WO2009099590A2

WO2009099590A2 - Psoriatic phenotype mice, cell lines, treatments, and methods

Info

Publication number: WO2009099590A2
Application number: PCT/US2009/000680
Authority: WO
Inventors: Jan Klysik; John Sedivy; Kim Boekelheide
Original assignee: Brown University
Priority date: 2008-01-31
Filing date: 2009-02-02
Publication date: 2009-08-13
Also published as: WO2009099590A3

Abstract

A genetically-modified, non-human animal, ES cells and methods for diagnosing and identifying agents useful in the treatment of psoriasis, and psoriatic conditions or disorders is provided.

Description

PATENT BU2007-45-WO

PSORIATIC PHENOTYPE MICE, CELL LINES, TREATMENTS, AND METHODS ACKNOWLEDGEMENT

This invention was made with government support under NIH Grant No. 5P20RR015578. The government has certain rights in the invention.

FIELD OF THE INVENTION The invention is in the field of psoriasis.

BACKGROUND

Psoriasis is a papulosquamous skin disease. It is believed to be an immune-mediated disorder involving Tumor Necrosis Factor α (TNFα), t-cells, and dendritic cells. The disease has three principal histological features: epidermal hyperplasia; dilated, prominent blood vessels in the dermis; and an inflammatory infiltrate of leucocytes predominantly into the dermis. The hyperplasticity of the epidermis is associated with underexprcssion of keratinocyte differentiation markers, loss of the granular cell layer, parakeratosis, elongation of rete ridges, and the presence of micropustules of Kogoj and Microabscesses of Munro. The abnormal vascular proliferation appears to involve angiogenic factors produced by epidermal keratinocytes, particularly vascular endothelial growth factor (VEGF), serum concentration levels of which correlate with clinical severity of the disease. TNFα modulates the interaction between VEGF and the angiopoietin/Tie signaling pathway and infliximab, a TNF-blocking chimeric monoclonal antibody, inhibits this pathway and is one of the few current drug treatment for the disease. The inflammatory infiltrate of leukocytes into the dermal layer of the skin consists predominantly of CD4+ and CD8+ T-cells. Highly or overly expressed in psoriatic skin are intercellular adhesion molecule-1, E-selectin, interferon-γ, interleukin (IL)-2, IL-12, TNFα, and the endogenous anti-microbial peptides cathelicidins and β defensins. Ciclosporin, a immunosuppressant that targets T-cells, and denileukin difitox, an IL- 2/diphtheria fusion protein that exhibits activated T-cell cytolytic activity, are efficacious in treatment of the disease. Other current treatments include topical, tar- based, skin medications and light treatment The most common form of psoriasis, psoriasis vulgaris, is unique to human beings. The various types of psoriasis and their clinical features are discussed in greater detail in Griffiths and Barker¹.

No reliable biomarkers are currently known to be representative or predictive of psoriasis. Still, animal models have been provided. Various models are described and their utility assessed in Griffiths and Barker¹, supra, in Schon², and in Nickoloff and Nestle³. See also, Zenz et al.⁴ describing one such animal model. The role of VEGF is explored in Xia et al.⁵ and the role of αi βi integrin is disclosed in Conrad et al.⁶ In brief, none of the transgenic rodent models currently available appear satisfactory in recapitulating all of the basic phenotypic characteristics of the disease. In sum, it would be advantageous to provide such a model.

Knockout mouse models of other helicases believed to have a critical role in DNA repair and genome maintenance processes are known. For example, trichothiodystrophy (TTD) mice⁷ carrying a mutation in the xeroderma pigmentosum (XPD) gene that is involved in nucleotide excision repair (NER) pathway show ichthyosis and hyperkeratosis, growth retardation, adipose tissue hypoplasia, reduced lifespan, and prematurely aged appearance. Disruption of PASG (proliferation associated SNF-2-like gene) or lsh (lymphocyte-specific helicase), which encodes a SNF2-like protein involved in genome methylation, causes growth retardation and premature aging symptoms such as hyperkeratosis, alopecia, reduced fat deposition, cachexia, and kyphosis*. These knock out models are not conditionally disruptive; the gene disruption was done in all cells and tissues across the organism. Further, the art recognized use of these models is in the study of ageing-and/or DNA repair defects. To our knowledge, there has been no reported recognition or suggestion that any mouse model having a disrupted helicase gene could be employed in the study of psoriasis.

INVENTION SUMMARY

The invention is based on the unexpected discovery that disruption of a gene coding for a ubiquitous helicase enzyme recapitulates the basic phenotypic characteristics of psoriasis. The helicase is localized primarily in mitochondria, with a small fraction in the nucleus, and although it is well understood that mitochondrial proteins may contribute to apoptosis, aging and neoplastic changes, the involvement of helicases in psoriasis, particularly mitochondrial helicases, appears to be an entirely novel and unexpected finding.

The helicase encoded by the human gene is known as SupvSLl or SUV3 and it is highly conserved. In Sacharomyces cerevisicte, the homologue, Suv3, has been identified as an ATP-dependent RNA helicase that belongs to the DEAD/DExH family of genes involved in RNA processing in mitochondria. ' ' Homologies have also been found in Caenorhabditis elegans, Arabidopsis thaliana, Drosophila melanogaster, and in mice. For ease of reference, all homologues, including the human homologue, will be termed Suv3 herein. The human protein encoded by human Suv3 has been recently shown to unwind double-stranded DNA, DNA/RNA, and RNA/RNA.¹²'¹³ In the mouse, we demonstrate that the mouse gene functions as an important contributing factor in the development of phenotypes characteristic for psoriasis. While an insertional disruption of the gene is embryonic lethal²⁰, it has been discovered that a conditional disruption of Suv3 in adult mice leads to skin lesions that closely resemble and mimic psoriasis in humans.

No one knows what causes psoriasis. Currently, there is a considerable argument in the literature between two concepts: (1) that the etiology of psoriasis is strictly immunological on the one hand, and (2) that psoriasis is of genetic origin whereby there is a genetic change, or multiple genetic changes, that take place first, followed by immunological changes damaging the skin. While we are reluctant to be bound by theory and because it is too early in this research to propose a definitive conclusion that one or more helicase genes are the or a causative factor of psoriasis, our working hypothesis is that the SUV3 mitochondrial helicase is not the only gene that, if damaged, can lead to psoriasis provided the damage occurs locally in the skin to induce the recruitment of the immune system. But we believe it may be a key gene in a pathway of many genes. Because SUV3 is primarily localized in mitochondria, mitochondrial dysfunction may be a factor in psoriasis.

Accordingly, in one aspect, the invention provides a non-human animal model for psoriasis, psoriatic conditions or disorders. The animal model comprises a non-human animal whose genome includes a conditional disruption of the Suv3 gene, as a result of which the mammal is predisposed to exhibition of a psoriatic phenotype. As known in the art, the gene of interest is slightly modified in the organism (i.e. exon(s) are floxed = flanked by loxP sites), such that the modifications do not affect the gene's spatial and temporal expression/function without additional factors. These artificial changes can be used to induce disruption of the gene at a later, desired time, typically by administration of a drug or a substance that induces Cre recombinase. Cre recombinase is introduced, typically via genetic crosses, into all cells of these animals independently of the exon-floxing changes of a gene under investigation. This Cre recombinase becomes expressed upon administration of a drug. Once expressed (present in the cells), Cre works site- specifically on the modifications of a gene of interest {loxP sites) to delete exon(s) located between them. Thus a gene of interest becomes disrupted/modified at the time investigator administers the drug (hence, a conditional disruption). The animal may be a pig, sheep, or rodent for example. Rodents, including guinea pigs, hamsters, rats and mice, are preferred. Mice are especially preferred and employed herein to exemplify the invention.

The mammal can be initially produced by promoting homologous recombination between an SUV3 gene in its chromosome and a targeting vector carrying portion of an exogenous SUV3 gene that has been modified to contain, preferably, but not necessarily, one or more floxed exons, including exon 14. In a preferred aspect, the homologous recombination is carried out by transforming embryo-derived stem (ES) cells with a vector containing the modified SUV3 gene such that homologous recombination occurs, followed by injecting the modified ES cells into a blastocyst and implanting the blastocyst into a foster mother, followed by the birth of the chimeric mammal in which the SUV3 gene has been modified but not inactivated. Male chimerasies are mated with females to obtain heterozygous Fl progeny. Since, typically, the targeting vector, and therefore the Fl progeny, contains a selective cassette (such as Neo) flanked by Frt sites, this cassette is then removed by mating Fl animals with appropriately chosen strain of mice expressing FIp recombinase. From the resulting progeny, heterozygous animals are selected that carry the floxed exon(s)j of Suv3, but not a selective cassette. Further multiple mating steps usually involve, but are not limited to: intercrosses of heterozygous animals to produce homozygous offspring (i) containing floxed exon(s) of Suv3 on both copies of the gene, crosses of heterozygous animals with mice carrying inducible Cre recombinase to produce double heterozygous (ii) animals, and crosses of (i) x (ii) that produce offspring carrying the inducible Cre allele and floxed both copies of Suv3 gene (iii). The conditionally disrupted genetically modified animals develop or are predisposed to developing the psoriatic phenotype and thus can be employed as a animal model of the disease, for example, to screen molecules for the ability to effectively inhibit, cure, or treat the disease. Thus, the invention provides genetically modified animals in which one or both of the SUV3 gene alleles is appropriately modified, cells lines derived from these animals, and ES cells in which expression of the SUVi gene can be conditionally disrupted.

The currently known knock out models of the other helicases⁷' ⁸ are not appropriately modified to result in animals predisposed to developing the psoriatic phenotype because their disruptions are not appropriately designed. The gene disruption in those models was done in all cells and tissues across the organism. In the conditionally disrupted model of this invention i.e. involving Mxl-Cte transgene, the disruption damages the gene in the skin first, while the other tissues can function more or less normally for a longer period of time. Consequently, it appears there is a time window for healthy immune cells to invade the damaged (exonl4-deleted) skin to induce and/or reveal psoriatic changes much more profoundly in our model then in the other aforementioned models of non-conditionally disrupted helicase genes. Our model shows much greater foot scaling, greater alopecia, greater hyperkeratosis, etc, relative to the other models.

Evidence of this is provided by our results using the tamoxifen-Cre system (see Examples). In that system, the Suv3 disruption causes premature ageing- like phenotype, with some skin defects, analogous to what was seen with the non- conditional disruption of the other helicase genes disclosed in deBoer⁷ and Sun⁸. Consequently, what is believed to be a key factor in the creation of an animal model of psoriasis is not the ubiquitous expression/damage of the gene, but rather selective, skin localized expression/damage of an important mitochondrial helicase that is otherwise ubiquitous.

Given the fact that there are hundreds of genes encoding helicases in the mammalian genome that are neither identical structurally nor functionally, and that operate in different compartments of the cell, in some cases the helicase gene may be involved in more discrete diseases (well defined monogenic diseases like trichothiodystrophy (TTD) or Bloom syndrome (BLM)) while in other cases they may be involved in less defined diseases (typically polygenic). The key factor for the purpose of creating an animal model of psoriasis is that the gene knockout results in damaging the gene in the skin first, while the other tissues can function more or less normally for a longer period of time.

In another aspect the invention provides a method for identifying compounds suitable for treatment or prophylacsis of psoriatic conditions or disorders or their complications in humans. In this aspect, the invention includes providing a collections of compounds or compositions to be tested in the psoriatic animal model; administering the compounds or compositions of the collection to the model animal having the conditional disruption in its Suv3 gene that leads to the psoriatic phenotype; assessing the effect of the compound or composition administered on the animal; and identifying the compounds or compositions in the collection that modulate the expression of the psoriatic phenotype. According to this aspect, potential drugs and other treatments are tested on the animals provided herein. Drugs or treatments can be administered and selected as potential leads by scoring the skin response in the psoriatic phenotype expressing animals administered the drugs as compared to control psoriatic phenotype expressing animals. A drug is a lead drug when the psoriatic phenotype is significantly modulated compared to the control.

More specifically, the invention provides a genetically modified non- human animal in which the SUV3 gene is artificially changed and leads to lower expression of the encoded protein or expression of a non-functional protein. In another aspect, the invention provides a genetically modified non-human animal in which a modified gene is inserted into one or both of the SUV3 alleles. In either case, the non-human animal is preferentially a rodent, especially a mouse. In yet another aspect, the invention includes a cell line established from one or more of the aforementioned genetically modified non-human animals.

The genetically modified non-human animal can be constructed using genetic engineering techniques well known in the art. For example, DNA including the exons of the SUV3 gene is isolated from the animal and an appropriate marker gene is inserted into it forming a targeting vector, which is then introduced into an embryonic stem cell line using electroporation or other known methods. A cell line in which homologous recombination has occurred is then selected using the marker gene, which is typically a gene that is resistant to an antibiotic such as the neomycin- resistant gene. Incubating the cells in a medium containing the antibiotic allows for easy selection of the cells in which homologous recombination has occurred. Alternatively, a gene allowing for exclusion of cell lines in which non-homologous recombination has occurred, such as the thymidine kinase gene, may be employed. Another method of selecting cell lines in which one of the SUV3 gene alleles has been inactivated or changed is by selecting the homologous recombinants using PCR and Southern blotting. Once these cell lines have been selected, chimeric animals are typically constructed using multiple clones to account for the possibility of nonspecific effects involving unintended changes in unknown genes. The chimeric animals are produced by injecting the obtained ES cell lines into blastocysts from the animal. Animals in which -one SUV3 allele is inactivated can be obtained by crossing these chimeric mice with wild type mice. By crossing the offspring of these crosses with each other, mice can be obtained in which both SUV3 alleles have been inactivated or changed.

DESCRIPTION OF THE DRAWINGS Figure IA is a schematic representation illustrating the creation of the targeting vector as described in Example 1. Fig. IA shows the genomic structure of the wild-type Supv3Ll locus, targeting vector, and allelic modifications obtained through targeting the ES cells and matings. The sequence of genomic homology is in bold. Abbreviations: Seal, Seal restriction sites; Pr, probe used in Southern blotting; Frt,frt sites; loxP, loxP site; neo, G418 resistance gene. Arrows indicate the position of PCR priπ. ;rs. Fig. IB is a reproduction of the Southern blot analysis of the targeted ES cells showing correct integration event at the 5' homology arm. Fig. 1C is a reproduction of the results of the agarose gel electrophoresis of PCR products generated using DNA from targeted ES cell clones and primers 5 and 5a confirming the correct integration event at the 3' homology arm. Fig ID lists the primers used for RCR analysis of various Supv3Ll alleles.

Figure 2A-G are photographic reproductions showing the phenotypic appearance of Mxl-Cτe, Supv3Ll'^m2M/'^m2M representative animals. In Fig. 2(A) an Mc/-Cre Supv3Ll^tm2JkVtm2Jk' animal at 17 days of age shows flattened and disfigured ears (left) relative to normal Mr/-Cre Supv3Ll ^m2JW+ (right) littermate. In Fig. 2(B) the flattened morphology of ears and size differences between a representative MxI- Cre Supv3Ll^tm2JWlm2JU animal (left) and a representative normal MxI-CtQ Supv3Ll'^m2ΛJ/* littermate at 27 days of age is shown. Fig. 2(C) is a copy of a photograph of a representative Mxl-Cre Supv3Ll^tmmVmm animal with alopecia of abdominal regions at 10 weeks of age. Fig. 2(D) shows alopecia, scaling of the back skin and ears in a representative MxI -Cre Supv3Ll^lmVk'^/'^m2Jt' animal at 10 weeks of age. Fig. 2(E) is a copy of a photograph showing formation of scales on the feet of a representative Mx/-Cre Sυpv3Ll"^n2M"^m2M animal at 10 weeks of age (left) relative to a representative normal mouse (right) at the same age. Scales on the tail in Mxl-Cre Supv3Ll^lm2JU/'^m2M mouse are shown in Fig. 2(F) while scaling of ears is in Fig. 2(G). Fig. 2(H) is a graphic representation of the growth rate differences between the MxI- Cre Supv3Ll^tm2JU/"^n2J]d mice and control littermates recorded over a period of 11 days (average of three animals per genotype). Fig. 2(1) is a reproduction of the agarose gel electrophoresis results illustrating the progressive conversion of the floxed allele into a Δ14 allele in Mxl-Cre Supv3Ll^m2JWtm2M mouse. Tail biopsies were taken for PCR analysis at the age of 14, 21 and 28 days (lanes 1-3, respectively). PCR performed on skin sample collected at the time of death is shown for comparison in lane 4. Fig. 2(J) is a reproduction of agarose gel electrophoresis results showing the status of the floxed allele in Mxl-Cre Supv3Ll^tm2JWtmtm mouse at the time of death (10 weeks) demonstrating different degree of deletion in different tissues. Fig. 2(K) is a graphic representation showing survival of Mx7-Cre Supv3Ll^tm2JW* and Λf«/-Cre Supv3Ll^lmZMtm2M mice plotted against age in weeks. Figure 3 are photographic reproductions of H&E stained cross-sections of the abdominal skin of the experimental animals. Fig. 3 A shows the normal skin of an animal at 10 weeks of age. Fig. 3B shows the skin from the Mxl-Cre SupvSLI¹™ "" mouse showing thickened epidermis, severe hyperkeratosis, dystrophic dermis, lack of sebaceous glands, and almost total absence of adipose and muscle layers. Fig. 3C shows focal parakeratosis (arrow) in Mxl-Cre Supv3Ll^m2ΛVtm2M skin. Fig. 3D is a photographic reproduction at higher power magnification of Mr7-Cre Sυpv3Ll^tm2JWtmim skin cross-section showing parakeratotic scaling (arrow) and formation of epidermal structures resembling rete ridges (arrow head). Abbreviations: SC, subcutaneous muscle fibers; Ad, adipose layer, Der, dermis; Eder, epidermis; HC, hyperkeratosis.

Figure 4 are photographic reproductions of H&E stained sections of the ears of the experimental animals. Fig. 4A shows a cross-section through a normal ear of the age matched littermate. Fig. 4B shows a section of the Mxl-Cre Supv3Ll""^2JU/lm2JU animal at the age of 10 weeks exhibiting disfigured morphology, thickened epidermis, hyperkeratosis, and neutophilic microabscesses (arrowhead). Fig. 4C shows a cross-section of Mxl-Cxt Supv3Ll"^n7JUJ"^nUld ear biopsy exhibiting epidermal changes and focal parakeratosis (arrowhead). Fig. 4D shows a cross- section exhibiting the highly keratinized area of the ear with absent epidermal cells (arrowhead).

Figure 5 are photographic reproductions showing the changes induced by topical application of 4-OH tamoxifen in H&E stained cross-sections of a skin sample taken from a control animal, Λc/ό-Esrl/Cre Supv3Ll^tm2JU/λr , showing no epidermal changes at lower (A) and higher power magnification (C). The skin sample from Λc/6-Esrl/Cre Supv3Ll^tm2JUJtm2M animal after the same 4-OH tamoxifen treatment is shown at lower (B) and higher power magnification (D). Note hyperkeratotic and parakeratotic changes along with significantly thickened epidermal layer of cells. Dilated blood vessels in dermal layers are marked by asterisks (D). Subcutaneous vasculature in 4-OH tamoxifen treated Λcfδ-Esrl/Cre Supx3Ll"^n2Jia/lm2M animals relative to the control group is shown in panels (F) and (E) respectively. Panel (G) is a photographic reproduction of the agarose gel electrophoresis results showing the deletion status of the Supv3Ll gene in the skin of topically treated animals (+) and before 4-OH tamoxifen application (-) as assessed by PCR. Note virtually compete deletion of exon 14. In panel (H) kyphosis and sarcopenia in Λctf-Esrl/Cre SupvSLl""³™⁰"⁴*¹ animals (upper) 20 days after completion of topical application of 4-OH tamoxifen can be seen. The Actb-EsrllCre Supv3Ll'^miM/+ animal identically treated with 4-OH tamoxifen is shown for comparison (lower). In panel (I) weight loss of animals topically treated with 4-OH tamoxifen as a function of time is plotted graphically. Actb-EsτllCκ Supv3Ll"^n3JWtm4JU animals (lower line); Λc/ό-Esrl/Cre Supv3Ll^lm3Jkt/* (upper line). Data represent an average of three animals per genotype. This response was indistinguishable between Λctf-Esrl/Cre Supv3Ll^tmlMtm2Jk' and Λcrf>-Esrl/Cre

animals, and therefore unrelated to the presence or absence of the Neo cassette. In panel (J) the deletion status of ύiefloxed Supv3 Ll alleles in different tissues of Λcfό-Esrl/Cre Supv3Ll"^n2JWtm2JU animals is shown after topical 4-hydroxy tamoxifen administration.

Figure 6 are photographic reproductions showing the phenotypic appearance of mice injected subcutaneously with tamoxifen. In panel (A) kyphosis of the Λc/ό-Esrl/Cre Supv3Ll^tm2JU/"^n2JU animal 2 months after drug administration is shown. In panel (B) the same animal is shown next to the Actb-EsήlCτG Supv3Ll'^{m +} control littermate of the same age. Note, smaller size, sarcopenia, kyphosis, and lack of fat deposits. Profound scaling develops on feet and tails of Λc/δ-Esrl/Cre Supv3Ll^UntM"^m2JU m\∞ as can be seen in panels (C) and (D). In panel (E) the status of the floxed Supv3Ll alleles in different tissues of Λc/δ-Esrl/Cre Supv3Ll"^n2JWlm2M and Actb-EsrVCte Supv3Ll^tm2JW+ mice after SQ tamoxifen administration, as measured by agarose gel electrophoresis is shown.

Figure 7 are photographic reproductions showing the effect of subcutaneous administration of tamoxifen on KKϊU-Cre/Esrl Supv3Ll^tm3M/""^mι and KERT14-Cre/Esri Supv3Ll'^m3JW* mice as described in Example 11. Panels (A) (lower mag.) (C) (higher mag.) and (B) (lower mag.) (D)(higher mag.) are ear cross sections of a control mouse (A) (C) and a test mouse (B) (D), four weeks after completion of tamoxifen administration. Note in (B) (D) atrophy of hair follicles, sweat glands, thickening of epidermis, hyperkeratosis, dilation of blood vessels, and infiltrative changes.

DETAILED DESCRIPTION

We generated a conditional mouse, in which the phenotypes associated with the removal of exon 14 can be tested using a variety of systems. The Cre- mediated disruption of Supv3Ll driven by MxI gene promoter revealed a postnatal growth delay, reduced life span, cachexia, and severe skin abnormalities manifesting as severe ichthyosis, thickening of epidermis, and atrophy of dermis. In the tamoxifen inducible system, the Supv3Ll disruption induces growth retardation and ageing phenotypes including kyphosis, cachexia and premature death. Many of the abnormalities detectable in the Mc/-Cre mice, such as profound scaling of feet and tail, hyperkeratosis and deafness, could be also detected in tamoxifen-inducible Cre mice.

To generate mice carrying alleles of SUV3 that can be conditionally disrupted, a "knockin" gene targeting approach was employed to introduce loxP sites into the introns flanking exon 14. The targeting construct also carried the selectable marker Neo (neomycin resistance) flanked by Frt sites. ES cells were electroporated with this targeting construct and neomycin-resistant clones having correct homologous integration as determined by Southern blotting and PCR were selected. The targeted ES cell clones were expanded and injected into E3.5 blastosysts. The injected blastocysts were implanted into the uteri of pseudo-pregnant females for generation of chimeras. The male chimeras were mated with C57BL/C2J females to obtain Fl progeny. The strain carrying the germ line transmitted floxed allele (named Supv3Ll^lm2JU) was derived from two separate cell lines.

EXAMPLE 1: Construction of the targeting vector.

The genomic sequence for vector construction was derived from MICER MHPN407cl9, obtained from The Welcome Trust Sanger Institute¹⁴, the genomic part of which spans over 8.9 kb and includes exons 13 through 16 of the human SUV3 gene. The MICER plasmid was cleaved with Xhol to remove a 5.5 kb portion of the vector containing Neo resistance. The resulting plasmid, MHP407cl9ΔXhoI, was modified further by introduction of loxP sites on both sides of exon 14. The final targeting vector, p ΔXhoIFNFLlL, containing floxed exon 14 and the neo cassette flanked by Frt sites, was obtained by known recombineering methods^ls>1$ using strains SW 106 and plasmids pL451 and pL452, kindly donated by the National Cancer Institute, Frederick, Maryland, USA. See Fig. IA. The technique is well known in the art See DeBruyne et al.¹⁷

Appropriate primer pair combinations (see Table I below) allow for detection of all possible allele combinations. Primers oMR1084 and oIMR1085 were used to detect Cre allele.

Table I. Sizes of PCR products produced using different primer pair combinations

Primer PCR. product from PCR product from PCR product from PCR product from PCR product from pair wild -type allele

1+2 240 312 312

1+9 645 715 715

1+10 281 359 359

2+3 572 2552 764 363 2151

2+5 667 266

3+4 216 2128 340

3+8 186 186

3+10 619 2599 811 410 2198

4+5 241

4+6 17kb 3.6kb 1.8kb

4+7 690 2.6kb 810

6+8 1697 1697

7+8 660 660

9+5 1072 669

10+5 712 309

5+5a 2.4kb 2kb EXAMPLE 2: ES cell growth and targeting

Embryonic stem (ES) cells derived from a 12901a male embryo were grown on mitotically inactive SNL76/7 cells and used for targeting. Ten million ES cells were electroporated with 20 μg of the vector constructed in Example 1 linearized with Ascl, and G418 selection was initiated after 24 h using standard methods. Two hundred G418 resistant clones were selected for further analysis. Correctly targeted ES cell clones (see Fig. IB and 1C) were identified as described in Klysik and Singer¹⁸ and in Ramirez-Solis¹⁹.

EXAMPLE 3: Chimeric and mutant mice generation

The targeted ES cells were grown until 90% confluency and trypsinized before injection. E3.5 blastocysts were derived from C57BL/C2J female mice and injected with 12-20 ES cells as described in Pereira et al.²⁰ The injected blastocysts were implanted into the uteri of day 2.5 pseudo-pregnant females for generation of chimeras. Eight to ten injected embryos were implanted per uterine horn. The resulting male chimeras were then mated with C57BL/C2J females to obtain Fl progeny.

The strain carrying the germ line transmitted the floxed allele, which was named Supv3Ll^tm7JU (see Fig. IA)₁ was derived from two cell lines.

EXAMPLE 4: Genetic crosses

The Supv3Ll^lm2Jkl mice obtained in Example 3 were mated with B6.FVB-Tg(Ella-cre)C5379Lmgd/J mice (Jackson Laboratory, Bar Harbor, ME) to obtain Supv3Ll^tmiJkt mice (Δ14 allele), or mated with l29S4/SyJaeSoτGt(ROSA)26Sor^tmI(np'^)Dym/J (Jackson Laboratory) mice to remove the neo cassette and obtain mice carrying floxed SupvSLl¹™³™ allele. See Fig 1. The latter heterogous mice were intercrossed to generate homozygous animals carrying the floxed exon 14 (SupvSLl""³-™'"'¹*¹ mice). Likewise, heterozygous Supv3Ll^tm2M* mice were intercrossed to obtain homozygous Supv3Ll^tm2JU/tm2JU animals. Mice carrying the Supv3Ll^tm4M (ΔNeo and Δexon 14) allele were obtained by crossing heterozygous Supv3Ll^miJU mice with B6 FVB-Tg(ElIa-cre)C5379Lmgd/J mice. In the case of the Supv3Ll'^m5Jki mice (Δ14 allele) and the Supv3Ll'^m4J" (ΔNeo and Δexon 14) mice, additional backcrosses to C57BL/6 mice and genotyping was performed to eliminate Cre positive animals from further use.

The mice homozygous for Supv3Ll^tm2JU and heterozygous for interferon inducible Cre (Mc/-Cre Sup\3Ll'^m2JWtm2M) were obtained as follows: Supv3Ll'^m2JW+ mice were crossed with B6.Cg-Tg(Mr/-cre)lCgn/J strain (heterozygous)(Jackson Laboratory) and double heterozygous animals were collected. Double heterozygous mice were then mated with Supv3Ll^tmVkl/'^m2Jk' and offspring selected for A&/-Cre Supv3Ll^tm2J1d/tm2JU . These are the mice that exhibit psoriatic phenotype most profoundly. The mouse MxI gene is part of the viral defense system that is normally silent in healthy mice^21"22. Here, the MxI promoter drives the widespread expression of Cre and can be induced to high levels of transcription by administration of interferon α, interferon β, or synthetic double-stranded RNA^23*24.

The tamoxifen inducible Actb-Esrl/Cre SupvSLl""²™""²*¹ mice were generated by crossing B6.Cg-Tg(cre/Bsrl)5Amc/J mice (Jackson Laboratory) with Supv3Lr^2JWtmZJU and selecting for the Actb-Esrl/Cre Sυpv3Ll^tm2JW\ In the next step, the Actb-Esrl/Cκ SupvSLl⁰"¹™* animals were crossed with Supv3Ll^tm2Mtm2JU mice and Actb-Esrl/Cκ Stφv3Ll^t"^2JWtm2Jtt were selected. These mice exhibit psoriatic changes and ageing phenotypes (sarkopenia, kyphosis, loss of fat). Tamoxifen inducible Actb-Esrl/Cxt Supv3Ll^tm3Mtm4JU mice were generated by crossing B6.Cg-Tg(cre/Esrl)5Amc/J mice (Jackson Laboratory) with Supv3Ll'^m4MJ* and selecting for the Actb-Esrl/Cre Supv3Ll^tm4JW\ In the next step, the Actb-Esr 7/Cre Supv3Ll^tm4jm mice were crossed with Supv3Ll^tm3JUJtm3JU animals and Actb-Esrl/Cκ SupvSLl""³™⁰"⁴*¹ were selected. Thes& mice displayed psoriatic changes and ageing phenotypes (sarcopaenia, kyphosis).

EXAMPLE 5 : Genotyping

Genomic DNA was prepared from ES cells, tail biopsies, or tissues and PCR was performed using primers shown in Fig. ID. The expected sizes of PCR products are given in Table I. The amplification conditions for fragments not exceeding lkb consisted of an initial incubation at 94⁰C for 2 min, than 35 cycles at 94⁰C for 30 sec, 6O⁰C for 30 sec, and 72⁰C for 60 sec. For longer bands, the extension time at 72⁰C was adjusted to 1 min/kb. Genotyping by Southern blotting was performed using a 598bp PCR- generated probe (primers: AGTACTCAAGGCCAACTCTCCAACGCACC and TTCATGAAGACTGGCCTAAGGCAGACTTCXFig. IB).

EXAMPLE 6: Homozygous Supv3Ll^tm4ja (ΔNeoΔ14) and Sυpv3Ll^tm5Λ1

(Δ14) alleles are embryonic lethal while floxed alleles (Supv3Ll'^m2M and Supv3Lr^3JU ) can be maintained in a homozygous state. Heterozygous animals carrying Supv3Ll"^n2Jll _l Supv3Ll^tm3JU,

Supv3Ll^tm4JU and Supv3Ll'^mSM allele (Fig, IA) are normal up to 12 months of age and produce offspring with expected Mendelian distribution of genotypes in backcrosses with C57BL/6 mice. Intercrosses of Supv3U^tm2JW+ or Supv3Ll^m3JW+ males and females were performed. These intercrosses produced pups of all three genotypes at expected Mendelian ratios. The Supv3Ll^tm2Jld as well as Supv3Ll^tm}Jld alleles could be maintained in a homozygous state while gene modifications (floxing exon 14 with or without the Neo cassette) had no adverse effects to the overall health and reproduction rates. Intercrosses of SwpvJLΛ^* or Supv3Ll^w5JU/4' animals failed to produce homozygous mice, indicating embryonic lethality caused by the removal of exon 14 (see Table II and HI below). Thus, we confirmed that the Supv3Ll function is developmentally regulated and the disruption of both alleles by removing exon 14 confers an embryonic lethal phenotype.²⁰

Table II. Distribution of genotypes in offspring from intercrosses between Supv3Ll^tm5ΛV+ parents

Genotype Females Males F+M % expected

Sψv3Ll'^miJUJ* 31 34 65 64.35% 50% Sψv3Ll^tm5mm5jkl 0 0 0 0 25%

Wt 16 20 36 35.64% 25%

Total 101

X /2* = = 33.98; p<0.001 // Il Il Table III. Distribution of genotypes in offspring from intercrosses between Supv3Ll""^4Λ1/ parents

Wt 10 6 16 37.2% 25%

Total 53 X² = 14.72; p<0.001

EXAMPLE 7: Mxl-Cτe Supv3Ll^tm2JU/'^m2JU mice exhibit the psoriatic phenotype

The MXI-CK SupvSLl""¹™""¹*' animals were normal at birth and developed normally over the first two weeks of life. However, at weaning, signs of a developmental delay become apparent, manifesting through a slower growth, an abnormal appearance and density of coat hairs, and abnormally flattened and disfigured ears, as compared to WT; Supv3Ll^lmlM''; MXI-CK Supv3Ll^tm2M*\ or Supv3Ll^tm2JWtmim littermates (Fig. 2A). The feature of flattened and disfigured ears could actually be used for a convenient visual genotyping. At the age of four weeks, the MxI-Cn, Supv3Ll^tπaWtm2ΛI animals were about half the size relative to normal littermates of other genotypes (Fig. 2B and 2H). A profound scaling of the skin (ichthyosis), (Fig. 2C-D), feet (Fig. 2E), tail (Fig. 2F), and ears has developed together with alopecia (Fig. 2C-D)affecting 100% of animals at 8 weeks of age. While some of these mice become moribund at 4 weeks, other lived up to 10 weeks (Fig. 2K). At the time of. death, all displayed adipose tissue and muscular hypoplasia, cachectic appearance, and failing locomotor functions. Mild kyphosis has also been observed, particularly in longer-lived animals. Affected mice fed and drunk frequently, until moribund. The shortened lifespan of MXI-CK Supv3Ll'^m2JWtm2M mice (Fig. 2K) correlated with progressive loss of the floxed exon 14. Tail biopsies taken at the age of 16, 27 and 31 days after birth revealed partial but increasing loss of exon 14 (Fig. 21) in PCR assay. Although quantitative monitoring of the gene inactivation using PCR presents obvious limitations, it nevertheless provided clear evidence that non-induced (no poly (I-C) injections) and progressive deletion of exon 14 did occur. The MXI-CK activation could be attributed either to the MxI promoter leakage or to an endogenous influx(es) of interferon(s). The degree of leakage/endogenous interferon release and the resulting Λ£c/-Cre-mediated exon 14 removal was different in various cell types and organs, but all tissues were found to have a portion of the floxed allele deleted (Fig. 2J). Most notably, however, the skin layers of cells were found almost totally depleted of exon 14. Testes and cerebellum appeared to display lowest levels of Mic/-Cre-mediated gene damage. Pathology of deceased mice failed to reveal abnormalities pointing toward a cause of death. Since animals of other genotypes (i.e. MXI-CK Supv3LJ^lm2JW+ , SupvSLl""²*"*, Supv3Ll""^2JU/tm2JU) were normal, and because of prominent signs of starvation (adipose tissue and muscular hypoplasia, cachxia), the cumulative organ failure could be a likely cause of death in Mxl-Cτe Supv3Ll^tm2JWon2JU mice. As the greatest gene damage occurred in the skin, the pathologic changes in this organ were most early noticeable upon visual examination.

EXAMPLE 8: Stained skin sections confirm psoriatic changes in the skin Mouse tissues from the experimental and control litteπnate mice used in these studies were matched according to sex and age. Tissues were dissected out, fixed in 5% formaldehyde in PBS at 4⁰C, and embedded in paraffin. Hematoxylineosin staining was carried out by standard procedures²².

The histologic examination of skin sections revealed numerous defects, many of them consistent with psoriasis. The epidermis of MeV-Cre Supv3Ll^tm2JWtm2M mice was thickened and exhibited a severe hyperkeratosis (thickened stratum corneum) (Fig. 3B and D). The atrophy of dermis, muscle fibers, and adipose layers was evident along with a diminished number of hair follicles and sebaceous glands (Fig. 3B and C). Focal parakeratosis was readily detectable in the dorsal and abdominal skin (Fig.3C and D) and in the ear cross-sections (Fig. 4B and C). The disfigured ear tissue often revealed structures resembling rete ridges (Fig. 4B and 4C). Neutrophilic microabscesses formed in subepidermal layers of the skin (Fig. 4B) while dilated blood vessels could frequently be encountered in a dermal layer of cells (Fig. 4D).

EXAMPLE 9: Tamoxifen mediated disruption results in skin abnormalities resembling psoriasis

To test for local, 4-OH tamoxifen inducible changes in the skin, Actb- Esrl/Cre Supv3Ll^tm2JW"^n2M and Actb-Esτ\/Cn Supv3Ll^lm3Mtmm mice were used. The Actb-Esrl/Cre system utilizes a fusion Cre protein composed of Cre and a mutant form of the ligand binding domain of the estrogen receptor. The fusion protein is not able to bind a natural ligand (17 β-estradiol) but renders the estrogen receptor domain responsive to 4-OH tamoxifen²⁴. The fusion of Cre with estrogen receptor domain causes the cytoplasmic sequestration of Cre by Hsp90^27'28 to prevent Cre-mediated recombination in the nucleus. However, upon exposure to 4-OH tamoxifen, the ligand responsive estrogen receptor domain and Hsp90 interaction is disrupted, permitting for migration of the fusion Cre protein to the nucleus and initiation of recombination. In the Actb-Esτl/Cκ system, the 4-OH tamoxifen responsive Cre fusion protein operates under a chimeric promoter/enhancer of the cytomegalovirus immediate-early enhancer and the chicken-globin promoter/enhancer (Actb) that ensures a widespread spatial expression in adult and embryonal tissues²⁹.

The transgenic mice B6.Cg-Tg(cre/Esrl)5Amc/J (Jackson Laboratories)²⁹ were used in genetic crosses to generate Λc/δ-Esrl/Cre, Supv3Ll^tm2JU/tm2M and Λcri-Esrl/Cre Supv3Ll^tm3JUJtm4Jkl animals, and provided for a tamoxifen-inducible Cre-mediated recombination system. To assess changes inducible by topical application of 4-OH tamoxifen, the drug was applied on the shaved back skin, a site which is not easily accessible to the animal for self-grooming, scratching and mechanical irritation. Mice were separated from their Iittermates and kept individually for the duration of the experiment.

4-OH tamoxifen (Sigma) was prepared in ethanol at concentration of 5 mg/ml. 40 μl was applied daily for 10 days on a shaved surface of the back skin. For SQ injections, tamoxifen (Sigma) was-dissolved overnight in corn oil (Sigma) at the concentration of 20 mg/ml. The subcutaneous administration schedule consisted of five consecutive daily injections of 0.05 mg/gram of body weight.

Several days after completion of the topical 4-OH tamoxifen treatment schedule, visually noticeable erythromatous reaction and scaling has developed at the application site in Actb-Cxt Supv3Ll^ln2JU/tmVU and Actb-Esrl/Cre SupvSLl⁰"³™⁰"⁴-™ animals but not in Λctf-Esrl/Cre Sυpv3U^tm2JU/* and Λc/6-Esrl/Cre Supv3Ll^lm3JkV+ (control) mice. In the skin biopsies taken for analysis, exon 14 of the Supv3Ll gene was efficiently removed (Fig. 5G). The subcutaneous vasculature was more eminent in the Actb-Esrl/Cre Supv3Ll"^n2M/lmlJk' skin relative to the control skin (Fig. 5E and F). The H&E staining revealed that in the skin form animals carrying both floxed alleles epidermis was thickened, heperkeratotic, parakeratotic, while blood vessels were dilated relative to Aclb-Esτ\/Cτe ->«pv3Z,/^(mZΛy+ skin (Fig. 5B and Fig 5D). However, the hair follicle and sebaceous glands loss was not detectable at this stage. This response was indistinguishable between Actb-Cκ Supv3Ll""^2JW"^n2JU and Actb- Esrl/Cre Supv3Ll^tmiM""^m animals (therefore unrelated to the presence or absence of the Neo cassette (not shown)).

Over time, further phenotypic changes have occurred. The Actb- Esrl/Cre Supv3Ll""^3M/tm4Jki mice continued to lose weight (Fig. 51), eventually becoming sarcopaenicβ, kyphotic (Fig. 5H), and occasionally ataxic, within 20 days after completion of the drug application schedule. The gene inactivation appeared to be close to complete in most tissues (Fig. 5 J). In Actb-Cκ Supv3Ll^tm2JUItm2JU animals these farther changes developed somewhat slower, likely due to the presence of two floxed alleles and slower kinetics of complete gene inactivation (not shown).

EXAMPLE 10: Subcutaneous injection of tamoxifen leads to cachexia, kyposis, and skin defects.

The effects of subcutaneous administration of tamoxifen were tested using Λc/6-Esrl/Cre Supv3Ll^tm2JU/tm2ΛI and Λcfδ-Esrl/Cre SupvSLl*"²™* (control) animals at the age of 4 weeks. For subcutaneous injections, tamoxifen was dissolved overnight in corn oil (Sigma) at a concentration of 20 mg/ml. The administration schedule consisted of five consecutive daily injections of 0.05 mg/gram of body weight. Dramatic changes in growth, adipose tissue loss, muscle tissue loss (sarcopaenia) and body weight loss was evident in Actb-Esrl/Cτe Supv3Ll^tm2JWm2Jil but not Λc/6-Esrl/Cre Supv3Ll^tm2M/+ (control) animals. These changes occurred within 8 weeks after the completion of the injection schedule. The dystrophic muscles (Fig. 6A and B) and general cachexia lead to a decline in locomotor functions. A multiple organ failure was likely responsible for moribund appearance and death that occurred within 2 months after tamoxifen administration. One of the prominent futures of the subcutaneous tamoxifen-induced inactivation oϊSupv3Ll was the spinal deformity (kyphosis) (Fig. 6A and B), loss of adipose tissue and sarcopenia (Fig. 6B). The development of scales was detectable on limbs (Fig. 6C) and tails (Fig. 6D), although the body skin revealed a mild hyperkeratosis only (data not shown). The gene inactivation was widespread and almost complete (over 90% conversion into Δ14) throughout different organs, including skin (Fig. 6E). The largest fraction of intact (floxed) Supv3Ll allele remained in liver, spleen, lungs, duodenum and testes. The control animals (different by carrying one wild-type allele), displayed no tamoxifen-inducible phenotype, but measurably greater loss of the floxed allele. This result rises the possibility that, in Λc/6-Esrl/Cre Supv3U^m2M/tm2J" mice, a possible replacement of dying cells from a pool of unaffected stem cells (homozygous or heterozygous for exon 14), may have occurred, particularly in the spleen and liver.

Histopathology of skin samples isolated from the tamoxifen induced Λcri-Esrl/Cre Supv3Ll^m2JWtm2Jii and Λcrδ-Esrl/Cre SupvSLl'"'²™* (control) mice was different relative to untreated animals and revealed fewer sebaceous glands, mild hyperkeratosis, acanthosis, hypergranulosis, as sell as increased apoptosis in the basal layer of cells. Focal vascular ectasia was evident along with an absence of adipose tissue and a greatly atrophic muscle layer. Microscopic abscesses and mild dermal acute and chronic inflammation changes were apparent. In the lung, changes such as interstitial thickening with chronic and acute inflammation and focal accumulation of foamy macrophages were found. Although no obvious histological changes could be detected in the duodenum, substantially elevated levels of apoptosis were evident In the Λcώ-Esrl/Cre Supv3Ll^tm2JWtmim mice relative to the control mice. Subcutaneous delivery of tamoxifen did not result in detectable alopecia.

EXAMPLE 11: Keratinocyte-specific Supv3Ll disruption induces skin defects

Although important in several tissues such as epithelia of the tongue, mouth, esophagus, forestomach, and the thymic epithelium, the keratin 14 (KRT 14) gene is primarily expressed in keratinocytes and for that reason the KRT14 promoter is widely used to drive expression of various genes in the epidermis.⁴⁴ KRT14- Cre/Esrl Supv3Ll^Un3JW"^n4JU mice were created using the Tg(KRT 14-Cre/Esrl)20Efu/J strain of mice.⁴⁵ These mice carry a KRTl 4-driven transgene encoding Cre/Esrl . Thus, upon tamoxifen administration, disruption of the SupvLl gene in KRT14- Cre/Esrl SupvLl^tm3JU/tm4JU mice can be achieved primarily in the epidermal layer of cells.

KRT14-Cre^Esrl SupvLl'^m}JW'^m4JU mice and KRT14-Cre/Esrl SupvLl'^m3Jkl* mice at 5 weeks of age were injected subcutaneously with tamoxifen. Three weeks later, the KRT14-Cre/Esrl SupvLl'^m3mm4M mice showed disfiguring, erythromatous swelling of the ears while control animals appeared normal. H&E stained cross-sections of ear biopsies taken from a control mouse showed no apparent changes due to tamoxifen administration. See Fig 10 panels A and C. In contrast, ear biopsies form injected KRT14-Cre/Esrl SupvLl""^iMtmm mice revealed disfiguring lesions along with hyperkeratosis, acanthosis, parakeratosis and scaling. See Fig. 8 panels B and D. The epidermis was thickened, while dermal layer showed signs of chromic inflammation marked by apoptosis and the presence of focal intraepithelial lymphocyte infiltrates. Dilated blood vessels were readily detectable. KRT14-Cre/Esrl SupvLl""^3Mtm4M mice however, did not suffer from loss of fat, muscle mass, body weight, or body hair loss for at least three months after tamoxifen administration , and no other pathological changes could be detected within this time frame. Relative to the ears, the above changes were less pronounced in body skin. Since the keratinocyte-restricted Supv3Ll disruption leads to dramatic changes such as hyperkeratosis, scaling, and infiltrative immune responses without apparent effect on other organ systems, Supv3Ll function is critical for maintenance and proper function of the epidermis.

DISCUSSION

The Supv3Ll gene is indispensable in mammalian development and mouse embryos carrying homozygous insertional mutation die in utero before mid- gestation . Here, we confirmed previous findings and found that the deletion of exon 14-constitutes a recessive mutation that leads to embryonic lethal phenotype in homozygous mutants, while heterozygous animals are normal and indistinguishable from their wild-type littermates for the first 12 months of life. We combined the floxed allele with three different Cre driver systems: two of them (MxI -Cre and Actb- Esrl/Cre) provided widespread gene inactivation patterns, while the third one (KRT14-Cre/Esrl) was limited mostly to keratinocytes. In the Mxl-Cre system, the most striking phenotype of conditional knockout mutant mice (Mx/-Cre Supv3Ll"^n2JWlm2Jkl) was the numerous skin abnormalities and growth retardation leading to a short statue. The very characteristic flattening (and later deformities) of ears could be applied with a great precision for visual genotyping at a very early age (2-3 weeks). Severe alopecia and mild kyphosis was observed in mice that survived to an age of 2 months. The profound scaling could be noted in the skin, feet, tails and ears. Hyperkeratosis and focal parakeratosis was readily detectable in the skin and ear cross-sections, along with abnormally thickened epidermis suggesting epidermal hyper-proliferative reaction. Microabscesses were not frequent but occasionally evident. The exon 14 removal was progressive and an almost complete loss of it had occurred in the skin, while in other tissues a variable degree of Supv3Ll damage was detectable. Consistently, the earliest and greatest changes were seen in the skin.

One intriguing question is the mechanism by which the ΛΛ7-driven Cre expression, and therefore gene inactivation, was induced in these animals. The MxI gene belongs to a class of mouse influenza virus resistance loci that are silent in healthy animals but produce abundant proteins several days after IFN induction . The reported spatial pattern of Mri-driven Cre expression was greatest in liver, spleen and hematopoetic cells (near 100%) and somewhat lower in kidney, heart, and lung . Our Mt/-Cre SupviLl⁰"¹¹™""¹*¹ mice were thus expected to express Cre recombinase (to damage the βoxed gene) upon induction with interferon or (pI-pC) . Unexpectedly, we found that the induction was not necessary. The "self-induced" Cre expression was sufficient to produce profound pathological changes, which ultimately lead to death. The origin of endogenous mechanisms that lead to MXI-CK induction is not clear. The non-induced Cre expression could result from a combination of nonspecific factors (intrinsic leakage) and endogenous influxes of interferons taking place predominantly within the skin. Epidermis is the body's main barrier to environmental insult. Epidermal hyperplasia often arises due to the innate immune response involving a- variety of cytokines. Many of the symptoms seen in^our Mϊ/-Cre Sup\2Ll^tm2JWun2ja mice resemble those commonly found in psoriasis models (thickening of epidermis, hyperkeratosis, parakeratosis, prominent scaling, microabscesses, alopecia, shortened life span and skin disfiguring lesions) ' .

Such skin changes are believed to be driven by a mix leukocytic infiltrate composed of activated T lymphocytes, neutrophils and macrophages. Cytokines such as TNFα and ILl³⁴, IFN-γ³"⁶, IL-6^{37 38}, IL-8³⁹, vascular endothelial growth factor (VEGF)⁴⁰ and transforming growth factor-alpha (TGF-β) are thought to mediate psoriatic tissue alterations. Although, the involvement of innate immunologic mechanisms and their role in phenotypic changes observed in MXI-CK

mice remains to be determined, it is likely that the immune cells augment the Supv3Ll inactivation by supplying the Mr/-Cre-inducing cytokines to the skin cells.

Similar to Mxl-Cre, in the Actb-Esrl/Cre system sufficient deletion of floxed Supv3Ll occurred in the absence of exogenous induction with tamoxifen to elicit pronounced phenotypes and eventually death. The gross phenotypic changes included kyphosis, sarcopenia, complete loss of fat tissue, thymic atrophy, and atrophic changes in the skin. Administration of tamoxifen by subcutaneous injection significantly accelerated and exacerbated the development of phenotypes such as growth retardation, adipose tissue and muscle mass loss, which contributed to cachectic appearance at the time of death. Severe kyphosis developed within several weeks after drug administration. Scaling was prominent on feet and tails, a phenotype that was seen in the Mxl-Cre mice but did not appear in Λcfδ-Esrl/Cre Stφv3U"^n2M/""^2J" or Λcfδ-Esrl/Cre Supv3Ll^lm3M'^m4JU mice without tamoxifen administration. In the body skin, mild hyperkeratosis was seen after induction of Cre, while no hyperkeratosis was seen in the absence of tamoxifen. In contrast, when 4- hydroxy tamoxifen was applied topically to shaved backs of animals, severe skin phenotypes developed. The topical (local) application of 4-OH tamoxifen in Actb- Esrl/Cre Sυpv3Ll^tm2MJUn2Jkl and Λcffc-Esrl/Cre Sup\3Ll^tm3Mtm4JU mice efficiently removed exon 14 of Supv3Ll resulting in the skin changes similar to those seen in Mx-Cre system, including skin abnormalities such as hyperkeratosis, parakeratosis, thickened epidermis and dermal and subcutaneous dilation of blood vessels. Certain phenotypic differences, however, could be noted when the two delivery routes of the drug are compared (topical vs subcutaneous). For example, subcutaneous injected mice develop scaling -of feet and tails, while topically applied 4-OH tamoxifen- produced no such changes. The differences in the severity of the skin phenotypes elicited by different methods of Cre induction may be related to the corresponding spatial and temporal efficiencies of floxed allele deletion. In addition defects in innate immune functions, for example, occurring in the spleen and thymus due to Supv3Ll deletion, and their subsequent effects on the responses manifested in the skin cou.d also contribute to phenotypic differences.

The development of hallmarks of ageing such as sarcopaenia and kyphosis can be achieved using either delivery route of the inducing drug, although the dynamics of the premature ageing phenotype development was not identical and could be explained by the different kinetics of the exon 14 removal. Finally, when the same delivery route was applied, the induction of Supv3Ll disruption in mice with somewhat different genotypes (i.e. Actb-Esrl/Cre Supv3Ll'^m2M/"^n2Jkl and Actb- Esrl/CreSMpv3I7'^mλΛi/'^m^^wmice) have lead to similar changes.

Keratinocyte-restricted Supv3Ll ablation recapitulated, to a significant, extent, the skin phenotypes elicited in the Mxl-Cre and Actb-Esrl/Cre systems, such as ear lesions, hyperkeratosis, scaling, thickening of epidermis, dilation of blood vessels and Neutrophilic infiltration. Since other organs did not suffer Supv3Ll deletion, gross systemic phenotypes were not observed. The KRT14- Cre/Esrl system thus reinforces the notion that Sup3Ll activity in the epidermis is important and necessary for the maintenance of its protective barrier function. Taken together, the results obtained with all three Cre-induced ablation systems strongly implicated Supv3Ll in the maintenance of normal and healthy skin function. Compromised Supv3Ll helicase activity appears to be a contributor in debilitating skin diseases such as psoriasis and forms of ichthyoisis of unknown etiology. All patents, publications, and other references cited herein are hereby incorporated by reference. Although the invention has been particularly described with reference to certain preferred embodiments, skilled artisans appreciate that changes in form and details may be made without departing from the scope of the appended claims.

REFERENCES

1. Griffiths and Barker, "Psoriasis 1: Pathogenesis and clinical features of psoriasis," The Lancet 370:263-71 (21 JuI 2007).

2. Schon, "Animal Models of Psoriasis - What Can We Learn from Them?" J. Investigative Dermatology 112:405- 10 (4 Apr 1999).

3. Nickoloff and Nestle, "Recent insights into the immunopathogenesis of psoriasis provide new therapeutic opportunities," J. Clin. Invest. /75:1664-75 (June 2004).

4. Zenz et al., "Psoriasis-like skin disease and arthritis caused by inducible epidermal deletion of Jun proteins," Nature 437:369-75 (15 Sep 2005).

5. Xia et al., "Transgenic delivery of VEGF to mouse skin leads to an inflammatory condition resembling human psoriasis," Blood /02:161-68 (1 JuI 2003).

6. Conrad et al., "αβ integrin is crucial for accumulation of epidermal T cells and the development of psoriasis," Nature Medicine /3:836-42 (JuI

2007).

7. deBoer et al., "A mouse model for the basal transcription/DNA repair syndrome trichothiodystrophy," MoI Cell 1(7): 981-90 (1998).

8. Sun et al., "Growth retardation and premature aging phenotypes in mice with disruption of the SNF2-like gene, PASG," Genes Dev 18(9): 1035-36

(2004).

9. Stepien, et al., "The yeast nuclear gene suv3 affecting mitochondrial post-transcriptional processes encodes a putative ATP-dependent RNA helicase," Proc. Natl. Acad. ScL USA: 89:6813-17 (1992). 10. Margossian, et al., "The DExH box protein Suv3p is a component of a yeast mitochondrial 3'-to-5' exoribonuclease that suppresses group I intron toxicity," Cell 84: 199-209 (1996).

11. Dziembowski, et al., "The yeast mitochondrial degradosome. Its composition, interplay between RNA helicase and RNase activities and the role in mitochondrial RNA metabolism," J. Biol Chent. 278: 1603- 11 (2003).

12. Shu, et al., Purified human SUV3p exhibits multiple-substrate unwinding activity upon conformation change," Biochemistry 43:47% 1- 90 (2004).

13. MInczuk, et al., Localisation of the human hSuv3p helicase in the mitochondrial matrix and its preferential unwinding of dsDNA," Nucleic Acids Res. 30:5074-86 (2002).

14. Adams, et al., "Mutagenic inseπion and chromosome engineering resource (MlCER"), Na/ Genet, 36(8):S61-ll (2004).

15. Liu et al., "A highly efficient recombineering-based method for generating conditional knockout mutations," Genome Res.13(3):416-Z4 (2003). 16. Warming et al., "Simple and highly efficient BAC recombineering using galK selection," Nucleic Acids Res 33(4): e36 (2005).

17. DeBruyne et al., "A Clock Shock: Mouse CLOCK is Not Required for Circadian Oscillator Function," Neuron 50: 465-77 (2006).

18. Klysik and Singer, "Mice with the enhanced green fluorescent protein gen knocked in to chromosome 11 exhibit normal transmission ratios," Biochem.

Genet. 43: 321-33 (2005).

19. Ramirez-Solis et al., "Chromosome engineering in mice," Nature 378: 720-24 (1995).

20. Pereira et al., "Interaction of human SUV3 RNA/DNA helicase with BLM helicase: loss of the SUV3 gene results in mouse embryonic lethality," Mechanisms of Aging and Dev., (2007), doi:10.1016/j.mad.2007.09.001 (in press). 21. Arnheiter et al., "Transgenic mice with intracellular immunity to influenza virus," Cell 62(1): 51-61 (1990). 22. Horisberger and De Staritzky, "Expression and stability of the Mx protein in different tissues of mice, in response to interferon inducers or to influenza virus infection," J Interferon Res 9 (5): 583-90 (1989).

23. Kuhn et al., "Inducible gene targeting in mice," Science 269(5229): 1427-9 (1995). 24. Schneider et al., "Differential, inducible gene targeting in renal epithelia, vascular endothelium, and viscera of MxlCre mice," Am J Physiol Renal Physiol 284(2): F411-7 (2003).

24. Littlewood et al., "A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins," Nucleic Acids Res 23(10): 1686-90 (1995).

25. Fawell et al., "Characterization and colocalization of steroid binding and dimerization activities in the mouse estrogen receptor," Cell 60(6): 953-62 (1990).

26. Danielian et al., "Modification of gene activity in mouse embryos in utero by a tamoxifen-inducible form of Cre recombinase, Curr Biol 8

(24): 1323-6 (1998).

27. Picard, "Regulation of protein function through expression of chimaeric proteins," Curr Opin Biotechnol 5(5): 51 1-5 (1994).

28. Mattioni et al., Regulation of protein activities by fusion to steroid binding domains," Methods Cell Biol 43 PtA: 335-52 (1994).

29. Hayashi and McMahon, "Efficient recombination in diverse tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated gene activation/inactivation in the mouse," Dev Biol 244(2): 305-18 (2002).

30. Boehncke and Schon, "Animal models of psoriasis," Clin Dermatol 25(6): 596-605 (2007).

31. Gudjonsson et al., "Mouse models of psoriasis," J Invest Dermatol 127(6):\292-30i (2001).

32. Xia et al., "Effects of keratinocyte growth factor-2 (KGF-2) on wound healing in an ischaemia-impaired rabbit ear moHel and on scar formation," J Pathol 188(4): 431-8.

33. Copland et al., "Recombineering: a powerful new tool for mouse functional genomics," Nat Rev Genet. 2(10):769-79 (2001).

34. Kupper et al.,"Immune and inflammatory processes in cutaneous tissues. Mechanisms and speculations," J Clin Invest 86(6): 1783-9 (1990). 35. Barker et al., "Detection of interferon-gamma mRNA in psoriatic epidermis by polymerase chain reaction," J Dermatol Sci 2(2): 106-11 (1991).

36. Livden et al., "In situ localization of interferons in psoriatic lesions,". Arch Dermatol Res 281(6): 392-7 (1989).

37. Neuner et al., "Increased IL-6 production by monocytes and keratinocytes in patients with psoriasis," J Invest Dermatol 97(1): 27-33 (1991).

38. Grossman et al., "Interleukin 6 is expressed in high levels in psoriatic skin and stimulates proliferation of cultured human keratinocytes," Proc Natl Acad Sci U S A, 86(16): 6367-71 (1989). 39. Barker et al., "Modulation of keratinocyte-derived interleukin-8 which is chembtactic for neutrophils and T lymphocytes," Am J Pathol 139(4): 869-76 (1991).

40. Detmar et al., "Overexpression of vascular permeability factor/vascular endothelial growth factor and its receptors in psoriasis," J Exp Med 180(3):

1141-6 (1994).

41. Prinz et al., "T cell clones from psoriasis skin lesions can promote keratinocyte proliferation in vitro via secreted products," Eur J Immunol 24(3): 593-8 (1994). 42. Elder et al., "Overexpression of transforming growth factor alpha in psoriatic epidermis," Science 243(4892): 811-4 (1989). 43. Gottlieb et al., "Detection of transforming growth factor alpha in normal, malignant, and hyperproliferative human keratinocytes," J Exp Med

167(2): 670-5 (1988). 44. Wang et al., "Transgenic studies with a keratin promoter-driven growth hormone transgene: prospects for gene therapy." Proc Natl Acad Sci 94:

219-26 (1997). 45. Vasioukhin et al., "The magical touch: genome targeting in epidermal stem cells induced by tamoxiven application to mouse skin," Proc Natl Acad Sci 96: 8551-56 (1999).

Claims

Claims:

1. A non-human animal model for psoriasis, psoriatic conditions or disorders comprising a genetically modified, non-human animal whose genome includes a disruption of a gene encoding a helicase, as a result of which the mammal is predisposed to exhibition of a psoriatic phenotype.

2. The model according to claim 1 wherein the disruption damages the gene in the skin first while other tissues function normally for a longer period of time.

3. The model according to claim 2 wherein the disruption is a conditional disruption.

4. The model according to claim 3 wherein the helicase encoding gene is SUVS.

5. The model according to claim 4 where both alleles of the gene are disrupted.

6. The model according to claim 5 wherein both alleles of the same exon of

SUVS is disrupted.

7. The model according to claim 6 wherein the exon is exon 14.

8. The model according to claim 7 wherein exon 14 of the SUV3 gene is floxed.

9. The model according to claim 8 wherein the conditional disruption is Cre recombinase induced.

10. The model according to claim 9 wherein the animal is a pig, sheep, or rodent

11. The model according to claim 10 wherein the rodent is a mouse.

12. A non-human animal model for psoriasis, psoriatic conditions or disorders comprising a genetically modified, non-human animal whose genome includes a conditional disruption of a gene encoding a helicase, as a result of which the mammal is predisposed to exhibition of a psoriatic phenotype.

13. The model according to claim 12 wherein the helicase encoding gene is SUV3.

14. The model according to claim 13 wherein an exon of SUV3 is disrupted.

15. The model according to claim 14 wherein the exon is exon 14.

16. The model according to claim 15, wherein exon 14 of both alleles of the gene are conditionally disrupted.

17. The model according to claim 16 wherein exon 14 of the SUV3 gene is floxed and the conditional disruption is Cre recombinase induced.

18. The model according to claim 17 wherein the animal is a pig, sheep, or rodent.

19. The model according to claim 18 wherein the rodent is a mouse.

20. A mouse model for psoriasis, psoriatic conditions or disorders comprising a genetically modified, non-human animal whose genome includes a conditional disruption of both alleles of the gene encoding exon 14 of SUV3 helicase, as a result of which the mammal is predisposed to exhibition of a psoriatic phenotype.

21. A cell line established from a genetically modified non-human animal of claim 1, claiml2 or claim 20.

22. A non-human ES cell in which SUV3 gene expression is artificially suppressed.

23. A non-human ES cell in which SUV3 expression is conditionally disrupted.

24. The ES cell according to claim 22 or claim 23 in which exon 14 of the SUV3 gene is deleted.

25. The ES cell according to claim 24 wherein the ES cell is a rodent ES cell.

26. The ES cell according to claim 25 wherein the rodent is a mouse.

27. A method for identifying compounds suitable for treatment or prophylasis of psoriatic conditions or disorders or their complications in humans comprising the steps of (a) providing a collections of compounds or compositions to be tested in the psoriatic animal model of claims 1-3, (b) administering the compounds or compositions of the collection to the model animal having the conditional disruption in its Suv3 gene that leads to the psoriatic phenotype, (c) assessing the effect of the compound or composition administered on the animal; and (d) identifying the compounds or compositions in the collection that modulate the expression of the psoriatic phenotype.

28. The method according to claim 27 wherein the assessing step (c) is conducted by scoring the skin response in the psoriatic phenotype expressing animals administered the drugs as compared to control psoriatic phenotype expressing animals.