WO2010003002A9 - Modulation of follicular helper t cells - Google Patents

Abstract

Methods of modulating the differentiation of Tf1, cells by administering an effective amount of an agonist and/or antagonist of IL-6, IL-21, or STAT3.

Description

MODULATION OF FOLLICULAR HELPER T CELLS

CROSS-REFERENCE TO RELATED APPLICATIONS [0001] None.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This disclosure was developed at least in part using funding from the National

Institutes of Health, Regulation of Inflammatory Genes in Rheumatoid Arthritis, Grant No. ROl- AR-50772. The U.S. government has certain rights in this invention..

THE NAMES OF THE PARTIES TO A JOINT RESEARCH AGREEMENT

[0003] None.

REFERENCE TO SEQUENCE LISTING [0004] None.

BACKGROUND OF THE INVENTION

[0005] A fundamental function of Th cells is to provide "help" to B cells and regulate their proliferation and immunoglobulin class-switching, especially in the germinal center structures. ThI and Th2 cells have been shown to regulate B cell responses. For example, IFNγ regulates IgG2a production while IL-4 is critical in IgE class-switching. However, an additional Th subset called follicular helper T (T_fh) cells are present in germinal centers and are characterized by their expression of chemokine (C-X-C motif) receptor 5 (CXCR5). Vinuesa, C. G., et al., Follicular B Helper T Cells in Antibody Responses and Autoimmunity, Nature Reviews Immunology Nat Rev Immunol, 2005b, 5:853-865.

[0006] Human Tf₁, cells express distinct genes from ThI or Th2 cells. Chtanova, T., et al.,

T Follicular Helper Cells Express a Distinctive Transcriptional Profile, Reflecting Their Role as Non-Thl/Th2 Effector Cells That Provide Help for B Cells, J Immunol, 2004, 173:68-78. Despite their potential importance in humoral immunity and immunopathology, the developmental regulation of Tn₁ cells and their relationship with other Th subsets has been unclear to date. For example, IL-21 is expressed by both ThI 7 and T_f1, cells SUMMARY OF THE INVENTION

[0007] A subset of T cells, named T follicular helper cells (T_fh), provides a helper function to B cells. They stimulate the differentiation of B cells into antibody-forming cells. We found that T_f1, generation is regulated by IL-6, IL-21 and STAT3. Tfh cells have a distinct gene expression profile from THl, TH2 and TH 17 lineages as demonstrated by microarray analysis (The microarray data have been deposited into NCBI GEO with the accession number GSEl 1924). Finally in vitro generated T_f1, cells acquire T_f1, gene expression and function as in vivo generated T_fh cells. Antibody-producing B cells need to be tightly controlled. Any dysregulation of T cell function can have a significant effect on the antibody-producing B cells. For example, excessive function of T_fh cells can contribute to pathogenesis antibody-mediated autoimmune diseases (Systemic lupus erythematosus (SLE)). In this case targeting of specific T_f1, factors will help to prevent this autoimmune disease. However, T_f11 cells can be beneficial during parasite, viral and bacterial infection. During infection antibody is required to confer protection against infectious diseases by neutralizing pathogenic factors on the microorganisms (antibody- mediated protection). In this case T_fh cells will help to clear infection.

BRIEF DESCRIPTION OF THE DRAWINGS

[0008] The foregoing summary as well as the following detailed description of the preferred embodiment of the invention will be better understood when read in conjunction with the appended drawings. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities shown herein.

[0009] For a more complete understanding of the present invention, and the advantages thereof, reference is now made to the following descriptions taken in conjunction with the accompanying drawings, in which:

[0010] Figures 1A-1D show that T_fh cells express distinct genes from ThI, Th2 and Thl7 cells.

[0011] Figures 2A-2D depict the generation of T_f]₁ cells as independent of ThI and Th2 lineages.

[0012] Figures 3A-3E show B7H expressed on B cells as required for generation of T_f]₁ cells.

[0013] Figures 4A-4D show IL-21 is necessary for T_f]₁ cell development.

[0014] Figures 5A-5C show the generation of T_fh cells requires IL-6 and STAT3. [0015] Figures 6A-6C show the generation of Ta cells is independent of THl 7 lineage

[0016] Figures 7A-7G show IL-21, in the absence of IL-4, IFNγ and TGF-b signaling, generates Ta cells.

[0017] Figure 8 depicts follicular helper T cells co-express CXCR5 and BTLA.

[0018] Figures 9 A and 9B show FDR estimated from ANOVA tests using resampled samples.

[0019] Figure 10 shows antigen-specific cytokine production by Tn₁ cells.

[0020] Figures 1 IA-I ID shows T_fl, cell generation is independent of THl and TH2 cells.

[0021] Figure 12 shows regulation of antibody responses by STAT3.

[0022] Figures 13 A and 13B show normal germinal center reaction in IL-17 KO, IL- 17F

KO and RORα/γ KO mice.

[0023] Figure 14 depicts a schematic demonstration that development of T^ cells, independent of THl, TH2 or TH 17 lineages, is regulated by IL-6 and IL-21.

DETAILED DESCRIPTION

[0024] Naϊve CD4⁺ helper T (Th) cells, upon encountering their cognate antigens presented on professional antigen-presenting cells (APC), differentiate into effector cells that are characterized by their distinct cytokine production profiles and immune regulatory functions.

[0025] In addition to ThI and Th2 cells, ThI 7, a third subset of Th cells, has been recently identified. ThI 7 cells produce IL-17, IL-17F and IL-22 and regulate inflammatory responses by tissue cells. Dong, C, et al., Cell Fate Decision: T-helper 1 and 2 Subsets in Immune Responses, Arthritis Res, 2000, 2:179-188; Dong, C, THl 7 Cells in Development: An Updated View of Their Molecular Identity and Genetic Programming, Nat Rev Immunol, 2008, 8:337-348. In mouse, ThI 7 differentiation is initiated by transforming growth factor β (TGFβ) and IL-6, possibly via regulating the chromatin remodeling of the III 7-1117 f ^'locus. Bettelli, E., et al., Reciprocal Developmental Pathways for the Generation of Pathogenic Effector TH 17 and Regulatory T Cells, Nature , 2006, 441 :235-238; Mangan, P.R., et al., Transforming Growth Factor-beta Induces Development of the T(H)17 Lineage, Nature, 2006, 441 :231 -234; Veldhoen, M., et al., TGFbeta in the Context of an Inflammatory Cytokine Milieu Supports de novo Differentiation of IL- 17 -producing T Cells, Immunity, 2006, 24:179-189; Akimzhanov, A.M., et al., Chromatin Remodeling of Interleukin-17 (IL-17J-IL-17F Cytokine Gene Locus During Inflammatory Helper T Cell Differentiation, J Biol Chem, 2007, 282:5969-972. While IL-6 is necessary for Th 17 differentiation, IL-21 is reportedly an autocrine factor induced by IL-6 to regulate ThI 7 differentiation. Korn, T., et al., IL-21 Initiates an Alternative Pathway to Induce Proinflammatory TH 17 Cells, Nature, 2007, 448:484-487; Yang, X.O., et al., STAT3 Regulates Cytokine-mediated Generation of Inflammatory Helper T Cells, J Biol Chem, 2007, 282:9358-9363; Nurieva, R., et al., Essential Autocrine Regulation by IL-21 in the Generation of Inflammatory T Cells, Nature, 2007, 448:480-483; Zhou, L., et al., IL-6 Programs TH-17 Cell Differentiation by Promoting Sequential Engagement of the IL-21 and IL-23 Pathways, Nat Immunol, 2007, 8:967-974. On the other hand, TGFβ signaling mediates ThI 7 differentiation in vivo. Bettelli, E., et al., Reciprocal Developmental Pathways for the Generation of Pathogenic Effector THl 7 and Regulatory T Cells, Nature , 2006, 441 :235-238; Mangan, P.R., et al., Transforming Growth Factor-beta Induces Development of the T(H)17 Lineage, Nature, 2006, 441 :231-234; Veldhoen, M., et al., Signals Mediated by Transforming Growth Factor-beta Initiate Autoimmune Encephalomyelitis, but Chronic Inflammation is Needed to Sustain Disease, Nat Immunol, 2006, 7:1151-1156. Thl7 cell development is dependent on STAT3, which functions to upregulate the expression of two Thl7-specific orphan nuclear receptors RORγt and RORα and ultimately determines ThI 7 terminal differentiation. Laurence, A., et al., Interleukin- 2 Signaling Via STAT5 Constrains T Helper 17 Cell Generation, Immunity, 2007, 26:371-381 ; Yang, X.O., et al., STAT3 Regulates Cytokine-mediated Generation of Inflammatory Helper T Cells, J Biol Chem, 2007, 282:9358-9363; Ivanov, II, et al., The Orphan Nuclear Receptor RORgammat Directs the Differentiation Program of Proinflammatory IL-17+ T Helper Cells, Cell, 2006, 126:1121-1133.

[0026] Although activated T cells may transiently express CXCR5, the T_fh cell subset demonstrates more stable expression of this chemokine receptor. These cells also regulate humoral immunity, especially germinal center reactions. Consistent with this notion, CXCR5 has been shown to be important for proper T and B cell localization in immune responses and antibody production. Haynes, N.M., et al., Role of CXCR5 and CCR7 in Follicular Th Cell Positioning and Appearance of a Programmed Cell Death Gene-lHigh Germinal Center-associated Subpopulation, J Immunol, 2007, 179:5099-5108; Junt, T., et al., CXCR5- Dependent Seeding of Follicular Niches by B and Th Cells Augments Antiviral B Cell Responses, J Immunol, 2005, 175:7109-7116. In addition to CXCR5, other markers have been also reported for T_fI1 cells, such as inducible costimulatory receptor (ICOS), IL-21 cytokine and Bcl-6 transcription factor. [0027] ICOS is essential for generation of Ta cells in vivo. Akiba, H., et al., The Role of

ICOS in the CXCR5+ Follicular B Helper T Cell Maintenance In Vivo, J Immunol, 2005, 175:2340-2348. In addition to ThI 7 cells, IL-21 is also expressed in T_f1, cells and may serve as an important regulator of humoral responses by Tn, cells. IL-21 directly regulates B cell proliferation and class-switching. IL-21 R deficiency results in defective antibody responses and impaired germinal center formation. Spolski, R., et al., Interleukin-21 : Basic Biology and Implications for Cancer and Autoimmunity, Annu Rev Immunol, 2008, 26. On the other hand, sanroque mice, which have a mutation in a RING-type E3 ubiquitin ligase, Roquin, developed spontaneous autoantibody production and lupus-like autoimmunity, associated with greatly increased numbers of CXCR5⁺ CD4⁺ T cells and enhanced expression of IL-21 and ICOS. Vinuesa, C. G., et al., A RING-type Ubiquitin Ligase Family Member Required to Repress Follicular Helper T Cells and Autoimmunity, Nature, 2005, 435:452-458.

[0028] T_f1, cells have a divergent gene expression profile from ThI, Th2 and ThI 7 cells, and develop in vivo independent of these lineages. IL-21, IL-6 and STAT3 are critical in the generation of T_f1, cells. Moreover, T cells activated in vitro in the presence of IL-21 but without TGFβ signaling preferentially acquired T_f1, gene expression and functioned to promote humoral immunity in vivo. Thus, as shown herein, our data indicate that T_f1, cells represent a distinct Th lineage and suggest a reciprocal relationship between the Ta and ThI 7 lineages.

[0029] Ta cells are strongly implicated in humoral immunity, including antibody production and antibody-mediated autoimmunity, and germinal center reactions. As shown in the figures, T_f1, cells are distinct from ThI, Th2 or Th 17 cells in their gene expression and developmental regulation. Generation of T_fh cells requires IL-21, IL-6 and STAT3. Thus, IL- 21, IL-6 and STAT3, their signaling, expression and activity are targets in modulating Tf₁, cell- mediated immune response. Methods of treating disease, therefore, include administering an agent that modulates IL-6, IL-21, and/or STAT3 signaling, expression or activity in an amount effective to modulate the differentiation of T_f1, cells. Useful agents may modulate the production, growth or activity of Tn, cells. The agent may also modulate the expression of genes expressed by T_fh cells and/or be used in combination with other agents.

[0030] Inducible costimulator (ICOS)-Inducible costimulator ligand (ICOSL) interaction regulates humoral immunity and germinal center reactions. Dong, C, et al., Regulation of Immune and Autoimmune Responses by ICOS, J Autoimmun, 2003, 21 :255-260. This costimulatory pathway is also important in generation OfT_f1, cells in mouse. Akiba, H., et al., The Role of ICOS in the CXCR5+ Follicular B Helper T Cell Maintenance In Vivo, J Immunol, 2005, 175:2340-2348. ICOS deficiency in human patients causes a severe reduction of T_fh cells. Bossaller, L., et al., ICOS Deficiency is Associated With a Severe Reduction of CXCR5+CD4 Germinal Center Th Cells, J Immunol, 2006, 177:4927-4932. Conversely, impaired negative regulation of ICOS by Roquin E3 ubiquitin ligase leads to increased numbers of CXCR5⁺ T_f1, cells and IL-21 hyperproduction. Vinuesa, C.G., et al., A RING-type Ubiquitin Ligase Family Member Required to Repress Follicular Helper T Cells and Autoimmunity, Nature, 2005a, 435:452-458; Yu, D., et al., Roquin Represses Autoimmunity by Limiting Inducible T-cell Co-stimulator Messenger RNA, Nature, 2007, 450:299-303.

[0031] The mechanism by which ICOS and ICOSL regulates T_fh cell development has been studied by the inventors. ICOS-B7h interaction is necessary for IL-21 expression by T cells. ICOS regulates Tn, cells through production of IL-21. IL-21 regulation by calcium signaling and NFAT factors has been shown. Kim, H.P., et al., Calcium-dependent Activation of Interleukin-21 Gene Expression in T Cells, J Biol Chem, 2005, 280:25291-25297. ICOS, together with TcR and CD28 has been shown to increase the expression of NFATcI through a PI-3 kinase- Itk-calcium pathway. Nurieva, R.I., et al., A Costimulation-initiated Signaling Pathway Regulates NFATcI Transcription in T Lymphocytes, J Immunol, 2007b, 179:1096-1103; Nurieva, R.I., et al., Transcriptional Regulation of Th2 Differentiation by Inducible Costimulator, Immunity, 2003a, 18:801-811. ICOS can act through NFATcI to regulate IL-21 expression. Since IL-21 regulates ThI 7 differentiation, an IL-21 defect can account for the impairment in IL- 17 expression in the ICOS-deficient animals. Dong, C, et al., Regulation of Immune and Autoimmune Responses by ICOS, J Autoimmun, 2003, 21 :255-260. As shown, using a B cell-specific ICOSL deficient mouse, ICOSL expression on B cells is required for the generation of T_f]₁ cells and IL-21 expression. This result not only substantiates the importance of ICOS-ICOSL interaction in T_fh cell development, but also suggests an important function of B cells in vivo as APCs in the generation or maintenance of T_f1, cells. Consistent with our findings, Ebert et al previously showed that human B cells regulate T_fh cell phenotypes. Ebert, Lisa M., et al., B Cells Alter the Phenotype and Function of Follicular-homing CXCR5+ T Cells, Eur J Immunol, 2004, 34:3562-3571.

[0032] Previous gene expression analysis has revealed that human T_fh cells are distinct from ThI and Th2 cells. Chtanova, T., et al., T Follicular Helper Cells Express a Distinctive Transcriptional Profile, Reflecting Their Role as Non-Thl/Th2 Effector Cells That Provide Help for B Cells, J Immunol, 2004, 173:68-78; Kim, CH. , et al., Unique Gene Expression Program of Human Germinal Center T Helper Cells, Blood, 2004, 104:1952-1960. The data reported here also reveals that T_f1, cells do not produce ThI or Th2 cytokines. Although human T_fh cells appear to express IL-10 and CXCLl 3, a ligand for CXCR5, mouse T_f1, cells do not. Chtanova, T., et al., T Follicular Helper Cells Express a Distinctive Transcriptional Profile, Reflecting Their Role as Non-Thl/Th2 Effector Cells That Provide Help for B Cells, J Immunol, 2004, 173:68-78; Ebert, Lisa M., et al., B Cells Alter the Phenotype and Function of Follicular-homing CXCR5+ T Cells, Eur J Immunol, 2004, 34:3562-3571; Kim, C.H., et al., Unique Gene Expression Program of Human Germinal Center T Helper Cells, Blood, 2004, 104:1952-1960; Kim, C.H., et al., Subspecialization of CXCR5+ T Cells: B Helper Activity is Focused in a Germinal Center-localized Subset of CXCR5+ T Cells, J Exp Med, 2001, 193:1373-1381. The data reported here show that naϊve T cells differentiate into Ta cells in vivo, independent of IFNγ, IL- 4 and STAT6. Hence, T^ cells develop independent of ThI and Th2 lineages.

[0033] On the other hand, T^ cells share common regulators with ThI 7 cells. Both subsets express IL-21 and their development depends similarly on IL-6, IL-21 and STAT3. However, T_fh cells differ from ThI 7 cells in the following aspects. First, they are distinct in their gene expression profiles. Second, T_fh cells do not produce IL-17, IL-17F or IL-22. Additionally, T_fh cell development does not require RORα or RORγt. Thus, we conclude that T_f1, cells develop independent of the Th 17 lineage.

[0034] ThI 7 development in mouse is not only mediated by the IL-6-IL-21 axis, but also by TGFβ. As shown, IL-21 can be induced in T cells independent of TGFβ signaling. T cells activated in the presence of IL-21 but in the absence of IL-4, IFNγ and TGFβ signaling produced IL-21 but not IL-4, IFNγ, IL-17, IL-17F or IL-22. Furthermore, these cells acquired expression of CXCR5, Bcl-6, IL-6R and IL-6st, genes expressed by in vivo generated T_fh cells, suggesting that T_fh cells may be generated in vitro under the above condition. Moreover, these T_fh-Hke cells generated in vitro preferentially expressed CXCR5 in vivo and functioned to promote humoral immunity, similar to in vivo-generated T_f)₁ cells. Thus, a novel approach and methods for generating T_fh cells in vitro is provided herein.

[0035] Furthermore, TGFβ signaling, is not essential for T_f1, cells, although required for

IL- 17 expression in vivo, indicating a reciprocal relationship of T_f1, and Th 17 cells. Interestingly, Bcl-6 has recently been shown as a repressor of TGFβ-SMAD signaling. Wang, D., et al., BCL6 Represses Smad Signaling in Transforming Growth Factor-B Resistance, Cancer Research, 2008. The lack of TGFβ signaling favors T_fi, cell development. T_fh cell development is independent of ThI, Th2 and Thl7 cells, and IL-21 serves as critical factor for generation of this lineage. Our in vitro generated T_f1, cells also enhanced the T_f11 cell generation in recipient mice, suggesting that IL-21 may function in a paracrine fashion to regulate T_fh cell development.

[0036] In summary, an extensive characterization of the developmental regulation of Ta cells and useful applications of this information are disclosed herein. The data shows that T_fh cells are distinct in their gene expression and immune function and develop via a pathway that is dependent on IL-21 or IL-6 but independent of ThI, Th2 or ThI 7 lineages (Figure 14). In mice defective in T_fh cells, there were still detectable amounts of antigen-specific antibodies, suggesting that other Th subsets may independently regulate the humoral immunity. This knowledge may be applied to treat disease, e.g., antibody-mediated autoimmune diseases or other diseases associated with T_f1, cell-mediated immune response.

[0037] As a result, T_f1, cell function and/or generation may be modulated by use of an agent such as an antagonist of one or more of IL-6, IL-21, and STAT3, and/or an agonist of one or more of IL-6, IL-21, and STAT3. Use of such an agent in an amount effective to inhibit or induce the differentiation of Ta cells, and/or to modulate the expression of genes expressed by Ta cells, can affect T_f1, cell-mediated immune response. For example, antibody-mediated autoimmune diseases may be treated by administration of a antagonist of one or more of IL-6, IL-21, and STAT3 in an amount effective to inhibit the differentiation of T_f1, cells and/or modulate gene expression by T_f1, cells. On the other hand, an agonist of one or more of IL-6, IL- 21, and STAT3 may be used to increase antibody production against infections and cancers by administering the agonist in an amount effective to induce the differentiation of T_f1, cells and/or modulate the gene expression by T_f1, cells.

[0038] Differentiation Of T_f1, cells can be modulated via one or more of the IL-6, IL-21, and STAT3 signaling pathways. Antagonists that may interrupt these pathways may be small molecule inhibitors, antibodies and the like. IL-6, IL-21, and/or STAT3 antagonists which are suitable agents to modulate T_fh cell mediated immune response include molecules that bind to any of these signalling factors and/or their corresponding receptors. Examples of antagonists that may be suitable include soluble receptor antagonists and antibodies that prevent binding of IL-6, IL-21, and/or STAT3 to its receptor. For example, inhibition of the activity of any of IL-6, IL-21, and STAT3 may be accomplished by binding the corresponding receptor with a therapeutically effective amount of a receptor antagonist such as a blocking antibody. Functions of T_fh cells which may be reduced by interrupting a IL-6, IL-21 , and STAT3 signaling pathway include, for example, expansion of Tn, cells and production of factors produced by T_f11 cells. [0039] Methods of modulating Ta cell mediated immune response through inhibition of

IL-6, IL-21, and/or STAT3 may be useful for the treatment of disorders or a wide variety of conditions where decreased Ta cell mediated immune response is useful. Disorders or conditions advantageously treated by these methods include autoimmune diseases, which involve Ta cell-mediated immune response. Examples of disorders or conditions which may be treated by decreasing Ta cell-mediated immune response include, antibody-mediated auto immune diseases such as lupus.

[0040] Further disclosed herein are methods of treating infection or cancer by inducing

Ta cell -mediated immune response through induction of IL-6, IL-21, and/or STAT3 activity and/or expression. These methods include administering a therapeutically effective amount of IL-6, IL-21, and/or STAT3 or an agonist for IL-6, IL-21, and/or STAT3 to an individual in need thereof. Here, the IL-6, IL-21, and/or STAT3, or agonist thereof, increases the generation, differentiation and function of T^ cells in the individual, thereby increasing T^ cell-mediated response to infection or, in some cases, tumors. Examples of the types of infections or tumors that may benefit from increased Ta, cell mediated immune response include immunity against excellular bacteria, fungus, viruses, and tumors including melanoma. IL-6, IL-21, and/or STAT3 agonists or similar include mimicry fragments, small molecules, and molecules and proteins of similar function.

[0041] The phrase "therapeutically effective" is intended to qualify the amount of active ingredients used in the treatment of a disease or disorder. This amount will achieve the goal of reducing or eliminating the said disease or disorder.

[0042] As used herein, reference to "treatment" of a patient is intended to include prophylaxis. The term "patient" means all mammals including humans. Examples of patients include humans, cows, dogs, cats, goats, sheep, pigs, and rabbits. Preferably, the patient is a human.

[0043] While it may be possible for the molecules which inhibit or induce IL-6, IL-21, and/or STAT3 activity to be administered as the raw chemical, it is also possible to present them as a pharmaceutical formulation. Accordingly, the pharmaceutical formulation may include the molecule or a pharmaceutically acceptable salt, ester, prodrug or solvate thereof, where appropriate, together with one or more pharmaceutically acceptable carriers thereof and optionally one or more other therapeutic ingredients. The carrier(s) must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof. Proper formulation is dependent upon the route of administration chosen. Any of the well-known techniques, carriers, and excipients may be used as suitable and as understood in the art; e.g., in Remington's Pharmaceutical Sciences.

[0044] The formulations of use molecules include those suitable for oral, parenteral

(including subcutaneous, intradermal, intramuscular, intravenous, intraarticular, and intramedullary), intraperitoneal, transmucosal, transdermal, rectal and topical (including dermal, buccal, sublingual and intraocular) administration although the most suitable route may depend upon for example the condition and disorder of the recipient. The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods may include the step of bringing into association the molecule or a pharmaceutically acceptable salt, ester, prodrug or solvate thereof ("active ingredient") with the carrier which constitutes one or more accessory ingredients.

[0045] In certain instances, it may be appropriate to administer at least one molecule (or a pharmaceutically acceptable salt, ester, or prodrug thereof) in combination with another therapeutic agent. By way of example only, if one of the side effects experienced by a patient upon receiving one molecule is hypertension, then it may be appropriate to administer an antihypertensive agent in combination with the initial therapeutic agent. Or, by way of example only, the therapeutic effectiveness of one molecule may be enhanced by administration of an adjuvant (i.e., by itself the adjuvant may only have minimal therapeutic benefit, but in combination with another therapeutic agent, the overall therapeutic benefit to the patient is enhanced). Or, by way of example only, the benefit of experienced by a patient may be increased by administering one molecule as described herein with another therapeutic agent (which also includes a therapeutic regimen) that also has therapeutic benefit.

[0046] Multiple therapeutic agents may be administered in any order or even simultaneously. If simultaneously, the multiple therapeutic agents may be provided in a single, unified form, or in multiple forms (by way of example only, either as a single pill or as two separate pills). One of the therapeutic agents may be given in multiple doses, or both may be given as multiple doses. If not simultaneous, the timing between the multiple doses may be any duration of time ranging from a few minutes to four weeks.

[0047] Thus, a subset of T cells, termed T follicular helper cells ("T_FH", "Tfh", T_f]₁", and the like), provides a helper function to B cells and contributes to pathogenesis of certain antibody-mediated autoimmune diseases and immunodeficiencies. CXCR5+ TFH cells are important in humoral immunity. The targeting of factors regulating TFH generation and function is a novel method of treating disease. It is shown that TFH cells have a distinct gene expression profile from other effector T cells and develop in vivo independent of the THl or TH2 lineages. T_FH cell generation is regulated by B7h expressed on B cells and, similar to TH 17 cell development, is dependent on IL-21, IL-6 and STAT3. However, differentiation of TFH cells, unlike THl 7 cells, does not require TGFβ signaling or TH17-specific orphan nuclear receptors RORα and RORγ in vivo. Further, naϊve T cells activated in vitro in the presence of IL-21 but not TGFβ signaling preferentially acquire TFH gene expression and function to promote germinal center reactions in vivo. TFH is thus demonstrated as a distinct lineage of effector TH differentiation, and IL-6, IL-21, and STAT3 are shown to be important regulators of these cells. Antagonists of these factors can be used in the treatment of autoimmune diseases, while agonists of these factors can be used to promote generation and expansion of TFH cells, which can help antibody production against infections and cancers.

METHODS

[0048] Mice. IL-4-, IFNγ- and IL-6-defϊcient mice on C57BL/6 background and STAT6 and STAT4-deficient mice on BALB/c background were purchased from Jackson Laboratories and C57BL/6, B6.SJL (CD45.1) and BALB/c mice were used as controls. Rord^t/st, Rord^l/sl Rorγ'^~ and wild-type bone marrow chimeras were generated as described by Yang et al. Yang, X.O., et al., T Helper 17 Lineage Differentiation is Programmed by Orphan Nuclear Receptors RORfalphaJ and RORfgammaJ, Immunity, 2008b, 28:29-39. Stat3 fl/fl mice were bred with CD4-Cre mice provided by Dr. Christopher Wilson. Takeda, K., et al., Enhanced ThI Activity and Development of Chronic Enterocolitis in Mice Devoid of Stat3 in Macrophages and Neutrophils, Immunity, 1999, 10:39-49; Lee, P.P., et al., A Critical Role for Dnmtl and DNA Methylation in T Cell Development, Function, and Survival, Immunity, 2001, 15:763-774. IL-21 deficient mice on 129xC57BL/6 Fl mixed background were obtained from NIH Mutant Mouse Regional Resource Centers (MMRRC). Nurieva, R., et al., Essential Autocrine Regulation by IL-21 in the Generation of Inflammatory T Cells, Nature, 2007, 448:480-483. ICOSL-BKO mice were created by breeding ICOSL flox mice with CD19-cre mice. Nurieva, R.I., et al., B7h is Required for T Cell Activation, Differentiation, and Effector Function, Proc Natl Acad Sci U S A, 2003, 100:14163-14168; Rickert, R.C., et al., Impairment of T-cell-dependent B-cell Responses and B-I Cell Development in CD 19 -deficient Mice, Nature, 1995, 376:352-355. IL- 17- and IL-17F- deficient mice were recently generated in the lab. Yang, X., et al., Regulation of Inflammatory Responses by 1L-17F, J Exp Med In press, 2008. Mice were housed in the SPF animal facility at M. D. Anderson Cancer Center and the animal experiments were performed at the age of 6-10 weeks using protocols approved by Institutional Animal Care and Use Committee.

[0049] T cell differentiation. Differentiation of OT-II cells as represented in Figures

IA-B was performed as previously described. Chung, Y., et al., Expression and Regulation of IL-22 in the IL- 17 -Producing CD4+ T Lymphocytes, Cell Res, 2006, 16:902-907. In Figure 7A, the cytokine stimuli for Thl7 differentiation were 100 ng/ml of IL-21, 5 ng/ml of TGFβ, and 10 μg/ml of anti-IL-4 and 10 μg/ml of anti-IFNγ, and for generation of T_fh cells were 50 ng/ml of IL-21, 10 μg/ml anti-IFNγ, 10 μg/ml anti-IL-4 and 20 μg/ml TGF-β (lDl l) neutralizing antibodies. IL-4, IL-6, IL- 12 and TGFβ were purchased from Peprotech. IL-21, IL-23 and TGF- β (IDl 1) neutralizing antibodies were purchased from R&D. To characterize the in vitro- differentiated CD4⁺ T cells under these conditions, these cells were restimulated with plate- bound anti-CD3 (5 μg/ml) for 4 hours for real-time PCR analysis, or for 24 hours for cytokine measurement by ELISA.

[0050] Keyhole Limpet Hemocyanin (KLH) Immunization. Various strains of mice

(6-8 wk old; three per group) were immunized with KLH (0.5 mg/ml) emulsified in CFA (0.5 mg/ml) at the base of the tail (100 μl each mouse). In Figure 6 for local blockade of TGF-β, 100 μg anti-TGFβ (IDl 1) was included in the emulsion; the control group received 100 μg isotype control antibodies. Seven days after immunization, these mice were sacrificed and analyzed individually. The germinal center B cells were determined by staining with FITC-labeled PNA (Pharmingen) and PerCP-labeled anti-B220 mAb (Pharmingen). The T_f1, cell induction was determined by staining with PerCP-labeled anti-CD4 mAb (Pharmingen) and biotinylated anti- CXCR5 mAb (Pharmingen), followed by APC-labeled streptavidin (Jackson ImmunoResearch Laboratories, Inc.). In some experiments, sera from immunized mice were collected, and antigen- specific IgM, and IgG antibodies were measured by using ELISA. Briefly, serum samples were added in a 3 -fold serial dilution onto plates precoated with 10 μg/ml KLH or Ova protein. Antigen-specific antibodies were detected with biotinylated goat antimouse IgM or rat anti- mouse IgG antibodies (Southern Biotechnology Associates). To analyze the role of B7h in regulation of T cell responses in vivo (Fig. 3A and C), spleen cells from KLH-immunized mice were stimulated in 96-well plates as triplicates with or without KLH. Effector cytokines (IFN-γ and IL-21) were analyzed 4 days later by ELISA (Pharmingen). In Figure 6 B, spleen cells from immunized mice were restimulated with 50 μg KLH for 24 h. In the final 5 hours, Golgi-stop (BD Bioscience) was added and IL-17- and IFNγ-producing cells were analyzed using a BD CytoFix/CytoPerm intracellular staining kit (BD Bioscience). [0051] Statistical analysis of microarray data. The DNA microarray analysis was carried out at the Institute for Systems Biology microarray core facility using Affymetrix Mouse 430 2.0 chips. The total RNA samples were labeled according to manufacturer's instruction using One-Cycle Target Labeling method, which consists of oligo-dT primed cDNA synthesis followed by in vitro transcription that incorporates biotinylated nucleotides. The microarray data were normalized using GCRMA. Zhijin, W., et al., A Model-based Background Adjustment for Oligonucleotide Expression Arrays, Journal of the American Statistical Association, 2004, 99:909-917. We then selected the genes whose expression was changed across the ThI, Th2, ThI 7, and T_f1, cells using a False Discovery Rate (FDR) estimation method: 1) one-way ANOVA was performed to compute unadjusted p-value for the four classes of cells; 2) the number of non- differentially expressed probe-sets (m₀) was estimated as 2 x the number of the probe-sets with p-value>0.5 (mθ= 25088); 3) the expected number of false positives under the complement null hypothesis E(Vo) was estimated for a given ANOVA F-statistic value by performing 500 times of resampling; and 4) FDR was finally estimated as m_o/m x E(V₀)/R where m is the total number of the probe-sets (m=45037) and R is the number of the genes being selected using the given ANOVA F-statistic value (FDR estimated for various F-statistic value is shown in Figure 9B). Storey, J.D., et al., Estimating the Positive False Discovery Rate Under Dependence, With Applications to DNA Microarrays, (Department of Statistics, Stanford University), 2001, VoI 2001. Then, the expression of 8350 probe-sets showing differential expressions among the four types of cells (FDR = 0.1, corresponding to an unadjusted p-value = 0.033 from one-way ANOVA) was used for hierarchical clustering (Euclidian distance metric and Ward Minimum Variance Linkage) and PCA. The microarray data have been deposited into NCBI GEO with accession GSEl 1924.

[0052] Adoptive transfer study. CD4⁺ T cells from OT-II mice (CD45.2) were intravenously transferred into C57BL/6 (CD45.1⁺) mice (3x10⁶ cells/mouse) (3 groups; 3 mice per group). 2 groups of recipient mice were immunized subcutaneously with 100 μg Ova protein emulsified in CFA and treated with a 300 μg of control rat Ig or anti-IFNγ and anti-IL-4 mAbs at the time of immunization (day 0) and on days 2 and 4. Seven days after the immunization, experimental mice were sacrificed and splenic CD45.1+ and CD45.2+ CD4 cells were stained with biotinylated anti-CXCR5 mAb, followed by APC-labeled streptavidin. In Figure 7C-E, FACS-sorted naϊve (CD4⁺CD62L^hiCD44^~CD25^~) T cells from CD45.1+ OT-II mice were activated under THO or Tn₁ condition, washed and intravenously transferred into C57BL/6 (CD45.2⁺) mice (4x10⁶ cells/mouse) and the recipient mice were subcutaneously immunized with 100 μg OVA protein emulsified in IFA. A group of C57BL/6 mice that did not receive T cells was used as a control (No transfer). In Fig. 7G, CXCR5⁺CD44^hl cells were sorted from B6.SJL (CD45.1) mice immunized with KLH. These cells were transferred into C57BL/6 (CD45.2⁺) mice (5x10⁶ cells/mouse) (3 mice per group). Second group did not receive cells. All mice were immunized subcutaneously with 1000 μg KLH. Seven days after immunzation, lymphoid cells from the draining lymph nodes of the recipient mice were isolated and stained with FITC-labeled anti-CD45.1 mAb and PerCP-labeled anti-CD4 mAb plus biotinylated anti- CXCR5, followed by APC-labeled streptavidin, or stained with FITC-labeled PNA and PerCP- labeled anti-B220.

[0053] Quantitative real-time PCR. Total RNA was prepared from T cells using TriZol regent (Invitrogen). cDNA were synthesized using Superscript reverse transcriptase and oligo(dT) primers (Invitrogen) and gene expression was examined with a Bio-Rad iCycler Optical System using iQ™ SYBR green real-time PCR kit (Bio-Rad Laboratories, Inc.). The data were normalized to β-actin reference. The following primer pair for Bcl-6, IL-6R, IL-6st, and CXCR5 were used: Bcl6 forward: CACACCCGTCCATCATTGAA, reverse: TGTCCTCACGGTGCCTTTTT; IL6R forward: GGTGGCCCAGTACCAATGC, reverse: GGACCTGGACCACGTGCT; CXCR5 forward: ACTCCTTACCACAGTGC ACCTT, reverse: GGAAACGGGAGGTGAACCA; IL-6st forward: ATT TGT GTG CTG AAG GAG GC, reverse: AAA GGA CAG GAT GTT GCA GG. The primers for IL-21, IL-17, IL- 17F, IL-4, IFNγ, RORγ, RORα, T-bet, GATA3, and β-actin were previously described. Yang, X.O., et al., STAT3 Regulates Cytokine-mediated Generation of Inflammatory Helper T Cells, J Biol Chem, 2007, 282:9358-9363.

[0054] Immunohistochemical analysis. Fresh mouse spleen tissues were embedded in

OCT and frozen with isopentane in Histobath. Tissue blocks were sliced 6 μm with cryotome. Slides were fixed with acetone cold. Purified anti-mouse CD4 or biotin labeled anti-mouse PNA were applied as primary antibody ("Ab") following with biotinylated anti-rat secondary antibody and avidin-peroxidase complex reagent. Novared was used as substrate. For double staining, biotin-labeled B220 was applied and following with avidin-aklinphosphotase complex reagent. Vector blue was used as substrate. CD4 and B220 are from BD Pharmagen. PNA and other reagents were from Vector Laboratary. Slides for PNA staining were count stained with Hematoxlin. EXAMPLE 1 Distinct Gene Expression Profile of T_fh Cells

[0055] As a first step toward understanding Tβ, cell regulation, we compared the gene expression profiles of ThI, Th2 and ThI 7 cells differentiated in vitro with in- vivo generated T_fh cells. Taking advantage of the co-expression of B and T lymphocyte attenuator (BTLA) by CXCR5⁺ Ta cells (Figure 8), CD4⁺CD44^hiCXCR5⁺BTLA⁺ were FACS sorted from splenocytes of C57BL/6 mice seven days after immunization with keyhole limpet hemocyanin (KLH). These cells as well as ThI, Th2 and ThI 7 cells were restimulated with anti-CD3 for 4 hours and subject to gene profiling analysis in duplicates using Affimetrix gene chips. The microarray data were normalized using GCRMA and the genes whose expression was changed across the ThI, Th2, Th 17 and T_fh cells were then selected using a False Discovery Rate (FDR) estimation method. Then, the expression levels of 8350 probe-sets showing differential expressions among the four types of cells were used for hierarchical clustering, which revealed that T_fh cells have a very distinct gene expression profile (Figure IA, Figure 9A).

[0056] To confirm the above results, we performed real-time RT-PCR analysis on multiple subset-specific genes. The data indicate that T_f1, cells did not express the typical markers for ThI (IFNγ and T-bet) or Th2 (IL-4 and GATA3) cells (Figure IB), consistent with a previous report on human T_f]₁ cells. Chtanova, T., et al., T Follicular Helper Cells Express a Distinctive Transcriptional Profile, Reflecting Their Role as Non-Thl/Th2 Effector Cells That Provide Help or B Cells, J Immunol, 2004, 173:68-78. Although T_f11 cells shared IL-21 expression with ThI 7 cells, they did not express IL-17, IL-17F, IL-22 or RORγt (Figure IB). Instead, similar to their human counterparts, mouse Ta cells express mRNAs for CXCR5 as well as Bcl-6 (Figure IB). Chtanova, T., et al., T Follicular Helper Cells Express a Distinctive Transcriptional Profile, Reflecting Their Role as Non-Thl/Th2 Effector Cells That Provide Help for B Cells, J Immunol, 2004, 173:68-78; Kim, CH. , et al., Unique Gene Expression Program of Human Germinal Center T Helper Cells, Blood, 2004, 104:1952-1960. In addition, T_f11 cells preferentially expressed mRNAs for IL-6R and IL-6st (gpl30) and also upregulated the expression of IL-21R (Figure IB), suggesting possible regulation Of T_f11 cells by IL-6 and IL-21. Moreover, consistent with human T_f11 cells and a report by Haynes et al. indicating that T_f11 cells express programmed death- 1 (PD-I) protein, PD-I mRNA was highly upregulated in T_f11 cells compared to other Th subsets (data not shown). Chtanova, T., et al., T Follicular Helper Cells Express a Distinctive Transcriptional Profile, Reflecting Their Role as Non-Thl/Th2 Effector Cells That Provide Helpor B Cells, J Immunol, 2004, 173:68-78; Haynes, N.M., et al., Role of CXCR5 and CCRl in Follicular Th Cell Positioning and Appearance of a Programmed Cell Death Gene-lHigh Germinal Center-associated Subpopulation, J Immunol, 2007, 179:5099-5108.

[0057] To substantiate the above results, we also measured cytokine secretion of purified

Ta cells after they were activated ex vivo with anti-CD3 and anti-CD28 for 24 hours. High expressions of IL-21 but not IL-4, IL-10, IFNγ or IL- 17 were observed in T_fh cells (Figure 1C). In addition, purified Ta cells were activated with KLH and irradiated splenic APC. Consistent with above results, Ta cells preferentially produced IL-21, but not ThI, Th2 and Th 17 cytokines (Figure 10). Furthermore, intracellular analysis on CXCR5⁺ and CXCR5^" cells following PMA and ionomycin restimulation also revealed that T_fh cells did not express IFNγ or IL- 17 (Figure ID). These results indicate that T_f1, cells are distinct from ThI, Th2 and ThI 7 cells in their gene expression and cytokine production.

EXAMPLE 2 Naϊve T cell differentiation into Ta cells is independent of ThI and Th2 lineages

[0058] Previous and our current gene expression analysis on human and mouse T_fh cells, respectively, suggested that they are distinct from ThI and Th2 cells. Chtanova, T., et al., T Follicular Helper Cells Express a Distinctive Transcriptional Profile, Reflecting Their Role as Non-Thl/Th2 Effector Cells That Provide Help for B Cells, J Immunol, 2004, 173:68-78. To determine whether generation of Ta cells is distinct from ThI or Th2 differentiation, we transferred FACS sorted naϊve CD4⁺ T cells (CXCR5 ) from OT-II TcR transgenic mice (CD45.2⁺, Figure 2A) into C57BL/6 recipients (CD45.1⁺) followed by immunization with Ova protein in CFA. Seven days later, we examined splenic CD45.1⁺ and CD45.2⁺ CD4⁺ T cells, and found a substantial increase in the frequency of CXCR5⁺CD4⁺ T cells (Figure 2A). Treatment of recipient mice with antibodies to IL-4 and IFNγ did not reduce the proportion of CXCR5⁺CD4⁺ T cells (Figure 2A), suggesting that T_f1, cell development is independent of ThI or Th2 development. In addition, donor CD44^hiCXCR5⁺ and CD44^hiCXCR5^" OT-II cells from immunized mice were purified and real-time RT-PCR analysis of T_f11 specific genes was performed. CXCR5⁺ T cells were generated in the presence of blocking antibodies to IL-4 and IFNγ exhibited gene expression patterns comparable to those from control group (Figure 2A), supporting that these CXCR5⁺ cells were indeed T_f1, cells.

[0059] To substantiate the above finding, we also immunized mice deficient in IL-4,

IFNγ, STAT6 or STAT4 and their appropriate controls with KLH. Seven days after immunization, we did not detect any defect in T_fh cells or PNA⁺ germinal center B cells in the IL-4, IFNγ, STAT6 or STAT4 deficient animals compared to wild-type controls (Figure 2B-D, Figures 1 IA-11C). To confirm the above results, we also measured cytokine secretion of purified CXCR5⁺ cells from IL-4- and IFNγ-deficient mice and their controls after they were activated ex vivo with anti-CD3 and anti-CD28 for 24 hours. Ta cells from IL-4- or IFNγ-deficient mice produced similar amount of IL-21, but did not express IL-4, IL-10, IFNγ or IL-17 (Supplementary Figure 4D), supporting that they were Ta cells. Thus, we conclude that CXCR5⁺CD4⁺ Ta cells develop independent of the ThI and Th2 lineages.

EXAMPLE 3 ICOSL expressed on B cells regulates the generation of T_fh cells

[0060] Inducible costimulator (ICOS) is the third member of the CD28 family with an important role in regulation of T-dependent antibody responses and germinal center reactions. Dong, C, et al., Regulation of Immune and Autoimmune Responses by ICOS, J Autoimmun, 2003, 21 :255-260. ICOS was previously shown to be expressed at high levels on human tonsillular CXCR5+ T cells within the light zone of germinal centers and efficiently supported the immunoglobulin production. Breitfeld, D., et al., Follicular B Helper T Cells Express CXC Chemokine Receptor 5, Localize to B Cell Follicles, and Support Immunoglobulin Production, J Exp Med, 2000, 192:1545-1552; Schaerli, P., et al., CXC Chemokine Receptor 5 Expression Defines Follicular Homing T Cells With B Cell Helper Function, J Exp Med, 2000, 192:1553-1562. In addition, ICOS deficiency in human and mouse resulted in substantially reduced numbers of Ta cells, indicating an essential role of ICOS in the differentiation of CXCR5⁺ CD4 T cells. Akiba, H., et al., The Role of ICOS in the CXCR5+ Follicular B Helper T Cell Maintenance In Vivo, J Immunol, 2005, 175:2340-2348; Bossaller, L., et al., ICOS Deficiency is Associated With a Severe Reduction of CXCR5+CD4 Germinal Center Th Cells, J Immunol, 2006, 177:4927-4932. Consistently, we also observed reduced percentages of CXCR5⁺CD4⁺ cells and decreased expression of IL-21 but not IFNγ in our ICOSL germline deficient animals following KLH immunization (Figure 3A). Nurieva, R.I., et al., B7h is Required for T Cell Activation, Differentiation, and Effector Function, Proc Natl Acad Sci U S A, 2003, 100:14163-14168. T_fh cells are regarded as regulators of the germinal center reaction by providing help to activated B cells that also express CXCR5. Because B cells constitutively express ICOSL, we asked whether the generation of Ta cells may require B cell help via engagement of ICOS receptor on T cells. We thus bred mice carrying the ICOSL conditional flox (f) allele with CD19-cre mice. Nurieva, R. I., et al., B7h is Required for T Cell Activation, Differentiation, and Effector Function, Proc Natl Acad Sci U S A, 2003, 100:14163-14168; Rickert, R. C, et al., Impairment of T-cell-dependent B-cell Responses and B-I Cell Development in CD19-deficient Mice, Nature, 1995, 376:352-355. In ICOSL f/f mice carrying the CD19-cre (ICOSL-BKO), in comparison to those without ere expression, there was efficient deletion of the ICOSL gene in B cells, similar to those in ICOSL germline deficient mice (Figure 3B). We then immunized ICOSL BKO mice with KLH and found that absence of ICOSL in B cells led to a greatly reduced frequency of CXCR5⁺CD4⁺ cells (Figure 3C). Similarly, when CD45.1⁺ OT-II cells were transferred into B cell specific ICOSL deficient mice, the numbers of CD45.1⁺ Tfh cells were also greatly reduced following Ova peptide immunization (data not shown). In addition to CXCR5 expression, we found that the expression of IL-21 was also greatly reduced in ICOSL BKO mice, whereas IFNγ expression was elevated in these mice (Figure 3C). Moreover, PNA⁺ germinal center B cells were greatly reduced in these animals (Figure 3 C and E). KLH-specific IgG production was also reduced (Figure 3D). Overall, these data indicate that B cell expression of ICOSL is necessary for IL-21 production and for the generation of T_fh cells and appropriate antibody responses, indicating that T_f11 cell differentiation is regulated by B cells.

EXAMPLE 4 IL-21 and IL-6 are required for generation of T_fh cells, which is dependent on STAT3

[0061] IL-21 has been recently shown to be induced by IL-6 and to autoregulate its own expression during ThI 7 differentiation. Nurieva, R., et al., Essential Autocrine Regulation by IL-21 in the Generation of Inflammatory T Cells, Nature, 2007, 448:480-483. In addition, TQ₁ T cells produced a greater amount of IL-21 compared to ThI and Th2 subsets, and induced the differentiation of autologous B cells into Ig-secreted plasma cells through IL-21. Chtanova, T., et al. , T Follicular Helper Cells Express a Distinctive Transcriptional Profile, Reflecting Their Role as Non-Thl/Th2 Effector Cells That Provide Help for B Cells, J Immunol, 2004, 173:68-78; Bryant, V.L., et al., Cytokine-mediated Regulation of Human B Cell Differentiation Into Ig-secreting Cells: Predominant Role of IL-21 Produced by CXCR5+ T Follicular Helper Cells, J Immunol, 2007, 179:8180-8190. Becouse IL-21 is also expressed in Ta cells, we assessed if IL-21 is important for T_f1, cell generation. I121^+/+' ^+/~ and ^~'^~ mice were immunized with KLH and splenic T_f11 cells were analyzed in these mice. Il21^+/~ mice exhibited reduced number of T_fh cells, which was further reduced in I121^'1' mice (Figure 4A). In addition, PNA⁺ germinal center B cells were also greatly reduced in 1121^~'^~ mice (Figure 4B-C). In contrast, CD4 T cells from 112 f'^~ and ^~'^~ mice showed normal proliferation and IFNγ expression after re-stimulation with KLH ex vivo. (Figure 5D). Thus, these results indicate that IL-21 is necessary for T_f11 cell development.

[0062] Because IL-6 induces IL-21 expression, we also tested Tn₁ cell generation in mice lacking IL-6. It has been previously that IL-6 deficient mice showed reduced germinal centers and antigen specific Ig-production (IgG). Kopf, M., et al., Interleukin 6 Influences Germinal Center Development and Antibody Production Via a Contribution of C3 Complement Component, J Exp Med, 1998, 188:1895-1906. Compared to the wild-type controls, I16^~'^~ mice exhibited greatly reduced numbers of T_f1, cells and germinal center B cells (Figure 5A), indicating that IL-6 is also necessary for T_f1, cell generation.

[0063] Because T_f]₁ cells expressed high amounts of IL-21R, IL-6R and IL-6st (Figure

IB), we also examined if IL-6 and IL-21 signaling regulates Tf₁, cells. C57BL/6 mice were immunized with KLH and CD4⁺CD44^hi T cells with or without CXCR5 expression were FACS sorted and restimulated with anti-CD3 and anti-CD28 in the absence or presence of IL-21 or IL- 6. Compared to non-T_fh cells, CXCR5⁺ T cells showed a significant reduction in proliferation when activated with anti-CD3 and anti-CD28. Treatment of CXCR5⁺ T cells with IL-6 or IL-21 significantly enhanced their proliferation (p<0.005) (Figure 5B), suggesting that IL-6 and IL-21 preferentially regulate T_f1, cells. Furthermore, we stained restimulated CXCR5⁺ and CXCR5^" cells with Annexin V. We found that a substantial portion of CXCR5⁺ cells underwent apoptosis compare to CXCR5- (Figure 5B). However, IL-6 or IL-21 treatment reduced apoptosis of Tf₁, cells.

[0064] Because both IL-6 and IL-21 signal through STAT3, we analyzed T_f1, cell generation in STAT3 flox/flox mice bred with CD4-cre mice. Takeda, K., et al., Enhanced ThI Activity and Development of Chronic Enterocolitis in Mice Devoid ofStat3 in Macrophages and Neutrophils, Immunity, 1999, 10:39-49; Lee, P.P., et al., A Critical Role for Dnmtl and DNA Methylation in T Cell Development, Function, and Survival, Immunity, 2001, 15:763-774. The deletion of STAT3 gene in CD4⁺ thymocytes was found to be complete (data not shown). When we immunized these mice as well as their controls with KLH, the numbers of CXCR5+ Tf₁, cells were found to be greatly reduced in the absence of STAT3 (Figure 5C). Moreover, STAT3 deficiency in T cells also led to defective germinal center B cell generation (Figure 5C). KLH- specific IgG and IgM production was also reduced in the absence of STAT3 in T cells (Figure 12). Overall, these data indicate that T_f1, cell generation is dependent on IL-21, IL-6 and STAT3.

EXAMPLE 5 T_fh cell generation is independent of ThI 7 differentiation or function

[0065] The above results indicate that the IL-6-IL-21 axis and STAT3 transcription factor are necessary for T_f1, cell generation, which is similar to the regulation of ThI 7 differentiation. To test whether the development of T_f1, cells is dependent or independent upon the ThI 7 lineage, we utilized Ragl^'1' mice reconstituted with bone marrow cells from wild-type, Rord^t/st or Rord^tlstRorγ'^~ mice. We previously reported that the latter mice were completely impaired in ThI 7 differentiation in vitro and in vivo. Yang, X.O., et al., T Helper 17 Lineage Differentiation is Programmed by Orphan Nuclear Receptors RORfalphaJ and RORfgammaJ, Immunity, 2008, 28:29-39. However, upon KLH immunization, these mice deficient in both RORα and RORγ in lymphocytes developed more CXCR5⁺ cells in spleen (Figure 6A), indicating that T_f1, cells can be generated in the absence of ThI 7 development. Moreover, PNA⁺ germinal center B cells were not affected in these animals (Figure 13B).

[0066] Since ThI 7 differentiation requires also TGFβ in addition to IL-6 or IL-21, we examined whether TGFβ signaling is required for T_f11 cell generation. C57BL/6 mice were immunized with KLH in the absence or presence of TGFβ blocking antibody as previously described. Veldhoen, M., et al., Signals Mediated by Transforming Growth Factor-beta Initiate Autoimmune Encephalomyelitis, but Chronic Inflammation is Needed to Sustain Disease, Nat Immunol, 2006, 7:1151-1156. While IL-17 expression was substantially decreased in anti- TGFβ-treated mice, CXCR5 expression was not (Figure 6B), indicating that TGFβ signaling is not essential for Tn, cell generation. Moreover, PNA expression on B cells was not affected either (Figure 6B).

[0067] To understand if T_f1, cell generation requires Th 17 function, we also immunized mice deficient in IL-17 or IL- 17F. Lack of IL-17 or IL- 17F did not significantly reduce the number of T_f11 cells in spleen or the number of germinal center B cells (Figure 6C, Figure 13B). IL-17 or IL- 17F is thus not essential in the generation of T_f11 cells in vivo.

EXAMPLE 6 IL-21 in the absence of TGFβ initiates T_f1, cell differentiation

[0068] Our results thus far suggest that although IL-6 and IL-21 are required for both T_fh and Th 17 differentiation, these two subsets appear to have distinct genetic program and differ in their dependency on TGFβ signaling. We next assessed whether IL-21 is sufficient to drive Tfh cell development in vitro in the absence of TGFβ signaling. Naϊve OT-II cells were activated by Ova peptide and splenic APC in the absence (neutral condition) or presence of IL-21, TGFβ and antibodies to IL-4 and IFNγ (Th 17 condition) or IL-21 plus antibodies to IL-4, IFNγ and TGFβ. 5 days later, the activated T cells were extensively washed and restimulated with anti-CD3 for 4 hours and their gene expression was assessed by real-time RT-PCR. As expected, cells cultured under Th 17 condition highly expressed TH17-specific genes, including genes encoding IL-17, IL-17F, IL-22, RORα and RORγt (Figure 7A). In contrast, T cells treated with IL-21 in the absence of TGFβ signaling upregulated genes that are specifically expressed in Tβ, cells, including those encoding CXCR5, Bcl-6, IL-6R and IL-6st (Figure 7A). They also upregualted IL-21R expression but did not express Th 17 genes (Figure 7A). The gene encoding PD-I was also highly expressed in these cells (data not shown). To confirm this result, cell supernatants were measured 24 hours after restimulation for cytokine secretion by ELISA. IL-21 in the absence of TGFβ signaling did not support IL- 17 expression, but the resulting cells expressed high levels of IL-21 (Figure 7B), supporting that IL-21 expression is independent of TGFβ signaling.

[0069] To test the function of these T_fh-like cells in vivo, we transferred OT-II cells

(CD45.1⁺) activated under neutral conditions or with IL-21 plus blocking antibodies to IFNγ, IL- 4 and TGFβ into recipient mice (CD45.2⁺) followed by immunization with Ova protein. Compared to mice receiving no cells or T cells activated under neutral condition, the recipients of IL-21 -treated cells exhibited greatly increased CD45.1^"1" T_f1, cells (Figure 7C). Interestingly, host T cells in these mice also had approximately 4 times T_fh cells compared to those receiving T cells activated under neutral condition (Figure 7C). The transferred cells also promoted Ova- specific antibody production and germinal center reactions (Figure 7D-F). As a control for the above experiment, we sorted CD45.1⁺ CXC5⁺CD44^hl cells from KLH immunized mice and transferred them into recipient mice (CD45.2⁺) followed by immunization with KLH. Similar to in vitro generated T_fh cells, in vivo generated CXCR5⁺ cells also promoted a substantial increase in PNA⁺ germinal center B cells (Figure 7G). These results indicate that IL-21, in the absence of ThI, Th2 and Th 17 differentiation, drives Ta cell development.

[0070] As shown in Figure 1, C57BL/6 mice were immunized with KLH in CFA. Seven days later CD4⁺CD44^hiCXCR5⁺ BTLA⁺ (T_n,) cells were sorted and restimulated with anti-CD3 for 4 hours for gene profiling analysis (A) and for real-time PCR analysis (B). OT-II T cells differentiated under various conditions were restimulated with anti-CD3 for 4 hours and were analyzed together with Tfh cells. (A). A distinct gene expression profile of T_fh cells from ThI, Th2, and Th 17 cells. Hierarchical clustering and PCA were applied to the expression levels of 8350 probe-sets showing differential expressions among the four types of cells (FDR = 0.1, corresponding to an unadjusted p-value = 0.033 from one-way ANOVA). (B). Real-time RT- PCR analysis of Th specific genes. (C-D). CD4⁺CD44^hiCXCR5⁺ BTLA⁺ and CD4⁺CD44^hiCXCR5^' cells were restimulated with anti-CD3 plus anti-CD28 for 48 hours for cytokine measurement by ELISA (C) and with PMA and Ionomicin for 6 hours for detection of IL-17 and IFNγ expression by intracellular cytokine staining (D). The data represent one of two independent experiments with similar results.

[0071] As shown in Figure 2, (A) CD4⁺ T cells from OT-II mice (CD45.2) were transferred into C57BL/6 (CD45.1) mice which were subsequently divided into 2 groups (3 mice per group). Mice were immunized subcutaneously with Ova protein emulsified in CFA and treated with a 300 μg of control rat Ig or anti-IFNγ and anti-IL-4 mAbs. Seven days after the immunization, experimental mice were sacrificed and splenic CD45.1⁺ and CD45.2⁺ CD4 cells were stained with biotinylated CXCR5 mAb, followed by APC-labeled streptavidin. Numbers in dot plot quadrants represent the percentages. CD44hiCXCR5⁺ and CD44MCXCR5^" cells from immunized mice were purified and real-time RT-PCR analysis of Ta specific genes were performed. (B-C). IU^''^', Ifnγ^1' (B), Stat6^~'^~ (C) and Stat4^~A (D) and their appropriate controls (WT, 3 mice per group) were immunized with KLH emulsified in CFA. Seven days after the immunization, experimental mice were sacrificed and the germinal center B cells were determined by staining with FITC-labeled PNA and PerCP-labeled B220 mAb. The T_ft cells were analyzed by staining with PerCP-labeled CD4 mAb and biotinylated CXCR5 mAb, followed by APC-labeled streptavidin. Numbers in dot plot quadrants represent the percentages. The experiments were repeated three times with consistent results.

[0072] As shown in Figure 3, (A) ICOSL germline deficient mice (JcosT') and their controls (WT, 3 mice per group) were immunized with KLH in CFA. Seven days after the immunization, experimental mice were sacrificed and spleen cells from immunized mice were stimulated in 96-well plates as triplicates with the indicated concentration of KLH. Effector cytokines (IFN -γ and IL-21) were measured after 4 days of treatment. The germinal center B cells and T_f]₁ cells were analyzed. P values were calculated with the t-test by comparing the CXCR5⁺ cells and B220⁺PNA⁺ cells between wild-type and ICOSL deficient mice and are indicated as followed: * P < 0.005; #, P < 0.001. Numbers in dot plot quadrants represent the percentages. (B). Splenic B220⁺ B cells from ICOSL germline deficient mice (Icosl^''^'), B cell specific ICOSL deficient mice (ICOSL-BKO, cre+) and the ere- controls were analyzed for ICOSL expression. (C-E). Wild-type (WT) and B cell specific ICOSL deficient mice (3 mice per group) were immunized with KLH in CFA. Seven days after the immunization, experimental mice were sacrificed and analyzed as in A . P values were calculated with the t-test by comparing the CXCR5⁺ cells and B220⁺PNA⁺ cells between wild-type and B cell specific B7h deficient mice and are indicated as followed: ** P < 0.001 ; ##, P < 0.001. (C). (D). KLH specific antibodies (IgM and IgG) were measured in the sera by ELISA. The sera from WT and B cell specific ICOSL deficient mice were subject to a 3-fold serial dilution, and the concentrations of KLH-specific IgM and IgG were analyzed by ELISA and averaged for each group. (E). GC in the spleens of KLH -immunized WT and B cell specific ICOSL deficient mice were identified by PNA staining (brown). T and B cells were identified by staining with anti-CD4 (red) and anti- B220 (blue). The data represent at least three independent experiments with consistent results.

[0073] As shown in Figure 4, I121^+/+, Il21^+/~ and 1121^'1' mice (3 mice per group) were immunized subcutaneously with KLH emulsified in CFA. Seven days after the immunization, experimental mice were sacrificed and Ta cells (A) and the germinal center B cells (B) were analyzed. Numbers in dot plot quadrants represent the percentages. Germinal centers were determined by immunohistochemical analysis (C). Spleen cells from immunized mice were stimulated in 96-well plates as triplicates with the indicated concentration of KLH peptide. Proliferation was assayed after 3 days of treatment by adding [³H]thymidine to the culture for the last 8 h. IFN-γ was measured after 4 days of treatment. The experiments were repeated twice with consistent results.

[0074] As shown in Figure 5, I16^'A (A) or T-cell specific Stat3^'A mice (C) and their appropriate controls (WT, 3 mice per group) were immunized subcutaneously with KLH emulsified in CFA. Seven days after the immunization, experimental mice were sacrificed and Ta cells and the germinal center B cells were analyzed. Numbers in dot plot quadrants represent the percentages. (B) C57BL/6 mice were immunized with KLH in CFA. Seven days later, CD4⁺CD44^hiCXCR5⁺ and CD4⁺CD44^hiCXCR5^" cells were sorted and restimulated with anti- CD3 and anti-CD28 with or without IL-6 or IL-21 for 48 hours. Proliferation was assayed by adding [³H]-thymidine to the culture for the last 8 h. P values were calculated with the t-test by comparing the CXCR5⁺ cells proliferation in the absence and in the presence of IL6 (*p<0.005) or in the absence and in the presence of IL21 (*p<0.005). CD4⁺CD44^hiCXCR5⁺ and CD4⁺CD44^hiCXCR5^" cells were restimulated with anti-CD3 and anti-CD28 for 24 hours and stained with Annexin V-FITC. The experiments were performed two times with consistent results.

[0075] As shown in Figure 6, Ragl^'1' reconstituted with WT and Rord^tl$t/Rorγ ^~'^~ bone marrow cells (A) or IUT'^' and Ill7f ^~ mice and their controls (C) (3 mice per group) were immunized subcutaneously with KLH in CFA. Seven days after the immunization, experimental mice were sacrificed and the Tn₁ cells were determined. Numbers in dot plot quadrants represent the percentages. (B). C57BL/6 mice were immunized with KLH emulsified in CFA with 100 μg of isotype control antibodies or TGFβ blocking antibodies (3 mice per group). Seven days later, experimental mice were sacrificed and splenic Ta cells and germinal center B cells were analyzed. Splenocytes were restimulated with KLH for overnight and the production of IL- 17 and IFNγ was analyzed in CD4⁺ gate by intracellular cytokine staining. The results represent one of three individuals with similar results.

[0076] As shown in Figure 7, A-F, FACS-sorted CD62^hiCD44^IoCD25^negCD4⁺ T cells from CD45.1⁺ OT-II mice were cultured with irradiated splenic APC plus OVA_323-339 peptide under ThO, T_fh (IL-21 plus antibodies to IL-4, IFNγ and TGFβ) or TH 17 condition for 5 days. After 5 days, CD4⁺ T cells were restimulated with anti-CD3 for 4 hours for real-time PCR analysis (A) or for 24 hours for cytokine measurement by ELISA (B). (C-F). Five days after in vitro differentiation, cells were adoptively transferred into CD45.2⁺ congenic mice (n=3-4) before the recipient mice were subcutaneously immunized with OVA in IFA. A group of mice that did not receive T cells was used as a control (No transfer). Seven days after immunzation, lymphoid cells from the draining lymph nodes of recipient mice were isolated and Tg₁ cells and germinal center B cells were analyzed (D). Numbers in the boxes represent the percentages. (E). The sera from the recipient mice were subject to a 3-fold serial dilution, and the concentrations of OVA-specific IgM and IgG were analyzed by ELISA and averaged for each group. (F). Germinal center in the spleens of the recipient mice were identified by PNA staining (brown). The results are a representative of multiple mice of two independent experiments with similar results. (G). CXCR5⁺CD44^hl cells were sorted from CD45.1 mice on day 7 after immunization with KLH and transferred to CD45.2 (n=3) recipient mice following immunization with KLH in CFA. A group of mice that did not receive T cells was used as a control (No transfer). Seven days after immunization, germinal center in the spleens of the recipient mice were identified by PNA staining (brown).

[0077] As shown in Figure 8, follicular helper T cells co-express CXCR5 and BTLA.

C57BL/6 mice were immunized with KLH in CFA. Seven days after the immunization, experimental mice were sacrificed and the T_f1, cell induction was determined by staining CD4 cells with PE-labeled anti-BTLA mAb and biotinylated anti-CXCR5 mAb, followed by APC-labeled streptavidin.

[0078] As shown in Figure 9, FDR estimated from ANOVA tests using resampled samples.

[0079] As shown in Figure 10, antigen-specific cytokine production by T_f]₁ cells.

C57BL/6 mice were immunized with KLH in CFA. Seven days later CD4⁺CD44^h'CXCR5⁺ (T_ft) and CD4⁺CD44hiCXCR5^~ (non-Ta) cells were sorted and restimulated with KLH and irradiated APC for 48 hours for cytokine measurement by ELISA.

[0080] As shown in Figure 11, T_fh cell generation is independent of THl and TH2 cells.

(A-C). Basal levels of CXCR5 expression in non-immunized IL-4 KO, IFNγ KO, STAT6 KO and STAT4 KO mice were analyzed by staining with PerCP-labeled anti-CD4 mAb and biotinylated anti-CXCR5 mAb, followed by APC-labeled streptavidin. Numbers in dot plot quadrants represent the percentages. (D). IL-4 KO, IFNγ KO and their appropriate controls (WT, 3 mice per group) were immunized with KLH emulsified in CFA. Seven days after the immunization, CD4⁺CD44^hlCXCR5⁺ (T_ft) and CD4⁺CD44hiCXCR5^" (non-Ta) cells were sorted and restimulated with anti-CD3 for 4 hours for real-time RT-PCR analysis of TH subset-specific genes.

[0081] As shown in Figure 12, regulation of antibody responses by STAT3. T cell-specific STAT3 KO and their controls (WT, 3 mice per group) were immunized with KLH in CFA. Seven days after the immunization, Anti-KLH antibodies (IgM and IgG) were measured in the sera by ELISA. The sera from WT and KO mice were subject to a 3-fold serial dilution, and the concentrations of KLH-specific IgM and IgG were analyzed by ELISA and averaged for each group.

[0082] As shown in Figure 13, normal germinal center reaction in IL-17 KO, IL-17F KO and RORα/γ KO mice. IL-17 KO, IL-17F KO (A), RORα/γ KO (B) mice and their controls (WT, 3 mice per group) were immunized with KLH in CFA. Seven days after the immunization, germinal centers in the spleens of KLH-immunized mice were identified by PNA staining (brown).

[0083] As shown in Figure 14, schematic demonstration that development of T_fh cells, independent of TH 1 , TH2 or TH 17 lineages, is regulated by IL-6 and IL-21.

Claims

CLAIMS What is claimed is:

1. A method of treating a disease or condition associated with T_FH cell-mediated immune response in a subject in need thereof comprising administering to the subject an agent that modulates the IL-6, IL-21, and/or STAT3 signaling pathway, wherein the agent is administered in an amount effective to modulate the differentiation of T_FH cells.

2. The method of claim 1 wherein the agent is an antagonist of one or more of IL-6, IL-21, and STAT3.

3. The method of claim 1 wherein the agent is an agonist of one or more of IL-6, IL- 21, and STAT3.

4. A method of producing a T_fh cell comprising the steps of: providing an activated T cell; and contacting said cell with IL-2, IL-21 or STAT3, wherein said T cell differentiates into one or more Ta cells.