WO2009148552A2

WO2009148552A2 - Methods and compositions for treating disease

Info

Publication number: WO2009148552A2
Application number: PCT/US2009/003303
Authority: WO
Inventors: Dolores J. Takemoto; Thu A. Nguyen
Original assignee: Kansas State University
Current assignee: Kansas State University
Priority date: 2008-06-02
Filing date: 2009-05-29
Publication date: 2009-12-10
Anticipated expiration: 2010-12-02
Also published as: WO2009148552A3

Abstract

Methods and compositions are disclosed for disease treatment, and in particular any condition or disease which is associated with a hypoxic/ischemic component. In one embodiment, the invention relates to treating cancer, and in particular to a method of treating breast cancer and ocular retinoblastoma in a human patient. In another embodiment, the invention relates to treating or preventing heart disease.

Description

METHODS AND COMPOSITIONS FOR TREATING DISEASE

This invention was made with Government support under Grant No. EY 13421 awarded by NTH. The Government has certain rights in the invention.

FIELD OF INVENTION

This invention relates to the field of disease treatment, and in particular any disease which is associated with a hypoxic/ischemic component. In one embodiment, the invention relates to treating cancer, and in particular to a method of treating breast cancer in a human patient. In another embodiment, the invention relates to treating or preventing heart disease. In a third, it relates to the treatment of human ocular retinoblastoma.

BACKGROUND

Breast cancer is the most common form of cancer and the second leading cause of mortality in women around the world. Over 182,500 (female) and 1,990 (male) estimated new cases are expected in United States in 2008. Breast cancer growth depends on the ratio of proliferating and dying cells. Estrogens are the main regulator of this ratio, and they act by both stimulating proliferation and inhibiting apoptosis. Despite the improvements in detection and treatments, about 40-50% of patients still succumb to the disease. The development of distant metastases is the major cause of these deaths, and breast cancer is no longer curable when metastases are detected.

Breast cancer patients initially respond to estrogen ablation therapy, but estrogen- independent cells almost always aggressively emerge, and the disease eventually progresses to what is defined as estrogen-independent breast cancer; at which point the tumor is no longer responsive to estrogen ablation therapy, and unrestrained progression of the disease is inevitable. Progress in understanding the etiology of this disease and developing therapies has been slow due to multiple deregulations of various genes. SUMMARY OF THE INVENTION

This invention relates to hypoxic environments, and in particular any disease which is associated with a hypoxic/ischemic component. For example, in one embodiment, the present invention contemplates a method of reducing the growth of cells in an hypoxic environment comprising inhibiting the expression of Connexin 46. In one embodiment, the invention relates to treating cancer, and in particular to a method of treating breast cancer in a human patient. In another embodiment, the invention relates to treating or preventing heart disease. In a third it relates to the treatment of ocular retinoblastoma.

In a preferred embodiment, the present invention provides a method of treating cancer in a subject. In one embodiment, the present invention contemplates a method of treating cancer in a subject, comprising administering to said subject an effective amount of a short interfering ribonucleic acid (siRNA) directed to Connexin 46 (CX46), a gap junction protein. Treating both humans and animals is contemplated. In one embodiment, the present invention contemplates administering anti-CX46 siRNA to control and potentially eliminate early breast cancers while at the hypoxic stage.

It is not intended that the present invention be limited by the amount of siRNA administered. The effective amount of the short interfering ribonucleic acid (siRNA) can range from about 1 nM to about 100 nM, or even greater (e.g. 1000 nM).

It is not intended that the present invention be limited by the cancer type or stage of the cancer. A variety of cancers can be treating according to the present invention (e.g. prostate, ovarian, etc.), and in particular breast cancer (including metastatic breast cancer). It is not intended that the present invention be limited by the mode of administration. In one embodiment, the short interfering ribonucleic acid (siRNA) is administered in conjunction with a delivery reagent. In one embodiment, the delivery agent is selected from the group consisting of lipofectin, lipofectamine, cellfectin, polycations, nanoparticles and liposomes. It is preferred that the siRNA target a sequence of Connexin 46. A variety of different target sequences are contemplated. In one embodiment, the siRNA is directed to the nucleic acid sequence CGCATGGAAGAGAAGAAGAAA (SEQ ID NO: 1).

It is not intended that the present invention be limited by the route of administration, hi one embodiment, the short interfering ribonucleic acid (siRNA) is administered by an enteral administration route, hi one embodiment, the enteral administration route is selected from the group consisting of oral, rectal, and intranasal, hi yet another embodiment, the short interfering ribonucleic acid (siRNA) is administered by a parenteral administration route. In one embodiment, the parenteral administration route is selected from the group consisting of intravascular administration, peri- and intra-tissue injection, subcutaneous injection or deposition, subcutaneous infusion, and direct application at or near the site of the tumor, hi one embodiment, the intravascular administration is selected from the group consisting of intravenous bolus injection, intravenous infusion, intra- arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature, hi one embodiment, the peri- and intra-tissue injection is selected from the group consisting of peri-tumoral injection, and intra- tumoral injection.

In one embodiment, the present invention contemplates a method of inhibiting expression of Connexin 46 in a tumor comprising: administering to a subject having a tumor an effective amount of a short interfering ribonucleic acid (siRNA) directed to a sequence of Connexin 46. hi one embodiment, the cancer is breast cancer (e.g. metastatic breast cancer), hi one embodiment, said siRNA is directed to the SEQ ID NO:1.

Compositions are also contemplated. In one embodiment, the present invention contemplates a short interfering ribonucleic acid (siRNA) directed to a sequence of Connexin 46. hi one embodiment, said sequence of Connexin 46 is SEQ ED NO:1. hi another, the siRNA would be modified for a longer half-life. The present invention also provides a method of treating other diseases in a subject, hi one embodiment, the present invention contemplates down-regulating Cx46 or inhibiting (e.g. reducing) the expression of Cx46 in the context of any condition or disease which is associated with a hypoxic/ischemic component. These include but are not limited to: Acute or chronic ischemia in heart, brain and the eye and for treatment of all tumors with hypoxic components. It is not intended that the present invention be limited by the means by which Cx46 is down-regulated or by which Cx46 expression is inhibited or reduced. At the protein level, antibodies can be used to bind Cx46 protein. At the gene or RNA level, the present invention contemplates the use of siRNA or RNAi. The use of siRNA and RNAi either alone or in a nanoparticle specifically to decrease the levels of the protein Cx46 is contemplated to be used for treatment of diseases associated with hypoxia.

These include but are not limited to cancer, heart disease, and brain and retinal ischemia during stroke. In one preferred embodiment, the present invention contemplates a method of treating or preventing heart disease (or simply treating or preventing damage to the heart) in a subject, comprising administering to said subject an effective amount of a short interfering ribonucleic acid (siRNA) directed to Connexin 46. Treating both humans and animals is contemplated.

Comparison of a naturally hypoxic tissue, the lens, with breast cancer cells has allowed us to identify a hypoxia-specific gap junction protein, Cx46, which, until now, was thought only to be found in the lens. Our work clearly demonstrates that the levels of Cx46 increase in breast cancer cell lines which are known to be at the early hypoxic stage. This protein is also highly expressed in human breast cancer tumors. Furthermore, as in the lens epithelial cells, there is an inverse relationship between Cx46 levels compared to Cx43 levels. Overexpression of Cx46 in lens epithelial cells causes the ubiquitin- proteasome directed degradation of Cx43. Since Cx43 loss is directly related to breast tumor growth, the hypoxia-directed increase in Cx46 may provide the growing and hypoxic tumor with a survival advantage. Thus, without intending to limit the present invention to any mechanism, it is believed that Cx46 is a hypoxia-specific gap junction protein which provides survival benefits for the hypoxic breast cancer tumor. This occurs through a proteasomal/ubiqui tin-driven degradation of Cx43. If this is the case, then, directed down-regulation of Cx46 could provide a novel treatment for breast cancer.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure Ia is a Western Blot showing upregulation of Cx46 in HLEC. Figure Ib is a Western Blot showing siRNA knockdown of Cx46 in HLEC. Figure Ic is a bar graph showing the magnitude of the knockdown. Figure Id is a Western Blot showing the lack of knockdown with a non-silencing siRNA control. Figure Ie is a bar graph demonstrating the impact of siRNA on cell viability.

Figure 2 is a graph showing that overexpression of Cx46 confers survival of neuronal cells in hypoxia. Figure 3a is a Western Blot showing expression of Cx46 in human breast cancer tumors. Fig. 3b is a gel showing RT-PCT results which agree with the results of Fig 3b. Figure 3c are immunohistochemistry results showing that pre-metastatic breast tumors express Cx46. Figure 3d is a Western Blot showing that Cx46 is upregulated in breast tumors. Figure 3e is a Western Blot showing siRNA knockdown of Cx46 in breast cancer cells. Figure 3f is a Western Blot showing the lack of siRNA knockdown with a non-silencing siRNA control. Figure 3g is a bar graph showing the impact on breast cancer cell viability.

Figures 4a, 4b and 4c are Western blots showing knockdown by anti-Cx46 siRNA (with controls) of tumors grown and treated in vivo.

DESCRIPTION OF THE INVENTION

Among the most studied genes are those for hypoxia. Breast tumors are known to require a hypoxic state for enhanced metastasis. There is a direct correlation between the increase in the hypoxia gene regulator, HIFl alpha and the estrogen receptor. This hypoxia gene regulator directly correlates with the degree of metastasis of breast cancer tumors. Besides hypoxic tumors, one other tissue in the human body thrives under hypoxia, the lens. Normal tissues cannot live under hypoxic conditions and this is one of the survival mechanisms for a tumor. The human lens cells also survive in 1% oxygen throughout life. The lens has the normal and ubiquitous gap junction proteins, Cx43 and Cx50.

However, in addition there is a unique gap junction protein, Cx46, which appears during lens fiber cell formation, inside the even more hypoxic center of the lens. This is the major functioning gap junction protein inside the lens. We have found that the overexpression of Cx46 causes the ubiquitin-proteasomal driven degradation of Cx43. This is not due to a change in transcript, is reversible by using a proteasome inhibitor, and causes an increase in ubiquitination of Cx43.

Importantly, we have found that breast cancer cell lines which have elevated estrogen receptor also have a high level of Cx46. Second, we have found that human breast cancer tumors strongly express Cx46. While not intended to limit the present invention to any particular mechanism, we believe that Cx46 plays a role in the breast tumor to protect from hypoxia and to enhance metastasis. Further, as in the lens, it is likely that the Cx46 will enhance the degradation of Cx43, thus, playing a role in the well documented decrease in Cx43 in breast cancer.

It is contemplated that the compositions and methods of the present invention will have high impact as regulation of the hypoxia stage of a breast cancer tumor would provide an entirely new line of drugs to treat (and perhaps eradicate) breast cancer, through a directed down-regulation of Cx46. Targeted down-regulation of Cx46 can be used therapeutically to cause hypoxic tissues such as tumors to die. It is expected that the side effects of down-regulation of Cx46 would be very minimal. Indeed, side effects on the lens or eye would be non-existent since very little gets across the blood/ocular barrier.

DESCRIPTION OF PREFERRED EMBODIMENTS

In one embodiment, the present invention contemplates using RNA interference to reduce the expression or "knockdown" of Connexin 46. RNA interference (hereinafter "RNAi") is a method of post-transcriptional gene regulation that is conserved throughout many eukaryotic organisms. RNAi is induced by short (i.e. <30 nucleotide) double stranded RNA ("dsRNA") molecules which are present in the cell (Fire A et al. (1998), Nature 391: 806-811). These short dsRNA molecules, called "short interfering RNA" or "siRNA," cause the destruction of messenger RNAs ("mRNAs") which share sequence homology with the siRNA to within one nucleotide resolution (Elbashir S M et al. (2001), Genes Dev, 15: 188-200). It is believed that the siRNA and the targeted mRNA bind to an "RNA-induced silencing complex" or "RISC", which cleaves the targeted mRNA. The siRNA is apparently recycled much like a multiple-turnover enzyme, with 1 siRNA molecule capable of inducing cleavage of approximately 1000 mRNA molecules. siRNA- mediated RNAi degradation of an mRNA is therefore more effective than currently available technologies for inhibiting expression of a target gene.

Elbashir S M et al. (2001), supra, has shown that synthetic siRNA of 21 and 22 nucleotides in length, and which have short 3' overhangs, are able to induce RNAi of target mRNA in a Drosophila cell lysate. Cultured mammalian cells also exhibit RNAi degradation with synthetic siRNA (Elbashir S M et al. (2001) Nature, 411 : 494-498), and RNAi degradation induced by synthetic siRNA has recently been shown in living mice (McCaffrey A P et al. (2002), Nature, 418: 38-39; Xia H et al. (2002), Nat. Biotech. 20: 1006-1010). The therapeutic potential of siRNA-induced RNAi degradation has been demonstrated in several recent in vitro studies, including the siRNA -directed inhibition of HIV-I infection (Novina C D et al. (2002), Nat. Med. 8: 681-686) and reduction of neurotoxic polyglutamine disease protein expression (Xia H et al. (2002), supra).

Applications to Cardiovascular Disease

Gap junctions, especially Cx43, are abundant in myocardium where they localize at regions connecting the cardiomyocytes. Cx43 is essential for fast propagation of the action potential necessary for coordinated contraction. Cx43 has been proven to be a key in the process of ischemic reperfusion injury and in cardiac protection from ischemia. More recently this process has been found to include the translocation of Cx43 to the mitochondria. Sold, G., Willecke, K. Cardiovasc Res 62:228-232.(2004). The phosphor- ylation of Cx43 by PKCε is essential for control of Cx43 in response to ischemia, and some anti-arrhythmic drugs are directed at this target. Loss of Cx43 prevents the protective effects of ischemic preconditioning on infarct size. This has been shown in genetic models, in aged mice, and, most important, in patients with falling hearts. The mechanism by which age or heart failure causes a reduction in Cx43 is not known. However, in both cases an individual may encounter transient ischemic episodes. Ischemia/hypoxia, in all cells, causes expression of many genes. Hypoxia inducible factor- 1 (HIF-I) is a regulatory transcription factor that causes up-regulation of proteins involved in oxygen homeostasis, mitochondrial protection, and proteasomal degradation pathways, among a few. HEF-I is a heterodimer composed of an Ch-sensing HIF- lα subunit and a constitutively expressed HEF-I β subunit, or aryl hydrocarbon receptor nuclear translocator (ARNT). HIF-I primarily functions as a response element to protect cells from accumulated reactive oxygen species (ROS) or hypoxic insult which causes cell death. Under normoxic conditions, HIF-lα is continuously synthesized and degraded. Conserved proline residues are hydroxylated allowing the E3 ubiquitin ligase complex to bind and target the HIF- lα for proteasomal degradation. Hypoxic conditions decrease the essential rate-limiting oxygen levels for proline hydroxylation which, in turn, decreases the rate of ubiquitination. This allows the HIF- lα to dimerize with the HIF-I β, translocate to the nucleus, and subsequent expression of genes with HIF-I response elements occurs. One of these is the gap junction protein Cx46. Cx46 is usually only found in the lens, a tissue which thrives naturally under hypoxic conditions. Normal tissues, including the heart, cannot live under hypoxic conditions and this is one of the survival mechanisms which is required for the lens. The human lens cells survive in 1% oxygen throughout life. The lens has the normal and ubiquitous gap junction proteins, Cx43 and Cx50. However, in addition there is a unique gap junction protein, Cx46, which appears during lens fiber cell formation, inside the even more hypoxie center of the lens. This is the major functioning gap junction protein inside the lens. We have found that the overexpression of Cx46 causes the ubiquitin- proteasomal driven degradation of Cx43. This is not due to a change in transcript, is reversible by using a proteasome inhibitor, and causes an increase in ubiquitination of Cx43.

These findings in the lens have implications for the heart. Both the aging heart and the diseased heart would encounter transient ischemic episodes which would activate the HIF-I and could cause the expression of HIF-1-responsive genes. In Zebrafish the Cx46 equivalent is called Cx48.5. Knockout of this gap junction protein causes severe cardiovascular abnormalities. The presence of Cx46 in heart could be a survival strategy to decrease Cx43 and prevent the passage of apoptotic signals to adjacent myocardial cells after stress. It is expected that Cx46 is up-regulated during transient ischemic episodes in heart. Further, as in the lens, it is likely that the Cx46 will enhance the degradation of Cx43, thus, playing a role in the well documented decrease in Cx43 in the diseased and aging heart. Overexpression of Cx46 in N/N epithelial cells caused the ubiquitin-proteasome directed degradation of Cx43. Since Cx43 loss is directly related to heart disease, a hypoxia-directed increase in Cx46 may cause a loss of Cx43. Thus, we expect that Cx46 is a hypoxia-specific gap junction protein which causes the loss of Cx43. This likely occurs through a proteasomal/ubiquitin-driven degradation of Cx43. If this is the case, then directed down-regulation of Cx46 could provide a novel treatment for heart disease. In one embodiment, the present invention contemplates down-regulation of CX46 using siRNA, in order to restore CX43 levels and protect cardiac cells from transient hypoxia.

EXPERIMENTAL

Cell Culture and transfection. Rabbit lens epithelial NNl 003 A cells, human lens epithelial cells (HLEC) and murine neuronal N2A cells were cultured in Dulbecco's modified Eagle's medium (DMEM, low glucose; Invitrogen, San Diego, CA) supplemented with 10% fetal bovine serum and 50 μg/mL gentamicin, 0.05 U/mL penicillin, and 50 μg/mL streptomycin (pH 7.4) at 37 °C in 5% CO₂ and 21% O₂ (normoxic conditions). MCF-7 cells were grown in Minimal Essential Medium (MEM) supplemented with Earl's salts, 10% FBS, glutamine, ImM sodium pyruvate, 0.01 mM nonessential amino acids, antibiotic/antimycotic, and 1.5 g/L sodium bicarbonate at 37 ⁰C under normoxic conditions (21% O₂, 5% CO₂). To generate a stable line of neuronal N2A cells expressing Cx46 or Cx43, the cDNA of rat Cx46 or rat Cx43 was cloned in pEGFP- N3 vector (BD Biosciences; cat. no. 6080-1) and transfection was carried out using Lipofectamine 2000 (Invitrogen). The selection of transfected cells was done by growing cells in the presence of G418 antibiotic (500ug/ml) for six weeks.

Antibodies. Rabbit polyclonal anti-Cx46 was purchased from US Biological, Massachusetts, MA (cat. no. C7858-07A). Anti-Cx50 (cat. no. 33-4300), anti-Cx26 (cat. no. 71-0500) and mouse anti-α-tubulin (cat. no. 32-2500) were purchased from Zymed- Invitrogen (San Francisco, CA). Anti-β-actin was purchased from Sigma (cat. no. A5441). Hypoxia. Hypoxia conditions were considered as 1% O₂, 5% CO₂ at 37°C and 100% relative humidity. Hypoxia conditions were created by a Proox C21 hypoxic chamber (BioSpherix, NY) using nitrogen and CO₂ as displacement gases. Normoxia conditions were considered as 21% O₂, 5% CO₂ at 37⁰C and 100% relative humidity. For hypoxia studies, 6 ^χlθ⁵ rabbit NNl 003 A cells were pre-incubated with DMEM low glucose media (supplemented with 10% FBS) at 21% O₂, 5% CO₂ (normoxic conditions) for 12 h. Following this incubation, the media was replaced with DMEM low glucose complete media that was pre-equilibrated to 1% O₂ .Then the cells were incubated under hypoxic conditions (1% O₂, 5% CO₂) in Proox C21 hypoxic chamber (Biospherix, NY) and harvested after 1-7 days. Whole cell lysates were run on 8% SDS-PAGE followed by western blot to check the expression levels of different proteins.

Whole cell lysate preparation and Western Blot. NNl 003 A, HLEC, MCF-7 or MEC cell lysates were prepared as previously described; Western blot was performed as previously described. See Akoyev, V & Takemoto D. J. ZO-I is required for protein kinase C gamma-driven disassembly of connexin Cellular Signalling 19, 958-967 (2007).

siRNA transfection: Anti-Cx46 siRNA (cat. no. SI00131670, Target: CGC ATG GAA GAG AAG AAG AAA) and negative non-silencing control siRNA (cat. no. 1023076) were purchased from Qiagen (Valencia,CA). HLEC or MCF-7 cells were cultured in their respective medium under normoxic conditions (5% CO₂, 21% O₂) on 60 mm dishes. 20 X 10⁵ HLEC or MCF-7 cells were transfected with 512 ng of Cx46 siRNA (Final cone.1OnM) or 512 ng negative control siRNA and 20 uL of HiPerFect transfectant reagent (Qiagen, cat. no. 301704). After transfection, cells were incubated under normoxic conditions (21% O₂, 5% CO₂) and harvested at different time intervals (24 h and 48 h for HLEC and 12 h, 24 h and 48 h, for MCF-7 cells). Whole cell lysates were analysed by western blot.

Cell Viability Assay. Cell viability assay was performed using CellTiter-Blue^® Cell Viability Assay kit (Promega Madison, WI).The kit applies the fiuorometric detection of resorufin converted from resazurin by viable cells. The amount of fluorescence measured is directly proportional to the number of viable cells. For this assay, 3O x 10³ HLEC or MCF-7cells, in 100 uL of DMEM low glucose media or MEM media respectively, were seeded into each well in 96 well micro-titer plates and cultured for 14 h at 37°C under normoxic conditions (21% O₂, 5% CO₂). The cells were then transfected with IOng (per well, final cone.1OnM) of Cx46 siRNA or 10 ng negative non-silencing siRNA along with .75ul (per well) of HiPerFect transfectant reagent and incubated for 24 h under normoxic conditions (21% O₂, 5% CO₂). Cells with no siRNA treatment were considered as controls. Following this incubation, the media for HLEC or MCF-7 cells were changed with lOOuL (per well) of their respective media that was equilibrated to 1% O₂. Then the cells were incubated under hypoxic conditions (21% O₂, 5% CO₂) in Proox C21 hypoxic chamber (Biospherix, NY) for different time intervals depending on cell type (6 h, 12 h, 18 h and 36 h for HLEC and 12 h and 24 h for MCF-7 cells). Another set of 96-well plates of HLEC or MCF-7 cells with similar siRNA treatment containing lOOuL media but equilibrated to 21% O₂ were incubated under normoxic conditions (21% O₂, 5% CO₂) for the same interval of time. For the estimation of number of viable cells, 20 uL of Cell Titer-Blue reagent was added in each well for MCF-7 or HLEC cells incubated under hypoxic or normoxic conditions and following incubation, for 4 h for HLEC or 3 h for MCF-7 cells, at 37⁰C, fluorescence was recorded at 560(5) _Ex/ 590(5) _Em.

To determine the cell viability of wild type N2A cells and N2A cells overexpressing Cx46-GFP or Cx43 GFP under hypoxic or normoxic conditions, 30 x 10³ cells (per well of 96 well micro-titer plate) were cultured in lOOuL DMEM low glucose media for 14 h at 37°C under normoxic conditions (21% O₂, 5% CO₂).Then the media was replaced with lOOul (per well) DMEM low glucose media equilibrated to 1% O₂ or 21% O₂. The cells were then incubated under hypoxic or normoxic conditions and cell viability was assessed every 4h for up to 24 h. To measure the number of viable cells 20 uL of Cell Titer-Blue reagent was added in each well, incubated for 4 h at 37⁰C and fluorescence was recorded at 560(5) _Ex/ 590(5) _Em. Reverse transcriptase (RT)-PCR. Total RNA was purified from MEC, MCF-7 and HLEC cells using RNeasy Mini Kit (Qiagen) and RT-PCR was performed using one step RT-PCR kit (Qiagen, cat. no. 210212) according to the instruction manual with Cx46 specific primers and β-actin primers as control. Reverse transcription was performed at 50⁰C for 30 min. For PCR, initial activation was done at 95⁰C for 15 min, denaturation at 95⁰C for 30 sec, annealing at 60⁰C for 30 sec. PCR was performed at 35 cycles with final extension at 70⁰C for 10 min. The primer set for Cx46 cDNA were 5'-CTG GCC CTG CTG GCC TTG-3' and 5'-CCA CCA CCT GCT GAT GAC-3'. The primers for β-actin were 5'-GAA ATC GTG CGT GAC ATT AAG-3' and 5'-CTA GAA GCA TTT GCG GTG GAC GAT-3'. The PCR products were run on 1% agarose gel at 90 V for 80 min. Gels were photographed using Fotodyne software. PCR products were sequenced for confirmation.

Immunohistochemical study. Immunohistochemsitry was performed on paraffin- embedded human breast tumor tissue (Histologic type: Infiltrating ductal carcinoma;

Histologic grade: Nottingham grade 3; Tumor type: PT2, PNO, PMO with undetected lympho vascular invasion). Tissue slides were baked for 1 h at 56°C. Paraffin was washed off the tissue by rinsing three times in xylene for 5 min each, followed by graded series of ethanol washes. Slides were washed with distilled water twice before incubating with antigen retrieval in a steamer for 20 min. Slides were incubated in 3% hydrogen peroxide and washed twice in PBS-T. Slides were blocked in horse serum for 1 h and then rabbit

Cx46, 1:200 (US biological), was applied for 1 h. Slides were washed for 15 min in PBS-

T and incubated in secondary antibody, anti-rabbit 1 :200, for 45 min. ABC Elite reagent was applied for 15 min before incubating with DAB. Slides were counterstained and coversliped.

Human breast tumor and normal tissues. The human breast tissues were purchased as tissue lysates from Protein Biotechnologies (Ramona, CA). The characterisations of human breast tumors tissues are as follows; Tumor breast tissue 1 : Infiltrating Ductal Carcinoma, grade 2, stage EtA. T2N0M0, source: female, 42 years; Tumor breast tissue 2: Invasive Ductal Carcinoma, grade 2, stage HA. T2N0M0, source: female,42 years. The Human adult normal tissue lysate was purchased from Novus Biologicals (Littleton, CO). 20 ug of total protein of each lysate was loaded and run in 8% agarose gel. The blot was probed with rabbit polyclonal anti-Cx46 antibody (1 :500; US Biological) and developed as described previously²².

Xenograft tumors of MCF-7 cells in Nu/Nu Mice: Nu/Nu mice (strain NuFox" ) were purchased from Charles River Laboratory. Mice were implanted with 17 β-estradiol (1.7 mg/pellet) one week before the injection of 1 x 10 MCF-7 breast cancer cells subcutaneously into the inguinal region of mammary fat pad. Cell viability of MCF-7 cells was performed prior to the injection. Mice were observed for any change in behavior, appearance or weight. Tumors were injected with 7.5 ug of anti-Cx46 siRNA or negative non-silencing siRNA or no siRNA (control) every 40 h for minimum of 10 days to maximum of 20 days at two-three different locations of each tumor. The tumor size was measured in two dimensions by a caliper every other day before injection. The tumor volume was estimated by the formula: tumor volume = a (b²)/2, where a and b is the tumor length and width respectively in mm. The tumor size measured prior to first siRNA injection is considered day 0 measurement. After 10 days of first injection, two anti-Cx46 siRNA treated, one negative non-silencing siRNA treated and one control (no siRNA) tumors were dissected out. Three anti-Cx46 siRNA treated tumors were dissected out at day 16. The rest of the anti-Cx46 siRNA treated tumors were isolated from euthanised mice at day 20. Tumors dissected out were homogenised and lysed in RIPA buffer. The lysates were sonicated for 10 sec for three times. Whole tumor tissue lysate were quantitated by Bio-Rad Protein Assay and analysed by western blot.

Statistical analysis: The level of significance (see in figure legends) was considered at P < 0.01 or P O.001 using paired- 1 test analyses. All data are presented as mean ± s.e.m. of at least three independent experiments. EXAMPLE 1

In this example, we demonstrate that Cx46 protein is upregulated in response to hypoxia (1% O₂), in vitro, in rabbit lens epithelial NNl 003 A cells (Fig. Ia). Cells were subjected to hypoxia or normoxia and harvested at 1-7 days. Cx46 protein level was analysed by western blot using anti-Cx46 antibody. Tubulin acted as a loading control. Normoxia treatment (21% O₂, 5% CO₂) had no effect on Cx46 proteins level. We downregulated the Cx46 protein in human lens epithelial cells (HLEC) using siRNA and investigated the effect of Cx46 downregulation on cell viability under hypoxic conditions (1% O₂, 5% CO₂). 20 X 10⁵ cells were transfected with 512 ng anti-Cx46 siRNA (final cone.1OnM) or 512ng negative non-silencing siRNA and the level of knockdown was determined by western blot at 24 and 48 h after transfection (Fig Ib). Densitometric analyses (Figure Ic) showed effective knockdown (more than 85%) of Cx46 was achieved. Cx50 blot was done to show specific action of anti Cx46-siRNA. The non- silencing siRNA control showed no appreciable reduction (Fig Id). Viability was investigated. Briefly, 30 X 10³ HLEC (per well of 96 well micro- titer plate) were treated with 10 ng (per well, final cone.1OnM) of anti-Cx46 siRNA or non-silencing siRNA or no siRNA (control) and pre-incubated for 24 h at normoxia conditions (21% O₂, 5% CO₂). Then the cells were incubated at 1% O₂ and cell viability was measured by fiuorometric resazurin reduction method at 6, 12, 18 and 36 h intervals. Data are represented as mean ± s.e.m of three independent experiments. Asterisk indicates significant statistical difference (P<0.01) between indicated data and control. HLEC with Cx46 knocked-down showed significant reduction in cell viability under hypoxic conditions (Fig. Ie). Anti-Cx46 siRNA treated HLEC viability was reduced to 23% at 6 h, 38% at 12 h and 42% at 18 h compared to untreated (control) or non- silencing siRNA treated cells under hypoxia. Interestingly, Cx46 downregulation had no effect on HLEC viability under normoxic conditions which suggested that Cx46 provides protections to lens cells only against hypoxia induced death. EXAMPLE II

In this example, we investigated whether the protective function of Cx46 in hypoxia is specific for Cx46. To test this, Cx46 was stably overexpressed as a GFP tagged fusion protein in murine neuronal N2A cells. A stable line of N2A cells overexpressing Cx43-GFP fusion protein was also generated to test the effect of another gap junction protein, Cx43, on hypoxia induced death. N2A cells do not express endogenous Cx46 or Cx43 proteins. N2A cells transfected with Cx43-GFP or Cx46-GFP expressed fusion proteins of predicted molecular weight of ~71kDa and 73kDa, respectively as determined by western blot using antibody against GFP (data not shown). These N2A cells overexpressing Cx46-GFP or Cx43-GFP were incubated under hypoxic conditions (1% O₂, 5% CO₂) or at normoxic conditions (21% O₂, 5% CO₂) and cell viability was assessed by fluorometric resazurin reduction method. More specifically, 30^χ l0³ wild type N2A cells or N2A cells overexpressing Cx46 or Cx43 were incubated under hypoxic conditions (1% O₂, 5% CO₂). The viability was assessed every 4 h for up to 24 h by fluorometric resazurin reduction assay. The data are plotted as mean ± s.e.m of three independent experiments. Asterisk indicates the statistical significance (PO.01) between indicated data and control (N2AWT). Wild type N2A cells were hypoxia sensitive as they began to die after 4 h under hypoxic conditions and cell viability was reduced 40% at 12 h and almost 90% at 24 h (Fig. 2). The cell viability of N2A cells overexpressing Cx43-GFP showed the same pattern as wild type N2A cells with cell viability reducing significantly during 4-24 h time period at 1% O₂ (Fig. 2b). But interestingly, N2A cells overexpressing Cx46-GFP remained viable to a considerable extent even after 12 h at 1% O₂. The cell viability of these cells was only reduced 3% at 12 h and 51% at 24 h at 1% O₂. No reduction in cell viability was observed for all these three types of cells under normoxic conditions (Supplementary Information, Fig. S2b). Taken together, these results suggested that Cx46 can confer protection to a hypoxia sensitive cell while another connexin, Cx43, cannot. EXAMPLE III

In this example, we show, for the first time, that human breast cancer cells and human breast tumor tissue also express Cx46 protein. Expression of Cx46 protein was detected in human breast cancer cells MCF-7 as determined by western blot analyses; however, in normal human mammary epithelial (HMEC) cells and non-tumorigenic transformed breast epithelial cells (MCF-IOA) the expression was not seen (Fig. 3a). RT- PCR results (Fig. 3b) correlated with western blot analyses where Cx46 protein expression was only detected in MCF-7 cells.

We further investigated the expression of Cx46 protein in human breast tumor tissue. Pre-metastatic breast tumors also express Cx46 protein as determined by immunohistochemistry (Fig. 3c) and western blot (Fig. 3d) analysis. For immunohistochemical study, a standard protocol for 3, 3 diaminobenzidine (DAB) was used. The blue arrow indicates Cx46 staining. The characterisation of this tumor breast tissue is infiltrating ductal carcinoma, grade 3, T2N0M0. At the lowest panel, western blot analysis shows Cx46 protein is upregulated in pre-metastatic breast tumor tissue. Tumor breast tissue 1 : Infiltrating Ductal Carcinoma, grade 2, stage HA. T2N0M0, source: female, 42 years; Tumor breast tissue 2: Invasive Ductal Carcinoma, grade 2, stage DA. T2N0M0, source: female, 54 years. Indeed, Cx46 protein was present in pre- metastatic breast tumor and the protein was upregulated in tumor tissues as compared to normal breast tissue (Fig. 3d).

The presence of Cx46 in breast tumors led us to hypothesise that breast cancer cells and breast tumors also use Cx46, as an adaptation to hypoxia, to survive and grow. To confirm this Cx46 protein was downregulated in MCF-7 cells using anti-Cx46 siRNA. Briefly, 20 X 10⁵ MCF-7 cells were transfected with 512 ng anti-Cx46 siRNA (final cone. 1OnM) or negative non-silencing siRNA. The level of knockdown was determined by western blot at 12, 24 and 48 h after transfection. Maximum knockdown using anti-Cx46 siRNA was achieved between 24-48hr time period (Fig 3e). A Cx26 blot was done to show the absence of any non-specific action of anti-Cx46 siRNA in MCF-7 cells. The blot associated with the negative non-silencing siRNA (Fig. 3f) showed no significant knockdown.

Downregulation of Cx46 remarkably reduced the MCF-7 cell viability (Fig. 3g). Briefly, 30><10³ MCF-7 cells (per well of 96 well micro-titer plate) were pre-incubated with IOng (per well, final cone. 1OnM) negative control siRNA or anti-Cx46 siRNA for 24 h at normoxic conditions (21% O₂, 5% CO₂) and then cells were kept at hypoxic conditions (1% O₂, 5% CO₂). Cell viability was assessed every 12 h intervals for up to 24 h. The data are represented as mean ± s.e.m of three independent experiments. The asterisk indicates significant statistical difference (PO.01) between indicated data and control to approximately 34% at 12 h and 40% at 24 h under hypoxic conditions (1% O₂, 5% CO₂) as compared to control (no siRNA) or negative non-silencing siRNA treated cells (Fig.3g). As seen in the case for HLEC cells, the downregulation of Cx46 had no effect on MCF-7 cell viability under normoxia (data not shown). This data clearly demonstrated that human breast cancer cells MCF-7 utilize Cx46 to survive against death caused by hypoxia.

EXAMPLE IV

In this example, we carried forward our work to an in vivo mouse system. We asked whether Cx46 plays a similar and significant hypoxia-protective role in the growth of human breast tumors using a tumor-bearing xenograft mice model. Estrogen stimulated immunodeficient Nu/Nu mice were injected with 1 x 10⁷ MCF-7 cells to develop tumors of human origin. More specifically, mice were implanted with 17β-estradiol (1.7 mg/pellet) followed by the injection of 1 x 10 MCF-7 cells subcutaneously into the inguinal region of mammary fat pads to develop breast tumors. 10 days after MCF-7 cells injection, the tumors were directly injected with 7.5ug of anti-Cx46 siRNA (n=10 tumors) or negative non-silencing siRNA (n=7 tumors) or no siRNA (control, n=7 tumors) every 40 h for a minimum of 10 to a maximum of 20 days. Tumor size was measured perpendicularly by a caliper every alternate day prior to siRNA injection and hence the tumor size measured prior to first injection was considered as day 0 (measurement). We found that after 10 days of siRNA injection (total of five siRNA injections with injection every 40 h), all the tumors with no siRNA (n= 7 tumors) and most rumors that received non-silencing (n=6 tumors) siRNA treatment increased in size (although tumor 19 appeared to stop growing) with time (see Tables 1 and 3). Importantly, no notable reduction in size of control (no siRNA) or non-silencing siRNA injected tumors was observed even after 18 days (see Tables 1 and 3). However, anti-Cx46 siRNA treatment inhibited the tumor growth significantly in most cases (only Tumors 8 and 13 appeared to continue to grow in the Day 8 to 10 period) (see Table 2). When looking at the time period from day 10 to day 18 for the anti-Cx46 siRNA treated tumors (see Table 2), either reduction in size or no appreciable increase in growth was seen.

To confirm that the inhibition of anti-Cx46 siRNA treated tumor growth is due to Cx46 protein downregulation, we analysed the tumors by western blot. Briefly, Mice were euthanised and tumors were dissected and isolated after 10 days of siRNA treatment. Tumors were harvested and western blot was performed on whole tissue lysate using rabbit anti-Cx46 antibody. The same blot was reprobed with anti-Cx26 antibody to show the specificity of anti-Cx46 siRNA action in vivo. Out of ten anti-Cx46 siRNA injected tumors, five tumors (tumors 16 and 17 at day 10, tumor 10 at day 16, tumors 14, 15 and 11 at day 18) presented reduced level of Cx46 protein (Figs 4a, 4b and 4c); two tumors (tumors 13 and 8 at day 16) showed no reduction in Cx46 protein expression. Two tumors (tumors 9 and 10) became too small to be analysed by western blot. The two anti-Cx46 siRNA injected tumors (tumors 13 and 8) that showed no decrease in Cx46 protein level were associated with less inhibited tumor growth as compared to other tumors of same treatment (see Table 2). We also measured Cx26 protein level in all tumors to investigate any nonspecific effect of the siRNA but no change of Cx26 protein was observed. This suggested that Cx46 knockdown data were consistent with decreased tumor growth. EXAMPLE V

In this example, we seek to determine how overexpression of CX46, after transient hypoxia, causes down-regulation of CX43 in HPc2 myocardiac cells in culture. The gap junction protein, Cx43, is known to have a turnover rate of 1.5-5 h. Degradation of Cx43 is known to be through both the lysosomal and proteasomal pathways and ubiquitination is essential for both. Cx43 ubiquitination is controlled by a MAPK pathway which directs binding of the E3 ubiquitin ligase Nedd4, a process which is controlled by Cx43 phosphorylation. The interaction of the Nedd4 is at a proline-rich region conforming to the consensus PY sequence (XPPXY) which is on the C-terminus of Cx43 at residues 282-286. Ubiquitination on lysines occurs at many sites on Cx43 but one K is at residue 287. Cx46 also has a XPPXY site at residues 274-279 but lacks the nearby K site. We hypothesize that Cx46 induces the ubiquitination, and, subsequent degradation of Cx43 through binding Nedd4 and bringing it to the gap junction plaque. Gap junction plaques are known to exist in eaveolin-containing lipid rafts which contain both Cx43 and Cx46. Overexpression of Cx46 should, in a myocardiac cell, cause the ubiquitination and degradation of Cx43. This should not occur in similar cells which over-express a Cx46 which lacks the correct Nedd4 site.

Myocardiac cells in culture will be transfected with plasmid for Cx46 or Nedd4- site mutated Cx46. Following overexpression, cells will be examined for growth properties using a cell viability dye assay, presence of Cx43 protein and transcript, ubiquitination of Cx43, using both confocal co-localization and Western blot, and reversal by a proteasomal inhibitor. Over-expression of cells with Cx50 will be used as a control. For mutations the Cx46 will be altered as: P275L and Y277F/Y278F using standard site-directed mutagenesis procedures. In these studies we will also examine how Cx46 overexpression can occur in these normal myocardiac cells. The Cx46 gene contains a hypoxia response element. Following exposure of the myocardiac cells to transient hypoxia (1-20% oxygen for 1 hr, at 4 hr intervals for up to 4 days) the ceils will be examined for changes in Cx46 and Cx43 protein and transcript levels. Long term exposure of epithelial cells to hypoxia causes a strong up-regulation of Cx46 protein. Oxygen levels will be varied to reflect different ischemic conditions (1,5, 10 and the normoxic 20% oxygen).

Transfection of myocardiac cells will take place when the cells have reached approximately 60% confiuency. The cells will be transfected using Lipofectamine 2000 (invitrogen). Four μg of the DNA plasmid (E.g. GFP-CX46 plasmid cloned into a Clontech pEGFP-N3 vector) and 0.1 mg of Lipofectamine in 250 μl of serum and antibiotic free media will be used for each transfection. The cells will be incubated with the DNA plasmid and Lipofectamine for 24 h at 37 ⁰C. After incubation, media containing twice the amount of fetal calf serum (20%) will be added for 24 h. Following this incubation, the media will be replaced with media containing 10% fetal calf serum. The transfected cells will be selected with 1 mg/ml G418 (Research Products International) for 6 weeks and grown in half that concentration of G418 thereafter. Transfection will be monitored by confocal microscopy and Western blot. Standard protocols will be used for site directed mutants of Cx46. For hypoxia studies cells will be cultured in a O₂/CO₂ dual controlled chamber (BioSpherix, ProOx model C21).

Expression of Connexin Proteins will be done as follows: Degradation of 43 caused by overexpression of Cx46 or by hypoxia, will be measured by standard PCR and by Western blot analyses. The H9c2 heart-derived cardiomyoblast cells will be cultured in DMEM. Cells will be harvested and 5 x 10 cells in a 75 cm culture flask will be lysed with ice cold extraction buffer: 2OmM Tris, pH 7.5, 0.5 mM EDTA, 0.5 mM EGTA, 0.5% Triton X-100, 25 ktg/ml aprotinin and leupeptin. Equal amount of protein, determined by Pierce Protein assay, will be used. Proteins will be separated on SDS- PAGE and transferred to nitrocellulose membranes and probed with Cx43 or Cx46 antisera then visualized by ECL. This will identify which connexin proteins are present and/or the effect of overexpressed Cx46 on Cx43 protein levels. Effects on transcript and reversal by proteasome inhibitors will also be done using treatments with (ALLN at lOOμM and clasto-Lactacystin β- lactone at 10 μM, both for 4 hrs) proteasomal inhibitors. Binding of Cx43 or Cx46 to Nedd4 will be determined using co-immunoprecipitation studies and by confocal co-localization. EXAMPLE VI

In this example, we seek to determine if down-regulation of CX46 using siRNA, will restore CX43 levels and protect cardiac cells from transient hypoxia, restore normal cell hypoxia response properties, and lower Cx43 associated ubiquitination. Western blots of immunoprecipitated Cx43, with ubiquitin antisera, will also be used.

The downregulation of Cx46, in lens cells, caused an increased cell death due to hypoxia (1% oxygen, 1-7 days). In lens, the major driving force for increased Cx46 would be hypoxia. Since the lens requires hypoxia, a loss of Cx46 caused cell death. The opposite should occur in the myocardiac cells, which require oxygen. Both short and long term studies under hypoxia will be done for the myocardiac cells.

Knockdown of connexin46 by siRNA: The siRNA transfectant reagent (Cat. No 301605) and siRNA (Cat. No. S 100131670) against Connexin 46(Gene ID 2700) will be purchased from Qiagen (Valencia, CA). We have found this siRNA to be effective in knocking down Cx46 in human lens epithelial cells (HLEC) after 24 hr of transfection. The target sequence for this siRNA is GCATGGAAGAGAAGAAGAAA. The day before transfection 2.0 x 10⁵ myocardiac cells, exposed to transient hypoxia for up- regulation of Cx46, will be seeded in each well of a 6-well plate in 2.3 mL of DMEM low glucose media containing 10% fetal bovine serum. Transfection will be carried out with 150 ng of Cx46 siRNA diluted in 100 uL DMEM media without serum to make the final siRNA concentration of 5 nm for each well. The diluted siRNA will be mixed with 12 uL of HiPerFeet transfection reagent (Qiagen) and added drop-wise onto cells. The down-regulation of Cx46 protein will be determined by Western blot analysis at 24, 48 and 72 hours after transfection. Effects on cell viability will be measured.

Transient exposure of myocardiac cells to hypoxia should cause up-regulation of Cx46 which should be reversed by treatment with siRNA to Cx46. Once the Cx46 levels are down-regulated the myocardiac cells will be examined for return to normal responses to hypoxia: 1) phosphorylation of Cx43 using p368 antisera and Western blots of immunoprecipitated Cx43, 2) activation of PKCε using a PKC assay, 3) translocation of PKCε and Cx43 to mitoehondria and, 4) activation of cytochrome C FV. These up- regulation and reversal studies are designed to mimic what would occur in a heart exposed to transient ischemia. It is proposed that the use of the siRNA for targeting Cx46, will provide a novel drug strategy.

It will be appreciated that modifications to the embodiments described in detail above, are of course possible. Accordingly, the present invention is not limited to the embodiments which have been described in detail above. Various other embodiments and ramifications are possible within the scope.

Table . ¹I The volume (mm ) of no siRNA injected (control) tumors measured every alternate day prior to injection. E = Euthanised.

Table 2 The volume (mm³) of anti-Cx46 siRNA injected tumors measured every alternate day prior to injection. Tumor 14 and tumor 15 appeared at Day 6. E = Euthanised.

Table 3 The volume (mm³) of negative non-silencing siRNA injected tumors measured every alternate day prior to injection. Tumor 23 appeared at Day 6. E = Euthanised.

Claims

1. A method of treating cancer in a subject, comprising reducing the expression ofConnexin 46.

2. The method of Claim 1, wherein said reducing is achieved by administering to said subject an effective amount of a short interfering ribonucleic acid (siRNA) directed to Connexin 46.

3. The method of claim 1, wherein the subject is a human being.

4. The method of claim 2, wherein the effective amount of the short interfering ribonucleic acid (siRNA) is from about 1 nM to about 100 nM.

5. The method of claim 2, wherein the short interfering ribonucleic acid (siRNA) is administered in conjunction with a delivery reagent.

6. The method of claim 5, wherein the delivery agent is selected from the group consisting of lipofectin, lipofectamine, cellfectin, polycations, nanoparticles and liposomes.

7. The method of claim 1, wherein the cancer is breast cancer.

8. The method of claim 2, wherein said siRNA is directed to the SEQ ID NO:1.

9. The method of claim 2, wherein the short interfering ribonucleic acid (siRNA) is administered by an enteral administration route.

10. The method of claim 9, wherein the enteral administration route is selected from the group consisting of oral, rectal, and intranasal.

11. The method of claim 2, wherein the short interfering ribonucleic acid (siRNA) is administered by a parenteral administration route.

12. The method of claim 11, wherein the parenteral administration route is selected from the group consisting of intravascular administration, peri- and intra-tissue injection, subcutaneous injection or deposition, subcutaneous infusion, and direct application at or near the site of the tumor.

13. The method of claim 12, wherein the intravascular administration is selected from the group consisting of intravenous bolus injection, intravenous infusion, intra- arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature.

14. The method of claim 12, wherein the peri- and intra-tissue injection is selected from the group consisting of peri-tumoral injection, and intra- tumoral injection.

15. A method of inhibiting expression of Connexin 46 in a tumor comprising: administering to a subject having a tumor an effective amount of a short interfering ribonucleic acid (siRNA) directed to a sequence of Connexin 46.

16. The method of claim 15, wherein the subject is a human being.

17. The method of claim 15, wherein the effective amount of the short interfering ribonucleic acid (siRNA) is from about 1 nM to about 100 nM.

18. The method of claim 15, wherein the short interfering ribonucleic acid (siRNA) is administered in conjunction with a delivery reagent.

19. The method of claim 18, wherein the delivery agent is selected from the group consisting of lipofectin, lipofectamine, cellfectin, polycations, and liposomes.

20. The method of claim 15, wherein the cancer is breast cancer.

21. The method of claim 15, wherein said siRNA is directed to the SEQ ED NO:1.

22. The method of claim 15, wherein the short interfering ribonucleic acid (siRNA) is administered by an enteral administration route.

23. The method of claim 22, wherein the enteral administration route is selected from the group consisting of oral, rectal, and intranasal.

24. The method of claim 15, wherein the short interfering ribonucleic acid (siRNA) is administered by a parenteral administration route.

25. The method of claim 24, wherein the parenteral administration route is selected from the group consisting of intravascular administration, peri- and intra-tissue injection, subcutaneous injection or deposition, subcutaneous infusion, and direct application at or near the site of the tumor.

26. The method of claim 25, wherein the intravascular administration is selected from the group consisting of intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature.

27. The method of claim 25, wherein the peri- and intra-tissue injection is selected from the group consisting of peri-tumoral injection, and intra-tumoral injection.

28. A delivery reagent comprising a short interfering ribonucleic acid (siRNA) directed to a sequence of Connexin 46.

29. The delivery reagent of Claim 28, wherein said sequence of Connexin 46 is SEQ ID NO:!.