WO2009154460A1

WO2009154460A1 - Modulation of memory function.

Info

Publication number: WO2009154460A1
Application number: PCT/NL2009/050360
Authority: WO
Inventors: Ingrid Maria Nijholt; Martina Schmidt
Original assignee: Rijksuniversiteit Groningen
Priority date: 2008-06-19
Filing date: 2009-06-18
Publication date: 2009-12-23

Abstract

The invention relates to means and methods for modulating memory function. In particular, the invention provides a method to enhance or facilitate memory retrieval, in particular for the treatment of Alzheimer. Provided is a method of modulating memory retrieval in a mammalian subject, comprising administering to the subject a composition comprising an effective amount of an agent capable of modulating the activity of exchange proteins directly activated by cAMP (Epacs).

Description

Title: Modulation of memory function.

The invention relates to means and methods for modulating memory function. In particular, the invention provides methods to either enhance or suppress memory retrieval.

One of the most remarkable features of the mammalian central nervous system is its ability to store large amounts of information for periods approaching a lifetime. In humans it is this long-term storage of life events associated with emotional dimensions as part of the phenomenon of consciousness that makes this species so highly dependent on cognitive functioning. Consequently, disruption of the memory storage and memory retrieval capacity e.g. as it occurs during aging and in dementias, seriously affects the quality of life and the independence and survival of the individual specimen in its social environment. Memory is often considered to be a process that consists of several stages, which include the acquisition, consolidation and retrieval of information. One prominent component of age-associated memory impairment (AAMI) is a defect in the ability to retrieve previously encoded information. The memory decline associated with AAMI affects at least 50% of the individuals in their 60s according to the latest estimations. These memory lapses are similar to those of someone in the earliest stage of Alzheimer's disease, and some experts see it as a precursor to Alzheimer's or other forms of dementia. Both AAMI and dementia cause an increasing pressure on the individual affected and on our society. Although the awareness of the need of defining and understanding the neurobiological basis of cognitive dysfunction has certainly grown in recent years, therapeutic interventions for an effective treatment of cognitive decline are still limited. It is therefore of great importance to develop innovative, more effective and specific strategies for treatment of cognitive deficits. The present inventors set out to identify novel agents that are of use in modulating learning and/or memory function. More specifically, it is an aim of the present invention to provide means and methods to modulate memory retrieval.

It was surprisingly discovered that compounds capable of modulating the activity of exchange proteins directly activated by cAMP (Epacs) are potent modulators of memory function, in particular memory retrieval. Using an established animal model (contextual fear conditioning) it was found that Epac activators can enhance memory retrieval, whereas inhibitors of Epac activity can be used to suppress memory retrieval. Accordingly, the invention provides a method of modulating memory function in a mammalian subject, comprising administering to the subject a composition comprising an effective amount of an agent capable of modulating the activity of Epac. In one embodiment, said modulating memory function comprises modulating memory retrieval, preferably essentially without affecting acquisition and/or consolidation of information.

Epacs have identified fairly recently as a new effector of cAMP signaling. In independent studies, two subtypes of the Epac protein, namely Epacl (also called cAMP-GEF-I) and Epac2 (also called cAMP-GEF-II), were found (Kawasaki et al., 1998; de Rooij et al., 1998). Both Epac proteins are multi-domain proteins that function as guanine-nucleotide-exchange factors (GEFs) for Rapl and Rap2, members of the Ras superfamily of small GTPases. Activation of Epac by cAMP leads to activation of Rapl and Rap2, which then act as molecular switches on downstream cascades. Epac proteins consist of a C-terminal catalytic domain responsible for the guanine-nucleotide exchange activity, and an N-terminal regulatory domain that provides one or more binding sites for cAMP. Since their discovery, Epac proteins have been found to control key cellular processes, including cellular calcium handling, integrin-mediated cell adhesion, gene expression, cardiac hypertrophy, inflammation, and exocytosis (Pereira et al., 2007; Oestreich et al., 2007; Hucho et al., 2005; Rangarajan et al., 2003; Lotfi et al., 2006; Kang et al., 2003; Morel et al., 2005; Roscioni et al., 2008). The exact nature of any involvement that Epacs have in neuronal function has only recently begun to be investigated. Epac was shown to enhance neurotransmitter release in glutamatergic synapses of the rat brain calyx of Held (Sabaka et al., 2003) and in the crayfish neuromuscular junction (Zhong and Zucker, 2005), whereas in cerebellar granule cells Epac can modulate neuronal excitability (Ster et al., 2007). US2007/0197482 reports the up-regulation of the Epacl gene and down-regulation of the Epac2 gene in Alzheimer's patients, which merely leads the authors to speculate that Epacl inhibitors may have potential therapeutic effects in this disease area. Disclosed is a screening method for identifying Epac inhibtors. However, an in vivo role for Epac in the process of learning and memory as disclosed herein has never been shown Furthermore, the use of Epac-activators for modulating memory function, in particular memory retrieval, has heretofore never been suggested As said, it was found that Epac modulation can either enhance or suppress memory retrieval depending on whether an Epac activator or an Epac inhibitor is used. In one embodiment, the invention provides a method of enhancing memory retrieval in a mammalian subject, comprising administering to the subject a composition comprising an effective amount of an agent capable of increasing the activity of Epac. Any kind of Epac activator that is tolerated by the subject can be employed in the method of the invention. Activation of Epac can be achieved by any available means, e.g.: (1) enhancing the expression, mRNA stability, protein trafficking, or modification of Epac; (2) inhibition of degradation of Epac; or (3) activation of one or more of the normal functions of Epac, such as guanine exchange. Thus, the activator can be a polypeptide (such as, e.g., an activating anti-Epac antibody), a polynucleotide (e.g., an inhibitory RNA or a polynucleotide that encodes a polypeptide having a negative regulatory effect on Epac), or a small molecule. In preferred embodiments, the Epac inhibitor acts directly on Epac. An activator of Epac can be non-selective or selective. Preferred activators are generally small molecules that act directly on, and are selective for, the target Epac. Activators of Epac are known in the art. Preferably, the Epac activator is a cAMP analog, more preferably a cAMP analog which has no effect on the activity of protein kinase A (PKA). Suitable compounds for use in the present invention are the cAMP analogs disclosed in WO 03/104250, in particular those shown in Table 1. As is exemplified in the experimental section below, very good results with respect to memory retrieval were obtained with the compound referred to in WO 03/104250 as 1-007, or 8-pCPT-2'-O-Me-cAMP. Accordingly, in a preferred embodiment a method of the invention comprises the use of Epac activator 8-pCPT-2'-O-Me-cAMP. Of course, other known or yet to be identified (small molecule) agents capable of activating Epac, preferably without affecting PKA activity, may also be used.

A method as provided herein is preferably used to modulate memory function in a human subject, for instance an aged human subject. In fact, any subject suffering from cognitive impairment may benefit from a treatment with an Epac activator. In a specific aspect, the invention provides a method of enhancing memory function in a human subject known or suspected to be suffering from Alzheimer's disease or another form of cognitive disorder, comprising administering to the subject a composition comprising an effective amount of an agent capable of increasing Epac activity.

A further aspect of the invention relates to methods for suppressing memory function, in particular suppressing memory retrieval. This is for instance highly desirable in subjects who suffer from post-traumatic stress. It was found that inhibition of Epac, in particular Epac2, resulted in impaired fear memory retrieval. Accordingly, the invention also provides a method of suppressing memory retrieval, in particular fear memory retrieval, in a mammalian subject, comprising administering to the subject a composition comprising an effective amount of an agent capable of inhibiting Epac activity. Any kind of Epac inhibitor that is tolerated by the subject can be employed in the method of the invention. Thus, the inhibitor can be a polypeptide (such as, e.g., an anti-Epac antibody), a polynucleotide (e.g., an inhibitory RNA or a polynucleotide that encodes an inhibitory polypeptide), or a small molecule. In one embodiment, the inhibitory agent is a small interfering RNA (siRNA), for example Epac2 siRNA. In particular embodiments, when the inhibitor is a polynucleotide-encoded inhibitory polypeptide, the polynucleotide is introduced into the subject's cells, e.g. by means of a (targeted) lipid-based delivery vehicle, where the encoded polypeptide is expressed in an amount sufficient to inhibit Epac. Inhibition of Epac can be achieved by any available means, e.g.: (1) inhibition of the expression, mRNA stability, protein trafficking, or modification of Epac; (2) stimulation of degradation of Epac; or (3) inhibition of one or more of the normal functions of Epac, such as guanine exchange. In preferred embodiments, the Epac inhibitor acts directly on Epac.

Also provided is the use of an Epac activator for the manufacture of a medicament for the treatment or prophylaxis of memory loss. In particular, an Epac activator can be used to enhance memory retrieval, preferably to enhance memory retrieval essentially without affecting acquisition and/or consolidation. As described herein above, the activator of Epac is for instance a cAMP analog, preferably a cAMP analog which has no effect on the activity of protein kinase A (PKA). The cAMP analog may be selected from the group of compounds disclosed in WO03/104250. Preferably, the cAMP analog is 8-pCPT-2'OMe-cAMP is used for the manufacture of a medicament for the treatment or prophylaxis of a disease or disorder associated with unwanted memory loss.

In a further aspect the invention provides the use of an Epac inhibitor for the manufacture of a medicament for the treatment or prophylaxis of a condition or disorder associated with unwanted memory retrieval. For example, an Epac inhibitor may be advantageously used to alleviate symptoms associated with post-traumatic stress disorder (PTSD), especially by suppressing the retrieval of traumatic memories. PTSD is characterized by traumatic memories that can manifest as daytime recollections, traumatic nightmares, or flashbacks in which components of the event are relived. These symptoms reflect excessive retrieval of traumatic memories that often retain their vividness and power to evoke distress for decades or even a lifetime. Exemplary causes of PTSD include a serious threat to one's life (or that of one's children, spouse, etc.), loss of a child, rape, military combat, natural or accidental disasters, and torture. Suitable small molecule Epac-inhibitors include those disclosed in US2007/0197482.

LEGENDS TO THE FIGURES

Figure 1 Upper: Fear conditioning paradigm. Lower. Injection time point corresponding to different phases of learning process: acquisition, consolidation and retrieval

Figure 2 Left: Scheme depicting the passive avoidance experimental apparatus. Right: Experimental setup

Figure 3 Scheme depicting the elevated plus maze experimental apparatus

Figure 4 Panel A. Representative coronal brain sections of bilateral dorsal hippocampal (i.h.) injections with methylene blue after counterstaining with nuclear fast red. Panel B. Fluorescent microphotograph depicting siGLO transfection into the pyramidal neurons of CAl area of mouse hippocampus. DAPI was used as contrast staining. Figure 5 Intrahippocampal injection of Epac activator 8-pCPT-2'-OMe-cAMP (1 niM) facilitates the retrieval of contextual fear memory. Mice were injected either 20 min before training (panel A), immediately after training (panel B), or 20 min before retention (panel C) with 8-pCPT-2'-OMe-cAMP (1 mM) or vehicle. Untreated mice served as controls. Freezing behaviour was measured in the memory test 24 h after training. Error bars indicate standard error of the mean. Statistically significant differences: *p < 0.05 versus control groups.

Figure 6 Hippocampal Epac plays an important role in memory retrieval in a passive avoidance paradigm. Mice were habituated to the dark compartment during three sessions. All animals showed similar latency times in the training trial (panel A). In the retention test 24 h after training (panel B), latency to enter the dark compartment was taken as a measure of memory retrieval. Animals were injected i.h. with 8-pCPT- 2'-OMe-cAMP (1 mM) or vehicle 20 min before the retention test. Untreated mice served as controls. Error bars indicate standard error of the mean. Statistically significant differences: *p < 0.05 versus control groups.

Figure 7 Intrahippocampal Epac activation does not affect anxiety. Mice were injected i.h. with 8-pCPT-2'-OMe-cAMP (1 mM) or vehicle 20 min before the test.

Time spent in the different compartments of the maze was measured during 480 s and ratio between time in open arms and total time in maze was taken as a measure of anxiety. Error bars indicate standard error of the mean.

Figure 8 Efficient downregulation of hippocampal Epac2 expression by in vivo siRNA transfection. Panel (A): Bar graphs show the ratio of Epac2 mRNA band intensities verified to be within the linear range of product accumulation, divided by those of the co-amplified HPRT (hypoxanthine-guanine phosphoribosyltransferase) product after 34 cycles. Statistically significant difference: *p < 0.05 versus control groups. Panel (B): Bands reflect the levels of Epacl and Epac2 mRNA expression after 34 cycles.

Figure 9 Intrahippocampal injection of Epac2 siRNA impairs memory retrieval in contextual fear conditioning. Mice were injected with Epac2 or control siRNA either 72, 48 and 24 h before the training (panel A) or 3, 24 and 48 h after training (panel B). Untreated mice served as additional controls. Freezing behaviour was assessed as a measure of memory performance. Error bars represent standard error of the mean. Statistically significant differences: *p < 0.05 versus control groups.

EXPERIMENTAL SECTION

MATERIALS AND METHODS

Animals and housing conditions

Male C57BL/6J mice (Harlan, Horst, the Netherlands), 9 to 12 weeks old, were individually housed in standard macrolon cages. Subjects were maintained on a 12 hour light/dark cycle (lights on at 7.30 a.m.) with food (hopefarm® standard rodent pellets) and water ad libitum. A layer of sawdust served as bedding. The procedures concerning animal care and treatment were in accordance with the regulations of the ethical committee for the use of experimental animals of the University of Groningen (DEC 41741, 4174K).

Cannulation

Double guide cannulae (C235, Plastics One, Roanoke, VA) were implanted using a stereotactic holder during 1.2 % avertin anesthesia (0.02 ml/g, i.p.) under aseptic conditions. Each double guide cannula with inserted dummy cannula and dust cap was fixed to the skull with dental cement. The cannulae were placed into both dorsal hippocampi (intrahippocampal; ih), AP -1.5 mm, lateral 1 mm, depth 2 mm (Franklin and Paxinos, 1997). The animals were allowed to recover for 6-7 d before the experiments started. Bilateral injections were performed during a short anesthetic period of isoflurane inhalation using a syringe pump (TSE systems, Bad Homburg, Germany) at a constant rate 0.33 μl/min (final volume: 0.25 μl per side). The exact site of injection was confirmed after the behavioral experiments by injection of methylene blue solution into each hemisphere and subsequent histological evaluation. Data were evaluated only from those mice that received an injection in the correct target site. In vivo Epac2 siRNA transfection

Mice injected i.h. with 50 ng siGLO Green (25 ng/hippocampus; D-001630-01- 05, Dharmacon, Inc. Lafayette, CO, USA), were sacrificed 6, 24 or 48 h post injection. The brain hemispheres were placed in a 4% PFA solution for 24 h, followed by 48 h 30% sucrose immersion. Afterwards, 30 μm thick coronal sections were stained with DAPI (1:5000) in PBS 0.01 M. After a quick washing step in PBS 0.01 M, sections were mounted, dried and analyzed under a Leica fluorescent microscope. ON- TARGET plus SMART pool mouse RAPGEF3 (Epacl siRNA) and RAPGEF4 (Epac2 siRNA) probes were purchased from Dharmacon, (Dharmacon, USA). The target sequences for the mouse-specific Epacl siRNAs mixture were as follows: sense: C CAGGCAGGAAC C GGUAUAUU (J-057800-09); sense: GAUCUUUGUUCACGGCCAAUU (057800-10); sense: GGUCAAUUCUGCCGGUGAUUU (057800-11) and sense: CCACCAUCAUCCUUCGAGAUU (057800-12).

The target sequences for the mouse-specific Epac2 siRNAs mixture were: sense: CGAAAGACCUGGCGUACCAUU (J-057784-05); sense: CAAGUUAGCUCUAGU-GAACUU (J-057784-06); sense: GACAGAAAGUAC CAC CUAAUU (J-057784-07) and sense: GGAGGAACUGUGUUGUUUAUU.

ON-TARGETplus Non-targeting Pool siRNA (D-001810-10) was used as control (Dharmacon, USA). siRNAs were resuspended in RNAse free water. In vivo siRNA brain delivery was performed using jetSI 10 mM cationic polymer transfection reagent (Polyplus transfection Inc., New York) according to the transfection protocol of the manufacturer. 50 ng siRNA was injected i.h. on three consecutive days either 72, 48, 24 h before training or 3, 24 and 48 h after the training session or on the three days prior to the second retention test.

Drug treatment The Epac activator 8-pCPT-2'-OMe-cAMP ( Biolog, Bremen, Germany) was injected in a final concentration of 1 mM in artificial cerebrospinal fluid (ACSF) solution of the following composition (in mM): 130 NaCl, 3.5 KCl, 1.25 NaH₂PO₄, 1.5 MgSO₄, 2 CaCl₂, 24 NaHCO₃, and 10 glucose (pH 7.4). 8-pCPT-2'-OMe-cAMP was stored as a 100 mM stock solution in H2O. A separate set of animals was injected with vehicle (ACSF pH 7.4). 8-pCPT-2'-OMe-cAMP was injected either 20 min before the training or the retention session or immediately after the training session (Fig 1). 50 ng Epac2 siRNA or 50 ng scrambled control was injected bilaterally in the CAl area of hippocampus either 72, 48, 24 h before training or 3 hr, 24 hr and 48 hr after training in the fear conditioning paradigm. Untreated animals without cannula served as controls for possible cannulation and injection effects. As a transfection control 50 ng siGLO Green was injected bilaterally in the CAl area of the hippocampus.

Fear Conditioning

Fear conditioning was performed in a Plexiglas cage (44 x 22 x 44 cm) with constant illumination (12 V, 10 W halogen lamp, 100-500 lux). The training (conditioning) consisted of a single trial. The mouse was exposed to the conditioning context for 180 sec followed by a footshock (0.7 mA, 2 sec, constant current) delivered through a stainless steel grid floor. The mouse was removed from the fear conditioning box 30 sec after shock termination to avoid an aversive association with the handling procedure. Memory tests were performed 24 hr or 72h after fear conditioning. Contextual memory was tested in the fear conditioning box for 180 sec without footshock presentation. Freezing, defined as the lack of movement except for respiration and heart beat, was assessed as the behavioral parameter of the defensive reaction of mice by a time-sampling procedure every 10 s throughout memory tests. In addition, mean activity of the animal during the training and retention test was measured with the Ethovision system (Noldus, The Netherlands).

Passive avoidance

Passive avoidance, also known as inhibitory avoidance, is a one trial fear-motivated avoidance task in which the mouse learns to refrain from stepping through a door to an apparently safer but previously punished dark compartment. Passive avoidance experiments were performed in a plexiglas cage (44 x 22 x 44 cm) consisting of a dark compartment (22 x 22 x 20 cm) equipped with a stainless steel grid floor and a light compartment (22 x 22 x 44 cm) with a plastic floor (Fig. 2.). Both compartments were separated by a guillotine door. The light compartment was brightly illuminated by a 100 W bulb. Before each individual mouse entered the cage, the box was cleaned with 70% ethanol. Mice were habituated to the dark compartment during three sessions 30, 24 and 6 hr prior to the training session. During habituation sessions, the mouse was introduced into the light compartment facing the closed guillotine door. After 60 sec the door was opened and the mouse was allowed to enter the dark compartment. Upon entering the dark compartment the door was closed and the mouse was allowed to explore the compartment for 60 sec. Then the mouse was returned to the home cage. During the training session, the mouse was again introduced into the light compartment, and the guillotine door was opened after 60 sec. Latency (defined as the time between the opening of the door and the mouse entering the dark compartment with all four paws) was recorded for each animal. Upon entering the dark chamber the door was closed and a single footshock (0.3 mA, 2 sec, constant current) was delivered to the mouse. The mouse was removed from the apparatus 30 sec after shock termination to avoid an aversive association with the handling procedure. Memory tests were performed 24 hr after training. During the memory test the guillotine door was opened 60 sec after introducing the mouse into the light compartment and left opened for 480 sec. During this time period, latency to enter the dark compartment was recorded and assessed as the behavioral parameter. If a mouse did not enter the dark compartment, it was assigned a latency of 480 sec.

Elevated plus maze

The elevated plus maze is a test of unconditioned anxiety-related behavior that involves a conflict between the rodent's desire to explore a novel environment and anxiogenic elements such as elevation and an unfamiliar, brightly illuminated area (Lister, 1987). Elevated plus maze experiments were performed in a plus maze (50 cm above the floor) with two opposite closed and two opposite open arms (50 cm long, 5 cm wide) in a cross position, thus creating five zones - the north, south, east, and west arms, as well as a central zone where the arms intersect (5 x 5 cm) (Fig. 3). The maze was positioned in the center of an otherwise empty test room, directly beneath dim lighting (50 lux). Before each individual mouse was introduced into the maze, the maze was cleaned with 70% ethanol. The experiment consisted of a single trial. The mouse was placed in the central zone of the plus maze, facing an open arm, after which the researcher left the experiment room and the mouse was allowed to explore the maze. The behavior of the mouse was recorded for 480 s with the Ethovision system (Noldus, The Netherlands) that was operated in an adjacent room. Time spent in dark arms, open arms and center compartment were recorded for each animal. The ratio of time spent in the open arms to total time spent in the maze was calculated for each group of animals as a measure of anxiety-related behaviour, with a higher ratio being indicative of lower anxiety levels.

Histology

Immediately after the behavioral test mice were injected i.h. with methylene blue solution during 1.2 % avertin anesthesia (0.02 ml/g, i.p.). Brains were removed and serially sectioned at 50 μm, collecting the sections on glass slides. Sections were stained on glass for 5 minutes in 0.1% nuclear fast red solution. To identify the location of the injection, sections were analyzed using light microscopy. Only data from animals in which the proper site of injection was confirmed, were evaluated. The methylene blue injections did not show a diffusion of the solution to other brain or hippocampal areas (Fig. 4A). Mice injected with siGLO Green were sacrificed 6 hr, 24 hr or 48 hr post injection. The brain hemispheres were placed in 50 ml 4% PFA for 24 hr, followed by 48 hr 30% sucrose immersion. Afterward, tissue was sectioned at 30 μm and stained with DAPI (1:5000) in PBS 0.01 M. After a quick washing in PBS 0.01 M, sections were analyzed under a Leica fluorescent microscope. siGLO Green injection resulted in a specific transfection of CAl pyramidal neurons (Fig. 4B).

Statistics

Statistical comparisons were made by analysis of variance (ANOVA). For each significant F ratio, Fisher's protected least significant difference (PLSD) test was used to analyze the statistical significance of appropriate multiple comparisons. Data were expressed as mean ± s.e.m. Significance was determined at the level of p < 0.05.

RESULTS

Epac activation facilitates memory retrieval in contextual fear conditioning

To investigate the effect of Epac activation on the acquisition or consolidation of fear memory, animals were injected i.h. with the Epac activator 8-pCPT-2'-OMe-cAMP (1 mM) or vehicle either 20 min before training or immediately after training, respectively. Injection of none of these substances resulted in changes in mean activity during training or shock reactivity when compared to untreated animals without cannulae (data not shown). When injected 20 min before training, 8-pCPT-2'- OMe-cAMP caused no significant change in freezing behavior during the retention test 24 hr after training in comparison to vehicle-injected and untreated animals (Fig. 5A). Similarly, no significant change in freezing behavior was observed between groups during the retention test 24 hr after training when 8-pCPT-2'-OMe-cAMP was injected immediately after training (Fig. 5B). To determine the effect of Epac activation on the retrieval of fear memory, mice were injected i.h. with 8-pCPT-2'-OMe-cAMP or vehicle 20 min before the retention test 24 hr after training. Injection of 8-pCPT-2'-OMe-cAMP resulted in a significant increase in freezing behavior during the retention test 24 hr after training in comparison to vehicle-injected and untreated animals (one-way ANOVA: F(2,24) = 5.550, p = 0.010; Fig. 5C).

Taken together, these data indicate that Epac proteins play a specific role in the retrieval of contextual fear memory, but not in acquisition or consolidation.

Epac activation facilitates memory retrieval in passive avoidance The effect of i.h. 8-pCPT-2'O-Me-cAMP injection on memory acquisition, consolidation and retrieval was also tested in the passive avoidance task. We further investigated the effect of Epac activation on memory retrieval using a passive avoidance test. Passive avoidance is considered to be more complex than fear conditioning due to the combination of classical Pavlovian conditioning with the manifestation of an active response. The animal makes a choice in the memory test by avoiding or entering a dark compartment in which it received an aversive footshock during training. Animals were habituated to the dark compartment during three sessions prior to the training session. In the training session no differences between groups were observed in latencies to enter the dark compartment (Fig. 6A). The next day, animals were injected i.h. with 8-pCPT-2'-OMe-cAMP (1 mM) or vehicle 20 min before the retention test 24 hr after training. In this way we aimed to interfere with the retrieval stage of the memory process. Animals injected with 8-pCPT-2'-OMe-cAMP showed significantly increased latency to enter the dark compartment when compared to vehicle-injected animals and untreated animals without cannulae (one-way ANOVA: F(2,23) = 4.650, p = 0.020, Fig. 6B). Overall, the memory retrieval enhancing effect of 8-pCPT-2'O-Me-cAMP in the passive avoidance paradigm was even more prominent than in fear conditioning. When 8-pCPT-2'O-Me-cAMP (1 mM) was injected 20 min before the training or immediately after the training session, the latency to enter the dark compartment during the retention test did not differ from the control groups (before training: vehicle latency 149.2 ± 43.4 s versus 8-pCPT-2'O-Me-cAMP 186.8 ± 60.4 s; after training vehicle latency 152.2 ± 28.9 s versus 8-pCPT-2'O-Me-cAMP 146.4 ± 38.3 s). Thus, also in the passive avoidance task Epac activation only promotes memory retrieval whereas memory acquisition and consolidation remained unaffected. These results confirmed the findings of the fear conditioning experiments that Epac activation facilitates memory retrieval.

Epac activation does not affect anxiety In passive avoidance, the active choice an animal makes to avoid or enter the dark compartment depends on its memory of the footshock, but may also be influenced by the level of anxiety the animal experiences. Injection of the Epac activator 8-pCPT-2'- OMe-cAMP could in principal affect either one of these processes. To test whether the observed effect of 8-pCPT-2'-OMe-cAMP injection on passive avoidance performance may have been caused by an effect on anxiety, we injected animals with 8-pCPT-2'-

OMe-cAMP (1 mM) 20 min before an elevated plus maze test. Intrahippocampal Epac activation by 8-pCPT-2'-OMe-cAMP did not affect anxiety levels (one-way ANOVA: F(2,19) = 1.741; p = 0.202, Fig 7). Cannulated animals, i.e. 8-pCPT-2'-OMe-cAMP- injected and vehicle-injected mice, did show slightly, but not significantly higher levels of anxiety. This can be explained by the surgery procedure these animals underwent 6-7 days prior to testing in the elevated plus maze. Since injection of 8- pCPT-2'-OMe-cAMP did not affect anxiety in the elevated plus maze test, the effect of Epac activation by 8-pCPT-2'-OMe-cAMP in the passive avoidance task can be ascribed solely to enhanced memory retrieval of the association between the electric footshock and the dark compartment.

Overall, we can conclude that hippocampal Epac is instrumental in retrieval of contextual fear memory. Intrahippocampal Epac2 siRNA injection impairs fear memory retrieval To investigate the role of hippocampal Epac2 in memory acquisition, consolidation or retrieval, we specifically downregulated Epac2 expression before the training session or the memory test using in vivo lipid mediated siRNA gene silencing. A previous study already showed the efficient downregulation of Epac2 expression by these siRNA probes in in vitro neuronal cell cultures (Nijholt et al., 2008). To check for siRNA transfection efficiency in the in vivo mouse brain, we first injected mice i.h. with fluorescent siGLO green. A single bilateral injection of siGLO green resulted in a strong fluorescent signal in the pyramidal cell layer of the CAl area already as early as 6 h after injection. The signal lasted at least up to 48 h after injection. Other brain areas were not affected by the treatment (data not shown).

Downregulation of Epac2 expression by i.h. injection of specific siRNA probes on three consecutive days was verified by semi- quantitative RT-PCR on the fourth day. Injection of Epac2 siRNA resulted in a 47 % reduction of hippocampal Epac2 mRNA (Fig 8 A,B). The low level of Epacl mRNA was not affected by the transfection with Epac2 siRNA. In the behavioral experiments, mice were injected i.h. with Epac2 siRNA (50 ng/brain) 72, 48 and 24 h before the training or 3, 24 and 48 h after training in a contextual fear conditioning paradigm (Fig. 9A, B). Epac2 siRNA injection before the training did not affect memory performance in the retention test (one way ANOVA: F(2,26) = 0.326; p =

0.725, Fig. 6A) whereas Epac2 siRNA injection after the training completely abolished the 8-pCPT-2'O-MecAMP-induced enhancement of retrieval and already caused a significant decrease in freezing behavior by itself during the first retention test (oneway ANOVA: F(4,37) = 9.187; p = 0.001, Fig. 9B). In animals that received control siRNA injections after training, 8-pCPT-2'O-Me-cAMP injection again improved memory retrieval (Fig. 9B).

Claims

1. A method of modulating memory retrieval in a mammalian subject, comprising administering to the subject a composition comprising an effective amount of an agent capable of modulating the activity of exchange proteins directly activated by cAMP (Epacs).

2. Method according to claim 1, wherein modulating memory retrieval comprises modulating memory retrieval essentially without affecting acquisition and/or consolidation of information.

3. Method according to claim 1 or 2, wherein the subject is a human subject.

4. Method according to any one of claims 1-3, wherein modulating memory retrieval comprises enhancing memory retrieval, and wherein the agent is an activator of Epac.

5. Method according to claim 4, wherein the subject is an aged subject.

6. Method according to claim 4 or 5, wherein the subject is suffering from cognitive impairment.

7. Method according to claim 6, wherein the subject is suffering from Alzheimer's disease or a related cognitive disorder.

8. Method according to any one of claims 4-7, wherein the activator of Epac is a cAMP analog, preferably a cAMP analog which has no effect on the activity of protein kinase A (PKA).

9. Method according to claim 8, wherein the cAMP analog is selected from the group of compounds disclosed in WO03/104250.

10. Method according to claim 9, wherein the cAMP analog is 8-pCPT-2'OMe- cAMP.

11. Method according to any one of claims 1-3, wherein modulating memory retrieval comprises suppressing memory retrieval, and wherein the agent is an inhibitor of Epac activity.

12. Method according to claim 11, wherein the subject is suffering from posttraumatic stress.

13. Method according to claim 11 or 12, wherein the inhibitory agent is capable of down-regulating or inhibiting the expression of Epac, preferably Epac2.

14. Method according to claim 13, wherein the inhibitory agent is Epac siRNA.

15. Use of an Epac activator for the manufacture of a medicament for the treatment or prophylaxis of memory loss.

16. Use of an Epac activator to enhance memory retrieval, preferably to enhance memory retrieval essentially without affecting acquisition and/or consolidation.

17. Use according to claim 15 or 16, wherein the activator of Epac is a cAMP analog, preferably a cAMP analog which has no effect on the activity of protein kinase A (PKA).

18. Use according to claim 17, wherein the cAMP analog is selected from the group of compounds disclosed in WO03/104250.

19. Use according to claim 18, wherein the cAMP analog is 8-pCPT-2'-O-Me- cAMP.

20. Use of an Epac inhibitor for the manufacture of a medicament for the treatment or prophylaxis of a condition or disorder associated with unwanted memory retrieval.

21. Use according to claim 20, wherein said disorder is post-traumatic stress disorder.