WO2005047321A2 - Polynucleotides for inhibition of polypeptide expression and methods of use - Google Patents

Abstract

The present invention provides polynucleotides that can inhibit expression of polypeptides such as a UbcH7 polypeptide, an E6-AP polypeptide, a mucin-1 polypeptide, or a mucin-2 polypeptide. The present invention also provides methods of using the polynucleotides.

Description

POLYNUCLEOTIDES FOR INHIBITION OF POLYPEPTIDE EXPRESSION AND METHODS OF USE

CONTINUING APPLICATION DATA This application claims the benefit of U.S. Provisional Application Serial No. 60/520,479, filed 14 November 2003; U.S. Provisional Application Serial No. 60/577,002, filed 04 June 2004; and U.S. Provisional Application Serial No. 60/538,740, filed 23 January 2004, each of which is incorporated by reference herein

GOVERNMENT FUNDING The present invention was made with government support under

Grant No. DK56833, awarded by the National Instititutes of Health. The Government may have certain rights in this invention.

BACKGROUND Breast cancer is the primary killer of women. One in eight

American women will develop breast cancer in her lifetime. In 2001, an estimated 192,700 women in the U.S. will be diagnosed with invasive breast cancer and 42,600 with in situ (tumors contained in the milk ducts). An estimated 40,000 will die from the disease. An estimated 3 million women in the U.S. today are living with breast cancer, of which 2 million have been diagnosed with the disease and 1 million have the disease but do not yet know it. The incidence of breast cancer in the U.S. has more than doubled in the past 30 years. In 1964, the lifetime risk was 1 in 20. Today it is 1 in 8. Breast cancer is the most commonly diagnosed cancer in women in both America and worldwide. Breast cancer rates are the highest in industrialized countries. It is estimated that 1.2 million new diagnoses and 500,000 deaths from breast cancer will occur worldwide this year. Further, it appears that breast cancer is the leading cause of death for American women of ages 25 to 55 years. Prostate cancer is the most common cause of cancer in men. In 1996, 317,000 new cases of prostate adenocarcinoma were diagnosed and over 41,400 men died of the disease (Karp et al., Cancer Res., 56:5547- 5556 (1996)). The chance of a man developing invasive prostate cancer during his lifetime is 1 in 6 or 13.4%. At the age of 50, a man has a 42% chance of developing prostate cancer and 2.9% of dying from the disease. While advances in early diagnosis and treatment of locally confined tumors have been achieved, prostate cancer is incurable once it has metastasized. Patients with metastatic prostate cancer on hormonal therapy will eventually develop an androgen-refractory (androgen independent) state that will lead to disease progression and death. It has long been accepted that steroid hormone receptors, such as estrogen receptors, progesterone receptors, and androgen receptors, play an important role in the biology of endocrine-related cancers. The majority of the tumors of endocrine-related cancers express high levels of steroid hormone receptors in contrast to the normal tissue. Also the presence of steroid hormone receptors often predicts a more favorable disease outcome and treatment response, and is an established prognostic marker in breast cancer. Current endocrine therapies of steroid hormone receptor positive cancers are used, but the effectiveness of these therapies is limited by several factors. For instance, in breast cancer, only 60-70% of breast cancers are positive for the steroid hormone receptor estrogen receptor. Also, many endocrine-related cancers develop resistance to endocrine therapies (Clarke et al., Proc. Natl. Acad. Sci. U S A, 86:3649-3653 (1989), Nicholson et al., Cancer Surv., 5:463-486 (1986), and Nicholson et al., J. Clin. Pathol., 48:890-895 (1995)). Mucins are high-molecular weight glycoproteins with a high content of clustered oligosaccharides O-linked to tandem repeat peptides rich in serine, threonine and proline. There are two structurally and functionally distinct classes of mucins: secreted gel-forming mucins (MUC2, MUC5AC, MUC5B, and MUC6) and transmembrane mucins (MUC1, MUC3A, MUC3B, MUC4, MUC12, MUC17). MUC1 and MUC2 over-expression has been observed in colon cancers. MUC1 mucin is increased in expression in human colon cancers, which correlates with a worse progression (Nakomori et al., Gastroenterol., 106:353-361 (1994)), and has been linked to aggressive tumors in human breast carcinoma. MUC2 may play a role in the metastasis of mucinous colon cancer (Schwartz et al., Int. J. Cancer, 52:60-65 (1992), Sternberg et al., Gastroenterol., 116:363-371 (1999 ), Bresalier et al., J. Clin. Invest., 87:1037-1045 (1991)) although MUC2 down versus up- regulation in non-mucinous colorectal cancer is still debatable (Chang et al., Gastroenterol., 107:160-172 (1994); Weiss et al, 1994, and Chu et al., Am. J. Clin. Patho , 121(6):884-92 (2004)). Pseudomyxoma peritonei is characterized by pathologic overproduction of mucin 2 protein (MUC-2), which accumulates as an insoluble extracellular jelly (Bechtold et al., Abdom. Imaging, 26:406-410 (2001), Jackson et al., Mod. Pathol., 14:664-671 (2001), and O'Connell et al., Am. J. Pathol., 161: 551-564 (2002). The accumulation of mucin is a significant causes of the disease's morbidity and mortality. Mucins and mucin binding proteins in colorectal cancer have been recently reviewed by Byrd (Byrd et al., Cancer and Metastasis Reviews 23:77-99 (2004)).

SUMMARY OF THE INVENTION

The present invention represents an advance in the art of treating certain conditions in humans, such as breast cancer, prostate cancer, colon cancer, and pseudomyxoma peritonei. The present invention provides polynucleotides, such as RNA polynucleotides, that include a sense strand and an antisense strand. The sense strand includes a nucleotide sequence of between 16 and 30 nucleotides. When the nucleotide sequence is substantially identical to consecutive nucleotides of an raRNA encoding a polypeptide of SEQ ID NO:42 (e.g., nucleotides depicted at SEQ ID NO: 13), the polynucleotide inhibits expression of a UbcH7 polypeptide. When the nucleotide sequence is substantially identical to consecutive nucleotides of an mRNA encoding a polypeptide of SEQ ID NO:43 (e.g., nucleotides depicted at SEQ JD NO: 17), the polynucleotide inhibits expression of an E6-AP polypeptide. When the nucleotide sequence is substantially identical to consecutive nucleotides of an mRNA encoding a polypeptide of SEQ ID NO:46 (e.g., nucleotides depicted at SEQ JD NO:23), the polynucleotide inhibits expression of a mucin-1 polypeptide. When the nucleotide sequence is substantially identical to consecutive nucleotides of an mRNA encoding a polypeptide of SEQ ID NO:47 (e.g., nucleotides depicted at SEQ ID NO:31), the polynucleotide inhibits expression of a mucin-2 polypeptide. The sense strand may include a nucleotide sequence of between 19 and 23 nucleotides, and the sense strand may begin with an AA dinucleotide. Optionally, the sense strand and the antisense strand are a covalently linked by spacer having at least 3 nucleotides. Specific examples of polynucleotides include SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:24, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:33, or SEQ ID NO:36. The polynucleotides of the present invention may be part of a composition that includes, for instance, a pharmaceutically acceptable carrier. The present invention also includes a vector having a DNA polynucleotide encoding the a polynucleotide of the present invention, and a cell containing the DNA polynucleotide. The present invention further provides a method for inhibiting expression of a polypeptide. The method includes administering into a cell an effective amount of a polynucleotide, preferably an RNA polynucleotide, of the present invention., wherein the cell containing the polynucleotide has less of the polypeptide when compared to the same polypeptide present in a corresponding control cell that does not contain the polynucleotide. The polypeptide that is inhibited can be a UbcH7 polypeptide, an E6-AP polypeptide, a mucin-1 polypeptide, or a mucin-2 polypeptide. The cell can be ex vivo or in vivo. The administration can be to a subject, preferably a human, and can occur during surgical resection of a tumor or resection of mucinous material. The administration can be by, for instance, perfusion of the area from which the tumor and/or mucinous material was resected, or by deposition of an implant in the area from which the tumor or mucinous material was resected. Alternatively, the administration can be done before resection, for instance, by intravenous injection of a composition including the polynucleotide and a pharmaceutically acceptable carrier. The present invention also provides a method for treating cancer in a subject. In one aspect, the method includes administering to a subject an effective amount of a polynucleotide, preferably an RNA polynucleotide, of the present invention, wherein the subject has or is at risk for an endocrine-related cancer, such as breast cancer or prostate cancer, wherein a symptom associated with the cancer is decreased. In another aspect, the method includes administering to a subject an effective amount of a polynucleotide, preferably an RNA polynucleotide, of the present invention, wherein the subject has or is at risk for a cancer having the symptom of mucin-overproduction, wherein a symptom associated with the cancer is decreased. Examples of such cancers are colon cancer, pseudomyxoma peritonei, and breast cancer. The subject may be a human being, and the administration may occur during surgical resection of a tumor and/or mucinous material. The administration can be by, for instance, perfusion of the area from which the tumor and/or mucinous material was resected, or by deposition of an implant in the area from which the tumor and/or mucinous material was resected. Alternatively, the administration can be done before resection, for instance, by intravenous injection of a composition including the polynucleotide and a pharmaceutically acceptable carrier. BRIEF DESCRIPTION OF THE FIGURES

Figure 1. A: UBCH7 modulates the hormone-dependent transcriptional activity of various nuclear hormone receptors. HeLa cells were transiently transfected with receptor expression plasmid for PR-B, GR, AR, RAR and their cognate hormone response elements in the presence or absence of UBCH7. Later, cells were treated with respective hormones as follows: PR, progesterone (IO-7M); AR, R1881 (2.5X10-ιoM); GR, Dexamethasone (10-?M); and RAR, Retinoic acid (10- ₇M). Hormone treated cells are referred to as +H, and untreated cells are referred to as -H. Cells were harvested after 24 hrs and assayed for luciferase activity and bars are mean and SD from three different determinations. The data is presented as fold activation. The activity of receptor in the presence of hormone and in the absence of UBCH7 was defined as 1-fold, and the data for other bars were scaled accordingly. B: UBCH7 modulates the hormone-dependent transcriptional activity of endogenous PR in T47D cells. T47D cells were transiently transfected with reporter plasmid that contain the progesterone response element in the presence and absence of UBCH7. Cells were treated with progesterone (IO-7M) and after 24 hours cells were harvested and assayed for luciferase activity. Hormone treated cells are referred to as +H, and untreated cells are referred to as -H. The data is presented as fold activation. The activity of receptor in the presence of hormone and in the absence of UBCH7 was defined as 1-fold, and the data for other bars were scaled accordingly. C: Overexpression of UBCH7 in T47D cells had no significant effect on the expression levels of progesterone receptors. T47D cells were transfected either with control vector (pBKRSV) or UBCH7 vector (pBKRSV-UBCH7). Cells were treated with progesterone (IO-7M) and after 48hrs cells were harvested. The expression levels of PR protein were assessed by Western blot analysis using progesterone receptor specific antibodies, β-actin expression was used as a loading control. PROG, progesterone; PR-A, progesterone Receptor-A; PR-B, progesterone Receptor-B. D: Co-expression of UBCH7 had no significant effect on the transcriptional activity of nonnuclear hormone receptor transcription factors p53 and VP-16 activation domain. HeLa cells were transiently transfected with expression plasmid p53 or VP-16 activation domain along with their respective reporter plasmids, p21 promoter-LUC and 17mer-LUC, in the presence or absence of UBCH7. Data expressed as mean and SD of three different transfections. The data is presented as fold activation. E : Other ubiquitin-conjugating enzymes are not involved in steroid receptor transactivation pathway. Cells were transiently transfected with PR-B expression and progesterone responsive reporter plasmids in the presence of either control vector, UBCH5B expression plasmid, UBCH7 expression plasmid, UBCH8 expression plasmid or UBC12 expression plasmid. Cells were treated with progesterone (IO-7M) and after 24 hrs cells were harvested and assayed for luciferase activity. Hormone treated cells are referred to as +H, and untreated cells are referred to as -H. The data is presented as fold activation. The activity of receptor in the presence of hormone and in the absence of ubiquitin- conjugation enzyme was defined as 1-fold, and the data for other bars were scaled accordingly.

Figure 2. A: Depletion of endogenous UBCH7 levels reduces transcriptional activity of PR. HeLa cells were transiently transfected with PR and PRE-TATA- LUC expression plasmid and its response element in presence or absence of different UBCH7 siRNA's. Transfection was also done using GAPDH siRNA as a control. At 4 hours after transfection cells were treated either with progesterone (IO-7M) or vehicle (ethanol). Twenty-four hours after transfection cells were harvested and luciferase activity was assayed. The data is presented as fold activation. PROG, progesterone. B: Expression analysis of UBCH7 protein after siRNA treatment. Cell lysates were run on a 4-20% gradient gel, transferred onto nitrocellulose paper and protein levels were assessed by Western Blot using UBCH7 specific antibodies. Equal loading of samples was confirmed using β-actin specific antibodies. PROG, progesterone.

Figure 3. UBCH7 reverses the transcriptional interference between PR and ER. HeLa cells were transfected with 0.2 μg of PR expression plasmid, 0.3 μg of ER expression plasmid, 1.0 μg of PRE.TATA.LUC. and increasing concentration (0, 0.1, 0.15, 0.2, 0.25, 0.3 μg) of UBCH7. Cells were then treated with progesterone alone or progesterone (PROG) and estradiol (E2) together (each at 10^"7M). Last bar corresponds to control cells transfected with UBCH7 and PR expression plasmids only. Data is expressed as mean and SD of three independent transfections. The data is presented as fold activation. The activity in the presence of hormone and in the absence of UBCH7 was defined as 1-fold, and the data for other bars were scaled accordingly. Figure 4. UBCH7 had minimal effect on the transcriptional activity of AF-1 and AF-2 regions of hPR-B, however, it significantly enhance the transcriptional activity of the full length PR-B. HeLa cells were transiently transfected with either RSV.hPR-B (full length PR-B), RSV. hPR"A/B (ΔAF-2) or RSV.hPRΕ (ΔAF-1) expression plasmid along with progesterone responsive reporter (PRE.TATA.LUC) plasmid. After 4 hours, cells were treated with or without progesterone (10^~7M). Twenty four hours later, cells were harvested and assayed for luciferase activity. Data expresses as mean and SD of three different experiments. The data is presented as fold activation.

Figure 5. The ubiquitin-conjugating activity of UBCH7 is required for its co- activation function. A: The ubiquitin-conjugation defective mutant UBCH7 (C-S) had no significant effect on the transcriptional activity of PR in transient transfection assay. HeLa cells were transfected with PR-B expression and reporter plasmids in the presence or absence of either wild-type (W) or mutant UBCH7 (C-S). Cells were treated with progesterone (10^"7M) and luciferase activity was measured. The data is presented as fold activation. The activity of PR-B in the presence of hormone and in the absence of UBCH7 was defined as 1-fold, and the data for other bars were scaled accordingly. B: Wild-type (W) and ubiquitin-conjugation defective mutant UBCH7 (C-S) expressed at equal level. Protein levels were analyzed by Western blot using anti-UBCH7 antibody. Control lane represents cells that were transfected with empty vector, β-actin expression was used as loading control. C: UBCH7 potentiates PR transcriptional activity in a cell free transcription system on chromatin template. Briefly, initial reaction was carried out with drosophila embryo extract, core histones assembled on control template that lacks PR binding site and template that contains PR binding site-PRE₃-E4, purified PR-B, progesterone (10^"7M), no progesterone (-) and purified UBCH7 (wild-type and ubiquitin-conjugation defective mutant (C-S)). HeLa extract was added to pre-assembled chromatin assembly and reaction was allowed to continue for 30 minutes at 27°C. The samples were then subjected to in vitro transcription analysis.

Figure 6. UBCH7 is recruited onto ER and PR-responsive promoters. Chromatin

Immunoprecipitaion (ChIP) was performed using MCF-7 and T47D/CAT0 cells in the presence or absence of estrogen or progesterone hormones. A: Primers specific for pS2 promoter were used to amplify the genomic DNA associated with ER and UBCH7 in MCF-7 cells. B: Primers specific for MMTV promoter were used to amplify the genomic DNA associated with PR and UBCH7 in T47D/CATO cells. In these experiments 0.1% input DNA was used in the control lanes (Input lanes). Primers specific for GAPDH coding region were used as loading control. The data was quantified by using the NTH image scan program 1.62 and data was plotted as intensity vs. hormone treatment.

Figure 7. A: UBCH7 and E6-AP synergistically enhance PR transactivation. Cells were transiently transfected with PR-B expression plasmid and progesterone responsive reporter plasmid (PRE.TATA.LUC) in the absence (Control) or presence of UBCH7 (UBCH7) or wild type E6-AP (E6-AP) or ligase defective mutant E6-AP (Mutant E6-AP) or both (UBCH7+wild-type E6-AP) or both (UBCH7+mutant E6-AP). Cells were treated with or without progesterone (10^~7 M). Data is expressed as mean and SD of three different transfections and plotted as fold activation. The activation in presence of hormone using empty vector was taken as 1-fold. Hormone treated cells are referred to as +H, and untreated cells are referred to as -H. B: E6-AP is not required for UBCH7 to potentiate transcriptional activity of PR in vivo. E6-AP knock out (KO) fibroblasts were transiently transfected with full-length progesterone receptor (PR-B) expression plasmid along with the progesterone responsive reporter (PRE.TATA.LUC) plasmid. In addition cells were also transfected with either E6-AP or UBCH7 expression plasmid vectors. After 4hrs cells were treated with progesterone (10^"7M) or vehicle. Twenty-four hours later, cells were harvested and assayed for luciferase activity. Data is expressed as fold activation in presence of progesterone. The activation in presence of hormone using empty vector was taken as 1-fold. Data expressed is mean and SD of three different experiments. Hormone treated cells are referred to as +H, and untreated cells are referred to as -H.

Figure 8. A: UBCH7 interacts with SRC-1 protein. Interaction of UBCH7 with SRC-1, SRC-2 and SRC-3 was determined in a GST pull down assay. SRC-1, SRC-2 and SRC-3 were labeled by in vitro translation and incubated overnight at 4°C with E.coli expressed GST alone (control) or GST-UBCH7 bound to beads or GST-UBCH5B in NETN buffer {50mM NaCl; ImM EDTA; 20mM Tris (pH- 8.0); 0.1%NP-40}. Bound proteins were analyzed by 7.5% SDS-PAGE and autoradiographed. B: In vivo UBCH7 interacts with SRC-1 protein. After growing cells for 24 hrs, the cell lysates were prepared in RIPA buffer. Then lysates were immunoprecipitated (IP) with either control serum, or UBCH7 specific antibody (0C-UBCH7) or UBCH5 specific antibody (a - UBCH5) and precipitated proteins were immunobloted with either anti-SRC-1 antibody (upper panel, WB: -SRC- 1), anti-UBCH7 antibody (middle panel, WB: α -UBCH7) or anti-UBCH5 antibody (lower panel, WB: -UBCH5). C: Overexpression of UBCH7 has no effect on the expression levels of SRC-1 protein: HeLa cells were transfected either with control or UBCH7 expression plasmid. Cells were harvested 48 hours after transfection and SRC- llevels were assessed by Western blot using SRC-1 specific antibodies. Equal loading of samples was confirmed using β-actin specific antibodies. D: SRC-1 is required for UBCH7 to potentiate transcriptional activity of PR in vivo. SRC-1 KO fibroblasts were transiently transfected with full-length progesterone receptor (PR-B) expression plasmid along with the progesterone responsive reporter PRE.TATA.LUC) plasmid. In addition cells were also transfected with either SRC-1 or UBCH7 expression plasmid vectors or both. After 4hrs cells were treated with progesterone (IO-7M) or vehicle. Twenty-four hours later, cells were harvested and assayed for luciferase activity. Data is expressed as fold activation in presence of progesterone. The activation in presence of hormone using empty vector was taken as 1-fold. Data expressed is mean and SD of three different experiments.

Figure 9. MUC-2 expression by HT-29 cells. Control, control cells that were transfected with the non-specific siRNA; MUC-2 siRNA, cells transfected with MUC-2 specific siRNA#2.

Figure 10. Quantitative analysis of MUC-2 expression in HCT-116 cell line. Cl, control cells; C2, control cells transfected with non-specific siRNA; siRNA, cells transfected with a mixture of the two MUC-2 specific siRNAs#l+5.

Figure 11. Amino acid of a UbcH7 polypeptide (SEQ ID NO:42) and nucleotide sequence encoding the polypeptide (SEQ ID NO: 13).

Figure 12. Amino acid of an E6-AP polypeptide (SEQ ID NO:43) and nucleotide sequence (nucleotides 1-2628 of SEQ ID NO: 17) encoding the polypeptide.

Figure 13. Amino acid of a mucin-1 polypeptide (SEQ ID NO:46) and nucleotide sequence (nucleotides 1172 through 1229, 1732 through 1832, 3045 through 3167, 3267 through 3322, 3472 through 3608, 3754 through 3875, 3956 through 4105, and 5121 through 5195 of SEQ ID NO:23) encoding the polypeptide.

Figure 14. Amino acid of a mucin-2 polypeptide (SEQ ID NO:47) and nucleotide sequence (nucleotides 28-15576 of SEQ ID NO:31) encoding the polypeptide. DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS OF THE INVENTION The present invention is directed to polynucleotides and the uses thereof. As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, either ribonucleotides, deoxynucleotides, or a combination thereof, and includes both single- stranded molecules and double-stranded duplexes. A polynucleotide can be obtained directly from a natural source, or can be prepared with the aid of recombinant, enzymatic, or chemical techniques. Preferably, a polynucleotide of the present invention is isolated. An "isolated" polynucleotide is one that has been removed from its natural environment. A "purified" polynucleotide is one that is at least 60% free, preferably 75% free, and most preferably 90% free from other components with it may be naturally associated. Polynucleotides that are produced by recombinant, enzymatic, or chemical techniques are considered to be isolated and purified by definition, since they were never present in a natural environment. As used herein, "coding region" and "coding sequence" are used interchangeably and refer to a nucleotide sequence that encodes an mRNA or an unprocessed preRNA (i.e., an RNA molecule that includes both exons and introns) that is processed to produce an mRNA. As used herein, a "target coding region" and "target coding sequence" refer to a specific coding region whose expression is inhibited by a polynucleotide of the present invention. As used herein, a "target mRNA" is an mRNA encoded by a target coding region. Unless otherwise specified, "a," "an," "the," and "at least one" are used interchangeably and mean one or more than one. Polynucleotides of the present invention include double stranded RNA (dsRNA) polynucleotides. The sequence of a polynucleotide of the present invention includes one strand, referred to herein as the sense strand, of between 16 to 30 nucleotides, for instance, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. The sense strand is substantially identical, preferably, identical, to a target mRNA. As used herein, the term "identical" means the nucleotide sequence of the sense strand has the same nucleotide sequence as a portion of the target mRNA. As used herein, the term "substantially identical" means the sequence of the sense strand differs from the sequence of a target mRNA at 1, 2, or 3 nucleotides, preferably 1 nucleotide, and the remaining nucleotides are identical to the sequence of the mRNA. These 1, 2, or 3 nucleotides of the sense strand are referred to as non-complementary nucleotides. When a polynucleotide of the present invention includes a sense strand that is substantially identical to a target mRNA, the 1 , 2, or 3 non- complementary nucleotides are preferably located in the middle of the sense strand. For instance, if the sense strand is 21 nucleotides in length, the non-complementary nucleotides are typically at nucleotides 9, 10, 11, or 12, preferably nucleotides 10 or 11. The other strand of a dsRNA polynucleotide of the present invention, referred to herein as the anti- sense strand, is complementary to the sense strand. The term "complementary" refers to the ability of two single stranded polynucleotides to base pair with each other, where an adenine on one polynucleotide will base pair to a thymine or uracil on a second polynucleotide and a cytosine on one polynucleotide will base pair to a guanine on a second polynucleotide. The polynucleotides of the present invention also include the double stranded DNA polynucleotides that correspond to the dsRNA polynucleotides of the present invention. Also included in the present invention are the single stranded RNA polyncleotides and single stranded DNA polynucleotides corresponding to the sense strands and anti-sense strands disclosed herein. It should be understood that the sequences disclosed herein as DNA sequences can be converted from a DNA sequence to an RNA sequence to replacing each thymidine nucleotide with a uracil nucleotide. Without intending to be limiting, the polynucleotides of the present invention cause the post- transcriptional silencing of a target coding region. Modifications to polynucleotides for use in silencing are known in the art and the polynucleotides of the invention can be so modified. The sense and anti-sense strands of a dsRNA polynucleotide of the present invention may also be covalently attached, typically by a spacer made up of nucleotides. Such a polynucleotide is often referred to in the art as a short hairpin RNA (shRNA). Upon base pairing of the sense and anti-sense strands, the spacer region forms a loop. The number of nucleotides making up the loop can vary, and loops between 3 and 23 nucleotides have been reported (Sui et al., Proc. NatL Acad. Sci. USA, 99, 5515-5520 (2002), and Jacque et al., Nature, 418, 435-438 (2002)). Polynucleotides of the present invention are preferably biologically active. A biologically active polynucleotide causes the post- transcriptional inhibition of expression, also referred to as silencing, of a target coding region. Without intending to be limited by theory, after introduction into a cell a polynucleotide of the present invention will hybridize with a target mRNA and signal cellular endonucleases to cleave the target mRNA. The result is the inhibition of expression of the polypeptide encoded by the mRNA. Whether the expression of a target coding region is inhibited can be determined by, for instance, measuring a decrease in the amount of the target mRNA in the cell, measuring a decrease in the amount of polypeptide encoded by the mRNA, or by measuring a decrease in the activity of the polypeptide encoded by the mRNA. As used herein, the term "polypeptide" refers broadly to a polymer of two or more amino acids joined together by peptide bonds. The term "polypeptide" also includes molecules which contain more than one polypeptide joined by a disulfide bond, or complexes of polypeptides that are joined together, covalently or noncovalently, as multimers (e.g., dimers, tetramers). Thus, the terms peptide, oligopeptide, and protein are all included within the definition of polypeptide and these terms are used interchangeably. In one aspect, the present invention includes polynucleotides that inhibit expression of a UbcH7 polypeptide. As used herein a "UbcH7 polypeptide" refers to a polypeptide having a molecular weight of 17 kilodaltons (kDa) as determined by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis, and bound by an antibody that specifically binds to a human UbcH7 polypeptide, such as the polypeptide disclosed at Genbank accession number X92962 (SEQ ID NO:42). Such antibodies are commercially obtainable from, for instance, BD Biosciences (San Jose, CA), Chemicon (Temecula, CA), and Boston Biochem Inc. (Cambridge, MA). As used herein, an antibody that can specifically bind a polypeptide is an antibody that interacts only with the epitope of the antigen that induced the synthesis of the antibody, or interacts with a structurally related epitope. An antibody that specifically binds to an epitope will, under the appropriate conditions, interact with the epitope even in the presence of a diversity of potential binding targets. A UbcH7 polypeptide has the activity of promoting the degradation of estrogen receptor (Nawaz et al., Proc. Natl. Acad. Sci. USA, 96, 1858-1862 (1999) and Yan et al., Mol. Endocrinol., 17, 1315- 1331 (2003)). An example of a target mRNA encoding a Ubch7 polypeptide is the sequence available at Genbank accession number X92962 (SEQ ID NO: 13). Examples of polynucleotides of the present invention that will act to silence the expression of a target UbcH7 coding region include polynucleotides having a sense strand that includes AATTCAGAGCCAGCAATGCCT (SEQ ID NO:6) AAATGTGGGATGAAAAACTTC (SEQ ID NO:7), AAGCTAATTTATTGACTTGGC (SEQ ID NO: 14), GATCACATTTAAAACAAAG (SEQ ID NO: 15), GGACCGTAAAAAATTCTGT (SEQ ID NO: 8), and AAAAAATTCTGTAAGAATGCT (SEQ ID NO: 16). In another aspect, the present invention includes polynucleotides that inhibit expression of an E6-AP polypeptide. As used herein, an " E6-AP polypeptide" refers to a polypeptide having a molecular weight of 100 kDa as determined by sodium dodecyl sulfate SDS-polyacrylamide gel electrophoresis, and bound by an antibody that specifically binds to a human E6-AP polypeptide, such as the polypeptide disclosed at Genbank accession number NM-000462 (SEQ JD NO:43). Such antibodies are commercially obtainable from, for instance, Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), Bethyl Laboratories (Montgomery, TX), and Abeam (Cambrige, MA). An E6-AP polypeptide has the activity of interacting with and coactivating the transcriptional activity of human progesterone receptor (Nawaz et al., Mol. Cellul. Biol., 19, 1182-1189 (1999)). An example of a target mRNA encoding a polypeptide having E6-AP activity is the sequence available at Genbank accession number NM-000462 (SEQ ID NO: 17). Examples of polynucleotides of the present invention that will act to silence the expression of a target E6- AP coding region include polynucleotides having a sense strand that includes AATGAGTTTTGTGCTTCCTG (SEQ ID NO: 18), AAATGAACAAGAAAGGCGCTA (SEQ ID NO: 19), AACTTTTGGGAGAAGAAAGAA (SEQ ID NO:20), AATCCAGATATTGGTATGTTC (SEQ ID NO:21), AACTGTATACTGGATGTACA (SEQ ID NO:22), AATGAGTTTTGTGCTTCCTGT (SEQ ID NO:44), and AAAGGAGCAAGCTCAGCTTAC (SEQ ID NO:45). In another aspect, the present invention includes polynucleotides that inhibit expression of a mucin-1 polypeptide. As used herein, a "mucin-1 polypeptide" refers to a polypeptide having a molecular weight of approximately 250 kDa as determined by sodium dodecyl sulfate

SDS-polyacrylamide gel electrophoresis, and bound by an antibody that specifically binds to a human mucin-1 polypeptide, such as the polypeptide disclosed at Genbank accession number AY463543 (SEQ ID NO:46). Such antibodies are commercially obtainable from, for instance, BD Biosciences (San Jose, CA), and Calbiochem (San Diego, CA). An example of a target mRNA encoding a mucin-1 polypeptide is the sequence available at Genbank accession number AY463543 (SEQ ID NO:23), where the mRNA is encoded by nucleotides 1147 through 1229 joined to nucleotides 1732 through 1832 joined to nucleotides 3045 through 3167 joined to nucleotides 3267 through 3322 joined to nucleotides 3472 through 3608 joined to nucleotides 3754 through 3875 joined to nucleotides 3956 through 4105 joined to nucleotides 5121 through 5207. Examples of polynucleotides of the present invention that will act to silence the expression of a target mucin-1 coding region include polynucleotides having a sense strand that includes

AAGAATTGCAGACAGAGGCTG (SEQ ID NO:24) and , and AAGAGCTGCAGAGAGACATTT (SEQ ID NO:30). Examples of polynucleotides that will not act to silence the expression of a target mucin-1 coding region are AAGAGAGTAGGGAGAGGGAAG (SEQ ID NO:25), AAGTTCAGTGCCCAGCTCTAC (SEQ ID NO:26), AAGAATGCTGTGAGTATGACC (SEQ ID NO:27), AACCAGCTTCAGGTTCAGCTG (SEQ ID NO:28), and AAGACTGATGCCAGTAGCACT (SEQ ID NO:29). In another aspect, the present invention includes polynucleotides that inhibit expression of a mucin-2 polypeptide. As used herein, a "mucin-2 polypeptide" refers to a polypeptide having a molecular weight of approximately 250 kDa as determined by sodium dodecyl sulfate SDS-polyacrylamide gel electrophoresis, and bound by an antibody that specifically binds to a human mucin-2 polypeptide, such as the polypeptide disclosed at Genbank accession number L21998 (SEQ ID NO:47). Such antibodies are commercially obtainable from, for instance, BD Biosciences (San Jose, CA), and Calbiochem (San Diego, CA). An example of a target mRNA encoding a mucin-2 polypeptide is the sequence available at Genbank accession number L21998 (SEQ ID

NO: 31). Examples of polynucleotides of the present invention that will act to silence the expression of a target mucin-2 coding region include polynucleotides having a sense strand that includes AACTTCCACTACAAGACCTTC (SEQ ID NO:32), AATTTGCTGTGCACCTGAAGC (SEQ ID NO:33), and

AAGAAGACAGAGACCCCCTTT (SEQ ID NO:36). Examples of polynucleotides that will not act to silence the expression of a target mucin-2 coding region are AAGAGCGATGCCTACACCAAA (SEQ ID NO:34), AAGAAGAAGAATGCGGTGGTC (SEQ ID NO:35), AAGATCAAGGTGGACTGCAAT (SEQ ID NO:37), AACAACACAGTCCTGGTGGAA (SEQ ID NO:38), AACTGCACATTCTTCAGCTGC (SEQ ID NO:39), AAGATCCACAACCAGCTCATC (SEQ JD NO:40), and AACTTTGATGCCAGCATTTGC (SEQ ID NO:4l). A polynucleotide of the present invention may include additional nucleotides. For instance, with respect to the sense strand, the 5' end, the 3' end, or both ends can include additional nucleotides, provided the additional nucleotides are identical to the appropriate target mRNA and the overall length of the sense strand is not greater than 30 nucleotides. For instance, a polynucleotide having a sense strand that includes the sequence of SEQ ID NO:7 can further include at the 3' end a C, or CG, or CGT, or CGTA, and so on. A polynucleotide may also include overhangs of 1, 2, or 3 nucleotides, typically on the 3' end of the sense strand, the anti-sense strand, or both (see, for instance, Reich et al., U.S. Patent Application Publication 2004/0180357 Al). A polynucleotide of the invention can be present in a vector. A vector is a replicating polynucleotide, such as a plasmid, phage, or cosmid, to which another polynucleotide may be attached so as to bring about the replication of the attached polynucleotide. Construction of vectors containing a polynucleotide of the invention employs standard ligation techniques known in the art. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989). A vector can provide for further cloning (amplification of the polynucleotide), i.e., a cloning vector, or for expression of the polynucleotide, i.e., an expression vector. The term vector includes, but is not limited to, plasmid vectors, viral vectors, cosmid vectors, or artificial chromosome vectors. Examples of viral vectors include, for instance, adenoviral vectors, adeno-associated viral vectors, lentiviral vectors, retroviral vectors, and herpes virus vectors. A vector may result in integration into a cell's genomic DNA. Typically, a vector is capable of replication in a bacterial host, for instance E. coli. Preferably the vector is a plasmid. A polynucleotide of the present invention can be present in a vector as two separate complementary polynucleotides, each of which can be expressed to yield a sense and an antisense strand of the dsRNA, or as a single polynucleotide containing a sense strand, a loop region, and an anti-sense strand, which can be expressed to yield an RNA polynucleotide having a sense and an antisense strand of the dsRNA. Selection of a vector depends upon a variety of desired characteristics in the resulting construct, such as a selection marker, vector replication rate, and the like. Suitable host cells for cloning or expressing the vectors herein are prokaryote or eukaryotic cells. Preferably the host cell secretes minimal amounts of proteolytic enzymes. Suitable prokaryotes include eubacteria, such as gram-negative organisms, for example, E. coli. An expression vector optionally includes regulatory sequences operably linked to the polynucleotide of the present invention. Typically, the promoter results in the production of an RNA polynucleotide.

Examples of such promoters include those that cause binding of an RNA polymerase III complex to initiate transcription of an operably linked polynucleotide of the present invention. Examples of such promoters include U6 and HI promoters. Vectors may also include inducible or regulatable promoters for expression of a polynucleotide of the present invention in a particular tissue or intracellular environment. The polynucleotide of the present invention also typically includes a transcription terminators. Suitable transcription terminators are known in the art and include, for instance, a stretch of 5 consecutive thymidine nucleotides. The present invention is also directed to compositions including a polynucleotide of the present invention. Such compositions typically include a pharmaceutically acceptable carrier. As used herein "pharmaceutically acceptable carrier" includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Additional active compounds can also be incorporated into the compositions. A composition may be prepared by methods well known in the art of pharmacy. In general, a composition can be formulated to be compatible with its intended route of administration. Examples of routes of administration include perfusion and parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions can include the following components: a sterile diluent such as water for administration, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates; electrolytes, such as sodium ion, chloride ion, potassium ion, calcium ion, and magnesium ion, and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. A composition can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. Compositions can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). A composition is typically sterile and, when suitable for injectable use, should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin. Sterile solutions can be prepared by incorporating the active compound (i.e., a polynucleotide of the present invention) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring. For administration by inhalation, the active compounds are delivered in the form of an aerosol spray from a pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art. The active compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery. The active compounds can also be administered by any method suitable for administration of polynucleotide agents, e.g., using gene guns, bio injectors, and skin patches as well as needle-free methods such as the micro-particle DNA vaccine technology disclosed by Johnston et al. (U.S. Pat. No. 6,194,389). Additionally, intranasal delivery is possible, as described in, for instance, Hamajima et al. Clin. Immunol. Immunopathol., 88, 205-210 (1998). Liposomes and microencapsulation can also be used. The active compounds may be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using standard techniques. The materials can also be obtained commercially from, for instance, Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art. Toxicity and therapeutic efficacy of such active compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD₅₀ (the dose lethal to 50% of the population) and the ED₅₀ (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD₅₀/ED₅₀. Compounds which exhibit high therapeutic indices are preferred. The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED₅₀ with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For a compound used in the methods of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC₅₀ (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography. The compositions can be administered one or more times per day to one or more times per week, including once every other day. The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with an effective amount of a polypeptide can include a single treatment or, preferably, can include a series of treatments. The polynucleotides of the present invention can be designed using methods that are routine and known in the art. For instance, polynucleotides that inhibit the expression of one of the polypeptides described herein (e.g., a UbcH7 polypeptide, an E6-AP polypeptide, a mucin-1 polypeptide, or a mucin-2 polypeptide) may be identified by scanning the target mRNA for AA dinucleotide sequences; each AA and the downstream (3 consecutive 16 to 30 nucleotides of the mRNA can be used as the sense strand of a candidate polynucleotide. A candidate polynucleotide is the polynucleotide that is being tested to determine if it decreases expression of one of the polypeptides described herein. The candidate polynucleotide can be identical to nucleotides located in the region encoding the polypeptide, or located in the 5' or 3' untranslated regions of the mRNA. Optionally and preferably, a candidate polynucleotide is modified to include 1, 2, or 3, preferably 1, non- complementary nucleotides. Other methods are known in the art and used routinely for designing and selecting candidate polynucleotides. A polynucleotide of the present invention may, but need not, begin with the dinucleotide AA at the 5' end of the sense strand. A candidate polynucleotide may also include overhangs of 1, 2, or 3 nucleotides, typically on the 3' end of the sense strand, the anti-sense strand, or both. Candidate polynucleotides are typically screened using publicly available algorithms (e.g., BLAST) to compare the candidate polynucleotide sequences with coding sequences. Those that are likely to form a duplex with an mRNA expressed by a non-target coding region are typically eliminated from further consideration. The remaining candidate polynucleotides may then be tested to determine if they inhibit expression of one of the polypeptides described herein. In general, candidate polynucleotides are individually tested by introducing a candidate polynucleotide into a cell that expresses the appropriate polypeptide. The candidate polynucleotides may be prepared in vitro and then introduced into a cell. Methods for in vitro synthesis include, for instance, chemical synthesis with a conventional DNA/RNA synthesizer. Commercial suppliers of synthetic polynucleotides and reagents for such synthesis are well known. Methods for in vitro synthesis also include, for instance, in vitro transcription using a circular or linear vector in a cell free system. The candidate polynucleotides may also be prepared by introducing into a cell a construct that encodes the candidate polynucleotide. Such constructs are known in the art and include, for example, a vector encoding and expressing a sense strand and an anti- sense strand of a candidate polynucleotide, and RNA expression cassettes that include the sequence encoding the sense strand and an anti-sense strand of a candidate polynucleotide flanked by operably linked regulatory sequences, such as an RNA polymerase III promoter and an RNA polymerase III terminator, that result in the production of an RNA polynucleotide. A cell that can be used to evaluate a candidate polynucleotide may be a cell that expresses the appropriate polypeptide (e.g., a UbcH7 polypeptide, an E6-AP polypeptide, a mucin-1 polypeptide, or a mucin-2 polypeptide). A cell can be ex vivo or in vivo. As used herein, the term "ex vivo" refers to a cell that has been removed from the body of a subject. Ex vivo cells include, for instance, primary cells (e.g., cells that have recently been removed from a subject and are capable of limited growth in tissue culture medium), and cultured cells (e.g., cells that are capable of extended culture in tissue culture medium). As used herein, the term "in vivo" refers to a cell that is within the body of a subject. Whether a cell expresses one of the polypeptides can be determined using methods that are routine and known in the art including, for instance, Western immunoblot, ELISA, immunoprecipitation, or immunohistochemistry. Western immunoblot and immunoprecipitation are generally used with ex vivo cells, and immunohistochemistry is generally used with in vivo cells. Examples of readily available cells expressing UbcH7 polypeptide include cultured cells such as MCF-7 (ATCC number HTB-22), LNCaP (ATCC number CRL-1740), HeLa, and T47D (ATCC number HTB-133), and primary cells such as breast carcinoma cells and prostate carcinoma cells. Examples of cells expressing E6-AP polypeptide include cultured cells such as MCF-7 (ATCC number HTB-22), HeLa, and T47D (ATCC number HTB-133), and primary cells such as breast carcinoma cells and prostate carcinoma cells. Examples of cultured cells expressing mucin-1 polypeptide include HT-29 (ATCC number HTB-38), HCT-116 (ATCC number CCL-247), LS174T, and MCF-7 (ATCC number HTB-22). Examples of cultured cells expressing mucin-2 polypeptide include HT-29 (ATCC accession number HTB-38), LS 174T, and HCT-116 (ATCC accession number CCL-247). Primary cells that produce mucin-1, mucin-2, or the combination thereof, can be obtained from tumors of patients with pseudomyxoma peritonei or colon cancer. Other cells can also be modified to express one of the polypeptides by introducing into a cell a vector having a polynucleotide encoding the polypeptide. Candidate polynucleotides may also be tested in animal models. The study of various cancers in animal models (for instance, mice) is a commonly accepted practice for the study of cancers. For instance, the nude mouse model, where human tumor cells are injected into the animal, is commonly accepted as a general model useful for the study of a wide variety of cancers (see Example 4). Transgenic animal models are also available. For instance, models for the study of prostate cancer such as the TRAMP model (see, for instance, Greenberg et al., Proc. Natl. Acad. Sci. USA, 92:2429-3443 (1995)) and for breast cancer such as the MMTV-Wnt-1 model (see, for instance, Tsukamoto et al., Cell, 55:619- 625 (1988)) are commonly accepted as models for human disease. Candidate polynucleotides can be used in these animal models to determine if a candidate polynucleotide decreases one or more symptoms associated with the disease. Methods for introducing a candidate polynucleotide, including a vector or RNA expression cassette encoding a candidate polynucleotide, are known in the art and routine. When the cells are ex vivo, such methods include, for instance, transfection with lipid or amine based reagents such as cationic liposomes or polymeric DNA-binding cations (such as poly-L-lysine and polyethyleneimine). Alternatively, electroporation or viral transfection can be used to introduce a candidate polynucleotide, or a vector or RNA expression cassette encoding a candidate polynucleotide. When evaluating whether a candidate polynucleotide functions to inhibit expression of one of the polypeptides described herein, the amount of target mRNA in a cell containing a candidate polynucleotide can be measured and compared to the same type of cell that does not contain the candidate polynucleotide. Methods for measuring mRNA levels in a cell are known in the art and routine. Such methods include quantitative reverse-transcriptase polymerase chain reaction (RT-PCR). Primers and specific conditions for amplification of an mRNA vary depending upon the mRNA, and can be readily determined by the skilled person. Other methods include, for instance, Northern blotting, and array analysis. Other methods for evaluating whether a candidate polynucleotide functions to inhibit expression of one of the polypeptides described herein include monitoring the polypeptide. For instance, assays can be used to measure a decrease in the amount of polypeptide encoded by the mRNA, or to measure a decrease in the activity of the polypeptide encoded by the mRNA. Methods for measuring a decrease in the amount of a polypeptide include assaying for the polypeptide present in cells containing a candidate polynucleotide and comparing to the same type of cell that does not contain the candidate polynucleotide. For instance, antibody to one of the polypeptides described herein can be used in Western immunoblot, immunoprecipitation, or immunohistochemistry. Antibodies to each of the polypeptides described herein are commercially available. Methods for measuring a decrease in the activity of one of the polypeptides, e.g., UbcH7 and E6-AP, vary depending upon the polypeptide. In general, methods for measuring a decrease in the activity of a polypeptide include assaying the appropriate activity present in a cell containing a candidate polynucleotide and comparing to the same type of cell that does not contain the candidate polynucleotide. Methods for measuring the activity of UbcH7 polypeptide or an E6-AP polypeptide are known in the art. A candidate polynucleotide that is able to decrease the expression of a UbcH7 polypeptide, an E6-AP polypeptide, a mucin-1 polypeptide, or a mucin-2 polypeptide by at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%, is considered to be a polynucleotide of the present invention. The present invention is further directed to methods for treating certain diseases in a subject. The subject is a mammal, preferably a human. As used herein, the term "disease" refers to any deviation from or interruption of the normal structure or function of a part, organ, or system, or combination thereof, of a subject that is manifested by a characteristic symptom or set of symptoms. Diseases include cancers dependent upon signalling via steroid hormone receptors such as estrogen receptors, progesterone receptor, and androgen receptor. Examples of such diseases are referred to as endocrine-related cancers and include breast cancer and prostate cancer. Other diseases include those having symptoms including mucin over-production. Examples of such diseases include colon cancer, pseudomyxoma peritonei (Pmp), breast cancer, and mesothelioma. Typically, whether a subject has a disease, and whether a subject is responding to treatment, is determined by evaluation of symptoms associated with the disease. As used herein, the term "symptom" refers to objective evidence of a disease present in a subject. Symptoms associated with diseases referred to herein and the evaluation of such symptoms are routine and known in the art. Examples of symptoms of cancers dependent upon signalling via steroid hormone receptors include, for instance, the presence and size of tumors, and the presence and amount of biomarkers. Biomarkers are compounds, typically polypeptides, present in a subject and indicative of the progression of cancer. An example of a biomarker is prostate specific antigen (PSA). Regarding diseases having the symptom of mucin over- expression to result in mucinous material, other symptoms of such diseases include, for instance, the presence and size of tumors. Treatment of a disease can be prophylactic or, alternatively, can be initiated after the development of a disease. Treatment that is prophylactic, for instance, initiated before a subject manifests symptoms of a disease, is referred to herein as treatment of a subject that is "at risk" of developing a disease. An example of a subject that is at risk of developing a disease is a person having a risk factor, such as a genetic marker, that is associated with the disease. Examples of genetic markers indicating a subject has a predisposition to develop certain cancers such as breast, prostate, or colon cancer include alterations in the BRAC1 and/or BRAC2 genes. Treatment can be performed before, during, or after the occurrence of the diseases described herein. Treatment initiated after the development of a disease may result in decreasing the severity of the symptoms of one of the conditions, or completely removing the symptoms. In some aspects, the methods typically include introducing into a cell a composition including an effective amount of one or more polynucleotides of the present invention. As used herein, an "effective amount" is an amount effective to inhibit expression of a polypeptide in a cell, decrease symptoms associated with a disease, or the combination thereof. The polynucleotide may be introduced into a cell as an RNA polynucleotide, or as a vector including a DNA polynucleotide that encodes and will express the RNA polynucleotide. More than one type of polynucleotide can be administered. For instance, two or more polynucleotides that are designed to silence the same mRNA can be combined and used in the methods herein. Alternatively, two or more polynucleotides can be used together where the polynucleotides are each designed to silence different RNAs. Whether a polynucleotide is expected to function in the methods of the present invention can be evaluated using ex vivo models and animal models. Such models are known in the art and are generally accepted as representative of disease or methods of treating humans. The cell may be ex vivo or in vivo. When the cell is ex vivo, the presence of a polypeptide in the cell can be compared with the same type of cell that does not contain the polynucleotide of the invention. Such a cell that does not contain the polynucloetide is referred to as a control cell. A decrease in, for instance, the target mRNA or the amount of polypeptide encoded by the target mRNA in the cell containing a polynucleotide of the present invention indicates the expression of the polypeptide has been inhibited. When the cell is in vivo, it is preferably present in a mammalian subject, preferably, a human. In this aspect, an effective amount of a polynucleotide of the present invention is an amount effective to decrease symptoms associated with a disease. The methods of the present invention provide for inhibiting the expression of a UbcH7 polypeptide, an E6-AP polypeptide, a mucin-1 polypeptide, or a mucin-2 polypeptide. The methods of the present invention also provide for treating a disease, preferably a cancer, in a subject. The methods typically include administering to a subject at risk for the disease or having the disease a composition including an effective amount of a polynucleotide of the present invention, wherein a symptom associated with the disease is decreased. Preferred methods for administering one or more of the polynucleotides of the present invention include administration during surgery, for instance surgery to resect a diseased part, organ, system, or combination thereof, of a subject. A diseased part, organ, or system can include, for instance, tumor cells, or mucinous materials that can accumulate as a result of a disease such as colon cancer and/or Pmp. For instance, after removal of breast cancer cells or mucinous material the surrounding area can be perfused with a solution containing one or more of the polynucleotides of the present invention, or an implant containing one or more of the polynucleotides of the present invention can be placed near the area of resection. The polynucleotides may also be administered by other methods known in the art including, for instance, intravenous administration. The present invention also provides a kit for practicing the methods described herein. The kit includes one or more of the polynucleotides of the present invention in a suitable packaging material in an amount sufficient for at least one administration. Optionally, other reagents such as buffers and solutions needed to practice the invention are also included. Instructions for use of the packaged polynucleotide(s) are also typically included. As used herein, the phrase "packaging material" refers to one or more physical structures used to house the contents of the kit. The packaging material is constructed by well known methods, preferably to provide a sterile, contaminant-free environment. The packaging material has a label which indicates that the polynucleotide(s) can be used for the methods described herein. In addition, the packaging material contains instructions indicating how the materials within the kit are employed to practice the methods. As used herein, the term "package" refers to a solid matrix or material such as glass, plastic, paper, foil, and the like, capable of holding within fixed limits the polynucleotide(s). Thus, for example, a package can be a glass vial used to contain appropriate quantities of the polynucleotide(s). "Instructions for use" typically include a tangible expression describing the conditions for use of the polynucleotide(s). The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein. EXAMPLES

Example 1 The Ubiquitin-conjugating enzyme UBCH7 acts as a coactivator for steroid hormone receptors

This example details experiments that describe a role for UBCH7 in steroid hormone receptor function. UBCH7 modulates the hormone- dependent transcriptional activity of various steroid and nuclear hormone receptors. Furthermore, UBCH7 is recruited to progesterone receptor (PR) and estrogen receptor-responsive promoters in a hormone- dependent manner. Depletion of endogenous UBCH7 protein with small interfering RNA (siRNA) significantly reduced the transactivation of PR. These data also suggest that coexpression of UBCH7 and E6-AP enhances PR transactivation synergistically. Furthermore, UBCH7 is physically associated with SRC-1 (steroid receptor coactivator- 1), and data from SRC-1 knockout (KO) cell line indicates that SRC-1 is required for UBCH7 to modulate steroid hormone receptor function. Together, these results demonstrate the role of UBCH7 as a coactivator in modulating nuclear receptor function.

Materials and Methods: Plasmid Construction: The mammalian expression plasmids for progesterone receptor-B (pCR3.1 PR-B), glucocorticoid receptor

(pCR3.1.GR), androgen receptor (pCR3.1.AR), retinoic acid receptor (RSV.RAR), and GAL-VP16 have been described previously (Allan et al., J. Biol. Chem., 267:19513-19520 (1992); Nawaz et al., Mol.Cell Biol., 19:1182-1189 (1999); Onate et al., Science, 270:1354-1357 (1995); Tilley et al., Proc Natl Acad Sci U S A, 86:327-331 (1989)). The progesterone/glucocorticoid/androgen-responsive reporter (PRE.TATA.LUC), retinoic acid responsive reporter, p53-responsive reporter, and 17mer-LUC reporter plasmids also have been described previously (el-Deiry et al., Cell, 75:817-825 (1993); Lonard et al., Mol.Cell, 5:939-948 (2000); Nawaz et al., Mol.Cell Biol., 19:1182-1189 (1999)). The expression vector for p53, SRC-1, pGEM.E6-AP (3003), pRSh PRB, pRShPRA/B, pRShPRΔE, and pPRE₃-E4 have been published previously (el-Deiry et al., Cell, 75:817-825 (1993); Liu et al., Proc Natl Acad Sci U S A, 96:9485-9490 (1999); Onate, J.Biol Chem., 273:12101-12108 (1998); Xu et al., Proc Natl Acad Sci U S A, 93:12195-12199 (1996)). To construct the mammalian expression vector pBKRSV- UBCH7, a BamHl-EcoRl fragment containing UBCH7 was amplified by PCR with the following primer pairs : 5 ' -

GCGGATCCCCGCGGCCAGCAGGAGGCTGAT (SEQ ID NO:l) and 5'-CCGGAATTCTTAACAAAAA (SEQ ID NO:2) using pET-UBCH7 as a template and subcloned into the corresponding sites of plasmid pBKRSV. The ubiquitin-conjugation defective mutant UBCH7 (C-S) was generated by PCR with the following primers: 5' -

GAAGATCTATCACCCAAACATCGACGAAAAGGGGCAGGTCAG TCTGCCAGTA (SEQ ID NO:3) and 5'-

CCGGAATTCTTAGTCCACAGGTCGCTTTTCCCCATATTTCTTTG TAAACTC (SEQ ID NO:4). The PCR product was digested with EcoRl-Bgl 11 and cloned into the corresponding sites of plasmid pBKRSV.UBCH7. For Glutathione-S-transferase expression vector, GST-UBCH7 was constructed by subcloning the BamHI-EcoRl fragment from pBKRSV.UBCH7 into the pGEX4T-l plasmid. In order to generate siRNA against UBCH7, the siRNA target finder program from Ambion, Inc. (Austin, TX) was used. The GAPDH (control) siRNA was purchased from Ambion Inc. The oligo used for GAPDH siRNA was 5'-GGATATTGTTGCCATCATT (SEQ ID NO:5) The oligos used for UBCH7 siRNA #(1) was 5'- AATTCAGAGCCAGCAATGCCT (SEQ ID NO:6), for siRNA#(2) was 5'-AAATGTGGGATGAAAAACTTC (SEQ ID NO:7) and for siRNA#(3) was 5'-

GGACCGTAAAAAATTCTGT (SEQ ID NO:8) respectively. All constructs were verified by DNA sequencing. In vitro Interaction Assay: In vitro expression of radiolabeled SRC-1, SRC-2 and SRC-3 was performed by in vitro transcription and translation (TNT) from rabbit reticulocyte extracts in the presence of [₃5S]-methionine according to the manufacturer's recommended conditions (Promega, Madison, WI). GST-UBCH7 and GST-UBCH5B were expressed in E.coli DH-5α cells and purified on glutathione- sepharose beads. The purified and glutathione bound UBCH7 and UBCH5B were incubated with in vitro translated SRC-1 or SRC-2 or SRC-3 in NETN buffer (50mM NaCl; lmM EDTA; 20mM Tris pH (8.0); 0.1 % Nonidet P-40) overnight at 4°C. After washing four times with NETN buffer, UBCH7 and UBCH5B bound SRC proteins were eluted and separated on a 7.5% SDS-polyacrylamide gels and detected using autoradiography. Coimmunoprecipitation: Twenty-four hours after growth, cells were washed in TEN buffer (40 mM Tris-HCl, pH 7.5, 1 mM EDTA, 150 mM NaCl) and lysed in ice-cold RJPA buffer containing salt (400 mM NaCl, 1XPBS, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, 10 mg/ml PMSF (10 μl/ml), Aprotinin (30 μl/ml) and 100 nM Sodium orthovanadate (10 μl/ml)) by pipeting up and down. Thereafter, cell lysates were placed on ice for 30 minutes. In order to bring the salt concentration of cell lysates to 150 mM NaCl, 150 μl of NaCl free RIPA buffer (1XPBS, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, 10 mg/ml PMSF (10 μl/ml), Aprotinin (30 μl/ml) and 100 nM Sodium orthovanadate (10 μl/ml)) was added to the lysates. After centrifugation at 4°C (21 ,000g), lysates were incubated with 20 μl of Protein A sepharose and rocked at 4°C for 30 minutes. After centrifugation, supernatants were transferred to fresh tubes and lysates were mixed either with serum or specific antibody (anti-UBCH7 and anti-UBCH5, obtained from Boston Biochem Inc., at 4°C for 2 hours on rocker. Afterward 20 μl of Protein A sepharose beads were added and lysates were incubated for an additional hour at 4°C on a rocker. Finally, after extensive washing with NaCl-free RIPA buffer, immunoprecipitates were subjected to SDS-PAGE and analyzed by Western blotting using either an anti-SRC- 1, anti-UBCH7 or anti-UBCH5 antibody. In vitro Transcription: Cell free transcription assays using a chromatin template were performed as described previously (Liu et al., Proc Natl Acad Sci U S A, 96:9485-9490 (1999)). To assemble DNA onto chromatin, plasmid DNAs pPRE3-E4 and E4 control template (Liu et al., Proc Natl Acad Sci U S A, 96:9485-9490 (1999)) lacking progesterone receptor binding site were incubated with Sfl90 extracts (derived from Drosophila embryos) and core histones. Purified receptor protein (PR-B), progesterone, wild-type and ubiquitin-conjugating defective mutant UBCH7 (Boston Biochem Inc.) and HeLa extract were added to pre-assembled chromatin assembly and the reaction was allowed to continue for 30 minutes at 27°C. The samples were then subjected to in vitro transcription analysis as described previously. Transient Transfection: HeLa cells were maintained in Dulbecco modified-Eagle medium (DMEM) containing 10% fetal bovine serum (FBS). 3X10^"5 cells were plated 24 hours before transfection in 6 well plates containing 5% dextran coated charcoal stripped serum. Cells were transfected with the indicated amount of DNA using FuGene 6 transfection reagent (Roche Diagnostics). After 4 hours, cells were treated with the indicated hormones and harvested 24 hours later. Luciferase assays were performed using a luciferase assay system available from Promega. SRC-1 and E6-AP KO fibroblasts were plated at a density of 3X10^"5 cells in 6-well plates in DMEM containing 10%FBS, β-mercaptoethanol (β-ME) and antibiotics. The next day medium with stripped serum was added and cells were incubated overnight at 37°C. Cells were transfected with PR and PRE expression vectors. In addition the cells were also transfected with appropriate coactivator expression vectors. After 4 hours cells were treated with progesterone (10^~7 M) or vehicle and were incubated at 37°C overnight. The following day, cells were harvested and luciferase assays were performed using the luciferase kit system available from Promega. Chromatin Immunoprecipitation (ChlP): The MCF cells (ATCC# HTB-22) or T47D/CAT0 cells were used in ChlP analyses following a modified procedure based on previously described protocols (Li et al., Mol.Cell Biol., 23:3763-3773 (2003); Shang et al., Cell, 103:843-852 (2000)). The DNA was purified using QIAquick PCR purification Kit (Qiagen, Valencia) and eluted in 50 μl of H2O. Total input samples were eluted in 100 μl of H2O and diluted 1:10 before PCR analysis. Each PCR reaction contains 6 μl of immunoprecipitate or input, 0.5 μM of each primer, 0.4 mM dNTP mixture, IX Titanium Taq PCR buffer (Clontech, Palo Alto), and IX Titanium TaqDNA polymerase (Clontech) in a total volume of 25 μl. The primers for the PS2 promoter were: forward, 5'- GGCCATCTCTCACTATGAATCACTTCTGC (SEQ ID NO:9) and reverse, 5'-GGCAGGCTCTGTTTGCTTAAAGAGCG (SEQ ID NO: 10) and the primers for MMTV promoter were: forward, 5'- TATGGTTACAAACTGTTCTTAAAACGAGGATG (SEQ ID NO: 11) and reverse, 5'-GCAAGTTTACTCAAAAACAGCACTCTTT (SEQ ID NO: 12). PCR was performed for 29 cycles with 1 minute of denaturing at 94°C, annealing at 62°C and extension at 68°C.

Results UBCH7 modulates the transcriptional activities of various nuclear hormone receptors: To determine if UBCH7 is involved in receptor- dependent activation of target gene expression, transient transfection assays were carried out in HeLa cells. HeLa cells were co-transfected with mammalian expression plasmids for the PR, glucocorticoid (GR), androgen (AR), and retinoic acid (RAR) receptors along with reporter plasmids containing their cognate hormone response element with or without an expression vector for UBCH7. It was observed that UBCH7 had minimal effect on the transactivation functions of various receptors in the absence of hormone. However, UBCH7 significantly enhanced (~4.5-6.5-fold) the hormone-dependent transcriptional activity of PR, GR, AR, estrogen receptor (ER), and RAR (Fig. 1 A). These data suggest that UBCH7 modulates the ligand-dependent transcriptional activities of various nuclear receptors. Since HeLa cells are derived from a papillomavirus type 18-positive cervical carcinoma patient and thus express the viral E6 protein that can functionally interact with UBCH7, it was necessary to rule out the possibility that the viral E6 protein influences the coactivation function of UBCH7. As shown in Fig. IB, UBCH7 was able to stimulate the hormone-dependent transcriptional activity of PR in the E6 negative T47D cells, suggesting that the coactivation observed in HeLa cells is not dependent on the E6 protein. This data is consistent with our previously published data, which suggest that the coactivation function of E6-AP is not dependent on the viral E6 protein (Nawaz et al., Mol.Cell Biol., 19: 1182-1189 (1999)). In view of the fact that UBCH7 is a component of the ubiquitin-proteasome pathway, the expression levels of PR both in the absence and presence of exogenously expressed UBCH7 were also examined. As shown in Figure IC, UBCH7 has no significant effect on the expression levels of PR. The expression levels of PR were identical both in the absence and presence of UBCH7, suggesting that increased reporter activity observed in transcription assays in the presence of UBCH7 reflects a true increase in the specific transcriptional activity of the PR. In order to determine that UBCH7 specifically modulates the transcriptional activities of steroid hormone receptors, the effects of expression of UBCH7 on the transcriptional activities of other transcriptional factors such as p53 and the VP-16 activation domain were also examined (see Nawaz et al., Mo. Cell. Biol., 19, 1182-1189 (1999)). As shown in Fig ID, UBCH7 had no significant effect on the transactivation function of either of these transactivators. The transcriptional activity of p53 and the VP-16 activation domain is identical both in the absence and presence of exogenously expressed UBCH7. These observations suggest that UBCH7 preferentially modulates the hormone-dependent transcriptional activity of nuclear hormone receptors. A number of ubiquitin-conjugating enzymes have been identified. In order to determine if only UBCH7 is involved in receptor-dependent activation of target gene expression, transient transfection assays were carried out. Cells were co-transfected with mammalian expression plasmid for the PR along with reporter plasmid containing progesterone response element along with either control plasmid or expression plasmid for other ubiquitin-conjugating enzymes such as UBCH5B, UBCH8 and UBC12. UBCH5B, UBCH8 and UBC12 were unable to stimulate the hormone-dependent transcriptional activity of PR, whereas under similar conditions, UBCH7 was able to stimulate the transcriptional activity of PR (Fig. IE), suggesting that only UBCH7 is involved in steroid hormone receptor activation pathway. Depletion of endogenous UBCH7 levels reduces transcriptional activity of PR: In order to confirm that UBCH7 is indeed required for PR activation, endogenous expression of UBCH7 in HeLa cells was depleted by small interfering RNA (siRNA) directed against UBCH7. HeLa cells were transiently transfected with different UBCH7 siRNA' s (siRNA #1,2 or 3) and GAPDH control siRNA, along with PR and PR-responsive reporter plasmids. It was observed that expression of the different siRNA' s directed against UBCH7 resulted in reduced levels of UBCH7 expression, whereas control siRNA had no effect on the expression of UBCH7 (Fig. 2B). Furthermore, it was also observed that depletion of endogenous UBCH7 by the siRNA #1 and 2 resulted in reduction of PR transcriptional activity by 70% (Fig. 2A). Like siRNA#l and 2, siRNA# 3 was also able to reduce the transcriptional activity of PR. Similarly, the UBCH7 specific siRNA also reduced the expression levels of UBCH7 in E6 negative T47D cells. Furthermore, the transcriptional activity of the endogenous PR in T47D cell was also reduced. These data confirm that UBCH7 is required for the proper functioning of this steroid hormone receptor. UBCH7 reverses transcriptional interference between ER and PR: It has been reported that the transcriptional activity of one receptor can be squelched by the overexpression of another receptor indicating that both receptors compete for limited pools of common factors (Bocquel et al., Nucleic Acids Res., 17:2581-2595 (1989); Meyer et al., Cell, 57:433- 442 (1989)). To examine if UBCH7 can relieve ER-induced squelching of the transcriptional activity of PR, a transient transfection assay was used. PR-mediated transcriptional activity was reduced by 82% upon co- expression of estradiol-bound ER (Fig. 3; compare lanes 2 and 3). Addition of UBCH7 reversed this squelching by as much as 9.6-fold (Fig. 3; compare lanes 2 and 8) in a dose-dependent manner. In control cells that do not express ER, UBCH7 enhanced the PR-mediated transcriptional activity from eight- to nine-fold (Fig. 3; compare lanes 2 and 9). Thus co-expression of UBCH7 can reverse the interference between ER and PR, suggesting that UBCH7 is one of the limiting factors that is necessary for efficient PR and ER transcriptional activities. Effect of UBCH7 on the transcriptional activity of different regions of PR: Since UBCH7 modulates the transcriptional activity of PR in a hormone-dependent manner, we determined whether UBCH7 has any effect on the transactivation function of AF-1 and AF-2 regions of PR. HeLa cells were co-transfected with expression plasmids for AF-1 region of PR, AF-2 region of PR or full-length of PR along with progesterone response reporter gene with or without UBCH7 expression plasmid. The results demonstrate that in the absence of the AF-1 region of PR, UBCH7 had only a minimal effect on the expression of the reporter gene. However, addition of hormone significantly enhanced the activity of the AF-2 region of PR. Expression of UBCH7 further enhanced the activity of the AF-2 region of PR by only 1.5-fold over the transcriptional activity of the AF-2 region of PR in the absence of UBCH7 expression (Fig. 4). It has been shown that the AF-1 region of PR is a hormone-independent activation domain and that addition of hormone has no effect on its activity. These data also suggest that addition of hormone has no significant effect on the transcriptional activity of AF-1 region of PR (Fig. 4). Like the AF-2 region of PR, the addition of UBCH7 increases the transcriptional activity of the AF-1 region of PR by only 1.5-fold (Fig. 4) as compared to the activity in the absence of UBCH7. In contrast, UBCH7 was able to enhance the transcriptional activity of full-length PR by 11-fold. These data suggest that UBCH7 has only a minimal effect on the transcriptional activities of the isolated AF-1 and AF-2 regions of PR. However UBCH7 synergistically enhanced the transcriptional activity of the AF-1 and AF- 2 regions of PR in the context of the full-length receptor. The ubiquitin-conjugation enzymatic activity of UBCH7 is required for its ability to activate PR transcriptional activity: Since UBCH7 is an E2 ubiquitin-conjugating enzyme, it is pertinent to understand if its ability to modulate the transcriptional activity of PR is dependent on its ability to form a thioester bond with ubiquitin at its conserved cysteine residue (C87). It has been shown that mutation of the conserved cysteine residue into either alanine or serine abolishes the ubiquitin-conjugation activity of the UBCH7 enzyme. The ability of a C to S mutant of UBCH7 to modulate PR transcriptional activity was tested by both transient transfection assay and in vitro transcription assays. As shown in Fig. 5A, wild-type UBCH7 was able to enhance the transcriptional activity of PR in a hormone-dependent manner in a transient transfection assay. In contrast, the mutant (C-87-S) UBCH7 was unable to activate the transcriptional activity of PR. To confirm that loss of coactivation function of mutant UBCH7 is not due to the loss of expression of the mutant UBCH7, we also analyzed the expression of UBCH7 by Western blot analysis. These data suggest that both the wild- type and mutant UBCH7 are expressed at equal levels (Fig. 5B). These results indicated that the ubiquitin-conjugation activity of UBCH7 is required for its ability to enhance nuclear hormone receptor activities. UBCH7 potentiates PR transactivation on chromatin templates: To further confirm that UBCH7 modulates the transcriptional activity of PR in a ligand-dependent manner and that the ubiquitin conjugation activity of UBCH7 is required for the coactivation function, we employed a cell free in vitro transcription system. Naked plasmid DNA containing either a progesterone response element or control template that contains no progesterone response element was assembled into chromatin using a Drosophila embryo extract. The PR, progesterone and UBCH7 were added after chromatin assembly was completed. We found that addition of progesterone resulted in an activation of transcription on pre-assembled chromatin templates by PR. Addition of wild-type UBCH7 purified from E. coli further enhanced the hormone-dependent transcriptional activity of PR, whereas UBCH7 containing the C87S mutation had a minimal effect on the transcription activity of PR (Fig. 5C). However, no significant transcription was observed from the control template that lacks the progesterone response element (Fig. 5C). Our in vitro results confirmed that UBCH7 potentiates PR-mediated transactivation, and that the ubiquitin-conjugation activity of UBCH7 is required for its coactivator function. In vivo recruitment of UBCH7 onto the ΕR and PR responsive promoters: In order to better understand the coactivation function of UBCH7, a chromatin immunoprecipitaion (ChlP) assay was used to examine the recruitment of UBCH7 to ΕR- and PR-responsive promoters in vivo. Formaldehyde crosslinked chromatin complexes were immunoprecipitated with the appropriate antibodies from MCF-7 and T47D/CATO cells in the presence or absence of estrogen and progesterone. The precipitated genomic DNA associated with ΕR, PR receptors and UBCH7 were amplified by a polymerase chain reaction using primers specific for the PS2 and MMTV promoters. ChlP analyses demonstrated the recruitment of UBCH7 to ΕR and PR-responsive promoters in vivo in the presence of estrogen or progesterone (Fig. 6A and B). These results are consistent with previously published findings which suggest that coactivators are recruited to the target promoters by receptors in a hormone-dependent manner and demonstrate that UBCH7 is physically present on the promoter of these target genes. UBCH7 and Ε6-AP synergistically enhance receptor activity:

Further experiments were conducted to explore the functional interaction between E6-AP and UBCH7. HeLa cells were transiently transfected with wild-type E6-AP and UBCH7 expression plasmids. UBCH7 and E6-AP alone significantly enhance the activity of PR (Fig. 7A). However, when present together, UBCH7 and wild-type E6-AP synergistically enhanced the transactivation function of PR (Fig. 7A). E6- AP is an E3 ubiquitin-protein ligase enzyme and it has been previously shown that the ligase activity of E6- AP is not required for its coactivation function (Nawaz et al., Mol.Cell Biol., 19:1182-1189 (1999)). However, it is still possible that the synergy between E6-AP and UBCH7 may require the ligase activity of E6-AP. In order to test whether the ligase activity of E6-AP is required for its synergy with UBCH7, HeLa cells were transiently transfected with ligase defective mutant E6-AP and UBCH7 expression plasmids. As shown in Fig. 7A, like wild-type E6- AP, the ligase defective mutant E6-AP and UBCH7 were also able to synergistically enhanced the transactivation function of PR. This data suggests that the ligase activity of E6-AP is not required for its ability to synergize with UBCH7. Together, these findings suggest that E6-AP and UBCH7 functionally interact with each other. Since E6-AP has been reported to interact with UBCH7, we wished to examine the ability of UBCH7 to function as a coactivator in the absence of E6-AP. In order to test the ability of UBCH7 to function as a coactivator in the absence of E6-AP protein, we utilized the E6-AP knockout (KO) cells that were derived from E6-AP KO animals. Transient transfection assays indicate that UBCH7 was able to activate PR activity in E6-AP KO cell line (Fig.7B). This data suggests that UBCH7 coactivation function is not dependent on E6-AP expression. UBCH7 interacts with SRC-1: In order to determine whether UBCH7 also interacts with other coactivators, we also examined the ability of UBCH7 to interact with members of the pi 60 family of coactivators. [³⁵S]-methionine labeled SRC-1, SRC-2 and SRC-3 proteins were synthesized in vitro. Control protein (GST), GST-UBCH7 and GST-UBCH5B proteins were expressed and purified from E. coli. The in vitro translated SRC-1, SRC-2 and SRC-3 proteins and GST fused UBCH7/UBCH5B protein, along with GST control protein, were incubated together with glutathione sepharose beads and analyzed by SDS-PAGE and autoradiography. Fig. 8A depicts that UBCH7 was able to interact with SRC-1 (Fig. 8 A). However, UBCH7 was unable to interact with either SRC-2 or SRC-3 (Fig. 8 A). In order to determine that SRC-1 specifically interacts with UBCH7, we also examined the ability of UBCH5B that has no significant effect on the transactivation function of receptor to interact with SRC-1. The UBCH5B failed to interact with SRC-1 whereas under similar conditions UBCH7 was able to interact with SRC-1 (Fig. 8 A). These data suggest that UBCH7 specifically interacts with SRC-1 protein. To further confirm that UBCH7 indeed interacts with SRC-1, we also examined the in vivo interaction of UBCH7 with SRC-1 by coimrnunoprecipitation analysis. Cell lysates were immunoprecipitated with either serum or specific antibodies such as anti-UBCH7 and anti- UBCH5B, followed by Western blotting with an anti-SRC- 1, anti-UBCH7 or anti-UBCH5 specific antibody (Fig. 8B). The results presented in Fig. 8B demonstrates that SRC-1 was coimmunoprecipitated with UBCH7. In contrast, control serum and UBCH5B antibody failed to coimmunoprecipitate SRC-1, suggesting that in vivo UBCH7 also interacts with SRC-1. This data is consistent with our GST-pull down data which suggests that SRC-1 specifically interacts with UBCH7. Taken together, these findings suggest that UBCH7 and SRC-1 interact with each other both in vitro and in vivo. In view of the fact that, UBCH7 is a component of the ubiquitin-proteasome pathway and furthermore, it interacts with SRC-1, therefore, we also examined the expression levels of SRC-1 both in the absence and presence of exogenously expressed UBCH7. The expression levels of SRC-1 are identical both in the absence and presence of UBCH7 (Fig. 8C). This data is consistent with our previously published results which suggest that the ubiquitin-conjugation enzymes, UBC2 and UBC3 degrade SRC- 1 whereas UBCH7 has no significant effect on the degradation of SRC-1 (Yan et al., Mol. Endocrinol. 17:1315-1331 (2003)). Coactivation of PR by UBCH7 requires SRC-1: Since UBCH7 specifically interacts with SRC-1 protein; we tested the ability of UBCH7 to function as a coactivator in the absence of SRC-1. In order to test the ability of UBCH7 to function as a coactivator in the absence of SRC- 1 protein, we utilized the SRC-1 KO cells that were derived from SRC-1 KO animals. Transient transfection assays indicate that UBCH7 was unable to activate PR activity in SRC-1 KO cell line. However in presence of exogenously added SRC-1, the coactivation function of UBCH7 was restored (Fig. 8D). This data suggests that SRC-1 expression is essential for the coactivation function of UBCH7 (Fig. 8D). Discussion UBCH7, an E2 ubiquitin-conjugating enzyme, was isolated as an E6-AP interacting protein (Kumar et al., J.Biol.Chem., 272:13548-13554 (1997); Nuber et al., J.Biol.Chem., 271:2795-2800 (1996)). UBCH7 acts as an E2 ubiquitin-conjugating enzyme for E6-AP. In this report, we describe the involvement of UBCH7 in steroid hormone and nuclear receptor transactivation pathways. We demonstrated that UBCH7 preferentially modulates the ligand-dependent transcriptional activities of various nuclear hormone receptors. These results are consistent with previously published reports indicating that coactivators can modulate the hormone-dependent transcriptional activity of different nuclear receptors and most coactivators exhibit little detectable receptor specificity (Onate et al., Science, 270:1354-1357 (1995)). It has been suggested that most coactivators interact with receptors via the LXXLL motifs contained within the coactivator (Heery et al., Nature, 387:733- 736 (1997); Mclnerney et al., Genes Dev., 12:3357-3368 (1998)). Unlike these coactivators, UBCH7 does not contain LXXLL motifs and it fails to directly interact with receptor. However, previously published reports and our data from GST-pull down and coimmunoprecipitation experiments demonstrate that UBCH7 directly interacts with E6-AP and SRC-1, which contain LXXLL motifs and interact with receptor in a hormone-dependent manner. Additionally, our data also suggests that E6- AP expression is not required for UBCH7 coactivation function. Based on these findings, we suggest that UBCH7 likely modulates receptor function through its interaction with SRC-1. Hence it is possible that UBCH7 interacts with SRC-1 and forms a protein complex which interacts with receptor either via SRC-1, and thereby modulates the hormone-dependent transcriptional activity of the target gene. This possibility is supported by our findings from SRC-1 KO cells wherein we observed that UBCH7 is unable to coactivate steroid receptor functions unless SRC-1 protein is coexpressed. The existence of modulatory proteins in the nuclear hormone receptor transactivation pathway is supported by the finding that the transcriptional activity of one receptor can be squelched by the overexpression of another receptor, indicating that both receptors compete for a limited pool of common factors (Bocquel et al., Nucleic Acids Res., 17:2581-2595 (1989); Meyer et al., Cell, 57:433-442 (1989); Shemshedini et al., J.Biol.Chem., 267:1834-1839 (1992)). This observation led us to determine whether UBCH7 is one of these limiting factors and that its overexpression can abrogate this squelching phenomenon. Our results indicate that overexpression of UBCH7 in HeLa cells reverses the squelching effect of ER on PR transactivation in a dose-dependent manner. These results are consistent with previously published studies indicating that a genuine coactivator should be able to reverse squelching between two receptors (Meyer et al., Cell, 57:433-442 (1989)). There are two distinct activation function domains in nuclear hormone receptors, the AF-1 and AF-2. The activity of the amino- terminal AF-1 domain is not regulated by hormone and this domain is constitutively active, whereas the activity of the carboxy-terminal AF-2 domain is regulated by hormone (Shibita et al., Recent Prog Hormone Res., 52:141-165 (1997)). Our data demonstrated that UBCH7 has a marginal effect on the transcriptional activities of AF-1 and AF-2 domains of receptor when these domains are analyzed individually.

However, UBCH7 synergistically enhanced the transcriptional activity of AF-1 and AF-2 regions in the context of the full-length receptor. These results indicate that UBCH7 require both activation domains of the receptor for it to properly modulate the transcription activity of the receptor. It is possible that UBCH7 exerts its effect on both transactivation domains of the receptors via the SRC-1 protein that is known to interact with both transactivation domains of receptor as well as UBCH7 (Onate, LBiol Chem., 273:12101-12108 (1998)). The ubiquitin-proteasome pathway involves three classes of enzymes, an El ubiquitin-activating enzyme (UBA), E2 ubiquitin- conjugating enzymes (UBCs), and E3 ubiquitin-protein ligases. It is known that UBCs form a thioester bond with ubiquitin through a conserved cysteine residue (C87) contained within these proteins and that mutation of this residue abolishes its ability to bind to and to transfer ubiquitin. Our in vitro and in vivo experiments both show that the coactivation function of UBCH7 is dependent on its enzymatic activity, suggesting that the ubiquitin-conjugation activity of UBCH7 is required for steroid hormone receptor action. This data builds upon a common feature of coactivators that the enzymatic activities of coactivators such as SRC-1, p300/CBP, RAC3/ACTR/AIB1 and CARM-1 contribute to the receptor's ability to stimulate transcription (Chen et al., Cell, 90:569-580 (1997); Ii et al., Proc Natl Acad Sci.USA, 94:8479-8484 (1997); Ogryzko, Cell, 87:953-959 (1996); Spencer et al., Nature, 389:194-198 (1997)). We and others have previously published that the ubiquitin- protein ligase activity of the E3 ligases E6-AP and RSP5 are not required for their coactivation function (Nawaz et al., Mol.Cell Biol., 19:1182- 1189 (1999)). In contrast, here we report that the ubiquitin-conjugation activity of UBCH7 is essential for its ability to modulate receptor function, suggesting that an intact ubiquitin-proteasome pathway is requisite for proper functioning of the receptor. Our ChlP analyses demonstrate the recruitment of UBCH7 onto ER and PR-responsive promoters, indicating that UBCH7 physically associates with the pS2 and MMTV promoters. These results are consistent with previously published findings, which suggest coactivator proteins such as SRC family members are recruited to target promoters by receptors in a hormone-dependent manner (Shang et al., Cell, 103:843-852 (2000)). Our data is also in agreement with previously published studies demonstrating that E3 ubiquitin-protein ligase, E6-AP and the components of the regulatory subunit of the proteasome are recruited to the hormone-responsive promoter of the pS2 gene (Reid et al., Mol Cell, 11:695-707 (2003)). Since UBCH7 fails to physically associate with receptor it is likely that UBCH7 is recruited to the target promoters in a hormone-dependent manner by its association with E6-AP and/or SRC-1. Identification of the ubiquitin-conjugating enzyme, UBCH7 as a modulator of nuclear hormone receptors implicates the ubiquitin- proteasome pathway as an integral part of eukaryotic gene transcription. Consistent with this hypothesis, it has been shown that intact ubiquitin- proteasome pathway is required for proper execution of receptor function (Dennis et al., Front Biosci., 6:D954-D959 (2001); Stenoien et al., Hum.Mol.Genet., 8:731-741 (1999)). This hypothesis is further strengthened by the fact that the ubiquitin-conjugation activity of UBCH7 is required for its coactivation function and furthermore, that the ubiquitin-proteasome pathway enzymes are recruited to the promoter of hormone-responsive target genes. It is possible that in order to activate transcription, hormone bound receptor recruits ubiquitin-proteasome pathway enzymes such as E6-AP and UBCH7 to the promoter of target genes and which then modulate transcription by disrupting the preinitiation complex, allowing subsequent steps in transcription to proceed. It is also plausible that UBCH7 is involved in complex remodeling and turnover of the nuclear receptor-transcription complex via the ubiquitin-proteasome pathway for transcription initiation, elongation and RNA processing. The enzymatic activity of UBCH7 appears to be involved in exchange of coactivator complexes. This scenario is supported by our recently published report showing that UBCH7 selectively promotes the degradation of TIF-2and E6-AP (Yan et al., Mol.Endocrinol. 17:1315-1331 (2003)), therefore, UBCH7- dependent protein degradation is essential to 'maintain' efficient transcription of the target promoter-gene. In conclusion, results presented in this Example demonstrate that UBCH7, an E2 ubiquitinconjugating enzyme of the ubiquitin-proteasome pathway, acts as an enzymatic coactivator and modulates the transcriptional activities of steroid hormone receptors substantiating that the ubiquitin-proteasome pathway is intimately involved in the nuclear hormone receptor gene transactivation.

Example 2 Silencing expression of MUC-2

The aim of this study was to block MUC-2 production using molecular strategies that target the translation of the MUC-2 gene with small interfering RNAs designed against MUC-2 to block mucin-2 production.

Methods Several siRNA molecules were developed and tested against the

MUC-2 gene. The siRNAs tested were

AACTTCCACTACAAGACCTTC (siRNA#l, SEQ ID NO:32), AATTTGCTGTGCACCTGAAGC (siRNA#2, SEQ ID NO:33), AAGAGCGATGCCTACACCAAA (siRNA#3, SEQ ID NO:34), AAGAAGAAGAATGCGGTGGTC (siRNA#4, SEQ ID NO:35), AAGAAGACAGAGACCCCCTTT (siRNA#5, SEQ ID NO:36), AAGATCAAGGTGGACTGCAAT (siRNA#6, SEQ ID NO:37), AACAACACAGTCCTGGTGGAA (siRNA#7, SEQ ID NO:38), AACTGCACATTCTTCAGCTGC (siRNA#8, SEQ ID NO:39), AAGATCCACAACCAGCTCATC (siRNA#9, SEQ H> NO:40), and AACTTTGATGCCAGCATTTGC (siRNA#10, SEQ ID NO:41). The GAPDH siRNA used as a control was GGATATTGTTGCCATCATT (SEQ ID NO:5). The potential of these siRNA molecules to block MUC- 2 gene expression in vitro was analyzed in the colon cancer cell lines HT- 29 (ATCC accession number HTB-38) and HCT- 116 (ATCC accession number CCL-247). The expression of MUC-2 was analyzed by immunohistochemistry and Western blot analyses. For immunohistochemistry analysis, cells were grown in chamber slides for 24 hours. Cells were then transfected with different MUC-2 siRNAs using siPORT transfection reagent (Ambion) for 24 hrs. The expression of MUC-2 was analyzed using anti-MUC-2 antibody (BD Biosciences, San Jose, CA) and a biotin conjugated secondary antibody (Vector Laboratories, Burlingame, CA). Positive signal for MUC-2 was a brown staining of the cytoplasm (nuclear blue staining was seen as the result of counter staining by hematoxylin). For western blot analysis, HT-29 and HCT-116 cell lines were transfected with different siRNAs using siPORT transfection reagent for 24 hours. Equal amount of proteins were loaded on 4-20% gradient gels, transferred to a membrane, and then analyzed using an anti-MUC-2 antibody. The expression of MUC-2 was analyzed by Western blot analysis with quantification by NIH image scan program 1.62. The NTH image scan program is publicly available through the NIH Image FTP site, rsbweb.nih.gov.

Results MUC-2 expression in different colon cancer cell lines was evaluated by Western blot analysis and immunohistochemical analysis. The data showed that the colon cancer cell lines HT-29 and HCT-116 express MUC-2. These cell lines were used in this study. The effect of siRNA on the protein expression of MUC-2. The effect of the different siRNAs on the expression of MUC-2 gene was determined by immunohistochemical analysis. There was a marked reduction of brown staining in cells treated with siRNA#2 (SEQ ID NO:33) compared to cells treated with the control siRNA. Thus, expression of MUC-2 protein in HT-29 cell line was blocked by siRNA#2. Quantitative analysis of MUC-2 expression. The MUC-2 protein levels were determined using Western blot analysis. HT-29 cells were transfected with siRNA#2 (SEQ ID NO:33). After 24 hours, cell lysates were prepared and analyzed for MUC-2 expression (Fig. 9). The control lane represents control cells that were transfected with the non-specific siRNA. The siRNA lane represents cells that were transfected with MUC-2 specific siRNA#2. Actin expression was used as a loading control. In order to quantify the data, the Western blot was scanned with NIH 1.62 image scan program and the data was plotted as protein expression. The figure shows that siRNA#2 reduced expression of MUC- 2 by 60%. The effect of siRNAs on the expression of MUC-2 in HCT-116 cell line. The effect of different siRNAs on the expression of MUC-2 gene in HT-116 cells were examined by immunohistochemical analysis. The marked reduction of brown staining in cells treated with siRNAs #1+5 revealed that expression of MUC-2 protein in HT-116 cell line was blocked. Quantitative analysis of MUC-2 expression in HCT-116 cell line. The MUC-2 protein levels were determined by using Western blot analysis. The HT-116 cells were transfected with a mixture of two siRNAs#l+5. After 24 hours, cell lysates were prepared and analyzed for MUC-2 expression (Fig. 10). Cl lane represents control cells. C2 lane represents control cells that were transfected with non-specific siRNA. The siRNA lane represents cells that were transfected with a mixture of two MUC-2 specific siRNAs#l+5. Actin expression was used as a loading control. Quantitative analysis revealed reduced expression of MUC-2 by 80%. These assays were also conducted using the other siRNAs listed above. siRNA#l (SEQ ID NO:32) and siRNA#5 (SEQ ID NO:36) yielded results similar to siRNA#2. The siRNAs corresponding to siR A#3, siRNA#4, siRNA#6, siRNA#7, siRNA#8, siRNA#9, and siRNA#10 did not function to alter the expression of the MUC-2 gene. In conclusion, siRNAs developed against the MUC2 gene specifically block the expression of MUC2 in colon cancer cell lines HT- 29 and HCT-116. Example 3 Silencing expression of MUC-1

The aim of this study was to block MUC-1 production using molecular strategies that target the translation of the MUC-1 gene with small interfering RNAs designed against MUC-1 to block mucin-1 production.

Methods

Several siRNA molecules were developed and tested against the MUC-1 gene. The siRNAs tested were

AAGAATTGCAGACAGAGGCTG (siRNA#l, SEQ ID NO:24), AAGAGAGTAGGGAGAGGGAAG (siRNA#2, SEQ ID NO:25), AAGTTCAGTGCCCAGCTCTAC (siRNA#3, SEQ ID NO:26), AAGAATGCTGTGAGTATGACC (siRNA#4, SEQ ID NO:27), AACCAGCTTCAGGTTCAGCTG (siRNA#5, SEQ ID NO:28), AAGACTGATGCCAGTAGCACT (siRNA#6, SEQ ID NO:29), and AAGAGCTGCAGAGAGACATTT (siRNA#7, SEQ ID NO:30). The GAPDH siRNA used as a control was GGATATTGTTGCCATCATT (SEQ ID NO:5). The potential of these siRNA molecules to block MUC- 1 gene expression in vitro was analyzed in the colon cancer cell lines HT- 29 (ATCC accession number HTB-38) and HCT-116 (ATCC accession number CCL-24)using the methods described in Example 2. The anti- MUC-2 antibody was obtained from BD Biosciences. In Western blot analysis and immunohistochemical analysis siRNA#l and siRNA#7 specifically decreased expression of MUC-1 protein in the cells lines. The other siRNAs, siRNA#2, siRNA#3, siRNA#4, siRNA#5, and siRNA#6, did not cause a decrease in expression of MUC-1 protein in the cells lines.

Example 4 Evaluation of siRNA against mucins (MUCl & MUC2) in mouse xenograft model of colon cancer and peritoneal carcinomatosis

RNA interference (RNAi), mediated by small interfering RNA (siRNA), silences genes with a high degree of specificity and represents a general approach for molecularly targeted anticancer therapy. Several siRNAs against MUCl and MUC2 have been tested in colon cancer cell lines with preliminary results of greater than 60% of down-regulation of MUCl and MUC2 expressions (See Examples 2 and 3).

Materials and Methods Cells lines and cell culture Human colon cancer cell lines LS 174T, HT29 and HCT116 obtained from American Type Culture Collection (ATCC) (Rockville, MD) are maintained in Dulbecco Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS; Gibco BRL, Gaithersburg, MD), 1% penicillin and gentamicin and are incubated in a humidified (37°C, 5% CO2) incubator, grown in 75-cnι2 culture flasks and passaged upon reaching 80% confluence. These cell lines are treated with MUCl and MUC2 siRNA and compared with controls. Cell culture plates (6-well) are used. Each well contains 2 x 10⁵ cells and is treated with 200 nM MUCl, MUC2 or control siRNAs for 24 hours. Western blot, immunohistochemistry (for chamber slide culture), flow cytometry and apoptosis satin are used to characterize the difference between the experimental and control groups.

siRNA Preparation For preventing MUC-1 expression the following siRNAs are used:

AAGAATTGCAGACAGAGGCTG (siRNA#l, SEQ ID NO:24), AAGAGCTGCAGAGAGACATTT (siRNA#7, SEQ ID NO:30). For preventing MUC-2 expression the following siRNAs are used: AACTTCCACTACAAGACCTTC (siRNA#l, SEQ ID NO:32), AATTTGCTGTGCACCTGAAGC (siRNA#2, SEQ ID NO:33),

AAGAAGACAGAGACCCCCTTT (siRNA#5, SEQ ID NO:36), These siRNAs are synthesized using a commercially available siRNA construction kit (Ambion), or if larger amounts of siRNA are needed a commercially available siRNA expression vector (Ambion) is used. Control siRNA (CCCGACAGUUCCAUGUAUA) bears no homology with relevant human genes.

Western Blot Analysis Cells are harvested and rinsed twice with PBS. Cell extracts are prepared with lysis buffer (20 mM Tris, pH 7.5, 0.1 % Triton X- 100, 0.5% deoxycholate, 1 mM phenylmethylsulfonyl fluoride (PMSF), 10 μg/mL aprotinin, 10 μg/mL leupeptin) and cleared by centrifugation at 12,000g, 4°C. Total protein concentration is measured with bovine serum albumin as a standard. Cell extracts containing 50 μg total protein are subjected to 4% sodium dodecyl sulfate polycrylamide gel electrophoresis (SDS/PAGE), and the resolved proteins are transferred electrophoretically to nitrocellulose membranes. Equal protein loading is confirmed by Coomassie (BioRad, Hercules, CA) staining of the gel or by adding beta-actin. After blocking with phosphate buffered saline (PBS) containing 1 % milk for 1 hour at room temperature, membranes are incubated with primary antibodies against MUCl and MUC2 (PharMingen, San Diego, CA) in PBS containing 0.1% Tween 20 overnight at 4°C followed by goat anti-mouse IgG-HRP conjugated secondary antibodies (Bio Rad) for 2 hours at room temperature. Anti-actin monoclonal antibody is obtained from Lab Vision (Freemont, CA). Chemiluminescent detection (Upstate, Lake Placid, NY) is performed in accordance with the manufacturer's instructions. The MUCl and MUC2 signal is quantified using ImagePro Plus software version 4.0 and normalized to that of actin. Blots are performed in triplicate.

Nude Mouse Models Subcutaneous and intraperitoneal (IP) injection of cancer cells (LS174T, HT29 and HCT116) to create subcutaneous (sacral region) xenogaft tumor and peritoneal carcinomatosis respectively. Male and female athymic nu/nu mice 4-6 weeks of age, weighing 20-25 grams and specific pathogen-free obtained from Charles River Laboratories

(Wilmington, MA) are housed in microisolator cages with autoclaved bedding in a specific pathogen-free facility with 12-hour light-dark cycles. Water and food is supplied. Animals are observed for signs of tumor growth, activity, feeding, and pain in accordance with the guidelines of the Creighton University Animal Committee. To determine the effect of IP/systemic siRNA administration on tumor growth and metastasis, mice are anesthetized with intraperitoneal ketamine (200 mg kg) and xylazine (10 mg kg) and IP/subcutaneously implanted with 2x10 cells. Once ascites is observed or tumors reach approximately 50 mm in volume, mice are allocated to receive either MUCl, MUC2 or control siRNA (150 μg/kg by twice weekly JP or tail vein injection). Tumor dimensions and abdominal girdle are measured weekly and the tumor volumes calculated using the formula: [1/2] x a x b2, where a and b represent the larger and smaller tumor diameters, respectively. After 2 weeks' treatment, mice are terminated by overdose of ketamine (400 mg kg) and xylazine (50 mg/kg) and necropsy is performed. Tumors are weighed and intraperitoneal tumor implantation sites and metastases are counted and confirmed histologically. Tumor growth inhibition (TGI) is calculated using the formula TGI (%) = (1 - MT/MC) x 100, where MT and MC are the mean tumor masses in the treatment group and control group, respectively.

Survival group study Following the treatment period of 2 weeks, siRNA administration is discontinued. Mouse survival time is determined. The paracentesis and analysis of peritoneal fluid biweekly is performed. When necessary, mice are killed due to the presence of massive ascites or debilitating tumor growth.

Example of experimental design (e.g., cell line LS 174T and MUC2 siRNA)

Irnmunohistochemistry Cell line culture chamber slides and tumor sections (5-μm) are processed for MUCl and MUC2 immunohistochemistry. Primary antibodies are the same as used in the western blot analysis. Sections are incubated with primary antibodies first, followed by biotinylated secondary antibodies and visualized using ABC kit (Vecotor Lab) with 3,3'-diaminobenzidine tetra hydrochloride (DAB) as chromagen. Quenching of endogenous peroxidase activity is performed as needed. Sections are counterstained with hematoxylin before dehydration and mounting. Sections are examined microscopically.

Flow Cytometry and Apoptosis Staining Flow cytometry is used to assess cell growth. Apoptosis in tumor sections and cell culture chamber slides is quantified using a commercially available fluorescent terminal deoxynucleotidyl transferase nick-end labeling (TUNEL) kit, in accordance with the manufacturer's protocol (Roche Diagnostics Corporation, Indianapolis, IN). The fractions of apoptotic cells in 5 random fields from each tumor section are counted, scoring 100 cells in each field, and expressed as an apoptotic fraction (%).

Statistical Analysis Differences between groups is analyzed using Student t test, multifactorial ANOVA of initial measurements and Mann- Whitney U test, for nonparametric data, as appropriate, using standard statistical software. P < 0.05 is considered statistically significant.

The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims. All headings are for the convenience of the reader and should not to limit the meaning of the text that follows the heading, unlessified.

Claims

What is claimed is:

1. An RNA polynucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence of between 16 and 30 nucleotides, wherein the nucleotide sequence is substantially identical to consecutive nucleotides of an mRNA encoding a polypeptide of SEQ ID NO:42, and wherein the RNA polynucleotide inhibits expression of a UbcH7 polypeptide.

2. An RNA polynucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence of between 16 and 30 nucleotides, wherein the nucleotide sequence is substantially identical to consecutive nucleotides of an mRNA encoding a polypeptide of SEQ ID NO:43, and wherein the RNA polynucleotide inhibits expression of an E6-AP polypeptide.

3. An RNA polynucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence of between 16 and 30 nucleotides, wherein the nucleotide sequence is substantially identical to consecutive nucleotides of an mRNA encoding a polypeptide of SEQ ID NO:46, and wherein the RNA polynucleotide inhibits expression of a mucin-1 polypeptide.

4. An RNA polynucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence of between 16 and 30 nucleotides, wherein the nucleotide sequence is substantially identical to consecutive nucleotides of an mRNA encoding a polypeptide of SEQ ID NO:47, and wherein the RNA polynucleotide inhibits expression of a mucin-2 polypeptide.

5. The RNA polynucleotide of claim 1 , 2, 3, or 4 wherein the nucleotide sequence is identical to consecutive nucleotides of the mRNA encoding a polypeptide of SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:46, or SEQ ID NO:47, respectively.

6. The RNA polynucleotide of claim 1 , 2, 3, or 4 wherein the sense strand comprises a nucleotide sequence of between 19 and 23 nucleotides.

7. The RNA polynucleotide of claim 1, 2, 3, or 4 wherein the sense strand begins with an AA dinucleotide.

8. The RNA polynucleotide of claim 1 wherein the sense strand and the antisense strand are a covalently linked by spacer comprising at least 3 nucleotides.

9. The RNA polynucleotide of claim 1 wherein the RNA polynucleotide comprises SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:14, SEQ ID NO: 15, or SEQ ID NO:16.

10. The RNA polynucleotide of claim 2 wherein the RNA polynucleotide comprises SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:44, or SEQ ID NO:45.

11. The RNA polynucleotide of claim 3 wherein the RNA polynucleotide comprises SEQ ID NO:24 or SEQ ID NO:30.

12. The RNA polynucleotide of claim 4 wherein the RNA polynucleotide comprises SEQ ID NO:32, SEQ ID NO:33, or SEQ ID NO:36.

13. A composition comprising the RNA polynucleotide of claim 1, 2, 3, or 4 and a pharmaceutically acceptable carrier.

14. A vector comprising a DNA polynucleotide encoding the RNA polynucleotide of claim 1, 2, 3, or 4.

15. A cell comprising the DNA polynucleotide of claim 16.

16. A method for inhibiting expression of a UbcH7 polypeptide comprising: administering into a cell an effective amount of a RNA polynucleotide, wherein the polynucleotide comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence of between 16 and 30 nucleotides, wherein the nucleotide sequence is substantially identical to consecutive nucleotides of an mRNA encoding a polypeptide of SEQ ID NO:42, and wherein the cell comprising the RNA polynucleotide has less UbcH7 polypeptide when compared to UbcH7 polypeptide present in a corresponding control cell that does not comprise the RNA polynucleotide.

17. A method for inhibiting expression of an E6-AP polypeptide comprising: administering into a cell an effective amount of an RNA polynucleotide, wherein the polynucleotide comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence of between 16 and 30 nucleotides, wherein the nucleotide sequence is substantially identical to consecutive nucleotides of an mRNA encoding a polypeptide of SEQ ID NO:43, and wherein the cell comprising the polynucleotide has less E6-AP polypeptide when compared to E6-AP polypeptide present in a corresponding control cell that does not comprise the polynucleotide.

18. A method for inhibiting expression of a mucin- 1 polypeptide comprising: administering into a cell an effective amount of an R A polynucleotide, wherein the polynucleotide comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence of between 16 and 30 nucleotides, wherein the nucleotide sequence is substantially identical to consecutive nucleotides of an mRNA encoding a polypeptide of SEQ ID NO:46, and wherein the cell comprising the polynucleotide has less mucin-1 polypeptide when compared to mucin-1 polypeptide present in a corresponding control cell that does not comprise the polynucleotide.

19. A method for inhibiting expression of a mucin-2 polypeptide comprising: administering into a cell an effective amount of an RNA polynucleotide, wherein the polynucleotide comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence of between 16 and 30 nucleotides, wherein the nucleotide sequence is substantially identical to consecutive nucleotides of an mRNA encoding a polypeptide of SEQ ID NO:47, and wherein the cell comprising the polynucleotide has less mucin-2 polypeptide when compared to mucin-2 polypeptide present in a corresponding control cell that does not comprise the polynucleotide.

20. The method of claim 16, 17, 18, or 19 wherein the cell is ex vivo.

21. The method of claim 16, 17, 18, or 19 wherein administering comprises administering the polynucleotide to a subject.

22. The method of claim 21 wherein the subject is a human being.

23. The method of claim 21 wherein the administering occurs during surgical resection of a tumor or resection of mucinous material.

24. The method of claim 23 wherein the administering comprises perfusion of the area from which the tumor, mucinous material, or the combination thereof, was resected.

25. The method of claim 23 wherein the administering comprises deposition of an implant in the area from which the tumor, mucinous material, or the combination thereof, was resected, wherein the implant comprises the polynucleotide.

26. The method of claim 21 wherein the administration occurs by intravenous injection of a composition comprising the polynucleotide and a pharmaceutically acceptable carrier.

27. The method of claim 16, 17, 18, or 19 wherein the polynucleotide is expressed from a vector comprising a DNA polynucleotide encoding the RNA polynucleotide.

28. A method for treating cancer in a subject comprising: administering to a subject an effective amount of an RNA polynucleotide, wherein the subject has or is at risk for an endocrine- related cancer wherein the RNA polynucleotide comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence of between 16 and 30 nucleotides, wherein the nucleotide sequence is substantially identical to consecutive nucleotides of an mRNA encoding a polypeptide of SEQ ID NO:42 or an mRNA encoding a polypeptide of SEQ ID NO:43, wherein a symptom associated with the cancer is decreased.

29. The method of claim 28 wherein the endocrine-related cancer is breast cancer or prostate cancer.

30. The method of claim 28 wherein the subject is a human being.

31. The method of claim 28 wherein the administering occurs during surgical resection of a tumor.

32. The method of claim 31 wherein the administering comprises perfusion of the area from which the tumor was resected.

33. The method of claim 31 wherein the administering comprises deposition of an implant in the area from which the tumor was resected, wherein the implant comprises the RNA polynucleotide.

34. The method of claim 28 wherein the administration occurs by intravenous injection of a composition comprising the RNA polynucleotide and a pharmaceutically acceptable carrier.

35. The method of claim 28 wherein the administration comprises administering a vector to the subject, wherein the vector comprises a DNA polynucleotide encoding the RNA polynucleotide.

36. The method of claim 28 wherein the RNA polynucleotide comprises SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16.

37. The method of claim 28 wherein the RNA polynucleotide comprises SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:44, or SEQ ID NO:45.

38. A method for treating cancer in a subject comprising: administering to a subject an effective amount of an RNA polynucleotide, wherein the subject has or is at risk for a cancer comprising mucin-overproduction, wherein the RNA polynucleotide comprises a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence of between 16 and 30 nucleotides, wherein the nucleotide sequence is substantially identical to consecutive nucleotides of an mRNA encoding a polypeptide of SEQ ID NO:46 or an mRNA encoding a polypeptide of SEQ ID NO:47, wherein a symptom associated with the cancer is decreased.

39. The method of claim 38 wherein the cancer is colon cancer, breast cancer, or pseudomyxoma peritonei.

40. The method of claim 38 wherein the subject is a human being.

41. The method of claim 38 wherein the administering occurs during surgical resection of mucinous material, during resection of a tumor, or combination thereof.

42. The method of claim 41 wherein the administering comprises perfusion of the area from which the mucinous material, tumor, or combination thereof, was resected.

43. The method of claim 41 wherein the administering comprises deposition of an implant in the area from which the mucinous material, tumor, or combination thereof, was resected, wherein the implant comprises the RNA polynucleotide.

44. The method of claim 38 wherein the administration occurs by intravenous injection of a composition comprising the RNA polynucleotide and a pharmaceutically acceptable carrier.

45. The method of claim 38 wherein the administration comprises administering a vector to the subject, wherein the vector comprises a DNA polynucleotide encoding the RNA polynucleotide.

46. The method of claim 38 wherein the RNA polynucleotide comprises SEQ ID NO:24 or SEQ ID NO:30.

47. The method of claim 38 wherein the RNA polynucleotide comprises SEQ ID NO:32, SEQ ID NO:33, or SEQ ID NO:36.