WO2009108755A2 - Pharmaceutical combinations for the treatment of cancer - Google Patents

Abstract

This invention relates to pharmaceutical compositions for the treatment of cancer comprising a src kinase inhibitor and an HDAC inhibitor. It also relates to methods of treating cancer in a mammal by administering a src kinase inhibitor in comnbination with an HDAC inhibitor.

Description

PHARMACEUTICAL COMBINATIONS FOR THE TREATMENT OF CANCER

CROSS-REFERENCE TO RELATED APPLICATION

This application claims priority benefit of U.S. Provisional Application Serial No. 61/067,422 filed February 27, 2008, which is incorporated herein by reference in its entirety.

FIELD OF INVENTION

This invention relates to the combination of src kinase inhibitors and histone deacetylase (HDAC) inhibitors for the treatment of cancer, and, more specifically, to the combination of valproic acid (2-propylpentanoic acid) and bosutinib 4-(2,4-dichloro-5-methoxy- phenylamino)-6-methoxy7-[3-(4-methyl-piperizin-1-yl)-propoxy]-quinoline-3-carbonitrile) for the treatment of cancer.

BACKGROUND OF THE INVENTION

Colorectal cancer (CRC) is a major cause of death in Western countries. Over 100,000 people die from CRC in the European Union every year[1]. Current therapy relies primarily on surgical removal of non-metastatic disease. At a later stage, standard treatments have limited efficacy, despite recent progresses. More effective therapies are needed for the clinical management of this highly lethal cancer. Epidemiological studies have shown strong regional differences in terms of incidence rates. This seems to be associated to dietary fibre intake. It has been suggested that the short-chain fatty acid butyrate is the protective component of a high-fibre diet[2].

At a molecular level, mutations that hyperactivate the Wnt/β-catenin signalling pathway are commonly found in sporadic CRC, accounting for 80-90% of all cases[3]. These abnormalities lead to the aberrant accumulation of β-catenin in the nucleus, where it associates with the transcriptional factor TCF-4, thus inducing the synthesis of a number of proteins that promote cell growth and survival. Indeed, down-modulation of β-catenin induces growth arrest and differentiation of CRC cells, supporting a key role of β-catenin in the differentiative block of tumour cells. However, no or very little apoptosis is seen following β-catenin silencing or impairment of β-catenin/TCF-4 signalling[4, 5]. This makes clinical application of β-catenin inhibition less attractive. The small GTPase K-Ras is mutated in over 50% of CRCs. Constitutively active K-Ras transduces a potent growth factor-independent proliferation signal, mainly through the MAPK and PI3K cascades. Ras inhibition by prenyltransferase inhibitors has shown good activity against CRC cells in vitro, but have met with poor results in clinical trials[6].

Recently, HDACs have emerged as possible molecular targets in several cancer models[7]. It appears that cancer cells have an altered transcriptome compared to their normal counterpart, due to hyperactivity of HDACs. Indeed, HDAC1 , HDAC2 and HDAC3 have been shown to be overexpressed in CRC cells[8, 9]. In particular, HDAC2 aberrant expression is induced by loss of the adenomatosis polyposis coli (APC) tumour suppressor and blockage of HDAC2 expression causes cell death, indicating a role for HDAC2 in protecting cancer cells against apoptosis[10]. HDAC activity is physiologically counterbalanced by histone acetyl transferases (HATs). In sporadic CRCs with microsatellite-instability, more than 85% of cases carry loss-of-f unction mutations in CBP and p300, two highly homologous transcription factors with HAT activity[11]. As a general indicator of HDAC hyperactivation, global loss of histone H4 acetylation has been correlated to the transformed phenotype in several cancers, including

CRC[12]. All these data suggest that histone acetylation status may play a role in colon tumorigenesis.

HDAC inhibitors such as sodium butyrate, sulforaphane and suberoylanilide hydroxamic acid (SAHA) induce apoptosis in CRC cells[13-15]. Among HDAC inhibitors, valproic acid (VPA) has some attractive features from a clinical point of view: first, it is a very well-known drug which has already been in practice for long time, as an anti-convulsant. Therefore, its toxicity profile and pharmacokinetic properties are well established. VPA is orally available, is very well tolerated and has a longer in vivo half-life compared to other HDAC inhibitors[16, 17]. VPA has been shown to be a potent inducer of apoptosis in various cancer models[18-20].

Bosutinib is a novel quinoline compound with in vivo antitumor activity against colon cancer cell lines[21]. Bosutinib inhibits c-Src kinase and causes relocalization of nuclear β- catenin to the plasma membrane, leading to cell death[22]. However, despite very potent inhibition of the purified enzyme (IC₅₀ = 1 nM), bosutinib is active on CRC cells only at micromolar doses, In this work, we show that VPA induces apoptosis in CRC cells and enhances the cytotoxic effects of bosutinib, at clinically relevant concentrations. We investigated the effects of VPA on growth and survival of colon cancer cells. VPA caused growth inhibition and programmed cell death that correlated with histone hyperacetylation. VPA modulated the expression of various factors involved in cell cycle control and apoptosis and induced caspase activation. In addition, VPA caused down-regulation of c-Src and potentiated the cytotoxic effects of the c-Src inhibitor bosutinib, both in vitro and in vivo. The combination of sub-lethal doses of VPA and bosutinib led to massive apoptosis of colon cancer cells, irrespective of their genetic status.

SUMMARY OF THE INVENTION

This invention relates to a pharmaceutical composition for the treatment of cancer comprising a therapeutically effective amount of a src kinase inhibitor, or a pharmaceutically acceptable salt thereof, a therapeutically effective amount of an HDAC inhibitor, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, wherein the amounts of the src kinase inhibitor and the HDAC inhibitor in the composition are such that the combined therapeutic effect of the two active ingredients is synergistic.

Another more specific embodiment of this invention relates to a pharmaceutical composition for the treatment of cancer comprising a src kinase inhibitor or a pharmaceutically acceptable salt thereof, an HDAC inhibitor or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, wherein the src kinase inhibitor is selected from bosutinib, dasatinib, PP1 , PP2, AP23464 and PD166326 and wherein the amounts of the src kinase inhibitor and the HDAC inhibitor in the composition are such that the combined therapeutic effect of the two active ingredients is synergistic.

Another more specific embodiment of this invention relates to a pharmaceutical composition for the treatment of cancer comprising a src kinase inhibitor or a pharmaceutically acceptable salt thereof, an HDAC inhibitor or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, wherein the HDAC inhibitor is selected from VPA, sodium butyrate, sulforaphane and suberoylanilide hydroxamic acid, trichostatin A, and FK228 and wherein the amounts of the src kinase inhibitor and the HDAC inhibitor in the composition are such that the combined therapeutic effect of the two active ingredients is synergistic.

Another more specific embodiment of this invention relates to a pharmaceutical composition for the treatment of cancer comprising a src kinase inhibitor or a pharmaceutically acceptable salt thereof, an HDAC inhibitor or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, wherein the src kinase inhibitor is selected from bosutinib, dasatinib, PP1 , PP2, AP23464 and PD166326 and wherein the HDAC inhibitor is selected from

VPA, sodium butyrate, sulforaphane and suberoylanilide hydroxamic acid, trichostatin A, and FK228 and wherein the amounts of the src kinase inhibitor and the HDAC inhibitor in the composition are such that the combined therapeutic effect of the two active ingredients is synergistic. Another more specific embodiment of this invention relates to a pharmaceutical composition for the treatment of cancer comprising a src kinase inhibitor or a pharmaceutically acceptable salt thereof, an HDAC inhibitor or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, wherein the src kinase inhibitor is bosutinib, and wherein the amounts of the src kinase inhibitor and the HDAC inhibitor in the composition are such that the combined therapeutic effect of the two active ingredients is synergistic.

Another more specific embodiment of this invention relates to a pharmaceutical composition for the treatment of cancer comprising a src kinase inhibitor or a pharmaceutically acceptable salt thereof, an HDAC inhibitor or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, wherein the HDAC inhibitor is VPA, and wherein the amounts of the src kinase inhibitor and the HDAC inhibitor in the composition are such that the combined therapeutic effect of the two active ingredients is synergistic.

Another more specific embodiment of this invention relates to a pharmaceutical composition for the treatment of cancer comprising a src kinase inhibitor or a pharmaceutically acceptable salt thereof, an HDAC inhibitor or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, wherein the src kinase inhibitor is bosutinib and the HDAC inhibitor is VPA, wherein the amounts of the src kinase inhibitor and the HDAC inhibitor in the composition are such that the combined therapeutic effect of the two active ingredients is synergistic.

This invention also relates to a method of treating cancer in a mammal, including a human, comprising administering to a mammal in need of such treatment a therapeutically effective amount of a src kinase inhibitor, and a therapeutically effective amount of an HDAC inhibitor, or a pharmaceutically acceptable salt thereof, wherein the therapeutically effective amounts of the HDAC and src kinase inhibitors are such that the combined effect of these two active pharmaceutical ingredients is synergistic. This method is hereinafter referred to as "the inventive method".

Another more specific embodiment of this invention relates to the above inventive method, wherein the src inhibitor is selected from bosutinib, dasatinib, PP1 , PP2, AP23464 and PD166326.

A more specific embodiment of this invention relates to the above inventive method, wherein the src inhibitor is bosutinib. Another more specific embodiment of this invention relates to the above inventive method, wherein the HDAC inhibitor is selected from VPA, sodium butyrate, sulforaphane and suberoylanilide hydroxamic acid, trichostatin A, and FK228.

Another more specific embodiment of this invention relates to the above inventive method, wherein the HDAC inhibitor is VPA.

Another more specific embodiment of this invention relates to the above inventive method, wherein the src inhibitor is bosutinib and the HDAC inhibitor is VPA.

Another more specific embodiment of this invention relates to the above inventive method, wherein the src inhibitor is selected from bosutinib dasatinib, PP1 , PP2, AP23464 and PD166326 and wherein the HDAC inhibitor is selected from VPA, sodium butyrate, sulforaphane and suberoylanilide hydroxamic acid, trichostatin A, and FK228.

Another more specific emobiment of this invention relates to the above inventive method wherein the src kinase inhibitor and the HDAC inhibitor are administered simultaneously.

Another more specific emobiment of this invention relates to the above inventive method wherein the src kinase inhibitor is administered prior to minutes of administration of the HDAC infhibitor.

Another more specific emobiment of this invention relates to the above inventive method wherein the HDAC inhibitor is administered prior to administration of the src kinase inhibitor.

Another more specific emobiment of this invention relates to any of the above pharmaceutical compositions or methods wherein the cancer that is being treated is colon cancer.

In one embodiment, the methods comprise orally administering to a patient. In another embodiment, the methods comprise intravenously administering to a patient. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1. VPA inhibits CRC cell growth and viability. (A) Five CRC cell lines were treated with 3 mM VPA. MTS viability assay was run after 72 hours of drug exposure (B)

Increasing doses of VPA were administered to LS174T cell culture. Dose-response curve was obtained by non-linear fitting of percent viability data. IC₅ø = 2 mM. (C) Cells were harvested at various time points after treatment with different concentrations of VPA and analyzed by MTS; percent viability in logarithmic scale is plotted versus time.

Figure 2. VPA induces apoptosis in CRC cells. (A) Cell cycle analysis of LS174T cells, untreated (top), and treated with 5 mM VPA for 3 (middle) and 6 (bottom) days. Sub-G1 population is 5%, 74% and 83% of the total, respectively. (B) VPA induces caspase activation, as shown by appearance of the 17 kDa activated fragment (top-right panel) and by quantitative detection of caspase-3 (top-left), caspase-8 (bottom-left) and caspase-9 (bottom-right) activity

(**, p<0.001 ; *, p<0.01). (C) Quantitative expression analysis of pro-apoptotic proteins in

LS174T cells treated with vehicle (black bars) or 2.5 mM VPA (grey bars). For each sample, absolute transcript amounts were normalized over GAPDH housekeeping gene expression values. Relative expression is shown in the graph, where basal mRNA levels in untreated controls are set to 1.

Figure 3. Molecular consequences of VPA treatment. LS174T cells were treated with VPA at the indicated doses for 3 (A) or 24 (B) hours and lysed. Equal amounts of total lysate were run in Western blots with the indicated antibodies.

Figure 4. VPA potentiates bosutinib effects. (A) MTS viability assay showing effects of bosutinib and VPA combinations on LS174T growth. ^*, Synergistic interactions are indicated. (B) Cells were harvested at various time points after treatment with bosutinib alone (2.5 uM) or in combination with different doses of VPA and analyzed by MTS; percent viability data are plotted on a log scale as in figure 1C. (C) Effects of bosutinib (1 μM) alone or in combination with VPA (2.5 mM) on CRC cells growth. Viable cell number is bosutinib/VPA combination. Dose-response curves of apoptosis induction by bosutinib alone or in the presence 2.5 mM VPA (D) and by VPA alone or in the presence of 2.5 μM bosutinib (E) after 5 days. Apoptotic cells were identified by cell cycle analysis as the sub-G1 fraction, as described in Materials and Methods. (F) In vivo effects of bosutinib/VPA combination. Mice were inoculated s.c. with 5x10⁶ LS174T cells. When tumors were palpable, mice were treated with VPA alone (i.p., 200 mg/kg), bosutinib (p.o., 75 mg/kg), or bosutinib + VPA, twice a day for two weeks, 5 days/week. Control animals received vehicle (methylcellulose/TweenδO) with the same regimen (^*, p< 0.01 ). DETAILED DESCRIPTION OF THE INVENTION

Bosutinib may be synthesized as described in United States Patent 6,297,258, which issued on October 2, 2001. Epigenetic silencing of tumor suppresor genes is now recognized as an important mechanism of tumorigenesis. Histone acetylation is normally linked to a transcriptionally active state of chromatin. Therefore, HATs and HDACs have opposing functions in gene expression regulation, being activators and repressors of transcription, respectively. In CRC, there is evidence for a disruption in the balance of acetylating/deacetylating activities: HATs have been found mutated in the majority of MSI+ cancers, while HDACs are often overexpressed in CRC. HDAC2 is specifically up-regulated in tumours from mice that lack APC. Colon cancer cells have shown sensitivity to HDAC inhibitors in vitro. For instance, both SAHA and sodium butyrate induce DNA fragmentation and caspase activation in Caco-2 cells; the synthetic HDAC inhibitor CRA-024781 has in vivo antitumor activity against DLD-1 and HCT-116 cell lines. Although histone acetylation plays a relevant role in global gene regulation, several studies demonstrated that the expression of a relatively small number of genes is affected by HDAC inhibitors[28, 29]. This is possibly due to the fact that several other mechanisms of regulation exist, such as DNA methylation and various histone post-translational modifications. More importantly, transformed cells are more sensitive to HDAC inhibition than normal cells[30],

VPA is a short-chain fatty acid with anti-convulsant properties. It has been used to treat patients for epilepsy and bipolar disorders, for more than 30 years. More recently, its anti- tumoral effects have begun to be characterized. VPA reduces growth and survival and induces differentiation in various cancer cells, including both haematological and solid tumors.

We studied VPA effects on CRC cells in vitro and in vivo. VPA blocked cell growth, possibly through synthesis of p21^WAF1/CIP1, which is known to be repressed by Myc in CRC cells, and p27^KIP1. More importantly, VPA induced apoptosis. Two main pathways leading to programmed cell death are known in mammalian cells. The death receptor (extrinsic) pathway involves recruitment and activation of the initiator caspase-8 by death-domain proteins, while the mitochondrial (intrinsic) pathway is regulated by Bcl-2 family proteins and activates caspase- 9. HDAC inhibitors have been shown to initiate both cascades[20, 31]. We found activation of both caspase-8 and caspase-9 in VPA-treated CRC cells. Stimulation of the mitochondrial pathway was achieved by down-regulation of the anti-apoptotic factor Bcl-2 and up-regulation of the Bcl-2 inhibitor Bim. Inactivation of AKT, a strong inducer of cell survival through indirect activation of Bcl-2, was also observed and may contribute to the apoptotic phenotype, possibly by lowering the apoptosis threshold. These data showed that VPA triggers apoptosis in CRC cells by multiple mechanisms. Apoptosis is known to be impaired in APC-deficient cells[32]. Re-expression of wild- type APC in HT-29 cells restores caspase activity and the ability to undergo apoptosis[33]. Recently, Huang and Guo demonstrated that APC expression confers sensitivity to HDAC inhibitors[34]. Indeed, HT-29 cells, which express a truncated form of APC, were resistant to

VPA treatment in our experiments. By contrast, LS174T and HCT-116 (expressing wild-type

APC) were the most sensitive cells. SW480 and DLD-1 (both APC-mutated) showed intermediate sensitivity. Similarly, the cell lines showed different degrees of susceptibility to bosutinib toxic effects, which did not correlate with sensitivity to VPA. However, all cell lines were effectively killed by a combined VPA + bosutinib treatment, regardless of their genetic background and single-agent sensitivity. The tyrosine kinase pp60^c~src is a major target of the kinase inhibitor bosutinib[21]. Increased pp60^c"src kinase activity has been detected in CRC cells, due to overexpression or mutation[35]. Silencing or chemical inhibition of pp60^c~src causes growth inhibition and reduced tumorigenicity[22, 36], VPA induced down-modulation of pp60^{c src} expression, providing a rationale for the combination of VPA with bosutinib. Whether pp60^{c src} is the sole mediator of the observed synergism is unclear.

We investigated more in depth the synergy between VPA and bosutinib in LS174T cells. The same growth inhibitory effect observed with 2 mM VPA alone could be obtained by 0.5 mM VPA in bosutinib alone caused significant apoptosis at low doses. However, a dramatic increase of cell death was induced by a simultaneous treatment with the two drugs. Notably, the combination was highly effective at concentrations achievable in patients: peak plasma concentration in patients treated for epilepsy ranges between 0.5 and 1 mM [17]. Therefore, the combination regimen was tested in vivo and demonstrated to be more efficacious than the single treatments.

The above dexcribed work provides evidence that VPA enhances bosutinib effects on CRC cells at low doses, and may improve efficacy and tolerability of a bosutinib-based colon cancer therapy.

The pharmaceutical compositions of this invention, as well as pharmaceutical compositions containing only an HDAC inhibitor or a src kinase inhibitor for use in the inventive method, can be administered orally. Such compositions can also be administered by any other convenient route, for example, by continuous infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral, rectal, vaginal, and intestinal mucosa, ete.) and can be administered together with another therapeutic agent. Administration can be systemic or local. Various known delivery systems, including encapsulation in liposomes, microparticles, microcapsules, and capsules, can be used. Methods of administration of the pharmaceutical compositions of this invention, as well as pharmaceutical compositions containing only an HDAC inhibitor or a src kinase inhibitor for use in the inventive method include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intravaginal, transdermal, rectal, by inhalation, or topical, particularly to the ears, nose, eyes, or skin. In some instances, administration will result in release of the compound or a pharmaceutically acceptable salt of the compound into the bloodstream. The mode of administration is left to the discretion of the practitioner.

In one embodiment of the inventive method, the HDAC inhibitor and the src kinase inhibitor are administered in a single dosage form. In another embodmiment, they are administered simultaneously in separate dosage forms. In certain embodiments of the inventive method, the HDAC inhibitor and the src kinase inhibitor are administered via the same route of administration, while in other embodiments of the inventive method, they are administered via different routes of administration.

In another embodiment, it may be desirable to administer the HDAC inhibitor or the src kinase inhibitor locally. This can be achieved, for example, by local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository or edema, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.

In certain embodiments, it may be desirable to introduce HDAC inhibitor or the src kinase inhibitor into the central nervous system, circulatory system or gastrointestinal tract by any suitable route, including intraventricular, intrathecal injection, paraspinal injection, epidural injection, enema, and by injection adjacent to the peripheral nerve. Intraventricular injection can be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an

Ommaya reservoir.

Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent, or via perfusion in a fluorocarbon or synthetic pulmonary surfactant. In certain embodiments, the pharmaceutical compositions of this invention, as well as pharmaceutical compositions containing only an HDAC inhibitor or a src kinase inhibitor for use in the inventive method, can be formulated as a suppository, with traditional binders and excipients such as triglycerides. In another embodiment, the pharmaceutical compositions of this invention, as well as pharmaceutical compositions containing only an HDAC inhibitor or a src kinase inhibitor for use in the inventive method, can be delivered in a vesicle, in particular a liposome (see Langer,

Science 1990, 249, 1527-1533 and Treat et al., Liposomes in the Therapy of Infectious Disease and Cancer 1989, 317-327 and 353-365).

In yet another embodiment, the pharmaceutical compositions of this invention, as well as pharmaceutical compositions containing only an HDAC inhibitor or a src kinase inhibitor for use in the inventive method, can be delivered in a controlled-release system or sustained- release system (see, e.g., Goodson, in Medical Applications of Controlled Release, vol. 2, 1984, 115-138). Other controlled or sustained-release systems discussed in the review by Langer,

Science 1990, 249, 1527 1533 can be used. In one embodiment, a pump can be used (Langer,

Science 1990, 249, 1527-1533; Sefton, CRC Crit. Ref. Biomed. Eng. 1987, 14, 201 ; Buchwald et al., Surgery 1980, 88, 507; and Saudek et al., N. Engl. J Med. 1989, 321 , 574). In another embodiment, polymeric materials can be used (see Medical Applications of Controlled Release

(Langer and Wise eds., 1974); Controlled Drug Bioavailability, Drug Product Design and

Performance (Smolen and Ball eds., 1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macromol. Chem. 1983 2, 61; Levy et al., Science 1935, 228, 190; During et al., Ann. Neural. 1989, 25, 351; and Howard et al., J. Neurosurg. 1989, 71 , 105).

The pharmaceutical compositions of this invention, as well as pharmaceutical compositions containing only an HDAC inhibitor or a src kinase inhibitor for use in the inventive method, can optionally comprise a suitable amount of a physiologically acceptable excipient.

Such physiologically acceptable excipients can be liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. The physiologically acceptable excipients can be saline, gum acacia, gelatin, starch paste, talc, keratin, colloidal silica, urea and the like. In addition, auxiliary, stabilizing, thickening, lubricating, and coloring agents can be used. In one embodiment the physiologically acceptable excipients are sterile when administered to a patient. The physiologically acceptable excipient should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms. Water is a particularly useful excipient when the compound or a pharmaceutically acceptable salt of the compound is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid excipients, particularly for injectable solutions. Suitable physiologically acceptable excipients also include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The present compositions, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.

Liquid carriers may be used in preparing solutions, suspensions, emulsions, syrups, and elixirs. The active pharmaceutical ingredients used in this invention (i.e., the HDAC inhibitors and valproic acid) can be dissolved or suspended in a pharmaceutically acceptable liquid carrier such as water, an organic solvent, a mixture of both, or pharmaceutically acceptable oils or fat. The liquid carrier can contain other suitable pharmaceutical additives including solubilizers, emulsifiers, buffers, preservatives, sweeteners, flavoring agents, suspending agents, thickening agents, colors, viscosity regulators, stabilizers, or osmo- regulators. Suitable examples of liquid carriers for oral and parenteral administration include water (particular containing additives as above, e.g., cellulose derivatives, including sodium carboxymethyl cellulose solution), alcohols (including monohydric alcohols and polyhydric alcohols, e.g., glycols) and their derivatives, and oils (e.g., fractionated coconut oil and arachis oil). For parenteral administration the carrier can also be an oily ester such as ethyl oleate and isopropyl myristate. Sterile liquid carriers are used in sterile liquid form compositions for parenteral administration. The liquid carrier for pressurized compositions can be halogenated hydrocarbon or other pharmaceutically acceptable propellant.

The pharmaceutical compositions of this invention, as well as pharmaceutical compositions containing only an HDAC inhibitor or a src kinase inhibitor for use in the inventive method, can take the form of solutions, suspensions, emulsion, tablets, pills, pellets, capsules, capsules containing liquids, powders, sustained-release formulations, suppositories, emulsions, aerosols, sprays, suspensions, or any other form suitable for use. In one embodiment, the composition is in the form of a capsule. Other examples of suitable physiologically acceptable excipients are described in Remington's Pharmaceutical Sciences 1447 1676 (Alfonso R. Gennaro, ed., 19th ed. 1995).

The pharmaceutical compositions of this invention, as well as pharmaceutical compositions containing only an HDAC inhibitor or a src kinase inhibitor for use in the inventive method, when formulated for oral delivery, are formulated in accordance with routine procedures as a composition adapted for oral administration to humans. Compositions for oral delivery can be in the form of tablets, lozenges, buccal forms, troches, aqueous or oily suspensions or solutions, granules, powders, emulsions, capsules, syrups, or elixirs for example. Orally administered compositions can contain one or more agents, for example, sweetening agents such as fructose, aspartame or saccharin; flavoring agents such as peppermint, oil of wintergreen, or cherry; coloring agents; and preserving agents, to provide a pharmaceutically palatable preparation. In powders, the carrier can be a finely divided solid, which is an admixture with the finely divided compound or pharmaceutically acceptable salt of the compound. In tablets, the compound or pharmaceutically acceptable salt of the compound is mixed with a carrier having the necessary compression properties in suitable proportions and compacted in the shape and size desired. The powders and tablets can contain up to about 99% of the compound or pharmaceutically acceptable salt of the compound.

Capsules may contain mixtures of the compounds or pharmaceutically acceptable salts of the compounds with inert fillers and/or diluents such as pharmaceutically acceptable starches (e.g., corn, potato, or tapioca starch), sugars, artificial sweetening agents, powdered celluloses (such as crystalline and microcrystalline celluloses), flours, gelatins, gums, etc.

Tablet formulations can be made by conventional compression, wet granulation, or dry granulation methods and utilize pharmaceutically acceptable diluents, binding agents, lubricants, disintegrants, surface modifying agents (including surfactants), suspending or stabilizing agents (including, but not limited to, magnesium stearate, stearic acid, sodium lauryl sulfate, talc, sugars, lactose, dextrin, starch, gelatin, cellulose, methyl cellulose, microcrystalline cellulose, sodium carboxymethyl cellulose, carboxymethylcellulose calcium, polyvinylpyrroldine, alginic acid, acacia gum, xanthan gum, sodium citrate, complex silicates, calcium carbonate, glycine, sucrose, sorbitol, dicalcium phosphate, calcium sulfate, lactose, kaolin, mannitol, sodium chloride, low melting waxes, and ion exchange resins. Surface modifying agents include nonionic and anionic surface modifying agents. Representative examples of surface modifying agents include, but are not limited to, poloxamer 188, benzalkonium chloride, calcium stearate, cetostearl alcohol, cetomacrogol emulsifying wax, sorbitan esters, colloidal silicon dioxide, phosphates, sodium dodecylsulfate, magnesium aluminum silicate, and triethanolamine.

Moreover, when in a tablet or pill form, the compositions can be coated to delay disintegration and absorption in the gastrointestinal tract, thereby providing a sustained action over an extended period of time. Selectively permeable membranes surrounding an osmotically active driving compound or a pharmaceutically acceptable salt of the compound are also suitable for orally administered compositions. In these latter platforms, fluid from the environment surrounding the capsule can be imbibed by the driving compound, which swells to displace the agent or agent composition through an aperture. These delivery platforms can provide an essentially zero order delivery profile as opposed to the spiked profiles of immediate release formulations. A time-delay material such as glycerol monostearate or glycerol stearate can also be used. Oral compositions can include standard excipients such as mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, and magnesium carbonate. In one embodiment the excipients are of pharmaceutical grade. In another embodiment, the pharmaceutical compositions of this invention, as well as pharmaceutical compositions containing only an HDAC inhibitor or a src kinase inhibitor for use in the inventive method can be formulated for intravenous administration. Typically, compositions for intravenous administration comprise sterile isotonic aqueous buffer. Where necessary, the compositions can also include a solubilizing agent. Compositions for intravenous administration can optionally include a local anesthetic such as lignocaine to lessen pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container such as an ampule or sachette indicating the quantity of active agent. Where an HDAC inhibitor or valproic acid, or a pharmaceutically acceptable salt thereof, is to be administered by infusion, it can be dispensed, for example, with an infusion bottle containing sterile pharmaceutical grade water or saline. Where such compound or a pharmaceutically acceptable salt of the compound is administered by injection, an ampule of sterile water for injection or saline can be provided so that the ingredients can be mixed prior to administration.

In another embodiment, the pharmaceutical compositions of this invention, as well as pharmaceutical compositions containing only an HDAC inhibitor or a src kinase inhibitor for use in the inventive method, can be administered transdermally through the use of a transdermal patch. Transdermal administrations include administrations across the surface of the body and the inner linings of the bodily passages including epithelial and mucosal tissues. Such administrations can be carried out using the present compounds or pharmaceutically acceptable salts of the compounds, in lotions, creams, foams, patches, suspensions, solutions, and suppositories (e.g., rectal or vaginal).

Transdermal administration can be accomplished through the use of a transdermal patch containing the acive compound or pharmaceutically acceptable salt of the compound and a carrier that is inert to the compound or pharmaceutically acceptable salt of the compound, is non-toxic to the skin, and allows delivery of the agent for systemic absorption into the blood stream via the skin. The carrier may take any number of forms such as creams or ointments, pastes, gels, or occlusive devices. The creams or ointments may be viscous liquid or semisolid emulsions of either the oil-in-water or water-in-oil type. Pastes comprised of absorptive powders dispersed in petroleum or hydrophilic petroleum containing the active ingredient may also be suitable. A variety of occlusive devices may be used to release the compound or pharmaceutically acceptable salt of the compound into the blood stream, such as a semipermeable membrane covering a reservoir containing the compound or pharmaceutically acceptable salt of the compound with or without a carrier, or a matrix containing the active ingredient. The pharmaceutical compositions of this invention, as well as pharmaceutical compositions containing only an HDAC inhibitor or a src kinase inhibitor for use in the inventive method, may be administered rectally or vaginally in the form of a conventional suppository. Suppository formulations may be made from traditional materials, including cocoa butter, with or without the addition of waxes to alter the suppository's melting point, and glycerin. Water- soluble suppository bases, such as polyethylene glycols of various molecular weights, may also be used.

The pharmaceutical compositions of this invention, as well as pharmaceutical compositions containing only an HDAC inhibitor or a src kinase inhibitor for use in the inventive method, can be administered by controlled-release or sustained-release means or by delivery devices that are known to those of ordinary skill in the art. Such dosage forms can be used to provide controlled- or sustained-release of one or more active ingredients using, for example, hydropropylmethyl cellulose, other polymer matrices, gels, permeable membranes, osmotic systems, multilayer coatings, microparticles, liposomes, microspheres, or a combination thereof to provide the desired release profile in varying proportions. Suitable controlled- or sustained- release formulations known to those skilled in the art, including those described herein, can be readily selected for use with the active ingredients of the invention. The invention thus encompasses single unit dosage forms suitable for oral administration such as, but not limited to, tablets, capsules, gelcaps, and caplets that are adapted for controlled- or sustained-release.

In one embodiment a controlled- or sustained-release composition comprises a minimal amount of the compound or a pharmaceutically acceptable salt of the HDAC inhibitor or src kinase inhibitor to treat or prevent a bacterial infection or disease in a minimal amount of time. Advantages of controlled- or sustained-release compositions include extended activity of the drug, reduced dosage frequency, and increased compliance by the patient being treated. In addition, controlled or sustained release compositions can favorably affect the time of onset of action or other characteristics, such as blood levels of the compound or a pharmaceutically acceptable salt of the compound, and can thus reduce the occurrence of adverse side effects.

Controlled- or sustained-release compositions can initially release an amount of the

HDAC inhibitor or valproic acid, or a pharmaceutically acceptable salt thereof, that promptly produces the desired therapeutic or prophylactic effect, and gradually and continually release other amounts of the compound or a pharmaceutically acceptable salt of the compound to maintain this level of therapeutic or prophylactic effect over an extended period of time. To maintain a constant level of the HDAC inhibitor or valproic acid, or a pharmaceutically acceptable salt thereof, in the body, HDAC inhibitor or valproic acid, or a pharmaceutically acceptable salt thereof can be released from the dosage form at a rate that will replace the amount of the compound or a pharmaceutically acceptable salt of the compound being metabolized and excreted from the body. Controlled- or sustained-release of an active ingredient can be stimulated by various conditions, including but not limited to, changes in pH, changes in temperature, concentration or availability of enzymes, concentration or availability of water, or other physiological conditions or compounds.

A therapeutically effective amount of the HDAC inhibitor or valproic acid, or pharmaceutically acceptable salt thereof, is an amount that is effective for treating cancer. In vitro or in vivo assays can optionally be employed to help identify optimal dosage ranges. The precise dose to be employed can also depend on the route of administration, the condition, the seriousness of the condition being treated, as well as various physical factors related to the individual being treated, and can be decided according to the judgment of a health-care practitioner.

The amount of the HDAC inhibitor, or pharmaceutically acceptable salt thereof, that is generally employed in the combination compositions and methods of the present invention ranges from about 50 mg/day to about 1000 mg/day, while the amount of the src kinase inhibitor, or pharmaceutically acceptable salt thereof, that is generally employed in the combination compositions and methods of the present invention ranges from about 100 mg/day to about 700 mg/day, preferably from about 250 mg/day to about 600 mg/day.

In one embodiment, the pharmaceutical composition is in unit dosage form, e.g., as a tablet, capsule, powder, solution, suspension, emulsion, granule, or suppository. In such form, the composition is sub-divided in unit dose containing appropriate quantities of the active ingredient; the unit dosage form can be packaged compositions, for example, packeted powders, vials, ampoules, prefilled syringes or sachets containing liquids. The unit dosage form can be, for example, a capsule or tablet itself, or it can be the appropriate number of any such compositions in package form. Such unit dosage form may contain from about 1 mg/kg to about

250 mg/kg of the active ingredient or combined active ingredients, and may be given in a single dose or in two or more divided doses.

EXPERIMENTAL SECTION MATERIALS AND METHODS

Cells, antibodies and inhibitors

CRC cells lines were obtained from the ATCC collection (LGC Promochem, Sesto San Giovanni, Italy). LS174T and HCT116 have wild-type APC and mutated CTNNB1 genes. On the contrary, DLD-1 , HT29 and SW480 cells have mutated APC and wild-type CTNNB1. All cell lines except HT29 also carry activating mutations of KRAS protein. Antibodies that recognized acetylated histone H3 (used at 1 :500 dilution), FOXO3A (1 :500), phospho- FOXO3A(Ser²⁵³) (1 :300), c-Src (1 :1000) and caspase-3 (1 :500) were bought from Upstate (Millipore, Billerica, MA, USA); antibodies directed against AKT (1 :1000), phospho-AKT(Ser⁴⁷³) (1 :1000) and β-actin (1 :1000) were from Cell Signaling Technology (Danvers, MA, USA); anti- bcl-2 (1 :40) and anti-p21^WAF1/clp1 (EA10, 1 :50) were purchased from Calbiochem (Merck KGaA, Darmstadt, Germany); anti-p27^KIP1 (C-19, 1 :200) and bcl-xL (H-62, 1 :200) were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Valproic acid (VPA) was bought from Sigma-Aldrich (St. Louis, MO, USA) in the form of sodium salt, dissolved in water, aliquoted and stored at 4°C. Bosutinib was kindly provided by Dr. Frank Boschelli (Wyeth Research, Pearl River, NY, USA). The inhibitor was dissolved in DMSO and stored in small aliquots at -20⁰C.

Cell growth and viability assay

The CellTiter 96^® AQueous One Solution Cell Proliferation Assay (Promega Corporation, Madison, Wl, USA) was used to monitor cell culture viability. The cells were seeded in 96-well microtitre plates and treated with inhibitors or vehicle. At the times indicated in figure legends, the MTS tetrazolium reagent was added to the cells and incubated for 2 hours. Absorbance at 490 nm was read with a 96-well plate reader. Background absorbance (medium only) was subtracted and the data (average of three replicates) were normalised as percent of vehicle controls.

Cell cycle analysis

Cells were seeded in six-well plates at a density of 2x10⁵/well and treated with inhibitor or vehicle. The cells were harvested 3 or 5 days after treatment, washed with PBS and fixed in 70% ethanol overnight at 4°C. The samples were then centrifuged and resuspended in PBS containing 50 mg/ml propidium iodide and 100 mg/ml RNase A, incubated at 37°C for 30 minutes and analyzed by FACScan flow cytometer (Becton Dickinson, Franklin Lakes, NJ, USA). Western blot

Cells were seeded in 6-well plates and treated with VPA or vehicle. After 3 and 24 hours, cells were washed with PBS and lysed in Laemmli buffer 1X. Lysates were heated at 95⁰C for 10 minutes and loaded on SDS-polyacrylamide gels. After gel electrophoresis, the proteins were transferred onto nitrocellulose membranes, which were blocked with 5% non-fat milk for 1 hour and incubated with primary antibody overnight at 4°C. After extensive wash, the membranes were incubated 1 hour with horseradish peroxidase-conjugated secondary antibody, washed again and developed by chemiluminescence using the ECL™ detection reagent (Amers ham Biosciences, Piscataway, NJ, USA).

Caspase activity measurement

The cells were treated with VPA in 24-well plates in triplicate. After 48 hours, the cells were harvested and an aliquot was used to determine cell number by MTS assay. The remaining cells were used to measure cellular caspase activity, using Caspase-glo^® assay kits (Promega), according to instructions. Briefly, 100 μl of Caspase-glo^® reagent was added to 100 μl of cells in 96-well plates and incubated 1 hour at room temperature. Luminescence was read with a 1450 Microbeta Trilux luminescence counter (Perkin Elmer, Waltham, MA, USA). Caspase activity readings were normalised on viable cell number.

Quantitative real-time PCR

The cells were treated with VPA for 24 hours in 10-cm dishes and total RNA was extracted with Trizol^® reagent (Invitrogen, Carlsbad, CA, USA). RNA was reverse transcribed using TaqMan Reverse Transcription Reagents (Applied Biosystems, Foster City, CA, USA) according to instructions. Real-time PCR for BAX and NOXA was performed with the Brilliant

SYBR Green QPCR Master Mix (Stratagene, La JoIIa, CA, USA) on a 7900HT Sequence

Detection System (Applied Biosystems) under standard conditions. Annealing temperature was 6O⁰C. The GAPDH houskeeping gene was used as an internal reference. All the analysis were performed in triplicate. Primers for GAPDH were TGCACCACCAACTGCTTAGC (forward) and

GGCATGGACTGTGGTCATGAG (reverse) [23]. Primers for NOXA were

TCCAGCAGAGCTGGAAGTCGAGTGT (forward) and ATGAATGCACCTTCACATTCCTCT

(reverse) [24]. Primers for BAX were ATGATTGCCGCCGTGGACA (forward) and

CAACCACCCTGGTCTTGGATC (reverse). The specificity of PCR amplification of each primer pair was confirmed by analyzing PCR products by agarose gel electrophoresis and by melting curve analysis. Real Time PCR for BIM was performed using a TaqMan Universal PCR Master

Mix (Applied Biosystems) under standard conditions. The β-glucoronidase (GUS) housekeeping gene was used as an internal reference. The sequences of BIM and GUS probe were respectively: BimEx4_Rev Probe δ'FAM-CCGCAACTCTTGGGCGATCCATATCTCTC- TAMRA3' and GUS-probe δ'FAM-CCAGCACTCTCGTCGGTGACTGTTCA-TAMRAS'. The forward and reverse primers for BIM and GUS were respectively: BimEx4_For

TTCCATGAGGCAGGCTGAAC and BimEx8_Rev GGTGGTCTTCGGCTGCTTGG, GUS-for

GAAAATATGTGGTTGGAGAGCTCATT and GUS-rev CCGAGTGAAGATCCCCTTTTTA.

In vivo experiments

Female CD-1 nu/nu mice (7 weeks old) were purchased from Charles River

Laboratories (Calco, Italy) and kept under standard laboratory conditions according to the guidelines of the lstituto Nazionale Tumori (INT), Milan, Italy. Animal studies were approved by the Ethics Committee for Animal Experimentation of INT. Mice were implanted subcutaneously with LS174T cells resuspended in PBS (5x106 cells/mouse). When the tumors were measurable, the mice received either VPA, bosutinib, a combination of the two drugs, or vehicle, according to schedule and doses described in figure legend. Tumor weight and body weight were monitored twice weekly. Tumor weight was calculated by the formula tumor weight (mg) = (d² x D / 2), where d and D are the shortest and longest diameters of the tumor, respectively, measured in millimeters. Statistical anθlyses

Data were always generated in triplicate and mean ± SEM is reported on graphs. Dose-response curves were normalized on vehicle control and analyzed by non-linear regression using Graph Pad PRISM 4.0 software. IC₅₀ data are reported as the mean of at least three independent experiments. Synergism was calculated using CalcuSyn software, which performs multiple drug dose-effect calculations using the Median Effect methods described by Chou and his co-workers[25].

RESULTS

Biological effects of VPA treatment on CRC cells

CRC cell lines were treated with 3 mM VPA for 72 hours and cell culture viability was assessed by MTS assay (figure 1A). Cell growth was inhibited >50% in LS174T, DLD-1 , HCT116 and SW480 cell lines, while HT-29 cells (expressing a truncated APC protein) were resistant to the treatment. In line with published data, LS174T and HCT116 cell lines, carrying wild-type APC, were most sensitive to VPA. A dose-response curve with LS174T cells (figure

1 B) indicated an IC₅Q value of 2 mM. Time-course experiments showed that after nine days of exposure to 2 mM VPA less than 10% viable cells were present compared to vehicle-treated controls (figure 1C).

To determine whether growth inhibition was due to cell cycle arrest or cell death, LS174T cells were treated with 5 mM VPA and harvested after 3 and 5 days. Analysis of DNA content by propidium iodide staining showed the appearance of a large sub-G1 population in treated cells, indicating cell death (figure 2A). HDAC inhibitors-induced apoptosis has been linked to both the mitochondrial pathway (mediated by caspase-9) and the death receptor- associated pathway (which involves activation of caspase-8). To understand the mechanism through which VPA induced apoptosis in LS174T cells, caspase enzymatic activity was measured after 48 hours of VPA treatment (figure 2B). Both caspase-8 and caspase-9 activities were induced in VPA-treated cells. Downstream caspase-3 was consequently activated, as shown both by enzymatic assay and by detection of the 17-kDa catalytic fragment in western blot (figure 2B). These results indicate that VPA induces apoptosis in CRC cells, by activating both the intrinsic and the extrinsic pathways.

Quantitative real-time PCR was performed in order to evaluate the expression of the apoptosis inducers Bax, Noxa and Bim (figure 2C). Only Bim showed significant up-regulation upon VPA challenge (>2-fold). This result suggested that Bim may be an important mediator of VPA-promoted apoptosis in LS174T cells. In many cancer cells, Bim expression is kept silent by methylation and/or deacetylation of its promoter. VPA might relieve promoter impairment in LS174T cells through histone acetylation. To test this hypothesis, we analyzed Bim promoter acetylation status by ChIP assay, in the absence or presence of VPA. No change was observed (result not shown), indicating that Bim up-regulation was caused by a different mechanism.

Molecular effects of VPA treatment

The main molecular effect of HDAC inhibitors is a global increase in histone acetylation. Treatment of LS174T cells with 1.25 and 2.5 mM VPA led to acetylation of histone H3 (figure 3A) after 3 hours. Another early response of cells to the treatment was a dephosphorylation of AKT on Ser⁴⁷³, which indicates inactivation of the anti-apoptotic function of

AKT. A similar effect has been observed with Trichostatin A[26]. One direct substrate of AKT is the transcription factor FOXO3A, that up-regulates a series of growth-inhibiting and pro- apoptotic genes, including Bim[27]. AKT-mediated phosphorylation of FOXO3A leads to its inactivation by sequestration into the cytoplasm. In LS174T cells treated with VPA, a decrease of phospho-FOXO3A levels was observed (figure 3B). Thus, Bim transcription may be induced by increased FOXO3A activity. These results led us to consider the PI3K/AKT pathway as a key mediator of LS174T cell survival. However, treatment with the PI3K inhibitor LY294002 (50 μM) did not cause cell death in these cells, despite efficient phospho-AKT down-regulation (data not shown). Therefore, block of the PI3K/AKT pathway alone does not play a major role in VPA- mediated apoptosis, although it may sensitize the cells to other apoptotic stimuli[26].

At 24 hours, a significant reduction of the pro-survival factor Bcl-2 was observed in

VPA-treated cells, while Bcl-xL expression did not change. At the same time, strong increase of cell cycle inhibitors _P21^WAF1/CIP1 and p27^KIP1 levels was induced by VPA. Induction of _P21^WAF1/CIP1 by sodium butyrate has been described in colon cancer cells. Survivin, β-catenin, TCF-4 and

RhoB expression did not change.

VPA enhances bosutinib effects in CRC

Inhibition of c-Src-mediated phosphorylation causes re-localization of -catenin to the cell membrane and induces growth arrest of colon cancer cells[22]. Interestingly, pp60^{c Src} expression was substantially diminished in VPA-treated cells (figure 3B) and this effect correlated with a global decrease of phosphotyrosine levels in the cells (result not bosutinib. As shown in figure 4A, VPA enhanced the effect of bosutinib in LS174T cells. Statistical dose-effect analysis of the data indicated synergism (combination index < 0.8) between 0.5 mM VPA and bosutinib doses below or equal to 1 μM. The other combinations were only additive. Dose- response curves obtained with the same data showed that bosutinib alone blocked LS174T growth with an IC₅₀ of 3.5 μM. The presence of 0.5 and 1 mM VPA lowered the IC₅₀ value to 1.1 and 0.03 μM bosutinib, respectively. A time-course experiment was run in the presence of 2.5 μM bosutinib and different VPA concentrations (figure 4B). Over 90% inhibition was observed after nine days with 0.5 mM VPA, whereas no living cells remained when bosutinib was combined with 2 or 4 mM VPA. We then asked whether the VPA/bosutinib combination would also be efficacious in other CRC cell lines. Although the various cell lines showed different sensitivity to bosutinib, the combined treatment (72 hours) was highly effective on all tested cells

(figure 4C). After prolonged treatment (6 days) all cell lines were killed >90% by VPA + bosutinib (result not shown). The synergy between the two drugs was better visualized in terms of apoptosis. Each drug greatly enhanced the apoptotic effect of the other one at doses that caused little cell death when used as single agents (figure 4D-E). These data indicate that VPA and bosutinib can be combined to obtain higher efficacy.

Finally, to test whether this is also true in vivo, bosutinib alone (75 mg/kg), or a combination of the two drugs (figure 4F). The doses were chosen on the basis of preliminary experiments indicating minimal toxicity. Higher dosages of VPA were toxic when combined with bosutinib (data not shown). Mice were treated twice daily, starting when tumours reached an average mass of 0.1 grams (at day 7 post-injection). After two weeks of dosing, tumours were significantly smaller in mice trated with VPA + bosutinib combination, compared to untreated controls (p < 0.01 ). Each drug alone had a smaller effect on tumour growth. No overt toxicity was registered during the experiment, as assessed by measurement of body weight loss.

BIBLIOGRAPHY

[1] L. Bonelli, Colorectal carcinoma: is screening possible?, Tech Coloproctol 8 Suppl 2 (2004) S267-272.

[2] A. Mclntyre, P. R. Gibson, G. P. Young, Butyrate production from dietary fibre and protection against large bowel cancer in a rat model, Gut 34 (1993) 386-391.

[3] R. H. Giles, J. H. van Es, H. Clevers, Caught up in a Wnt storm: Wnt signaling in cancer, Biochim Biophys Acta 1653 (2003) 1-24.

[4] M. van de Wetering, E. Sancho, C. Verweij, W. de Lau, I. Oving, A. Hurlstone, K. van der Horn, E. Batlle, D. Coudreuse, A. P. Haramis, M. Tjon-Pon-Fong, P. Moerer, M. van den Born, G. Soete, S. Pals, M. Eilers, R. Medema, H. Clevers, The beta-catenin/TCF-4 complex imposes a crypt progenitor phenotype on colorectal cancer cells, Cell 111 (2002) 241-250.

[5] U. N. Verma, R. M. Surabhi, A. Schmaltieg, C. Becerra, R. B. Gaynor, Small interfering RNAs directed against beta-catenin inhibit the in vitro and in vivo growth of colon cancer cells, Clin Cancer Res 9 (2003) 1291-1300.

[6] B. B. Friday, A. A. Adjei, K-ras as a target for cancer therapy, Biochim Biophys Acta 1756 (2005) 127-144.

[7] D. C. Drummond, C. O. Noble, D. B. Kirpotin, Z. Guo, G. K. Scott, C. C. Benz, Clinical development of histone deacetylase inhibitors as anticancer agents, Annu Rev Pharmacol Toxicol 45 (2005) 495-528.

[8] A. J. Wilson, D. S. Byun, N. Popova, L. B. Murray, K. L'ltalien, Y. Sowa, D. Arango, A. Velcich, L. H. Augenlicht, J. M. Mariadason, Histone deacetylase 3 (HDAC3) and other class I HDACs regulate colon cell maturation and p21 expression and are deregulated in human colon cancer, J Biol Chem 281 (2006) 13548-13558.

[9] B. H. Huang, M. Laban, C. H. Leung, L. Lee, C, K. Lee, M. Saito-Tellez, G. C. Raju, S. C. Hooi, Inhibition of histone deacetylase 2 increases apoptosis and p21Cip1/WAF1 expression, independent of histone deacetylase 1 , Cell Death Differ 12 (2005) 395-404. [10] P. Zhu, E. Martin, J. Mengwasser, P. Schlag, K. P. Janssen, M. Gottlicher, Induction of HDAC2 expression upon loss of APC in colorectal tumorigenesis, Cancer Cell 5 (2004) 455- 463.

[11] Y. Ionov, S. Matsui, J. K. Cowell, A role for p300/CREB binding protein genes in promoting cancer progression in colon cancer cell lines with microsatellite instability, Proc Natl Acad Sci U S A 101 (2004) 1273-1278.

[12] M. F. Fraga, E. Ballestar, A. Villar-Garea, M. Boix-Chornet, J. Espada, G. Schotta, T. Bonaldi, C. Haydon, S. Ropero, K. Petrie, N. G. Iyer, A. Perez-Rosado, E. Calvo, J. A. Lopez, A. Cano, M. J. Calasanz, D. Colomer, M. A. Piris, N. Ahn, A. Imhof, C. Caldas, T. Jenuwein, M. Esteller, Loss of acetylation at Lys16 and trimethylation at Lys20 of histone H4 is a common hallmark of human cancer, Nat Genet 37 (2005) 391-400.

[13] M. C. Myzak, W. M. Dashwood, G. A. Orner, E. Ho, R. H. Dashwood, Sulforaphane inhibits histone deacetylase in vivo and suppresses tumorigenesis in Ape-minus mice, Faseb J 20 (2006) 506-508.

[14] J. M. Mariadason, K. L. Rickard, D. H. Barkla, L. H. Augenlicht, P. R. Gibson, Divergent phenotypic patterns and commitment to apoptosis of Caco-2 cells during spontaneous and butyrate-induced differentiation, J Cell Physiol 183 (2000) 347-354.

[15] L. C. Hsi, X. Xi, R. Lotan, I. Shureiqi, S. M. Lippman, The histone deacetylase inhibitor suberoylanilide hydroxamic acid induces apoptosis via induction of 15-lipoxygenase-1 in colorectal cancer cells, Cancer Res 64 (2004) 8778-8781.

[16] K. B. Glaser, M. J. Staver, J. F. Waring, J. Stender, R. G. Ulrich, S. K. Davidsen, Gene expression profiling of multiple histone deacetylase (HDAC) inhibitors: defining a common gene set produced by HDAC inhibition in T24 and MDA carcinoma cell lines, MoI Cancer Ther 2 (2003) 151-163.

[17] C. Van Lint, S. Emϋiani, E. Verdin, The expression of a small fraction of cellular genes is changed in response to histone hyperacetylation, Gene Expr 5 (1996) 245-253.

[18] A. Insinga, S. Monestiroli, S. Ronzoni, V. Gelmetti, F. Marchesi, A. Viale, L. Altucci, C. Nervi, S. Minucci, P. G. Pelicci, Inhibitors of histone deacetylases induce tumor-selective apoptosis through activation of the death receptor pathway, Nat Med 11 (2005) 71-76. [19] R. A. Blaheta, J. Cinatl, Jr., Anti-tumor mechanisms of valproate: a novel role for an old drug, Med Res Rev 22 (2002) 492-511.

[20] R. A. Blaheta, M. Michaelis, P. H. Driever, J. Cinatl, Jr., Evolving anticancer drug valproic acid: insights into the mechanism and clinical studies, Med Res Rev 25 (2005) 383-397.

[21] Q. Xia, J. Sung, W. Chowdhury, C. L. Chen, N. Hoti, S. Shabbeer, M. Carducci, R. Rodriguez, Chronic administration of valproic acid inhibits prostate cancer cell growth in vitro and in vivo, Cancer Res 66 (2006) 7237-7244.

[22] X. N. Li, Q. Shu, J. M. Su, L. Perlaky, S. M. Blaney, C. C. Lau, Valproic acid induces growth arrest, apoptosis, and senescence in medulloblastomas by increasing histone hyperacetylation and regulating expression of p21Cip1 , CDK4, and CMYC, MoI Cancer Ther 4 (2005) 1912-1922.

[23] M. G. Catalano, N. Fortunati, M. Pugliese, L. Costantino, R. PoIi, O. Bosco, G. Boccuzzi, Valproic acid induces apoptosis and cell cycle arrest in poorly differentiated thyroid cancer cells, J Clin Endocrinol Metab 90 (2005) 1383-1389.

[24] J. M. Golas, J. Lucas, C. Etienne, J. Golas, C. Discafani, L. Sridharan, E. Boghaert, K.

Arndt, F. Ye, D. H. Boschelli, F. Li, C. Titsch, C. Huselton, I. Chaudhary, F. Boschelli, BOSUTINIB, a Src/Abl inhibitor with in vivo activity in colon tumor xenograft models, Cancer Res 65 (2005) 5358-5364.

[25] A. M. Coluccia, D. Benati, H. Dekhil, A. De Filippo, C. Lan, C. Gambacorti-Passerini, BOSUTINIB decreases growth and motility of colorectal cancer cells by preventing ppδO(c-Src)- dependent tyrosine phosphorylation of beta-catenin and its nuclear signaling, Cancer Res 66 (2006) 2279-2286.

[26] Q. Chu, M. T. Ling, H. Feng, H. W. Cheung, S. W. Tsao, X. Wang, Y. C. Wong, A novel anticancer effect of garlic derivatives: inhibition of cancer cell invasion through restoration of E- cadherin expression, Carcinogenesis 27 (2006) 2180-2189.

[27] Y. Fernandez, M. Verhaegen, T. P. Miller, J. L. Rush, P. Steiner, A. W. Opipari, Jr., S. W. Lowe, M. S. Soengas, Differential regulation of noxa in normal melanocytes and melanoma cells by proteasome inhibition: therapeutic implications, Cancer Res 65 (2005) 6294-6304. [28] T. C. Chou, Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies, Pharmacol Rev 58 (2006) 621-681.

[29] H. Y. Lin, C. S. Chen, S. P. Lin, J. R. Weng, Targeting histone deacetylase in cancer therapy, Med Res Rev 26 (2006) 397-413.

[30] E. L. Greer, A. Brunet, FOXO transcription factors at the interface between longevity and tumor suppression, Oncogene. 24 (2005) 7410-7425.

[31] H. R. Kim, E. J. Kim, S. H. Yang, E. T. Jeong, C. Park, J. H. Lee, M. J. Youn, H. S. So, R. Park, Trichostatin A induces apoptosis in lung cancer cells via simultaneous activation of the death receptor-mediated and mitochondrial pathway?, Exp MoI Med 38 (2006) 616-624.

[32] T. Chen, I. Yang, R. Irby, K. H. Shain, H. G. Wang, J. Quackenbush, D. Coppola, J. Q. Cheng, T. J. Yeatman, Regulation of caspase expression and apoptosis by adenomatous polyposis coli, Cancer Res 63 (2003) 4368-4374.

[33] P. J. Morin, B. Vogelstein, K. W. Kinzler, Apoptosis and APC in colorectal tumorigenesis, Proc Natl Acad Sci U S A 93 (1996) 7950-7954.

[34] X. Huang, B. Guo, Adenomatous polyposis coli determines sensitivity to histone deacetylase inhibitor-induced apoptosis in colon cancer cells, Cancer Res 66 (2006) 9245-9251.

[35] S. Dehm, M. A. Senger, K. Bonham, SRC transcriptional activation in a subset of human colon cancer cell lines, FEBS Lett 487 (2001) 367-371.

[36] C. A. Staley, N. U. Parikh, G. E. Gallick, Decreased tumorigenicity of a human colon adenocarcinoma cell line by an antisense expression vector specific for c-Src, Cell Growth Differ 8 (1997) 269-274.

Claims

CLAIMS:What is claimed is:

1. A pharmaceutical composition for the treatment of cancer comprising a therapeutically effective amount of a src kinase inhibitor or a pharmaceutically acceptable salt thereof, a therapeutically effective amount of an HDAC inhibitor or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, wherein the amounts of the src kinase inhibitor and the HDAC inhibitor in the composition are such that the combined therapeutic effect of the two active ingredients is synergistic.

2. A pharmaceutical composition according to claim 1 wherein the src kinase nhibitor is selected from bosutinib, dasatinib, PP1 , PP2, AP23464 and PD166326.

3. A pharmaceutical composition according to claim 1 or claim 2, wherein the HDAC inhibitor is selected from valproic acid, sodium butyrate, sulforaphane and suberoylanilide hydroxamic acid, trichostatin A, and FK228.

4. A pharmaceutical composition according to claim 2, wherein the src kinase nhibitor is bosutinib.

5. A pharmaceutical composition according to claim 3, wherein the HDAC inhibitor is valproic acid.

6. A pharmaceutical composition according to claim 1 , wherein the src kinase inhibitor is bosutinib and the HDAC inhibitor is valproic acid.

7. A method of treating cancer in a mammal, comprising administering to a mammal in need of such treatment a therapeutically effective amount of a src kinase inhibitor, or a pharmnaceutically acceptable salt thereof, and a therapeutically effective amount of an HDAC inhibitor, or a pharmaceutically acceptable salt thereof, wherein the therapeutically effective amounts of the HDAC and src kinase inhibitors in such composition are such that the combined effect of the two active pharmaceutical ingredients is synergistic.

8. A method according to claim 7, wherein the src kinase inhibitor is selected from bosutinib, dasatinib, PP1 , PP2, AP23464 and PD166326.

9. A method according to claim 7 or claim 8, wherein the HDAC inhibitor is selected from valproic acid, sodium butyrate, sulforaphane and suberoylanilide hydroxamic acid, trichostatin A, and FK228.

10. A method according to claim 8, wherein the src kinase inhibitor is bosutinib.

11. A method according to claim 9, wherein the HDAC inhibitor is valproic acid.

12. A method according to claim 7, wherein the src kinase inhibitor is bosutinib and the HDAC inhibitor is valproic acid.

13. A method according to claim 7, wherein the src kinase inhibitor and the HDAC inhibitor are administered simultaneously.

14. A method according to claim 7, wherein the src kinase inhibitor is administered prior to administration of the HDAC inhibitor.

15. A method according to claim 7, wherein the HDAC inhibitor is administered prior to administration of the src kinase inhibitor.

16. A method according to claim 7 wherein the amount of the src kinase inhibitor that is administered is from about 100 mg/day to about 700 mg/day and the amount of the HDAC inhibitor that is administered is from about 50 mg/day to about 1000 mg/day.

17. A method according to claim 7 wherein the cancer that is being treated is colon cancer.