WO2010014905A2 - Polymorphisms associated with inflammatory bowel disease - Google Patents

Polymorphisms associated with inflammatory bowel disease Download PDF

Info

Publication number
WO2010014905A2
WO2010014905A2 PCT/US2009/052412 US2009052412W WO2010014905A2 WO 2010014905 A2 WO2010014905 A2 WO 2010014905A2 US 2009052412 W US2009052412 W US 2009052412W WO 2010014905 A2 WO2010014905 A2 WO 2010014905A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
xbpl
inflammatory bowel
bowel disease
postion
Prior art date
Application number
PCT/US2009/052412
Other languages
French (fr)
Other versions
WO2010014905A3 (en
Inventor
Laurie H. Glimcher
Richard S. Blumberg
Original Assignee
President And Fellows Of Harvard College
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by President And Fellows Of Harvard College filed Critical President And Fellows Of Harvard College
Publication of WO2010014905A2 publication Critical patent/WO2010014905A2/en
Publication of WO2010014905A3 publication Critical patent/WO2010014905A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes

Definitions

  • IEC intestinal epithelial cells
  • a subset of CD is genetically linked to mutations in the intracellular pattern recognition receptor NOD2/CARD15 (Ogura,Y. et al. Nature 411, 603-606 (2001); HugotJ.P. et al.
  • mice Nod2 deficient mice also do not develop spontaneous or induced intestinal inflammation (Kobayashi, K.S. et al. Science 307, 731-734 (2005)).
  • Polymorphisms in genes or regulatory regions of genes have been correlated with the development of, or susceptibility, to diseases or other conditions.
  • the genetic risk factors associated with the development of inflammatory bowel disease (IBD) is very important. The identification of genetic polymorphisms that are tightly liked with IBD are desirable and will aid in the diagnosis or prognosis of the disease.
  • IBD inflammatory bowel disease
  • the present invention is based, at least in part, on the discovery that certain known SNPs located in the XBP-I genomic region at human chromosome 22q are significantly associated with IBD. Furthermore, several novel SNPs have been discovered in the XBP-I gene of individuals suffering from IBD. Such SNPs are useful for determining the predisposition of a human subject to develop inflammatory bowel disease.
  • the present invention provides methods to determine the predisposition of a human subject to develop inflammatory bowel disease.
  • the invention is directed to a method method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting in a nucleic acid sample from the subject at least one single nucleotide polymorphism (SNP) in intron 4 of XBP-I, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
  • SNP single nucleotide polymorphism
  • the SNP is at position 31 of SEQ ID NO: 170 (i.e., SNP rs35873774), wherein a T at position 31 of SEQ ID NO: 170 indicates that the subject has an increased risk of developing inflammatory bowel disease, and wherein a C at position 31 of SEQ ID NO: 170 indicates that the subject has an decreased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
  • SEQ ID NO: 170 i.e., SNP rs35873774
  • the SNP is at position 31 of SEQ ID NO: 169 (i.e., SNP rs2097461), wherein a T at position 31 of SEQ ID NO: 169 indicates that the subject has an increased risk of developing inflammatory bowel disease, and wherein a A at position 31 of SEQ ID NO: 169 indicates that the subject has an decreased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
  • the invention is directed to a method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting in a nucleic acid sample from the subject at least one single nucleotide polymorphism (SNP) at position 48 of a nucleic acid sequence selected from the group consisting of SEQ ID NO: 114, 15, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, and 165, thereby determining the predisposition of a human subject to develop inflammatory bowel disease, the
  • the invention is directed to a method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting in a nucleic acid sample from the subject at least one single nucleotide polymorphism (SNP) at position 31 of a nucleic acid sequence selected from the group consisting of SEQ ID NO: 166, 167, 168, 169, and 171, wherein a C at position 31 of SEQ ID NO: 166, C at position 31 of SEQ ID NO: 167, C at position 31 of SEQ ID NO: 168, T at position 31 of SEQ ID NO: 169, and T at position 31 of SEQ ID NO: 171 indicate that the subject has an increased risk of developing inflammatory bowel disease, and wherein a wherein a T at position 31 of SEQ ID NO: 166, A at position 31 of SEQ ID NO: 167, A at position 31 of SEQ ID NO: 168, A at position 31 of SEQ ID NO: 169, and G at position
  • the invention is directed to a method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting in a nucleic acid sample from the subject a single nucleotide polymorphism (SNP), at position 31 of SEQ ID NO: 170, wherein a T at position 31 of SEQ ID NO: 170 indicates that the subject has an increased risk of developing inflammatory bowel disease, and wherein a C at position 31 of SEQ ID NO: 170 indicates that the subject has an decreased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
  • SNP single nucleotide polymorphism
  • the invention is directed to a method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting the single nucleotide polymorphisms (SNP) at position 31 of SEQ ID NO: 166, 168, 170, 172, 173, 174, and 175,wherein a T at postion 31 of SEQ ID NO: 166, a C at postion 31 of SEQ ID NO: 168, a C at postion 31 of SEQ ID NO: 170, a T at postion 31 of SEQ ID NO: 172, a G at postion 31 of SEQ ID NO: 173, a T at postion 31 of SEQ ID NO: 174, and a C at postion 31 of SEQ ID NO: 175 indicates that said subject has an increased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
  • SNP single nucleotide polymorphisms
  • the invention is directed to a method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting the single nucleotide polymorphisms (SNP) at position 31 of SEQ ID NO: 166, 168, 170, 172, 173, 174, and 175, wherein a T at postion 31 of SEQ ID NO: 166, a A at postion 31 of SEQ ID NO: 168, a T at postion 31 of SEQ ID NO: 170, a T at postion 31 of SEQ ID NO: 172, a G at postion 31 of SEQ ID NO: 173, a T at postion 31 of SEQ ID NO: 174, and a C at postion 31 of SEQ ID NO: 175 indicates that said subject has an decreased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
  • SNP single nucleotide polymorphisms
  • the invention is directed to a method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting the single nucleotide polymorphisms (SNP) at position 31 of SEQ ID NO: 166, 168, 170, 172, 173, 174, and 175, wherein a C at postion 31 of SEQ ID NO: 166, a A at postion 31 of SEQ ID NO: 168, a C at postion 31 of SEQ ID NO: 170, a T at postion 31 of SEQ ID NO: 172, a G at postion 31 of SEQ ID NO: 173, a T at postion 31 of SEQ ID NO: 174, and a T at postion 31 of SEQ ID NO: 175 indicates that said subject has an decreased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
  • SNP single nucleotide polymorphisms
  • the single nucleotide polymorphism is determined by primer extension of at least one PCR product and MALDI-TOF analysis.
  • At least one oligonucleotides primer selected from the group consisting of SEQ ID NO: 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, and 113 is used to detect the SNP.
  • the inflammatory bowel disease is Crohn' s disease or Ulcerative Colitis.
  • the invention is directed to an isolated and purified allele- specific oligonucleotide probe of about 5 to about 50 nucleotides that specifically detects a single nucleotide polymorphisms (SNP) at position 48 of a sequence selected from the group consisting of SEQ ID NO: 114, 15, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, and 165 etc.
  • SNP single nucleotide polymorphisms
  • the invention pertains to a diagnostic kit comprising an oligonucleotide that specifically detects a single nucleotide polymorphisms (SNP) at position 48 of a sequence selected from the group consisting of SEQ ID NO: 114, 15, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, and 165.
  • SNP single nucleotide polymorphisms
  • Figure 1 depicts a general scheme for the gene targeting strategy.
  • A Schematic representation of the gene targeting strategy.
  • a floxed Xbpl allele was generated by homologous recombination in W4/129 embryonic stem (ES) cells.
  • the targeting vector contains a loxP site in intron 3 and a floxed neomycin resistance gene cassette (neo) in intron 2 of the Xbpl gene.
  • neo floxed neomycin resistance gene cassette
  • a targeted ES cell clone identified by Southern blot was injected into C57BL/6 blastocysts to obtain chimeras, which were subsequently bred to establish the Xbpl a ° xaso strain.
  • mice were mated with EIIacre transgenic mice to induce a partial Cre-mediated recombination.
  • Male mice with the greatest deletion of the neo cassette were mated with wild type female mice to obtain an Xbpl ⁇ ox strain.
  • RNAs were isolated from small intestinal mucosal scrapings of untreated (NT) or mice injected with 1 mg/kg tunicamycin and harvested 6 hours later, and analyzed for the expression of XBPl mRNA by Northern blot and RT-PCR followed by DNA sequencing.
  • the mutant XBPl mRNA produced by Xbpl &/A mice is slightly smaller than the wild type XBPl mRNA, due to the deletion of exon 2 as confirmed by DNA sequencing of the cDNA.
  • the IREl splicing site of XBPl mRNA is located downstream of the floxed exon 2 in exon 4, which hence allowed to monitor splicing status in mRNA transcribed from floxed and Cre-deleted XBPl alleles alike. Absence of XBPl protein was confirmed by Western blotting of small intestinal mucosal scraping protein lysates from untreated and tunicamycin-injected mice. C. Deletion of exon 2 in the mutant XBPl mRNA resulted in the change of the translational reading frame, introducing a premature translational termination codon. D.
  • Truncated XBPl protein is not functional as evidenced by its failure to upregulate expression of a prototypical XBPIs target gene, ERdj4 (Dnajb9) upon ER stress induction through tunicamycin injection, as determined by qPCR on small intestinal mucosal scraping specimens.
  • tunicamycin injection led to upregulation of Chop (Ddit3) mRNA expression, transcriptionally regulated by PERK- Atf4 during ER stress, in XBPl flox/flox VCre mice, indicating that other branches of the UPR are intact in the presence of a non-functional, truncated XBPl.
  • Figure 2 depicts spontaneous enteritis and Paneth cell loss in XBPl " ' " mice.
  • A. Small intestinal mucosal scrapings (n 8 per group) from Xbpl -deleted (“XBPl " ' “ ”) and Xbpl -sufficient (“XBP1 +/+ ”) mouse intestinal epithelium were analyzed for cryptdin-1 (Defcrl), cryptdin-4 (Defcr4), cryptdin-5 (Defcr5), lysozyme (Lysz), mucin-2 (Muc2), cathelicidin (Campl), and XBPl (primers binding in the floxed region) mRNA expression.
  • IHC Immunohistochemistry for the granule proteins lysozyme and pro-cryptdin in XBP1 +/+ and XBPl " ' " epithelia.
  • F Goblet cell staining by PAS in XBPl +/+ and XBPl , -/- epithelia.
  • EM exhibited smaller cytoplasmic mucin droplets and a contracted ER in XBPl ,-/- goblet cells. No structural abnormalities were found in neighboring absorptive epithelia in XBPl ' mice.
  • G
  • the marker for enteroendocrine cells was detected by IHC in small intestines of XBP1 +/+ and XBPl ' mice.
  • Figure 3 depicts the result showing that villinCre-mediated XBPl deletion leads to Chop induction, intestinal inflammation, and does not affect colonic goblet cells or small intestinal enteroendocrine cells.
  • mice were administered 5 daily doses of 1 mg tamoxifen to induce deletion of the ⁇ BPl floxneo gene in the intestinal epithelium.
  • XBPl, cryptdin-5 (Defcr5), and Chop mRNA all expressed normalized to ⁇ -actin; left y axis expression in epithelium during and after tamoxifen treatment.
  • the 1 hour time-point labels the pool of proliferating IEC in the crypts (mostly transit amplifying IEC), whereas the 24-hour time -point assesses the migration along the crypt- villus axis indicating the turn-over of the IEC compartment.
  • Figure 6 depicts the result that XBPl deletion leads to the presence of apoptotic cells in the epithelium.
  • Apoptotic nuclei were identified in XBP1 +/+ (XBPl flox/flox ) and XBPl 7 (XBPl flox/flox VCre) sections by TUNEL staining. Arrows point to apoptotic cells.
  • Figure 7 depicts the result that XBPl deficiency in epithelium results in impaired antimicrobial function.
  • Upper panel. Small intestinal crypts isolated from XBP1 +/+ and XBPl 7 animals were stimulated with lO ⁇ M carbamyl choline (CCh). Supernatants were precipitated, resolved on SDS-PAGE and detected by anti-lysozyme IgG. Blots are representative of 2 independent experiments.
  • Figure 8 depicts the result that XBPl deficiency results in increased inflammatory tone of the epithelium.
  • B. Small intestinal formalin-fixed sections were stained with rabbit anti- phospho-JNK antibody, and revealed a patchy staining pattern in XBPl " ' " , but not XBP1 +/+ sections. Control rabbit mAb was negative (not shown). Representative of n 5 per group.
  • MODE-K.iXBP and MODE-K.Control were stimulated for the indicated time periods with flagellin (1 ⁇ g/ml) and TNF ⁇ (50 ng/ml) and analyzed for P-JNK and total JNK by Western.
  • MODE-K.iXBP (filled circles) and MODE-K.Ctrl (open circles) cells were stimulated for 4 hours with flagellin, and supernatants assayed by ELISA for CXCLl.
  • MODE-K.iXBP circles
  • MODE-K.Ctrl diamonds
  • lO ⁇ g/ml flagellin filled symbols
  • media alone open symbols
  • JNK inhibitor SP600125 supernatants assayed for CXCLl.
  • MODE-K cells were stimulated with 50 ng/ml TNF ⁇ (filled symbols) or media alone (open symbols).
  • MODE-K.iXBP filled circles
  • MODE-K.Ctrl open circles
  • ⁇ GC glycolipid antigen ⁇ - galactosylceramide
  • Figure 9 depicts the result that inhibitors of p38 and ERK1/2 phosphorylation do not affect CXCLl secretion in XBPl-silenced MODE-K cells.
  • MODE-K.iXBP (filled symbols) and MODE-K.Ctrl (open symbols) cells were stimulated for 4 hours with 50ng/ml TNF ⁇ in the presence of the indicated optimal concentrations of inhibitors (PD98059, inhibitor of MAP kinase kinase [MEK]; SB203580, p38 kinase inhibitor; U0126, MEK1/MEK2 inhibitor). Supernatants were assayed for CXCLl.
  • Figure 10 depicts the result that XBPl-silenced MODE-K cells are more sensitive to TNF ⁇ induced apoptosis.
  • B Same experiment as in (A) with cells stimulated with 50 ng/ml TNF ⁇ , except for that adherent cells were fixed and stained for cleaved caspase-3 (red) and nuclei (DAPI; blue) by immunofluorescence.
  • Figure 11 depicts the result that XBPl deficiency increases susceptibility to DSS colitis.
  • CD-I Inflamed
  • CD-NI non-inflamed
  • CD-NI non-inflamed
  • XBPl mRNA splicing is expressed as ratio of XBPls/XBPu (right y axis).
  • Figure 12 depicts the result that antibiotic treatment during 7% DSS colitis abrogates genotype-related differences in susceptibility to colitis.
  • Figure 14 depicts the deep sequencing of XBPl. All five exons and 4.3 kb of 5' upstream sequence were resequenced in 282 unaffected controls, 282 Crohn's disease, and 282 ulcerative colitis patients (total of 846 samples); the five XBPl exons were sequenced in 282 additional ulcerative colitis patients resulting in a total of 1128 patient and control DNAs analyzed. Chromosomal location of XBPl and amplicons used for sequencing are shown in the context of XBPIs and XBPIu transcripts. The panel underneath the transcript panel shows the sequence conservation score based on 16 different species (taken from UCSC Genome Browser, Vertebrate Multiz Alignment & Conservation). SNPs are presented in the context of their genomic localization. SNPs of particular interest are highlighted by color-coding as indicated. For further details on deep sequencing see Table 5.
  • Figure 15 depicts the result that rare XBPl variants are hypomorphic.
  • A. MODE- K cells were transfected with UPRE-luciferase and unspliced hXBPlu expression plasmids encoding the rare, IBD-associated minor alleles XBPlsnp8 (M139I) and XBPl snpl 7 (A162P) and treated with 1 ⁇ g/ml Tm. Values represent luciferase activities normalized to cotransfected Renilla reporter.
  • MODE-K cells were transfected with UPRE-luciferase and unspliced hXBPlu expression plasmids harbouring the rare, minor allele of XBPlsnp22 (P 15L), which occurs at equal frequencies in IBD patients and controls (Table 5). Luciferase activity (values presented normalized to cotransfected Renilla activities) was assessed in transfected cells treated with and without 1 ⁇ g/ml tunicamycin.
  • B Experiments as in (A), except that spliced hXBPls cDNA P15L variant was transfected into MODE-K cells (in the absence of tunicamycin treatment).
  • Figure 17 depicts the result that the IEC- specific XBPl deficiency leads to Paneth cell dysfunction and a pro-inflammatory tone of the mucosa.
  • A. Regular function of the IRE1/XBP1 axis. Continuous ER stress due to the high protein burden in IEC (in particular Paneth cells) leads to activation of the UPR and low-level baseline XBPl splicing. XBPIs protein regulates transcription of XBPIs target genes, required for normal IEC and Paneth cell function.
  • B Regular function of the IRE1/XBP1 axis.
  • Continuous ER stress due to the high protein burden in IEC in particular Paneth cells
  • XBPIs protein regulates transcription of XBPIs target genes, required for normal IEC and Paneth cell function.
  • XBPl splicing leads to a decrease in the expression of XBPIs target genes, and hence an inefficient UPR and accumulation of misfolded or unfolded proteins in highly secretory IECs and Paneth cells.
  • the present invention is based, at least in part, on the discovery that certain known SNPs located in the XBP-I genomic region at human chromosome 22q are significantly associated with IBD. Furthermore, several novel SNPs have been discovered in the XBP-I gene of individuals suffering from IBD. Such SNPs are useful for determining the predisposition of a human subject to develop inflammatory bowel disease. Accordingly, the present invention provides methods for detecting at least one SNP in the human XBP-I genomic region as well as methods to determine the predisposition of a human subject to develop inflammatory bowel disease.
  • polymorphism refers to the coexistence of more than one form of a gene, or portion thereof, or a segment of DNA.
  • a polymorphic locus can be a single nucleotide, the identity of which differs in the other alleles.
  • a polymorphic locus can also be more than one nucleotide long.
  • the allelic form occurring most frequently in a selected population is often referred to as the reference and/or wildtype form. Other allelic forms are typically designated or alternative or variant alleles.
  • Diploid organisms may be homozygous or heterozygous for allelic forms.
  • a diallelic or biallelic polymorphism has two forms.
  • a trialleleic polymorphism has three forms.
  • a polymorphism is a single nucleotide polymorphism.
  • single nucleotide polymorphism refers to a polymorphic site occupied by a single nucleotide (and the complementary nucleotide with which it forms a base-pair in a double stranded nucleic acid sequence), which is the site of variation between allelic sequences.
  • a SNP usually arises due to substitution of one nucleotide for another at the polymorphic site.
  • SNPs can also arise from a deletion of a nucleotide or an insertion of a nucleotide relative to a reference allele.
  • the polymorphic site is occupied by a base other than the reference base.
  • the altered allele can contain a "C” (cytidine), “G” (guanine), or "A” (adenine) at the polymorphic site.
  • SNP' s may occur in protein-coding nucleic acid sequences, in which case they may give rise to a defective or otherwise variant protein, or genetic disease. Such a SNP may alter the coding sequence of the gene and therefore specify another amino acid (a "missense” SNP) or a SNP may introduce a stop codon (a "nonsense" SNP). When a SNP does not alter the amino acid sequence of a protein, the SNP is called “silent.” SNP' s may also occur in noncoding regions of the nucleotide sequence. This may result in defective protein expression, e.g., as a result of alternative spicing, or it may have no effect.
  • linkage describes the tendency of genes, alleles, loci or genetic markers to be inherited together as a result of their location on the same chromosome. It can be measured by percent recombination between the two genes, alleles, loci, or genetic markers.
  • linkage disequilibrium also referred to herein as "LD,” refers to a greater than random association between specific alleles at two marker loci within a particular population. In general, linkage disequilibrium decreases with an increase in physical distance. If linkage disequilibrium exists between two markers, or SNPs, then the genotypic information at one marker, or SNP, can be used to make probabilistic predictions about the genotype of the second marker.
  • the term “detect” with respect to polymorphic elements includes various methods of analyzing for a polymorphism at a particular site in the genome.
  • the term “detect” includes both “direct detection,” such as sequencing, and “indirect detection,” using methods such as amplification amd/or hybridization.
  • XBP-I refers to a X-box binding human protein that is a DNA binding protein and has an amino acid sequence as described in, for example, Liou, H-C. et. al. (1990) Science 247:1581-1584 and Yoshimura, T. et al. (1990) EMBO J. 9:2537-2542, and other mammalian homologs thereof, such as described in Kishimoto T. et al., (1996) Biochem. Biophys. Res. Commun. 223:746-751 (rat homologue).
  • Exemplary proteins intended to be encompassed by the term "XBP-I” include those having amino acid sequences disclosed in GenBank with accession numbers A36299 [gi:105867], NP_005071 [gi:4827058], P17861 [gi:139787], CAA39149 [gi:287645], and BAA82600 [gi:5596360] or e.g., encoded by nucleic acid molecules such as those disclosed in GenBank with accession numbers AF027963 [gi: 13752783]; NM_013842 [gi: 13775155]; or M31627 [gi: 184485].
  • XBP-I is also referred to in the art as TREB5 or HTF (Yoshimura et al. 1990. EMBO Journal. 9:2537; Matsuzaki et al. 1995. J. Biochem. 117:303).
  • XBP-I gene refers to the coding sequence of XBP-I found in genomic DNA, as well as the intronic sequences and 5' and 3' untranslated/regulatory regions of the XBP-I gene.
  • an XBP-I gene includes, for example, about 5 kb, about 4 kb, about 3 kb, about 2 kb, about 1 kb of genomic DNA upstream of the XBP-I ATG initiation codon or downstream of the XBP-I termination codon.
  • NOD2-CARD15 refers to the caspase recruitment domain family member 15.
  • nucleotide and amino acid sequence of NOD2- CARD15 can be found in, for example, GenBank Accession No.: gi:11545911, the contents of which are incorporated by reference.
  • polymorphisms associated with susceptibility to inflammatory bowel disease have been identified and include, for example, a frameshift variant and two missense variants (Hugot, et al. Nature 411, 599- 603 (31 May 2001) and Ogura, et al. Nature 411, 603-606 (31 May 2001)), the contents of each of which are incorporated by reference.
  • One of skill in the art can readily determine the presence or absence of these polymorphisms.
  • the IDB-associaed SNPs disclosed herein are useful as markers, e.g., to make assessments regarding the propensity of an individual to develop inflammatory bowel disease or a related condition, and/or regarding the ability of an individual to respond to a certain course of treatment.
  • nucleic acid molecules e.g., mRNA or DNA, preferably genomic DNA
  • Cells can be obtained from biological samples, e.g., from tissue samples or from bodily fluid samples that contain cells, such as blood, urine, semen, or saliva.
  • biological sample is intended to include tissues, cells and biological fluids containing cells which are isolated from a subject, as well as tissues, cells and fluids present within a subject.
  • Body samples may be obtained from a subject by a variety of techniques known in the art including, for example, by the use of a biopsy or by scraping or swabbing an area or by using a needle to aspirate. Methods for collecting various body samples are well known in the art.
  • Tissue samples suitable for use in the methods of the invention may be fresh, frozen, or fixed according to methods known to one of skill in the art.
  • suitable tissue samples are sectioned and placed on a microscope slide for further analyses.
  • suitable solid samples i.e., tissue samples, are solubilized and/or homogenized and subsequently analyzed as soluble extracts.
  • the subject detection methods of the invention can be used to detect polymorphic elements in DNA in a biological sample in intact cells (e.g., using in situ hybridization) or in extracted DNA, e.g., using Southern blot hybridization.
  • immune cells are used to extract genetic material for use in the subject assays. ///. Uses of Polymorphic Elements Of The Invention
  • the SNPs of the invention are useful as markers in, e.g., in diagnostic assays, prognostic assays, and in monitoring clinical trials for the purposes of predicting outcomes of possible or ongoing therapeutic approaches.
  • the results of such assays can, e.g., be used to prescribe a prophylactic course of treatment for an individual, to prescribe a course of therapy after onset of IBD, or to alter an ongoing therapeutic regimen.
  • one aspect of the present invention relates to diagnostic assays for detecting polymorphisms, e.g., SNPs, in a biological sample ⁇ e.g., cells, fluid, or tissue) to thereby determine whether an individual is afflicted with IBD, or is at risk of developing IBD.
  • the methods of the invention can be characterized as comprising detecting, in a sample of cells from the subject, the presence or absence of a specific allelic variant, e.g., SNP, of one or more polymorphic regions of an XBPl gene.
  • allelic differences can be: (i) a difference in the identity of at least one nucleotide (or complement thereof) or (ii) a difference in the number of nucleotides (or complements thereof), which difference can be a single nucleotide at multiple sites or several nucleotides.
  • haplotypes can be protective from IBD (e.g., haploytpes 5 and 7 in Table 7) or prdipose to IBD (e.g., haploytpe 4 in Table 7).
  • the subject assays can also be used to determine whether an individual is at risk for passing on the propensity to develop a disease or disorder to an offspring.
  • the invention also provides for prognostic (or predictive) assays for determining whether an individual is at risk of developing inflammatory bowel disease.
  • the invention can also be used in prenatal diagnostics.
  • the methods further involve obtaining a control biological sample from a control subject, determining one or more polymorphic elements in the sample and comparing the polymorphisms present in the control sample with those in a test sample.
  • the invention also encompasses kits for detecting the polymorphic elements in a biological sample.
  • the kit can comprise a primer capable of detecting one or more SNP sequences in a biological sample.
  • the kit can further comprise instructions for using the kit to detect SNP sequences in the sample. IV. Detection of Polymorphisms
  • DNA polymorphisms can occur, e.g., when one nucleotide sequence comprises at least one of 1) a deletion of one or more nucleotides from a polymorphic sequence; 2) an addition of one or more nucleotides to a polymorphic sequence; 3) a substitution of one or more nucleotides of a polymorphic sequence, or 4) a chromosomal rearrangement of a polymorphic sequence as compared with another sequence.
  • assay techniques there are a large number of assay techniques known in the art which can be used for detecting alterations in a polymorphic sequence (suitable detection methods are disclosed, for example, in US Patent Number 7,306,913, which is hereby incorporated by refernce in its entirety).
  • analysis of polymorphisms is amenable to highly sensitive
  • Oligonucleotide primers corresponding to XBP-I sequences can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.
  • detection of the polymorphism involves the use of a probe/primer in a polymerase chain reaction (PCR) (see, e.g., U.S. Patent Nos. 4,683,195 and 4,683,202), such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e.g., Landegran et al. (1988) Science 241:1077-1080; and Nakazawa et al. (1994) PNAS 91:360-364).
  • PCR polymerase chain reaction
  • LCR ligation chain reaction
  • genomic DNA of a cell is exposed to two PCR primers and amplification for a number of cycles sufficient to produce the required amount of amplified DNA.
  • This method can include the steps of collecting a sample of cells from a patient, isolating nucleic acid (e.g., genomic, DNA) from the cells of the sample, contacting the nucleic acid sample with one or more primers which specifically amplify a subject SNP under conditions such that hybridization and amplification of the sequence occurs, and detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample. It is anticipated that PCR and/or LCR may be desirable to use as a preliminary amplification step in conjunction with any of the techniques used for detecting polymorphisms described herein. In one preferred embodiment, detection of single nucleotide polymorphisms
  • SNP SNP and point mutations in nucleic acid molecules
  • SNP primer extension of PCR products by DNA polymerase. This method is based on the fact that the nucleoside immediately 5' adjacent to any SNP/point mutation site is known, and the neighboring sequence immediately 3' adjacent to the site is also known.
  • a primer complementary to the sequence directly adjacent to the SNP on the 3' side in a target polynucleotide is used for chain elongation.
  • the polymerase reaction mixture contains one chain-terminating nucleotide having a base complementary to the nucleotide directly adjacent to the SNP on the 5' side in the target polynucleotide.
  • An additional dNTP may be added to produce a primer with the maximum of a two-base extension.
  • the resultant elongation/termination reaction products are analyzed for the length of chain extension of the primer, or for the amount of label incorporation from a labeled form of the terminator nucleotide. (See, e.g., U.S. Patent No. 6,972,174, the contents of which are incorporated by reference).
  • a polymorphism is detected by primer extension of PCR products, as described above, followed by chip-based laser deionization time-of- flight (MALDI-TOF) analysis, as described in, for example U.S. Patent No. 6,602,662, the contents of which are incorporated by reference.
  • Alternative amplification methods include: self sustained sequence replication
  • DNA amplification products are labeled by the incorporation of radiolabeled nucleotides or phosphate end groups followed by fractionation on sequencing gels alongside standard dideoxy DNA sequencing ladders. By autoradiography, the size of the repeated sequence can be visualized and detected heterogeneity in alleles recorded.
  • the incorporation of fluorescently labeled nucleotides in PCR reactions is followed by automated sequencing.
  • polymorphisms can be identified by hybridizing a sample and control nucleic acids to high density arrays containing hundreds or thousands of oligonucleotides probes (Cronin, M.T. et al (1996) Human Mutation 7: 244-255; Kozal, MJ. et al (1996) Nature Medicine 2: 753-759).
  • polymorphisms can be identified in two dimensional arrays containing light-generated DNA probes as described in Cronin, M.T. et al supra. Briefly, a first hybridization array of probes can be used to scan through long stretches of DNA in a sample and control to identify base changes between the sequences by making linear arrays of sequential overlapping probes. This step allows the identification of polymorphisms. This step is followed by a second hybridization array that allows the characterization of specific polymorphisms by using smaller, specialized probe arrays complementary to all polymorphisms detected.
  • any of a variety of sequencing reactions known in the art can be used to directly sequence XBPl, or a region surrounding XBPl and detect allelic variants, e.g., mutations, by comparing the sequence of the sample sequence with the corresponding reference (control) sequence.
  • Exemplary sequencing reactions include those based on techniques developed by Maxam and Gilbert (Proc. Natl Acad Sci USA (1977) 74:560) or Sanger (Sanger et al. (1977) Proc. Nat. Acad. Sci 74:5463).
  • any of a variety of automated sequencing procedures may be utilized when performing the subject assays (Biotechniques (1995) 19:448), including sequencing by mass spectrometry (see, for example, U.S. Patent No. 5,547,835 and international patent application Publication Number WO 94/16101, entitled DNA Sequencing by Mass Spectrometry by H. K ⁇ ster; U.S. Patent No. 5,547,835 and international patent application Publication Number WO 94/21822 entitled "DNA Sequencing by Mass Spectrometry Via Exonuclease Degradation" by H. K ⁇ ster), and U.S Patent No.5,605,798 and International Patent Application No. PCT/US96/03651 entitled DNA Diagnostics Based on Mass Spectrometry by H. K ⁇ ster; Cohen et al.
  • protection from cleavage agents can be used to detect mismatched bases in RNA/RNA DNA/DNA, or RNA/DNA heteroduplexes (Myers, et al. (1985) Science 230:1242).
  • cleavage agents such as a nuclease, hydroxylamine or osmium tetroxide and with piperidine
  • cleavage agents such as a nuclease, hydroxylamine or osmium tetroxide and with piperidine
  • RNA/DNA heteroduplexes Myers, et al. (1985) Science 230:1242).
  • the technique of "mismatch cleavage” starts by providing heteroduplexes formed by hybridizing a control nucleic acid, which is optionally labeled, e.g., RNA or DNA, comprising a nucleotide sequence of an XBPl allelic variant with a sample nucleic acid, e.g., RNA or DNA, obtained from a tissue sample.
  • RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with Sl nuclease to enzymatically digest the mismatched regions.
  • either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions.
  • control and sample nucleic acids After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine whether the control and sample nucleic acids have an identical nucleotide sequence or in which nucleotides they are different. See, for example, Cotton et al. (1988) Proc. Natl Acad Sci USA 85:4397; Saleeba et al (1992) Methods Enzymol. 217:286-295.
  • the control or sample nucleic acid is labeled for detection.
  • an allelic variant can be identified by denaturing high- performance liquid chromatography (DHPLC) (Oefner and Underhill, (1995) Am. J. Human Gen. 57:Suppl. A266).
  • DHPLC uses reverse-phase ion-pairing chromatography to detect the heteroduplexes that are generated during amplification of PCR fragments from individuals who are heterozygous at a particular nucleotide locus within that fragment (Oefner and Underhill (1995) Am. J. Human Gen. 57:Suppl. A266).
  • PCR products are produced using PCR primers flanking the DNA of interest.
  • DHPLC analysis is carried out and the resulting chromatograms are analyzed to identify base pair alterations or deletions based on specific chromatographic profiles (see O'Donovan et al. (1998) Genomics 52:44-49).
  • alterations in electrophoretic mobility is used to identify the type of XBP-I polymorphism.
  • SSCP single strand conformation polymorphism
  • SSCP single strand conformation polymorphism
  • Single- stranded DNA fragments of sample and control nucleic acids are denatured and allowed to renature.
  • the secondary structure of single- stranded nucleic acids varies according to sequence, the resulting alteration in electrophoretic mobility enables the detection of even a single base change.
  • the DNA fragments may be labeled or detected with labeled probes.
  • the sensitivity of the assay may be enhanced by using RNA (rather than DNA), in which the secondary structure is more sensitive to a change in sequence.
  • the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al. (1991) Trends Genet 7:5).
  • the identity of an allelic variant of a polymorphic region is obtained by analyzing the movement of a nucleic acid comprising the polymorphic region in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al. (1985) Nature 313:495).
  • DGGE denaturing gradient gel electrophoresis
  • DNA will be modified to insure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high-melting GC-rich DNA by PCR.
  • a temperature gradient is used in place of a denaturing agent gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner (1987) Biophys Chem 265:1275).
  • oligonucleotide probes may be prepared in which the known polymorphic nucleotide is placed centrally (allele-specific probes) and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324:163); Saiki et al (1989) Proc. Natl Acad. Sci USA 86:6230; and Wallace et al. (1979) Nucl. Acids Res. 6:3543).
  • Such allele specific oligonucleotide hybridization techniques may be used for the simultaneous detection of several nucleotide changes in different polylmorphic regions of XBP-I.
  • oligonucleotides having nucleotide sequences of specific allelic variants are attached to a hybridizing membrane and this membrane is then hybridized with labeled sample nucleic acid. Analysis of the hybridization signal will then reveal the identity of the nucleotides of the sample nucleic acid.
  • Oligonucleotides used as primers for specific amplification may carry the allelic variant of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al. (1989) Nucleic Acids Res. 17:2437-2448) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner (1993) Tibtech 11:238; Newton et al. (1989) Nucl. Acids Res. 17:2503). This technique is also termed "PROBE” for Probe Oligo Base Extension.
  • identification of the allelic variant is carried out using an oligonucleotide ligation assay (OLA), as described, e.g., in U.S. Patent No. 4,998,617 and in Landegren, U. et al, (1988) Science 241:1077-1080.
  • OLA oligonucleotide ligation assay
  • One of the oligonucleotides is linked to a separation marker, e.g., biotinylated, and the other is detectably labeled. If the precise complementary sequence is found in a target molecule, the oligonucleotides will hybridize such that their termini abut, and create a ligation substrate. Ligation then permits the labeled oligonucleotide to be recovered using avidin, or another biotin ligand.
  • Nickerson, D.A. et al have described a nucleic acid detection assay that combines attributes of PCR and OLA (Nickerson, D. A. et al, (1990) Proc. Natl. Acad.
  • OLA combined with PCR permits typing of two alleles in a single microtiter well.
  • each OLA reaction can be detected by using hapten specific antibodies that are labeled with different enzyme reporters, alkaline phosphatase or horseradish peroxidase. This system permits the detection of the two alleles using a high throughput format that leads to the production of two different colors.
  • the single base polymorphism can be detected by using a specialized exonuclease-resistant nucleotide, as disclosed, e.g., in Mundy, C. R. (U.S. Patent No. 4,656,127).
  • a primer complementary to the allelic sequence immediately 3' to the polymorphic site is permitted to hybridize to a target molecule obtained from a particular animal or human. If the polymorphic site on the target molecule contains a nucleotide that is complementary to the particular exonuclease-resistant nucleotide derivative present, then that derivative will be incorporated onto the end of the hybridized primer. Such incorporation renders the primer resistant to exonuclease, and thereby permits its detection.
  • a solution-based method is used for determining the identity of the nucleotide of a polymorphic site (Cohen, D. et al (French Patent 2,650,840; PCT Application No. WO91/02087).
  • a primer is employed that is complementary to allelic sequences immediately 3' to a polymorphic site. The method determines the identity of the nucleotide of that site using labeled dideoxynucleotide derivatives, which, if complementary to the nucleotide of the polymorphic site will become incorporated onto the terminus of the primer.
  • Goelet, P. et al An alternative method, known as Genetic Bit Analysis or GB ATM is described by Goelet, P. et al (PCT Application No. 92/15712).
  • the method of Goelet, P. et al uses mixtures of labeled terminators and a primer that is complementary to the sequence 3' to a polymorphic site.
  • the labeled terminator that is incorporated is thus determined by, and complementary to, the nucleotide present in the polymorphic site of the target molecule being evaluated.
  • Cohen et al French Patent 2,650,840; PCT Appln. No. WO91/02087
  • et al is preferably a heterogeneous phase assay, in which the primer or the target molecule is immobilized to a solid phase.
  • Several primer-guided nucleotide incorporation procedures for assaying polymorphic sites in DNA have been described (Komher, J. S. et al, Nucl Acids. Res. 17:7779-7784 (1989); Sokolov, B. P., Nucl Acids Res. 18:3671 (1990); Syvanen, A. -C, et al, Genomics 8:684-692 (1990); Kuppuswamy, M. N. et al, Proc. Natl. Acad. Sci.
  • the methods described herein may be performed, for example, by utilizing prepackaged diagnostic kits comprising at least one probe/primer nucleic acid or antibody reagent described herein, which may be conveniently used, e.g., in clinical settings to diagnose patients exhibiting symptoms or family history of a disease or illness involving a polymorphic elements.
  • a readily available commercial service can be used to analyze samples for the polymorphic elements of the invention.
  • primers can readily be designed to amplify the polymorphic sequences and/or detect XBP-I polymorphisms by one of ordinary skill in the art.
  • an XBP-I sequence comprising a polymorphism (e.g., SNP) of the invention can be identified in the NCBI Variation Database (dbSNP using the SNP IDs presented in Table 4) or by homology searching of another database containing human genomic sequences (e.g., using Blast or another program) and the location of the SNP sequence and/or flanking sequences can be determined and the appropriate primers identified and/or designed by one of skill in the art.
  • a primer for amplification of a SNP elements is at least about 5-10 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 15-20 base pairs in length. In one embodiment, a primer for amplification of a polymorphic element is at least about 20-30 base pairs in length.
  • a primer for amplification of a polymorphic element is at least about 30-40 base pairs in length. In one embodiment, a primer for amplification of a polymorphic element is at least about 40-50 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 50-60 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 60-70 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 70-80 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 80-90 base pairs in length.
  • a primer for amplification of a polymorphic elements is at least about 90-100 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 100-110 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 110- 120 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 120-130 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 130-140 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 140-150 base pairs in length.
  • a primer for amplification of a polymorphic elements is at least about 150-160 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 160- 170 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 170-180 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 180-190 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 190-200 base pairs in length.
  • a primer for amplification of a SNP of the invention is located at least about 200 base pairs away from (upstream or downstream of) the polymorphism to be amplified (i.e., leaving about 200 nucleotides from the end of the primer sequence to the polymorphism).
  • a primer for amplification of a polymorphism of the invention is located at least about 150 base pairs away from (upstream or downstream of) the polymorphic sequence to be amplified.
  • a primer for amplification of a polymorphism of the invention is located at least about 100 base pairs away from (upstream or downstream) of the polymorphic sequence to be amplified.
  • a primer for amplification of a polymorphism of the invention is located at least about 75 base pairs away from (upstream or downstream of) the polymorphic sequence to be amplified. In another embodiment, a primer for amplification of a polymorphism of the invention is located at least about 50 base pairs away from (upstream or downstream of) the polymorphic sequence to be amplified. In another embodiment, a primer for amplification of a polymorphism of the invention is located at least about 25 base pairs away from (upstream or downstream of) the polymorphic sequence to be amplified.
  • a primer for amplification of a polymorphism of the invention is located at least about 10 base pairs away from (upstream or downstream of) the polymorphic sequence to be amplified. In another embodiment, a primer for amplification of a polymorphism of the invention is located at least about 5 base pairs away from (upstream or downstream of) the polymorphic sequence to be amplified. In another embodiment, a primer for amplification of a polymorphism of the invention is located at least about 2 base pairs away from (upstream or downstream of) the polymorphic sequence to be amplified. In yet another embodiment a primer for amplification of a polymorphism of the invention is adjacent to the polymorphic sequence to be amplified.
  • the practice of the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, recombinant DNA technology, immunology (especially, e.g., immunoglobulin technology), and animal husbandry. See, e.g., Sambrook, Fritsch and Maniatis, Molecular Cloning: Cold Spring Harbor Laboratory Press (1989); Antibody Engineering Protocols (Methods in Molecular Biology), 510, Paul, S., Humana Pr (1996); Antibody Engineering: A
  • Villin (V)-Cre transgenic mice ( Madison et al., (2002) Qs elements of the villin gene control expression in restricted domains of the vertical (crypt) and horizontal (duodenum, cecum) axes of the intestine. J. Biol. Chem. 277, 33275-33283) (Jackson Laboratories) to obtain XBPl flox/flox VCre mice.
  • Colony maintenance involved mating ⁇ Bp l flox/flox VCre ⁇ ⁇ Bp l flox/flox as weU as ⁇ BP 1 flox/wt VCre ⁇ ⁇ Bp l flox/flox JQ ⁇
  • XBPl flox/wt VCre x ⁇ BPl flox/wt was bred to obtain XBPl wt/wt VCre mice, which were confirmed to be histologically and clinically indistinguishable from ⁇ Pl wt/wt or ⁇ BPl flox/wt mice. All experiments reported were performed with sex- and age-matched littermate "XBPl 7 " (i.e. XBPl flox/flox VCre), "XBP1 +/ “ (i.e. XBPl flox/wt VCre), and "XBP1 +/+ " (i.e.
  • mice obtained as above.
  • ⁇ BPl floxneo/+ mice mice (see Fig. IA) were mated with VCreER T2 (129;B6) mice, kindly provided by Dr. Nicholas Davidson (Washington University, St. Louis) and Dr. Sylvie Robine (Institut Curie-CNRS, Paris) (el Marjou et al., (2004) Tissue-specific and inducible Cre-mediated recombination in the gut epithelium. Genesis. 39, 186-193).
  • Cre recombinase was activated by administration of lmg tamoxifen (MP Biomedicals) intraperitoneally daily over 5 consecutive days.
  • EIIaCre (Lakso et al., (1996) Efficient in vivo manipulation of mouse genomic sequences at the zygote stage. Proc. Natl. Acad. Sci. U. S. A 93, 5860-5865.; Holzenberger et al., (2000) Cre-mediated germline mosaicism: a method allowing rapid generation of several alleles of a target gene.
  • Nucleic Acids Res. 28, E92.) transgenic mice were obtained from Jackson Laboratories. All mice were genotyped by PCR of genomic DNA isolated by phenol extraction and isopropanol precipitation of proteinase K-digested tails. Primer sequences are available upon request.
  • FIG. 1 The generation of XBPl flox/flox VCre and VCreER T2 transgenic mice is detailed in Figure 1.
  • a floxed Xbpl allele was generated by homologous recombination in W4/129 embryonic stem (ES) cells (panel A).
  • the targeting vector contains a loxP site in intron 3 and a floxed neomycin resistance gene cassette (neo) in intron 2 of the Xbpl gene.
  • neo floxed neomycin resistance gene cassette
  • Xbpl ao7ineo mice were mated with EIIacre transgenic mice to induce a partial Cre- mediated recombination.
  • Male mice with the greatest deletion of the neo cassette were mated with wild type female mice to obtain an Xbpl n ° x strain. Consequently, breeding of Xbpl ao7i mice with Villin-(V)Cre transgenic mice resulted in the deletion of exon 2 of the Xbpl gene as confirmed by Southern blot (panel B).
  • RNAs were isolated from small intestinal mucosal scrapings of untreated (NT) or mice injected with 1 mg/kg tunicamycin and harvested 6 hours later, and analyzed for the expression of XBPl mRNA by Northern blot and RT-PCR followed by DNA sequencing.
  • the mutant XBPl mRNA produced by Xbpl A/A mice is slightly smaller in its molecular weight than the wild type XBPl mRNA, due to the deletion of exon 2 as confirmed by DNA sequencing of the cDNA.
  • the IREl splicing site of XBPl mRNA is located downstream of the floxed exon 2 in exon 4, which hence allows monitoring the splicing status in mRNA transcribed from floxed and Cre-deleted XBPl alleles alike. Absence of XBPl protein was confirmed by Western blotting of small intestinal mucosal scraping protein lysates from untreated and tunicamycin-injected mice. As shown in panel C, the deletion of exon 2 in the mutant XBPl mRNA results in the change of the translational reading frame, introducing a premature translational termination codon.
  • the truncated XBPl protein is not functional as evidenced by its failure to upregulate expression of a prototypical target gene of XBPl, ERdj4 (Dnajb9), upon ER stress induction through tunicamycin injection (Lee et al., (2003) XBP-I regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. MoI. Cell Biol. 23, 7448-7459), as determined by qPCR on small intestinal mucosal scraping specimens.
  • the source of antibodies, proteins and inhibitors are as follows: rabbit phospho- JNK, total- JNK, active (cleaved) caspase-3 (Cell Signaling Technology), anti-lysozyme (DakoCytomation), antiprocryptdin (Ayabe,T., et al., (2002) Activation of Paneth cell alpha-defensins in mouse small intestine. J. Biol. Chem. 277, 5219-5228) (generously provided by A. Ouellette (UC Irvine)), flagellin (Invivogen), TNF ⁇ (Peprotech).
  • JNK-1,-2,-3 inhibitor SP600125 (Sigma), p38 inhibitor SB203580, MEK inhibitors PD98059 and U0126 (Calbiochem) were dissolved in DMSO as recommended.
  • Carbamyl choline and lipopolysaccharide (LPS; from Escherichia coli 0111:B4) (Sigma), were used at final concentrations of lO ⁇ M and l ⁇ g/ml, respectively.
  • Tissues were handled by standard methods. Tissues were collected in 10% neutral buffered formalin and embedded in paraffin. Sections were deparaffinized in isopropanol and graded alcohols, followed by antigen retrieval with Retrievagen A solution according to manufacturer's protocol (Becton Dickinson), and endogenous peroxidase quenched by H 2 O 2 . Sections were then blocked for 30 minutes with normal goat serum, and incubated overnight at 4 0 C with primary antibodies at dilutions recommended by the manufacturer. Secondary biotinylated anti-rabbit antibody (1:200) was added for 30 minutes followed by detection with streptavidin-HRP and development with DAB + chromogen according to manufacturer's recommendations (DakoCytomation). Slides were counterstained with Mayer's hematoxylin, dehydrated, and mounted with Eukitt. Apoptotic cells were detected on paraffin embedded small intestine using
  • TUNEL-POD kit (Roche Applied Sciences). Small intestinal tissue from sex-matched XBP1 +/+ and XBPl 7 littermates was fixed with 1.25% formaldehyde, 2.5% glutaraldehyde, 0.03% picric acid in 10OmM sodium cacodylate buffer. After washing with 10OmM sodium cacodylate buffer, tissues were treated for Ih with 1% osmium tetroxide and 1.5% potassium ferrocyanide, and then 30 minutes with 0.5% uranyl acetate in 5OmM maleate buffer, pH 5.15. After dehydration in ethanol, tissues were treated for 1 hour in propylenoxide and then embedded in Epon/Araldite resin. Ultrathin sections were collected on EM grids and observed by using a JEOL 1200EX transmission electron microscope at an operating voltage of 60 kV (with the kind assistance of Dr. Susumu Ito, Harvard Medical School).
  • mice were euthanized 72 hours after infection, followed by aseptically harvesting liver and spleen. Faecal pellets, liver and spleen were homogenized in PBS, and serial dilutions of the homogenates plated on LB plates containing 200 ⁇ g/ml streptomycin, incubated at 37 0 C for 18 hours and c.f.u. were counted. L. monocytogenes burden in faeces was expressed as c.f.u. per mg dry weight, whereas liver and spleen data were expressed as c.f.u. per organ.
  • mice Sex and age-matched littermates (8 to 12 weeks) received 4.5% DSS (ICN Biomedicals Inc.) in drinking water for 5 days then regular water thereafter, or neomycin sulfate and metronidazole (1.5 g/L) (Sigma).
  • Antibiotic treated mice received 7% DSS. Weight was recorded daily and rectal bleeding was assessed (0, absent; 1, traces of blood at anus or the base of the tail; 2, clearly visible rectal blood). Histological and mRNA expression studies on RNeasy kit isolated colon RNA (Qiagen) used mice sacrificed on day 8 after DSS treatment. Histological scoring of colons was described before (Garrett et al., (2007) Communicable ulcerative colitis induced by T-bet deficiency in the innate immune system. Cell 131, 33-45).
  • Small intestinal crypts were isolated following published protocols (Ayabe et al., (2000) Secretion of microbicidal alpha-defensins by intestinal Paneth cells in response to bacteria. Nat. Immunol. 1, 113-118).
  • the small intestinal lumen of adult mice was rinsed with ice-cold PBS and segments were everted and shaken in Ca ++ and Mg ++ - free PBS buffer containing 3OmM EDTA to elute crypts. Villi and crypts eluted during 5min intervals were recovered by centrifugation at 70Og and crypt fractions identified by light microscopy.
  • Crypt numbers were estimated by hemocytometry and 2,000 crypts resuspended in iPIPES buffer containing lO ⁇ M carbamyl choline (CCh; Sigma) or l ⁇ g/ml LPS and incubated for 30min at 37 0 C.
  • iPIPES buffer containing lO ⁇ M carbamyl choline (CCh; Sigma) or l ⁇ g/ml LPS
  • CCh carbamyl choline
  • LPS l ⁇ g/ml LPS
  • RNAs isolated using RNAeasy columns (Qiagen) was reverse transcribed and quantified by SYBR green PCR (Biorad).
  • SYBR green PCR Biorad
  • RNAs isolated from 3 specimens per genotype were pooled, and microarray was carried out at the Biopolymers Core Facility (Harvard Medical School) with mouse genome 430 2.0 array (Affymetrix, Santa Clara, CA). Data analysis was performed with Agilent GeneSpring GX and Affymetrix GCOS software under default parameter setting.
  • Quantitative PCR was performed as described before (Lee et al., (2003) XBP-I regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. MoI. Cell Biol. 23, 7448-7459). See Table 1 below for PCR primers.
  • HASPA5 (grp78, CATCACGCCGTCCTATGTCG CGTCAAAGACCGTGTTCTCG (Wang and Seed, BiP) (SEQ ID NO: 1) (SEQ ID NO: 2) 2003)
  • Haspa5 (grp78; ACTTGGGGACCACCTATTCCT ATCGCCAATCAGACGCTCC (Wang and Seed, BiP) (SEQ ID NO: 7) (SEQ ID NO: 8) 2003)
  • Lysz (lysozyme) (Wang and Seed, G (SEQ ID NO: 15) TGA (SEQ ID NO: 16) 2003)
  • Muc2 (mucin-2) GCCTGTTTGATAGCTGCTATG TGCC (SEQ ID NO: 17) CAC (SEQ ID NO: 18)
  • Atohl GAGTGGGCTGAGGTAAAAGAG GGTCGGTGCTATCCAGGAG (Wang and Seed, T (SEQ ID NO: 25) (SEQ ID NO: 26) 2003)
  • IHb (IL- l ⁇ ) GCAACTGTTCCTGAACTCAAC GCAACTGTTCCTGAACTCAA (Wang and Seed, T (SEQ ID NO: 41) CT (SEQ ID NO: 42) 2003)
  • Illrn (IL-IRa) A (SEQ ID NO: 43) G (SEQ ID NO: 44) 2003)
  • XBPl splicing assay XBPl splicing was measured by specific primers flanking the splicing site yielding PCR product sizes of 164 and 138bp for human XBPIu and XBPIs, 171bp and 145bp, for mouse XBPl. Products were resolved on 2% agarose gels, and band intensity was determined densitometrically (Optiquant Software, Perkin Elmer).
  • the SV40 large T antigen-immortalized small intestinal epithelial cell line MODE-K (gift of D.Kaiserlian, Institute Pasteur) was transduced as described (Iwakoshi et al., (2003) Plasma cell differentiation and the unfolded protein response intersect at the transcription factor XBP-I. Nat. Immunol. 4, 321-329) with an XBPl-specific RNAi vector and a control vector identical to the one described before (Lee et al., (2003) Proteasome inhibitors disrupt the unfolded protein response in myeloma cells. Proc. Natl. Acad. Sci. U. S. A.
  • JNK phosphorylation was assessed in MODE-K cells seeded at 1 x 10 6 per well 6 well plates, allowed to form confluent mono-layers over 48-72 hours, stimulated with flagellin and TNF ⁇ for the indicated time periods, washed in ice-cold PBS and lysed in 500 ⁇ l RIPA buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with protease (Complete ® , Roche Applied Science) and Ser/Thr and Tyr phosphatase (Upstate) inhibitors.
  • RIPA buffer 50 mM Tris, pH 7.4, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS
  • Protein content of lysates was determined by BCA assay, and equal amounts of lysates containing Laemmli buffer were boiled at 95 0 C for 5min, resolved on 10% SDS- PAGE (for MODE-K cell lysates) or 12% SDS-PAGE (for TCA precipitates of purified crypts), transferred to Protran membranes (Whatman), blocked with 5% milk in TBS-T, incubated with primary antibody in 3-5% BSA in TBS-T at 4 0 C overnight, washed, and incubated with a 1:2,000 dilution of HRPconjugated anti-rabbit secondary antibody in 3- 5% milk in TBS-T for 45min at room temperature. Bands were visualized using SuperS ignal chemoluminescent substrate (Pierce).
  • Ileal and colonic biopsies were obtained from randomly selected patients with clinically, endoscopically and histologically confirmed diagnosis of CD and UC, as well as healthy control patients without any signs of intestinal inflammation.
  • the diagnosis of CD and UC was confirmed by established criteria of clinical, radiological and endoscopic analysis, and from histology reports.
  • Informed consent was obtained and procedures performed according to the approval by the local ethics committee of the Innsbruck Medical University.
  • Biopsies were collected in RNAlater (Ambion), RNA isolated using RNAeasy columns (Qiagen), reverse transcribed, and used for quantitative PCR and XBPl splicing assays. Patient recruitment
  • German patients and controls in panels 1 and 2 almost completely overlap with the panels termed A and B in two recently published studies (Franke et al., (2007) Systematic association mapping identifies NELLl as a novel IBD disease gene. PLoS. ONE. 2, e691; Hampe et al., (2007) A genome-wide association scan of nonsynonymous SNPs identifies a susceptibility variant for Crohn disease in ATG16L1. Nat. Genet. 39, 207-211). Panel 3 is unpublished.
  • Genomic DNA was prepared using a variety of methods and DNA samples evaluated by gel electrophoresis for the presence of high-molecular weight DNA.
  • One ⁇ l of genomic DNA (30-300 ng) was amplified by the GenomiPhi (Amersham) whole genome amplification system and fragmented at 99 0 C for five minutes.
  • One hundred ngs of DNA was dried overnight in TwinTec hardshell 384well plates (Eppendorf, Hamburg, Germany) at room temperature and genotyping performed using the SNPlexTM Genotyping System (Applied Biosystems, Foster City, CA) on an automated platform.
  • genotypes were generated by automatic calling using the Genemapper 4.0 software (Applied Biosystems, Foster City, CA) and all cluster plots 5 reviewed manually. Prior to statistical analyses, quality checks (PHWE>0.01,
  • MAFcontrols>l%, callrate>90%) were applied to the SNPs under study.
  • Single-marker association and haplotype analyses, permutation tests, calculation of pairwise LD, and SNP selection were performed using Haploview 4.0 (Barrett et al., (2005) Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 21, 263-265).
  • Haplotype blocks were automatically defined as in (Gabriel et al., (2002) The structure of haplotype blocks in the human genome. Science 296, 2225-2229). Only haplotypes with population frequencies >1.0 % were included in the final association analysis. Single-marker disease associations and possible marker-marker interactions were assessed for statistical significance by means of logistic regression analysis (forward
  • Genomic DNA sequencing was performed using Applied Biosystems' BigDyeTM chemistry according to the supplier's recommendations (for primer sequences, see Table T). Genomic DNA sequencing traces
  • Probe- VIC 5'-CAGGGCATCTATC-S' (SEQ ID NO: 92)
  • Probe-FAM 5'-CGGGACCCTTAAAG-S' (SEQ ID NO: 100)
  • Probe- VIC 5'-ACGGGACCCCTAAAG-3' (SEQ ID NO: 101)
  • Probe-FAM 5'-CCCAATTGTCACCCC-3' (SEQ ID NO: 104)
  • Probe- VIC 5'-CCCAGTTGTCACCCC-S' (SEQ ID NO: 105)
  • XBPlsnp30 (D350E)
  • Probe-FAM 5'-TTCAGTGAGATGTCC-S' (SEQ ID NO: 108) Probe- VIC 5'-CATTCAGTGACATGTCC-S' (SEQ ID NO: 109)
  • Table 4 Genotype counts of the twenty single nucleotide polymorphisms that were genotyped in the three independent case-control IBD sample panels.
  • Marker Positions refer to NCBFs build 35 and nucleotides are listed for each SNPs for 5 the minor allele 1 (Al) and the major allele 2 (A2). Raw genotype counts are listed as A1A1/A1A2/A2A2. U: unaffected controls, CD: Crohn disease patients, UC: ulcerative colitis. Logistic regression (forward selection) was used to analyse the full German case- control panel for potential epistatic effects with N0D2. No statistically significant interaction was observed between any of the 20 SNPs in XBPl and the known disease- 10 associated variants in N0D2 (rs2066844/Arg702Trp, rs2066845/Gly908Arg, rs2066847/Leul007fs).
  • XBPlsnpU OxU, 4xCD, 2xUC
  • XBPlsnp8 OxU, IxCD, 3xUC
  • XBPlsnp30 OxU, IxCD, IxUC;
  • XBPlsnp29 OxU, IxCD, IxUC; XBPlsnp22: 5xU, 5xCD, 3xUC; rs5762809: minor allele frequencies of 13% in U, 12% in CD, and 12% UC.
  • Table 7 Resu 1599739 r slts of a seven-marker haplotype analysis at the XBPl locus.
  • Expression plasmids hXBPlu and hXBPls were engineered to incorporate the XBPl snpl 7 (Al 62Pj, XBPl snp8 (M139I) and XBPl snp22 (P15L) minor variants using the GeneTailor site directed mutagenesis system (Invitrogen).
  • Primers used were: XBPlsnpl7_R AGACCCGGCCACTGGCCTCACTTCATTCCC (SEQ ID NO: 176); XBPlsnpl7_F TGAGGCCAGTGGCCGGG-TCTcCTGAGTCCGC (SEQ ID NO: 177); XBPlsnp8_R ATCCCCAAGCGCTGTCTTAACTCCTGGTTC (SEQ ID NO: 178); XBPlsnp8_F TTAAGACAGCGCTTGGGGATaGATGCCCTGG (SEQ ID NO: 179); XBPlsnp22_F ccgacag-aagcagaactttaagggtcccgtc (SEQ ID NO: 180), and XBPlsnp22_R TAAAGTTCTGCTTCTGTCGGGG-CAGCCCGC (SEQ ID NO: 181).
  • XBPl 7 MEF cells Lee et al, (2003) XBP-I regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. MoI. Cell Biol. 23, 7448-7459
  • bicistronic retroviral vectors expressing GFP and human XBPl were constructed by inserting PCR amplified cDNAs for wildtype and
  • Retroviruses produced from 293T cells were used to transduce XBPl " ' " MEF cells in the presence of polybrene. Two days later, cells were replated, attached overnight and treated with l ⁇ g/ml tunicamycin for 6 hours. Retroviral transduction efficiency was determined by FACS analysis of cells for GFP expression, as well as western blot of XBPIs after treating cells with tunicamycin. The levels of ERdj4 and EDEM mRNA were determined by real time PCR and are expressed normalized to ⁇ -actin mRNA content.
  • Example 1 - XBPl deletion in IEC leads to ER stress and spontaneous enteritis
  • XBP l flox/flox mice were generated by targeting loxP sites to introns flanking exon 2, and bred onto Villin (V)-Cre transgenic mice (see methods above and Figure 1, panel A, B, and C), that directs Cre recombinase activity specifically to small and large intestinal epithelium (Madison et al., (2002) Cis elements of the villin gene control expression in restricted domains of the vertical (crypt) and horizontal (duodenum, cecum) axes of the intestine. J. Biol. Chem. 277, 33275-33283).
  • XBPl flox/flox VCre (XBPl " ' " ) offspring were born at a Mendelian ratio and developed normally.
  • Table 8 Identification of genes that are differentially expressed in the jejunum of the WT and Xbpl knock-out mice. Genes with more than two fold changes in the expression level are listed. Total RNA pools from three animals per each group were subjected to DNA chip experiments using Affymetrix mouse 430 Chips. Data was analyzed by GCOS 1.4 software. P, present; A, absent; D, decrease; I, increase; MI, modest increase.
  • RNAs pool from three animals per each group were subjected to DNA chip experiments using Affymetrix mouse 430 Chips. Data was analyzed by GCOS 1 4 software. P, present; A, absent; D, decrease; I, increase; MI, modest increase
  • Example 2 Absent Paneth cells and reduced goblet cells in XBPl-I- epithelium XBPl ' intestine was completely devoid of Paneth cells ( Figure 2D and 2E), compared to XBP1 +/+ and XBP1 +/ mice ( Figure 2E and 3B).
  • Paneth cell granules store lysozyme and pro-forms of cryptdins, which were barely detectable in XBPl ; crypts ( Figure 2D) and electron microscopy (EM) confirmed few rudimentary electron-dense granules of minute size, and a compressed ER in XBPl ⁇ Paneth cells ( Figure 2D).
  • Example 3 - XBPl deletion results in apoptosis of differentiated Paneth cells and exhibits signs of a regenerative response
  • Paneth cells might undergo programmed cell death from failure to manage ER stress as observed in pancreatic acinar cells (Lee et ah, (2005) XBP-I is required for biogenesis of cellular secretory machinery of exocrine glands. EMBO J. 24, 4368-4380). Indeed, a few pyknotic, apoptotic cells were detected in XBPl ' crypts (anti-active caspase-3 + and TUNEL + ; Figure 5A and Figure 6A).
  • Focal enteritis was present in 4 of 9 mice at day 5 (44%) ranging from lamina limbal infiltrates, to crypt abscesses and frank ulcerations (Fig. 2F, upper two panels), despite only minor reductions in Paneth cells ( Figure 5F, lower panel). Cumulatively, at all time points examined, enteritis was observed in 7/18 (39%) ⁇ Bpl flo ⁇ neo/fioxneo villinCre ER ⁇ 2 and Q/7 contr ⁇ ls after induction with tamoxifen.
  • the small intestinal epithelium exhibited villus shortening with a reduction of the villusxrypt ratio (Figure 5G), indicative of a regenerative response in XBPl ' mice.
  • a 1 hour pulse of bromodeoxyuridine (BrdU) labelled the proliferative pool of intestinal stem cells, and was similar in XBP1 +/+ and XBPl ⁇ mice ( Figure 5H).
  • BrdU bromodeoxyuridine
  • labeled cells were detected higher up in the crypt-villus axis in XBPl ' mice, indicating an increased migration rate (Figure 5H).
  • XBPl affects IEC homeostasis both through controlling cell renewal and cell death.
  • Example 4 - XBPl deletion impairs mucosal defence to oral Listeria monocytogenes infection
  • Oral infection with Listeria monocytogenes, a gram positive intracellular pathogen that is affected by Paneth cell defects Karl (Kobayashi et al., (2005) Nod2-dependent regulation of innate and adaptive immunity in the intestinal tract. Science 307, 731-734) revealed that 10 hours after infection, 100-fold higher numbers of colony forming units (c.f.u.) of L.
  • XBPl mRNA splicing is a marker of IREl activation and ER stress (Calfon et ah, (2002) IREl couples endoplasmic reticulum load to secretory capacity by processing the XBP-I mRNA. Nature 415, 92-96; Lin et ah, (2007) IREl signaling affects cell fate during the unfolded protein response. Science 318, 944-949).
  • XBPl mediated intestinal inflammation arose from increased INK activity in a microbiota and cytokine free system
  • XBPl expression was silenced in the mouse IEC line MODE-K with a siRNA retrovirus (iXBP), together with flagellin and TNF ⁇ as proinflammatory stimulants (Lodes et ah, (2004) Bacterial flagellin is a dominant antigen in Crohn disease. J. Clin. Invest 113, 1296-1306).
  • TNF ⁇ and flagellin increased INK phosphorylaton and CXCLl production from MODE-K.iXBP (50-90% reduction of XBPl) compared to MODE-K.Ctrl cells ( Figure 8C, 8D and 8E) that was dose- dependently and specifically (Figure 9A and 9B) blocked by the INK inhibitor, SP600125 ( Figure 8F and 8G) but did not affect CD Id-restricted MODE-K antigen presenting function (van de WaI et ah, (2003) Delineation of a CD Id-restricted antigen presentation pathway associated with human and mouse intestinal epithelial cells. Gastroenterology 124, 1420-1431) ( Figure 8H).
  • XBPl y colons displayed increased areas of mucosal erosions, edema, and cellular infiltration along with increased crypt loss compared to XBP1 +/+ littermates ( Figure HC and HD).
  • XBPl +7 mice exhibited an intermediate phenotype ( Figure HA, HB and HC).
  • Antibiotic treatment abrogated the differences in severity of DSS colitis between XBP1 +/+ and XBPl ; mice ( Figure 12A and 12B) highlighting the importance of the commensal flora in the colitis observed ( Figure 1 IA-D).
  • TNFq a central mediator of inflammation in DSS colitis
  • Example 7 Human ileal and colonic mucosa in CD and UC exhibit signs of ER stress
  • Example 8 SNPs within the XBPl gene region are associated with IBD
  • a German patient cohort of 1103 controls, 550 CD, and 539 UC patients were examined in the instant invention (Table 6, panel 1), genotyping for twenty tagging SNPs (average SNP distance 5.25 kb; Figure 13 A-E), selected from HapMap data of individuals of European ancestry using de Bakkers algorithm as implemented in Haploview (Barrett et al., (2005) Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 21, 263-265).
  • markers 2-5, 7, 9-14, and 18-20 are located in a 99 kb large block.
  • Table 7 summarizes the haplotype analysis results of the 7- marker haplotype tagging SNPs of this block (2-4, 9-10, 12, 18).
  • Three of the 8 haplotypes were significantly associated with IBD after 10,000 permutations.
  • Haplotypes #5 and #7 were protective, whereas #4 was a risk haplotype.
  • Multiple logistic regression analysis of the entire IBD panel including gender as a covariate revealed a best model fit with SNPs rs5997391 and rs35873774 (intron 4/5 of XBPl). Logistic regression analysis did not reveal epistatic effects.
  • Example 9 Deep sequencing reveals multiple rare variants including two hypomorphic variants that might confer risk
  • the discovery frequency for rare SNPs was 5, 16, and 18 for 282 controls, CD, and UC patients. Sequencing of the coding region in another 282 UC patients yielded another 3 novel SNPs. Five novel non- synonymous SNPs (nsSNPs; XBPl snp8, XBPlsnpl7, XBPlsnp22, XBPlsnp29, XBPlsnp30) were discovered in the sequencing cohort of 1128 patients but not controls. Taqman genotyping revealed the actual frequencies of these 5 novel nsSNPs in panels 1+2. Notably, heterozygous individuals were only observed among the case groups for 4 of the 5 rare nsSNPs, while the fifth nsSNP
  • XBPlsnpl7 in exon 4 is 10 bp upstream of the XBPl mRNA splice site recognized by IREl.
  • the respective mutations into unspliced (hXBPlu) and spliced (hXBPls) versions were engineered and transiently cotransfected MODE-K cells with wildtype or mutant XBPl plasmids and an UPRE-luciferase reporter construct (Lee et ⁇ l, (2003) XBP-I regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. MoI. Cell Biol. 23, 7448-7459).
  • hXBPlu.M139I and hXBPls.M139I had diminished UPRE transactivating function compared to wildtype plasmids in untreated and tunicamycin (Tm) treated MODE-K ( Figure 15A and 15B).
  • hXBPlu.A162P displayed impaired UPRE transactivation only in Tm-treated MODE-K cells ( Figure 15A), while hXBPls.A162P transactivation was unaltered ( Figure 15B).
  • XBPl " ' " mouse embryonic fibroblasts (MEFs) Iwakoshi et al., (2003) Plasma cell differentiation and the unfolded protein response intersect at the transcription factor XBP-I.
  • Example 10 Discussion of Examples 1-9
  • the instant invention presents the first spontaneous mouse model of intestinal inflammation that arises from a gene defect in an actual genetic risk factor for human IBD. It suggests that XBPl unifies key elements of IBD pathogenesis within the IEC compartment, pointing toward a primary defect in IEC function in IBD pathogenesis.
  • the instant invention introduces the ER stress response as a likely integral component of organ- specific inflammation. XBPl controls organ- specific inflammation through two major mechanisms that are probably codependent. First, Paneth cell function was strikingly impaired in XBPl " ' " mice as evidenced by diminished antimicrobial peptide secretion and a compromised response to pathogenic bacteria. Second, XBPl deficiency itself induced ER stress that led to a heightened pro-inflammatory response of the epithelium to known IBD inducers flagellin and TNF ⁇ ( Figure 17).
  • microbial- or food-derived XBPl inhibitors could interfere with the pathways described herein, particularly in a genetically susceptible host, thus contributing to the development of intestinal inflammation.
  • a 21-membered macrocyclic lactam termed 'trierixin' isolated from Streptomyces sp. potently inhibits endogenous XBPl splicing in an epithelial cell line (Tashiro et al, (2007) Trierixin, a Novel Inhibitor of ER Stress-induced XBPl Activation from Streptomyces sp. J. Antibiot. (Tokyo) 60, 547-553).
  • Paneth cell deficiency IEC inflammatory tone and enteritis
  • Paneth and absorptive epithelial cells have been linked to intestinal inflammation (Kobayashi et al, (2005) Nod2-dependent regulation of innate and adaptive immunity in the intestinal tract. Science 307, 731-734; Zaph et al., 2007; Nenci et al, (2007) Epithelial NEMO links innate immunity to chronic intestinal inflammation. Nature 446, 557-561; Wehkamp et al, (2005) Reduced Paneth cell ⁇ -defensins in ileal Crohn's disease. Proc. Natl. Acad. Sci. U. S.
  • XBPl deficiency in IECs resulted in IREl ⁇ hyperactivation through an unidentified mechanism and increased JNK phosphorylation in the epithelial compartment in vivo.
  • An increased susceptibility to DSS colitis was reported in IREl ⁇ ' mice (Bertolotti et al., (2001) Increased sensitivity to dextran sodium sulfate colitis in IRElbeta-deficient mice. J. Clin. Invest 107, 585-593).
  • IREl ⁇ -deficiency did not lead to spontaneous enteritis, colitis or Paneth cell depletion, baseline levels of grp78 were elevated consistent with an active UPR in the absence of IREl ⁇ .
  • IECs are currently emerging as key mediators of inflammatory and immune mechanisms in mucosal tissues.
  • IEC deletion of IKK ⁇ (Zaph et al., (2007) Epithelial-cell-intrinsic IKK- beta expression regulates intestinal immune homeostasis. Nature 446, 552-556) or NEMO (Nenci et al, (2007) Epithelial NEMO links innate immunity to chronic intestinal inflammation. Nature 446, 557-561), both upstream of NFKB, resulted in mucosal immune dysfunction and spontaneous colitis, respectively, the latter as a consequence of IEC barrier dysfunction. It was found that even minor deficiencies in XBPl expression within IECs lead to spontaneous enteritis, while leaving the intestinal barrier largely intact.
  • IBD is a complex polygenetic disease as evidenced by the recent discovery and replication of several genetic risk factors that include N0D2, the 5q31 haplotype (SLC22A4, SLC22A5), the 5pl3.1 locus (PTGER4), DLG5, the IL23 receptor, ATGl 6Ll, IRGM and IL12B on 5q33, NKX2-3, PTPN2, the 17q23.2 and the 17qll.l loci, and NELLl (Mathew, (2008) New links to the pathogenesis of Crohn disease provided by genome-wide association scans. Nat. Rev. Genet. 9, 9-14).
  • the instant invention suggests that the linkage results obtained on chromosome 22 from three independent microsatellite-based genome scans (Hampe et al, (1999) A genomewide analysis provides evidence for novel linkages in inflammatory bowel disease in a large European cohort. Am. J. Hum. Genet. 64, 808-816; Barmada et al, (2004) A genome scan in 260 inflammatory bowel disease-affected relative pairs. Inflamm. Bowel. Dis. 10, 513-520; Vermeire et al, (2004) Genome wide scan in a Flemish inflammatory bowel disease population: support for the IBD4 locus, population heterogeneity, and epistasis.
  • Gut 53, 980-986) could reflect the associations of rare and common variants of the XBPl gene region reported here.
  • a currently emerging concept is that rare sequence variants with strong phenotypic effects might contribute substantially to variation in complex traits, and the aggregated risk contribution may result in common traits (Cohen et al, (2004) Multiple rare alleles contribute to low plasma levels of HDL cholesterol. Science 305, 869-872; Gorlov et al, (2008) Shifting paradigm of association studies: value of rare single-nucleotide polymorphisms. Am. J Hum. Genet. 82, 100-112), a view strongly supported by analyzing frequencies of synonymous and non-synonymous SNPs in an extensive data set.
  • IBD-associated variants are indeed hypomorphic as would be predicted for risk conferring variants from the mechanisms established through the mouse model present in the instant invention. While the functional impact of non- synonymous SNPs can be estimated by in vitro studies as presented herein, the biological significance and contribution to disease risk of the other associated as well as rare SNPs located outside the coding region is hard to predict; nonetheless, there are excellent examples that those variants could have important functional consequences (Birney et al., (2007) Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature 447, 799-816; Libioulle et ah,
  • Novel Crohn disease locus identified by genome- wide association maps to a gene desert on 5pl3.1 and modulates expression of PTGER4.
  • PLoS. Genet. 3, e58 The phenomenon that multiple rare variants contribute to the overall risk at a particular locus most likely represents a common situation in many complex polygenic diseases (i.e. every patient has a "private" risk SNP). This is also exemplified by N0D2, which not only harbors few common alleles strongly associated with CD, but also multiple rare alleles that - taken together - account for a substantial proportion of disease risk attributed to that locus.

Abstract

The present invention is based, at least in part, on the discovery that certain known and novel SNPs located in the XBP-I genomic region at human chromosome 22q are significantly associated with IBD. Such SNPs are useful for determining the predisposition of a human subject to develop inflammatory bowel disease. Accordingly, the present invention provides methods for detecting at least one SNP in the human XBP-I genomic region, as well as methods to determine the predisposition of a human subject to develop inflammatory bowel disease.

Description

POLYMORPHISMS ASSOCIATED WITH INFLAMMATORY BOWEL
DISEASE
Related Applications This application claims priority to U.S. Provisional Application No. 61/137,492, filed July 31, 2008, the contents of which are hereby incorporated by reference.
Government Funding
Work described herein was supported, at least in part, by National Institutes of Health (NIH) under grants DK44319, P30 DK034854, AI32412, POl AI56296. The government may therefore have certain rights in this invention.
Background of the Invention
A single layer of intestinal epithelial cells (IEC) is the structure in immediate contact with the commensal microbiota and provides an immunologically functional barrier between these luminal microbes and the subepithelial hematopoietic system. IEC function is considered to play a role in inflammatory bowel disease (IBD) (Podolsky,D.K. N. Engl. J. Med. 347, 417-429 (2002)), a disorder thought to result from immune activation by commensal microbiota that presents as Crohn's disease (CD) or ulcerative colitis (UC) (Podolsky,D.K. N. Engl. J. Med. 347, 417-429 (2002)). In the small intestine, the four epithelial cell lineages, absorptive epithelium, goblet, Paneth and enteroendocrine cells, derive from a common, constantly renewing intestinal epithelial stem cell (Reya,T. & Clevers,H. Nature A3A, 843- 850 (2005)). Paneth cells, located at the crypt base, contain several anti-bacterial peptides, α-defensins (cryptdins), and other antimicrobial proteins. A subset of CD is genetically linked to mutations in the intracellular pattern recognition receptor NOD2/CARD15 (Ogura,Y. et al. Nature 411, 603-606 (2001); HugotJ.P. et al. Nature 411, 599-603 (2001)) in association with reduced expression of bactericidal Paneth cell cryptdins (WehkampJ. et al. Proc. Natl. Acad. ScL U. S. A 102, 18129-18134 (2005)). Nod2 deficient mice also exhibit decreased cryptdin expression and impaired clearance of oral Listeria monocytogenes infection (Kobayashi, K.S. et al. Science 307, 731-734 (2005)). However, factors apart from NOD2 must regulate Paneth cell function in IBD since CD patients without the CD-associated ./V0D2 polymorphisms have decreased Paneth cell α-defensins (WehkampJ. et al. Proc. Natl. Acad. ScL U. S. A 102, 18129-18134 (2005)). Nod2 deficient mice also do not develop spontaneous or induced intestinal inflammation (Kobayashi, K.S. et al. Science 307, 731-734 (2005)). Single nucleotide polymorphisms (SNPs), resulting from variations, insertions, or deletions, result in base changes that contribute to phenotypic diversity. Polymorphisms in genes or regulatory regions of genes have been correlated with the development of, or susceptibility, to diseases or other conditions. The genetic risk factors associated with the development of inflammatory bowel disease (IBD) is very important. The identification of genetic polymorphisms that are tightly liked with IBD are desirable and will aid in the diagnosis or prognosis of the disease.
Summary of the Invention The present invention is based, at least in part, on the discovery that certain known SNPs located in the XBP-I genomic region at human chromosome 22q are significantly associated with IBD. Furthermore, several novel SNPs have been discovered in the XBP-I gene of individuals suffering from IBD. Such SNPs are useful for determining the predisposition of a human subject to develop inflammatory bowel disease.
Accordingly, in one aspect the present invention provides methods to determine the predisposition of a human subject to develop inflammatory bowel disease. In certain embodiments, the invention is directed to a method method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting in a nucleic acid sample from the subject at least one single nucleotide polymorphism (SNP) in intron 4 of XBP-I, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
In a one embodiment, the SNP is at position 31 of SEQ ID NO: 170 (i.e., SNP rs35873774), wherein a T at position 31 of SEQ ID NO: 170 indicates that the subject has an increased risk of developing inflammatory bowel disease, and wherein a C at position 31 of SEQ ID NO: 170 indicates that the subject has an decreased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
In another embodiment, the SNP is at position 31 of SEQ ID NO: 169 (i.e., SNP rs2097461), wherein a T at position 31 of SEQ ID NO: 169 indicates that the subject has an increased risk of developing inflammatory bowel disease, and wherein a A at position 31 of SEQ ID NO: 169 indicates that the subject has an decreased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease. In another aspect, the invention is directed to a method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting in a nucleic acid sample from the subject at least one single nucleotide polymorphism (SNP) at position 48 of a nucleic acid sequence selected from the group consisting of SEQ ID NO: 114, 15, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, and 165, thereby determining the predisposition of a human subject to develop inflammatory bowel disease. In another aspect, the invention is directed to a method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting in a nucleic acid sample from the subject at least one single nucleotide polymorphism (SNP) at position 31 of a nucleic acid sequence selected from the group consisting of SEQ ID NO: 166, 167, 168, 169, and 171, wherein a C at position 31 of SEQ ID NO: 166, C at position 31 of SEQ ID NO: 167, C at position 31 of SEQ ID NO: 168, T at position 31 of SEQ ID NO: 169, and T at position 31 of SEQ ID NO: 171 indicate that the subject has an increased risk of developing inflammatory bowel disease, and wherein a wherein a T at position 31 of SEQ ID NO: 166, A at position 31 of SEQ ID NO: 167, A at position 31 of SEQ ID NO: 168, A at position 31 of SEQ ID NO: 169, and G at position 31 of SEQ ID NO: 171, indicates that the subject has an decreased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
In another aspect, the invention is directed to a method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting in a nucleic acid sample from the subject a single nucleotide polymorphism (SNP), at position 31 of SEQ ID NO: 170, wherein a T at position 31 of SEQ ID NO: 170 indicates that the subject has an increased risk of developing inflammatory bowel disease, and wherein a C at position 31 of SEQ ID NO: 170 indicates that the subject has an decreased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
In still another aspect, the invention is directed to a method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting the single nucleotide polymorphisms (SNP) at position 31 of SEQ ID NO: 166, 168, 170, 172, 173, 174, and 175,wherein a T at postion 31 of SEQ ID NO: 166, a C at postion 31 of SEQ ID NO: 168, a C at postion 31 of SEQ ID NO: 170, a T at postion 31 of SEQ ID NO: 172, a G at postion 31 of SEQ ID NO: 173, a T at postion 31 of SEQ ID NO: 174, and a C at postion 31 of SEQ ID NO: 175 indicates that said subject has an increased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
In yet another aspect, the invention is directed to a method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting the single nucleotide polymorphisms (SNP) at position 31 of SEQ ID NO: 166, 168, 170, 172, 173, 174, and 175, wherein a T at postion 31 of SEQ ID NO: 166, a A at postion 31 of SEQ ID NO: 168, a T at postion 31 of SEQ ID NO: 170, a T at postion 31 of SEQ ID NO: 172, a G at postion 31 of SEQ ID NO: 173, a T at postion 31 of SEQ ID NO: 174, and a C at postion 31 of SEQ ID NO: 175 indicates that said subject has an decreased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
In yet another aspect, the invention is directed to a method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting the single nucleotide polymorphisms (SNP) at position 31 of SEQ ID NO: 166, 168, 170, 172, 173, 174, and 175, wherein a C at postion 31 of SEQ ID NO: 166, a A at postion 31 of SEQ ID NO: 168, a C at postion 31 of SEQ ID NO: 170, a T at postion 31 of SEQ ID NO: 172, a G at postion 31 of SEQ ID NO: 173, a T at postion 31 of SEQ ID NO: 174, and a T at postion 31 of SEQ ID NO: 175 indicates that said subject has an decreased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
In one embodiment, the single nucleotide polymorphism (SNP) is determined by primer extension of at least one PCR product and MALDI-TOF analysis.
In one embodiment, at least one oligonucleotides primer selected from the group consisting of SEQ ID NO: 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, and 113 is used to detect the SNP.
In one embodiment, the inflammatory bowel disease is Crohn' s disease or Ulcerative Colitis.
In still another aspect, the invention is directed to an isolated and purified allele- specific oligonucleotide probe of about 5 to about 50 nucleotides that specifically detects a single nucleotide polymorphisms (SNP) at position 48 of a sequence selected from the group consisting of SEQ ID NO: 114, 15, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, and 165 etc. In yet another aspect, the invention pertains to a diagnostic kit comprising an oligonucleotide that specifically detects a single nucleotide polymorphisms (SNP) at position 48 of a sequence selected from the group consisting of SEQ ID NO: 114, 15, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, and 165.
Brief Description of the Figures
Figure 1 depicts a general scheme for the gene targeting strategy. A. Schematic representation of the gene targeting strategy. A floxed Xbpl allele was generated by homologous recombination in W4/129 embryonic stem (ES) cells. The targeting vector contains a loxP site in intron 3 and a floxed neomycin resistance gene cassette (neo) in intron 2 of the Xbpl gene. A targeted ES cell clone identified by Southern blot was injected into C57BL/6 blastocysts to obtain chimeras, which were subsequently bred to establish the Xbpla°xaso strain. Xbpla°™so mice were mated with EIIacre transgenic mice to induce a partial Cre-mediated recombination. Male mice with the greatest deletion of the neo cassette were mated with wild type female mice to obtain an XbplΑox strain. B. Breeding of Xbplao7i mice with Villin-( V) Cre transgenic mice resulted in the deletion of exon 2 of the Xbpl gene as confirmed by Southern blot. Total RNAs were isolated from small intestinal mucosal scrapings of untreated (NT) or mice injected with 1 mg/kg tunicamycin and harvested 6 hours later, and analyzed for the expression of XBPl mRNA by Northern blot and RT-PCR followed by DNA sequencing. The mutant XBPl mRNA produced by Xbpl&/A mice is slightly smaller than the wild type XBPl mRNA, due to the deletion of exon 2 as confirmed by DNA sequencing of the cDNA. The IREl splicing site of XBPl mRNA is located downstream of the floxed exon 2 in exon 4, which hence allowed to monitor splicing status in mRNA transcribed from floxed and Cre-deleted XBPl alleles alike. Absence of XBPl protein was confirmed by Western blotting of small intestinal mucosal scraping protein lysates from untreated and tunicamycin-injected mice. C. Deletion of exon 2 in the mutant XBPl mRNA resulted in the change of the translational reading frame, introducing a premature translational termination codon. D. Truncated XBPl protein is not functional as evidenced by its failure to upregulate expression of a prototypical XBPIs target gene, ERdj4 (Dnajb9) upon ER stress induction through tunicamycin injection, as determined by qPCR on small intestinal mucosal scraping specimens. In contrast, tunicamycin injection led to upregulation of Chop (Ddit3) mRNA expression, transcriptionally regulated by PERK- Atf4 during ER stress, in XBPlflox/floxVCre mice, indicating that other branches of the UPR are intact in the presence of a non-functional, truncated XBPl. E. Livers and spleens of XBPlflox/floxVCre (XBPl ' ) and χBPlflox/flox (XBP1+/+) mice were analyzed for XBPl mRNA levels (primers binding in the floxed region) quantified by qPCR (n = 2 per group).
Figure 2 depicts spontaneous enteritis and Paneth cell loss in XBPl"'" mice. A. Small intestinal mucosal scrapings (n = 8 per group) from Xbpl -deleted ("XBPl"'"") and Xbpl -sufficient ("XBP1+/+") mouse intestinal epithelium were analyzed for cryptdin-1 (Defcrl), cryptdin-4 (Defcr4), cryptdin-5 (Defcr5), lysozyme (Lysz), mucin-2 (Muc2), cathelicidin (Campl), and XBPl (primers binding in the floxed region) mRNA expression. Data are expressed as fold decrease in XBPl"'" compared to XBP1+/+ specimens, normalized to β-actin (Student's t test). B. Fold increase in grp78 mRNA expression in XBPl"'" compared to XBP1+/+ epithelium, normalized to β-actin (n = 3 per group, Student's t test). C. Spontaneous enteritis in XBPl"'" mice (upper panels and lower left panel), and normal histology of XBP1+/+ mice (lower right panel). Upper left, cryptitis with villous shortening, crypt regeneration and architectural distortion; upper right, neutrophilic crypt abscesses; lower left, duodenitis with surface ulceration and granulation tissue. D. Paneth cells with typical eosinophilic granules on H&E stained sections at the base of crypts in XBP1+/+, but not XBPl ' epithelium. Electron microscopy (EM) with only rudimentary electron-dense granules and a contracted ER in XBPl"'" basal crypt epithelial cells, normal configuration in XBP+/+ mice. Immunohistochemistry (IHC) for the granule proteins lysozyme and pro-cryptdin in XBP1+/+ and XBPl"'" epithelia. E. Enumeration of Paneth cells and goblet cells in small intestines (n = 5 per group, Student's t test). F. Goblet cell staining by PAS in XBPl +/+ and XBPl , -/- epithelia. EM exhibited smaller cytoplasmic mucin droplets and a contracted ER in XBPl ,-/- goblet cells. No structural abnormalities were found in neighboring absorptive epithelia in XBPl ' mice. G. The marker for enteroendocrine cells, chromogranin, was detected by IHC in small intestines of XBP1+/+ and XBPl ' mice. H. XBP1+/+ and XBPl"'" mice were orally administered FITC-dextran, and FITC- dextran serum levels assayed 4 hours later. Figure 3 depicts the result showing that villinCre-mediated XBPl deletion leads to Chop induction, intestinal inflammation, and does not affect colonic goblet cells or small intestinal enteroendocrine cells. A. Chop (Ddit3) mRNA expression was analyzed in small intestinal mucosal scrapings from XBP1+/+ and XBPl"'" mice (n = 7 per group). B. H&E stains of XBP1+/ small intestine, showing polymorphonuclear infiltration in the lamina propria (arrows point toward neutrophils between crypts). C. Goblet cells in the large intestine were identified by PAS staining (n = 3 per genotype). D. Chromogranin"1" cells per immunostained section were quantified by light microscopy (n = 4 per group). Figure 4 depicts the result that XBPl deletion does not regulate genes involved in intestinal cell fate decisions. A. Expression of indicated genes was analyzed in small intestinal mucosal scrapings of XBP1+/+ and XBPl "'" mice, n = 11-19 per group. Two- tailed Student's t-test. No significant differences were observed. B. Small intestinal paraffin-embedded sections were stained by anti-β-catenin. Representative of 5 specimens per genotype. Figure 5 depicts the result that XBPl deletion results in apoptotic Paneth cell loss, inflammation, a distorted villus:crypt ratio, and IEC hyperproliferation. A. Apoptotic nuclei were identified in XBP1+/+ (XBPlflox/floxVCre) and XBPl 7 (XBPlflox/flox) sections with anti-active (cleaved) caspase-3. Arrows point to apoptotic cells. B.
Figure imgf000008_0001
mice were administered 5 daily doses of 1 mg tamoxifen to induce deletion of the χBPlfloxneo gene in the intestinal epithelium. XBPl, cryptdin-5 (Defcr5), and Chop mRNA (all expressed normalized to β-actin; left y axis) expression in epithelium during and after tamoxifen treatment. Percentage of crypts with Paneth cells on H&E staining is shown (right y axis). Representative experiment of 3 performed. C. TUNEL and H&E staining on small intestinal sections of tamoxifen- treated XBPla°XΩe°m°"ieoWCτe-ΕRn mice collected at the indicated days. D. TUNEL+ and caspase-3+ cells were enumerated by light microscopy (3 mice per time-point with ileal and jejunal sections each; P values indicate comparisons to time-point 0; Student's t test). E. TNFα mRNA was quantified by qPCR in small intestinal epithelial scrapings from ileum harvested at the indicated time-points after start of tamoxifen administration from VCre-ERT2 χBplfloxIieo/floxIieo („ = 4 per time-point) or χBplfloxIieo/floxIieo („ = 1 per time-point) mice. P values indicate comparisons to time-point 0; Student's t test. F. Enteritis in the small intestine in VCre-ERT2 XBP lfloxneo/floxneo mice on day 5 after TAM administration. Upper left panel, 10Ox; upper right panel, same section, 40Ox, arrow points to a crypt abscess; lower panel 10Ox, crypts with Paneth cells (arrows). G. Jejunal sections of XBPlflox/flox (XBPl+/+; n = l) and XBPlflox/floxVCre (XBPl 7 ; n = 8) mice were assessed for their vilrus:crypt ratio on H&E stainings (ratios of > 4:1 are considered normal for jejunum). H. χBPlflox/flox (XBP1+/+) and XBPlflox/floxVCre (XBPl"'") mice were administered bromodeoxyuridine (BrdU) Lp., and small intestinal sections harvested after 1 hour and 24 hours (n = 3 per genotype per time-point). The 1 hour time-point labels the pool of proliferating IEC in the crypts (mostly transit amplifying IEC), whereas the 24-hour time -point assesses the migration along the crypt- villus axis indicating the turn-over of the IEC compartment. Figure 6 depicts the result that XBPl deletion leads to the presence of apoptotic cells in the epithelium. A. Apoptotic nuclei were identified in XBP1+/+ (XBPlflox/flox) and XBPl 7 (XBPlflox/floxVCre) sections by TUNEL staining. Arrows point to apoptotic cells. B. Deletion of XBPl gene in χBP1 fl°^°/fl°^°VCreERT2 mice was induced by a 5 day administration of 1 mg tamoxifen i.p. daily, and apoptotic cells stained by an anti- active (cleaved) caspase-3 antibody. Time-points in the figure indicate the length after start of tamoxifen administration. Arrows point to apoptotic cells.
Figure 7 depicts the result that XBPl deficiency in epithelium results in impaired antimicrobial function. A. Lower panel. Small intestinal tissue from XBP1+/+ and XBPl" '~ mice was homogenized, resolved on SDS-PAGE and detected by anti-lysozyme IgG and GAPDH to ensure equal loading. Upper panel. Small intestinal crypts isolated from XBP1+/+ and XBPl 7 animals were stimulated with lOμM carbamyl choline (CCh). Supernatants were precipitated, resolved on SDS-PAGE and detected by anti-lysozyme IgG. Blots are representative of 2 independent experiments. B. Small intestinal crypts were stimulated with LPS for 30 minutes, and supernatants assayed for bactericidal activity. Data are expressed as % killing compared to unstimulated crypts, and are representative of 2 independent experiments. C. Intestinal epithelial cell- specific XBPl"7" mice (n = 9) and XBP1+/+ littermates (n = 9; 5-10 weeks of age) were perorally infected with 3.6x108 L. monocytogenes. Faeces was aseptically collected 10 hours after infection and colony forming units (c.f.u.) of L. monocytogenes determined. Data are presented as c.f.u. per mg dry weight of faeces. D. Oral infection with L. monocytogenes was performed as in (C), liver and spleen aseptically harvested 72 hours after infection, and c.f.u. of L. monocytogenes determined (XBP1+/+ n = 20; XBPl "'" n = 17). Data are expressed as c.f.u. per organ. Two-tailed Mann-Whitney test was performed for (C) and (D).
Figure 8 depicts the result that XBPl deficiency results in increased inflammatory tone of the epithelium. A. Small intestinal and colonic epithelial mRNA scrapings from XBP1+/+, XBP1+/ , and XBPl 7 mice were analyzed for XBPl mRNA splicing status. B. Small intestinal formalin-fixed sections were stained with rabbit anti- phospho-JNK antibody, and revealed a patchy staining pattern in XBPl"'", but not XBP1+/+ sections. Control rabbit mAb was negative (not shown). Representative of n = 5 per group. C. MODE-K.iXBP and MODE-K.Control were stimulated for the indicated time periods with flagellin (1 μg/ml) and TNFα (50 ng/ml) and analyzed for P-JNK and total JNK by Western. D. MODE-K.iXBP (filled circles) and MODE-K.Ctrl (open circles) cells were stimulated for 4 hours with flagellin, and supernatants assayed by ELISA for CXCLl. E. Experiment as in (D), with TNFα. F. MODE-K.iXBP (circles) and MODE-K.Ctrl (diamonds) cells were stimulated with either lOμg/ml flagellin (filled symbols) or media alone (open symbols) for 4h, with the JNK inhibitor SP600125 and supernatants assayed for CXCLl. G. As in (F), MODE-K cells were stimulated with 50 ng/ml TNFα (filled symbols) or media alone (open symbols). H. MODE-K.iXBP (filled circles) and MODE-K.Ctrl (open circles) cells loaded with the glycolipid antigen α- galactosylceramide (αGC), fixed, and co-cultured with the CD Id-restricted NKT cell hybridoma DN32.D3 and antigen presentation measured as IL-2 release from DN32.D3. Figure 9 depicts the result that inhibitors of p38 and ERK1/2 phosphorylation do not affect CXCLl secretion in XBPl-silenced MODE-K cells. A. MODE-K.iXBP (filled symbols) and MODE-K.Ctrl (open symbols) cells were stimulated for 4 hours with 50ng/ml TNFα in the presence of the indicated optimal concentrations of inhibitors (PD98059, inhibitor of MAP kinase kinase [MEK]; SB203580, p38 kinase inhibitor; U0126, MEK1/MEK2 inhibitor). Supernatants were assayed for CXCLl. B. Experiment as in (A), except for stimulation with lOμg/ml flagellin instead of TNFα.
Figure 10 depicts the result that XBPl-silenced MODE-K cells are more sensitive to TNFα induced apoptosis. A. MODE-K.Control and MODE-K.iXBPl cells were cultured for 4 hours in medium alone, 50 ng/ml TNFα, or 10 μg/ml flagellin, trypsinized and analyzed for intracellular presence of cleaved caspase-3 by flow cytometry. B. Same experiment as in (A) with cells stimulated with 50 ng/ml TNFα, except for that adherent cells were fixed and stained for cleaved caspase-3 (red) and nuclei (DAPI; blue) by immunofluorescence.
Figure 11 depicts the result that XBPl deficiency increases susceptibility to DSS colitis. A. 4.5% DSS was administered in drinking water for 5 days and then replaced by regular drinking water in XBP1+/+ (n = 9), XBP1+/ (n = 9) and XBPl 7 (n = 12) littermates (age 6-12 weeks). Wasting is presented as % of initial weight. One-tailed Student's t test was performed. B. Presence of rectal bleeding during DSS colitis was assessed daily and scored as in Methods. Mean + s.e.m.; XBPl+/+ (w = 9), XBPl+/~(ra = 9) XBPl 7 (n = 12). Two-tailed Mann- Whitney test was peformed. C. Individual signs of inflammation of colonic tissue harvested on day 8 of DSS colitis were scored blindly. Two-tailed Mann-Whitney test was performed. D. Typical colonic histology on day 8 of DSS colitis. Arrows, borders of ulcers. E. rriRNA expression (normalized to β-actin) of inflammatory mediators was quantified by qPCR in colonic specimens on day 8 of DSS colitis, n = 4 per group. Mean + s.e.m analyzed by two-tailed Mann- Whitney test. F. Human ileum in Crohn's disease exhibits signs of ER stress. Inflamed ("CD-I", n = 3) and non-inflamed ("CD-NI", n = 3) ileal biopsies from CD patients and healthy control ("Ctrl", n = A) subjects were analyzed for grp78 rriRNA expression (levels in Controls were arbitrarily set at 1, and CD-I and CD-NI levels expressed as ratio to Controls; left y axis). XBPl mRNA splicing is expressed as ratio of XBPls/XBPu (right y axis). G. Human colon mucosa in Crohn's disease ("CD") and ulcerative colitis ("UC") exhibits signs of ER stress. Colonic biopsies from inflamed ("-I") and noninflamed ("-NI") CD and UC patients (n = 3 each) and healthy control subjects ("Ctrl", n = A) were analyzed for grp78 mRNA expression and XBPl splicing as described in (F).
Figure 12 depicts the result that antibiotic treatment during 7% DSS colitis abrogates genotype-related differences in susceptibility to colitis. A. XBP1+/+ (n = 6) and XBPl 7 (n = 4) littermates were treated with antibiotics (neomycin sulfate, 1.5g/l; metronidazole, 1.5g/l) in drinking water during the 5 days of high-dose DSS (7%; commensal flora-depleted mice are less susceptible to DSS colitis, which requires an increase in DSS dose to achieve colonic inflammation) administration as well as during the subsequent time on regular drinking water. Wasting was monitored by daily weight measurements. B. Colonic specimens harvested on day 8 of 7% DSS colitis in the presence of antibiotics were histologically assessed for inflammation. Two-tailed Mann- Whitney test. Figure 13 depicts the regional association plot and structure of linkage disequilibrium (LD) across the XBPl gene. A. Plot of the negative natural logarithm of the P- values obtained in fine mapping of the 120 kb region around the XBPl candidate gene. Twenty tagging SNPs were genotyped in overall 5322 controls, 2762 Crohn disease (CD), and 1627 ulcerative colitis (UC) patients (combined Panel 1+2+3). Negative log P- values are also shown for the combined inflammatory bowel disease (IBD) panel (CD+UC). The red dotted line corresponds to a significance threshold of 0.05 and the blue dotted line to the significance threshold according to the Bonferroni correction for multiple testing applied to the fine mapping results (n = 20). Positions are in NCBI's build 35 coordinates. For genotype counts see Table 4. B. shows the plotted recombination rate (in centimorgans [cM] per Mb), while C. shows the sequence conservation score based on 16 different species (taken from UCSC Genome Browser, Vertebrate Multiz Alignment & Conservation). D. The position and intron/exon structure of underlying genes. E. The pairwise LD in the combined sample for the 20 genotyped variants using the metric r2 and the GOLD color scheme.
Figure 14 depicts the deep sequencing of XBPl. All five exons and 4.3 kb of 5' upstream sequence were resequenced in 282 unaffected controls, 282 Crohn's disease, and 282 ulcerative colitis patients (total of 846 samples); the five XBPl exons were sequenced in 282 additional ulcerative colitis patients resulting in a total of 1128 patient and control DNAs analyzed. Chromosomal location of XBPl and amplicons used for sequencing are shown in the context of XBPIs and XBPIu transcripts. The panel underneath the transcript panel shows the sequence conservation score based on 16 different species (taken from UCSC Genome Browser, Vertebrate Multiz Alignment & Conservation). SNPs are presented in the context of their genomic localization. SNPs of particular interest are highlighted by color-coding as indicated. For further details on deep sequencing see Table 5.
Figure 15 depicts the result that rare XBPl variants are hypomorphic. A. MODE- K cells were transfected with UPRE-luciferase and unspliced hXBPlu expression plasmids encoding the rare, IBD-associated minor alleles XBPlsnp8 (M139I) and XBPl snpl 7 (A162P) and treated with 1 μg/ml Tm. Values represent luciferase activities normalized to cotransfected Renilla reporter. B. Experiments as in (a), with indicated amounts of spliced hXBPls cDNA variants C. Transduction efficiency measured by FACS of XBPl 7 MEF cells reconstituted with human XBPl wildtype or SNP variants bi-cistronic retroviral vectors (RVGFP) (MFI, mean fluorescence intensity). D. XBPIs protein levels were determined by western blot of Tm-treated cells (*, non-specific band). E. ERdj4 and EDEM rriRNA levels (normalized to β-actin mRNA expression) in untreated (NT) or Tm (1 μg/ml)-treated cells for 6 hours. Figure 16 depicts the result that the rare non-synonymous XBPlsnp22 (P15L) variant does not affect UPRE transactivation. A. MODE-K cells were transfected with UPRE-luciferase and unspliced hXBPlu expression plasmids harbouring the rare, minor allele of XBPlsnp22 (P 15L), which occurs at equal frequencies in IBD patients and controls (Table 5). Luciferase activity (values presented normalized to cotransfected Renilla activities) was assessed in transfected cells treated with and without 1 μg/ml tunicamycin. B. Experiments as in (A), except that spliced hXBPls cDNA P15L variant was transfected into MODE-K cells (in the absence of tunicamycin treatment).
Figure 17 depicts the result that the IEC- specific XBPl deficiency leads to Paneth cell dysfunction and a pro-inflammatory tone of the mucosa. A. Regular function of the IRE1/XBP1 axis. Continuous ER stress due to the high protein burden in IEC (in particular Paneth cells) leads to activation of the UPR and low-level baseline XBPl splicing. XBPIs protein regulates transcription of XBPIs target genes, required for normal IEC and Paneth cell function. B. Decrease or absence of functional XBPl proteins leads to a decrease in the expression of XBPIs target genes, and hence an inefficient UPR and accumulation of misfolded or unfolded proteins in highly secretory IECs and Paneth cells. This leads to increased ER stress, which leads dominantly to overactivation of IREl α through a yet to be defined mechanism, which manifests in the model of the instant invention as increased XBPl splicing and - through TRAF2 - as increased JNK phosphorylation upon ligation of TNFRl with TNFα or TLR5 with flagellin. The aforementioned increased ER stress in the absence of XBPIs protein leads further to increased expression of Chop, a major link between the UPR and apoptosis, which results in Paneth cell dysfunction and apoptosis. Alterations in the composition of the intestinal microbiota, or increased bacterial burden due to defensin deficiency in epithelium with impaired or absent Paneth cell function, might lead to increased flagellin expression, further fueling the pro-inflammatory JNK pathway that in turn increases pro-inflammatory gene expression including TNFα. TNFα consequently binds to TNFRl, with the TRAF2-IRE1 interaction further increasing phosphorylation of JNK. As a consequence, intestinal inflammation with features characteristic of IBD develops spontaneously.
Detailed Description The present invention is based, at least in part, on the discovery that certain known SNPs located in the XBP-I genomic region at human chromosome 22q are significantly associated with IBD. Furthermore, several novel SNPs have been discovered in the XBP-I gene of individuals suffering from IBD. Such SNPs are useful for determining the predisposition of a human subject to develop inflammatory bowel disease. Accordingly, the present invention provides methods for detecting at least one SNP in the human XBP-I genomic region as well as methods to determine the predisposition of a human subject to develop inflammatory bowel disease.
/. Definitions The term "polymorphism" refers to the coexistence of more than one form of a gene, or portion thereof, or a segment of DNA. A portion of a gene or segment of DNA of which there are at least two different forms, i.e., two different nucleotide sequences, is referred to as a "polymorphic region." A polymorphic locus can be a single nucleotide, the identity of which differs in the other alleles. A polymorphic locus can also be more than one nucleotide long. The allelic form occurring most frequently in a selected population is often referred to as the reference and/or wildtype form. Other allelic forms are typically designated or alternative or variant alleles. Diploid organisms may be homozygous or heterozygous for allelic forms. A diallelic or biallelic polymorphism has two forms. A trialleleic polymorphism has three forms. In one embodiment, a polymorphism is a single nucleotide polymorphism.
The term "single nucleotide polymorphism" (SNP) refers to a polymorphic site occupied by a single nucleotide (and the complementary nucleotide with which it forms a base-pair in a double stranded nucleic acid sequence), which is the site of variation between allelic sequences. A SNP usually arises due to substitution of one nucleotide for another at the polymorphic site. SNPs can also arise from a deletion of a nucleotide or an insertion of a nucleotide relative to a reference allele. Typically the polymorphic site is occupied by a base other than the reference base. For example, where the reference allele contains the base "T" (thymidine) at the polymorphic site, the altered allele can contain a "C" (cytidine), "G" (guanine), or "A" (adenine) at the polymorphic site.
SNP' s may occur in protein-coding nucleic acid sequences, in which case they may give rise to a defective or otherwise variant protein, or genetic disease. Such a SNP may alter the coding sequence of the gene and therefore specify another amino acid (a "missense" SNP) or a SNP may introduce a stop codon (a "nonsense" SNP). When a SNP does not alter the amino acid sequence of a protein, the SNP is called "silent." SNP' s may also occur in noncoding regions of the nucleotide sequence. This may result in defective protein expression, e.g., as a result of alternative spicing, or it may have no effect.
The term "linkage" describes the tendency of genes, alleles, loci or genetic markers to be inherited together as a result of their location on the same chromosome. It can be measured by percent recombination between the two genes, alleles, loci, or genetic markers. The term "linkage disequilibrium," also referred to herein as "LD," refers to a greater than random association between specific alleles at two marker loci within a particular population. In general, linkage disequilibrium decreases with an increase in physical distance. If linkage disequilibrium exists between two markers, or SNPs, then the genotypic information at one marker, or SNP, can be used to make probabilistic predictions about the genotype of the second marker. As used herein, the term "detect" with respect to polymorphic elements includes various methods of analyzing for a polymorphism at a particular site in the genome. The term "detect" includes both "direct detection," such as sequencing, and "indirect detection," using methods such as amplification amd/or hybridization.
As used herein, the term "XBP-I" refers to a X-box binding human protein that is a DNA binding protein and has an amino acid sequence as described in, for example, Liou, H-C. et. al. (1990) Science 247:1581-1584 and Yoshimura, T. et al. (1990) EMBO J. 9:2537-2542, and other mammalian homologs thereof, such as described in Kishimoto T. et al., (1996) Biochem. Biophys. Res. Commun. 223:746-751 (rat homologue). Exemplary proteins intended to be encompassed by the term "XBP-I" include those having amino acid sequences disclosed in GenBank with accession numbers A36299 [gi:105867], NP_005071 [gi:4827058], P17861 [gi:139787], CAA39149 [gi:287645], and BAA82600 [gi:5596360] or e.g., encoded by nucleic acid molecules such as those disclosed in GenBank with accession numbers AF027963 [gi: 13752783]; NM_013842 [gi: 13775155]; or M31627 [gi: 184485]. XBP-I is also referred to in the art as TREB5 or HTF (Yoshimura et al. 1990. EMBO Journal. 9:2537; Matsuzaki et al. 1995. J. Biochem. 117:303).
As used herein, the term "XBP-I gene" refers to the coding sequence of XBP-I found in genomic DNA, as well as the intronic sequences and 5' and 3' untranslated/regulatory regions of the XBP-I gene. For example, in one embodiment, an XBP-I gene includes, for example, about 5 kb, about 4 kb, about 3 kb, about 2 kb, about 1 kb of genomic DNA upstream of the XBP-I ATG initiation codon or downstream of the XBP-I termination codon. As used herein, the term "NOD2-CARD15" refers to the caspase recruitment domain family member 15. The nucleotide and amino acid sequence of NOD2- CARD15 can be found in, for example, GenBank Accession No.: gi:11545911, the contents of which are incorporated by reference. Several polymorphisms associated with susceptibility to inflammatory bowel disease have been identified and include, for example, a frameshift variant and two missense variants (Hugot, et al. Nature 411, 599- 603 (31 May 2001) and Ogura, et al. Nature 411, 603-606 (31 May 2001)), the contents of each of which are incorporated by reference. One of skill in the art can readily determine the presence or absence of these polymorphisms.
//. Isolation of Genetic Material
The IDB-associaed SNPs disclosed herein are useful as markers, e.g., to make assessments regarding the propensity of an individual to develop inflammatory bowel disease or a related condition, and/or regarding the ability of an individual to respond to a certain course of treatment.
Genetic material suitable for use in such assays can be derived from a variety of sources. For example, nucleic acid molecules (e.g., mRNA or DNA, preferably genomic DNA) can be isolated from a cell from a living or deceased individual using standard methods. Cells can be obtained from biological samples, e.g., from tissue samples or from bodily fluid samples that contain cells, such as blood, urine, semen, or saliva. The term "biological sample" is intended to include tissues, cells and biological fluids containing cells which are isolated from a subject, as well as tissues, cells and fluids present within a subject.
Body samples may be obtained from a subject by a variety of techniques known in the art including, for example, by the use of a biopsy or by scraping or swabbing an area or by using a needle to aspirate. Methods for collecting various body samples are well known in the art.
Tissue samples suitable for use in the methods of the invention may be fresh, frozen, or fixed according to methods known to one of skill in the art. In one embodiment, suitable tissue samples are sectioned and placed on a microscope slide for further analyses. In another embodiment, suitable solid samples, i.e., tissue samples, are solubilized and/or homogenized and subsequently analyzed as soluble extracts.
The subject detection methods of the invention can be used to detect polymorphic elements in DNA in a biological sample in intact cells (e.g., using in situ hybridization) or in extracted DNA, e.g., using Southern blot hybridization. In one embodiment, immune cells are used to extract genetic material for use in the subject assays. ///. Uses of Polymorphic Elements Of The Invention
In addition to being useful as markers to determine an individual's predisposition to inflammatory bowel disease or a related condition, the SNPs of the invention are useful as markers in, e.g., in diagnostic assays, prognostic assays, and in monitoring clinical trials for the purposes of predicting outcomes of possible or ongoing therapeutic approaches. The results of such assays can, e.g., be used to prescribe a prophylactic course of treatment for an individual, to prescribe a course of therapy after onset of IBD, or to alter an ongoing therapeutic regimen.
Accordingly, one aspect of the present invention relates to diagnostic assays for detecting polymorphisms, e.g., SNPs, in a biological sample {e.g., cells, fluid, or tissue) to thereby determine whether an individual is afflicted with IBD, or is at risk of developing IBD. In one embodiment, the methods of the invention can be characterized as comprising detecting, in a sample of cells from the subject, the presence or absence of a specific allelic variant, e.g., SNP, of one or more polymorphic regions of an XBPl gene. The allelic differences can be: (i) a difference in the identity of at least one nucleotide (or complement thereof) or (ii) a difference in the number of nucleotides (or complements thereof), which difference can be a single nucleotide at multiple sites or several nucleotides. SNPs suitable for determining an individual's predisposition to inflammatory bowel disease or a related condition as disclosed in Tables 4, 5, 6, 7 and 8 herein. The skilled artisan will appreciate that, although the DNA context of each SNP is presented herein as a single stranded nucleic acid sequence, the complement of that sequence can also be employed to determine the presence of the desired SNP.
Multiple SNPs can be assayed simultaneously to determine the haplotype of an individual. As disclosed herein in Table 7, haplotypes can be protective from IBD (e.g., haploytpes 5 and 7 in Table 7) or prdipose to IBD (e.g., haploytpe 4 in Table 7).
The subject assays can also be used to determine whether an individual is at risk for passing on the propensity to develop a disease or disorder to an offspring. The invention also provides for prognostic (or predictive) assays for determining whether an individual is at risk of developing inflammatory bowel disease. The invention can also be used in prenatal diagnostics.
In another embodiment, the methods further involve obtaining a control biological sample from a control subject, determining one or more polymorphic elements in the sample and comparing the polymorphisms present in the control sample with those in a test sample. The invention also encompasses kits for detecting the polymorphic elements in a biological sample. For example, the kit can comprise a primer capable of detecting one or more SNP sequences in a biological sample. The kit can further comprise instructions for using the kit to detect SNP sequences in the sample. IV. Detection of Polymorphisms
Practical applications of techniques for identifying and detecting polymorphisms relate to many fields including disease diagnosis.
DNA polymorphisms can occur, e.g., when one nucleotide sequence comprises at least one of 1) a deletion of one or more nucleotides from a polymorphic sequence; 2) an addition of one or more nucleotides to a polymorphic sequence; 3) a substitution of one or more nucleotides of a polymorphic sequence, or 4) a chromosomal rearrangement of a polymorphic sequence as compared with another sequence. As described herein, there are a large number of assay techniques known in the art which can be used for detecting alterations in a polymorphic sequence (suitable detection methods are disclosed, for example, in US Patent Number 7,306,913, which is hereby incorporated by refernce in its entirety). In one embodiment, analysis of polymorphisms is amenable to highly sensitive
PCR approaches using specific primers flanking the sequence of interest. Oligonucleotide primers corresponding to XBP-I sequences can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer. In one embodiment, detection of the polymorphism involves the use of a probe/primer in a polymerase chain reaction (PCR) (see, e.g., U.S. Patent Nos. 4,683,195 and 4,683,202), such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e.g., Landegran et al. (1988) Science 241:1077-1080; and Nakazawa et al. (1994) PNAS 91:360-364). In one embodiment, genomic DNA of a cell is exposed to two PCR primers and amplification for a number of cycles sufficient to produce the required amount of amplified DNA.
This method can include the steps of collecting a sample of cells from a patient, isolating nucleic acid (e.g., genomic, DNA) from the cells of the sample, contacting the nucleic acid sample with one or more primers which specifically amplify a subject SNP under conditions such that hybridization and amplification of the sequence occurs, and detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample. It is anticipated that PCR and/or LCR may be desirable to use as a preliminary amplification step in conjunction with any of the techniques used for detecting polymorphisms described herein. In one preferred embodiment, detection of single nucleotide polymorphisms
("SNP") and point mutations in nucleic acid molecules is based on primer extension of PCR products by DNA polymerase. This method is based on the fact that the nucleoside immediately 5' adjacent to any SNP/point mutation site is known, and the neighboring sequence immediately 3' adjacent to the site is also known. A primer complementary to the sequence directly adjacent to the SNP on the 3' side in a target polynucleotide is used for chain elongation. The polymerase reaction mixture contains one chain-terminating nucleotide having a base complementary to the nucleotide directly adjacent to the SNP on the 5' side in the target polynucleotide. An additional dNTP may be added to produce a primer with the maximum of a two-base extension. The resultant elongation/termination reaction products are analyzed for the length of chain extension of the primer, or for the amount of label incorporation from a labeled form of the terminator nucleotide. (See, e.g., U.S. Patent No. 6,972,174, the contents of which are incorporated by reference).
In one preferred embodiment, a polymorphism is detected by primer extension of PCR products, as described above, followed by chip-based laser deionization time-of- flight (MALDI-TOF) analysis, as described in, for example U.S. Patent No. 6,602,662, the contents of which are incorporated by reference. Alternative amplification methods include: self sustained sequence replication
(Guatelli, J.C. et al, 1990, Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh, D.Y. et al, 1989, Proc. Natl. Acad. Sci. USA 86:1173- 1177), Q-Beta Replicase (Lizardi, P.M. et all, 1988, Bio/Technology 6:1197), or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.
In one embodiment, after extraction of genomic DNA, amplification is performed using standard PCR methods, followed by molecular size analysis of the amplified product (Tautz, 1993; Vogel, 1997). In one embodiment, DNA amplification products are labeled by the incorporation of radiolabeled nucleotides or phosphate end groups followed by fractionation on sequencing gels alongside standard dideoxy DNA sequencing ladders. By autoradiography, the size of the repeated sequence can be visualized and detected heterogeneity in alleles recorded. In another embodiment, the incorporation of fluorescently labeled nucleotides in PCR reactions is followed by automated sequencing. (Yanagawa, T., et al, (1995). / Clin Endocrinol Metab 80: 41-5 Huang, D., et al, (1998). J Neuroimmunol 88: 192-8.
In other embodiments, polymorphisms can be identified by hybridizing a sample and control nucleic acids to high density arrays containing hundreds or thousands of oligonucleotides probes (Cronin, M.T. et al (1996) Human Mutation 7: 244-255; Kozal, MJ. et al (1996) Nature Medicine 2: 753-759). For example, polymorphisms can be identified in two dimensional arrays containing light-generated DNA probes as described in Cronin, M.T. et al supra. Briefly, a first hybridization array of probes can be used to scan through long stretches of DNA in a sample and control to identify base changes between the sequences by making linear arrays of sequential overlapping probes. This step allows the identification of polymorphisms. This step is followed by a second hybridization array that allows the characterization of specific polymorphisms by using smaller, specialized probe arrays complementary to all polymorphisms detected.
In one embodiment, any of a variety of sequencing reactions known in the art can be used to directly sequence XBPl, or a region surrounding XBPl and detect allelic variants, e.g., mutations, by comparing the sequence of the sample sequence with the corresponding reference (control) sequence. Exemplary sequencing reactions include those based on techniques developed by Maxam and Gilbert (Proc. Natl Acad Sci USA (1977) 74:560) or Sanger (Sanger et al. (1977) Proc. Nat. Acad. Sci 74:5463). It is also contemplated that any of a variety of automated sequencing procedures may be utilized when performing the subject assays (Biotechniques (1995) 19:448), including sequencing by mass spectrometry (see, for example, U.S. Patent No. 5,547,835 and international patent application Publication Number WO 94/16101, entitled DNA Sequencing by Mass Spectrometry by H. Kδster; U.S. Patent No. 5,547,835 and international patent application Publication Number WO 94/21822 entitled "DNA Sequencing by Mass Spectrometry Via Exonuclease Degradation" by H. Kδster), and U.S Patent No.5,605,798 and International Patent Application No. PCT/US96/03651 entitled DNA Diagnostics Based on Mass Spectrometry by H. Kδster; Cohen et al.
(1996) Adv Chromatogr 36:127-162; and Griffin et al. (1993) Appl Biochem Biotechnol 38:147-159). It will be evident to one skilled in the art that, for certain embodiments, the occurrence of only one, two or three of the nucleic acid bases need be determined in the sequencing reaction. For instance, A-track or the like, e.g., where only one nucleotide is detected, can be carried out.
Yet other sequencing methods are disclosed, e.g., in U.S. Patent No. 5,580,732 entitled "Method of DNA sequencing employing a mixed DNA-polymer chain probe" and U.S. Patent No. 5,571,676 entitled "Method for mismatch-directed in vitro DNA sequencing". In some cases, the presence of a specific polymorphism of XBPl in DNA from a subject can be shown by restriction enzyme analysis. For example, a specific nucleotide polymorphism can result in a nucleotide sequence comprising a restriction site which is absent from the nucleotide sequence of another allelic variant.
In a further embodiment, protection from cleavage agents (such as a nuclease, hydroxylamine or osmium tetroxide and with piperidine) can be used to detect mismatched bases in RNA/RNA DNA/DNA, or RNA/DNA heteroduplexes (Myers, et al. (1985) Science 230:1242). In general, the technique of "mismatch cleavage" starts by providing heteroduplexes formed by hybridizing a control nucleic acid, which is optionally labeled, e.g., RNA or DNA, comprising a nucleotide sequence of an XBPl allelic variant with a sample nucleic acid, e.g., RNA or DNA, obtained from a tissue sample. The double- stranded duplexes are treated with an agent which cleaves single- stranded regions of the duplex such as duplexes formed based on basepair mismatches between the control and sample strands. For instance, RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with Sl nuclease to enzymatically digest the mismatched regions. In other embodiments, either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine whether the control and sample nucleic acids have an identical nucleotide sequence or in which nucleotides they are different. See, for example, Cotton et al. (1988) Proc. Natl Acad Sci USA 85:4397; Saleeba et al (1992) Methods Enzymol. 217:286-295. In a preferred embodiment, the control or sample nucleic acid is labeled for detection.
In another embodiment, an allelic variant can be identified by denaturing high- performance liquid chromatography (DHPLC) (Oefner and Underhill, (1995) Am. J. Human Gen. 57:Suppl. A266). DHPLC uses reverse-phase ion-pairing chromatography to detect the heteroduplexes that are generated during amplification of PCR fragments from individuals who are heterozygous at a particular nucleotide locus within that fragment (Oefner and Underhill (1995) Am. J. Human Gen. 57:Suppl. A266). In general, PCR products are produced using PCR primers flanking the DNA of interest. DHPLC analysis is carried out and the resulting chromatograms are analyzed to identify base pair alterations or deletions based on specific chromatographic profiles (see O'Donovan et al. (1998) Genomics 52:44-49).
In other embodiments, alterations in electrophoretic mobility is used to identify the type of XBP-I polymorphism. For example, single strand conformation polymorphism (SSCP) may be used to detect differences in electrophoretic mobility between mutant and wild type nucleic acids (Orita et al. (1989) Proc Natl. Acad. Sci USA 86:2766; see also Cotton (1993) Mutat Res 285:125-144; and Hayashi (1992)
Genet Anal Tech Appl 9:73-79). Single- stranded DNA fragments of sample and control nucleic acids are denatured and allowed to renature. The secondary structure of single- stranded nucleic acids varies according to sequence, the resulting alteration in electrophoretic mobility enables the detection of even a single base change. The DNA fragments may be labeled or detected with labeled probes. The sensitivity of the assay may be enhanced by using RNA (rather than DNA), in which the secondary structure is more sensitive to a change in sequence. In another preferred embodiment, the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al. (1991) Trends Genet 7:5).
In yet another embodiment, the identity of an allelic variant of a polymorphic region is obtained by analyzing the movement of a nucleic acid comprising the polymorphic region in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al. (1985) Nature 313:495). When DGGE is used as the method of analysis, DNA will be modified to insure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high-melting GC-rich DNA by PCR. In a further embodiment, a temperature gradient is used in place of a denaturing agent gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner (1987) Biophys Chem 265:1275).
Examples of techniques for detecting differences of at least one nucleotide between two nucleic acids include, but are not limited to, selective oligonucleotide hybridization, selective amplification, or selective primer extension. For example, oligonucleotide probes may be prepared in which the known polymorphic nucleotide is placed centrally (allele-specific probes) and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324:163); Saiki et al (1989) Proc. Natl Acad. Sci USA 86:6230; and Wallace et al. (1979) Nucl. Acids Res. 6:3543). Such allele specific oligonucleotide hybridization techniques may be used for the simultaneous detection of several nucleotide changes in different polylmorphic regions of XBP-I. For example, oligonucleotides having nucleotide sequences of specific allelic variants are attached to a hybridizing membrane and this membrane is then hybridized with labeled sample nucleic acid. Analysis of the hybridization signal will then reveal the identity of the nucleotides of the sample nucleic acid.
Alternatively, allele specific amplification technology which depends on selective PCR amplification may be used in conjunction with the instant invention. Oligonucleotides used as primers for specific amplification may carry the allelic variant of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al. (1989) Nucleic Acids Res. 17:2437-2448) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner (1993) Tibtech 11:238; Newton et al. (1989) Nucl. Acids Res. 17:2503). This technique is also termed "PROBE" for Probe Oligo Base Extension. In addition it may be desirable to introduce a novel restriction site in the region of the mutation to create cleavage-based detection (Gasparini et al. (1992) MoI. Cell Probes 6:1). In another embodiment, identification of the allelic variant is carried out using an oligonucleotide ligation assay (OLA), as described, e.g., in U.S. Patent No. 4,998,617 and in Landegren, U. et al, (1988) Science 241:1077-1080. The OLA protocol uses two oligonucleotides which are designed to be capable of hybridizing to abutting sequences of a single strand of a target. One of the oligonucleotides is linked to a separation marker, e.g., biotinylated, and the other is detectably labeled. If the precise complementary sequence is found in a target molecule, the oligonucleotides will hybridize such that their termini abut, and create a ligation substrate. Ligation then permits the labeled oligonucleotide to be recovered using avidin, or another biotin ligand. Nickerson, D.A. et al have described a nucleic acid detection assay that combines attributes of PCR and OLA (Nickerson, D. A. et al, (1990) Proc. Natl. Acad. ScL (U.S.A.) 87:8923-8927. In this method, PCR is used to achieve the exponential amplification of target DNA, which is then detected using OLA. Several techniques based on this OLA method have been developed and can be used to detect specific allelic variants of a polymorphic region of an XBP-I gene. For example, U.S. Patent No. 5593826 discloses an OLA using an oligonucleotide having 3'-amino group and a 5'-phosphorylated oligonucleotide to form a conjugate having a phosphoramidate linkage. In another variation of OLA described in Tobe et al. ((1996) Nucleic Acids Res 24: 3728), OLA combined with PCR permits typing of two alleles in a single microtiter well. By marking each of the allele-specific primers with a unique hapten, i.e. digoxigenin and fluorescein, each OLA reaction can be detected by using hapten specific antibodies that are labeled with different enzyme reporters, alkaline phosphatase or horseradish peroxidase. This system permits the detection of the two alleles using a high throughput format that leads to the production of two different colors.
In another embodiment, the single base polymorphism can be detected by using a specialized exonuclease-resistant nucleotide, as disclosed, e.g., in Mundy, C. R. (U.S. Patent No. 4,656,127). According to the method, a primer complementary to the allelic sequence immediately 3' to the polymorphic site is permitted to hybridize to a target molecule obtained from a particular animal or human. If the polymorphic site on the target molecule contains a nucleotide that is complementary to the particular exonuclease-resistant nucleotide derivative present, then that derivative will be incorporated onto the end of the hybridized primer. Such incorporation renders the primer resistant to exonuclease, and thereby permits its detection. Since the identity of the exonuclease-resistant derivative of the sample is known, a finding that the primer has become resistant to exonucleases reveals that the nucleotide present in the polymorphic site of the target molecule was complementary to that of the nucleotide derivative used in the reaction. This method has the advantage that it does not require the determination of large amounts of extraneous sequence data.
In another embodiment of the invention, a solution-based method is used for determining the identity of the nucleotide of a polymorphic site (Cohen, D. et al (French Patent 2,650,840; PCT Application No. WO91/02087). As in the Mundy method of U.S. Patent No. 4,656,127, a primer is employed that is complementary to allelic sequences immediately 3' to a polymorphic site. The method determines the identity of the nucleotide of that site using labeled dideoxynucleotide derivatives, which, if complementary to the nucleotide of the polymorphic site will become incorporated onto the terminus of the primer.
An alternative method, known as Genetic Bit Analysis or GB A™ is described by Goelet, P. et al (PCT Application No. 92/15712). The method of Goelet, P. et al uses mixtures of labeled terminators and a primer that is complementary to the sequence 3' to a polymorphic site. The labeled terminator that is incorporated is thus determined by, and complementary to, the nucleotide present in the polymorphic site of the target molecule being evaluated. In contrast to the method of Cohen et al (French Patent 2,650,840; PCT Appln. No. WO91/02087) the method of Goelet, P. et al is preferably a heterogeneous phase assay, in which the primer or the target molecule is immobilized to a solid phase. Several primer-guided nucleotide incorporation procedures for assaying polymorphic sites in DNA have been described (Komher, J. S. et al, Nucl Acids. Res. 17:7779-7784 (1989); Sokolov, B. P., Nucl Acids Res. 18:3671 (1990); Syvanen, A. -C, et al, Genomics 8:684-692 (1990); Kuppuswamy, M. N. et al, Proc. Natl. Acad. Sci. (U.S.A.) 88:1143-1147 (1991); Prezant, T. R. et al, Hum. Mutat. 1:159-164 (1992); Ugozzoli, L. et al, GATA 9:107-112 (1992); Nyren, P. et al, Anal Biochem.
208:171-175 (1993)). These methods differ from GBA™ in that they all rely on the incorporation of labeled deoxynucleotides to discriminate between bases at a polymorphic site. In such a format, since the signal is proportional to the number of deoxynucleotides incorporated, polymorphisms that occur in runs of the same nucleotide can result in signals that are proportional to the length of the run (Syvanen, A. -C, et al, Amer.J. Hum. Genet. 52:46-59 (1993)).
The methods described herein may be performed, for example, by utilizing prepackaged diagnostic kits comprising at least one probe/primer nucleic acid or antibody reagent described herein, which may be conveniently used, e.g., in clinical settings to diagnose patients exhibiting symptoms or family history of a disease or illness involving a polymorphic elements. In addition, a readily available commercial service can be used to analyze samples for the polymorphic elements of the invention. V. Primers for Amplification of Polymorphic Elements
Given that the human XBP-I coding sequence and flanking genomic sequences are publically available, primers can readily be designed to amplify the polymorphic sequences and/or detect XBP-I polymorphisms by one of ordinary skill in the art. For example, an XBP-I sequence comprising a polymorphism (e.g., SNP) of the invention can be identified in the NCBI Variation Database (dbSNP using the SNP IDs presented in Table 4) or by homology searching of another database containing human genomic sequences (e.g., using Blast or another program) and the location of the SNP sequence and/or flanking sequences can be determined and the appropriate primers identified and/or designed by one of skill in the art.
The locations and genomic sequence contexts of the identified IBD-associated SNPs are presented herein (see e.g., Tables 4, 5, 6, 7, and 8). Using the sequences provided, one of skill in the art can readily design oligonocleoitdes to amplify and/or detect the polymorphism (or complement therof) within these sequences. In one embodiment, a primer for amplification of a SNP elements is at least about 5-10 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 15-20 base pairs in length. In one embodiment, a primer for amplification of a polymorphic element is at least about 20-30 base pairs in length. In one embodiment, a primer for amplification of a polymorphic element is at least about 30-40 base pairs in length. In one embodiment, a primer for amplification of a polymorphic element is at least about 40-50 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 50-60 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 60-70 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 70-80 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 80-90 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 90-100 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 100-110 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 110- 120 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 120-130 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 130-140 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 140-150 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 150-160 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 160- 170 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 170-180 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 180-190 base pairs in length. In one embodiment, a primer for amplification of a polymorphic elements is at least about 190-200 base pairs in length. In one embodiment, a primer for amplification of a SNP of the invention is located at least about 200 base pairs away from (upstream or downstream of) the polymorphism to be amplified (i.e., leaving about 200 nucleotides from the end of the primer sequence to the polymorphism). In another embodiment, a primer for amplification of a polymorphism of the invention is located at least about 150 base pairs away from (upstream or downstream of) the polymorphic sequence to be amplified. In another embodiment, a primer for amplification of a polymorphism of the invention is located at least about 100 base pairs away from (upstream or downstream) of the polymorphic sequence to be amplified. In another embodiment, a primer for amplification of a polymorphism of the invention is located at least about 75 base pairs away from (upstream or downstream of) the polymorphic sequence to be amplified. In another embodiment, a primer for amplification of a polymorphism of the invention is located at least about 50 base pairs away from (upstream or downstream of) the polymorphic sequence to be amplified. In another embodiment, a primer for amplification of a polymorphism of the invention is located at least about 25 base pairs away from (upstream or downstream of) the polymorphic sequence to be amplified. In another embodiment, a primer for amplification of a polymorphism of the invention is located at least about 10 base pairs away from (upstream or downstream of) the polymorphic sequence to be amplified. In another embodiment, a primer for amplification of a polymorphism of the invention is located at least about 5 base pairs away from (upstream or downstream of) the polymorphic sequence to be amplified. In another embodiment, a primer for amplification of a polymorphism of the invention is located at least about 2 base pairs away from (upstream or downstream of) the polymorphic sequence to be amplified. In yet another embodiment a primer for amplification of a polymorphism of the invention is adjacent to the polymorphic sequence to be amplified.
The contents of all references, pending patent applications and published patents, cited throughout this application are hereby expressly incorporated by reference. Each reference disclosed herein is incorporated by reference herein in its entirety. Any patent application to which this application claims priority is also incorporated by reference herein in its entirety. The contents of the attached appendix are specifically incorporated herein by this reference. This application is related to WO2008/039445, the entire contents of which are incorporated herein by this reference. This invention is further illustrated by the following examples which should not be construed as limiting.
EXEMPLIFICATION
Throughout the examples, the following materials and methods were used unless otherwise stated.
Materials and Methods In general, the practice of the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, recombinant DNA technology, immunology (especially, e.g., immunoglobulin technology), and animal husbandry. See, e.g., Sambrook, Fritsch and Maniatis, Molecular Cloning: Cold Spring Harbor Laboratory Press (1989); Antibody Engineering Protocols (Methods in Molecular Biology), 510, Paul, S., Humana Pr (1996); Antibody Engineering: A
Practical Approach (Practical Approach Series, 169), McCafferty, Ed., IrI Pr (1996); Antibodies: A Laboratory Manual, Harlow et al, C.S.H.L. Press, Pub. (1999); Current Protocols in Molecular Biology, eds. Ausubel et al., John Wiley & Sons (1992).
Mice χBpl floχ/+ (129;B6) and XBPlflox/" (129;B6;Balb/c) were initially mated with
Villin (V)-Cre transgenic mice ( Madison et al., (2002) Qs elements of the villin gene control expression in restricted domains of the vertical (crypt) and horizontal (duodenum, cecum) axes of the intestine. J. Biol. Chem. 277, 33275-33283) (Jackson Laboratories) to obtain XBPlflox/floxVCre mice. Colony maintenance involved mating χBp lflox/floxVCre χ χBp lflox/flox as weU as χBP 1flox/wtVCre χ χBp lflox/flox JQ ^^
XBPl-unrelated phenotypes, XBPlflox/wtVCre x χBPlflox/wt was bred to obtain XBPlwt/wtVCre mice, which were confirmed to be histologically and clinically indistinguishable from χβPlwt/wt or χBPlflox/wt mice. All experiments reported were performed with sex- and age-matched littermate "XBPl 7" (i.e. XBPlflox/floxVCre), "XBP1+/" (i.e. XBPlflox/wtVCre), and "XBP1+/+" (i.e. χBPlflox/flox or χBPlflox/wt) mice obtained as above. For experiments involving time-dependent Cre-mediated deletion of the floxed XBPl gene, χBPlfloxneo/+ (129;B6) mice (see Fig. IA) were mated with VCreERT2 (129;B6) mice, kindly provided by Dr. Nicholas Davidson (Washington University, St. Louis) and Dr. Sylvie Robine (Institut Curie-CNRS, Paris) (el Marjou et al., (2004) Tissue-specific and inducible Cre-mediated recombination in the gut epithelium. Genesis. 39, 186-193). Cre recombinase was activated by administration of lmg tamoxifen (MP Biomedicals) intraperitoneally daily over 5 consecutive days. EIIaCre (Lakso et al., (1996) Efficient in vivo manipulation of mouse genomic sequences at the zygote stage. Proc. Natl. Acad. Sci. U. S. A 93, 5860-5865.; Holzenberger et al., (2000) Cre-mediated germline mosaicism: a method allowing rapid generation of several alleles of a target gene. Nucleic Acids Res. 28, E92.) transgenic mice were obtained from Jackson Laboratories. All mice were genotyped by PCR of genomic DNA isolated by phenol extraction and isopropanol precipitation of proteinase K-digested tails. Primer sequences are available upon request.
The generation of XBPlflox/floxVCre and VCreERT2 transgenic mice is detailed in Figure 1. A floxed Xbpl allele was generated by homologous recombination in W4/129 embryonic stem (ES) cells (panel A). The targeting vector contains a loxP site in intron 3 and a floxed neomycin resistance gene cassette (neo) in intron 2 of the Xbpl gene. A targeted ES cell clone identified by Southern blot was injected into C57BL/6 blastocysts to obtain chimeras, which were subsequently bred to establish the Xbpla°™so strain. Xbplao7ineo mice were mated with EIIacre transgenic mice to induce a partial Cre- mediated recombination. Male mice with the greatest deletion of the neo cassette were mated with wild type female mice to obtain an Xbpln°x strain. Consequently, breeding of Xbplao7i mice with Villin-(V)Cre transgenic mice resulted in the deletion of exon 2 of the Xbpl gene as confirmed by Southern blot (panel B). Total RNAs were isolated from small intestinal mucosal scrapings of untreated (NT) or mice injected with 1 mg/kg tunicamycin and harvested 6 hours later, and analyzed for the expression of XBPl mRNA by Northern blot and RT-PCR followed by DNA sequencing. The mutant XBPl mRNA produced by XbplA/A mice is slightly smaller in its molecular weight than the wild type XBPl mRNA, due to the deletion of exon 2 as confirmed by DNA sequencing of the cDNA. The IREl splicing site of XBPl mRNA is located downstream of the floxed exon 2 in exon 4, which hence allows monitoring the splicing status in mRNA transcribed from floxed and Cre-deleted XBPl alleles alike. Absence of XBPl protein was confirmed by Western blotting of small intestinal mucosal scraping protein lysates from untreated and tunicamycin-injected mice. As shown in panel C, the deletion of exon 2 in the mutant XBPl mRNA results in the change of the translational reading frame, introducing a premature translational termination codon. Accordingly, as shown in panel D, the truncated XBPl protein is not functional as evidenced by its failure to upregulate expression of a prototypical target gene of XBPl, ERdj4 (Dnajb9), upon ER stress induction through tunicamycin injection (Lee et al., (2003) XBP-I regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. MoI. Cell Biol. 23, 7448-7459), as determined by qPCR on small intestinal mucosal scraping specimens. In contrast, tunicamycin injection led to upregulation of Chop (Ddit3) mRNA expression, transcriptionally regulated by PERK-Atf4 during ER stress, in XBPlflox/floxVθ6> mice, indicating that other branches of the UPR are intact in the presence of a non-functional, truncated XBPl. In panel E, livers and spleens of mice were analyzed for XBPl
Figure imgf000029_0001
mRNA levels (primers binding in the floxed region) quantified by qPCR (n = 2 per group).
Reagents
The source of antibodies, proteins and inhibitors are as follows: rabbit phospho- JNK, total- JNK, active (cleaved) caspase-3 (Cell Signaling Technology), anti-lysozyme (DakoCytomation), antiprocryptdin (Ayabe,T., et al., (2002) Activation of Paneth cell alpha-defensins in mouse small intestine. J. Biol. Chem. 277, 5219-5228) (generously provided by A. Ouellette (UC Irvine)), flagellin (Invivogen), TNFα (Peprotech). The JNK-1,-2,-3 inhibitor SP600125 (Sigma), p38 inhibitor SB203580, MEK inhibitors PD98059 and U0126 (Calbiochem) were dissolved in DMSO as recommended. Carbamyl choline and lipopolysaccharide (LPS; from Escherichia coli 0111:B4) (Sigma), were used at final concentrations of lOμM and lμg/ml, respectively.
Immunohistochemistry, TUNEL and Electron microscopy
Tissues were handled by standard methods. Tissues were collected in 10% neutral buffered formalin and embedded in paraffin. Sections were deparaffinized in isopropanol and graded alcohols, followed by antigen retrieval with Retrievagen A solution according to manufacturer's protocol (Becton Dickinson), and endogenous peroxidase quenched by H2O2. Sections were then blocked for 30 minutes with normal goat serum, and incubated overnight at 40C with primary antibodies at dilutions recommended by the manufacturer. Secondary biotinylated anti-rabbit antibody (1:200) was added for 30 minutes followed by detection with streptavidin-HRP and development with DAB+ chromogen according to manufacturer's recommendations (DakoCytomation). Slides were counterstained with Mayer's hematoxylin, dehydrated, and mounted with Eukitt. Apoptotic cells were detected on paraffin embedded small intestine using
TUNEL-POD kit (Roche Applied Sciences). Small intestinal tissue from sex-matched XBP1+/+ and XBPl 7 littermates was fixed with 1.25% formaldehyde, 2.5% glutaraldehyde, 0.03% picric acid in 10OmM sodium cacodylate buffer. After washing with 10OmM sodium cacodylate buffer, tissues were treated for Ih with 1% osmium tetroxide and 1.5% potassium ferrocyanide, and then 30 minutes with 0.5% uranyl acetate in 5OmM maleate buffer, pH 5.15. After dehydration in ethanol, tissues were treated for 1 hour in propylenoxide and then embedded in Epon/Araldite resin. Ultrathin sections were collected on EM grids and observed by using a JEOL 1200EX transmission electron microscope at an operating voltage of 60 kV (with the kind assistance of Dr. Susumu Ito, Harvard Medical School).
Oral L. monocytogenes infection
Sex and age matched groups of XBP1+/+ and XBPl"'" littermates were infected under BL2 conditions using gastric gavage at 3.6 x 108 L. monocytogenes strain 10403s per mouse. CFU assays (faeces c.f.u./mg dry weight; liver and spleen c.f.u./organ) were performed as described before (Kobayashi et al, (2005) Nod2-dependent regulation of innate and adaptive immunity in the intestinal tract. Science 307, 731-734) and as following. In brief, for colony forming units (c.f.u.) assay, faecal pellets were aseptically collected 10 hours after oral infection. Mice were euthanized 72 hours after infection, followed by aseptically harvesting liver and spleen. Faecal pellets, liver and spleen were homogenized in PBS, and serial dilutions of the homogenates plated on LB plates containing 200μg/ml streptomycin, incubated at 37 0C for 18 hours and c.f.u. were counted. L. monocytogenes burden in faeces was expressed as c.f.u. per mg dry weight, whereas liver and spleen data were expressed as c.f.u. per organ. For the determination of dry weight, feces were aseptically collected, divided into two parts, weighed, and one part homogenized and serial dilutions plated. The other part was dried in a speed-vac to allow for accurate weighing to correct the colony counts for differences in water content. Dextran sodium sulphate colitis
Sex and age-matched littermates (8 to 12 weeks) received 4.5% DSS (ICN Biomedicals Inc.) in drinking water for 5 days then regular water thereafter, or neomycin sulfate and metronidazole (1.5 g/L) (Sigma). Antibiotic treated mice received 7% DSS. Weight was recorded daily and rectal bleeding was assessed (0, absent; 1, traces of blood at anus or the base of the tail; 2, clearly visible rectal blood). Histological and mRNA expression studies on RNeasy kit isolated colon RNA (Qiagen) used mice sacrificed on day 8 after DSS treatment. Histological scoring of colons was described before (Garrett et al., (2007) Communicable ulcerative colitis induced by T-bet deficiency in the innate immune system. Cell 131, 33-45).
Crypt isolation, stimulation, and bactericidal activity assays
Small intestinal crypts were isolated following published protocols (Ayabe et al., (2000) Secretion of microbicidal alpha-defensins by intestinal Paneth cells in response to bacteria. Nat. Immunol. 1, 113-118). In brief, the small intestinal lumen of adult mice was rinsed with ice-cold PBS and segments were everted and shaken in Ca++ and Mg++- free PBS buffer containing 3OmM EDTA to elute crypts. Villi and crypts eluted during 5min intervals were recovered by centrifugation at 70Og and crypt fractions identified by light microscopy. Crypt numbers were estimated by hemocytometry and 2,000 crypts resuspended in iPIPES buffer containing lOμM carbamyl choline (CCh; Sigma) or lμg/ml LPS and incubated for 30min at 370C. For lysozyme detection, supernatants were harvested and proteins were precipitated by trichloroacetic acid (TCA). Protein precipitates were resuspended in Laemmli's buffer and resolved on 12% SDS-PAGE. Rabbit anti-lysozyme (DakoCytomation) was used for detection by Western blotting. Bactericidal activity of crypt supernatants was assayed against 1 x 103 c.f.u. Salmonella typhimurium cs015 as described (Ayabe et al., (2000) Secretion of microbicidal alpha- defensins by intestinal Paneth cells in response to bacteria. Nat. Immunol. 1, 113-118).
Bromodeoxyuridine (BrdU) incorporation XBP1+/+ and XBPl"'" littermates were injected with lmg BrdU (Becton
Dickinson) in 500μl PBS. Small intestinal tissue was harvested after 1 hour or 24 hours, paraffin embedded, sectioned and stained with anti-BrdU antibody (Becton Dickinson). Epithelial RNA isolation and quantification
XBP1+/+ and XBPl"'" intestines were opened longitudinally, rinsed with cold PBS and everted on a plain surface. RNAlater was added and the epithelium was immediately scraped off using RNAse-free glass slides. Total RNA isolated using RNAeasy columns (Qiagen) was reverse transcribed and quantified by SYBR green PCR (Biorad). For microarray analysis, RNAs isolated from 3 specimens per genotype were pooled, and microarray was carried out at the Biopolymers Core Facility (Harvard Medical School) with mouse genome 430 2.0 array (Affymetrix, Santa Clara, CA). Data analysis was performed with Agilent GeneSpring GX and Affymetrix GCOS software under default parameter setting. Quantitative PCR was performed as described before (Lee et al., (2003) XBP-I regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. MoI. Cell Biol. 23, 7448-7459). See Table 1 below for PCR primers.
Table 1. Primer sequences
Gene name forward reverse Ref. (common name)
Human primers
HASPA5 (grp78, CATCACGCCGTCCTATGTCG CGTCAAAGACCGTGTTCTCG (Wang and Seed, BiP) (SEQ ID NO: 1) (SEQ ID NO: 2) 2003)
GAPDH ATGGGGAAGGTGAAGGTCG GGGGTCATTGATGGCAACAA (Wang and Seed, (SEQ ID NO: 3) TA (SEQ ID NO: 4) 2003)
GGAGTTAAGACAGCGCTTGGG TGTTCTGGAGGGGTGACAAC
XBPl splicing GA (SEQ ID NO: 5) TGGG (SEQ ID NO: 6)
Mouse primers
Haspa5 (grp78; ACTTGGGGACCACCTATTCCT ATCGCCAATCAGACGCTCC (Wang and Seed, BiP) (SEQ ID NO: 7) (SEQ ID NO: 8) 2003)
Defer1 AAGAGACTAAAACTGAGGAGC CGACAGCAGAGCGTGTA
(cryptdin-1) AGC (SEQ ID NO: 9) (SEQ ID NO: 10) (Fre et al., 2005)
Defcr4 GCTGTGTCTATCTCCTTTGGA CGTATTCCACAAGTCCCACG (Kobayashi et al., (cryptdin-4) GGC (SEQ ID NO: 11) AAC (SEQ ID NO: 12) 2005)
Defer5 AGGCTGATCCTATCCACAAAA TGAAGAGCAGACCCTTCTTG (Kobayashi et al., (cryptdin-5) CAG (SEQ ID NO: 13) GC (SEQ ID NO: 14) 2005)
ATGGAATGGCTGGCTACTATG ACCAGTATCGGCTATTGATC
Lysz (lysozyme) (Wang and Seed, G (SEQ ID NO: 15) TGA (SEQ ID NO: 16) 2003)
GTTCCGCCAGTCAATGCAGA
Muc2 (mucin-2) GCCTGTTTGATAGCTGCTATG TGCC (SEQ ID NO: 17) CAC (SEQ ID NO: 18)
Camp GCTGTGGCGGTCACTATCAC TGTCTAGGGACTGCTGGTTG (Wang and Seed, (cathelicidin) (SEQ ID NO: 19) A (SEQ ID NO: 20) 2003)
AGCAGCAAGTGGTGGATTTG GAGTTTTCTCCCGTAAAAGC
Xbpl (Wang and Seed, (SEQ ID NO: 21) TGA (SEQ ID NO: 22) 2003)
CTGGAAGCCTGGTATGAGGAT CAGGGTCAAGAGTAGTGAAG
Ddit3 (Chop) (SEQ ID NO: 23) GT (SEQ ID NO: 24) (Wang and Seed, 2003)
Atohl (Mathl) GAGTGGGCTGAGGTAAAAGAG GGTCGGTGCTATCCAGGAG (Wang and Seed, T (SEQ ID NO: 25) (SEQ ID NO: 26) 2003)
CCAGCCAGTGTCAACACGA AATGCCGGGAGCTATCTTTC (Wang and Seed,
Hesl (SEQ ID NO: 27) T (SEQ ID NO: 28) 2003)
Ctnnbl (β- AT GGAGC C GGAC AGAAAAGC CTTGCCACTCAGGGAAGGA (Wang and Seed, Catenin) (SEQ ID NO: 29) (SEQ ID NO: 30) 2003)
Tcf4 CGAGATATCAACGAGGCTTTC CATGTGATTCGCTGCGTCTC AAG (SEQ ID NO: 31) C (SEQ ID NO: 32) (Fre et al, 2005)
CATCTTCTCAAAATTCGAGTG TGGGAGTAGACAAGGTACAA (Giuliettietal,
Tnf(TNFα) ACAA (SEQ ID NO: 33) CCC (SEQ ID NO; 34) 2001)
TCAAGTGGCATAGATGTGGAA TGGCTCTGCAGGATTTTCAT (Giuliettietal.,
Ifng (IFNγ) GAA (SEQ ID NO: 35) G (SEQ ID NO: 36) 2001)
ACAGGAGAAGGGACGCCAT
114 (IL-4) GAAGCCCTACAGACGAGCTC (Giuliettietal., (SEQ ID NO: 37) A (SEQ ID NO: 38) 2001)
GGTTGCCAAGCCTTATCGGA ACCTGCTCCACTGCCTTGCT (Giuliettietal.,
1110 (IL-IO) (SEQ ID NO: 39) (SEQ ID NO: 40) 2001)
IHb (IL- lβ) GCAACTGTTCCTGAACTCAAC GCAACTGTTCCTGAACTCAA (Wang and Seed, T (SEQ ID NO: 41) CT (SEQ ID NO: 42) 2003)
GCTCATTGCTGGGTACTTACA CCAGACTTGGCACAAGACAG (Wang and Seed,
Illrn (IL-IRa) A (SEQ ID NO: 43) G (SEQ ID NO: 44) 2003)
TGAGCAACTATTCCAAACCAG GCACGTAGTCTTCGATCACT
Ptgs2 (Cox2) (Wang and Seed, C (SEQ ID NO: 45) ATC (SEQ ID NO: 46) 2003)
CAGCTGGGCTGTACAAACCTT CATTGGAAGTGAAGCGTTTC (Giuliettietal.,
Nos2 (iNOS) (SEQ ID NO: 47) G (SEQ ID NO: 48) 2001)
GATGCTCCCCGGGCTGTATT GGGGTACTTCAGGGTCAG
Actb (β-actin) (SEQ ID NO: 49) GA (SEQ ID NO: 50)
ACACGCTTGGGAATGGACAC CCATGGGAAGATGTTCTGGG (Iwakoshi et al.,
XBPl splicing (SEQ ID NO: 51) (SEQ ID NO: 52) 2003)
* primers designed using Invitrogen VectorNTI software
References in Table 1 : Fre et ah, (2005) Notch signals control the fate of immature progenitor cells in the intestine. Nature 435, 964-968
Giulietti et ah, (2001) An overview of real-time quantitative PCR: applications to quantify cytokine gene expression. Methods 25, 386-401
Iwakoshi et al., (2003) Plasma cell differentiation and the unfolded protein response intersect at the transcription factor XBP-I. Nat. Immunol.4, 321-329
Kobayashi et ah, (2005) Nod2-dependent regulation of innate and adaptive immunity in the intestinal tract. Science 307, 731-734
Wang and Seed, (2003) A PCR primer bank for quantitative gene expression analysis. Nucleic Acids Res.31, el54
XBPl splicing assay XBPl splicing was measured by specific primers flanking the splicing site yielding PCR product sizes of 164 and 138bp for human XBPIu and XBPIs, 171bp and 145bp, for mouse XBPl. Products were resolved on 2% agarose gels, and band intensity was determined densitometrically (Optiquant Software, Perkin Elmer).
XBPl silencing in MODE-K cells
The SV40 large T antigen-immortalized small intestinal epithelial cell line MODE-K (gift of D.Kaiserlian, Institute Pasteur) was transduced as described (Iwakoshi et al., (2003) Plasma cell differentiation and the unfolded protein response intersect at the transcription factor XBP-I. Nat. Immunol. 4, 321-329) with an XBPl-specific RNAi vector and a control vector identical to the one described before (Lee et al., (2003) Proteasome inhibitors disrupt the unfolded protein response in myeloma cells. Proc. Natl. Acad. Sci. U. S. A. 100, 9946-9951) except that SFGΔU3hygro was used and the knockdown was confirmed by qPCR. MODE-K.iXBP and MODEK.Ctrl were seeded for CXCLl experiments as described (Song et al., (1999) Expression of the neutrophil chemokine KC in the colon of mice with enterocolitis and by intestinal epithelial cell lines: effects of flora and proinflammatory cytokines. J. Immunol. 162, 2275-2280) at 1 x 105 cells/well in 96 well plates, adhered for 2-4 hours, with supernatant removed, and then stimulated with flagellin and TNFα for 4 hours or preincubated for 30 minutes with JNK, p38, and MEK inhibitors, with supernatants removed, and stimulated in fresh media with flagellin and TNFα. To analyze the CD Id-restricted antigen presentation by MODE-K cells (van de WaI et al, (2003) Delineation of a CD Id-restricted antigen presentation pathway associated with human and mouse intestinal epithelial cells. Gastroenterology 124, 1420-1431), 1 x 105 MODE-K.iXBP and MODE-K.Ctrl cells were seeded in 96 well plates and allowed to adhere for 2-4 hours. The CD Id-binding model glycolipid α-galactosyl-ceramide (αGC) was then added at a concentration of 100ng/ml along with the indicated concentrations of SP600125. After 2 hours of incubation, MODE-K cells (Vidal et al., (1993) Immortalization of mouse intestinal epithelial cells by the SV40-large T gene. Phenotypic and immune characterization of the MODE-K cell line. J. Immunol. Methods 166, 63-73) were washed and fixed with glutaraldehyde, followed by quenching with glycine, exactly as described (Kang and Cresswell, (2004) Saposins facilitate CD Id-restricted presentation of an exogenous lipid antigen to T cells. Nat. Immunol. 5, 175-181). After 4 washes with media, the CDId- restricted NKT cell hybridoma DN32.D3 (Bendelac et al, (1995) CDl recognition by mouse NKl+ T lymphocytes. Science 268, 863-865) (kindly provided by Dr. Albert Bendelac, University of Chicago, Chicago, IL), which is activated upon recognition of OcGC presented by CDId, was added to fixed MODE-K cells, and supernatants harvested after 18h assessed for IL-2 secretion by ELISA (BD Pharmingen). JNK phosphorylation was assessed in MODE-K cells seeded at 1 x 106 per well 6 well plates, allowed to form confluent mono-layers over 48-72 hours, stimulated with flagellin and TNFα for the indicated time periods, washed in ice-cold PBS and lysed in 500μl RIPA buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with protease (Complete®, Roche Applied Science) and Ser/Thr and Tyr phosphatase (Upstate) inhibitors.
Western blot
Protein content of lysates was determined by BCA assay, and equal amounts of lysates containing Laemmli buffer were boiled at 950C for 5min, resolved on 10% SDS- PAGE (for MODE-K cell lysates) or 12% SDS-PAGE (for TCA precipitates of purified crypts), transferred to Protran membranes (Whatman), blocked with 5% milk in TBS-T, incubated with primary antibody in 3-5% BSA in TBS-T at 40C overnight, washed, and incubated with a 1:2,000 dilution of HRPconjugated anti-rabbit secondary antibody in 3- 5% milk in TBS-T for 45min at room temperature. Bands were visualized using SuperS ignal chemoluminescent substrate (Pierce).
Human biopsy samples
Ileal and colonic biopsies were obtained from randomly selected patients with clinically, endoscopically and histologically confirmed diagnosis of CD and UC, as well as healthy control patients without any signs of intestinal inflammation. The diagnosis of CD and UC was confirmed by established criteria of clinical, radiological and endoscopic analysis, and from histology reports. Informed consent was obtained and procedures performed according to the approval by the local ethics committee of the Innsbruck Medical University. Biopsies were collected in RNAlater (Ambion), RNA isolated using RNAeasy columns (Qiagen), reverse transcribed, and used for quantitative PCR and XBPl splicing assays. Patient recruitment
German patients and controls in panels 1 and 2 almost completely overlap with the panels termed A and B in two recently published studies (Franke et al., (2007) Systematic association mapping identifies NELLl as a novel IBD disease gene. PLoS. ONE. 2, e691; Hampe et al., (2007) A genome-wide association scan of nonsynonymous SNPs identifies a susceptibility variant for Crohn disease in ATG16L1. Nat. Genet. 39, 207-211). Panel 3 is unpublished. All patients were recruited at the Charite University Hospital (Berlin, Germany) and the Department of General Internal Medicine of the Christian-Albrechts-University (Kiel, Germany), with support from the German Crohn and Colitis Foundation and BMBF competence network "IBD". Clinical, radiological and endoscopic {i.e. type and distribution of lesions) studies unequivocally confirmed the diagnosis of CD or UC, with confirmative or compatible histological findings. In the case of uncertainty, patients were excluded from the study. German healthy control individuals were obtained from the popgen biobank (Krawczak et al., (2006) PopGen: population-based recruitment of patients and controls for the analysis of complex genotype-phenotype relationships. Community Genet. 9, 55-61). Informed written consent was obtained from all study participants. All collection protocols were approved by the Charite University Hospital and the Department of General Internal Medicine of the Christian-Albrechts-University ethics committees.
Genotyping and Sequencing
Genomic DNA was prepared using a variety of methods and DNA samples evaluated by gel electrophoresis for the presence of high-molecular weight DNA. One μl of genomic DNA (30-300 ng) was amplified by the GenomiPhi (Amersham) whole genome amplification system and fragmented at 990C for five minutes. One hundred ngs of DNA was dried overnight in TwinTec hardshell 384well plates (Eppendorf, Hamburg, Germany) at room temperature and genotyping performed using the SNPlex™ Genotyping System (Applied Biosystems, Foster City, CA) on an automated platform. All process data were logged into, and administered by, a database-driven LIMS (Teuber et al., (2005) Improving quality control and workflow management in high-throughput single-nucleotide polymorphism genotyping environments. J. Assoc. Lab. Automat. 10, 43-47). Graphical summaries of LD were created using GOLD 1.0 (Abecasis and Cookson, (2000) GOLD— graphical overview of linkage disequilibrium. Bioinformatics. 16, 182-183).
Specifically, genotypes were generated by automatic calling using the Genemapper 4.0 software (Applied Biosystems, Foster City, CA) and all cluster plots 5 reviewed manually. Prior to statistical analyses, quality checks (PHWE>0.01,
MAFcontrols>l%, callrate>90%) were applied to the SNPs under study. Single-marker association and haplotype analyses, permutation tests, calculation of pairwise LD, and SNP selection were performed using Haploview 4.0 (Barrett et al., (2005) Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 21, 263-265).
10 Haplotype blocks were automatically defined as in (Gabriel et al., (2002) The structure of haplotype blocks in the human genome. Science 296, 2225-2229). Only haplotypes with population frequencies >1.0 % were included in the final association analysis. Single-marker disease associations and possible marker-marker interactions were assessed for statistical significance by means of logistic regression analysis (forward
15 selection), as implemented in the procedure LOGISTIC of the SAS software package (SAS Institute, Cary, NC). Prior to analyses, individuals with missing data were removed and genotypes coded numerically. Genomic DNA sequencing was performed using Applied Biosystems' BigDyeTM chemistry according to the supplier's recommendations (for primer sequences, see Table T). Genomic DNA sequencing traces
20 were visually inspected for the presence of SNPs and InDeIs using the software tool novoSNP (Weckx et al., (2005) novoSNP, a novel computational tool for sequence variation discovery. Genome Res. 15, 436-442). The automated platform used for Taqman genotyping has been previously described (Hampe et al., (2001) An integrated system for high throughput TaqMan based SNP genotyping. Bioinformatics. 17, 654-
25 655). Authenticity of the five novel discovered rare nsSNPs and rs5762809 was checked by TaqMan genotyping (Applied Biosystems) on an automated platform. For primer and probe sequences, see Tables 2 and 3. For genotype counts, see Tables 4 and 5.
Table 2. Primers used for re-sequencing of the XBPl locus
Figure imgf000037_0001
Figure imgf000038_0001
Figure imgf000039_0001
Table 3. TaqMan primers and probes 5
XBPlsnpU (A162P)
Forward 5'-GAGGCACCAAATAAAGGAGATGAT-S' (SEQ ID NO: 90)
Reverse 5'-TGTAGTTGAGAACCAGGAGTTAAGACA-S' (SEQ ID NO: 91)
Probe- VIC 5'-CAGGGCATCTATC-S' (SEQ ID NO: 92)
10 Probe-FAM 5'-CAGGGCATCCATC-3' (SEQ ID NO: 93) XBPlsnpβ (M139I)
Forward 5'-TGCAGAGGTGCACGTAGTCT-S' (SEQ ID NO: 94)
Reverse 5'-TCCCAGGGGAATGAAGTG-S' (SEQ ID NO: 95)
Probe- VIC 5'-ACTCAGGAGACCCGG-3' (SEQ ID NO: 96)
15 Probe-FAM 5'-CTCAGCAGACCCGG-3' (SEQ ID NO: 97)
XBPlsnpU (P15L)
Forward 5'-GCCCCGACAGAAGCAGAA-S' (SEQ ID NO: 98)
Reverse 5'-GCTATGGTGGTGGTGGCA-S' (SEQ ID NO: 99)
20 Probe-FAM 5'-CGGGACCCTTAAAG-S' (SEQ ID NO: 100) Probe- VIC 5'-ACGGGACCCCTAAAG-3' (SEQ ID NO: 101)
XBPlsnp29 (V179I / Q171Q)
Forward 5'-GAGTCAATACCGCCAGAATCCAT-S' (SEQ ID NO: 102)
25 Reverse 5'-CGCAGCACTCAGACTACGT-S' (SEQ ID NO: 103)
Probe-FAM 5'-CCCAATTGTCACCCC-3' (SEQ ID NO: 104) Probe- VIC 5'-CCCAGTTGTCACCCC-S' (SEQ ID NO: 105) XBPlsnp30 (D350E)
Forward 5'-TGTCCTCCCAAGAATGGTTTACAC-S' (SEQ ID NO: 106)
Reverse 5'-CCTGCCTACTGGATGCTTACAG-S' (SEQ ID NO: 107)
Probe-FAM 5'-TTCAGTGAGATGTCC-S' (SEQ ID NO: 108) Probe- VIC 5'-CATTCAGTGACATGTCC-S' (SEQ ID NO: 109)
rs5762809 (A7S)
Forward 5'-GCCCCGACAGAAGCAGAACT-S' (SEQ ID NO: 110)
Reverse 5'-AGGGCCACGACCGTAGAAA-S' (SEQ ID NO: 111) Probe- VIC 5'-TTCGGCGTGGCTG-S' (SEQ ID NO: 112) Probe-FAM 5'-TTCGGCGCGGCTG-3' (SEQ ID NO: 113)
Table 4: Genotype counts of the twenty single nucleotide polymorphisms that were genotyped in the three independent case-control IBD sample panels.
Marker Positions refer to NCBFs build 35 and nucleotides are listed for each SNPs for 5 the minor allele 1 (Al) and the major allele 2 (A2). Raw genotype counts are listed as A1A1/A1A2/A2A2. U: unaffected controls, CD: Crohn disease patients, UC: ulcerative colitis. Logistic regression (forward selection) was used to analyse the full German case- control panel for potential epistatic effects with N0D2. No statistically significant interaction was observed between any of the 20 SNPs in XBPl and the known disease- 10 associated variants in N0D2 (rs2066844/Arg702Trp, rs2066845/Gly908Arg, rs2066847/Leul007fs).
Figure imgf000041_0001
Table 5. Summary of deep sequencing of XBPl.
All five exons and the promoter were resequenced in 282 unaffected controls (U), 282 5 Crohn's disease (CD), and 282 ulcerative colitis (UC) patients (total of 846 samples); the five XBPl exons were sequenced in 282 additional UC patients. Fifty-one not yet annotated polymorphisms were identified (highlighted by bold type), including five rare non- synonymous (ns) SNPs (XBPl snp30, XBPlsnp29, XBPlsnpH, XBPl snp8, and XBPl snp22; underlined). Fifteen annotated SNPs were verified. Marker positions are in NCBI' s build 35,
10 and Δ indicates the distance in bp from the previous SNP. Dark gray shading highlights rare SNPs that were only identified once within either U, CD, and/or UC patients; the 3 right columns indicate the panel(s) individual rare SNPs were detected in. Within the 846 controls and patients - with both coding region and promoter sequenced - rare SNPs were detected in 5, 16, and 18, controls, CD, and UC patients, respectively (in the additional 282 UC
15 patients - with only exons sequenced - 3 additional rare SNPs were detected).
^ SNPs genotyped as reported in Table 6 and Table 4. § Significantly associated with IBD in panels 1+2+3 (see Table 6).
* Heterozygote counts of TaqMan-genotyped nsSNPs in Panels 1+2: XBPlsnpU: OxU, 4xCD, 2xUC; XBPlsnp8: OxU, IxCD, 3xUC; XBPlsnp30: OxU, IxCD, IxUC;
20 XBPlsnp29: OxU, IxCD, IxUC; XBPlsnp22: 5xU, 5xCD, 3xUC; rs5762809: minor allele frequencies of 13% in U, 12% in CD, and 12% UC.
Figure imgf000042_0001
Figure imgf000043_0001
Figure imgf000044_0001
Figure imgf000045_0001
Figure imgf000046_0001
Table 6. Association results of twenty SNPs genotyped across the XBPl gene region. Singlepoint association results for the three independent IBD, (i.e. CD+UC) panels are shown. Intermarker distances are shown in kilobases (kb) and positions refer to NCBI' s build 35. Minor allele frequencies (MAF) are listed for unaffected controls (U), Crohn 5 disease (CD), and ulcerative colitis (UC) patients. P-values are shown for the standard χ2- test with one degree of freedom and P-values <0.05 are highlighted by bold type. Odds ratios (OR) including 95% confidence intervals (95% CI) are shown for carriership of the rarer allele Al and P-values <0.05 are highlighted by bold type. For detailed genotype counts see Table 4. SNPs marked with * were included in the seven-marker haplotype 10 analysis (Table 7). t P-values that were significant after 10,000 permutations; X P-values that were significant after correcting for multiple testing using Bonferroni correction (Bonferroni significance threshold: P- value <0.0025).
Figure imgf000047_0001
Figure imgf000048_0001
Table 7 Resu1599739 rslts of a seven-marker haplotype analysis at the XBPl locus.
"/controls" and "/IBD5752792 rs" represent haplotype frequencies among controls and affected individuals, respective6005863 rsly. P- values refer to the null hypothesis of equal haplotype frequencies. Nominal P-va5762795 rslues (Pnom) are shown besides P-values after 10,000 permutations (PPerm). The two SNPs that ach1122673i rseved the best model fit in a logistic regression analysis among all 20 SNPs in this study are43587377 rs highlighted in bold type. Numbers given above SNP designations refer to consecutive SNP n5762839 rsumbers as assigned in the first column of Table 6.
2 3 4 9 10 12 18
Haplotype 'controls flBD rnom f perm
1 T T A C T C C 0.402 0.404 0.81 1
2 T C A C T C C 0.173 0.184 0.035 0.212
3 T T G A C C T 0.128 0.127 0.71 1
4 T T G C T C C 0.101 0.1 15 0.002 0.014
5 T T G A T T C 0.074 0.058 0.000020 <0.00001
6 T T G A T C C 0.048 0.051 0.33 0.949
7 C T G A T C T 0.038 0.031 0.0032 0.02
8 C T G A T C C 0.029 0.024 0.060 0.348
10
Table 8. Genomic sequence contexts and alleles of IBD-associated SNPs.
Figure imgf000049_0001
UPRE reporter assays
Expression plasmids hXBPlu and hXBPls were engineered to incorporate the XBPl snpl 7 (Al 62Pj, XBPl snp8 (M139I) and XBPl snp22 (P15L) minor variants using the GeneTailor site directed mutagenesis system (Invitrogen). Primers used were: XBPlsnpl7_R AGACCCGGCCACTGGCCTCACTTCATTCCC (SEQ ID NO: 176); XBPlsnpl7_F TGAGGCCAGTGGCCGGG-TCTcCTGAGTCCGC (SEQ ID NO: 177); XBPlsnp8_R ATCCCCAAGCGCTGTCTTAACTCCTGGTTC (SEQ ID NO: 178); XBPlsnp8_F TTAAGACAGCGCTTGGGGATaGATGCCCTGG (SEQ ID NO: 179); XBPlsnp22_F ccgacag-aagcagaactttaagggtcccgtc (SEQ ID NO: 180), and XBPlsnp22_R TAAAGTTCTGCTTCTGTCGGGG-CAGCCCGC (SEQ ID NO: 181). Transient transfection of MODE-K cells followed by luciferase assays was performed as described previously (Lee et al, (2003) XBP-I regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. MoI. Cell Biol. 23, 7448- 7459). Briefly, cells plated in 24 well plates at 75,000 cells/well were transfected with 50 ng of UPRE-luciferase and various quantities of XBPl plasmids by using lipofectamine 2000 reagent. pcDNA3.1 (Invitrogen) plasmid was added to adjust the total transfected DNA to 0.5 μg. Cells were treated for 16 hours with 1 μg/ml tunicamycin prior to harvest in certain experiments. Dual luciferase assays were performed following the protocol provided by the manufacturer (Promega). For reconstitution of XBPl 7 MEF cells ( Lee et al, (2003) XBP-I regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. MoI. Cell Biol. 23, 7448-7459), bicistronic retroviral vectors expressing GFP and human XBPl were constructed by inserting PCR amplified cDNAs for wildtype and
XBPlsnpl 7 and XBPlsnp8 variants of human XBPl into RVGFP vector between BgIII and Sail sites, as described previously (Iwakoshi et al, (2003) Plasma cell differentiation and the unfolded protein response intersect at the transcription factor XBP-I. Nat. Immunol. 4, 321-329). Retroviruses produced from 293T cells were used to transduce XBPl"'" MEF cells in the presence of polybrene. Two days later, cells were replated, attached overnight and treated with lμg/ml tunicamycin for 6 hours. Retroviral transduction efficiency was determined by FACS analysis of cells for GFP expression, as well as western blot of XBPIs after treating cells with tunicamycin. The levels of ERdj4 and EDEM mRNA were determined by real time PCR and are expressed normalized to β-actin mRNA content.
Example 1 - XBPl deletion in IEC leads to ER stress and spontaneous enteritis
XBP lflox/flox mice were generated by targeting loxP sites to introns flanking exon 2, and bred onto Villin (V)-Cre transgenic mice (see methods above and Figure 1, panel A, B, and C), that directs Cre recombinase activity specifically to small and large intestinal epithelium (Madison et al., (2002) Cis elements of the villin gene control expression in restricted domains of the vertical (crypt) and horizontal (duodenum, cecum) axes of the intestine. J. Biol. Chem. 277, 33275-33283). XBPlflox/floxVCre (XBPl"'") offspring were born at a Mendelian ratio and developed normally.
Specifically, small intestinal mucosal scrapings (n = 8 per group) from Xbpl -deleted ("XBPl"'"") and Xbpl- sufficient ("XBP1+/+") mouse intestinal epithelium were analyzed for cryptdin-1 (Defcrl), cryptdin-4 (Defcr4), cryptdin-5 (Defcr5), lysozyme (Lysz), mucin-2 (Muc2), cathelicidin (Campl), and XBPl (primers binding in the floxed region) mRNA expression. Data are expressed as fold decrease in XBPl"'" compared to XBP1+/+ specimens, normalized to β-actin (Student's t test). As in Figure 2A, Figure ID and IE, XBPl exon 2 was efficiently and functionally deleted specifically within the intestinal epithelium (99% in small intestine, 87 + 4% in colon). The fold increase in grp78 mKJNA expression in XBFl ' was compared to XBPl ' epithelium, normalized to p1- actin (n = 3 per group, Student's t test) (Figure 2B). Further in Table 8 and Figure 3A, elevated basal grp78 levels in XBPl ' small intestinal epithelia indicated increased ER stress (Figure 2B), confirmed by microarray analysis showing both increased grp78 (Haspa5) and Chop (DditJ) (P=O.02). Spontaneous enteritis in XBPl ' mice is shown as upper panels and lower left panel of Figure 2C. The normal histology of XBP1+/+ mice is shown as the lower right panel of Figure 2C. Specifically, the Upper left represents cryptitis with villous shortening, crypt regeneration and architectural distortion; the upper right represents neutrophilic crypt abscesses; and the lower left represents duodenitis with surface ulceration and granulation tissue. As the result, spontaneous small intestinal mucosal inflammation, in association with increased ER stress occurred in 19/31 (61%) adult XBPl ' but not in (0/20) XBP1+/+ mice (x2 P=9.87 x 10"6; Figure 2C). Notably, 5/16 (31%) heterozygous XBPlflox/wtVCre "XBP1+/" mice displayed mild spontaneous small intestinal inflammation (x2 P=0.007; Figure 3B). The inflammatory changes were patchy and ranged in severity from lamina propria polymorphonuclear infiltrates, to crypt abscesses and frank ulcerations without granulomas (Figure 2C and 3B).
Table 8 Identification of genes that are differentially expressed in the jejunum of the WT and Xbpl knock-out mice. Genes with more than two fold changes in the expression level are listed. Total RNA pools from three animals per each group were subjected to DNA chip experiments using Affymetrix mouse 430 Chips. Data was analyzed by GCOS 1.4 software. P, present; A, absent; D, decrease; I, increase; MI, modest increase.
Figure imgf000052_0001
Figure imgf000053_0001
Supplementary Table 1. Identification of genes that are differentially expressed in the jejunum of the WT and Xbpl knock-out mice. Genes with more than two fold changes in the expression level are listed. Total RNAs pool from three animals per each group were subjected to DNA chip experiments using Affymetrix mouse 430 Chips. Data was analyzed by GCOS 1 4 software. P, present; A, absent; D, decrease; I, increase; MI, modest increase
Figure imgf000054_0001
Figure imgf000055_0001
Figure imgf000056_0001
Figure imgf000057_0001
Figure imgf000058_0001
Figure imgf000059_0001
Figure imgf000060_0001
Figure imgf000061_0001
Figure imgf000062_0001
Figure imgf000063_0001
Figure imgf000064_0001
Figure imgf000065_0001
Figure imgf000066_0001
Figure imgf000067_0001
Figure imgf000068_0001
Figure imgf000069_0001
Figure imgf000070_0001
Figure imgf000072_0001
Figure imgf000073_0001
Figure imgf000074_0002
Figure imgf000074_0001
Figure imgf000075_0001
Figure imgf000076_0001
Figure imgf000077_0001
Figure imgf000078_0001
Figure imgf000079_0001
Figure imgf000080_0001
Figure imgf000081_0001
Figure imgf000082_0001
Figure imgf000083_0001
Figure imgf000084_0001
Figure imgf000085_0001
Figure imgf000086_0001
Figure imgf000088_0001
Figure imgf000089_0001
Figure imgf000090_0001
Figure imgf000091_0001
Figure imgf000092_0001
Figure imgf000093_0001
Figure imgf000094_0001
Figure imgf000095_0001
Figure imgf000096_0001
Figure imgf000097_0001
Figure imgf000098_0001
Figure imgf000099_0001
Figure imgf000100_0001
Figure imgf000101_0001
Figure imgf000102_0001
Example 2 - Absent Paneth cells and reduced goblet cells in XBPl-I- epithelium XBPl ' intestine was completely devoid of Paneth cells (Figure 2D and 2E), compared to XBP1+/+ and XBP1+/ mice (Figure 2E and 3B). Paneth cell granules store lysozyme and pro-forms of cryptdins, which were barely detectable in XBPl ; crypts (Figure 2D) and electron microscopy (EM) confirmed few rudimentary electron-dense granules of minute size, and a compressed ER in XBPl ^ Paneth cells (Figure 2D). mRNA expression of cryptdins- 1, -4, and -5 and lysozyme, but not cathelicidin, were substantially reduced (Figure 2A). It was also noted that the number and size of goblet cells were reduced within the small intestine, but not in colon, with reduced secretory granules by EM and reduced mRNA for the goblet cell protein Muc2 in XBPl ' small intestinal epithelia (Figure 2A, 2F and Figure 3C). Enteroendocrine cells were unaffected (Figure 2G and Figure 3D) and the epithelial barrier function of absorptive epithelia was normal (Figure 2H). Thus, XBPl ; mice exhibited a major defect in Paneth cells and a minor defect in goblet cells in the small intestine with an unperturbed epithelial barrier.
Example 3 - XBPl deletion results in apoptosis of differentiated Paneth cells and exhibits signs of a regenerative response
Quantitative PCR (β-catenin, Tcf4, Mathl, Hesl; Figure 4A), microarray analysis (Table 8) and β-catenin distribution (Figure 4B) of XBPl ' and XBP1+/+ intestinal epithelial mRNA did not reveal significant alterations in factors involved in intestinal cell fate decisions (Barker et ah, (2007) Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature 449, 1003-1007). It is hypothesized in this invention that the highly secretory Paneth cells might undergo programmed cell death from failure to manage ER stress as observed in pancreatic acinar cells (Lee et ah, (2005) XBP-I is required for biogenesis of cellular secretory machinery of exocrine glands. EMBO J. 24, 4368-4380). Indeed, a few pyknotic, apoptotic cells were detected in XBPl ' crypts (anti-active caspase-3+ and TUNEL+; Figure 5A and Figure 6A). To circumvent the problems associated with detecting a low-frequency event (apoptosis) in a slowly replenishing cell population, XBPlfloxαeo/floxneoVillinCre-ERT2 mice was generated (Figure IA). Along with efficient deletion of XBPl after initiation of tamoxifen treatment (Figure 5B), Paneth cell numbers were reduced by 98% on day 7, paralleled by a similar decrease in cryptdin- 5 mRNA transcripts. Apoptotic epithelial nuclei (Figure 5C and Figure 6B) were observed after 2.7 days, peaked at day 5, and declined on day 7 (Figure 5D). Apoptotic cells were present at the base of crypts (Paneth cells), and in villous epithelium (goblet cells) (Figure 5C). A gradual increase of TNFα and Chop (DditJ) mRNA was observed (Figure 5B and 5E), similar to XBPl ' mice (Table 8 and Figure 3A). Small intestinal inflammation was also noted in individual χBplfloκneo/floxneovillinCre ERτ2 ^6 at ^ time_pomts anaiyzed (2.7, 5, and 7 days).
Focal enteritis was present in 4 of 9 mice at day 5 (44%) ranging from lamina propria polymorphonuclear infiltrates, to crypt abscesses and frank ulcerations (Fig. 2F, upper two panels), despite only minor reductions in Paneth cells (Figure 5F, lower panel). Cumulatively, at all time points examined, enteritis was observed in 7/18 (39%) χBplfloκneo/fioxneovillinCre ERτ2 and Q/7 contrøls after induction with tamoxifen. The small intestinal epithelium exhibited villus shortening with a reduction of the villusxrypt ratio (Figure 5G), indicative of a regenerative response in XBPl ' mice. A 1 hour pulse of bromodeoxyuridine (BrdU) labelled the proliferative pool of intestinal stem cells, and was similar in XBP1+/+ and XBPl ^ mice (Figure 5H). However, 24 hours after BrdU injection, labeled cells were detected higher up in the crypt-villus axis in XBPl ' mice, indicating an increased migration rate (Figure 5H). Thus XBPl affects IEC homeostasis both through controlling cell renewal and cell death.
Example 4 - XBPl deletion impairs mucosal defence to oral Listeria monocytogenes infection
XBPl ' small intestinal lysates and supernatants lacked detectable lysozyme in response to carbamyl choline (Figure 7A) or LPS (not shown), and LPS-elicited XBPl ; crypt supernatants lacked bactericidal killing activity (Figure 7B). Oral infection with Listeria monocytogenes, a gram positive intracellular pathogen that is affected by Paneth cell defects (Kobayashi et al., (2005) Nod2-dependent regulation of innate and adaptive immunity in the intestinal tract. Science 307, 731-734) revealed that 10 hours after infection, 100-fold higher numbers of colony forming units (c.f.u.) of L. monocytogenes were recoverable from faeces of XBPl y compared to XBP1+/+ mice (Figure 7C). Translocation into liver and spleen after 72 hours revealed a 10- fold higher number of L. monocytogenes recovered from XBPl ' livers, but similar numbers from spleen (Figure 7D). These data suggest that XBPl in Paneth cells is required to decrease the luminal burden of L. monocytogenes. Example 5 - XBPl deficiency results in enhanced responses of IECs to typical mucosal inflammatory signals
XBPl mRNA splicing is a marker of IREl activation and ER stress (Calfon et ah, (2002) IREl couples endoplasmic reticulum load to secretory capacity by processing the XBP-I mRNA. Nature 415, 92-96; Lin et ah, (2007) IREl signaling affects cell fate during the unfolded protein response. Science 318, 944-949). Virtually complete splicing of mutant XBPl mRNAs in XBPl ' small and large intestine and partial splicing in XBPl+/~ small intestine was observed in contrast to barely detectable splicing in XBP1+/+ mice (Figure 8A) indicating IREl hyperactivation. INK phosphorylation was increased in XBPl ' small intestinal epithelia compared to controls consistent with the described TRAF2-dependent function of IREl to activate INK (Urano et ah, (2000) Coupling of stress in the ER to activation of INK protein kinases by transmembrane protein kinase IREl. Science 287, 664-666) (Fig. 4B). To test whether XBPl mediated intestinal inflammation arose from increased INK activity in a microbiota and cytokine free system, XBPl expression was silenced in the mouse IEC line MODE-K with a siRNA retrovirus (iXBP), together with flagellin and TNFα as proinflammatory stimulants (Lodes et ah, (2004) Bacterial flagellin is a dominant antigen in Crohn disease. J. Clin. Invest 113, 1296-1306). TNFα and flagellin increased INK phosphorylaton and CXCLl production from MODE-K.iXBP (50-90% reduction of XBPl) compared to MODE-K.Ctrl cells (Figure 8C, 8D and 8E) that was dose- dependently and specifically (Figure 9A and 9B) blocked by the INK inhibitor, SP600125 (Figure 8F and 8G) but did not affect CD Id-restricted MODE-K antigen presenting function (van de WaI et ah, (2003) Delineation of a CD Id-restricted antigen presentation pathway associated with human and mouse intestinal epithelial cells. Gastroenterology 124, 1420-1431) (Figure 8H). Thus it is concluded that impaired XBPl expression directly heightens proinflammatory INK/SAPK signaling in IECs in response to environmental stimuli and may contribute to Paneth, goblet cell and MODE- K.iXBP apoptosis (Figure 5A, 5C and 5D, Figure 1OA and 10B).
Example 6 - XBPl deficiency leads to increased susceptibility to experimental colitis
The XBPl ' colon, unlike the small intestine, did not exhibit spontaneous colitis but colonic IECs displayed evidence of increased ER stress (Figure 8A). Therefore, the in vivo effects of DSS, a toxin for mucosal epithelial cells that disrupts barrier function, (Strober et ai, (2002) The immunology of mucosal models of inflammation. Annu. Rev. Immunol. 20, 495-549) was examined. XBPl ' mice given 4.5% DSS in the drinking water exhibited more severe wasting and rectal bleeding than XBP1+/+ littermates (Figure HA and HB). Histologically, XBPl y colons displayed increased areas of mucosal erosions, edema, and cellular infiltration along with increased crypt loss compared to XBP1+/+ littermates (Figure HC and HD). XBPl+7 mice exhibited an intermediate phenotype (Figure HA, HB and HC). Antibiotic treatment abrogated the differences in severity of DSS colitis between XBP1+/+ and XBPl ; mice (Figure 12A and 12B) highlighting the importance of the commensal flora in the colitis observed (Figure 1 IA-D). Levels of TNFq, a central mediator of inflammation in DSS colitis
(Kojouharoff et al., (1997) Neutralization of tumour necrosis factor (TNF) but not of IL- 1 reduces inflammation in chronic dextran sulphate sodium-induced colitis in mice. Clin. Exp. Immunol. 107, 353-358), were elevated in DSS treated XBPl 7 vs. XBP1+/+ colonic tissues with intermediate TNFα expression in XBPl+7 mice (Figure HE).
Example 7 - Human ileal and colonic mucosa in CD and UC exhibit signs of ER stress
UPR activation in the intestine of healthy individuals, CD and UC in ileal and colonic biopsies were analyzed. Grp78 expression was increased in inflamed ileal CD mucosa and XBPIs levels were increased in both inflamed and non-inflamed ileal CD biopsies (Figure 11F). Similarly, XBPIs levels in inflamed and non-inflamed colonic CD and UC mucosa were increased compared to those from healthy individuals, and there was increased grp78 in inflamed UC and a trend toward increased grp78 expression in inflamed CD specimens (Figure 11G). These data indicate the presence of ER stress and increased IREl activity in the ileum and colon of CD and UC patients.
Example 8 - SNPs within the XBPl gene region are associated with IBD
Three previously reported genome-wide linkage studies independently suggested linkage of the 22ql2 region with IBD (Hampe et al., (1999) A genomewide analysis provides evidence for novel linkages in inflammatory bowel disease in a large European cohort. Am. J. Hum. Genet. 64, 808-816; Barmada et al, (2004) A genome scan in 260 inflammatory bowel disease-affected relative pairs. Inflamm. Bowel. Dis. 10, 513-520; Vermeire et al., (2004) Genome wide scan in a Flemish inflammatory bowel disease population: support for the IBD4 locus, population heterogeneity, and epistasis. Gut 53, 980-986), with signals as close as 0.3 Mb from the XBPl gene. A German patient cohort of 1103 controls, 550 CD, and 539 UC patients were examined in the instant invention (Table 6, panel 1), genotyping for twenty tagging SNPs (average SNP distance 5.25 kb; Figure 13 A-E), selected from HapMap data of individuals of European ancestry using de Bakkers algorithm as implemented in Haploview (Barrett et al., (2005) Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 21, 263-265). Three SNPs were significantly associated with IBD: rs5997391, rs5762795, and rs35873774 (Table 6). The latter SNP, located in intron 4 of XBPl, remained significantly associated after correcting for multiple testing using Bonferroni correction (P-valuecorr = 0.0011).
This index finding was replicated in the instant invention by genotyping two additional independent patient panels (panel 2: 1854 patients; 2042 controls, panel 3: 1446 patients; 2177 controls) and reproduced the significant association with two of these three index SNPs in each panel (rs5997391 and rs5762795 in panel 2; rs5762795 and rs35873774 in panel 3; Table 6 and Table 4). Significant associations of 11 and 8 additional SNPs in panels 2 and 3, respectively, with CD, UC, and/or IBD were obtained. Several association signals in each panel were robust to correction for multiple testing and remained significant after 10,000 permutations. The combined analysis of panels 1, 2 and 3 in a total of 5322 controls, 2762 CD, and 1627 UC patients identified a total of 6 SNPs associated with IBD that were robust after correction for multiple testing and significant after 10,000 permutations; the minor alleles of these six SNPs conferred protection from IBD (Table 6 and Figure 13A). The strongest associated variant was rs35873774 (P- value = 1.6 x 10'5). The odds ratio (OR) for carriership of the rarer C allele of rs35873774 in the combined IBD panel was 0.74 (95% confidence interval [CI] 0.66-0.84; Table 6).
Among the 20 SNPs tested, markers 2-5, 7, 9-14, and 18-20 (Table 6) are located in a 99 kb large block. Table 7 summarizes the haplotype analysis results of the 7- marker haplotype tagging SNPs of this block (2-4, 9-10, 12, 18). Three of the 8 haplotypes were significantly associated with IBD after 10,000 permutations. Haplotypes #5 and #7 were protective, whereas #4 was a risk haplotype. Multiple logistic regression analysis of the entire IBD panel including gender as a covariate, revealed a best model fit with SNPs rs5997391 and rs35873774 (intron 4/5 of XBPl). Logistic regression analysis did not reveal epistatic effects.
Example 9 - Deep sequencing reveals multiple rare variants including two hypomorphic variants that might confer risk
LD around the XBPl gene, flanked by two recombination hotspots (Figure 13B), is generally weak (Figure 13E). The complex haplotype structure of the locus (Table 7) suggested that multiple rare, private SNPs might contribute to its IBD association. All exons, splice sites, promoter regions in 282 unaffected controls, 282 CD, and 282 UC patients, and exons and splice sites only in an additional 282 UC patients were re- sequenced in the present application (Table 5 and Figure 14). Apart from verifying 15 already annotated variants, 51 new polymorphisms were identified, among them 39 rare SNPs detected once in either the CD, UC, and/or control cohort. The discovery frequency for rare SNPs was 5, 16, and 18 for 282 controls, CD, and UC patients. Sequencing of the coding region in another 282 UC patients yielded another 3 novel SNPs. Five novel non- synonymous SNPs (nsSNPs; XBPl snp8, XBPlsnpl7, XBPlsnp22, XBPlsnp29, XBPlsnp30) were discovered in the sequencing cohort of 1128 patients but not controls. Taqman genotyping revealed the actual frequencies of these 5 novel nsSNPs in panels 1+2. Notably, heterozygous individuals were only observed among the case groups for 4 of the 5 rare nsSNPs, while the fifth nsSNP
(XBPlsnp22) occurred at equal frequencies in all groups (Table 5 and Figure 14). The novel nsSNPs were too rare to warrant formal statistical analysis.
The nsSNPs, XBPlsnp8 (M 1391) and XBPlsnpl7 (A162P), present in IBD patients but not controls (Table 5) lead to amino acid changes in the XBPl hinge region between the bZiP and transactivation domains. XBPlsnpl7 in exon 4 is 10 bp upstream of the XBPl mRNA splice site recognized by IREl. In the present application, the respective mutations into unspliced (hXBPlu) and spliced (hXBPls) versions were engineered and transiently cotransfected MODE-K cells with wildtype or mutant XBPl plasmids and an UPRE-luciferase reporter construct (Lee et αl, (2003) XBP-I regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. MoI. Cell Biol. 23, 7448-7459). hXBPlu.M139I and hXBPls.M139I had diminished UPRE transactivating function compared to wildtype plasmids in untreated and tunicamycin (Tm) treated MODE-K (Figure 15A and 15B). hXBPlu.A162P displayed impaired UPRE transactivation only in Tm-treated MODE-K cells (Figure 15A), while hXBPls.A162P transactivation was unaltered (Figure 15B). To test ability to induce XBPl 's target genes, XBPl"'" mouse embryonic fibroblasts (MEFs) (Iwakoshi et al., (2003) Plasma cell differentiation and the unfolded protein response intersect at the transcription factor XBP-I. Nat. Immunol. 4, 321-329) were reconstituted with either wildtype or mutant hXBPlu-GFP retroviral constructs, obtaining similar GFP fluorescence and comparable protein levels (Figure 15C and 15D). hXBPl.M139I induced less ERdj4 (DNAJB9) and EDEM (EDEMl) mRNA than wildtype both at baseline and upon Tm treatment, while hXBPlu.A162P was hypomorphic only under conditions of ER stress (Figure 15E) as above (Figure 15B). hXBPls.P15L
(XBPl snp22), the only rare nsSNP present at similar frequencies in IBD patients and controls, was not hypomorphic in these assays (Figure 16A and 16B).
Example 10 - Discussion of Examples 1-9 The instant invention presents the first spontaneous mouse model of intestinal inflammation that arises from a gene defect in an actual genetic risk factor for human IBD. It suggests that XBPl unifies key elements of IBD pathogenesis within the IEC compartment, pointing toward a primary defect in IEC function in IBD pathogenesis. The instant invention introduces the ER stress response as a likely integral component of organ- specific inflammation. XBPl controls organ- specific inflammation through two major mechanisms that are probably codependent. First, Paneth cell function was strikingly impaired in XBPl"'" mice as evidenced by diminished antimicrobial peptide secretion and a compromised response to pathogenic bacteria. Second, XBPl deficiency itself induced ER stress that led to a heightened pro-inflammatory response of the epithelium to known IBD inducers flagellin and TNFα (Figure 17).
XBPl and environmental factors
Consistent with the data in the instant invention, increased grp78 expression has recently been reported in IBD patients (Shkoda et ah, (2007) Interleukin-10 blocked endoplasmic reticulum stress in intestinal epithelial cells: impact on chronic inflammation. Gastroenterology 132, 190-207; Heazlewood et al., (2008) Aberrant Mucin Assembly in Mice Causes Endoplasmic Reticulum Stress and Spontaneous Inflammation Resembling Ulcerative Colitis. PLoS. Med 5, e54). While Shkoda et al. suggested that ER stress occurs secondary to an inflammatory insult to IECs, the data in the instant invention instead point to specific impairment of the ER stress response as a cause, rather than a consequence, of intestinal inflammation. This might be obvious in the context of the genetic association of XBPl variants with IBD reported here, but the instant invention speculates that environmental factors may also impair XBPl function (and hence the ER stress response). Monozygotic twin studies have highlighted the importance of as yet unknown environmental and/or epigenetic factors in the development of IBD (Halfvarson et al, (2003) Inflammatory bowel disease in a Swedish twin cohort: a long-term follow-up of concordance and clinical characteristics. Gastroenterology 124, 1767-1773). One might speculate that microbial- or food-derived XBPl inhibitors could interfere with the pathways described herein, particularly in a genetically susceptible host, thus contributing to the development of intestinal inflammation. Along those lines, a recent report found that a 21-membered macrocyclic lactam termed 'trierixin' isolated from Streptomyces sp. potently inhibits endogenous XBPl splicing in an epithelial cell line (Tashiro et al, (2007) Trierixin, a Novel Inhibitor of ER Stress-induced XBPl Activation from Streptomyces sp. J. Antibiot. (Tokyo) 60, 547-553).
Paneth cell deficiency, IEC inflammatory tone and enteritis Although Paneth and absorptive epithelial cells have been linked to intestinal inflammation (Kobayashi et al, (2005) Nod2-dependent regulation of innate and adaptive immunity in the intestinal tract. Science 307, 731-734; Zaph et al., 2007; Nenci et al, (2007) Epithelial NEMO links innate immunity to chronic intestinal inflammation. Nature 446, 557-561; Wehkamp et al, (2005) Reduced Paneth cell α-defensins in ileal Crohn's disease. Proc. Natl. Acad. Sci. U. S. A 102, 18129-18134), neither Paneth cell depletion (Garabedian et al, (1997) Examining the role of Paneth cells in the small intestine by lineage ablation in transgenic mice. J. Biol. Chem. 272, 23729-23740), inability to convert pro-cryptdins to cryptdins (Wilson et al, (1999) Regulation of intestinal alpha-defensin activation by the metalloproteinase matrilysin in innate host defense. Science 286, 113-117) nor Nod2 deletion (Kobayashi et al, (2005) Nod2- dependent regulation of innate and adaptive immunity in the intestinal tract. Science 307, 731-734) cause spontaneous or induced intestinal inflammation. A recent study reported development of spontaneous UC that is dependent on a specific 'colitogenic' microbial milieu arising in a genetically altered host, which is vertically and horizontally transmissible to genetically intact mice (Garrett et al., (2007) Communicable ulcerative colitis induced by T-bet deficiency in the innate immune system. Cell 131, 33-45). However, such 'colitogenic' microbiota does not apparently arise in Paneth cell- or cryptdindeficient mice (Garabedian et al., 1997; Wilson et al., 1999; Kobayashi et al., (2005) Nod2-dependent regulation of innate and adaptive immunity in the intestinal tract. Science 307, 731-734). It is concluded in the instant invention that bacterial "dysbiosis" alone is insufficient to cause intestinal inflammation if unaccompanied by a pro-inflammatory state including that primarily of the epithelium.
XBPl deficiency in IECs resulted in IRElα hyperactivation through an unidentified mechanism and increased JNK phosphorylation in the epithelial compartment in vivo. An increased susceptibility to DSS colitis was reported in IREl β ' mice (Bertolotti et al., (2001) Increased sensitivity to dextran sodium sulfate colitis in IRElbeta-deficient mice. J. Clin. Invest 107, 585-593). Although IRElβ-deficiency did not lead to spontaneous enteritis, colitis or Paneth cell depletion, baseline levels of grp78 were elevated consistent with an active UPR in the absence of IRElβ. IECs are currently emerging as key mediators of inflammatory and immune mechanisms in mucosal tissues. IEC deletion of IKKβ (Zaph et al., (2007) Epithelial-cell-intrinsic IKK- beta expression regulates intestinal immune homeostasis. Nature 446, 552-556) or NEMO (Nenci et al, (2007) Epithelial NEMO links innate immunity to chronic intestinal inflammation. Nature 446, 557-561), both upstream of NFKB, resulted in mucosal immune dysfunction and spontaneous colitis, respectively, the latter as a consequence of IEC barrier dysfunction. It was found that even minor deficiencies in XBPl expression within IECs lead to spontaneous enteritis, while leaving the intestinal barrier largely intact.
Genetic association of XBPl polymorphisms with IBD
IBD is a complex polygenetic disease as evidenced by the recent discovery and replication of several genetic risk factors that include N0D2, the 5q31 haplotype (SLC22A4, SLC22A5), the 5pl3.1 locus (PTGER4), DLG5, the IL23 receptor, ATGl 6Ll, IRGM and IL12B on 5q33, NKX2-3, PTPN2, the 17q23.2 and the 17qll.l loci, and NELLl (Mathew, (2008) New links to the pathogenesis of Crohn disease provided by genome-wide association scans. Nat. Rev. Genet. 9, 9-14). Since the functionally relevant variants for most of these loci and their role in IBD pathogenesis remain to be identified, a coherent model from gene to intestinal inflammation has yet to be developed although some of these risk alleles point towards abnormalities of innate immune responses (e.g. N0D2) and autophagy (e.g. ATGl 6Ll, IRGM), adaptive immune functions (e.g. IL23R) and the intestinal epithelial barrier (e.g. DLG5) in human IBD. The studies in the instant invention reveal abnormalities of the ER stress response as another pathway for the development of intestinal inflammation and IBD.
The instant invention suggests that the linkage results obtained on chromosome 22 from three independent microsatellite-based genome scans (Hampe et al, (1999) A genomewide analysis provides evidence for novel linkages in inflammatory bowel disease in a large European cohort. Am. J. Hum. Genet. 64, 808-816; Barmada et al, (2004) A genome scan in 260 inflammatory bowel disease-affected relative pairs. Inflamm. Bowel. Dis. 10, 513-520; Vermeire et al, (2004) Genome wide scan in a Flemish inflammatory bowel disease population: support for the IBD4 locus, population heterogeneity, and epistasis. Gut 53, 980-986) could reflect the associations of rare and common variants of the XBPl gene region reported here. A currently emerging concept is that rare sequence variants with strong phenotypic effects might contribute substantially to variation in complex traits, and the aggregated risk contribution may result in common traits (Cohen et al, (2004) Multiple rare alleles contribute to low plasma levels of HDL cholesterol. Science 305, 869-872; Gorlov et al, (2008) Shifting paradigm of association studies: value of rare single-nucleotide polymorphisms. Am. J Hum. Genet. 82, 100-112), a view strongly supported by analyzing frequencies of synonymous and non-synonymous SNPs in an extensive data set. The authors found that the distribution of SNPs predicted to be 'possibly' and 'probably' damaging was shifted toward rare SNPs compared with the MAF distribution of benign and synonymous SNPs that are not likely to be functional (Gorlov et al, 2008). It was found in this instant invention that rare SNPs were 3 times more frequent in the CD and UC sequencing cohorts than the control cohort and five rare non-synonymous coding variants, 4 of which present only in IBD patients, were also validated.
Functional studies revealed that two of these IBD-restricted non- synonymous SNPs behaved as hypomorphs as evidenced by decreased transactivation of the UPR and induction of XBPl' s target genes, either in all conditions tested (XBPl snp8), or in response to exogenous induction of ER stress (XBPlsnplT). This pattern of decreased transactivation upon transfection of mutant XBPl cDNAs was observed in IEC lines
- Ill - with endogenous (wildtype) XBPl, as well as XBPl ; MEFs reconstituted with mutant or wildtype XBPl. Hence, these rare, IBD-associated variants are indeed hypomorphic as would be predicted for risk conferring variants from the mechanisms established through the mouse model present in the instant invention. While the functional impact of non- synonymous SNPs can be estimated by in vitro studies as presented herein, the biological significance and contribution to disease risk of the other associated as well as rare SNPs located outside the coding region is hard to predict; nonetheless, there are excellent examples that those variants could have important functional consequences (Birney et al., (2007) Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature 447, 799-816; Libioulle et ah,
(2007) Novel Crohn disease locus identified by genome- wide association maps to a gene desert on 5pl3.1 and modulates expression of PTGER4. PLoS. Genet. 3, e58). The phenomenon that multiple rare variants contribute to the overall risk at a particular locus most likely represents a common situation in many complex polygenic diseases (i.e. every patient has a "private" risk SNP). This is also exemplified by N0D2, which not only harbors few common alleles strongly associated with CD, but also multiple rare alleles that - taken together - account for a substantial proportion of disease risk attributed to that locus. It cannot be excluded though, taking the results of the haplotype analysis into account, that common variants contribute to disease risk at the XBPl locus in addition to the excess of private variants in patients. It is assumed in the instant invention that most given disease-associated genes will have a wide spectrum of allelic variants, both common and rare/private.
EQUIVALENTS Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the following claims.

Claims

What is claimed is:
1. A method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting in a nucleic acid sample from the subject at least one single nucleotide polymorphism (SNP) in intron 4 of XBP-
1. thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
2. The method of claim 1, wherein the SNP is at position 31 of SEQ ID NO: 170, wherein a T at position 31 of SEQ ID NO: 170 indicates that the subject has an increased risk of developing inflammatory bowel disease, and wherein a C at position 31 of SEQ ID NO: 170 indicates that the subject has an decreased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
3. The method of claim 1, wherein the SNP is at position 31 of SEQ ID NO: 169, wherein a T at position 31 of SEQ ID NO: 169 indicates that the subject has an increased risk of developing inflammatory bowel disease, and wherein a A at position 31 of SEQ ID NO: 169 indicates that the subject has an decreased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
4. A method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting in a nucleic acid sample from the subject at least one single nucleotide polymorphism (SNP) at position 48 of a nucleic acid sequence selected from the group consisting of SEQ ID NO: 114, 15, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, and 165, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
5. A method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting in a nucleic acid sample from the subject at least one single nucleotide polymorphism (SNP) at position 31 of a nucleic acid sequence selected from the group consisting of SEQ ID NO: 166, 167, 168, and 171, wherein a C at position 31 of SEQ ID NO: 166, C at position 31 of SEQ ID NO: 167, C at position 31 of SEQ ID NO: 168, and T at position 31 of SEQ ID NO: 171 indicate that the subject has an increased risk of developing inflammatory bowel disease, and wherein a wherein a T at position 31 of SEQ ID NO: 166, A at position 31 of SEQ ID NO: 167, A at position 31 of SEQ ID NO: 168, and G at position 31 of SEQ ID NO: 171, indicates that the subject has an decreased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
6. A method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting the single nucleotide polymorphisms (SNP) at position 31 of SEQ ID NO: 166, 168, 170, 172, 173, 174, and 175,wherein a T at postion 31 of SEQ ID NO: 166, a C at postion 31 of SEQ ID NO: 168, a C at postion 31 of SEQ ID NO: 170, a T at postion 31 of SEQ ID NO: 172, a G at postion 31 of SEQ ID NO: 173, a T at postion 31 of SEQ ID NO: 174, and a C at postion 31 of SEQ ID NO: 175 indicates that said subject has an increased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
7. A method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting the single nucleotide polymorphisms (SNP) at position 31 of SEQ ID NO: 166, 168, 170, 172, 173, 174, and 175, wherein a T at postion 31 of SEQ ID NO: 166, a A at postion 31 of SEQ ID NO: 168, a T at postion 31 of SEQ ID NO: 170, a T at postion 31 of SEQ ID NO: 172, a G at postion 31 of SEQ ID NO: 173, a T at postion 31 of SEQ ID NO: 174, and a C at postion 31 of SEQ ID NO: 175 indicates that said subject has an decreased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
8. A method for determining the predisposition of a human subject to develop inflammatory bowel disease, the method comprising detecting the single nucleotide polymorphisms (SNP) at position 31 of SEQ ID NO: 166, 168, 170, 172, 173, 174, and 175, wherein a C at postion 31 of SEQ ID NO: 166, a A at postion 31 of SEQ ID NO: 168, a C at postion 31 of SEQ ID NO: 170, a T at postion 31 of SEQ ID NO: 172, a G at postion 31 of SEQ ID NO: 173, a T at postion 31 of SEQ ID NO: 174, and a T at postion 31 of SEQ ID NO: 175 indicates that said subject has an decreased risk of developing inflammatory bowel disease, thereby determining the predisposition of a human subject to develop inflammatory bowel disease.
9. The method of any one of the preceding claims, wherein the single nucleotide polymorphism (SNP) is determined by primer extension of at least one PCR product and MALDI-TOF analysis.
10. The method of claim 9, wherein at least one oligonucleotides primer selected from the group consisting of SEQ ID NO: 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, and 113 is used to detect the SNP.
11. The method of any one of the preceding claims, wherein the inflammatory bowel disease is Crohn's disease or Ulcerative Colitis.
12. An isolated and purified allele-specific oligonucleotide probe of about 5 to about 50 nucleotides that specifically detects a single nucleotide polymorphisms (SNP) at position 48 of a sequence selected from the group consisting of SEQ ID NO: 114, 15, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, and 165.
13. A diagnostic kit comprising an oligonucleotide that specifically detects a single nucleotide polymorphisms (SNP) at position 48 of a sequence selected from the group consisting of SEQ ID NO: 114, 15, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, and 165.
PCT/US2009/052412 2008-07-31 2009-07-31 Polymorphisms associated with inflammatory bowel disease WO2010014905A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US13749208P 2008-07-31 2008-07-31
US61/137,492 2008-07-31

Publications (2)

Publication Number Publication Date
WO2010014905A2 true WO2010014905A2 (en) 2010-02-04
WO2010014905A3 WO2010014905A3 (en) 2010-07-08

Family

ID=41323593

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2009/052412 WO2010014905A2 (en) 2008-07-31 2009-07-31 Polymorphisms associated with inflammatory bowel disease

Country Status (1)

Country Link
WO (1) WO2010014905A2 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9957506B2 (en) 2013-09-25 2018-05-01 Cornell University Compounds for inducing anti-tumor immunity and methods thereof
US9956236B2 (en) 2011-02-07 2018-05-01 Cornell University Methods for increasing immune responses using agents that directly bind to and activate IRE-1
WO2019209942A1 (en) * 2018-04-24 2019-10-31 Cedars-Sinai Medical Center Methods and systems for characterizing severe crohn's disease
US10655130B2 (en) 2012-03-09 2020-05-19 Cornell University Modulation of breast cancer growth by modulation of XBP1 activity

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040077020A1 (en) * 2001-11-30 2004-04-22 Mannick Elizabeth E. Diagnostic microarray for inflammatory bowel disease, crohn's disease and ulcerative colitis
WO2008039445A2 (en) * 2006-09-25 2008-04-03 President And Fellows Of Harvard College Polymorphisms in the human xbp-1 gene are associated with inflammatory bowel disease

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040077020A1 (en) * 2001-11-30 2004-04-22 Mannick Elizabeth E. Diagnostic microarray for inflammatory bowel disease, crohn's disease and ulcerative colitis
WO2008039445A2 (en) * 2006-09-25 2008-04-03 President And Fellows Of Harvard College Polymorphisms in the human xbp-1 gene are associated with inflammatory bowel disease

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KASER A ET AL: "Endoplasmic reticulum stress in the intestinal epithelium and inflammatory bowel disease" SEMINARS IN IMMUNOLOGY, W.B. SAUNDERS COMPANY, PA, US, vol. 21, no. 3, 1 June 2009 (2009-06-01), pages 156-163, XP026140246 ISSN: 1044-5323 *
KASER ARTHUR ET AL: "XBP1 links ER stress to intestinal inflammation and confers genetic risk for human inflammatory bowel disease" CELL, vol. 134, no. 5, September 2008 (2008-09), pages 743-756, XP002559654 ISSN: 0092-8674 *
KASER ET AL: "O01 TRANSCRIPTION FACTOR XBP1 REGULATES PANETH CELL FUNCTION AND INFLAMMATION IN THE INTESTINE" 20070301, vol. 1, no. 1, 1 March 2007 (2007-03-01), pages 1-2, XP022365957 *
VAN LIMBERGEN JOHAN ET AL: "The genetics of Crohn's disease." ANNUAL REVIEW OF GENOMICS AND HUMAN GENETICS 2009, vol. 10, 19 May 2009 (2009-05-19), pages 89-116, XP0026140246 ISSN: 1545-293X *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9956236B2 (en) 2011-02-07 2018-05-01 Cornell University Methods for increasing immune responses using agents that directly bind to and activate IRE-1
US10655130B2 (en) 2012-03-09 2020-05-19 Cornell University Modulation of breast cancer growth by modulation of XBP1 activity
US9957506B2 (en) 2013-09-25 2018-05-01 Cornell University Compounds for inducing anti-tumor immunity and methods thereof
US10421965B2 (en) 2013-09-25 2019-09-24 Cornell University Compounds for inducing anti-tumor immunity and methods thereof
US10450566B2 (en) 2013-09-25 2019-10-22 Cornell University Compounds for inducing anti-tumor immunity and methods thereof
WO2019209942A1 (en) * 2018-04-24 2019-10-31 Cedars-Sinai Medical Center Methods and systems for characterizing severe crohn's disease

Also Published As

Publication number Publication date
WO2010014905A3 (en) 2010-07-08

Similar Documents

Publication Publication Date Title
Kaser et al. XBP1 links ER stress to intestinal inflammation and confers genetic risk for human inflammatory bowel disease
Jun et al. EPHA2 is associated with age-related cortical cataract in mice and humans
US20220056529A1 (en) Identification of pediatric onset inflammatory bowel disease loci and methods for use thereof for the diagnosis and treatment of the same
Downs et al. Late‐onset progressive retinal atrophy in the G ordon and I rish S etter breeds is associated with a frameshift mutation in C2orf71
EP1978107A1 (en) Fto gene polymorphisms associated to obesity and/or type II diabetes
Burnicka-Turek et al. Cilia gene mutations cause atrioventricular septal defects by multiple mechanisms
Tosi et al. Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor gene and summary of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic
US20100190162A1 (en) Methods of using single nucleotide polymorphisms in the tl1a gene to predict or diagnose inflammatory bowel disease
US20100240043A1 (en) Methods of using genetic variants to diagnose and predict inflammatory bowel disease
Oh et al. Single nucleotide polymorphisms of 8 inflammation‐related genes and their associations with smoking‐related cancers
US20150086567A1 (en) Role of ifng methylation in inflammatory bowel disease
JP2014097060A (en) Genetic sensitive variant of type 2 diabetes
US20180208988A1 (en) Methods of diagnosis and treatment of inflammatory bowel disease
WO2010014905A2 (en) Polymorphisms associated with inflammatory bowel disease
EP2411533B1 (en) Genetic severity markers in multiple sclerosis
WO2008039445A2 (en) Polymorphisms in the human xbp-1 gene are associated with inflammatory bowel disease
US20140377379A1 (en) Method for prognosing the age-at-onset of huntington&#39;s disease
EP2770325A1 (en) Mutations of DEPDC5 for diagnosing epilepsic diseases, disorders or conditions
Morgan et al. Association analysis of 3p21 with Crohn's disease in a New Zealand population
EP2611931A1 (en) Genomic markers for prediction of long-term response to growth hormone (gh) therapy
Li et al. Linkage analysis of the chromosome 5q31-33 region identifies JAKMIP2 as a risk factor for Graves’ disease in the Chinese Han population
JP4979382B2 (en) Use of genetic polymorphisms to predict drug-induced hepatotoxicity
Böhm ATM mutations in familial pancreatic cancer
Böhm ATM Mutations in Familial Pancreatic Cancer: ATM Mutationen Bei Familiärem Pankreaskarzinom
US9206480B2 (en) Genomic markers for prediction of long-term response to 2 years of growth hormone (GH) therapy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09791049

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09791049

Country of ref document: EP

Kind code of ref document: A2