WO2009107820A1 - Evaluation method for amount of fat and oil in seed and screening method for plant body with changed amount of fat and oil - Google Patents

Abstract

The amount of fat and oil in a seed and genetic change thereof are evaluated. The amount of fat and oil contained in a seed of a plant body and change thereof are determined based on a fluorescence intensity of a fluorescent protein such as GFP in a cotyledon by expressing a fusion protein of an oil-body specific protein and a fluorescent protein such as an oleosin-GFP fusion protein.

Description

Method for evaluating the amount of oil and fat in seeds and screening method for plants having changed oil content

 The present invention relates to a method for evaluating the amount of fats and oils in seeds and a method for screening a plant having a changed fat content. Light

Background art

 Oil bodies (oil bodies, sometimes called lipid bodies) are typesetting

It is an intracellular organelle present in large quantities in the seed cells of foods, especially oil crops. The oil body is made up of a single phospholipid membrane containing a specific protein called oleosin, steroleosin, and force leucine. Inside, the vegetable oil is in the form of triacylglycose mouth (TAG, neutral fat, neutral lipid). In particular, it accumulates in large quantities in plant seeds. Conventionally, as a method for analyzing fat and oil accumulated in an oil body, an analysis method using gas chromatography, liquid chromatography, etc., was conducted by destroying seeds and extracting fat and oil components. In such an analytical method, there is a possibility that a low temperature condition is necessary for the addition of a lipid degradation inhibitor and the treatment temperature, and that the fat and oil component is degraded.

 On the other hand, Non-Patent Document 1 discloses that the size of the oil body is affected by the abundance of oleosin. Non-patent document 2 describes the oleosin gene and GFP.

It is disclosed that the oil body, which is an organelle in plant cells, can be visualized by fluorescence derived from GFP by fusing a gene (green fluorescent protein). However, even though the oil bodies could be observed, the correlation between the number and shape of the oil bodies and the amount of fat and oil accumulated in the oil bodies was still unclear. In particular, the correlation between the shape and number of oil bodies in the cotyledons and the amount of oil in the seeds has not been elucidated. In the cotyledon, during storage, various storage compounds such as stored starch and stored fats and oils are decomposed while performing photosynthesis, so the shape and number of oil bodies in the cotyledons oil It was considered difficult to infer the amount of fat.

 Non-Patent Document 1 Si loto, RMP Et al., Plant Cel 18, 1961-1974, (2006) Non-Patent Document 2 Wahlroos et-al., GENESIS, 35 (2): 125-132, (2003) Disclosure

 Therefore, in view of the above-described situation, the present invention evaluates the amount of oil and fat in the seed non-destructively, and determines the change in the amount of oil and fat in the seed non-destructively, thereby changing the amount of oil and fat in the seed. The purpose is to screen plant mutants.

 In order to achieve the above-mentioned object, the present inventors have conducted intensive studies, found that the oleosin-GFP fusion protein is expressed, and that the amount of fats and oils contained in plant seeds can be determined based on the GFP fluorescence intensity. It came to be completed.

 That is, the present invention includes the following.

 (1) A step of measuring the visible light intensity in the cotyledons in a plant expressing a fusion protein of a protein that exists specifically in the oil body and a protein that can be detected by visible light, and the visible light intensity measured in the above step. And a method for determining the fat content in the seed based on the step of determining the fat content in the seed.

 (2) The evaluation method according to (1), wherein the protein specifically present in the oil body is any one protein selected from the group consisting of oleosin, steroleosin and force leucine.

 (3) The evaluation method according to (1), wherein the protein specifically present in the oil body is oleosin.

 (4) The evaluation method according to (1), wherein the protein detectable by visible light is GFP (green fluorescent protein).

 (5) The step of determining the fat content is characterized by calculating the sum of visible light intensities in cotyledons and making a determination based on a positive correlation between the sum and the fat content in seeds (1 ) Evaluation method described.

(6) The relationship between the total visible light intensity and the oil content in the seeds is positively correlated with the total visible light intensity measurement and the measured value using the method for quantifying the oil content in nondestructive seeds using pulsed NMR. The evaluation method according to (5), further comprising a step of determining (7) The evaluation method according to (6), wherein the total measurement of visible light intensity is measured with a fluorescence microscope, a fluorescence spectrophotometer, a fluorescence titer, a single plate reader, or a fluorescence image analyzer.

 (8) The evaluation method according to (1), wherein the plant body is obtained from a plant cell or plant cell culture that has been subjected to a mutagen treatment.

 (9) The evaluation method according to (1), wherein the plant body is an oil plant.

(1 0) The evaluation method according to (1), wherein the plant is a dicotyledonous plant.

 (1 1) The evaluation method according to (1), wherein the plant body is a cruciferous plant.

 (1 2) The evaluation method according to (1), wherein the plant is Arabidopsis thaliana.

 (13) The evaluation method according to (1), wherein the visible light intensity is measured with a fluorescence microscope, a fluorescence spectrophotometer, a fluorescence titer plate reader, or a fluorescence image analyzer.

 (14) To measure the intensity of visible light in cotyledons derived from plant cells, plant cell cultures or plant bodies that express fusion proteins of oil body-specific proteins and proteins detectable by visible light. Based on this, a screening method for selecting plant species, plant varieties or plant mutants in which the oil content in seeds has changed.

 (15) The screening method according to (14), wherein the protein specifically present in the oil body is any one protein selected from the group consisting of oleosin, steroleucine and force leucine.

 (16) The screening method according to (14), wherein the protein specifically present in the oil body is oleosin.

 (17) The screening method according to (14), wherein the protein detectable by visible light is GFP (green fluorescent protein).

(18) Plant cells, plant cell cultures or plants that express a fusion protein of an oil body-specific protein and a protein detectable by visible light And the step of measuring the visible light intensity in the cotyledon after the mutagen treatment, and the fats and oils in the seed resulting from the mutagen treatment based on the visible light intensity measured in the step And a method for screening a plant having a changed fat content.

(19) The screening method according to (18), wherein the protein specifically present in the oil body is any one protein selected from the group consisting of oleosin, steroleucine and force leucine.

 (20) The screening method according to (18), wherein the oil body-specific protein is oleosin.

 (2 1) The screening method according to (18), wherein the protein detectable by visible light is GFP (green fluorescent protein).

 (2 2) In the step of determining the change in the fat content, the sum of visible light intensities in the cotyledons is calculated, and the sum is determined based on a positive correlation between the fat content in the seeds. (19) The screening method described.

 (2 3) The relationship between the total visible light intensity and the fat content in the seeds is positively correlated with the total visible light intensity measurement and the measured value using the nondestructive seed fat content determination method using pulsed NMR. The screening method according to (2 2), further comprising the step of determining .

 (24) The screening method according to (23), wherein the total measurement of visible light intensity is measured with a fluorescence microscope, a fluorescence spectrophotometer, a fluorescence titer plate reader, or a fluorescence image analyzer.

 (2 5) The screening method according to (18), wherein the plant body is an oil plant.

 (2 6) The screening method according to (18), wherein the plant body is a dicotyledonous plant.

 (2 7) The screening method according to (18), wherein the plant body is a cruciferous plant.

(2 8) The plant according to (1 8), wherein the plant is Arabidopsis thaliana Screening method.

(29) The screening method according to (18), wherein the visible light intensity is measured with a fluorescence microscope, a fluorescence spectrophotometer, a fluorescence titer plate reader, or a fluorescence image analyzer. This specification includes the contents described in the specification and Z or drawings of Japanese Patent Application No. 2008-048485, which is the basis of the priority of the present application. Brief Description of Drawings

 FIG. 1 is a block diagram schematically showing an oleosin-GFP fusion gene. ) Are fluorescence photographs of cotyledons on day 6 of germination of 01eG, mutant A and mutant B, respectively.

 Fig. 2 is a characteristic diagram showing the relationship between the total GFP fluorescence% and the lipid content of seeds.

BEST MODE FOR CARRYING OUT THE INVENTION

 Hereinafter, the present invention will be described in detail with reference to the drawings.

 In the present invention, Arabidopsis thaliana, which is a model plant, was transformed using the oleosin-GFP fusion gene, and the oil body contained in the cotyledon collected from the transformed Arabidopsis thaliana was visualized by fluorescence. Specifically, the oil body contained in the seed can be observed by germinating the collected seed and observing fluorescence in the expanded cotyledon. Mutations were induced in the transformed Arabidopsis thaliana (mutagen treatment), and changes in various properties such as the shape and number of oil bodies were observed, as well as changes in fat content and oil composition. Surprisingly, it is clear that among the various properties of the oil body, there is a positive correlation between the total fluorescence in the cotyledons (in other words, the fluorescence intensity per unit area) and the amount of oil contained in the seeds. Became.

Based on the above findings, the fat content and its changes in plant seeds are determined by the fusion of the oil body-specific protein and the protein detectable by visible light in the cotyledon visible in the plant body expressing the gene encoding the protein. It became clear that measurement and evaluation can be performed by measuring the light intensity. The evaluation method according to the present invention is based on the above-described knowledge, and quantitatively evaluates the amount of fats and oils in seeds. It is. The screening method according to the present invention is based on the above-described knowledge, and is a method for screening mutant plants in which the amount of oils and fats in seeds has been genetically changed due to mutagen treatment. This screening method is effective if the amount of oil in the seed is genetically changed, and can be applied not only to mutant plants but also to plant species and plant varieties in which the amount of oil in the seed has changed. .

 In the present invention, first, a plant that expresses a fusion protein of a protein that exists specifically in an oil body and a protein that can be detected by visible light is prepared. Here, examples of the protein specifically present in the oil body include membrane proteins such as oleosin, normal leucine and caleosin. As the fusion protein, one of these membrane proteins may be used, or a plurality of proteins may be used. Examples of proteins that can be detected by visible light include fluorescent proteins and photoproteins. Fluorescent proteins include not only GFP (green fluorescent protein) but also various GFP mutant proteins known to have similar effects.

(YFP (yel low fluorescent protein), RFP red fluorescent protein), OFP (.orange fluorescent protein), BFP (blue fluorescent protein), etc.) and other proteins capable of emitting fluorescence can be used. Examples of the photoprotein include luciferase. In particular, the fluorescent protein as described above is preferably used as the protein that can be detected by visible light. This is because the fluorescent protein can be quantitatively analyzed with very high accuracy by a conventionally known fluorescence measuring means. In the following, a fusion protein of oleosin and GFP (hereinafter referred to as oleosin-GFP fusion protein) will be described as a representative example, but it is clear that the above fusion protein is not limited to oleosin-GFP fusion protein. .

Here, the oleosin-GFP fusion protein can be expressed in a desired plant body by obtaining a fusion gene encoding the fusion protein by a conventionally known genetic engineering technique. As an example, the base sequence of the fusion gene encoding the oleosin-GFP fusion protein and the amino acid sequence of the oleosin-GFP fusion protein are shown in SEQ ID NOs: 1 and 2, respectively. In the present invention, the oleosin-GFP fusion protein is shown in SEQ ID NO: 2. It is not limited to the one containing the amino acid sequence, and one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 2 are deleted, substituted, or added. Alternatively, it may be a protein that contains an inserted amino acid sequence, is present in the oil body membrane, and exhibits fluorescence. Here, the plurality of amino acid residues means 2 to 40, preferably 2 to 30, more preferably 2 to 20, more preferably 2 to 10, most preferably 2 to Means 5 amino acids.

 The oleosin-GFP fusion protein may be a protein having 70% or more homology with the amino acid sequence shown in SEQ ID NO: 2. The homology is preferably 80% or more, more preferably 85% or more, further preferably 90% or more, and most preferably 95% or more.

 The amino acid deletion, addition, and substitution can be performed by modifying the gene encoding the protein by a technique known in the art. Mutation can be introduced into a gene by a known method such as the Kunkel method or the Gapped duplex method, or a method equivalent thereto. For example, a mutation introduction kit using site-directed mutagenesis (for example, Mutant -Mutations are introduced using K CTAKARA Bio) or Mutant-G (TAKARA Bio)), or using LA PCR in vitro Mutagenesis series kits from TAKARA Bio. Mutagenesis methods include EMS (ethinoremethansenorephonic acid), 5-bromouracinole, 2-aminopurine, hydroxynoleamine, N-methyl-N'-nitro-N nitrosoguanidine, and other carcinogenesis. It may be a method using a chemical mutagen such as a sexual compound, or a method using radiation treatment or ultraviolet treatment such as X-ray, alpha ray, beta ray, gamma ray or ion beam.

Furthermore, as a gene encoding the oleosin-GFP fusion protein, it hybridizes with DNA consisting of a base sequence complementary to the base sequence shown in SEQ ID NO: 1 under stringent conditions, and exists in the oil body membrane. And DNA encoding a fluorescent protein. Here, the stringent condition refers to a condition in which a so-called specific hybrid is formed and a non-specific hybrid is not formed. For example, at 45 ° (:, 6 X SSC (sodium chloride Z sodium citrate)) Imbridation, followed by washing at 50-65 ° C, 0.2-1 X SS (:, 0.1% SDS, or such conditions include 65-70 ° C, 1 Hybridization with X SSC, followed by washing at 65-70 ° C, 0.3 X SSC.

 The gene encoding the oleosin-GFP fusion protein described above has the nucleotide sequence after the base sequence is determined, by chemical synthesis, by PCR using a cloned cDNA as a cage, or by the PCR. It can be obtained from various plants by hybridizing the DNA fragment as a probe. The gene encoding the oleosin-GFP fusion protein according to the present invention described above is functionally expressed in a desired plant by modification so as to replace the wild-type oleosin gene in the plant genome. It will be. Alternatively, in the present invention, the gene encoding the fusion protein may be introduced so that it can be expressed in a plant lacking the wild-type oleosin gene in the plant genome. Furthermore, in the present invention, the gene encoding the fusion protein may be introduced so that the wild-type oleosin gene in the plant genome is not deleted and the gene encoding the fusion protein is overexpressed.

As vectors for introducing and expressing the gene encoding the oleosin-GFP fusion protein described above into plant cells, pBI vectors, pUC vectors, and pTRA vectors are preferably used. The pBI and pTRA vectors can introduce a target gene into a plant via agrobacterium. A pBI binary vector or intermediate vector system is preferably used, and examples thereof include pBI121, pBI101, ρΒΙ101.2, ρΒΙΒΙ.3, and the like. A pUC vector can directly introduce a gene into a plant, and examples thereof include pUC18, pUC19, and pUC9. In addition, plant virus vectors such as cauliflower mosaic virus (CaMV), kidney bean mosaic virus (BGMV), and tabaco mosaic virus (TMV) can be used. The gene encoding the above-mentioned oleosin-GFP fusion protein needs to be incorporated into a vector so that the function of the gene is exhibited. Therefore, a vector, a promoter, an enhancer, a splicing signal, a poly A addition signal, a selection marker, a 5′-UTR sequence, and the like can be linked to the vector. Examples of selection markers include dihydrofolate reductase gene and ampicillin. Resistance genes, neomycin resistance genes, hygromycin resistance genes, bialaphos resistance genes, and the like.

 A “promoter” does not have to be derived from a plant as long as it is a DNA that functions in plant cells and can induce expression in a specific tissue of a plant or in a specific developmental stage. Specific examples include Cauliflower mosaic virus (CaMV) 35S promoter, nopaline synthase gene promoter (Pnos), corn-derived ubiquitin promoter, rice-derived actin promoter, and tabacco-derived PR protein promoter. It is done.

 The “terminator” may be any sequence that can terminate transcription of a gene transcribed by the promoter. Specific examples include nopaline synthase gene terminator (Tnos) and force reflower mosaic virus poly A terminator.

 “Enhancer” is used to increase the expression efficiency of a target gene. For example, an enhancer region containing an upstream sequence in the CaMV35S promoter is preferable. In addition, a transformed plant can be produced according to a standard method using an expression vector having a gene encoding the oleosin-GFP fusion protein described above. A transformed plant can be obtained by introducing the expression vector into a host so that the introduced gene can be expressed. The target of transformation is plant tissue (eg, epidermis, phloem, soft tissue, xylem, vascular bundle, etc., including plant organs (eg, leaves, petals, stems, roots, seeds, etc.)) or plant cells.

 Examples of plants used for transformation include dicotyledonous plants and monocotyledonous plants, such as plants belonging to the family Brassicaceae, Gramineae, Eggplant, Legume, Willow, etc. (see below). It is not limited to.

Abfuna larvae: Arabidopsis thal iana, 7 buchuna (Brassica rapa,

Brassica napus; _N = r hehet (Brassica oleracea var. Capitata), rapeseed (Brassica rapa, Brassica napus) _N Nanosona (Brassica rapa ^ Brassica napus) ^

(Brassica rapa var. Pekinensis), Japanese beetle (Brassica rapa var. Chinensis) Cap (Brassica rapa var. Hakabura), Mizuna (Brassica rapa var. Lancinifol ia), Komatsuna (var. peruviridis), Nokuchoi (Brassica rapa var. chinensis) _{x Japanese} radish (Brassica Raphanus sativus), Sasabi (Wasabia japonica).

Solanum: Nicotiana tabacum, eggplant (Solanum melongena), potato (Solaneum tuberosum; _N卜 7 卜 Lycopersicon lycopersicura no, 卜¹ ^: ^ f, </ (Capsicum annuum), Petunia When.

Legumes: Soybean (Glycine max), Endu (Pisum sativum), Broad bean (Vicia faba), Fun '(Wisteria floribunda), Rakkasei (Arachis. Hypogaea), Lotus corniculatus var. Japonicus li, Λ vulgaris)

(Vigna angularis) Acacia etc.

Asteraceae: Chrysanthemum morifo'l ium, Helianthus annuus, etc.

Palms: Elafis (Elaeis guineensis, Elaeis oleifera) Cocos nucifera ^ Dates (Phoenix dactyl ifera), Copernicia oleaceae: Rhus succedanea, Cade identi (Toxicodendron vernicifiuum), Mango (angiiera indica, -Pistacia vera)

Cucurbitaceae: Cubonaya (Cucurbita maxima ^ Gucurbita raoschata, Cucurbita pepo), cucumber (Cucumis sativus), cuff cucumber (Trichosanthes cucumeroides), gourd (Lagenaria siceraria var. Gourda)

Nola: Almond (Amygdalus communis) Rosa, Strawberry (Fragaria), Prunus, Apple (Malus puraila var. Domestica), etc.

Dianthus: Dianthus caryophyl lus etc.

Clanaceae: Pula (Populus trichocarpa Populus nigra., Populus tremula) Gramineae: Maize (Zea mays), Rice (Oryza sativa), Barley (Hordeura vulgare), Com = (Triticum aestivum), Bamboo (Phyllostachys), Sato

(Saccharum officinarum) etc.

Lily family: Tulip (Tul ipa), Lily (Li l ium), etc.

Methods for introducing an expression vector or DNA fragment having a gene encoding the oleosin-GFP fusion protein described above into a plant include the agrobacterium method, Examples include the PEG-calcium phosphate method, the electroporation method, the ribosome method, the particle gun method (bombardment method), and the microinjection method. For example, when the agro-actuary method is used, there are cases where a protoplast is used and a tissue piece is used. When using protoplasts, co-culture with agrobacterium with Ti plasmid, fusing with aglobacterium with spout plastoplast (spheroplast method), or leaf disk when using tissue pieces. Can be performed by a method of infecting a sterile cultured leaf piece of a target plant (leaf disc method), a method of infecting vigorous (undifferentiated cultured cells), a method of directly infiltrating a flower tissue, or the like. Also, for the transformation of monocotyledons by the agrobacterium method, acetosyringone can be used to increase the transformation rate.

 Whether or not the gene encoding the oleosin-GFP fusion protein described above has been incorporated into the plant can be confirmed by a PCR method, Southern hybridization method, Northern hybridization method, or the like. For example, DNA is prepared from transformed plants, and DNA-specific primers are designed and PCR is performed. After PCR, the amplified product is subjected to agarose gel electrophoresis, polyacrylamide gel electrophoresis, capillary electrophoresis, etc., stained with bromide zyme, SYBR Green solution, etc., and the amplification product as a single band. By detecting it, it can be confirmed that it has been transformed. Alternatively, amplification products can be detected by PCR using primers previously labeled with a fluorescent dye or the like. Furthermore, the amplification product may be bound to a solid phase such as a microplate, and the amplification product may be confirmed by fluorescence or enzymatic reaction.

Tumor tissue, shoots, hairy roots, seeds, etc. obtained as a result of transformation can be used for cell culture, tissue culture, or organ culture as they are, and conventionally known plant tissue culture methods can be used. It can be regenerated into plants by administration of an appropriate concentration of plant hormones (auxin, cytokinin, gibberellin, abscisic acid, ethylene, brassinolide, etc.). Generally, plant regeneration from cultured cells involves differentiating roots on a medium containing an appropriate type of auxin and cytokinin, and then transplanting the shoot into a medium rich in cytokinin. After differentiation, transplanted to soil without hormones. In this way, a transformed plant into which the gene encoding the oleosin-GFP fusion protein described above has been introduced can be prepared. In the resulting transformed plant, the oleosin-GFP fusion protein is expressed in the oil body membrane, and the oil body can be visualized by observing the fluorescence derived from fluorescent proteins such as GFP. it can.

 In the present invention, the fluorescence intensity in the cotyledons of the plant body expressing the oleosin-GFP fusion protein is then measured. That is, there is no particular limitation on the method and apparatus for measuring the fluorescence intensity by germinating the seed collected from the transformed plant produced as described above, and measuring the fluorescence intensity in the expanded cotyledon. Examples thereof include a microscope, a fluorescence spectrophotometer, a fluorescence titer plate reader, and a fluorescence image analyzer.

Here, the total fluorescence intensity observed in the cotyledons is calculated as the cotyledon fluorescence intensity. Specifically, it can be calculated as the total fluorescence of the image a = _S um (fluorescence intensity X number of pixels). However, the fluorescence intensity and the number of pixels having each fluorescence intensity are calculated from confocal images acquired under the same conditions, the same area, and the same number of pixels.

The amount of fats and oils in the seed can be evaluated based on the total fluorescence intensity calculated in this way. In other words, there is a positive correlation between the sum of the fluorescence intensities derived from fluorescent proteins such as GFP in the cotyledon and the amount of oil and fat in the seeds. The amount of oil and fat in it can be evaluated. Specifically, the sum of the cotyledon fluorescence intensity in the plant body regenerated from the plant cell or plant cell culture treated with the mutagen is calculated, and the sum of the cotyledon fluorescence intensity in the untreated plant body is calculated. Compare. As a result, if the sum of the cotyledon fluorescence intensity in the plant body after the mutagen treatment is significantly increased compared to the sum of the cotyledon fluorescence intensity in the untreated plant body, A mutation that increases the amount of oil and fat was introduced. Thus, by calculating the sum of the cotyledon fluorescence intensity in the plant body obtained after the mutagen treatment, it is possible to screen a mutant plant having characteristics when the amount of oil in the seeds increases. . Conversely, if the sum of the cotyledon fluorescence intensity in the plant body after the mutagen treatment is significantly lower than the sum of the cotyledon fluorescence intensity in the untreated plant body, Therefore, a mutation that reduces the amount of oil in the seeds was introduced. Thus, by calculating the sum of the cotyledon fluorescence intensity in the plant body obtained after the mutagen treatment, it is possible to screen a mutant plant having characteristics when the amount of oil in the seeds decreases. it can.

 Here, the mutagen treatment is not particularly limited, and treatment with chemical mutagens and / or physical mutagens widely used for inducing mutations can be used. Examples of chemical mutagens that can be used include ethyl methanesulfonate (EMS), ethyl nitrosourea (ENS), 2-aminopurine, 5-bromouracil (5-BU), and alkylating agents. As physical mutagens, radiation, ultraviolet rays, etc. can be used. Mutagenesis using these mutagens can be performed by known methods. The target for evaluating the amount of oil and fat in seeds can be not only plant mutants after mutagen treatment but also different plant species and plant varieties.

 Oil content in seeds is the most important phenotype in oil crops such as rapeseed, soybean, sunflower and palm palm. The phenotype called oil content in seeds is a so-called quantitative phenotype, which is influenced by complex genotypes. According to the evaluation method and the screening method of the present invention, the amount of oil and fat in seeds and changes thereof are simple and easy without the need for laborious steps such as crushing seeds, extracting and purifying oil components and quantitative analysis. High throughput can be determined.

 EXAMPLES Hereinafter, the present invention will be described in more detail with reference to examples. However, the technical scope of the present invention is not limited to the following examples.

 Example 1

 In this example, Arabidopsis thaliana, which is widely used as a model plant, was transformed to express the oleosin-GFP fusion gene, and a transformed plant capable of observing the oil body by fluorescence observation was created. After that, the obtained transformed plant was subjected to mutation treatment, and the mutant in which the amount of oil and fat in the seed was changed was identified using the change in the properties of the oil body as an index. Hereinafter, a specific experimental flow and experimental results will be described in detail.

 Materials and methods

Plant material>

Arabidopsis thal iana Colombian ecotype was used. Plant According to a conventional method, germination was carried out on a sterilized seed and a sterile agar medium (1/2 Murashige scoog medium, 0.8% agar) for 7 days at 22 ° C light conditions. After that, it was planted in a pot containing vermiculite: perlite = 1: 1, and was grown at 22 ° C. for 16 hours light and 8 hours dark. <Creation of oleosin GFP gene>

RNA was isolated from Arabidopsis sheaths using Qiagen's RNeasy plant mini kit, and reverse transcription was performed using Invitrogen's Superscript III first strand synthesis system for RT-PCR. PCR was performed using the obtained cDNA and primer 1 ( ³ 'AAAAAGCAGGCTCAATGGCGGATACAGCTAGAGGA ³ ': SEQ ID NO: 3) and primer 2 ( ³ 'CTCGCCCTTGCTCACCATAGTAGTGTGCTGGCCACC ³ ': SEQ ID NO: 4). And DNA fragment A with a part of the GFP gene was amplified. At the same time, cDNA and primers 3 encoding green fluorescent protein GFP in Owankurage ⁽³ 'GGTGGCCAGCACACTACTATGGTGAGCAAGGGCGAG ^3': SEQ ID NO: 5), primer 4: by PCR using the ⁽³ 'AGAAAGCTGGGTCTTACTTGT ACAGCTCGTCCAT ^3' SEQ ID NO: 6), the GFP cDNA A DNA fragment B having both oleosin S3 cDNA and a part of attB2 sequence added at both ends was amplified. Then, DNA fragments A DNA fragment B, primer one ^{5 (3 'GGGG ACA AGT TTG} TAC AAA AAA GCA GGC T 3': SEQ ID NO: 7) and primer one ^{6 (3 'GGGG AC CAC TTT} GTA CAA GAA AGC TGG G ³ ': SEQ ID NO: 8) were mixed and further PCR was performed to create an oleosin-GFP fusion gene with attBl and attB2 sequences on both sides. The nucleotide sequence of the oleosin-GFP fusion gene and the amino acid sequence of the gene product are shown in SEQ ID NOs: 1 and 2, respectively.

 The obtained fusion gene was cloned into a Ti vector having attRl and attR2 sequences downstream of the CaMV 35S promoter and containing a kanamycin resistance marker via the PD0NR221 vector according to the Gateway system protocol of Invitrogen. The obtained plasmid was agrobacterium by electroporation.

Introduced into (Agrobacterium tumefacience C58C1 rifR) and named Ti_01eG. <Transformation of Arabidopsis thaliana>

The oleosin-GFP fusion gene was introduced into the Arabidopsis genome using the agrobacterium. First, Ti-OleG is added to YEB medium (5g 8 polypeptone, 5g / l beef extract, lg / 1 yeast extract, 5g / l sucrose, 0.5g / l MgS0 ₄ ) A600 = 0.8-1. 0 The cells were grown at 28 ° C until they were collected, and then collected by centrifugation. The obtained microbial cells were suspended in an infiltration solution (10 mM MgCl ₂ , 5% sucrose, 0.05% Silwet L-77) so as to be A600 20.8. The flowering Arabidopsis flower stalks were immersed in this suspension for 1 minute, and then the seeds with fruit were collected. The collected seeds were sterilized and then sown on a sterile agar medium containing 25 mg / l kanamycin, and transformed Arabidopsis thaliana in which the oleosin-GFP fusion gene was inserted into the genome was isolated using kanamycin resistance as an index. The seeds were collected from the obtained transgenic Arabidopsis thaliana, and a transformant having a homozygous kanamycin resistance marker as a progeny was selected and named OleG.

<Mutagen treatment of transformant>

 OleG seeds were treated with 0.2% ethylmethanesulfonic acid solution for 16 hours, and then sown in a pot containing vermiculite: parrite = 1: 1. 2 Progeny seeds were collected under 16-hour light and 8-hour drought conditions at 2 ° C and used as M2 seeds.

<GFP fluorescence observation>

 A fluorescent stereomicroscope (Carl Zeiss SteRE0 Lumar V12) was used for screening the mutants. OleG and M2 seeds were germinated on a sterile agar medium upright for 6 days in the dark. Under the fluorescent stereomicroscope (Carl Zeiss), the oleosin-GFP fusion protein in the yellow cotyledon, hypocotyl and root cells GFP fluorescence was observed. OleG was identified as a mutant with a different GFP fluorescence intensity and distribution.

A confocal laser microscope (Carl Zeiss LSM 510) was used to compare the GFP fluorescence of the oleosin-GFP fusion protein in OleG and mutants. From the OleG and mutants germinated for 6 days, the yellow cotyledons, hypocotyls and roots were cut out and mounted in a slide class. GFP fluorescence images at each cell taken under the same conditions, using image analysis software microscope accessories, calculates the frequency distribution of the fluorescence intensity for pixels in the same area, the fluorescence sum a = _S um (fluorescence intensity X pixel count) was calculated.

<Electrophoresis and imunobutt analysis of seed protein>

Twenty seeds were crushed in a 40/1 SDS sample buffer, and the centrifuged supernatant was used as a seed protein sample. According to a standard method, 15 μl of the sample was subjected to SDS polyacrylamide gel electrophoresis. The gel after electrophoresis was stained with 0.2% Kumashi mono-priorint blue R250 solution (containing 25% methanol and 10% acetic acid). For the Imunobutt analysis, 5 μl of the sample was electrophoresed on SDS polyacrylamide gel, and then the protein in the gel was transferred to a nitrocellulose membrane using the semi-drive lot method. Detection of proteins transcribed on the nitrocellulose roll using anti-protein antibodies is performed according to the GE Healthcare Bioscience protocol and TT using ECL Western blotting detection ion reagents. At that time, the primary antibody (anti-oleosin antibody or anti-GFP antibody) and the secondary antibody were both diluted 1/5000. A luminescence image analyzer LAS-1000 plus made by Fuji Film was used for detection of luminescence.

Observation of Guseed Cell by Electron Microscope>

 Half-cut seeds were fixed with fixative (4% paraformaldehyde, 1% dartalaldehyde, 10% DMS0, 0.05M strength codylate buffer pH 7.4). The fixed sample was embedded in Ebon 812 resin, and an ultrathin section was prepared using a Leica microtome Ultracut UCT. Ultrathin sections were electron-stained with 4% uranium acetate and 0.4% lead citrate and then observed with an electron microscope (Hitachi Seisakusho H-7600).

<Measurement of oil content of seeds>

 The seeds were weighed with a precision electronic balance using a medicine wrapping paper while performing static neutralization, and weighed so that the seed weight would be 10-12 mg. The seeds were put in a test tube for pulse NMR, and the fat content (% by weight) in the seed was determined from the pulse NMR relaxation time value using Resonance MARAN-23 pulse NMR. The detailed measurement procedure was in accordance with pulse NMR measurement.

Analysis of fatty acid composition in oil of fat

 After weighing the seed sample of about 1 mg to 5 mg, it was placed in a 1.5 ml microtest tube. Add one grain of 3 ιηιη φ tungsten carbide beads to a microtest tube, and then add 50 1 methanol, 0.2% (w / v) methanol solvent in a butyl hydroxytoluene solution mixed with 50 // 1. 0.2% as internal standard substance

C15: 0 Fatty acid 10 μ 1 was added. The micro test tube to which these various reagents and samples were added was shaken for 1 minute at a frequency of l / 20 s using a Retsch Mixer Mill Type MM301 to grind the seeds. Samples were transferred to 10 ml test tubes with screw caps. Wash the inside of the micro test tube twice with 250 μl of methanol The purified methanol solution was added to the above test tube to make the sample solution about 1 ml. Add 1 ml of 10% hydrochloric acid in methanol, treat at 80 ° C for 1 hour, add 1.5 ml of n-hexane, stir with a vortex mixer, and add n-hexane layer. Transfer to a 10 ml Spitz tube. The inside of the test tube used for methanolysis was further washed with 1 ml of n-hexane, and the washed _n- hexane liquid layer was added to the above-mentioned spipe tube. The obtained n-hexane solvent solution was purged with nitrogen gas at 40 ° C. to dry the fatty acid methyl ester. The dried fatty acid methyl ester was dissolved in 500 µ 1 of n-hexane, and various fatty acid methyl esters were separated and quantified by GC-FID. In quantification, the area value of the internal standard (C15: 0 fatty acid) was referred.

Results and discussion

 <Establishment of oil body dysplastic mutant screening method>

 A fusion gene (Oleosin-GFP) encoding a fusion protein of oleosin and GFP (green fluorescent protein) was prepared and ligated downstream of the cauliflower mosaic virus-derived 35S promoter DNA (Fig. 1A). This DNA construct was introduced into the genomic DNA of Arabidopsis thaliana using the Agrobacterium method, and transformed Arabidopsis thaliana was prepared and named oleG. Figure 1B shows the result of observation of oleG cotyledons after germination for 6 days under dark conditions using fluorescence microscopy. From Fig. 1B, it can be seen that the oil body membrane is labeled with GFP fluorescence, and that many small oil bodies are present as aggregates. In addition to the cotyledons germinated under dark black conditions, it was found that oil bodies also exist in green cotyledons, true leaves, and petals germinated under embryonic conditions.

 In order to determine the genes involved in the mechanism of vegetable oil accumulation in the oil body, oleG seeds were mutated with ethylmethanesulfonic acid to obtain progeny M2 seeds. Fluorescence microscopy of M2 plants germinated for 6 days under dark black was performed, and mutant A (Fig. 1 C) and mutant B (Fig. 1 D) with different fluorescence intensity compared to oleG were obtained. These mutants had lower GFP fluorescence intensity in germinated cotyledons than oleG.

<Relationship between GFP fluorescence and lipid content of seeds>

For OleG, Mutant A and Mutant B, GFP fluorescence of cotyledons germinated under dark black for 6 days was acquired as a laser confocal microscope image with the same conditions, the same area, and the same number of pixels. From the frequency distribution of the number of pixels with respect to the GFP fluorescence intensity of each image, the total GFP fluorescence a ( _a = sum (fluorescence intensity X number of pixels)) was obtained. Assuming that the total fluorescence of OleG is 100%, the total fluorescence of mutant A is 37.9% and that of mutant B is 85.1%. On the other hand, the lipid content (mean standard deviation) contained in the seeds of 01eG, Mutant A, and Mutant B was measured and found to be 34. 66% ± 0.43% and 26. 91% ± 0 · 34%, respectively. 32. 34% ± 0.49%.

 Based on these results, the relationship between the total GFP fluorescence and the lipid content of seeds is shown in Fig. 2 and Table 1.

 table 1

As shown in Fig. 2 and Table 1, the total fluorescence in cotyledons caused by oleosi-GFP fusion protein correlates with the fat content in seeds measured nondestructively (y = 8.1 1331X-180. 25, R ² = 0. 9959). From the results of this Example, it has been clarified that the oil and fat content in seeds can be easily determined only by measuring the fluorescence intensity of cotyledons in a transformed plant in which the oleosi-GFP fusion protein is expressed. Industrial applicability

According to the present invention, it is possible to provide an evaluation method that evaluates the amount of oil and fat in seeds in a non-destructive manner only by performing visible light measurement that is simple in operation and capable of quantitative measurement of a large number of samples at once. In addition, according to the present invention, plant species, plant varieties, or plant variants in which the amount of fats and oils in seeds is changed can be screened only by performing visible light measurement that is easy to operate and enables quantitative measurement of a large number of samples at once. A screening method can be provided. The evaluation method and screening method according to the present invention are very simple because the amount of fats and oils in seeds or their genetic changes can be evaluated nondestructively. The amount of oil and fat in seeds is a genetic quantitative trait, and a method that can easily and quantitatively measure this amount has industrial advantages. All publications, patents and patent applications cited in this specification are used as is for reference. Incorporated herein.

Claims

The scope of the claims

1. measuring the visible light intensity in the cotyledons in a plant expressing a fusion protein of a protein that exists specifically in the oil body and a protein detectable by visible light;

 A method for evaluating the fat content in the seed based on the visible light intensity measured in the above step.

 2. The evaluation method according to claim 1, wherein the protein specifically present in the oil body is any one protein selected from the group consisting of oleosin, sterolesin and force leucine.

 3. The evaluation method according to claim 1, wherein the protein specifically present in the oil body is oleosin.

 4. The evaluation method according to claim 1, wherein the protein detectable by visible light is GFP (green fluorescent protein).

 5. The step of determining the fat content is characterized by calculating a sum of visible light intensities in cotyledons and judging from a relationship in which the sum and the fat content in seeds are positively correlated. The evaluation method described.

 6. Determine the positive correlation between the total visible light intensity and the oil content in the seeds, based on the total visible light intensity measurement and the measurement using the nondestructive seed oil content determination method using pulsed NMR. 6. The evaluation method according to claim 5, further comprising the step of:

 7. The evaluation method according to claim 6, wherein the total measurement of visible light intensity is measured by a fluorescence microscope, a fluorescence spectrophotometer, a fluorescence titer, a single plate reader, or a fluorescence image analyzer.

 .

8. The evaluation method according to claim 1, wherein the plant body is obtained from a plant cell or a plant cell culture subjected to a mutagen treatment.

 9. The evaluation method according to claim 1, wherein the plant body is an oil plant.

10. The evaluation method according to claim 1, wherein the plant body is a dicotyledonous plant.

1 1. The plant according to claim 1, wherein the plant is a cruciferous plant. Evaluation methods.

 1 2. The evaluation method according to claim 1, wherein the plant is Arabidopsis thaliana.

 1 3. The evaluation method according to claim 1, wherein the visible light intensity is measured with a fluorescence microscope, a fluorescence spectrophotometer, a fluorescence titer plate reader, or a fluorescence image analyzer.

 1 4. Based on measuring the intensity of visible light in plant cells, plant cell cultures, or cotyledons derived from plant bodies that express a fusion protein of oil body-specific proteins and proteins detectable by visible light. A screening method for selecting plant species, plant varieties or plant mutants in which the oil content in seeds has changed.

 15. The screening method according to claim 14, wherein the protein specifically present in the oil body is any one protein selected from the group consisting of oleosin, steroleucine and force leucine.

 16. The screening method according to claim 14, wherein the oil body-specific protein is oleosin.

 17. The screening method according to claim 14, wherein the protein detectable by visible light is GFP (green fluorescent protein).

 1 8. performing a mutagen treatment on a plant cell, plant cell culture or plant expressing a fusion protein of an oil body specific protein and a protein detectable by visible light;

 After the mutagen treatment, measuring the visible light intensity in the cotyledon,

 A method for screening a plant having a changed oil content, comprising: determining a change in the oil content in the seed resulting from the mutagen treatment based on the visible light intensity measured in the above step.

 19. The screening method according to claim 18, wherein the protein specifically present in the oil body is any one protein selected from the group consisting of oleosin, steroleucine and force leucine.

2 0. The above oil body specific protein is oleosin. The screening method according to claim 18, wherein:

 21. The screening method according to claim 18, wherein the protein detectable by visible light is GFP (green fluorescent protein).

2 2. In the step of determining the change in the oil content, the sum of visible light intensity in the cotyledons is calculated, and the sum is determined from a relationship in which the oil content in the seed is positively correlated. Item 18. The screening method according to Item 18.

 2 3. The relationship between the total visible light intensity and the fat content in the seeds is positively correlated with the total visible light intensity measurement and the measured value using the nondestructive seed fat content determination method using pulsed NMR. The screening method according to claim 22, further comprising a step of determining.

 24. The screening method according to claim 23, wherein the total measurement of the visible light intensity is measured with a fluorescence microscope, a fluorescence spectrophotometer, a fluorescence titer plate reader, or a fluorescence image analyzer.

 25. The screening method according to claim 18, wherein the plant body is an oil plant.

 26. The screening method according to claim 18, wherein the plant body is a dicotyledonous plant.

 27. The screening method according to claim 18, wherein the plant body is a cruciferous plant.

 28. The screening method according to claim 18, wherein the plant is Arabidopsis thaliana.

 29. The screening method according to claim 18, wherein the visible light intensity is measured with a fluorescence microscope, a fluorescence spectrophotometer, a fluorescence titer plate reader, or a fluorescence image analyzer.