold) hsa-miR-190 -16.76 -16.28 -14.50 hsa-miR-190b -16.76 -16.28 -14.55

* Example miRNAs identified from microRNA.org website

EXAMPLE 23 miRNAs that modulate OPRSl expression

This example supplements Example 22 hereof in demonstrating the efficacy of OPRSl modulatory compounds comprising nucleic acid inhibitors to reduce OPRSl gene expression in neural cells. Accordingly, this example provides support for the use of OPRSl modulators e.g., miRNA in the treatment and/or prevention of a TDP-43 proteinopathy e.g., a neurodegenerative disease such as ALS, AD or pre-senile dementia or advanced dementia.

23.1 Methods 23.1.1 Microarray analysis of miRNA expression

OPRSl shows an age-dependent increase in expression (Example 14). miRNA expression is compared in cell lines from patients of known ages to investigate whether this age-dependent increase is due to changing levels of selected miRNAs. RNA is extracted from lymphoblastoid cell lines and characterized for sample integrity using the Agilent 2100 Bioanalyser. RNA is then labelled with Cyanine 3-pCp and hybridised to the Agilent miRNA Microarray chip, which contains probes for all human miRNAs in the Sanger miRBASE database. Sixteen cell lines of differing ages and OPRSl expression levels are analysed, to ensure statistically relevant data. miRNA expression data are analysed with GeneSpring GX software. Correlation analyses and/or TaqMan miRNA-specific quantitative RT-PCR are performed to determine the miRNA(s) that predict expression of OPRSl mRNA species correlated to neurodegeneration and recovery or amelioration of symptom(s) indicative of neurodegeneration.

23.2 Validation of miRNA effects on OPRSl expression miRNAs that show a significant age-dependent difference in expression (see section 23.1 hereof) are individually tested for a direct effect on OPRSl expression by luciferase reporter assays, as described in Example 22. The existence of a negative feedback circuit between OPRSl and its regulatory miRNA(s) is tested by transfection of SK-N-MC and SK-N-SH cells with empty vector or OPRSl constructs and comparison of the levels of the regulatory rm^'RNA(s) by quantitative RT-PCR, as described herein above.

EXAMPLE 24 Modulation q/OPRSl activity in animal model ofTDP-43proteinopathy

This example provides methods for demonstrating efficacy of OPRSl modulatory compounds in therapy of neuropathology in one or more animal models of a TDP -43 proteinopathy e.g., a neurodegenerative disease such as ALS, FTLD, AD or pre-senile dementia or advanced dementia.

24.1 Methods

Transgenic mice carrying AD gene mutations are known to be important in the elucidation of biochemical pathways leading to the cognitive and neuropathological features of AD, FTLD and ALS. Examples 14 and 15 indicate that the mutation identified in FTLD/MND family EOAD 14 leads to OPRSl upregulation, and that OPRSl expression is necessary for γ-secretase cleavage of APP (Example 20). A mouse model of increased expression of OPRSl having a role in a general pathogenic pathway of neurodegeneration is described.

24.1 Mouse Strains Mouse models that mimic either AD, FTLD or ALS are selected.

For example, the J20 AD mouse model is available from Prof Lennart Mucke (University of California). The J20 mouse is transgenic for human APP with the mutations KM670 671NL and V717F, under control of the neuronal-specific PDGF β chain promoter. J20 brains show a decrease in the density of SYN-IR presynaptic terminals and amyloid plaque formation, with all mice developing plaques by age 8-10 months (Mucke L et al. J Neurosci 20:4050-8, 2000). Six-month-old J20 mice show significant deficits in the reference-memory version of the Morris water maze (R- MWM) (Maier M et al. J Neurosci 26:4717-28, 2006).

In another example, a pR5-183 FTLD mouse model is available from Prof Jurgen Gotz. This mouse is transgenic for human 4-repeat MAPT with the mutation P301L, under control of the neuron-specific mThyl.2 promoter. Six-month-old pR5-183 mice show significantly accelerated extinction of memory in the conditioned taste aversion (CTA) test and deficits in the R-MWM (Pennanen L et al. Neurobiol Dis 15:500-9, 2004; Pennanen L et al. Genes Brain Behav 5:369-79, 2006). pR5-183 brains show accumulated, hyperphosphorylated tau that forms abnormal filaments and is accompanied by astrocytosis and neuronal apoptosis, and neurofibrillary tangles (Gotz J et al. J Biol Chem 276:529-34, 2001).

In other examples, a progranulin knockout mouse (Kayasuga Y et al. Behav Brain Res 185:110-8, 2007) and a transgenic mouse model expressing a mutant form of superoxide dismutase 1 (glycine93Alanine) are available (Gurney ME et al. Science 264:1772, 1994) and are included in this study.

Transgenic mice carrying mutations in the OPRSl gene are prepared according to standard molecular biology techniques and are analysed as described below.

24.2 Treatment Period

Mouse models are treated for two months from six months of age in accordance with published procedures for mouse models of AD (Cherny RA et al. Neuron 30:665-76, 2001).

In one example, mice are fed with standard laboratory chow, or chow supplemented with the OPRSl receptor agonist, opipramol, at a dosage adjusted to average food intake to give 20 mg/kg/day).

In another example, mice are fed with standard laboratory chow, or chow supplemented with haloperidol at a dosage adjusted to average food intake to give 20 mg/kg/day).

In another example, mice are fed with standard laboratory chow, or chow supplemented with the OPRSl receptor antagonist, BMY 14802, at a dosage of 40 mg/kg/day.

Opripramol, haloperidol and BMY 14802 have established bioavailability following oral administration, are able to cross the blood-brain barrier and are commercially- available. .

In another example, mice are injected with siRNA(s) targeting expression of at least one OPRSl mRNA variant.

24.3 Behavioral characterization of drug-treated mice

After drug treatment is completed, their effect(s) on behavior is(are) examined. In one example, general health of the animals is determined for control and treatment groups after drug treatment is completed. In another example, neurological reflexes of the control and treatment groups are determined after drug treatment is completed, hi another example, sensory capacities of the control and treatment groups are determined after drug treatment is completed. Method for determining neurological reflex and sensory capacity are described e.g., by Karl T et al. Proc Natl Acad Sci U S A 101 :12742-7, 2004; Karl T et al. Behav Brain Res 171 :286-94, 2006; and Karl T et al Exp Toxicol Pathol 55:69-83, 2003. In another example, motor function of the control and treatment groups is determined after drug treatment is completed. In another example, co-ordination of the control and treatment groups is determined after drug treatment is completed. Exemplary tests for coordination and motor function include a pole test, beam walking, rotarod/accelerod test, footprint pattern, grid walking, and a learning/memory test such as the CTA or R-MWM test.

24.4 Neuropathology of drug-treated mice.

Each mouse brain is analysed for age-related neuropathological markers including senile plaque density, neuronal loss, and Tau phosphorylation and aggregation. Each time-point analysis consists of 10 mice per genotype and treatment group to ensure statistically relevant data. Brains are removed and divided into right and left hemispheres. The right hemisphere is frozen at -80⁰C for future biochemical analysis and the left hemisphere is fixed and cryoprotected for histological analysis. Immunohistochemical stainings is performed on 4-μm paraffin sections from 3 sections each from frontal cortex and dentate gyrus. The images are transferred to NIH Image and mean pixel intensity determined for each anatomical region (frontal cortex, and inner, middle, and outer molecular layer of dentate gyrus) and adjusted for background. Neuropathological changes are assessed by ANOVA of model/drug treatment.

24.5 Analysis of Tau and amyloid pathology

The AT8 antibody (Innogenetics Inc) is used to detect Tau phosphorylated at Ser-202 and Thr-205, and neurofibrillary tangles are detected by Gallyas silver staining. To detect amyloid plaques, the mouse monoclonal anti-Ab peptide 1-16 antibody (Athena Neuroscience) is used. Brain regions are homogenized and PBS, 1% Triton X-100 and 5 M guanidine HCl fractions are extracted to detect soluble, membrane-associated and plaque-associated APP products, respectively. Protein concentrations are determined and full length APP and cleaved products assessed by western blotting and ELISA. 24.6 Analysis of gliosis, neuronal loss and synaptic integrity

In one example, astrocytosis is detected using a glial fibrillary acidic protein antibody (DAKO). In another example, apoptosis is measured by TUNEL staining using the peroxidase in situ cell death detection kit (Roche). In another example, the density of SYN-IR presynaptic terminals is examined by confocal microscopy of vibratome sections using anti-synaptophysin antibody (Boehringer Mannheim).

EXAMPLE 25

Use of OPRSl 3 'UTR Repeat Length and other OPRSl polymorphisms as basis for pharmacogenomic response to OPRSl ligands.

Polymorphisms in OPRSl gene associated with disease risk and altered gene function or expression are used to determine the pharmacogenomic response to OPRSl ligands. Patients with mutations or functional haplotypes associated with increased expression of OPRSl are treated with OPRSl antagonist and vice versa for patients with predicted pathological decrease in OPRSl expression.

Functional polymorphisms within OPRSl are used to determine whether they can be used to predict endogenous OPRSl samples from a cohort of normal brain tissue by regression analyses. These functional polymorphisms are also be tested for association with altered risk to neurodenegerative disorders.

Claims

WE CLAIM:

1. A method of treatment of a TDP-43 proteinopathy comprising administering to a subject an amount of a composition comprising a modulator of OPRSl activity and/or level and/or expression for a time and under conditions sufficient to reduce, inhibit, prevent or delay cytoplasmic sequestration and/or cytoplasmic accumulation of TDP-43 protein in neuroglia and/or neuronal cells, thereby treating the TDP-43 proteinopathy in the subject.

2. The method of claim 1 , wherein the TDP-43 proteinopathy is incipient.

3. The method of claim 1, wherein the TDP-43 proteinopathy is progressive.

4. A method of preventing a TDP-43 proteinopathy in a subject at risk thereof, said method comprising administering an amount of a composition comprising a modulator of OPRSl activity and/or level and/or expression for a time and under conditions sufficient to inhibit, prevent or delay cytoplasmic sequestration of TDP-43 protein in neuroglia and/or neuronal cells and/or to inhibit, prevent or delay an increase in level of TDP-43 protein in cytoplasmic inclusion bodies of neuroglia and/or neuronal cells, thereby preventing the TDP-43 proteinopathy in the subject.

5. The method of claim 4, wherein the subject is at risk of developing a progressive TDP-43 proteinopathy.

6. The method according to any one of claims 1 to 5, wherein the composition comprises a modulator of OPRSl activity that reduces activity of at least one isoform of OPRSl in neuroglia and/or neuronal cells.

7. The method according to claim 6, wherein the modulator of OPRSl activity comprises an inverse agonist of OPRSl activity.

8. The method according to claim 6, wherein the modulator of OPRSl activity comprises an antagonist of OPRSl activity.

9. The method according to claim 7 or 8, wherein the inverse agonist or antagonist is a small molecule.

10. The method according to claim 9, wherein the small molecule is selected from 9-[3-(cώ-3,5-dimethyl- 1 -piperazinyl)propyl]carbazole (rimcazole), N-[2-(3,4- Dichlorophenyl)ethyl]-N-methyl-2-(dimethylamino)ethylamine (BD-1047), l-[2-(3,4- Dichlorophenyl)ethyl]-4-methylpiperazine (BD-1063), (4-Fluorophenyl)-4-(5-fluoro-2- pyrimidinyl)- 1 -piperazinebutanol (BMY- 14802), (N,N-dipropyl-2-[4-methoxy-3-(2- phenylethoxy)phenyl]-ethylamine (ΝE-100), N-(2-(3,4-dichlorophenyl)acetoxy)- ethylpyrrolidine (AC915), 4-[4-(4-chlorophenyl)-4-hydroxypiperidino]-4^t- fluorobutyrophenone (haloperidol), combinations thereof, and salts, solvates, hydrates, analogs and derivatives having inverse agonist or antagonist activity toward OPRS 1.

11. The method according to claim 9, wherein the small molecule is selected from AC915 and haloperidol, a combination thereof, and salts, solvates, hydrates, analogs and derivatives having inverse agonist or antagonist activity toward OPRSl .

12. The method according to claim 9, wherein the small molecule is haloperidol decanoate or a salt, solvate or hydrate thereof.

13. The method according to any one of claims 1 to 5, wherein the composition comprises a modulator of OPRS 1 expression that reduces the expression of at least one

OPRSl mRΝA variant in neuroglia and/or neuronal cells.

14. The method according to claim 13, wherein the modulator of OPRSl expression comprises siRΝA, RΝAi or miRΝA.

15. The method according to claim 14, wherein the siRNA, RNAi or miRNA comprises a sequence complementary to a region spanning about 21 to 23 contiguous base pairs of a 3 '-untranslated region (3'-UTR) of mRNA encoding at least one OPRSl mRNA variant in neuroglia and/or neuronal cells, thereby reducing the expression of OPRSl in said neuroglia and/or neuronal cells.

16. The method according to any one of claims 1 to 15, comprising disrupting or perforating the blood-brain barrier to thereby permit the composition to cross the blood brain barrier and then administering the composition.

17. The method according to any one of claims 1 to 15, comprising oral administration of the composition.

18. The method according to any one of claims 1 to 15, comprising administration of the composition, by injection.

19. The method according to any one of claims 1 to 15, comprising administration of the composition by inhalation.

20. The method according to any one of claims 1 to 19, wherein the TDP-43 proteinopathy is selected from frontotemporal lobar degeneration (FTLD), amyotrophic lateral sclerosis (ALS), motor neurone disease (MND), Parkinson's disease (PD), Guam parkinsonism-dementia, and a Lewy body-related disease.

21. The method according to claim 20, wherein the TDP-43 proteinopathy is FTLD.

22. The method according to claim 20, wherein the TDP-43 proteinopathy is MND.

23. The method according to claim 20, wherein the Lewy body-related disease is Alzheimer's disease (AD).

24. The method according to claim 20, wherein the TDP-43 proteinopathy is a Lewy body-related disease and wherein said method further comprises administering the composition for a time and under conditions sufficient to reduce gamma-secretase activity in neuroglia and/or neuronal cells, thereby reducing the formation and/or level of amyloid deposits in Lewy Bodies of neuronal cells and/or neuroglia.

25. The method according to claim 20, wherein the TDP-43 proteinopathy is a Lewy body-related disease and wherein said method further comprises administering the composition for a time and under conditions sufficient to reduce Lewy Body formation or level in Lewy Bodies of neuronal cells and/or neuroglia .

26. The method according to any one of claims 1 to 25 further comprising determining a level of TDP-43 protein in the cytoplasm of neuroglia and/or neuronal cells of the subject wherein a reduced level thereof indicates effective therapy or prevention of the TDP-43 proteinopathy.

27. A method of reducing, inhibiting, preventing or delaying cytoplasmic sequestration and/or cytoplasmic accumulation of TDP-43 protein in a neuronal cell having cytoplasmic TDP-43 level indicative of a TDP-43 proteinopathy, said method comprising administering to the neuronal cell an amount of a composition comprising a modulator of OPRSl activity and/or level and/or expression for a time and under conditions sufficient to reduce activity of at least one isoform of OPRSl or reduce expression of at least one OPRSl mRNA variant in the neuronal cells.

28. The method according to claim 27, further comprising determining a level of

TDP-43 protein in the cytoplasm of the neuronal cell wherein a reduced level of cytoplasmic TDP-43 in the neuronal cell following administration of the modulator compared to a level of cytoplasmic TDP-43 indicative of a TDP-43 proteinopathy indicates that the modulator has reduced, inhibited, prevented or delayed sequestration and/or cytoplasmic accumulation of TDP-43 protein in the neuronal cell.

29. The method according to claim 27 or 28, wherein the composition comprises a modulator of OPRSl activity that reduces activity of at least one isoform of OPRSl in the neuronal cell.

30. The method according to claim 29, wherein the modulator of OPRSl activity comprises an inverse agonist of OPRS 1 activity.

31. The method according to claim 29, wherein the modulator of OPRSl activity comprises an antagonist of OPRSl. activity.

32. The method according to claim 30 or 31, wherein the inverse agonist or antagonist is a small molecule.

33. The method according to claim 32, wherein the small molecule is selected from 9-[3-(cJ5-3,5-dimethyl-l-piperazinyl)propyl]carbazole (rimcazole), N-[2-(3,4- Dichlorophenyl)ethyl]-N-methyl-2-(dimethylamino)ethylamine (BD- 1047), l-[2-(3,4- Dichlorophenyl)ethyl]-4-methylpiperazine (BD-1063), (4-Fluorophenyl)-4-(5-fluoro-2- pyrimidinyl)- 1 -piperazinebutanol (BMY- 14802), (N,N-dipropyl-2-[4-methoxy-3 -(2- phenylethoxy)phenyl]-ethylamine (NE- 100), 7V-(2-(3 ,4-dichlorophenyl)acetoxy)- ethylpyrrolidine (AC915), 4-[4-(4-chlorophenyl)-4-hydroxypiperidino]-4'- fluorobutyrophenone (haloperidol), combinations thereof, and salts, solvates, hydrates, analogs and derivatives having inverse agonist or antagonist activity toward OPRSl.

34. The method according to claim 32, wherein the small molecule is selected from AC915 and haloperidol, a combination thereof, and salts, solvates, hydrates, analogs and derivatives having inverse agonist or antagonist activity toward OPRSl .

35. The method according to claim 32, wherein the small molecule is haloperidol decanoate or a salt, solvate or hydrate thereof.

36. The method according to claim 27 or 28, wherein the composition comprises a modulator of OPRSl expression that reduces the expression of at least one OPRSl mRNA variant in the neuronal cell.

37. The method according to claim 36, wherein the modulator of OPRSl expression comprises siRNA, RNAi or miRNA.

38. The method according to claim 37, wherein the siRNA, RNAi or miRNA comprises a sequence complementary to a region spanning about 21 to 23 contiguous base pairs of a 3 '-untranslated region (3'-UTR) of mRNA encoding at least one OPRSl mRNA variant in the neuronal cell, thereby reducing the expression of OPRS 1 in said neuronal cell.

39. The method according to any one of claims 27 to 38, wherein said method further comprises administering the composition for a time and under conditions sufficient to reduce gamma-secretase activity in the neuronal cell, thereby reducing the formation and/or level of amyloid deposits in Lewy Bodies of the neuronal cell.

40. The method according to any one of claims 27 to 39, wherein said method further comprises administering the composition for a time and under conditions sufficient to reduce Lewy Body formation or level in Lewy Bodies of the neuronal cell.

41. Use of a modulator of OPRSl activity and/or level and/or expression in the preparation of a medicament for the treatment or prevention of a TDP-43 proteinopathy in a subject.

42. Use of a modulator of OPRSl activity and/or level and/or expression in the preparation of a composition for reducing, inhibiting, preventing or delaying cytoplasmic sequestration and/or cytoplasmic accumulation of TDP-43 protein in a neuronal cell having cytoplasmic TDP-43 level indicative of a TDP-43 proteinopathy.

43. The use according to claim 41 or 42, wherein the modulator reduces activity of at least one isoform of OPRSl in neuroglia and/or neuronal cells.

44. The use according to claim 43, wherein the modulator comprises an inverse agonist of OPRSl activity.

45. The use according to claim 43, wherein the modulator comprises an antagonist of OPRSl activity.

46. The use according to claim 44 or 45, wherein the inverse agonist or antagonist is a small molecule.

47. The use according to claim 46, wherein the small molecule is selected from 9- [3 -(cis-3 ,5-dimethyl- 1 -piperazinyl)propyl] carbazole (rimcazole), N-[2-(3 ,4- Dichlorophenyl)ethyl]-N-methyl-2-(dimethylamino)ethylamine (BD-1047), l-[2-(3,4- Dichlorophenyl)ethyl]-4-methylpiperazine (BD-1063), (4-Fluorophenyl)-4-(5-fluoro-2- pyrimidinyl)-l-piperazinebutanol (BMY- 14802), (N,N-dipropyl-2-[4-methoxy-3-(2- phenylethoxy)ρhenyl]-ethylamine (ΝE-100), N-(2-(3,4-dichlorophenyl)acetoxy)- ethylpyrrolidine (AC915), 4-[4-(4-chlorophenyl)-4-hydroxypiperidino]-4'- fluorobutyrophenone (haloperidol), combinations thereof, and salts, solvates, hydrates, analogs and derivatives having inverse agonist or antagonist activity toward OPRSl.

48. The use according to claim 46, wherein the small molecule is selected from AC915 and haloperidol, a combination thereof, and salts, solvates, hydrates, analogs and derivatives having inverse agonist or antagonist activity toward OPRSl .

49. The use according to claim 46, wherein the small molecule is haloperidol decanoate or a salt, solvate or hydrate thereof.

50. The use according to claim 41 or 42, wherein the modulator reduces the expression of at least one OPRSl mRNA variant in neuroglia and/or neuronal cells.

51. The use according to claim 50, wherein the modulator comprises siRNA, RNAi or miRNA.

52. The use according to claim 51, wherein the siRNA, RNAi or miRNA comprises a sequence complementary to a region spanning about 21 to 23 contiguous base pairs of a 3 '-untranslated region (3'-UTR) of mRNA encoding at least one OPRS 1 mRNA variant in neuroglia and/or neuronal cells, thereby reducing the expression of OPRSl in said neuroglia and/or neuronal cells.

53. The use according to claim 41, wherein the medicament is formulated for oral administration to a subject.

54. The use according to claim 41, wherein the medicament is formulated for administration to a subject by injection.

55. The use according to claim 41, wherein the medicament is formulated for administration to a subject by inhalation.

56. The use according to claim 41, wherein the TDP -43 proteinopathy is selected from frontotemporal lobar degeneration (FTLD), amyotrophic lateral sclerosis (ALS), motor neurone disease (MND), Parkinson's disease (PD), Guam parkinsonism- dementia, and a Lewy body-related disease.

57. The use according to claim 41 , wherein the TDP-43 proteinopathy is FTLD.

58. The use according to claim 41 , wherein the TDP-43 proteinopathy is MND.

59. The use according to claim 56, wherein the Lewy body-related disease is Alzheimer's disease (AD).

60. The use according to claim 41, wherein the medicament is additionally for reducing the formation and/or level of amyloid deposits in Lewy Bodies in neuronal cells and/or neuroglia of the subject.

61. The use according to claim 41, wherein the medicament is additionally for reducing gamma secretase activity in neuronal cells and/or neuroglia of the subject.

62. An isolated modulator of OPRSl activity and/or level and/or expression or a pharmaceutical composition comprising said modulator for use in a method to treat or prevent a TDP-43 proteinopathy in a subject.

63. An isolated modulator of OPRSl activity and/or level and/or expression for use in reducing, inhibiting, preventing or delaying cytoplasmic sequestration and/or cytoplasmic accumulation of TDP-43 protein in a neuronal cell having cytoplasmic TDP-43 level indicative of a TDP-43 proteinopathy.

64. The isolated modulator or pharmaceutical composition for use according to claim 62 or 63, wherein the modulator reduces activity of at least one isoform of OPRSl in neuroglia and/or neuronal cells.

65 . The isolated modulator or pharmaceutical composition for use according to claim 64, wherein the modulator comprises an inverse agonist of OPRSl activity.

66. The isolated modulator or pharmaceutical composition for use according to claim 64, wherein the modulator comprises an antagonist of OPRSl activity.

67. The isolated modulator or pharmaceutical composition for use according to claim 65 or 66, wherein the inverse agonist or antagonist is a small molecule.

68. The isolated modulator or pharmaceutical composition for use according to claim 67, wherein the small molecule is selected from 9-[3-(czs-3,5-dimethyl-l- piperazinyl)propyl] carbazole (rimcazole), N- [2-(3 ,4-Dichlorophenyl)ethyl] -N-methyl- 2-(dimethylamino)ethylamine (BD-1047), l-[2-(3,4-Dichlorophenyl)ethyl]-4- methylpiperazine (BD- 1063), (4-Fluorophenyl)-4-(5-fluoro-2-pyrimidinyl)- 1 - piperazinebutanol (BMY-14802), (N,JV-dipropyl-2-[4-methoxy-3-(2- phenylethoxy)phenyl] -ethylamine (NE-100), JV-(2-(3 ,4-dichlorophenyl)acetoxy)- ethylpyrrolidine (AC915), 4-[4-(4-chlorophenyl)-4-hydroxypiperidino]-4'- fluorobutyrophenone (haloperidol), combinations thereof, and salts, solvates, hydrates, analogs and derivatives having inverse agonist or antagonist activity toward OPRSl .

69. The isolated modulator or pharmaceutical composition for use according to claim 67, wherein the small molecule is selected from AC915 and haloperidol, a combination thereof, and salts, solvates, hydrates, analogs and derivatives having inverse agonist or antagonist activity toward OPRSl.

70. The isolated modulator or pharmaceutical composition for use according to claim 67, wherein the small molecule is haloperidol decanoate or a salt, solvate or hydrate thereof.

71. The isolated modulator or pharmaceutical composition for use according to claim 62 or 63, wherein the modulator reduces the expression of at least one OPRSl mRNA variant in neuroglia and/or neuronal cells.

72. The isolated modulator or pharmaceutical composition for use according to claim 71, wherein the modulator comprises siRNA, RNAi or miRNA.

73. The isolated modulator or pharmaceutical composition for use according to claim 72, wherein the siRNA, RNAi or miRNA comprises a sequence complementary to a region spanning about 21 to 23 contiguous base pairs of a 3 '-untranslated region (3'-UTR) of mRNA encoding at least one OPRSl mRNA variant in neuroglia and/or neuronal cells, thereby reducing the expression of OPRSl in said neuroglia and/or neuronal cells.

74. The isolated modulator or pharmaceutical composition for use according to claim 62, wherein the modulator is formulated for oral administration to a subject.

75. The isolated modulator or pharmaceutical composition for use according to claim 62, wherein the modulator is formulated for administration to a subject by injection.

76. The isolated modulator or pharmaceutical composition for use according to claim 62, wherein the modulator is formulated for administration to a subject by inhalation.

77. The isolated modulator or pharmaceutical composition for use according to claim 62, wherein the TDP -43 proteinopathy is selected from frontotemporal lobar degeneration (FTLD), amyotrophic lateral sclerosis (ALS), motor neurone disease (MND), Parkinson's disease (PD), Guam parkinsonism-dementia, and a Lewy body- related disease.

78. The isolated modulator or pharmaceutical composition for use according to claim 62, wherein the TDP-43 proteinopathy is FTLD.

79. The isolated modulator or pharmaceutical composition for use according to claim 62, wherein the TDP-43 proteinopathy is MND.

80. The isolated modulator or pharmaceutical composition for use according to claim 62, wherein the Lewy body-related disease is Alzheimer's disease (AD).

81. A method of identifying a compound for the treatment or prophylaxis of a TDP-43 proteinopathy, said method comprising selecting a modulator that inhibits and/or reduces OPRSl activity and/or level and/or expression wherein said modulator additionally reduces sequestration and/or accumulation of TDP-43 in the cytoplasm of the neuroglia and/or neuronal cells, thereby identifying a compound for the treatment or prophylaxis of a TDP-43 proteinopathy.

82. The method according to claim 81, further comprising determining sequestration and/or accumulation of TDP-43 in the cytoplasm of the neuroglia and/or neuronal cells in the presence and absence of the modulator.

83. The method according to claim 81 or 82 further comprising providing the modulator to the neuroglia and/or neuronal cells.

84. The method according to any one of claims 81 to 83, further comprising obtaining the modulator.

85. A process for isolating a composition for the treatment or prophylaxis of a TDP-43 proteinopathy, said process comprising performing the method according to any one of claims 81 to 84 and isolating the identified modulator from a library of compounds.

86. A process for producing a composition for the treatment or prophylaxis of a TDP-43 proteinopathy, said process comprising performing the method according to any one of claims 81 to 84 and synthesizing the identified modulator.

87. A process for producing a composition for the treatment or prophylaxis of a TDP-43 proteinopathy, said process comprising performing the method according to any one of claims 81 to 84 and formulating the identified modulator for administration to a subject suffering from a TDP-43 proteinopathy or at risk of suffering from a TDP- 43 proteinopathy.

88. A composition for the treatment or prophylaxis of a TDP-43 proteinopathy wherein said composition comprises a modulator isolated by the process according to claim 85.