WO2010009534A1 - Méthode de traitement, de prévention et de diagnostic de maladies associées au métabolisme lipidique - Google Patents

Méthode de traitement, de prévention et de diagnostic de maladies associées au métabolisme lipidique Download PDF

Info

Publication number
WO2010009534A1
WO2010009534A1 PCT/CA2009/000986 CA2009000986W WO2010009534A1 WO 2010009534 A1 WO2010009534 A1 WO 2010009534A1 CA 2009000986 W CA2009000986 W CA 2009000986W WO 2010009534 A1 WO2010009534 A1 WO 2010009534A1
Authority
WO
WIPO (PCT)
Prior art keywords
hdlc
gene
expression
protein
lipid metabolism
Prior art date
Application number
PCT/CA2009/000986
Other languages
English (en)
Inventor
Anny Fortin
Eduardo Diez
Philippe Gros
Ian William Tietjen
Original Assignee
Xenon Pharmaceuticals Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xenon Pharmaceuticals Inc. filed Critical Xenon Pharmaceuticals Inc.
Publication of WO2010009534A1 publication Critical patent/WO2010009534A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/92—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving lipids, e.g. cholesterol, lipoproteins, or their receptors
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276—Knock-out vertebrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/15—Animals comprising multiple alterations of the genome, by transgenesis or homologous recombination, e.g. obtained by cross-breeding
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/035—Animal model for multifactorial diseases
    • A01K2267/0362—Animal model for lipid/glucose metabolism, e.g. obesity, type-2 diabetes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/04—Endocrine or metabolic disorders
    • G01N2800/044—Hyperlipemia or hypolipemia, e.g. dyslipidaemia, obesity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/50—Determining the risk of developing a disease

Definitions

  • the present invention relates to the prevention, treatment and/or diagnosis of lipid metabolism associated diseases and disorders. More specifically, the present invention is concerned with the modulation of the expression and/or biological activity of cholesterol-related genes and their encoded proteins for the prevention and treatment of cholesterol-related diseases and disorders such as hyperlipidemia, atherosclerosis and cardiovascular diseases.
  • the present invention also relates to HDL related genes or encoded proteins and fragments thereof.
  • the present invention relates to HDLc related genes or encoded proteins as therapeutic and/or diagnosis targets in metabolic diseases.
  • HDL high-density lipoprotein
  • HDL particles may mediate protection against atherosclerosis (reviewed in Barter ef a/., 2003). These include the stimulation of reverse cholesterol transport, the inhibition of LDL oxidation, the inhibition of inflammation by suppressing the formation of adhesion molecules and macrophage chemotatic proteins, the reduction of lipoprotein retention, and the attenuation of endothelial dysfunction.
  • Apolipoprotein A-I Apolipoprotein A-I
  • Apolipoprotein A-IV Apolipoprotein A-IV
  • Lcat lecithin-cholesterol acyltransferase
  • Cetp cholesteryl ester transfer protein
  • LpI lipoprotein lipase
  • ATP-binding cassette transporter A1 Abcai
  • Inbred strains of mice diverge widely in their response to high-fat high-cholesterol diets as measured by plasma lipid levels and susceptibility to fatty streak lesions and gallstones formation (Paigen, 1995). For instance, C57BL/6J mice are prone to fatty streak lesions when fed a 15%, fat 1 % cholesterol diet for an 18 week-period, as opposed to A/J mice, and their post-diet HDLc is significantly different.
  • the phenotypic variation observed in inbred strains in response to high-fat diet provided the basis for several QTL (Quantitative Trait Loci) analyses aiming to identify atherosclerosis and HDLc controlling genes (Wang et a/., 2005; Wang & Paigen, 2005).
  • QTL Quality of Trait Loci
  • the AcB/BcA set of recombinant congenic mouse strains is a series of 36 inbred strains that were produced from the second backcross generation of the two progenitor strains A/J and C57BL/6J (Fortin et a/., 2001 b).
  • Each individual RCS carries a small amount (about 12.5%) of DNA from one parental strain fixed as a set of discrete congenic segments on the background (87.5%) of the other parent.
  • the strain set has been genetically characterized using a panel of 625 SSLP (simple sequence- length polymorphism) markers and the position of all congenic fragments has been established (Fortin et a/., 2001 b).
  • the AcB/BcA set of recombinant congenic strains provides an invaluable resource to decipher the complex genetic component of differential disease susceptibility reported for the A/J and C57BL/6J strains, as exemplified by their recent use to study a series of multigenic phenotypes such as susceptibility to malaria and Salmonella infections, pre-pulse inhibition of acoustic startle, lung fibrosis, and several others (Fortin et a/., 2001 a; Fortin et a/., 2002; Joober et a/., 2002; Lemay & Haston, 2005; Min-Oo et a/., 2004; Roy et a/., 2006).
  • individual genetic effects contributing to a complex trait may have segregated in individual RCS and can be studied in isolation, both to identify the gene involved and to elucidate unigenic contributions to the overall phenotype.
  • the relatively small size of the congenic segments fixed in individual RCS facilitates the search and testing of candidate genes (Min-Oo et a/., 2007).
  • secondary genetic effects can be detected in strains fixed for certain alleles at major mapped loci, yet showing deviations from expected phenotypes (Fortin et a/., 2001 a).
  • chr.9 locus Sequencing analysis of the chr.9 locus revealed a cfe novo loss of function mutation in the Apoai gene of the BcA68 strain, which prematurely truncates the ApoA1 protein (SEQ ID NO:4).
  • ApoA1 represents the major protein component of HDL in plasma and promotes cholesterol efflux from tissues to the liver for excretion. ApoA1 is also a cofactor for lecithin cholesterolacyltransferase (LCAT), which is responsible for the formation of most plasma cholesteryl esters.
  • LCAT lecithin cholesterolacyltransferase
  • the present invention relates to the fact that the BcA68 mice identified herein lack functional ApoA1 (i.e., Apoai-/-). Therefore, these mice may attempt to compensate for the absence of functional ApoA1 protein by up-regulating genes and/or proteins involved in cholesterol elimination and/or HDL expression/activity. For example, up-regulated genes and/or proteins may include those involved in boosting cholesterol efflux from the liver through its efflux and cholesterol transport in HDL lipoproteins. In parallel, ApoA1 deficient mice may also attempt to compensate for the absence of functional ApoA1 protein by down-regulating genes and/or proteins involved in cholesterol uptake/synthesis and/or HDL inhibition/catabolism.
  • lipid metabolism is evolutionarily conserved across many organisms and compounds that target specific enzymes or pathways involved in lipid metabolism have been shown to be effective not only in higher vertebrae but also in species as evolutionarily diverse as Caenorhabditis elegans (Hihi ef a/., 2007).
  • mouse knock-out model systems e.g., ApoA1 -/- mice
  • ApoA1 -/- mice are an established system for validation of a particular target, because they provide, among others, a targeted loss of function and the ability to observe the resulting effect at the physiological level in the animal as a whole.
  • the 47 genes of the present invention represent valid and desirable targets in humans and other species, they relate to genes and proteins that are differentially regulated in the absence of ApoAL
  • High HDL families were for the most part healthy, while low HDL families had very high rates of particular coronary artery disease (CAD) and/or CAD-related disorders.
  • CAD coronary artery disease
  • mutations in known HDL genes such as ABCA1, APOAI, LCAT, LPL, or CETP were ruled out by DNA sequencing of the pedigree probands.
  • the present invention allows the identification of novel therapeutic targets for the prevention, treatment and/or diagnosis of lipid metabolism associated diseases.
  • the present invention relates to preventing, treating or decreasing susceptibility to a lipid metabolism associated disease, as well as to identifying prophylactic and/or therapeutic compounds in this regard and diagnosing susceptibility and/or presence to such diseases.
  • the present invention relates to methods of identifying and/or selecting biologically active compounds that modulate (either increase or decrease) the activity of an HDLc related gene or encoded protein identified herein. These compounds are particularly suitable for treating lipid metabolism associated diseases and disorders including, but not limited to, hyperlipidemia, atherosclerosis and CVD.
  • the present invention concerns methods of identifying and/or selecting biologically active compounds that inhibit completely or partially the activity and/or expression of at least one HDLc related gene or encoded protein of the present invention involved directly or indirectly in lipid metabolism associated diseases and disorders. More particularly, the genes or proteins of the present invention which are inhibited are involved in, for example, i) the degradation of ApoA1 ; ii) the inhibition of the expression and/or maturation of ApoA1 ; iii) cholesterol synthesis; or iv) any combination of i), ii) and iii).
  • the at least one HDLc related gene or encoded protein which is inhibited isCelsri , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, IdM , Ppp1 r3c, Igfbp3, Cd163, C12ORF72 (4833442J19Rik), C7ORF50 (3110082117Rik), Il 13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk-C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, Fndc3b, Apob, S100a9, Plscri , SId 0a2, S100a
  • the at least one HDLc related gene or encoded protein that is targeted for screening for compounds that inhibit completely or partially its biological activity and/or expression is an HDLc related gene or encoded protein which shows a decrease in expression (i.e., is under-expressed) in the absence of ApoA1.
  • the at least one gene or encoded protein that is targeted for screening for compounds that inhibit completely or partially its biological activity and/or expression is CeIsM , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, IdM , Ppp1 r3c, Igfbp3, Cd163 or any combination thereof.
  • the HDLc related gene or encoded protein is CeIsM , Rfx4, or a combination thereof.
  • the present invention concerns methods of identifying and/or selecting biologically active compounds that increase the biological activity and/or expression of at least one HDLc related gene or encoded protein involved directly or indirectly in the biosynthesis pathway of ApoA1 and/or in the elimination of cholesterol.
  • the at least one HDLc related gene or encoded protein that is targeted for screening for compounds that increase its biological activity and/or expression is: CeIsM , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, IdM 1 Ppp1 r3c, Igfbp3, Cd163, C12ORF72 (4833442J19Rik), C7ORF50 (3110082117Rik), Il13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk-C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, Fndc3b, Apob, S100a9, Plsc
  • the at least one HDLc related gene or encoded protein that is targeted for screening for compounds that increase its biological activity and/or expression or facilitate cholesterol elimination is an HDLc related gene or encoded protein identified herein which shows an increased expression (i.e., is over-expressed) in the absence of ApoAL
  • the at least one HDLc related gene or encoded protein that is targeted for screening for compounds that increase its biological activity and/or expression or facilitate cholesterol elimination is an HDLc related gene or encoded protein which is C12ORF72 (4833442J19Rik), C7ORF50 (31 10082117Rik), Il 13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk-C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, Fndc3b, Apob, S100a9, PlscM , SId 0a2, S100a8, Steap4, CxcM , Saa1 , Orm2, Saa2, Lcn2, Mt2 or any combination thereof.
  • C12ORF72 48334
  • the HDLc related gene or encoded protein is C12ORF72 (4833442J19Rik), C7ORF50 (31 10082117Rik), Il 13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk-C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, or any combination thereof.
  • the present invention provides a method of identifying a compound for preventing, treating or decreasing susceptibility to a lipid metabolism associated disease, the method comprising determining whether:
  • test compound is increased in the presence of a test compound as compared to in the absence of the test compound; wherein the increase is indicative that the test compound can be used for preventing, treating or decreasing susceptibility to the lipid metabolism associated disease.
  • genes involved in the "biosynthesis pathway of ApoA1” are meant to encompass positive and negative regulators of ApoA1 , such as genes or proteins of the present invention which are either over-expressed or under-expressed in ApoA1 -/- mice.
  • the reference to genes involved in the "biosynthesis pathway of ApoA1” are also meant to encompass genes whose expression is altered in the presence or absence of ApoA1 (e.g. downstream genes involved in ApoA1 catabolism or degradation) but may not function as strict positive and negative regulators of ApoA1 (i.e., genes and/or proteins that act downstream of ApoA1 ).
  • genes involved in the "biosynthesis pathway of ApoA1" is meant to relate to genes and proteins of the present invention that are associated with increased ApoA1 expression or activity and/or decreased cholesterol levels in a subject (e.g., lower risk of CVD).
  • genes involved in the "biosynthesis pathway of ApoA1" is meant to relate to genes and proteins of the present invention that are associated with reduced ApoA1 expression or activity and/or increased cholesterol levels in a subject (e.g., high risk of CVD).
  • ApoA1 and/or in the elimination of cholesterol is CeIsM , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, IdM 1 Ppp1 r3c, Igfbp3, Cd163, C12ORF72 (4833442J19Rik), C7ORF50 (31 10082117Rik), Il13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk-C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, Fndc3b, Apob, S100a9, PlscM , Slc10a2, S100a8, Steap4, CxcM , Saa
  • the present invention provides a method of identifying a compound for preventing, treating or decreasing susceptibility to a lipid metabolism associated disease, the method comprising determining whether:
  • the HDLc related gene or protein is C12ORF72 (4833442J19Rik), C7ORF50 (3110082117Rik), Il 13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk-C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, Fndc3b, Apob, S100a9, PlscM , Slc10a2, S100a8, Steap4, CxcM , Saa1 , 0rm2, Saa2, Lcn
  • the HDLc related gene or encoded protein that is over- expressed in the above method is C12ORF72 (4833442J19Rik), C7ORF50 (31 10082117Rik), Il 13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk-C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, or any combination thereof.
  • the present invention provides a method of identifying a compound for preventing, treating or decreasing susceptibility to a lipid metabolism associated disease, themethod comprising determining whether:
  • the test compound is decreased in the presence of a test compound as compared to in the absence of the test compound; wherein the decrease is indicative that the test compound can be used for preventing, treating or decreasing susceptibility to the lipid metabolism associated disease,; wherein the HDLc related gene or encoded protein is involved, for example, in i) the degradation of ApoA1 ; ii) the inhibition of the expression and/or maturation of ApoA1 ; iii) cholesterol synthesis; or iv) any combination of i), ii) and iii).
  • the HDLc related gene or encoded protein used in the above method is the HDLc related gene or encoded protein used in the above method.
  • the present invention provides a method of identifying a compound for preventing, treating or decreasing susceptibility to a lipid metabolism associated disease, the method comprising determining whether:
  • the HDLc related gene or encoded protein is CeIsM , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, IdM , Ppp1 r3c, Igfbp3, Cd163, or any combination thereof.
  • the HDLc related gene or encoded protein that is under- expressed in the above method is CeIsM , Rfx4, or a combination thereof.
  • the present invention provides a method of identifying or characterizing a compound for preventing, treating or decreasing susceptibility to a lipid metabolism associated disease, the method comprising:
  • the decrease in the reporter gene expression or reporter protein activity is indicative that the test compound is useful for preventing, treating or decreasing susceptibility to the lipid metabolism associated disease
  • the HDLc gene in (a) is involved, for example, in i) the degradation of ApoA1 ; ii) the inhibition of the expression and/or maturation of ApoA1 (e.g., a negative regulator of ApoA1); iii) cholesterol synthesis; or iv) any combination of i), ii) and iii); and wherein the HDLc related gene or encoded protein is CeIsM , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, IdM 1 Ppp1 r3c, Igfbp3, Cd163, C12ORF72 (4833442J19Rik), C7ORF50 (3110082117Rik), Il13ra1 , Ighg,
  • the HDLc related gene of the above method is involved in, for example, i) the degradation of ApoA1 ; ii) the inhibition of the expression and/or maturation of ApoA1 ; iii) cholesterol synthesis; or iv) any combination of i), ii) and iii), is under-expressed in the absence of ApoA1 and is CeIsM , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, IdM , Ppp1 r3c, Igfbp3, Cd163 or any combination thereof.
  • the HDLc related gene is CeIsM , Rfx4, or a combination thereof.
  • the present invention provides a method of identifying or characterizing a compound for preventing, treating or decreasing susceptibility to a lipid metabolism associated disease, the method comprising:
  • the increase in reporter gene expression or reporter protein activity is indicative that the test compound is useful for preventing, treating or decreasing susceptibility to the lipid metabolism associated disease
  • the HDLc gene in (a) is involved, for example, directly or indirectly in the biosynthesis pathway of ApoA1 (e.g., a gene or protein that increases or decreases the activity or expression of ApoA1) and/or in the elimination of cholesterol
  • the HDLc related gene is CeIsM , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, IdM 1 Ppp1 r3c, Igfbp3, Cd163, C12ORF72 (4833442J19Rik), C7ORF50 (31 10082117Rik), Il 13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyp2b10,
  • the HDLc related gene of the above method that is involved directly or indirectly in the biosynthesis pathway of ApoA1 and/or in the elimination of cholesterol is over-expressed in the absence of ApoA1 and is C12ORF72 (4833442J19Rik), C7ORF50 (31 10082117Rik), Il 13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk-C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, Fndc3b, Apob, S100a9, PlscM , SId 0a2, S100a8, Steap4, CxcM , Saa1 , 0rm2, Saa2, Lcn2, Mt
  • HDLc related gene over-expressed in the absence of ApoA1 is
  • C12ORF72 (4833442J19Rik), C7ORF50 (3110082117Rik), Il 13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk-C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, or any combination thereof.
  • the present invention also relates to a method of preventing, treating or decreasing susceptibility to a lipid metabolism associated disease in a subject comprising administering to the subject at least one functional HDLc related protein of the present invention, or a functional fragment thereof, or a nucleic acid encoding same.
  • Particularly useful HDLc related proteins or functional fragment thereof or nucleic acids encoding same for treating or preventing a lipid metabolism associated disease are those involved directly or indirectly in the biosynthesis pathway of ApoA1 (e.g., a gene or protein that increases or decreases the activity or expression of ApoA1 ) and/or in the elimination of cholesterol.
  • the HDLc related protein, functional fragment thereof or nucleic acid encoding same which is involved directly or indirectly in the biosynthetic pathway of ApoA1 (e.g., a gene or protein that increases or decreases the activity or expression of ApoA1 ) and/or in the elimination of cholesterol and which is administered is encoded by a gene which is CeIsM , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, IdM 1 Ppp1 r3c, Igfbp3, Cd163, C12ORF72 (4833442J19Rik), C7ORF50 (31 10082117Rik), Il 13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini
  • the HDLc related protein or functional fragment thereof which is administered is encoded by a gene over-expressed in the absence of ApoA1 which is C12ORF72 (4833442J19Rik), C7ORF50 (3110082117Rik), Il13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk-C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, Fndc3b, Apob, S100a9, PlscM , Slc10a2, S100a8, Steap4, CxcM , Saa1 , 0rm2, Saa2, Lcn2, Mt2, or any combination thereof.
  • ApoA1 which is C12ORF72 (4833442J19R
  • the HDLc related protein or functional fragment thereof or nucleic acid encoding same is C12ORF72 (4833442J19Rik), C7ORF50 (3110082117Rik), Il13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk-C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, or any combination thereof.
  • the present invention further relates to a method of preventing, treating or descreasing susceptibility to a lipid metabolism associated disease in a subject comprising increasing the biological activity and/or expression of an HDLc related gene or encoded protein of the present invention in the subject.
  • Particularly useful therapeutic targets for the above method are those involved directly or indirectly in the biosynthesis pathway of ApoA1 and/or in the elimination of cholesterol.
  • the method of preventing, treating or descreasing susceptibility to a lipid metabolism associated disease in a subject comprises increasing the biological activity and/or expression of an HDLc related gene or encoded protein involved directly or indirectly in the biosynthesis pathway of ApoA1 and/or in the elimination of cholesterol, wherein the HDLc related gene is CeIsM , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, IdM 1 Ppp1 r3c, Igfbp3, Cd163, C12ORF72 (4 ⁇ 33442J19Rik), C7ORF50 (31100 ⁇ 2l 17Rik), Il13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns
  • the method of preventing, treating or decreasing susceptibility to a lipid metabolism associated disease in a subject comprises increasing the biological activity and/or expression of at least one HDLc related gene or encoded protein over-expressed in the absence of ApoA1 , wherein the HDLc related gene is C12ORF72 (4833442J19Rik), C7ORF50 (31 10082117Rik), Il 13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk-C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, Fndc3b, Apob, S100a9, PlscM , Slc10a2, S100a8, Steap4, CxcM , Saa1
  • the method of preventing, treating or decreasing susceptibility to a lipid metabolism associated disease in a subject comprises increasing the biological activity and/or expression of one or more HDLc related genes or encoded proteins, wherein the HDLc related gene is C12ORF72 (4833442J19Rik), C7ORF50 (3110082117Rik), Il 13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk-C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2 or any combination thereof.
  • the HDLc related gene is C12ORF72 (4833442J19Rik), C7ORF50 (3110082117Rik), Il 13ra1 , Ighg, hnrpab, Su
  • the present invention further relates to a method of preventing, treating or decreasing susceptibility to a lipid metabolism associated disease in a subject comprising inhibiting totally or partially the expression and/or biological activity of an HDLc related gene or encoded protein identified herein which directly or indirectly lowers HDL level, increases LDL level, etc.
  • Particularly useful HDLc related genes or encoded proteins to be inhibited in the above-mentioned method are those that have a general positive effect on cholesterol synthesis (e.g., genes that prevent the expression or maturation of Apoal , genes involved in the degradation of ApoA1 , or genes involved in cholesterol synthesis).
  • the present invention relates to a method for preventing, treating or decreasing susceptibility to a lipid metabolism associated disease in a subject comprising inhibiting totally or partially in the subject the expression and/or biological activity of an HDLc related gene or encoded protein involved in, for example, i) the degradation of ApoA1 ; ii) the inhibition of the expression and/or maturation of ApoA1 ; iii) cholesterol synthesis; or iv) any combination of i), ii) and iii), and wherein the HDLc related gene or encoded protein is CeIsM , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, IdM , Ppp1 r3c, Igfbp3, Cd163, C12ORF72 (4833442J19Rik), C7ORF50 (3110082117Rik), Il13ra1 , Ighg,
  • the method of preventing, treating or decreasing susceptibility to the lipid metabolism associated disease comprises inhibiting totally or partially the activity and/or expression in a subject of one or more HDLc related genes or encoded proteins under-expressed in the absence of ApoA1 , wherein the HDLc related gene is CeIsM , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, Idi1 , Ppp1 r3c, Igfbp3, Cd163, or any combination thereof.
  • the HDLc related genes or encoded proteins under-expressed in the absence of ApoA1 is CeIsM , Rfx4 or a combination thereof.
  • the invention relates to the use of biologically active compounds that increase the biological activity and/or expression of an HDLc related protein or nucleic acid encoding same, identified herein, in the manufacture of a pharmaceutical composition or medicament for preventing, treating or decreasing susceptibility to a lipid metabolism associated disease in a subject.
  • Particularly useful compounds are those that increase the biological activity and/or expression of a functional HDLc related protein or nucleic acid encoding same that is involved directly or indirectly in the biosynthesis pathway of ApoA1 and/or in the elimination of cholesterol and which is CeIsM , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, IdM 1 Ppp1 r3c, Igfbp3, Cd163, C12ORF72 (4833442J19Rik), C7ORF50 (31 10082117Rik), Il 13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk- C, Nrg4, Slc41 a2, Tgm1 , B3galt1 ,
  • the HDLc related protein or nucleic acid encoding the same targeted by the compounds used in the manufacture or the preparation of a pharmaceutical composition or medicament for preventing, treating or decreasing susceptibility to a lipid metabolism associated disease, is over-expressed in the absence of ApoA1 and is C12ORF72 (4833442J19Rik), C7ORF50 (31 10082117Rik), Il 13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk- C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, Fndc3b, Apob, S100a9, PlscM , Slc10a2, S100a8, Steap4, CxcM , Saa1
  • the HDLc related protein or nucleic acid encoding the same targeted by the compounds used in the manufacture or the preparation of a pharmaceutical composition or medicament for preventing, treating or decreasing susceptibility to a lipid metabolism associated disease, is over-expressed in the absence of ApoA1 and is C12ORF72 (4833442J19Rik), C7ORF50 (31 10082117Rik), Il 13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk- C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, or any combination thereof.
  • the present invention is concerned with the use of an HDLc related protein, functional fragment thereof or nucleic acid encoding the same, involved directly or indirectly in the biosynthesis pathway of ApoA1 and/or in the elimination of cholesterol, in the preparation of a pharmaceutical composition or medicament for preventing, treating or decreasing susceptibility to a lipid metabolism associated disease, wherein the HDLc related protein, functional fragment thereof or nucleic acid encoding same is CeIsM , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, IdM , Ppp1 r3c, Igfbp3, Cd163, C12ORF72 (4833442J19Rik), C7ORF50 (3110082117Rik), Il13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇
  • the HDLc related protein, functional fragment thereof is C12ORF72
  • the HDLc related protein, functional fragment thereof or nucleic acid encoding same is C12ORF72 (4833442J19Rik), C7ORF50 (3110082117Rik), Il13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk-C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, or any combination thereof.
  • the present invention is concerned with the use of biologically active compounds that inhibit totally or partially the biological activity and/or expression of a functional HDLc related protein or nucleic acid encoding same, identified herein, in the manufacture of a medicament or pharmaceutical composition for preventing, treating or decreasing susceptibility to a lipid metabolism associated disease in a subject.
  • Particularly useful compounds are those that inhibit totally or partially the biological activity and/or expression of a functional HDLc related protein or nucleic acid encoding same involved in, for example, i) the degradation of ApoA1 ; ii) the inhibition of the expression and/or maturation of ApoA1 ; iii) cholesterol synthesis; or iv) any combination of i), ii) and iii), and is CeIsM , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, IdM 1 Ppp1 r3c, Igfbp3, Cd163, C12ORF72 (4 ⁇ 33442J19Rik), C7ORF50 (31 100 ⁇ 2l 17Rik), Il 13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb56
  • the HDLc related protein or nucleic acid encoding the same targeted by the compounds used in the manufacture of a pharmaceutical composition or medicament for preventing, treating or decreasing susceptibility to a lipid metabolism associated disease, is under-expressed in the absence of ApoA1 and is CeIsM , Rfx4, SqIe, Cyp2b10, Cyp ⁇ bi , Elovl3, Ctgf, Fdps, IdM , Ppp1 r3c, Igfbp3, Cd163 or any combination thereof.
  • the HDLc related protein or nucleic acid encoding the same targeted by the compounds used in the manufacture of a pharmaceutical composition or medicament for preventing, treating or decreasing susceptibility to a lipid metabolism associated disease is under-expressed in the absence of ApoA1 and is CeIsM , Rfx4, or a combination thereof.
  • the present invention provides a method for diagnosing a subject as having or having a predisposition to a lipid metabolism associated disease, the method comprising determining in a biological sample from the subject:
  • a difference in the level relative to a corresponding control level or the presence of a functional mutation in the HDLc related nucleic acid or encoded protein is indicative of having or having a predisposition to lipid metabolism associated diseases.
  • biological sample is intended to include tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject.
  • a preferred biological sample is a plasma or blood sample isolated by conventional means from a subject.
  • a sample taken from a patient having, suspected of having or at risk of developing a disease or disorder can be compared to a known standard.
  • the term "known standard" may be, but is not limited to, a statistically significant reference group of: (1 ) normal, unaffected or asymptomatic patients and/or (2) abnormal and/or symptomatic patients that have a disease or disorder (e.g., a disease related to abnormal lipid metabolism) to provide diagnostic, prognostic, or predictive information pertaining the patient from whom the sample was obtained. It should be understood that in certain cases it might be advantageous to compare the result of a patient with a standard calculated or known from a group mentioned above, but within a population or ethnic group from which the patient originates or belongs.
  • the present invention is concerned with a method of detecting a functional mutation in an HDLc related gene or encoded protein in a biological sample from a subject, wherein the gene is CeIsM , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, IdM , Ppp1 r3c, Igfbp3, Cd163, C12ORF72 (4833442J19Rik), C7ORF50 (3110082117Rik), Il 13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk-C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, Fndc3b,
  • the present invention also provides a kit or package for diagnosing a subject as having or having a predisposition to a lipid metabolism associated disease, the kit comprising a means for determining in a biological sample from the subject:
  • the present invention also provides diagnostic kits comprising primers, probes and/or antibodies for detecting in a biological sample from a subject the presence of an alteration in an HDLc related gene sequence, RNA sequence or expression level, encoded protein sequence, expression level or protein activity.
  • the diagnostic kits further comprise buffers and reagents for detecting the alteration as well as instructions for using the diagnostic kits.
  • the present invention also provides a non-human animal model having a 66-67GOTT mutation in the Apoai gene, which results in a 22-23WOC Stop truncated protein.
  • the non-human animal model is a mouse, particularly a mouse of the recombinant congenic line, BcA68.
  • the non-human animal model is used to study diseases related to abnormal lipid metabolism. In another embodiment, the non-human animal model is used to identify or ameliorate agents for preventing, treating and/or decreasing susceptibility to diseases related to abnormal lipid metabolism in general and abnormal HDL metabolism in particular.
  • the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), "including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, un-recited elements or method steps.
  • Table A The genes and proteins of the present invention are summarized in Table A, which also lists the genes that are differentially expressed in Apoai -/- mice, genes that are under- and over-expressed in Apoai -/- mice, genes that are poorly annotated or whose function has not been described in the prior art, and genes that have been identified herein via human linkage studies (e.g., Example 8).
  • Figure 1 shows cholesterol levels in AcB/BcA recombinant congenic strains of mice when fed a normal or high-fat diet. Cholesterol fractions were determined in 3-6 males (A) and females (B) pre- and post- a four-week period of high-fat diet. Mean values were used to generate the graphs. Standard errors of the means are shown for both HDL and non-HDL cholesterol. The non HDL cholesterol fraction was calculated by subtracting the HDLc value from the total cholesterol value;
  • FIG. 2 shows segregation analyses of HDLc in BcA68- and AcB65 -derived crosses.
  • F1 and F2 mice derived from BcA68 (A) and AcB65 (B) were fed normal and high-fat diet prior to HDLc measurements, respectively. Males and females are combined for BcA68-derived crosses. Each dot represents a mouse. Averages for each group are indicated by horizontal bars;
  • Figure 3 shows genome-wide interval mapping in (AcB65 X AKR)F2 mice (groupi ).
  • Figure 5 shows that low HDLc in BcA68 is caused by a premature truncation in apolipoprotein A1 (ApoA1 ).
  • A Comparison of nucleotide sequences from PCR-Amplified DNA of BcA68 and C57BL/6J parental control has revealed the presence of two mutations (66-67GG>TT) predicted to cause premature translation termination of the BcA68 ApoA1 protein.
  • B The 66-67GC>TT mutation in Apoai (resulting in 22-23WQ>CStop) destroys an Mwol restriction site in genomic DNA.
  • Digestion products corresponding to B6, A/J (270 bp + 280 bp; Apoa166-67GC), BcA68 (550 bp; Apoa166-67TT) and to homozygous and heterozygous combinations seen in segregating F2 mice are shown after agarose gel electrophoresis.
  • C The effect of homozygosity or heterozygosity with respect to either wild type (+; Apoa166-67GC) or mutated (-; Apoai 66-67TT) Apoai alleles on plasma HDLc is shown for informative (BcA68 X AKR)F2 mice. Mice were grouped according to their Apoai haplotypes. Each dot represents a mouse and averages for each group are indicated by horizontal bars;
  • FIG. 6 shows the clustering and graphical display of functional Apoai -dependent gene expression levels.
  • F2 mice were derived from BcA68 and C57BL/6J parental strains.
  • Figure 7 shows representative high HDL pedigree NL-510 with allele segregation analysis of two SNPs located near candidate genes ORM2 and SUSD1.
  • the two SNPs shown are representative of nine informative SNPs that have undergone segregation analysis. Inferred genotypes are shown in parenthesis. The susceptibility haplotype segregates with high HDL throughout the pedigree with the exception of individual 111:21 (circled) who is non-penetrant.
  • the present invention is thus based in one aspect, on the fact that the Apoai -/- mouse identified herein is trying to compensate the absence of ApoA1 by boosting cholesterol efflux from liver through its efflux and transport in HDL lipoproteins. Ingestion of large amounts of fatty foods causes high circulating cholesterol. Since the level of ApoA1 is insufficient to metabolize such cholesterol in the Apoai - /- mice of the present invention, the expression of genes involved in the biosynthesis pathway of ApoA1 and/or in the elimination of cholesterol in general is increased in order to try to eliminate such cholesterol.
  • genes involved in, for example, i) the catabolism of ApoA1 ; ii) the inhibition of the expression of ApoA1 ; iii) the inhibition of the maturation of ApoA1 ; and/or iv) cholesterol synthesis are downregulated since there is already too much cholesterol in the subject.
  • subject or "patient” as used herein refers to an animal, preferably a mammal, and most preferably a human who is the object of treatment, observation or experiment.
  • mammal includes humans and both domestic animals such as laboratory animals and household pets, (e.g. cats, dogs, swine, cattle, sheep, goats, horses, rabbits), and non-domestic animals such as wildlife and the like.
  • the HDLc related genes of the present invention are either up-regulated or down- regulated in the absence of ApoA1 , depending on their agonistic or antagonistic role on same.
  • the modulation of gene expression observed in the Apoai -/- mice of the present invention mimics what is generally seen in lipid metabolism associated disease state.
  • the therapeutic strategy of the present invention implies either a) stimulating genes that are in the biosynthesis pathway of ApoA1 (HDLc related genes up-regulated in the complete absence of ApoA1 , for example), or b) inhibiting genes that i) prevent its expression and/or maturation; ii) stimulate its degradation; or iii) have a positive effect on cholesterol synthesis (HDLc related genes down-regulated in complete absence of Apoal , for example).
  • the present invention provides, for example, 1) screening methods for the identification of compounds that modulate the activity and/or expression level of one or more HDLc related genes or encoded proteins identified herein; 2) methods of treating or preventing lipid metabolism associated diseases and disorders; and 3) diagnostic methods and kits for detecting a predisposition to lipid metabolism associated diseases and disorders; 4) methods and kits to identify mutations in the genes , cDNA and proteins of the present invention; and 5) the sequences of mouse genes cDNA and proteins (Table 5) of the present invention and those of the corresponding human orthologs (Table 6).
  • the terms "molecule”, “compound”, “agent” or “ligand” are used interchangeably and broadly to refer to natural, synthetic or semi-synthetic molecules or compounds.
  • the term “compound” therefore denotes, for example, chemicals, macromolecules, cell or tissue extracts (from plants or animals) and the like.
  • Non-limiting examples of compounds include peptides, antibodies, carbohydrates, nucleic acid molecules and pharmaceutical agents.
  • the compound can be selected and screened by a variety of means including random screening, rational selection and by rational design using, for example, protein or ligand modeling methods such as computer modeling.
  • the terms “rationally selected” or “rationally designed” are meant to define compounds which have been chosen based on the configuration of interacting domains of the present invention.
  • the modulating compounds of the present invention are modified to enhance their stability and their bioavailability.
  • the compounds or molecules identified in accordance with the teachings of the present invention have a therapeutic value in diseases or conditions related to abnormal lipid metabolism or HDL-related diseases.
  • binding agent is a molecule or compound that specifically binds to or interacts with a polypeptide or nucleic acid of the present invention.
  • binding agents include antibodies, interacting partners, ligands, RNA, DNA, oligonucleotides, primers, probes and the like. It will be understood that such binding agents can be natural, recombinant or synthetic.
  • antagonists refer to any molecule, compound or agent capable of inhibiting (completely or partially) a biological activity of a polypeptide of the present invention.
  • agonists or “stimulators” refer to any molecule, compound or agent capable of enhancing or stimulating (completely or partially) a biological activity of a polypeptide of the present invention.
  • modulates means increase or decrease.
  • an agent that modulates lipid levels e.g., HDL-c levels or total cholesterol levels
  • the expression, activity, stability or degradation of a polypeptide of the present invention does so by at least 5%, preferably by at least 10%, more preferably by at least 25% and most preferably by at least 50%.
  • other units e.g., 6, ...9, ...23, ...51, ...60%.
  • Modulators of the present invention may include large or small inorganic or organic molecules.
  • modulators are small organic molecules, or derivatives or analogs thereof. Such small molecules preferably have a molecular weight below 2,000 daltons, more preferably between 300 and 1,000 daltons, and even more preferably between 400 and 700 daltons.
  • a modulator includes a protecting group.
  • protecting group refers to chemical moieties that block at least some reactive moieties and prevent such groups from participating in chemical reactions until the protective group is removed (or "cleaved”). Examples of suitable blocking/protecting groups are described, e.g., in Greene, T.W. and P.G.M. Wuts, Greene's Protective Groups in Organic Synthesis (2006), 4th Ed., Wiley.
  • any of the modulators may possess one or more chiral centers and each center may exist in the R or S configuration.
  • Modulators of the present invention include all diastereomeric, enantiomeric, and epimeric forms as well as mixtures thereof. The present invention is meant to include all such possible isomers, as well as their racemic and optically pure forms. Stereoisomers may be obtained, if desired, by methods known in the art as, for example, the separation of stereoisomers by chiral chromatographic columns and/or fractional crystallisation.
  • Modulators further include of N-oxides, crystalline forms (also known as polymorphs), and pharmaceutically acceptable salts, as well as active metabolites of any inhibitor.
  • modulators described herein can exist in unsolvated as well as solvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like.
  • solvated forms of the modulators presented herein are also included within the present invention.
  • intermediate forms of the modulators thereof and prodrugs that may be inactive when administered to a subject in need thereof, but is converted in vivo to an active compound, for example, by hydrolysis in blood.
  • Modulators of the polynucleotides and polypeptides of the present invention may be identified according to any number of routine in vitro or in vivo screening procedures available in the art, e.g., using commercially available libraries of such compounds.
  • the invention further provides methods of identifying and selecting compounds useful in the prevention or treatment of lipid metabolism associated and HDL-related diseases or disorders.
  • Compounds that modulate the expression, stability or activity of a gene or protein of the present invention are considered useful in the invention. These compounds include modulators (i.e., inhibitors and inducers, including antagonists and agonists) of the expression, stability and/or activity of a polynucleotide or polypeptide of the present invention.
  • modulators i.e., inhibitors and inducers, including antagonists and agonists
  • such modulators are identified by screening candidate molecules, including, e.g., all of the different types of molecules described above.
  • any assay suitable for determining expression or activity of a polynucleotide or polypeptide of the present invention may be utilized, including, but not limited to, binding assays and biological functional assays described herein.
  • the invention contemplates at least two different types of inhibitors, including (1 ) compounds that decrease a functional activity of a polypeptide of the present invention; and (2) compounds that decrease expression levels of a polynucleoide or polypeptide of the present invention.
  • An inhibitor is identified as a compound that reduces one or more activities or expression of a polynucleotide or polypeptide of the present invention by at least 10%, at least 25%, at least 50%, at least 75%, or 100%.
  • the units e.g., 1 1 , 12...81 , 82,...91 , 92%.
  • an inducer is identified as a molecule or compound that increases one or more activities by at least two-fold, at least five-fold, at least ten-fold, at least one hundred-fold or more.
  • an inducer is a molecule or compound that increases expression at least two-fold, at least five-fold, at least ten-fold, at least one hundred-fold or more.
  • Modulators may be identified from a variety of sources, for example, cells, cell-free preparations, chemical libraries, collections of chemical compounds, natural product mixtures and/or bioinformatic analysis. They may be identified using any of the numerous approaches in combinatorial library methods known in the art, including, e.g., screening of biological libraries, screening of spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound” library method, and synthetic library methods using affinity chromatography selection.
  • Candidate modulators may be screened individually, e.g., when a specific molecule is predicted to function as an inhibitor or inducer/activator.
  • Candidate modulators may be purified (or substantially purified) molecules or may be one component of a mixture of compounds (e.g., an extract or supernatant obtained from cells).
  • expression or activity of a polynucleotide or polypeptide of the present invention is tested against progressively smaller subsets of the candidate compound pool until a single compound or minimal compound mixture is demonstrated to modulate expression or activity of a polynucleotide or polypeptide of the present invention.
  • diverse mixtures i.e., libraries
  • libraries of test compounds may be assayed in such a way that the pattern of response indicates which compounds in the various mixtures are responsible for the effect (deconvolution).
  • Libraries of compounds are commercially available and may be synthesized accordingly to methods known in the art.
  • the present invention provides a method of identifying a compound that modulates activity or expression of a polynucleotide or polypeptide of the present invention, comprising contacting a cell comprising a polynucleotide or polypeptide of the present invention with a compound and determining whether said contacting results in increased expression or activity of the corresponding polynucleotide or polypeptide of the present invention.
  • a variety of different polypeptides and polynucleotides of the present invention may be used in such assays, including full length cDNAs, RNAs and polypeptides, as well as fragments or variants thereof.
  • polypeptide or polynucleotide fragments or variants of the present invention may be adapted to utilize polypeptide or polynucleotide fragments or variants of the present invention.
  • the selectivity of a compound that modulates the activity of a polypeptide of the present invention over its effect on a control polypeptide is desired.
  • the polypeptide or polynucleotide of the present invention employed in these various assays may either be free in solution, attached to a solid support, borne on a cell surface or located intracellular ⁇ or associated with a portion of a cell.
  • a solid support borne on a cell surface or located intracellular ⁇ or associated with a portion of a cell.
  • One skilled in the art can, for example, measure the formation of complexes between the polypeptide of the present invention and the compound being tested.
  • one skilled in the art can examine the diminution in complex formation between a polypeptide of the present invention and its substrate caused by the compound being tested.
  • modulators are identified by their ability to bind to a polynucleotide or polypeptide of the present invention, or fragment thereof. Binding molecules are particularly useful in modulating (i.e., blocking, inhibiting or stimulating) biological activities of polypeptides of the present invention. Accordingly, the present invention provides a method of identifying a modulator of a polypeptide of the present invention comprising contacting the polypeptide with a compound and determining whether the compound specifically binds to the polypeptide as compared to a control polypeptide. In particular embodiments, at least two-fold, three-fold, five-fold, or ten-fold more modulator will be bound to the polypeptide of the present invention as to an equivalent amount of an unrelated polypeptide.
  • Routine binding assays suitable for screening candidate molecules and compounds are well known in the art and include, e.g., GST pulldown assays using recombinantly-produced GST- polypeptide of the present invention fusion polypeptides, affinity chromatography, phage display, immunoprecipitation assays under low stringency conditions suitable for precipitating polypeptide complexes using antibodies to the polypeptides, ELISA assays, and radioimmunoassays.
  • modulators are identified by other means of identifying the polypeptide's binding partner, such as phage display techniques and yeast two-hybrid screening. Such interactions can be further assayed by means including but not limited to fluorescence polarization or scintillation proximity methods.
  • binding molecules are identified or developed using an isolated or recombinant polypeptide of the present invention, variants thereof, or cells expressing polypeptides of the present invention.
  • variants have at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to the polypeptide of the present invention.
  • the use of recombinant polypeptides of the present invention may allow for better specificity (higher relative purity), provide the ability to generate large amounts of receptor material, and can be used in a broad variety of formats (see Hodgson, Bio/Technology, 1992, 10, 973-980; each of which is incorporated herein by reference in its entirety).
  • methods of identifying a modulator of a polypeptide of the present invention comprise identifying a compound that modulates (i.e., increases or decreases) an activity of the polypeptide. These methods comprise contacting a polypeptide of the present invention with a compound, and determining whether the compound modifies an activity of the polypeptide.
  • the polypeptide will be present in a cell or animal.
  • the degree of biological activity of the polypeptide in the presence of a candidate compound is compared to the degree of activity in its absence, under equivalent conditions. Where the activity of the sample containing the test compound is higher than the activity in the sample lacking the test compound, the compound will have increased activity.
  • Biological activity of a polypeptide of the present invention may be measured by any standard assay, for example, those described herein.
  • Suitable assays for measuring the binding of a modulator to a target protein or for measuring the ability of a modulator to affect a biological activity of a target protein include, but are not limited to, Western blot, immunoblot, enzyme-linked immunosorbant assay (ELISA), radioimmunoassay (RIA), immunoprecipitation, surface plasmon resonance, chemiluminescence, fluorescent polarization, phosphorescence, immunohistochemical analysis, matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, microcytometry, microarray, microscopy, fluorescence activated cell sorting (FACS), and flow cytometry.
  • Other assays include cell-based assays such as: cytokine secretion assays, or intracellular signal transduction assays that determine, for example, protein or lipid phosphorylation, mediator release or intracellular Ca ++ mobilization.
  • the present invention also relates to method for identifying an HDL-enhancing agent, comprising administering to an animal an effective amount of an agent found to have modulating HDL levels or activity using any of the assays disclosed herein and detecting an increase in plasma HDL levels or activity in said animal due to said administering thereby identifying an agent as useful in enhancing HDL levels or activity.
  • the present invention specifically contemplates a situation whereby a user of an assay of the invention may use the assay to screen for compounds having the desired biological activity and, having identified the compound, then conveys that information (i.e., information as to structure, dosage, etc.) to another user who then utilizes the information to reproduce the agent and administer it for therapeutic, clinical trials or research purposes.
  • This transmission of information is specifically contemplated by the present invention and it may occur in any form: verbal, written or electronically, for example.
  • Treating covers the treatment of the lipid metabolism associated or HDL-related disease or disorders of interest in a mammal, preferably a human, having the related disease or disorders of interest, and includes:
  • HDL is a well-established and strong predictor of, for example, cardiovascular diseases. Indeed, epidemiological, mechanistic and intervention studies suggest that low HDL is a major cardiovascular risk factor and that increasing HDL plasma levels may be beneficial, particularly in patients with low HDL levels (Hansel et al. (2007) Int. J. Clin. Pract. 61 (11 ): 1905-1913). With this knowledge in mind, and the data provided by the studies in mice, genetic analysis studies were conducted herein on a large family of human patients with extreme HDL levels.
  • HDLc related gene “HDLc related nucleic acid”, “HDLc related protein” and the like, is meant any nucleic acid (cDNA, mRNA, DNA, etc.) or encoded protein identified herein whose expression and/or activity is modulated (either increased or decreased) in the absence of ApoA1.
  • cDNA cDNA, mRNA, DNA, etc.
  • encoded protein identified herein whose expression and/or activity is modulated (either increased or decreased) in the absence of ApoA1.
  • the skilled artisan will understand whether to use a gene per se or a cDNA, mRNA and the like for particular embodiments of the present invention.
  • HDLc related genes or encoded proteins of the present invention comprise the genes CeIsM , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, IdM 1 Ppp1 r3c, Igfbp3, Cd163, C12ORF72 (4833442J19Rik), C7ORF50 (3110082117Rik), Il13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gna ⁇ l , T2bp, Gvini , Asns, Igk-C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, Fndc3b, Apob, S100a9, PlscM , Slc10a2, S100a8, Steap4, Cx
  • HDLc related genes or proteins of the present invention which are under-expressed in the absence of ApoA1 include CeIsM , Rfx4, SqIe, Cyp2b10, Cyp8b1 , Elovl3, Ctgf, Fdps, IdM , Ppp1 r3c, Igfbp3, Cd163 and combinations thereof.
  • HDLc related genes or proteins of the present invention which are over-expressed in the absence of ApoA1 include C12ORF72 (4833442J19Rik), C7ORF50 (31 10082117Rik), Il13ra1 , Ighg, hnrpab, SusD1 , Arrdc3, Ung, Nol5, Dnajc12, Cpne ⁇ , Cyb561 , Gnati , T2bp, Gvini , Asns, Igk-C, Nrg4, Slc41 a2, Tgm1 , B3galt1 , Socs2, Fndc3b, Apob, S100a9, PlscM , Slc10a2, S100a8, Steap4, CxcM , Saa1 , 0rm2, Saa2, Lcn2, Mt2 and combinations thereof.
  • the mouse (Table 5) and human (Table 6) sequences are provided herein, but the invention
  • the terms “disease” and “disorder” may be used interchangeably or may be different in that the particular malady or condition may not have a known causative agent (so that etiology has not yet been worked out) and it is therefore not yet recognized as a disease but only as an undesirable condition or syndrome, wherein a more or less specific set of symptoms have been identified by clinicians.
  • lipid metabolism associated diseases or “HDL-related disease or disorders” is meant any disease or disorder in a mammal, preferable human, which would be affected (e.g., ameliorated) by the modulation of an HDLc related gene or encoded protein of the present invention.
  • diseases or disorders include, hypercholesterolemia, hyperlipidemia, lipoprotein metabolism diseases, atherosclerosis, cardiovascular disease (CVD) in particular coronary artery disease (CAD), low HDL cholesterol (HDL-C) or hypoalphalipoproteinemia, ischemic heart disease, cerebrovascular disease, coronary restenosis, dyslipidemias, Tangier disease (TD), familial HDL deficiency (FHA) and peripheral vascular disease.
  • Lipid metabolism associated diseases or “HDL-related disease or disorders” also includes lipidoses, Gaucher's disease, Tay-Sachs disease, Niemann-Pick disease, Fabry's disease, fatty acid oxidation disorders, cystic fibrosis, adrenoleukodystrophy, Zellweger syndrome, progressive familial intrahepatic cholestatis, different eye disorders (e.g., Stargardt disease, autosomal recessive retinitis pigmentosa, and cone-rod dystrophy), obesity, diabetes, hypertension, and metabolic syndrome.
  • lipidoses Gaucher's disease, Tay-Sachs disease, Niemann-Pick disease, Fabry's disease, fatty acid oxidation disorders, cystic fibrosis, adrenoleukodystrophy, Zellweger syndrome, progressive familial intrahepatic cholestatis, different eye disorders (e.g., Stargardt disease, autosomal recessive retinitis pigmentosa
  • Lipid metabolism associated diseases or “HDL-related disease or disorders” also includes complications associated with CVD, for non-limiting example, myocardial infarction, stroke, angina pectoris, transient ischemic attacks, congestive heart failure, and aortic aneurysm.
  • the present invention provides novel targets and methods for the screening of drug candidates or leads.
  • drug candidates or leads are useful for developing treatments against lipid metabolism associated diseases such as hypercholesterolemia, lipoprotein metabolism diseases, atherosclerosis, and/or CVD.
  • the methods include expression assays, binding assays and/or functional assays, and may be performed in vitro, in cell systems, in animals, etc.
  • the "in vivo" experimental model e.g., a natural, inbred or transgenic animal of the present invention
  • an "in vitro” assay e.g., cellular extracts from the indicator cells can be prepared and used in one of the aforementioned "in vitro" tests (such as in binding assays or in vitro translation assays).
  • cells can be native, i.e., cells that normally express an HDLc related gene of the present invention expanded in cell culture.
  • these native cells are derived from the liver.
  • the cells are recombinant host cells expressing an HDLc related gene of the present invention.
  • genes or cDNAs may be of mouse or human origin (or of other origins as described above).
  • the invention concerns methods for screening for compounds that modulate the activity and/or expression level of one or more HDLc related genes or encoded proteins identified herein.
  • Such compounds can increase or decrease the affinity and/or rate of binding of an HDLc related protein to its substrate, compete with substrate for binding to an HDLc related protein, or displace substrate bound to an HDLc related protein.
  • Compounds identified by the screening methods of the present invention are particularly useful in the prevention and/or treatment of lipid metabolism associated diseases including, but not limited to, lipoprotein metabolism diseases, hyperlipidemia, atherosclerosis and CVD.
  • the invention concerns methods for identifying compounds that increase or restore the natural biological activity and/or expression level of one or more HDLc related genes or encoded proteins of the present invention.
  • such methods use HDLc related genes or proteins which are involved directly or indirectly in the biosynthesis pathway of ApoA1 and/or in the elimination of cholesterol in general.
  • the HDLc related genes which are targeted by the above method are over- expressed in the absence of ApoA1.
  • HDLc related protein naturally-occlusive protein
  • naturally-type HDLc related protein identified herein.
  • the invention concerns methods for identifying compounds that inhibit the activity and/or expression level of an HDLc related gene or encoded protein of the present invention.
  • the compounds are able to inhibit totally or partially the natural biological activity and/or expression of an HDLc related gene or encoded protein of the present invention.
  • the methods for identifying compounds that inhibit totally or partially the activity and/or expression of an HDLc related gene use at least one HDLc related genes or encoded proteins that is involved directly or indirectly in, for example: i) the degradation of ApoA1 ; ii) the inhibition of the expression and/or maturation of ApoA1 ; iii) cholesterol synthesis; or iv) any combination of i), ii) and iii).
  • the HDLc related genes or encoded proteins that are targeted by the above screening methods are HDLc related genes under-expressed in the absence of ApoAL
  • the present invention concerns a method of selecting biologically active compounds, said method comprising contacting a test compound with an HDLc related gene or an HDLc related protein or functional fragment thereof, and determining the ability of said test compound to modulate (i.e., either increase or decrease) the expression and/or activity of said gene or protein or functional fragment thereof.
  • a particular object of this invention resides in a method of selecting compounds useful for preventing, treating or decreasing susceptibility to lipid metabolism associated diseases.
  • said method comprises contacting in vitro a test compound with an HDLc related gene or encoded polypeptide or a functional fragment thereof involved directly or indirectly in, for example: i) the degradation of ApoA1 ; ii) the inhibition of the expression and/or maturation of ApoA1 ; iii) cholesterol synthesis; or iv) any combination of i), ii) and iii), and determining the ability of the test compound to inhibit totally or partially the expression and/or activity of the HDLc related gene or encoded protein or functional fragment thereof, wherein a compound useful for preventing or treating lipid metabolism associated diseases is selected when said compound inhibits totally or partially the expression and/or activity of said HDLc related gene or encoded protein or functional fragment thereof as compared to in the absence thereof.
  • the present invention relates to a method of selecting compounds useful for preventing, treating or decreasing susceptibility to lipid metabolism associated diseases comprising: contacting in vitro a test compound with an HDLc related gene or encoded polypeptide or a functional fragment thereof, involved directly or indirectly in the synthesis of ApoA1 and/or in the elimination of cholesterol in general (e.g.
  • the above methods of the present invention comprise contacting recombinant host cells (e.g.
  • liver cells such as HepG2
  • liver cells such as HepG2
  • expressing an HDLc related gene or encoded polypeptide or functional fragment thereof with a test compound, and determining the ability of thetest compound to bind to the HDLc related gene, polypeptide and/or functional fragment thereof and/or to modulate (i.e. increase or decrease) the activity and/or expression of the HDLc related gene, polypeptide and/or functional fragment thereof.
  • the determination of binding may be performed by various techniques, such as by labeling of the test compound, by competition with a labeled reference ligand, two-hybrid Screening Assay, etc. Modulation of activity includes, but is not limited to, biosynthesis, uptake and efflux of HDLc and/or ApoA1 , phospholipid Efflux Assay, etc...
  • HDL2, HDL3, ApoA1 can be added as cholesterol acceptor to the media at a fixed concentration.
  • media is collected, centrifuged, and counted for radioactivity by liquid scintillation counting. The residual radioactivity in the cell fraction is also determined.
  • the percent efflux is calculated by dividing the radioactive counts in the efflux media by the sum of the radioactive counts in the media plus the cell fraction. Results from blank media are subtracted from the radioactive counts obtained in the presence of a cholesterol acceptor.
  • Experiments involving quantitation of the cellular content of radiolabeled cholesterol and cholesteryl esters are performed on cells fractionated by thin-layer chromatography, as previously described (Rothblat, 1986). Cholesteryl ester formation after efflux can be determined by the incorporation of 1 -[ 14 C]oleate into cholesteryl esters, as previously described (Rothblat, 1986).
  • the percent efflux is calculated by dividing the radioactive counts in the efflux media by the sum of the radioactive counts in the efflux media plus the cell fraction. Media is used as a blank, and the results from the blank are subtracted from the radioactive counts obtained in the presence of a phospholipid acceptor.
  • ApoA-l is iodinated with [ 125 l]iodide by the iodide monochloride method (Schaefer EJ, Ordovas JM. Metabolism of apolipoproteins A-I, A-Il, and A-IV. In: Segrest JP, Albers JJ, eds. Methods of Enzymology. London: Academic Press; 1986; 129:420-443) to a specific activity per minute per ⁇ g. Confluent cells are incubated with indicated concentration of iodinated ApoA-l in the presence and absence of an excess of the apolipoprotein fraction isolated from HDL. Cells are then washed rapidly. Bound counts are determined by gamma counting, after dissolving the cell fraction.
  • the present invention provides a method of identifying a compound for preventing, treating or decreasing susceptibility to lipid metabolism associated diseases, said method comprising determining whether:
  • test compound is modulated in the presence of a test compound as compared to in the absence of said test compound; wherein said modulation is indicative that said test compound can be used for preventing, treating or decreasing susceptibility to lipid metabolism associated diseases.
  • a reporter assay-based method of selecting agents which modulate the expression of an HDLc nucleic acid includes providing a cell comprising a nucleic acid sequence comprising a transcriptional regulatory sequence of an HDLc related gene of the present invention operably-linked to a suitable reporter gene.
  • the cell is then exposed to the agent suspected of affecting the HDLc nucleic acid expression (e.g., a test compound) and the transcription efficiency is measured by the activity of the reporter gene.
  • the activity can then be compared to the activity of the reporter gene in cells unexposed to the agent in question.
  • Suitable reporter genes include, but are not limited to, beta-D galactosidase, luciferase, chloramphenicol acetyltransferase and green fluorescent protein.
  • the present invention further provides, a method of identifying or characterizing a compound for preventing, treating or decreasing susceptibility to lipid metabolism associated diseases, the method comprising:
  • a transcriptionally regulatory element normally associated with HDLc related gene identified herein e.g. a promoter sequence or functional portion thereof naturally associated with an HDLc related gene of the present invention
  • the modulation in the reporter gene expression or the reporter protein activity is indicative that the test compound is useful for preventing, treating or decreasing susceptibility to the lipid metabolism associated disease.
  • the above screening assays may be performed in any suitable device, such as plates, tubes, dishes, flasks, etc. Typically, the assay is performed in multi-wells plates. Several test compounds can be assayed in parallel.
  • test compound may be of various origin, nature and compositions. It may be any organic or inorganic substance, such as a lipid, peptide, polypeptide, nucleic acid, small molecule, etc., isolated or in mixture with other substances.
  • the compounds may be all or part of a combinatorial library of products, for instance.
  • the test compounds can be an antisense or an RNAi.
  • an inhibitor of expression of a polynucleotide of the present invention is an antisense RNA directed to said polynucleotide, or another components of its signaling cascade or biological pathway.
  • Antisense oligonucleotides have been demonstrated to be effective and targeted inhibitors of protein synthesis, and, consequently, can be used to specifically inhibit protein synthesis by a targeted gene.
  • the efficacy of antisense oligonucleotides for inhibiting protein synthesis is well established. For example, the synthesis of polygalactauronase and the muscarine type 2 acetylcholine receptor are inhibited by antisense oligonucleotides directed to their respective mRNA sequences (U. S.
  • Patent 5,739,119 and U. S. Patent 5,759,829) examples of antisense inhibition have been demonstrated with the nuclear protein cyclin, the multiple drug resistance gene (MDG1), ICAM-1 , E-selectin, STK-1 , striatal GABAA receptor and human EGF (Jaskulski et a/., Science. 1988 Jun 10;240(4858): 1544-6; Vasanthakumar and Ahmed, Cancer Commun. 1989; 1 (4):225-32; Peris et a/., Brain Res MoI Brain Res. 1998 Jun 15;57(2):310-20; U. S. Patent 5,801 ,154; U.S. Patent 5,789,573; U. S.
  • MDG1 multiple drug resistance gene
  • Patent 5,718,709 and U.S. Patent 5,610,288) Furthermore, antisense constructs have also been described that inhibit and can be used to treat a variety of abnormal cellular proliferations, e.g. cancer (U. S. Patent 5,747,470; U. S. Patent 5,591 ,317 and U. S. Patent 5,783,683).
  • cancer U. S. Patent 5,747,470; U. S. Patent 5,591 ,317 and U. S. Patent 5,783,683
  • antisense molecules are known in the art and can be readily adapted to produce an antisense molecule that targets a polynucleotide of the present invention. Selection of antisense compositions specific for a given sequence is based upon analysis of the chosen target sequence and determination of secondary structure, Tm, binding energy, and relative stability. Antisense compositions may be selected based upon their relative inability to form dimers, hairpins, or other secondary structures that would reduce or prohibit specific binding to the target mRNA in a host cell. Highly preferred target regions of the mRNA include those regions at or near the AUG translation initiation codon and those sequences that are substantially complementary to 5' regions of the mRNA.
  • Ribozyme molecules are used to inhibit expression of a target gene or polynucleotide sequence of the present invention.
  • Ribozymes are RNA-protein complexes having specific catalytic domains that possess endonuclease activity (Kim and Cech, (1987) Proc. Natl. Acad. Sci. U S A. 84(24):8788-92; Forster and Symons, (1987) Cell. 49(2):211 -20).
  • ribozymes accelerate phosphoester transfer reactions with a high degree of specificity, often cleaving only one of several phosphoesters in an oligonucleotide substrate (Cech ef a/. (1981 ) Cell. 27(3 Pt 2):487-96; Michel and Westhof (1990) J. MoI. Biol. 5;216(3):585-610; Reinhold-Hurek and Shub (1992) Nature. 14;357(6374): 173-6).
  • This specificity has been attributed to the requirement that the substrate bind via specific base-pairing interactions to the internal guide sequence ("IGS") of the ribozyme prior to chemical reaction.
  • IGS internal guide sequence
  • Ribozymes may be designed as described in PCT Application Publication No. WO 93/23569 and WO 94/02595, each specifically incorporated herein by reference, and synthesized to be tested in vitro and in vivo, as described therein.
  • Ribozyme activity can be optimized by altering the length of the ribozyme binding arms or chemically synthesizing ribozymes with modifications that prevent their degradation by serum ribonucleases (see e.g., PCT Application Publication Nos: WO 92/07065, WO 93/15187 and WO 91/03162; European Patent Application Publication No. 92110298.4; U. S. Patent 5,334,71 1 ; and PCT Application Publication No. WO 94/13688, which describe various chemical modifications that can be made to the sugar moieties of enzymatic RNA molecules), modifications which enhance their efficacy in cells, and removal of stem Il bases to shorten RNA synthesis times and reduce chemical requirements.
  • RNA interference methods using RNAi molecules also may be used to disrupt the expression of a gene or polynucleotide of the present invention or another gene associated with its signaling cascade or biological pathway. While the first described RNAi molecules were RNA: RNA hybrids comprising both an RNA sense and an RNA antisense strand, it has now been demonstrated that DNA sense: RNA antisense hybrids, RNA sense: DNA antisense hybrids, and DNA: DNA hybrids are capable of mediating RNAi (Lamberton, J. S. and Christian, AT. (2003) Molecular Biotechnology 24:1 11 -1 19). Accordingly, the invention includes the use of RNAi reagents comprising any of these different types of double-stranded molecules.
  • RNAi reagents may be used and introduced to cells in a variety of forms (e.g., transfection, infection, etc.). Accordingly, as used herein, RNAi reagents encompasses any and all reagents capable of inducing an RNAi response in cells, including, but not limited to, double- stranded polynucleotides comprising two separate strands, i.e.
  • polynucleotides comprising a hairpin loop of complementary sequences, which forms a double-stranded region, e.g., shRNAi molecules, and expression vectors that express one or more polynucleotides capable of forming a double-stranded polynucleotide alone or in combination with another polynucleotide.
  • a dsRNA molecule that targets and induces degradation of a polynucleotide of the present invention is introduced to a cell. While the exact mechanism is not essential to the invention, it is believed the association of the dsRNA to the target gene is defined by the homology between the dsRNA and the actual and/or predicted mRNA transcript. It is believed that this association will affect the ability of the dsRNA to disrupt the target gene.
  • DsRNA methods and reagents are described in PCT Application Publication Nos: WO 99/32619, WO 01/68836, WO 01/29058, WO 02/44321 , WO 01/92513, WO 01/96584 and WO 01/75164, which are hereby incorporated by reference in their entirety.
  • RNA interference may be used to specifically inhibit expression of a polynucleotide of the present invention.
  • Double-stranded RNA-mediated suppression of gene and nucleic acid expression may be accomplished according to the invention by introducing dsRNA, siRNA or shRNA into cells or organisms.
  • SiRNA may be double-stranded RNA, or a hybrid molecule comprising both RNA and DNA, e.g., one RNA strand and one DNA strand. It has been demonstrated that the direct introduction of siRNAs to a cell can trigger RNAi in mammalian cells (Elshabir, S. M., ef a/. (2001 ) Nature 41 1 :494-498).
  • RNA silencing (Brown, D. ef a/. TechNotes 9(1 ): 1 -7, available at http://www.dot.ambion.dot.com/techlib/tn/91/912.html (9/1/02)).
  • RNAi reagents targeting polynucleotides of the present invention can be readily prepared according to procedures known in the art. Structural characteristics of effective siRNA molecules have been identified (see, e.g., Elshabir, S.M. et al. (2001 ) Nature 41 1 :494-498 and Elshabir, S.M. et al. (2001 ), EMBO 20:6877-6888). Accordingly, one of skill in the art would understand that a wide variety of different siRNA molecules may be used to target a specific gene or transcript. In certain embodiments, siRNA molecules according to the invention are 16 - 30 or 18 - 25 nucleotides in length, including each integer in between.
  • an siRNA is 21 nucleotides in length. In certain embodiments, siRNAs have 0-7 nucleotide 3' overhangs or 0-4 nucleotide 5' overhangs. In one embodiment, an siRNA molecule has a two nucleotide 3' overhang. In one embodiment, an siRNA is 21 nucleotides in length with two nucleotide 3' overhangs (i.e. they contain a 19 nucleotide complementary region between the sense and antisense strands). In certain embodiments, the overhangs are UU or dTdT 3' overhangs.
  • siRNA molecules are completely complementary to one strand of a target DNA molecule, since even single base pair mismatches have been shown to reduce silencing.
  • siRNAs may have a modified backbone composition, such as, for example, 2'-deoxy- or 2'-O-methyl modifications.
  • the entire strand of the siRNA is not made with either 2' deoxy or 2'-O-modified bases.
  • siRNA target sites are selected by scanning the target mRNA transcript sequence for the occurrence of AA dinucleotide sequences. Each AA dinucleotide sequence in combination with the 3' adjacent approximately 19 nucleotides are potential siRNA target sites.
  • siRNA target sites are preferentially not located within the 5' and 3' untranslated regions (UTRs) or regions near the start codon (within approximately 75 bases), since proteins that bind regulatory regions may interfere with the binding of the siRNP endonuclease complex (Elshabir, S. ef a/. (2001) Nature 411 :494-498); Elshabir, S. ef a/. (2001 ) EMBO J.
  • potential target sites may be compared to an appropriate genome database, such as BLASTN 2.0.5, available on the NCBI server at www.ncbi.nlm, and potential target sequences with significant homology to other coding sequences eliminated.
  • Short hairpin RNAs may also be used to inhibit or knockdown gene or nucleic acid expression according to the invention.
  • Short Hairpin RNA is a form of hairpin RNA capable of sequence-specifically reducing expression of a target gene.
  • Short hairpin RNAs may offer an advantage over siRNAs in suppressing gene expression, as they are generally more stable and less susceptible to degradation in the cellular environment. It has been established that such short hairpin RNA-mediated gene silencing (also termed SHAGging) works in a variety of normal and cancer cell lines, and in mammalian cells, including mouse and human cells (Paddison, P. et al. (2002) Genes Dev. 16(8):948-58).
  • transgenic cell lines bearing chromosomal genes that code for engineered shRNAs have been generated. These cells are able to constitutively synthesize shRNAs, thereby facilitating long-lasting or constitutive gene silencing that may be passed on to progeny cells (Paddison, P. ef a/. (2002) Proc. Natl. Acad. Sci. USA 99(3): 1443-1448).
  • ShRNAs contain a stem loop structure. In certain embodiments, they may contain variable stem lengths, typically from 19 to 29 nucleotides in length, or any number in between. In certain embodiments, hairpins contain 19 to 21 nucleotide stems, while in other embodiments, hairpins contain 27 to 29 nucleotide stems. In certain embodiments, loop size is between 4 to 23 nucleotides in length, although the loop size may be larger than 23 nucleotides without significantly affecting silencing activity. ShRNA molecules may contain mismatches, for example G-U mismatches between the two strands of the shRNA stem without decreasing potency.
  • shRNAs are designed to include one or several G-U pairings in the hairpin stem to stabilize hairpins during propagation in bacteria, for example.
  • complementarily between the portion of the stem that binds to the target mRNA (antisense strand) and the mRNA is typically required, and even a single base pair mismatch is this region may abolish silencing.
  • 5' and 3' overhangs are not required, since they do not appear to be critical for shRNA function, although they may be present (Paddison ef a/. (2002) Genes & Dev. 16(8):948-58).
  • test compounds can be competitive or suicide substrates.
  • suicide substrate is intended to cover a compound that, after binding an HDLc related protein or functional fragment thereof, the reactive group forms an irreversible bond with the HDLc protein or functional fragment thereof, rendering it inactive.
  • any such compounds may be utilized as lead compounds and further modified to improve their therapeutic, prophylactic and/or pharmacological properties for the prevention and treatment of lipid metabolism associated diseases.
  • the assay systems of the methods of the present invention may comprise a variety of means to enable and optimize useful assay conditions.
  • Such means may include, but are not limited to, suitable buffer solutions, for example, for the control of pH and ionic strength and to provide any necessary components for optimal HDLc related nucleic acid or protein activity and stability (e.g., protease inhibitors), temperature control means for optimal HDLc related gene or protein activity and or stability, and detection means to enable the detection of the a reaction product.
  • suitable buffer solutions for example, for the control of pH and ionic strength and to provide any necessary components for optimal HDLc related nucleic acid or protein activity and stability (e.g., protease inhibitors), temperature control means for optimal HDLc related gene or protein activity and or stability, and detection means to enable the detection of the a reaction product.
  • detection means may be used, including, but not limited to, one or a combination of the following: radiolabelling (e.g.
  • the assay may be carried out in vitro utilizing a source of HDLc related nucleic acid or protein which may comprise naturally isolated or recombinantly produced HDLc related molecules (i.e., nucleic acid or polypeptide), in preparations ranging from crude to pure.
  • a source of HDLc related nucleic acid or protein which may comprise naturally isolated or recombinantly produced HDLc related molecules (i.e., nucleic acid or polypeptide), in preparations ranging from crude to pure.
  • the assay may, in an embodiment, be performed using an appropriate host cell expressing naturally or recombinantly an HDLc related molecule of the present invention.
  • a host cell which recombinantly expresses an HDLc related nucleic acid of the present invention may be prepared by the introduction of DNA encoding such nucleic acid into the host cell and providing conditions for the expression of the nucleic acid encoded protein.
  • Recombinant HDLc related molecules may be produced in a number of prokaryotic or eukaryotic expression systems, which are well known in the art (see for example Martin F. ef a/., 2001. lmmunogenetics 53(4): 296-306).
  • Such assays may be performed in an array format. In certain embodiments, one or a plurality of the assay steps are automated.
  • homologs include protein sequences, which are substantially identical to the amino acid sequence of an HDLc related protein of the present invention, sharing significant structural and functional homology with such an HDLc related protein.
  • Variants include, but are not limited to, proteins or peptides, which differ from an HDLc related protein of the present invention by any modifications, and/or amino acid substitutions, deletions or additions. Modifications can occur anywhere including the polypeptide backbone, (i.e., the amino acid sequence), the amino acid side chains and the amino or carboxy termini. Such substitutions, deletions or additions may involve one or more amino acids.
  • Fragments include a functional fragment or a portion of an HDLc related protein or a fragment or a portion of a homolog or variant of an HDLc related protein.
  • variant refers herein to a protein, which is substantially similar in structure and biological activity to the protein, or nucleic acid of the present invention to maintain at least one of its biological activities.
  • two molecules possess a common activity and can substitute for each other they are considered variants as that term is used herein, even if the composition, or secondary, tertiary or quaternary structure of one molecule is not identical to that found in the other, or if the amino acid sequence or nucleotide sequence is not identical.
  • a homolog is a gene sequence encoding a polypeptide isolated from an organism other than a human being.
  • a homolog of a native polypeptide is an expression product of a gene homolog.
  • Expression vectors, regulatory sequences (e.g. promoters), leader sequences and methods to generate same and introduce them in cells are well known in the art.
  • nucleic acid molecules proteins or polypeptides
  • the term "native” refers to a naturally occurring nucleic acid or polypeptide.
  • a homolog or more particularly an ortholog is a gene sequence encoding a polypeptide isolated from an organism other than a human being.
  • a homolog of a native polypeptide is an expression product of a gene homolog.
  • the non-coding portion of a gene can also find a homolog portion in another organism.
  • Amino acid sequence variants of the polypeptides of the present invention can be prepared by mutations in the DNA. Such variants include, for example, deletions from, or insertions or substitutions of, residues within the amino acid sequences of the present invention. Any combination of deletion, insertion, and substitution can also be made to arrive at the final construct, provided that the final construct possesses the desired activity.
  • the site for introducing an amino acid sequence variation is predetermined, the mutation per se need not be predetermined.
  • random mutagenesis can be conducted at the target codon or region and the expressed polypeptide variants screened for the optimal combination of desired activity.
  • Techniques for making substitution mutations at predetermined sites in DNA having a known sequence are well known in the art and include, for example, site-specific mutagenesis.
  • Preparation of a variant in accordance with the present invention is preferably achieved by site-specific mutagenesis of DNA that encodes an earlier prepared variant or a non-variant version of the protein.
  • Site-specific mutagenesis allows the production of variants through the use of specific oligonucleotide sequences that encode the DNA sequence of the desired mutation.
  • the technique of site-specific mutagenesis is well known in the art, as exemplified by publications such as Adelman ef a/., DNA 2:183 (1983) and Ausubel ef a/., "Current Protocols in Molecular Biology", J. Wiley & Sons, NY, NY, 1996.
  • Amino acid sequence deletions generally range from about 1 to 30 residues, more preferably 1 to 10 residues, and typically are contiguous.
  • Amino acid sequence insertions include amino and/or carboxyl-terminal fusions of from one residue to polypeptides of essentially unrestricted length, as well as intra-sequence insertions of single or multiple amino acid residues.
  • Intra-sequence insertions can range generally from about 1 to 10 residues, more preferably 1 to 5.
  • the third group of variants are those in which at least one amino acid residue in a polypeptide of the present invention, has been removed and a different residue inserted in its place. Such substitutions preferably are made in accordance with the following Table B when it is desired to modulate finely the characteristics of the polypeptide.
  • Stereoisomers e.g., D-amino acids
  • a,a-disubstituted amino acids, N-alkyl amino acids, lactic acid and other unconventional amino acids may also be suitable components for the polypeptides of the present invention.
  • unconventional amino acids include but are not limited to selenocysteine, citrulline, ornithine, norvaline, 4-(E)-butenyl-4(R) -methyl-N-methylthreonine (MeBmt), N- methyl-leucine (MeLeu), aminoisobutyric acid, statine, N-methyl-alanine (MeAIa).
  • Substantial changes in functional or immunological identity can be made by selecting substitutions that are less conservative than those in Table B, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.
  • substitutions that in general are expected are those in which (a) glycine and/or proline is substituted by another amino acid or is deleted or inserted; (b) a hydrophilic residue, e.g., seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl, or alanyl; (c) a cysteine residue is substituted for (or by) any other residue; (d) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histidyl, is substituted for (or by) a residue having an electronegative charge, e.g., glutamyl or aspartyl; or (e) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having such a side chain, e
  • a variant typically is made by site-specific mutagenesis of a nucleic acid encoding a protein of the present invention, expression of the variant nucleic acid in recombinant cell culture, and, optionally, purification from the cell culture, for example, by immunoaffinity adsorption on a column (to absorb the variant by binding it to at least one remaining immune epitope).
  • the activity of the cell lysate or purified variant is then screened in a suitable screening assay for the desired characteristic.
  • a change in the immunological character of the polypeptide molecule such as affinity for a given antibody, is measured by a competitive type immunoassay. Changes in immunomodulation activity are measured by the appropriate assay. Modifications of such protein properties as redox or thermal stability, hydrophobicity, susceptibility to proteolytic degradation or the tendency to aggregate with carriers or into multimers are assayed by methods well known to the ordinarily skilled artisan.
  • purified refers to a molecule (e.g., polypeptides and nucleic acids of the present invention) having been separated from a component of the composition in which it was originally present.
  • the term purified can sometimes be used interchangeably with the term “isolated”.
  • a “purified or isolated polypeptide or polynucleotide” has been purified to a level not found in nature.
  • a “substantially pure” molecule is a molecule that is lacking in most other components (e.g., 30, 40, 50, 60, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, 100% free of contaminants).
  • sample components include nucleic acids in a generally aqueous solution that may include other components, such as proteins, carbohydrates, or lipids.
  • a separating or purifying step preferably removes at least about 70% (e.g., 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, 100%), more preferably at least about 90% (e.g., 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100%) and, even more preferably, at least about 95% (e.g., 95, 96, 97, 98, 99, 100%) of the other components present in the sample from the desired component.
  • 70% e.g., 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, 100%
  • 90% e.g., 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100%
  • 95% e.g., 95, 96, 97, 98, 99, 100%
  • Homology and “homologous” and “homolog” refer to sequence similarity between two peptides or two nucleic acid molecules. Homology can be determined by comparing each position in the aligned sequences. A degree of homology between nucleic acid or between amino acid sequences is a function of the number of identical or matching nucleotides or amino acids at positions shared by the sequences.
  • nucleic acid sequence is "homologous” to or is a "homolog” of another sequence if the two sequences are substantially identical and the functional activity of the sequences is conserved (as used herein, the term 'homologous' does not infer evolutionary relatedness).
  • Two nucleic acid or amino acid sequences are considered “substantially identical” if, when optimally aligned (with gaps permitted), they share at least about 50% sequence similarity or identity, or if the sequences share defined functional motifs.
  • sequence similarity in optimally aligned substantially identical sequences may be at least 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%, e.g., with any of the HDLc related nucleic acid or protein sequences disclosed in the present invention.
  • the units e.g., 66, 67...81 , 82,...91, 92%.
  • a given percentage of homology between sequences denotes the degree of sequence identity in optimally aligned sequences.
  • An "unrelated" or “non-homologous" sequence shares less than 40% identity, though preferably less than about 25% identity, with any of the HDLc related nucleic acid or protein sequences herein.
  • Substantially complementary nucleic acids are nucleic acids in which the complement of one molecule is substantially identical to the other molecule. Two nucleic acid or protein sequences are considered substantially identical if, when optimally aligned, they share at least about 70% sequence identity. In alternative embodiments, sequence identity may for example be at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%, e.g., with any of the HDLc related sequences disclosed herein. Optimal alignment of sequences for comparisons of identity may be conducted using a variety of algorithms, such as the local homology algorithm of Smith and Waterman, 1981, Adv. Appl. Math 2: 482, the homology alignment algorithm of Needleman and Wunsch, 1970, J. MoI.
  • the BLAST algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold.
  • HSPs high scoring sequence pairs
  • Initial neighborhood word hits act as seeds for initiating searches to find longer HSPs.
  • the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension of the word hits in each direction is halted when the following parameters are met: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment.
  • W word length
  • B BLOSUM62 scoring matrix
  • E expectation
  • P(N) the smallest sum probability
  • nucleotide or amino acid sequences are considered substantially identical if the smallest sum probability in a comparison of the test sequences is less than about 1 , preferably less than about 0.1 , more preferably less than about 0.01 , and most preferably less than about 0.001.
  • “sufficiently complementary” is meant a contiguous nucleic acid base sequence that is capable of hybridizing to another sequence by hydrogen bonding between a series of complementary bases.
  • Complementary base sequences may be complementary at each position in sequence by using standard base pairing (e.g., G:C, A:T or A:U pairing) non standard base pairing (e.g., I:C) or may contain one or more residues (including a basic residues) that are not complementary by using standard base pairing, but which allow the entire sequence to specifically hybridize with another base sequence in appropriate hybridization conditions.
  • standard base pairing e.g., G:C, A:T or A:U pairing
  • non standard base pairing e.g., I:C
  • residues including a basic residues
  • Contiguous bases of an oligomer are preferably at least about 80% (81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100%), more preferably at least about 90% complementary to the sequence to which the oligomer specifically hybridizes.
  • the binding free energy for a nucleic acid molecule with its complementary sequence is sufficient to allow the relevant function of the nucleic acid to proceed (e.g., RNAi activity).
  • the degree of complementarity between the sense and antisense region (or strand) of the siRNA construct can be the same or can be different from the degree of complementarity between the antisense region of the siRNA and the target RNA sequence (e.g., an RNA sequence corresponding to a gene of the present invention).
  • the target RNA sequence e.g., an RNA sequence corresponding to a gene of the present invention.
  • Complementarity to the target sequence of less than 100% in the antisense strand of the siRNA duplex is reported to be tolerated when these differences are located between the 5'-end and the middle of the antisense siRNA (Elbashir et al., 2001 , EMBO, 20(23):68- 77-6888).
  • protein or “polypeptide” means any peptide-linked chain of amino acids, regardless of post-translational modifications (e.g., acetylation, phosphorylation, glycosylation, sulfatation, sumoylation, prenylation, ubiquitination, etc).
  • post-translational modifications e.g., acetylation, phosphorylation, glycosylation, sulfatation, sumoylation, prenylation, ubiquitination, etc.
  • the proteins of the present invention are expression products of their corresponding nucleic acids and include native proteins, natural splice variants, allelic variants and protein homologs thereof that share at least 60% (but preferably, at least 65, 70, 75, 80, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100%) amino acid sequence identity with a corresponding protein of the present invention and displays functional activity of the native protein.
  • the units e.g., 66, 67...81 , 82%
  • Peptides and polypeptides of the present invention may be readily synthesized or produced recombinantly using routine methods known and available in the art. Methods well known to those skilled in the art may be used to construct expression vectors containing sequences encoding a polynucleotide or polypeptide of interest and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook, J. ef al. (2001 ) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plainview, N. Y., and Ausubel, F. M. ef al. (1988) Current Protocols in Molecular Biology, John Wiley & Sons, New York. N. Y.
  • a detection step may use any of a variety of known methods to detect the presence of nucleic acid by hybridization to a probe oligonucleotide.
  • One specific example of a detection step uses a homogeneous detection method such as described in detail previously in Arnold ef al., Clinical Chemistry 35:1588-1594 (1989), and U.S. Patent Nos. 5,658,737 (Nelson ef al.), and 5,118,801 and 5,312,728 (Lizardi ef al.).
  • probes can be used include Southern blots (DNA detection), dot or slot blots (DNA, RNA), and Northern blots (RNA detection). Labelled proteins could also be used to detect a particular nucleic acid sequence to which it binds (e.g., protein detection by far western technology: Guichet ef a/., 1997, Nature 385(6616): 548-552; and Schwartz ef a/., 2001 , EMBO 20(3): 510- 519). Other detection methods include kits containing reagents of the present invention on a dipstick setup and the like. Of course, it might be preferable to use a detection method which is amenable to automation. A non-limiting example thereof includes a chip or other support comprising one or more (e.g., an array) different probes.
  • a "label” refers to a molecular moiety or compound that can be detected or can lead to a detectable signal.
  • a label is joined, directly or indirectly, to a nucleic acid probe or the nucleic acid to be detected (e.g., an amplified sequence).
  • Direct labelling can occur through bonds or interactions that link the label to the nucleic acid (e.g., covalent bonds or non-covalent interactions), whereas indirect labelling can occur through the use of a "linker” or bridging moiety, such as additional oligonucleotide(s), which is/are either directly or indirectly labelled.
  • Bridging moieties may amplify a detectable signal.
  • Labels can include any detectable moiety (e.g., a radionuclide, ligand such as biotin or avidin, enzyme or enzyme substrate, reactive group, chromophore such as a dye or coloured particle, luminescent compound including a bioluminescent, phosphorescent or chemiluminescent compound, and fluorescent compound).
  • a detectable moiety e.g., a radionuclide, ligand such as biotin or avidin, enzyme or enzyme substrate, reactive group, chromophore such as a dye or coloured particle, luminescent compound including a bioluminescent, phosphorescent or chemiluminescent compound, and fluorescent compound.
  • the label on a labelled probe is detectable in a homogeneous assay system, i.e., in a mixture, the bound label exhibits a detectable change compared to an unbound label.
  • oligonucleotides or “oligos” define a molecule having two or more nucleotides (ribo or deoxyribonucleotides). The size of the oligo will be dictated by the particular situation and ultimately on the particular use thereof and adapted accordingly by the person of ordinary skill.
  • An oligonucleotide can be synthesized chemically or derived by cloning according to well-known methods. While they are usually in a single-stranded form, they can be in a double-stranded form and even contain a "regulatory region". They can contain natural, rare or synthetic nucleotides. They can be designed to enhance a chosen criterion like stability, for example. Chimeras of deoxyribonucleotides and ribonucleotides may also be within the scope of the present invention.
  • amplicons of a target nucleic acid sequence or its complement or fragments thereof.
  • In vitro amplification refers to the production of an amplified nucleic acid that may contain less than the complete target region sequence or its complement.
  • Known in vitro amplification methods include, e.g., transcription-mediated amplification, replicase-mediated amplification, polymerase chain reaction (PCR) amplification, ligase chain reaction (LCR) amplification, nucleic acid sequence-based amplification (NASBA), and strand-displacement amplification (SDA).
  • Replicase-mediated amplification uses self-replicating RNA molecules, and a replicase such as Q ⁇ -replicase (e.g., Kramer ef al., U.S.
  • PCR amplification is well known and uses DNA polymerase, primers and thermal cycling to synthesize multiple copies of the two complementary strands of DNA or cDNA (e.g., MuIMs ef al., U.S. Pat. Nos. 4,683, 195, 4,683,202, and 4,800,159).
  • LCR amplification uses at least four separate oligonucleotides to amplify a target and its complementary strand by using multiple cycles of hybridization, ligation, and denaturation (e.g., EP Pat. App. Pub. No. 0 320 308).
  • SDA is a method in which a primer contains a recognition site for a restriction endonuclease that permits the endonuclease to nick one strand of a hemimodified DNA duplex that includes the target sequence, followed by amplification in a series of primer extension and strand displacement steps (e.g., Walker ef a/., U.S. Pat. No. 5,422,252).
  • Another known strand-displacement amplification method does not require endonuclease nicking (Dattagupta et al., U.S. Patent No. 6,087,133).
  • Transcription-mediated amplification can also be used in the present invention.
  • TMA and NASBA isothermic methods of nucleic acid amplification are used.
  • oligonucleotide primer sequences of the present invention may be readily used in any in vitro amplification method based on primer extension by a polymerase (see generally Kwoh ef a/., 1990, Am. Biotechnol. Lab. 8:14 25 and (Kwoh ef a/., 1989, Proc. Natl. Acad. Sci. USA 86, 1173 1177; Lizardi et al., 1988, BioTechnology 6:1 197 1202; Malek et al., 1994, Methods MoI.
  • oligos are designed to bind to a complementary sequence under selected conditions.
  • An alternative indication that two nucleic acid sequences are substantially complementary is that the two sequences hybridize to each other under moderately stringent, or preferably stringent, conditions.
  • Hybridization to filter-bound sequences under moderately stringent conditions may, for example, be performed in 0.5 M NaHPO 4 , 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65°C, and washing in 0.2 x SSC/0.1 % SDS at 42°C (see Ausubel, ef al. (eds), 1989, Current Protocols in Molecular Biology, Vol. 1 , Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3).
  • hybridization to filter-bound sequences under stringent conditions may, for example, be performed in 0.5 M NaHPO 4 , 7% SDS, 1 mM EDTA at 65°C, and washing in 0.1 x SSC/0.1 % SDS at 68°C (see Ausubel, ef al. (eds), 1989, supra).
  • Hybridization conditions may be modified in accordance with known methods depending on the sequence of interest (see Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York).
  • stringent conditions are selected to be about 5°C lower than the thermal melting point for the specific sequence at a defined ionic strength and pH.
  • the hybridization temperature can be changed to 62, 63, 64, 65, 66, 67 or 68 0 C.
  • the stringency of hybridization can be readily manipulated, such as by altering the salt and SDS concentration of the hybridizing and washing solutions and/or temperature at which the hybridization is performed. The temperature and salt concentration selected is determined based on the melting temperature (Tm) of the DNA hybrid.
  • Tm melting temperature
  • Other protocols or commercially available hybridization kits using different annealing and washing solutions can also be used as well known in the art.
  • the use of formamide in different mixtures to lower the melting temperature may also be used and is well known in the art.
  • Transcriptional regulatory sequence refers to DNA sequences, such as initiation and termination signals, enhancers, and promoters, splicing signals, polyadenylation signals which induce or control transcription of protein coding sequences with which they are operably linked.
  • a first nucleic acid sequence is "operably-l inked” with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
  • a promoter is operably-linked to a coding sequence if the promoter affects the transcription or expression of the coding sequences.
  • operably-linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in reading frame.
  • the construct may comprise an in frame fusion of a suitable reporter gene within the open reading frame of an HDLc related gene of the present invention.
  • the reporter gene may be chosen as such to facilitate the detection of its expression, e.g., by the detection of the activity of its gene product.
  • Such a reporter construct may be introduced into a suitable system capable of exhibiting a change in the level of expression of the reporter gene in response to exposure to a suitable biological sample.
  • Such an assay would also be adaptable to a possible large scale, high-throughput, automated format, and would allow more convenient detection due to the presence of its reporter component.
  • the above-described assay methods may further comprise determining whether any compounds so identified can be used for decreasing susceptibility to lipid metabolism associated diseases or for preventing or treating lipid metabolism associated diseases.
  • the present invention contemplates methods of preventing, treating or decreasing susceptibility to lipid metabolism associated diseases such as, but not limited to, lipoprotein metabolism disorders, hypercholesterolemia, atherosclerosis and/or CVD.
  • the present invention relates to a method of preventing, treating or decreasing susceptibility to lipid metabolism associated diseases in a subject (an animal such as a mammal, in a further embodiment a human), the method comprising administering to said subject a functional (e.g., wild-type or functional fragment thereof) HDLc related polypeptide or a nucleic acid encoding the same.
  • a functional e.g., wild-type or functional fragment thereof
  • the HDLc related nucleic acid or polypeptide is involved directly or indirectly in the biosynthesis of ApoA1 and/or in the elimination of cholesterol.
  • the HDLc related polypeptide or nucleic acid encoding the same is over-expressed in the absence of ApoA1.
  • the invention further concerns the use of a functional HDLc related polypeptide or a nucleic acid encoding the same, in the manufacture of a pharmaceutical composition or medicament for preventing, treating or decreasing susceptibility to lipid metabolism associated diseases such as hypercholesterolemia, lipoprotein metabolism disorders, atherosclerosis and/or CVD in a subject.
  • lipid metabolism associated diseases such as hypercholesterolemia, lipoprotein metabolism disorders, atherosclerosis and/or CVD in a subject.
  • the invention also relates to a method of preventing, treating or decreasing susceptibility to lipid metabolism associated diseases such as hypercholesterolemia, lipoprotein metabolism disorders, atherosclerosis and/or CVD in a subject, the method comprising administering to the subject a compound that modulates the expression and/or activity of an HDLc related protein or nucleic acid encoding the same.
  • lipid metabolism associated diseases such as hypercholesterolemia, lipoprotein metabolism disorders, atherosclerosis and/or CVD
  • the invention further relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a compound that modulates the expression and/or activity of an HDLc related protein or nucleic acid encoding the same together with a pharmaceutically acceptable carrier.
  • the invention relates, generally, to the use of a compound (or pharmaceutical composition) that modulates the expression and/or activity of one or more HDLc related proteins or nucleic acids encoding the same in the manufacture of a pharmaceutical composition or medicament for treating or preventing lipid metabolism associated diseases such as hypercholesterolemia, lipoprotein metabolism disorders, atherosclerosis and/or CVD in a subject.
  • Particularly useful compounds and pharmaceutical compositions of the present invention are those that inhibit totally or partially the expression and/or activity of an HDLc related gene of the present invention involved in, for example, one or more of i) the degradation of ApoA1 ; ii) the inhibition of the maturation of ApoA1; iii) the inhibition of the expression of ApoA1; or iv) cholesterol synthesis.
  • Other useful compounds and pharmaceutical compositions of the present invention are those that increase the expression and/or activity of an HDLc related gene of the present invention involved directly or indirectly in the biosynthesis pathway of ApoA1 and/or in the elimination of cholesterol.
  • the methods of the invention comprise administering pharmaceutical compositions (medicaments) containing one or more active agent(s) (i.e., compounds that modulate the expression and/or activity of an HDLc related gene of the present invention).
  • the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier or excipient.
  • pharmaceutically acceptable carrier or “excipient” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
  • the carrier can be suitable, for example, for parental, intravenous, intraperitoneal, intramuscular, sublingual or oral administration.
  • compositions of the invention include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the use of such media and agents for pharmaceutically active substances is well known in the art (Rowe ef a/., Handbook of pharmaceutical excipients, 2003, 4 th edition, Pharmaceutical Press, London UK). Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions of the invention is contemplated.
  • the composition may also contain more than one active compound for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. It may be desirable to use the composition in addition to one or more agents currently used to prevent or treat the disease in question.
  • the active ingredients may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin- microcapsule and poly-(methylmethacylate) microcapsule, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles or nanocapsules) or in macroemulsions.
  • colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles or nanocapsules
  • macroemulsions for example, in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980).
  • Formulations to be used for in vivo administration are preferably sterile. This is readily accomplished, for example, by filtration through sterile filtration membranes.
  • Any appropriate route of administration may be employed, for example, parenteral, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraarticular, intraspinal, intracisternal, intraperitoneal, intranasal, aerosol, or oral administration.
  • routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration.
  • compositions and formulations Conventional pharmaceutical practice may be employed to provide suitable formulations or compositions to administer such compositions to patients. Methods well known in the art for making pharmaceutical compositions and formulations are found in, for example, Remington: The Science and Practice of Pharmacy, (20th ed.) ed. A. R. Gennaro A R., 2000, Lippincott: Philadelphia. Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes.
  • Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds.
  • Other potentially useful parenteral delivery systems for compounds of the invention include ethylenevinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes.
  • Formulations for inhalation may contain excipients, or example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.
  • Therapeutic formulations may be in the form of liquid solutions or suspension; for oral administration, formulations may be in the form of tablets or capsules; and for intranasal formulations, in the form of powders, nasal drops, or aerosols.
  • Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose.
  • the pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • the parenteral preparation can be enclosed in
  • compositions suitable for injectable use include sterile aqueous solutions
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
  • Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
  • the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays or suppositories.
  • the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
  • Liposomal suspensions can also be used as pharmaceutically acceptable carriers.
  • liposomal formulations suitable for delivering a compound to an animal have been described and demonstrated to be effective in delivering a variety of compound, including, e.g., small molecules, nucleic acids, and polypeptides.
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • about 1 ug/Kg to 15 mg/Kg (e.g., 0.1 to 20 mg/Kg) of antibody is an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations, or by continuous infusion.
  • a typical daily dosage might range from about 1 ug/Kg to 100 mg/Kg or more, depending on the factors mentioned above.
  • the treatment is sustained until a desired suppression of disease symptoms occurs.
  • other dosage regimens may be useful.
  • the progress of this therapy can be monitored by standard techniques and assays.
  • the specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
  • Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population).
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50.
  • Compounds that exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
  • the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the therapeutically effective dose can be estimated initially from cell culture assays.
  • a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in assays.
  • IC50 i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms
  • levels in plasma may be measured, for example, by high performance liquid chromatography.
  • treatment of a subject with a therapeutically effective amount of a protein, polypeptide, or antibody can include a single treatment or, preferably, can include a series of treatments.
  • the amount of the therapeutic or pharmaceutical composition (e.g., an agent capable of modulating the expression and/or activity of an HDLc related gene and encoded protein of the present invention or an HDLc related protein, nucleic acid encoding same or functional fragment thereof) which is effective in the treatment of a particular disease, disorder or condition (e.g., lipid metabolism associated diseases) will depend on the nature and severity of the disease, the chosen therapeutic regimen (i.e., compound, DNA construct, protein, cells), the target site of action, the patient's weight, special diets being followed by the patient, concurrent medications being used, the administration route and other factors that will be recognized by those skilled in the art.
  • a particular disease, disorder or condition e.g., lipid metabolism associated diseases
  • the dosage will be adapted by the clinician in accordance with conventional factors such as the extent of the disease and different parameters from the patient. Typically, 0.01 mg/Kg to 100 mg/Kg of body weight/day will be administered to the subject depending on the potency of the negatively charged polymer. Effective doses may be extrapolated from dose response curves derived from in vitro or animal model test systems. For example, in order to obtain an effective mg/Kg dose for humans based on data generated from rat studies, the effective mg/Kg dosage in rat may be divided by six.
  • the present invention encompasses compounds that modulate expression or activity.
  • a compound may, for example, be a small molecule.
  • small molecules include, but are not limited to, peptides, peptidomimetics, amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, nucleotides, nucleotide analogs, organic or inorganic compounds (i.e.
  • heteroorganic and organometallic compounds having a molecular weight less than about 10,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1 ,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds.
  • doses of small molecule agents depends upon a number of factors within the ken of the ordinarily skilled physician, veterinarian, or researcher.
  • the dose(s) of the small molecule will vary, for example, depending upon the identity, size, and condition of the subject or sample being treated, further depending upon the route by which the composition is to be administered, if applicable, and the effect which the practitioner desires the small molecule to have upon the nucleic acid or polypeptide of the invention.
  • Appropriate doses of a small molecule also depend upon the potency of the small molecule with respect to the expression or activity to be modulated. Such appropriate doses may be determined using the assays described herein.
  • a physician, veterinarian, or researcher may, for example, prescribe a relatively low dose at first, subsequently increasing the dose until an appropriate response is obtained.
  • the specific dose level for any particular animal subject will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, gender, and diet of the subject, the time of administration, the route of administration, the rate of excretion, any drug combination, and the degree of expression or activity to be modulated.
  • preventing, treating or decreasing susceptibility to a lipid metabolism associated disease in a subject can be achieved by either administering a compound that modulates endogenous genes in the subject or by administering to the subject a nucleic acid molecule encoding an HDLc related protein or a functional variant thereof (e.g., via gene therapy).
  • an HDLc related nucleic acid or encoded polypeptide preferably of an HDLc related gene or encoded protein of the present invention involved in the biosynthesis pathway of ApoA1 and/or in the elimination of cholesterol
  • the induction of expression and/or activity of an HDLc related nucleic acid or encoded polypeptide may be achieved by administering to a subject a nucleic acid molecule encoding an HDLc related protein or a functional variant thereof.
  • the nucleic acid may be delivered to cells in vivo using methods such as direct injection of DNA, receptor-mediated DNA uptake, viral-mediated transfection or non-viral transfection and lipid based transfection, all of which may involve the use of gene therapy vectors.
  • Direct injection has been used to introduce naked DNA into cells in vivo (see e.g., Acsadi ef a/. (1991) Nature 332:815-818; Wolff ef a/. (1990) Science 247:1465-1468).
  • a delivery apparatus e.g., a "gene gun" for injecting DNA into cells in vivo may be used.
  • Such an apparatus may be commercially available (e.g., from BioRad).
  • Naked DNA may also be introduced into cells by complexing the DNA to a cation, such as polylysine, which is coupled to a ligand for a cell-surface receptor (see for example Wu, G. and Wu, C. H. (1988) J. Biol. Chem.
  • Binding of the DNA-ligand complex to the receptor may facilitate uptake of the DNA by receptor-mediated endocytosis.
  • a DNA-ligand complex linked to adenovirus capsids which disrupt endosomes, thereby releasing material into the cytoplasm may be used to avoid degradation of the complex by intracellular lysosomes (see for example Curiel ef a/. (1991) Proc. Natl. Acad. ScL USA 88:8850; Cristiano ef a/. (1993) Proc. Natl. Acad.
  • vector is commonly known in the art and defines a plasmid DNA, phage DNA, viral DNA and the like, which can serve as a DNA vehicle into which nucleic acid of the present invention can be cloned.
  • vectors Numerous types of vectors exist and are well known in the art.
  • One specific type of vector is called a targeting vector which may be used for homologous recombination with an endogenous target gene in a cell. Homologous recombination occurs between two sequences (i.e., the targeting vector and endogenous gene sequences) that are partially or fully complementary.
  • Homologous recombination may be used to alter a gene sequence in a cell (e.g., embryonic stem cells, (ES cells)) in order to completely shut down protein expression or to introduce point mutations, substitutions or deletions in the target gene sequence.
  • a cell e.g., embryonic stem cells, (ES cells)
  • ES cells embryonic stem cells
  • Such method is used for example to generate transgenic animals and is well known in the art.
  • targeting vectors are used to selectively disrupt a gene of the present invention.
  • Knockout vectors of the present invention include those that alter gene expression, for example, by disrupting a regulatory element of the gene, including, e.g., inserting a regulatory element that reduces gene expression or deleting or otherwise reducing the activity of an endogenous element that positively affects transcription of the target gene.
  • knockout vectors of the invention disrupt, e.g., delete or mutate, the 5' region, 3' region or coding region of the gene.
  • knockout vectors delete a region or the entirety of the coding region of the gene.
  • knockout vectors delete a region of the gene, while in other embodiments, they insert exogenous sequences into the gene. In addition, in certain embodiments, including those using replacement vectors, knockout vectors both remove a region of a gene and introduce an exogenous sequence.
  • Targeting vectors of the present invention include all vectors capable of undergoing homologous recombination with an endogenous gene of the present invention, including replacement vectors.
  • Targeting vectors include all those used in methods of positive selection, negative selection, positive-negative selection, and positive switch selection.
  • Targeting vectors employing positive, negative, and positive-negative selection are well known in the art and representative examples are described in Joyner, A.L., Gene Targeting: A practical Approach, 2nd ed. (2000) and references cited therein.
  • expression vector refers to a vector or vehicle similar to a cloning vector but which is capable of expressing a gene which has been cloned into it, after transformation into a host.
  • the cloned gene (or nucleic acid sequence) is usually placed under the control of (i.e., operably linked to) certain control sequences such as promoter sequences which may be cell or tissue specific.
  • the term "gene therapy” relates to the introduction and expression in an animal (preferably a human) of an exogenous sequence (e.g., an HDLc related gene of the present invention) to supplement, replace or inhibit a target gene, or to enable target cells to produce a protein having a prophylactic or therapeutic effect toward diseases related to abnormal lipid metabolism or HDL- related diseases.
  • the exogenous sequence is of the same origin as that of the animal (human sequence).
  • the exogenous sequence is of a different origin (e.g., human exogenous sequence in mice (e.g., knock-in).
  • Defective retroviruses are well characterized for use as gene therapy vectors (for a review see Miller, A. D. (1990) Blood 76:271). Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in Current Protocols in Molecular Biology, Ausubel, F. M. ef a/, (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14 and other standard laboratory manuals.
  • suitable retroviruses include pLJ, pZIP, pWE and pEM which are well known to those skilled in the art.
  • Non-limiting examples of suitable packaging virus lines include psiCrip, psiCre, psi2 and psiAm.
  • Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells, endothelial cells, lymphocytes, myoblasts, hepatocytes, bone marrow cells, in vitro and/or in vivo (see for example Eglitis ef a/. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. ScL USA 85:6460-6464; Wilson ef a/. (1988) Proc. Natl. Acad.
  • the genome of an adenovirus may be manipulated so that it encodes and expresses a nucleic acid compound of the invention (e. g., an HDLc related nucleic acid), but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle.
  • a nucleic acid compound of the invention e. g., an HDLc related nucleic acid
  • a nucleic acid compound of the invention e. g., an HDLc related nucleic acid
  • Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 dl324 or other strains of adenovirus are well known to those skilled in the art.
  • Recombinant adenoviruses are advantageous in that they do not require dividing cells to be effective gene delivery vehicles and can be used to infect a wide variety of cell types, including airway epithelium (Rosenfeld ef a/. (1992) cited supra), endothelial cells (Lemarchand ef a/. (1992) Proc. Natl. Acad. ScL USA 89:6482-6486), hepatocytes (Herz and Gerard (1993) Proc. Natl. Acad. ScL USA 90:2812-2816) and muscle cells (Quantin el al. (1992) Proc. Natl. Acad. ScI. USA 89:2581 -2584).
  • Adeno-associated virus may be used as a gene therapy vector for delivery of DNA for gene therapy purposes.
  • AAV is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle (Muzyczka ef al. Curr. Topics in Micro, and Immunol. (1992) 158:97-129).
  • AAV may be used to integrate DNA into non-dividing cells (see for example Flotte ef al. (1992) Am. J. Respir. Cell. MoI. Biol. 7:349-356; Samulski ef al. (1989) J. Virol.
  • An AAV vector such as that described in Tratschin ef al. (1985) MoI. Cell. Biol. 5:3251 -3260 may be used to introduce DNA into cells (see for example Hermonat ef al. (1984) Proc. Natl. Acad. ScL USA 81 :6466-6470; Tratschin ef al. (1985) MoI. Cell. Biol. 4:2072-2081 ; Wondisford ef al. (1988) MoI. Endocrinol. 2:32-39; Tratschin ef al. (1984) J. Virol. 51 :611 -619; and Flotte ef al. (1993) J. Biol. Chem. 268:3781 -3790).
  • Lentiviral gene therapy vectors may also be adapted for use in the invention.
  • the terms “treat/treating/treatment” and “prevent/preventing/prevention” as used herein, refer to eliciting the desired biological response, i.e., a therapeutic and prophylactic effect, respectively.
  • the therapeutic effect comprises an amelioration of symptoms and/or an increase in survival time of the affected subject, following administration of a pharmaceutical composition or compound of the present invention.
  • Such pharmaceutical composition or compound :
  • an HDLc related gene or encoded protein involved directly or indirectly in i) the degradation of ApoA1 ; ii) the inhibition of the expression or maturation of ApoA1 ; iii) cholesterol synthesis; or iv) any combination of i), ii), iii) and iv); and/or comprises an HDLc related nucleic acid encoded protein or functional fragment thereof involved directly or indirectly in the biosynthesis pathway of ApoA1 and/or in the elimination of cholesterol.
  • a "therapeutically effective” or “prophylactically effective” amount of a pharmaceutical composition or compound of the present invention may be administered to a subject (i.e., an animal, preferably a human), in the context of the methods of treatment and prevention, respectively, described herein.
  • kits or packages comprising the above-mentioned compositions or agents together with instructions for their use for decreasing susceptibility lipid metabolism associated diseases or for preventing or treating HDLc-related diseases.
  • the invention now provides diagnosis methods based on a monitoring of an alteration of an HDLc related nucleic acid of the present invention in a subject.
  • diagnosis includes the detection, monitoring, dosing, comparison, etc., at various stages, including early, pre-symptomatic stages, and late stages, in adults, children and pre-birth.
  • Diagnosis typically includes the prognosis, the assessment of a predisposition or risk of development, the characterization of a subject to define most appropriate treatment (pharmacogenetics).
  • a particular object of this invention resides in a method of detecting a predisposition to lipid metabolism associated diseases such as hypercholesterolemia; atherosclerosis; CVD and lipoprotein metabolism disorders in a subject, the method comprising (i) providing a sample from the subject and (ii) detecting the presence of an alteration in an HDLc related gene locus of the present invention in said sample, the presence of said alteration is indicative of the predisposition to lipid metabolism associated diseases.
  • lipid metabolism associated diseases such as hypercholesterolemia; atherosclerosis; CVD and lipoprotein metabolism disorders
  • a particular object of this invention resides in a method of detecting a predisposition to lipid metabolism associated diseases in a subject, the method comprising (i) providing a sample from the subject and (ii) detecting the presence of an alteration in an HDLc related mRNA of the present invention in said sample, the presence of said alteration being indicative of the predisposition to lipid metabolism associated diseases.
  • An additional particular object of this invention resides in a method of detecting a predisposition to lipid metabolism associated diseases in a subject, the method comprising (i) providing a sample from the subject and (ii) detecting the presence of an alteration in an HDLc related polypeptide of the present invention in said sample, the presence of said alteration being indicative of a predisposition to lipid metabolism associated diseases.
  • An alteration in the gene may be any form of mutation(s), deletion(s), rearrangement(s) and/or insertion(s) in the coding and/or non-coding region of the locus, alone or in various combination(s) which modifies the normal level of expression or activity of the protein or nucleic acid encoding same.
  • the detection of the presence of an altered HDLc related gene or an altered HDLc related mRNA sequence according to the present invention can be performed by sequencing all or part of the gene, polypeptide or RNA, by selective hybridization or by selective amplification, for instance.
  • An object of the present invention resides in a method of detecting a predisposition to lipid metabolism associated diseases in a subject, the method comprising (i) providing a sample from the subject and (ii) detecting the presence of an altered HDLc related RNA and/or polypeptide expression, the presence of said altered HDLc related RNA and/or polypeptide expression being indicative of a predisposition to lipid metabolism associated diseases.
  • Altered RNA expression includes the presence of an altered RNA sequence, the presence of an altered RNA splicing or processing, the presence of an altered quantity of RNA, etc. These may be detected by various techniques known in the art, including by sequencing all or part of the RNA or by selective hybridization or selective amplification of all or part of said RNA, for instance.
  • Altered HDLc related polypeptide expression includes the presence of an altered polypeptide sequence, the presence of an altered quantity of polypeptide, the presence of an altered tissue distribution, etc. These may be detected by various techniques known in the art, including by sequencing and/or binding to specific ligands (such as antibodies), for instance.
  • a further object of the present invention resides in a method of detecting a predisposition to lipid metabolism associated diseases in a subject, the method comprising (i) providing a biological sample from the subject and (ii) detecting the presence of an altered HDLc related protein activity, the presence of said altered activity being indicative of a predisposition to lipid metabolism associated diseases.
  • An object of the present invention resides in a method of genotyping at least one polymorphism of an HDLc related gene of the present invention, comprising (i) providing a biological sample from the subject and (ii) determining the identity of the allele of said polymorphism in said sample.
  • the identity of the allele is determined by performing a hybridization assay, a sequencing assay, a microsequencing assay, an allele-specific amplification assay.
  • polymorphism refers to any sequence in the human genome which exists in more than one version or variant in the population.
  • a “mutation” is a form of a polymorphism in which the expression level, stability, function or biological activity of the encoded protein is substantially altered.
  • a “mutation” is a detectable change in the genetic material which can be transmitted to a daughter cell.
  • a mutation can be, for example, a detectable change in one or more deoxyribonucleotide.
  • nucleotides can be added, deleted, substituted for, inverted, or transposed to a new position. Spontaneous mutations and experimentally induced mutations exist.
  • the result of a mutation of nucleic acid molecule is a mutant nucleic acid molecule.
  • a mutant polypeptide can be encoded from this mutant nucleic acid molecule.
  • linkage disequilibrium refers to any degree of non-random genetic association between one or more allele(s) of two different polymorphic DNA sequences, that is due to the physical proximity of the two loci. Linkage disequilibrium is present when two DNA segments that are very close to each other on a given chromosome will tend to remain unseparated for several generations with the consequence that alleles of a DNA polymorphism (or marker) in one segment will show a non-random association with the alleles of a different DNA polymorphism (or marker) located in the other DNA segment nearby.
  • the present invention also relates to a method of determining the existence of an association between a polymorphism and a disease or disorder, comprising the steps of: (i) genotyping at least one polymorphism of an HDLc related gene of the present invention, in a population having said disease or disorder; (ii) genotyping said polymorphism in a control population; and, (iii) determining whether a statistically significant association exists between said disease or disorder and said polymorphism.
  • RNA expression or sequence may be used to detect or quantify altered gene or RNA expression or sequence, including sequencing, hybridization, amplification and/or binding to specific ligands (such as antibodies).
  • Other suitable methods include allele-specific oligonucleotide (ASO), allele-specific amplification, Southern blot (for DNAs), Northern blot (for RNAs), single-stranded conformation analysis (SSCA), PFGE, fluorescent in situ hybridization (FISH), gel migration, clamped denaturing gel electrophoresis, heteroduplex analysis, RNase protection, chemical mismatch cleavage, ELISA, radio-immunoassays (RIA) and immuno-enzymatic assays (IEMA).
  • ASO allele-specific oligonucleotide
  • SSCA single-stranded conformation analysis
  • FISH fluorescent in situ hybridization
  • gel migration clamped denaturing gel electrophoresis, heteroduplex analysis, RNase protection, chemical mismatch cleavage,
  • Some of these approaches are based on a change in electrophoretic mobility of the nucleic acids, as a result of the presence of an altered sequence. According to these techniques, the altered sequence is visualized by a shift in mobility on gels. The fragments may then be sequenced to confirm the alteration. Some others are based on specific hybridization between nucleic acids from the subject and a probe specific for wild-type or altered gene or RNA. The probe may be in suspension or immobilized on a substrate. The probe is typically labeled to facilitate detection of hybrids.
  • a "probe” is meant to include a nucleic acid oligomer that hybridizes specifically to a target sequence in a nucleic acid or its complement, under conditions that promote hybridization, thereby allowing detection of the target sequence or its amplified nucleic acid. Detection may either be direct (i.e., resulting from a probe hybridizing directly to the target or amplified sequence) or indirect (i.e., resulting from a probe hybridizing to an intermediate molecular structure that links the probe to the target or amplified sequence).
  • a probe's "target” generally refers to a sequence within an amplified nucleic acid sequence (i.e., a subset of the amplified sequence) that hybridizes specifically to at least a portion of the probe sequence by standard hydrogen bonding or "base pairing.”
  • Some of these approaches are particularly suited for assessing a polypeptide sequence or its expression level, such as Western blot, immunoblot, enzyme-linked immunosorbant assay (ELISA), radioimmunoassay (RIA), immunoprecipitation, surface plasmon resonance, chemiluminescence, fluorescent polarization, phosphorescence, immunohistochemical analysis, matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, microcytometry, microarray, microscopy, fluorescence activated cell sorting (FACS), flow cytometry, and assays based on a property of the protein including, but not limited to, DNA binding, ligand binding, or interaction with other protein partners.
  • the latter requires the use of a ligand specific for the polypeptide, more preferably of a specific antibody.
  • Amplification may be performed according to various techniques known in the art, such as by polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA) and nucleic acid sequence based amplification (NASBA). These techniques can be performed using commercially available reagents and protocols. Preferred techniques use allele-specific PCR or PCR-SSCP. Amplification usually requires the use of specific nucleic acid primers, to initiate the reaction.
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • SDA strand displacement amplification
  • NASBA nucleic acid sequence based amplification
  • a "primer” defines an oligonucleotide which is capable of annealing to a target sequence, thereby creating a double stranded region which can serve as an initiation point for nucleic acid synthesis under suitable conditions.
  • Primers can be, for example, designed to be specific for certain alleles so as to be used in an allele-specific amplification system.
  • the primer's 5' region may be non- complementary to the target nucleic acid sequence and include additional bases, such as a promoter sequence (which is referred to as a "promoter primer").
  • any oligomer that can function as a primer can be modified to include a 5' promoter sequence, and thus function as a promoter primer.
  • any promoter primer can serve as a primer, independent of its functional promoter sequence.
  • the design of a primer from a known nucleic acid sequence is well known in the art.
  • the oligos it can comprise a number of types of different nucleotides.
  • Oligonucleotide probes or primers of the present invention may be of any suitable length, depending on the particular assay format and the particular needs and targeted genomes employed.
  • the oligonucleotide probes or primers are at least 12 nucleotides in length, preferably between 15 and 24 molecules, and they may be adapted to be especially suited to a chosen nucleic acid amplification system.
  • the length of the oligonucleotide or primer as mentioned above does not necessarily refer to the total length of the oligonucleotide but may refer to the length of the oligonucleotide that duplexes.
  • the oligonucleotide probes and primers can be designed by taking into consideration the melting point of hydrizidation thereof with its targeted sequence (see below and in Sambrook et al., 1989, “Molecular Cloning A Laboratory Manual", 2nd Edition, CSH Laboratories; Ausubel et al., 1989, in “Current Protocols in Molecular Biology”, John Wiley & Sons Inc., N. Y.).
  • a person of skill in the art would understand that the 5' end of a primer may vary considerably in length (e.g., to include a restriction endonuclease or promoter sequence) and that the 3' end of a primer may contain a minimum number of complementary nucleotides (e.g., 5, 6, 7, 8, ,9, 10, 1 1 , 12, etc.) necessary to bind to a target sequence.
  • the general principles of primer design would be within the scope the skilled person.
  • duplexes are conventionally perfect matches between a primer (or oligonucleotide) and its target sequence, they do not have to be perfect matches to enable hybridization, priming, etc., as well known in the art.
  • DNA can be synthesized artificially in a test tube by chemical process instead of using biological synthesis.
  • the process of synthesizing various lengths of DNA in vitro by using a chemical reaction is carried out by automated DNA synthesizers.
  • a DNA synthesizer consists of a set of valves and pumps that are programmed to introduce specific nucleotides and the reagents required for the coupling of each consecutive nucleotide to the growing chain.
  • Chemical DNA synthesis does not necessarily follow the biological direction of DNA synthesis. In the chemical process each incoming DNA is added to the 5 '- hydroxyl terminus of the growing chain.
  • the term "quantifying" or “quantitating” when used in the context of quantifying transcription levels of a gene can refer to absolute or to relative quantification. Absolute quantification may be accomplished by inclusion of known concentration(s) of one or more target nucleic acids and referencing the hybridization intensity of unknowns with the known target nucleic acids (e.g., through generation of a standard curve). Alternatively, relative quantification can be accomplished by comparison of hybridization signals between two or more genes, or between two or more treatments to quantify the changes in hybridization intensity and, by implication, transcription level.
  • the expression level of a gene of the present invention can be normalized on the basis of the relative ratio of the mRNA level of this gene to the mRNA level of a housekeeping gene or the relative ratio of the protein level of the protein encoded by this gene to the protein level of the housekeeping protein, so that variations in the sample extraction efficiency among cells or tissues are reduced in the evaluation of the gene expression level.
  • a "housekeeping gene” is a gene where the expression is substantially the same from sample to sample or from tissue to tissue, or one that is relatively refractory to change in response to external stimuli.
  • a housekeeping gene can be any RNA molecule other than that encoded by the gene of interest that will allow normalization of sample RNA or any other marker that can be used to normalize for the amount of total RNA added to each reaction.
  • the GAPDH gene, the G6PD gene, the actin gene, ribosomal RNA, 36B4 RNA, PGK1 , RPLPO, or the like may be used as a housekeeping gene.
  • Methods for calibrating the level of expression of a gene are well known in the art.
  • the expression of a gene can be calibrated using reference samples, which are commercially available.
  • reference samples include, but are not limited to: Stratagene® QPCR Human Reference Total RNA, ClontechTM Universal Reference Total RNA, and XpressRefTM Universal Reference Total RNA.
  • a mammal for purposes of treatment, prevention or diagnosis, refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports or pet animals such as dogs, horses, cats, cows etc.
  • the mammal is human.
  • the present invention also provides diagnostic kits comprising primers, probes and/or antibodies for detecting in a sample from a subject the presence of an alteration in an HDLc related gene sequence, RNA sequence or expression level, encoded protein sequence, expression level or protein activity.
  • said diagnostic kits further comprise buffers and reagents for detecting said alteration as well as instructions for using said diagnostic kits.
  • Diagnostic and prognostic methods of the present invention may be practiced by measuring the expression or activity of any combination of genes or polypeptides of the present invention, including combinations comprising genes and polypeptides identified in Table A as having altered expression in HDL-related disease or disorders in combination with genes or polypeptides previously identified as being associated with HDL levels.
  • the methods of the present invention comprise measuring the level of activity or expression of one or more polynucleotides or polypeptides of the present invention in a biological sample obtained from a patient, and then comparing the level measured to a control value or to a level measured in a control subject that does not have the HDL-related disease or disorders. If the level in the patient is significantly higher or lower than the control level, then the patient may be considered to have or be at risk of having the HDL-related disease or disorders. In certain embodiments, the patient is considered to have an HDL-related disease or disorder if the level in the patient is at least two-fold, threefold, or five-fold different than the level in the control.
  • a patient is diagnosed with an HDL-related disease or disorder if the level of expression or activity of a polynucleotide or polypeptide of the present invention is significantly lower than a control value.
  • the level of expression or activity in the patient is less than 75%, less than 50%, less than 25%, or less than 10% the level measured in the control.
  • One exemplary method for measuring levels of a polynucleotide of the present invention in a biological sample involves obtaining a biological sample from a test subject and contacting the biological sample with a compound or an agent capable of binding the polynucleotide (e.g., mRNA, genomic DNA), and then detecting an amount of bound agent.
  • the agent is a labeled nucleic acid probe capable of hybridizing to the polynucleotide.
  • the nucleic acid probe may be, for example, a full-length polynucleotide of the present invention, such as those set forth herein, or a portion or complement thereof, such as an oligonucleotide of at least 12, at least 15, at least 30, at least 50, at least 100, at least 250 or at least 500 nucleotides in length (and sizes comprised within 12 to 500) that specifically hybridizes under stringent conditions to a polynucleotide of the present invention, e.g., mRNA or genomic DNA. Suitable stringent conditions for testing the hybridization of a polynucleotide of this invention with other polynucleotides are described herein.
  • Another method for detecting levels of a protein of the present invention in a biological sample involves obtaining a biological sample from a patient and contacting the biological sample with an antibody that is capable of specifically binding the polypeptide, and then detecting the amount of bound antibody.
  • the antibody is detectably labeled.
  • Antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g., Fab or F(ab')2) can also be used.
  • labeled with regard to the probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled.
  • indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin.
  • the labels may be incorporated by any of a number of means well known to those of skill in the art.
  • Detectable labels suitable for use in the present invention include any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means.
  • Useful labels in the present invention include biotin for staining with labeled streptavidin conjugate, magnetic beads (e.g., DynabeadsTM), fluorescent dyes (e.g., fluorescein, texas red, rhodamine, green fluorescent protein, yellow fluorescent protein and the like), radiolabels (e.g., 3 H, 125 I, 35 S, 14 C, or 32 P), enzymes (e.g., horse radish peroxidase, alkaline phosphatase and others commonly used in an ELISA), and colorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads.
  • fluorescent dyes e.g., fluorescein, texas red, rhodamine, green fluorescent
  • radiolabels may be detected using photographic film or scintillation counters
  • fluorescent markers may be detected using a photodetector to detect emitted light
  • Enzymatic labels are typically detected by providing the enzyme with a substrate and detecting the reaction product produced by the action of the enzyme on the substrate, and colorimetric labels are detected by simply visualizing the colored label.
  • biological sample is intended to include tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject. That is, the detection method of the invention can be used to detect polynucleotides and polypeptides of the present invention in a biological sample in vitro as well as in vivo.
  • a preferred biological sample is a plasma sample isolated by conventional means from a subject.
  • methods of the present invention are practiced using one or more compounds that specifically bind polypeptides of the present invention, such as those identified in Tables A, 5 and 6, to determine the amount of the polypeptides present in a blood sample from a patient, wherein an alteration in the amount in the sample from the patient as compared to a sample from a normal control or control value, indicates that the patient has a lipid metabolism associated or HDL- related disease or disorder.
  • detection of a mutation or polymorphism in a gene or protein of the present invention involves the use of a probe/primer in a polymerase chain reaction (PCR) such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e.g., Landegran ef a/. (1988) Science 241 :1077-1080; and Nakazawa ef a/. (1994) Proc. Natl. Acad. Sci. USA 91 :360-364), the latter of which can be particularly useful for detecting point mutations (see Abravaya et al. (1995) Nucleic Acids Res. 23:675-682).
  • PCR polymerase chain reaction
  • LCR ligation chain reaction
  • detection of a mutation or polymorphism in a gene or protein of the present invention involves a DNA sequencing reaction with or without a prior amplification step. Suitable methods of DNA sequencing would be within the scope of the skilled person.
  • a lipid metabolism associated or HDL-related disease or disorder associated is diagnosed based upon a decreased level of expression or activity of a polynucleotide or polypeptide of the present invention in a biological sample obtained from a subject.
  • the biological sample is blood or plasma.
  • kits for detecting the presence of a lipid metabolism associated or HDL-related disease or disorder in a patient can comprise one or more compounds or agents capable of detecting a polypeptide or mRNA of the present invention in a biological sample, such as oligonucleotides and antibodies.
  • the antibody is labeled.
  • the kit may optionally include one or more control samples.
  • the compounds or agents can be packaged in a suitable container.
  • the kit can further comprise instructions for using the kit.
  • the kit or array comprises an oligonucleotide or antibody (or fragment thereof) that specifically binds to a polynucleotide or polypeptide of the present invention.
  • the present invention also relates to pharmacogenomics for the tailoring of drug treatments according to patient genotype, including the prediction of side effects upon administration of HDL increasing compounds of the invention. Differences in efficacy of therapeutics can lead to severe toxicity or therapeutic failure by altering the relation between dose and blood concentration of the pharmacologically active drug.
  • the pharmacogenomics of the individual permits the selection of effective agents for prophylactic or therapeutic treatments based upon a consideration of the individual's genotype.
  • Such pharmacogenomics can further be used to determine appropriate dosages and therapeutic regimens. Accordingly, the genetic complement of an individual with respect to the genes disclosed herein can be determined to thereby select appropriate agent(s) for therapeutic or prophylactic treatment of the individual.
  • Pharmacogenomics deals with clinically significant hereditary variations in the response to drugs due to altered drug disposition and abnormal action in affected individuals (Eichelbaum, M. (1996) Clin. Exp. Pharmacol. Physiol. 23:983-85; Linder, M. W. (1997) Clin. Chem. 43:254-66).
  • two types of pharmacogenetic conditions can be differentiated. Genetic conditions transmitted as a single factor altering the way drugs act on the body (altered drug action) or genetic conditions transmitted as single factors altering the way the body acts on drugs (altered drug metabolism).
  • Altered drug action may occur in patient having a polymorphism (e.g., SNP) in promoter, intronic or exonic sequences of one or more genes of the present invention.
  • polymorphisms in the promoter region may be critical in determining the risk of HDL deficiency and CVD.
  • polymorphisms of genes of the present invention may likewise be relevant to the identification and use of agents identified using the assays disclosed herein.
  • a further embodiment of the present invention relates to animal models of HDL metabolism-related diseases, in which the function of any of the disclosed HDL related genes or proteins has been perturbed. This may include animals that harbor a naturally occurring mutation or variant in the genes that affects function of the gene, including but not limited to decreased activity of the gene or protein.
  • the present invention relates to an animal model of low HDL cholesterol, as represented by the AcB68 recombinant congenic mouse line. As represented herein, this model animal can be used to identify further genes or proteins related to HDL metabolism.
  • Transgenic animal models of HDL metabolism-related diseases can also be engineered using standard methods in which exogenous HDL metabolism related gene sequences are stably introduced into animal cells, and the cells are used to produce animals.
  • These models may include: 1) gene knock-out animals in which the endogenous gene has been replaced by a sequence that disrupts its expression or function, 2) gene knock-in animals, in which the endogenous gene is replaced with a copy of the gene that perturbs normal gene or protein function (e.g., a missense mutation that reduces protein activity or expression), or 3) heterologous recombinant animals, in which heterologous integration of gene sequences lead to perturbed gene or protein function (e.g., stable expression of a dominant negative mutation, or of a siRNA that down-regulates gene expression). Both knock-out and knock-in animal models are considered homologous recombinant animals.
  • a "targeted gene” or “knockout” is a DNA sequence introduced into a germ-line or a non-human animal by way of human intervention, including, but not limited to, the methods described herein (e.g., homologous recombination, random integration).
  • Targeted genes or knockouts are commonly known in the art to which the present invention pertains and are further described, for example, in Tymms et al., 2001 , “Gene Knockout Protocols", Humana Press; Hogan ef a/., 1994, “Manipulating the Mouse Embryo”, Cold Spring Harbor Laboratory Press; and Nagy ef a/., 2002, “Manipulating the Mouse Embryo, 3rd edition", Cold Spring Harbor Laboratory Press.
  • the targeted genes of the present invention include DNA sequences which are designed to alter cognate endogenous alleles.
  • the transgene in these animal models may be either heterozygous (one or more copies of the transgene in the presence of the endogenous allele) or homozygous (e.g., two identical copies of the transgene in the absence of the endogenous allele).
  • Animal models of HDL metabolism-related diseases may also be produced to contain selected systems which allow for regulated expression of the transgene.
  • One example of such a system is the creloxP recombinase system of bacteriophage P1.
  • Another example of a recombinase system is the FLP recombinase system of Saccharomyces cerevisiae. If a creloxP recombinase system is used to regulate expression of the transgene, animals containing transgenes encoding both the Cre recombinase and a selected protein are required.
  • Such animals can be provided through the construction of "double" transgenic animals, e.g., by mating two transgenic animals, one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombinase.
  • animal models may be used in a number of applications. For instance, they can be used to identify or further characterize differentially expressed genes that are associated with HDL metabolism-related diseases, or identify additional physiological pathways that modulate HDL metabolism- related disease pathogenesis. Alternately, animal models of HDL metabolism-related diseases may be used as part of screening strategies designed to identify compounds which are capable of ameliorating HDL metabolism-related diseases, or modulating physiological phenomena associated with HDL metabolism- related diseases (e.g., plaque formation, or arterial inflammation). Thus, the animal models of HDL metabolism-related diseases may be used to identify or improve drugs, pharmaceuticals, therapies and interventions which may be effective in treating HDL metabolism-related diseases.
  • These animal models may also be used to determine the half lethal dose (LD50) and the half effective dose (ED50) of potential drugs, pharmaceuticals, therapies and interventions, and such data can be used to determine the in vivo efficacy of potential HDL metabolism-related diseases treatments.
  • LD50 half lethal dose
  • ED50 half effective dose
  • Cells from transgenic animals may be used for in vitro applications such as to determine gene function, or binding partners, or cellular responses to exogenous substances or stimuli (e.g., electrophysiological characteristics of neuronal cells from a transgenic animal). These transgenic cellular systems can also be used to identify or improve drugs, pharmaceuticals, therapies and interventions which may be effective in treating HDL metabolism-related diseases.
  • the following examples are illustrative of various aspects of the invention, and do not limit the broad aspects of the invention as disclosed herein.
  • Feedback regulation is a well-known and major mechanism by which cells regulate the activity of biosynthetic or catabolic pathways. This is a self-regulatory process that will indicate to the cell when to start and stop producing a certain molecule or similarly when to start and stop degrading a particular complex molecule.
  • One example is a metabolic intermediate binding to an "allosteric" regulatory site (as opposed to catalytic site reserved for the substrate to be modified) on an enzyme located downstream in the same pathway to activate this enzyme, and hence coordinate metabolic activity when the initial substrate enters the pathway.
  • the final product of the pathway may act as an inhibitor of the first enzyme in the pathway to dampen its activity, and so forth.
  • acetyl CoA is absolutely required as an activator of pyruvate carboxylase - i.e., if the citrate cycle intermediates are low, [acetyl CoA] is increased and activates pyruvate carboxylase to make Oxaloacetate for the cycle.
  • Citrate activates acetylCoA carboxylase (to make malonylCoA for FA synthesis); i.e., if citrate levels outside the mitochondria are high, then the substrates for FA synthesis are available.
  • FA CoA inhibits acetyl CoA carboxylase and helps to keep synthesis and degradation of FA from happening simultaneously.
  • this approach could be implemented in whole animals, by for example analyzing the effect of such a mutation on the transcript profiles of individual cell populations or individual organs. This could be done by generating a mouse mutant (knock-out allele) for a gene of interest, then preparing RNA from the mutant animal and its normal wild type control and hybridizing such RNA to microarrays containing probe sets for the whole genome.
  • this direct approach does not work very well for several reasons. Knock-out alleles are most of the time generated on the genetic background of 129Sv (donor embryonic stem cell), and are then backcrossed to the genetic background of B6 or other mouse strains for convenience resulting in animals that are genetically heterogeneous with respect to background.
  • mice from the mutant stocks not completely identical, but also all may be somewhat different from the "control" wild type strain. Although in most cases, this is not a problem (for phenotypic evaluation of an obvious trait), it is a major problem in the comparison of transcript profiles. Indeed, there are subtle differences in genome sequence of different inbred strains that translate sometimes in differences in cis-acting or trans-acting sequence elements regulating gene expression.
  • the inventors have used an alternate strategy.
  • the inventors were interested in identifying genes that are differentially regulated by the presence or absence of ApoA1 , a major low-density lipoprotein that binds cholesterol to form high-density lipoproteins, for transport to and from tissues.
  • Such genes could be used as targets for up or down-regulation by synthetic compounds or other therapeutic interventions, providing novel targets for drug discovery in lipid metabolism related diseases.
  • the approach consisted in taking a mutant null allele at ApoA1 generated on a mixed A/J and B6 background and outcrossing it for two generations (F2s) to C57BI/6J.
  • these F2 animals have completely mixed genetic background with contributions from the 2 parental strains distributed all over the genome.
  • These F2 mice were then divided in two groups based on the presence or absence of homozygosity for the Apoai mutations, being either wild type (+/+) or mutant (-/-). Individual animals from these two groups were then sacrificed and their liver collected for RNA extraction and hybridization to whole genome chips.
  • this experimental framework one looks for genes that are co-regulated in common between all mutant animals when compared to the wild type animals; the effect of the mixed genetic background is nullified in this configuration, on purpose. This has allowed the identification of a small number of genes whose expression is appropriately regulated (either over-expressed or under-expressed) by presence/absence of ApoA1 in liver.
  • B6.129P2-Apoa1 tm1 Unc/J were purchased from the Jackson Laboratory (Bar Harbor, ME).
  • the BcA68 strain is part of a set of 36 AcB/BcA recombinant congenic strains (RCS) derived from A/J and C57BL76J parents, which was generated according to a breeding scheme and genotyping protocol previously described (Fortin et al., 2001 b).
  • RCS congenic congenic strains
  • BcA68 X AKR BcA68 X DBA/2
  • BcA68 X B6 F1 crosses were first generated, then F2 crosses were performed by standard (F1 brother X F1 sister) mating. All mice were handled according to guidelines and regulations of the Canadian Council on Animal Care.
  • mice 8 to 12 weeks of age were fed a pro-atherogenic, high- fat diet (ID 90221 , Teklad Research Diets, Madison, Wi) for 4 consecutive weeks.
  • the diet contained (by weight) 75% Purina Mouse Chow, 7.5% cacao butter, 1.25% cholesterol, and 0.5% sodium cholate. Mice were weighed weekly. Blood collection was performed both pre- and post-diet following 4-6 hours of fasting. Pre-diet blood collections were done on lateral saphenous vein, while cardiac puncture under anaesthesia was used for exsanguinations at the end of the diet period (either high-fat or control normal diet).
  • Plasma lipids including HDL cholesterol (HDLc), total cholesterol (TC), triglycerides, free fatty acids, unesterified cholesterol, and glycerol were measured by enzymatic assays employing colorimetric end points (Castellani ef a/., 1998; Hedrick ef a/., 1993). Each sample was measured in triplicate. The non-HDL fraction was calculated by subtracting the HDLc value from the TC value.
  • HDLc HDL cholesterol
  • TC total cholesterol
  • triglycerides free fatty acids
  • unesterified cholesterol unesterified cholesterol
  • glycerol glycerol
  • Genotyping Tail biopsies were obtained from all animals and genomic DNA was isolated by a standard procedure involving proteinase K treatment (Fortin ef a/., 2001 b). Primer pairs defining dinucleotide repeat markers informative for the A/J, C57BL/6J, AKR and DBA/2J mouse strains, were purchased from Research Genetics (Huntsville, AL) and BioCorp Inc. (Montreal, QC). Linkage map positions were obtained from the Mouse Genome Assembly at the University of California Santa Cruz Bioinformatics website (UCSC Genome Browser : http://genome.ucsc.edu).
  • Exons from the Apoai gene were amplified from genomic DNA of parental C57BL76J strain as well as from BcA68. The following oligonucleotides were used to PCR amplify 3 fragments containing the 4 exons of Apoai .
  • Exon 1 5'- TTGTTCCAGGCTCAGAGGGCACTA -3' (SEQ ID NO:103)/5'- ATCAACTGGGAGGCGCTATGGAG -3' (SEQ ID NO: 104); Exons 2-3, 5'- ATATCTCGCACCTTTAGCCATTCT -3' (SEQ IS NO:105)/5'-CTCAGTTCCAGCATCTTCTCA-3'(SEQ ID NO: 106); Exon 4, ⁇ '-TTCGGGGAAACTAGGACCATAGCA-S' (SEQ ID NO:107)/5'- AGTGCGGCACCATGTTCTCACG -3' (SEQ ID NO:108).
  • the PCR products were visualized by agarose gel electrophoresis to confirm size.
  • Cycle sequencing of individual ApoA1 exons was performed at the McGiII University/Genome Quebec Innovation Centre (Montreal, QC). Reactions were done in the presence of fluorescently labeled BigDyeTM Terminator (Applied Biosystems, Foster CA), and the products were analyzed using an automated ABI 3700 instrument (Applied Biosystems, Foster CA). Genotyping of the QW22-23 CStop mutation was done by digesting the PCR amplified exon 2-3 fragment with Mwol restriction enzyme according to manufacturer's directions. Digested fragments were visualized by electrophoresis through 3% agarose gels.
  • RNA from each of the livers was extracted using QiagenTM RNeasyTM Mini kits and quality control was done on an Agilent BioanalyzerTM. Labeling and hybridization to AffymetrixTM MOE430_2 GeneChips was performed by the Microarray service of the McGiII University and Genome Quebec Innovation Centre (Montreal, Qc). Briefly, 10 ⁇ g of the recently isolated total cellular RNA was resuspended in DEPC water at a concentration of 1 ⁇ g/ ⁇ l or greater.
  • RNA was then reverse transcribed into cDNA and in vitro transcription was performed to generate biotin-labeled cRNA for subsequent hybridization.
  • Hybridized target cRNA was stained with streptavidin phycoerythrin and arrays were scanned using a GeneArray Scanner at an excitation wavelength of 488nm. Light emissions at 570nm were measured at each oligonucleotide position on the GeneChip® array.
  • RMA Robust Multichip Average
  • a pairwise comparison of each probe set was first performed using Welch's t-test statistic with P ⁇ 0.05 and a fold-change cutoff of 1.5 (retaining both up- and down-regulated genes). The resulting list of probe sets was then sorted by gene name; when more than one probe was available per gene, only the one with the smallest P-value was kept.
  • expression levels at 29 representative probe sets were graphically displayed using a color scale (green to red) representing the ratio between individual expression and the average expression in both genotype groups combined.
  • Hierarchical clustering of the probes (genes) according to expression pattern similarities in the 14 independent microarrays was performed and represented with Euclidean distances. Hierarchical clustering of the F2 animals was also performed based on individual expression profile at the 29 selected probe sets.
  • RNAse-free DNAse I Invitrogen, Burlington, ON
  • Superscript IIITM reverse transcriptase InvitrogenTM
  • Reverse transcriptase-free samples were produced in parallel to serve as negative controls in the expression studies.
  • Approximately 0.4% of the resulting cDNA was used, individually or pooled according to Apoai genotype, as template in subsequent PCR reactions.
  • PCR template quantity/quality was verified using primers for the mouse beta-actin gene: 5'- CCTCTGGTCGTACCACAGGC-3' (SEQ ID NO: 109) and ⁇ '-ACGGATGTCAACGTCACACTTC-S' (SEQ ID NO: 110), and by testing the samples on Agilent Bioanalyzers. Quantitative PCR was performed using the ABI PRISM 7000 sequence detector system.
  • TaqManTM assays specific for the candidate genes as well as for three housekeeping controls were purchased from Applied Biosystems (Toronto, ON): Mm00436772_m1 (SqIe), Mm00437569_m1 (Apoal ), Mm00474091_m1 (Cd163), Mm00850544_g1 (Socs2), MmO1351295_m1 (Susdi ), Mm00607939_s1 (Actin), Mm00446968_m1 (Hprt1 ), Mm00435617_m1 (Pgk1).
  • Amplification mixes contained 4 ⁇ l cDNA, 17.5 ⁇ l TaqMan PCR Mix (Applied Biosystems), 1.75 ⁇ l primers/probe mix and 11.75 ⁇ l water.
  • the ABI PRISM 7000 sequence detector system was programmed to start with uracil N-glycosylase activation for 2 min at 50 0 C followed by a 10 min denaturation at 95°C. The program continued with 40 cycles of DNA denaturation (15 sec at 95°C with a 50% ramp speed), primer annealing and elongation (1 min at 60 0 C). Relative quantitation of gene expression was performed using the comparative threshold cycle (Ct) method. Ct values kept for analysis ranged from 18.6 (Apoal) to 32 (Susdi) cycles.
  • Candidate gene expression levels were normalized to each of the three housekeeping genes tested (Actin, Pgk1 and Hprt1) and arbitrarily expressed relative to one of the samples. The median relative expression value obtained with the three housekeeping genes was then used for subsequent analyses.
  • Figure 1 presents the amounts (mg/dL) and ratios (percentage) of the non-HDLc (TC minus HDLc) and HDLc in the plasma of the AcB/BcA RC strains along with A/J and C57BL/6J (B6) parental strains, (A) on normal diet and (B) following four weeks on a high-fat diet.
  • HDL was the main cholesterol transport particle found in their plasma, holding respectively about 85% and 90% of their TC.
  • HDLc decreased to about 20% in both parental strains, paralleled with a 1.6- and 1.8- fold increase in total cholesterol, respectively (Table 1 ).
  • a similar situation was observed in males and in females, although females had generally lower levels of plasma cholesterol than males.
  • Strains of the AcB/BcA RC set presented a continuous phenotype distribution of cholesterol levels (TC and HDLc) on both normal and high-fat diet, indicating the presence of multigenic determinants controlling plasma cholesterol.
  • a second strain of interest was AcB65 (Table 1): on normal diet, this strain presented a HDLc/TC similar to those of A/J and B6 (about 87-88%), but as opposed to both parental strains, HDLc/TC stayed at about 40% when the mice were fed a high-fat diet.
  • the phenotypes seen in BcA68 and AcB65 were present in males and females, but were unique to these two strains suggesting that they were the result of specific parental allele assortments or spontaneous mutations that had occurred during the creation of the strains. BcA68 and AcB65 were then chosen for further analysis.
  • the 22-23WQ>CStop mutation is not found in A/J and C57BL/6J parental strains, or in any other strains of the AcB/BcA RCS set. Therefore it represents a cfe novo mutation that emerged and became fixed during the breeding of BcA68. When maintained on normal diet, BcA68 animals appeared healthy, did not show any gross abnormality and presented normal longevity.
  • a novel strategy to identify genes and proteins that are part of the ApoA1 pathway and that may play a role in cholesterol metabolism and HDL formation was used. This strategy is based on the observation that transcription of genes encoding multienzyme pathways is often regulated in response to availability of co-factors, precursors, intermediates, or products of this pathway. For instance, inhibition of a pathway enzyme may cause accumulation of precursors and depletion of final products, which can selectively induce changes in transcription of genes coding for enzymes in the inhibited pathway, before a generalized stress response appears. In the case of an inhibitor whose target is unknown, the resulting expression profile may incriminate the affected pathway and enzyme(s) involved.
  • the elevated level of serum amyloid A (Saa) transcripts seen in ApoA1 deficient-mice is interesting as SAA can replace ApoA1 as a structural apolipoprotein on HDL particles in the context of acute or chronic inflammation (Cabana et al., 1999), and that elevated SAA is seen in patients with atherosclerosis related pathologies, type 2-diabetes and metabolic syndrome (Hansel et al., 2006). Taken together, these results suggest that a low level of inflammation is ongoing in the liver of Apoai-/- mice.
  • Saa serum amyloid A
  • mice target genes of the present invention extend to their respective human orthologs (see Tables 5 and 6) as shown in Example 8.
  • mice genes and proteins of the present invention are differentially regulated in the absence of ApoA1 , and thus relate to various aspects of lipid metabolism including the control of HDL levels.
  • HDL high lipid metabolism
  • patients with extreme HDL are defined as having HDL levels less than 5 th percentile (low HDL) or greater than 95 th percentile (high HDL).
  • low HDL low percentile
  • high HDL 95 th percentile
  • patients with extreme HDL did not present additional accompanying clinical signs such as unusually high or low total cholesterol, triglycerides, or BMI.
  • patient medical histories did not indicate strong environmental, medication, diseases (e.g. Type 2 diabetes) or other medical factors that could significantly impact HDL levels.
  • pedigrees mutations in known HDL genes such as ABCA1 , APOAI, LCAT, or CETP were ruled out by DNA sequencing of the pedigree proband. In total, 52 pedigrees, including 24 low HDL pedigrees and 28 high HDL pedigrees, were selected for further analysis.
  • Genomic DNA was obtained from blood lymphocytes of individuals from each pedigree. Genomic DNAs were then probed with a genome-wide 5cM microsatellite panel (ABI) and/or HumanLinkage-12 BeadChipTM arrays (lllumina ® ) which measure approximately 6,000 SNP genotypes per individual.
  • ABSI 5cM microsatellite panel
  • lllumina ® HumanLinkage-12 BeadChipTM arrays
  • linkage interval boundaries were determined based on a combination of allele/haplotype segregation analyses, identification of -1 LOD interval obtained from subsequent multipoint linkage analysis, and/or identification of neighbouring upstream and downstream 2- point LOD scores ⁇ -3.0.
  • the boundaries are not yet estimated due to a lack of informative microsatellites or SNPs near the peak linkage signal.
  • Figure 7 shows a representative high HDL pedigree NL-510 with allele segregation analysis of two SNPs located near candidate genes ORM2 and SUSD1.
  • the two SNPs shown are representative of nine informative SNPs that have undergone segregation analysis. Inferred genotypes are shown in parenthesis. The susceptibility haplotype segregates with high HDL throughout the pedigree with the exception of individual 111:21 (circled) who is non-penetrant.
  • HDLs High-density lipoproteins
  • Bile acid-activated nuclear receptor FXR suppresses apolipoprotein A-I transcription via a negative FXR response element. J. Clin. Invest. 109: 961 -71.
  • Bile salt transporters molecular characterization, function, and regulation. Physiol. Rev. 83: 633-71.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Urology & Nephrology (AREA)
  • Pathology (AREA)
  • Environmental Sciences (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Endocrinology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne l'identification de gènes liés au métabolisme lipidique, et plus particulièrement de gènes qui sont modulés en l'absence de l'apoliprotéine A1 (ApoA1). Ainsi, la présente invention a trait aux éléments suivants : 1) des procédés de criblage permettant d'identifier des composés qui modulent l'activité et/ou le niveau d'expression d'un ou de plusieurs gènes liés au cholestérol à lipoprotéines de haute densité (HDLc) ou de protéines codées identifiées dans la présente description; 2) des méthodes de traitement ou de prévention de maladies associées au métabolisme lipidique; 3) des méthodes de diagnostic et des kits permettant de détecter une prédisposition à des troubles et à des maladies associés au métabolisme lipidique; 4) des modèles animaux permettant d'identifier des composés destinés à traiter ou à prévenir une maladie associée au métabolisme lipidique ou une maladie du métabolisme HDL, ou à diminuer la susceptibilité à une telle maladie; et 5) des gènes liés à HDLc et des protéines codées.
PCT/CA2009/000986 2008-07-24 2009-07-21 Méthode de traitement, de prévention et de diagnostic de maladies associées au métabolisme lipidique WO2010009534A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US8340108P 2008-07-24 2008-07-24
US61/083,401 2008-07-24

Publications (1)

Publication Number Publication Date
WO2010009534A1 true WO2010009534A1 (fr) 2010-01-28

Family

ID=41569951

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2009/000986 WO2010009534A1 (fr) 2008-07-24 2009-07-21 Méthode de traitement, de prévention et de diagnostic de maladies associées au métabolisme lipidique

Country Status (1)

Country Link
WO (1) WO2010009534A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014018375A1 (fr) * 2012-07-23 2014-01-30 Xenon Pharmaceuticals Inc. Cyp8b1 et ses utilisations dans des méthodes thérapeutiques et diagnostiques

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
"NOVARTIS FOUNDATION SYMPOSIUM.", vol. 281, 2007, ISSN: 1528-2511, article FORTIN, A. ET AL.: "The AcB/BcA recombinant congenic strains of mice: strategies for phenotype dissection, mapping and cloning of quantitative trait genes", pages: 141 - 155 *
DEDOUSSIS, GVZ.: "Apolipoprotein polymorphisms and familial hypercholererolemia", PHARMACOGENOMICS., vol. 8, September 2007 (2007-09-01), pages 1179 - 1189 *
PLUMP, A.S. ET AL.: "ApoA-1 knockout mice: characterization of HDL metabolism in homozygotes and identification of a post-RNA mechanism of apoA-1 up regulation in heterozygotes", JOURNAL OF LIPID RESEARCH., vol. 38, May 1997 (1997-05-01), pages 1033 - 1047 *
WILLIAMSON, R. ET AL.: "Marked reduction of high density lipoprotein cholesterol in mice genetically modified to lack apolipoprotein A-1", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCE., vol. 89, August 1992 (1992-08-01), pages 7134 - 7138 *
YAMADA, Y. ET AL.: "Identification of CELSRI as a susceptibility gene for ischemic stroke in Japanese individuals by a genome-wide assoication study", ATHEROSCLEROSIS., 5 April 2009 (2009-04-05) *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014018375A1 (fr) * 2012-07-23 2014-01-30 Xenon Pharmaceuticals Inc. Cyp8b1 et ses utilisations dans des méthodes thérapeutiques et diagnostiques

Similar Documents

Publication Publication Date Title
Bouchard Genetics of obesity: what we have learned over decades of research
US20060211020A1 (en) Methods for the diagnosis, prognosis and treatment of metabolic syndrome
WO2009059319A1 (fr) Evaluation de la sensibilité aux affections vasculaires
WO2010048497A1 (fr) Profil génétique des marqueurs associés à la maladie d'alzheimer
EP1888773A2 (fr) Procede de diagnostic et de traitement d'une maladie mentale
WO2012107580A1 (fr) Procédé de diagnostic in vitro pour prédire une prédisposition à la cardiomyopathie
US20130266937A1 (en) Compositions and methods for diagnosing and treating macular degeneration
US20080050358A1 (en) Identification of Snps Associated with Hyperlipidemia, Dyslipidemia and Defective Carbohydrate Metabolism
WO2005108613A9 (fr) Proteine d'interaction de voies du gene kv (kchip1) de diabete humain de type ii situee sur le chromosome 5
EP1934368B1 (fr) Moyens et procedes de diagnostic de troubles lies a lipase atgl
US20140171371A1 (en) Compositions And Methods For The Diagnosis of Schizophrenia
WO2010009534A1 (fr) Méthode de traitement, de prévention et de diagnostic de maladies associées au métabolisme lipidique
CA2852631A1 (fr) Un gene et ses mutations associees a une crise d'epilepsie et a des troubles moteurs
WO2011116311A1 (fr) Détermination d'une prédisposition à un événement cardiaque soudain
WO2009073167A2 (fr) Identification et diagnostic de la fibrose pulmonaire au moyen de gènes de mucines, et procédés et compositions apparentés
US20140288011A1 (en) Genetic association
US20080167326A1 (en) Method For Assessing the Predisposition and/or Susceptibility to Copd by Analysing Fgf-Bp1
EP1259649B1 (fr) Procedes et compositions pour le diagnostic et le traitement de la pseudoxanthoma elasticum et des pathologies associees
US9157119B2 (en) Methods for diagnosing skin diseases
Kontaraki et al. Myocardin gene regulatory variants as surrogate markers of cardiac hypertrophy–study in a genetically homogeneous population
US20080194419A1 (en) Genetic Association of Polymorphisms in the Atf6-Alpha Gene with Insulin Resistance Phenotypes
Zhang et al. Analysis of the association between Apolipoprotein D and schizophrenia
EP2233585A1 (fr) Procédé d'essai pour le diabète de type 2 à l'aide d'un polymorphisme de gène
JP2008502341A (ja) 電位型カリウムチャネルをコードするヒト肥満感受性遺伝子およびその使用
WO2011031769A2 (fr) Procédés pour l'évaluation des risques, le traitement, et le diagnostic d'un infarctus du myocarde

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09799887

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09799887

Country of ref document: EP

Kind code of ref document: A1