WO2009094726A1

WO2009094726A1 - Plasmodial polynucleotides, proteins and uses thereof

Info

Publication number: WO2009094726A1
Application number: PCT/AU2009/000115
Authority: WO
Inventors: Alan Cowman; James Beeson; Alexander Gerd Maier
Original assignee: The Walter And Eliza Hall Institute Of Medical Research
Priority date: 2008-02-01
Filing date: 2009-01-30
Publication date: 2009-08-06

Abstract

The present invention relates to vaccines for the treatment and prevention of malaria. In particular the invention provides Plasmodium molecules involved in remodelling of the Plasmodium falciparum infected erythrocyte.

Description

PLASMODIAL POLYNUCLEOTIDES, PROTEINS AND USES THEREOF

FIELD OF THE INVENTION

BACKGROUND

Human malaria is caused by infection with protozoan parasites of the genus Plasmodium. Four species are known to cause human disease: Plasmodium falciparum, Plasmodium malariae, Plasmodium ovale and Plasmodium vivax. However, Plasmodium falciparum is responsible for the majority of severe disease and death. Recent estimates of the annual number of clinical malaria cases worldwide range from 214 to 397 million (World Health Organization. The world health report 2002: reducing risks, promoting healthy life. Geneva: World Health Organization, 2002; Breman et al (2004) American Journal of Tropical Medicine and Hygiene 71 Suppl 2:1-15.), although a higher estimate of 515 million (range 300 to 660 million) clinical cases of Plasmodium falciparum in 2002 has been proposed (Snow et al. (2004) American Journal of Tropical Medicine and Hygiene 71 (Suppl 2):16-24). Annual mortality (nearly all from Plasmodium falciparum malaria) is thought to be around 1.1 million (World Health Organization. The world health report 2002: reducing risks, promoting healthy life. Geneva: World Health Organization, 2002; Breman et al (2004) American Journal of Tropical Medicine and Hygiene 71 Suppl 2:1-15.). Malaria also significantly increases the risk of childhood death from other causes (Snow et al. (2004) American Journal of Tropical Medicine and Hygiene 71 Suppl 2:16-24). Almost half of the world's population lives in areas where they are exposed to risk of malaria (Hay et al (2004) Lancet Infectious Diseases 4(6):327-36), and the increasing number of visitors to endemic areas are also at risk. Despite continued efforts to control malaria, it remains a major health problem in many regions of the world, and new ways to prevent and/or treat the disease are urgently needed.

Early optimism for vaccines based on malarial proteins (so called subunit vaccines) has been tempered over the last two decades as the problems caused by allelic polymorphism and antigenic variation, original antigenic sin, and the difficulty of generating high levels of durable immunity emerged, and with the limited success achieved to date with protein-based vaccines and the recognition that cell mediated immunity may be critical to protection against hepatic and perhaps blood stages of the parasite has led to a push for DNA and vectored vaccines, which generate relatively strong cell mediated immunity. To date DNA vaccines have demonstrated poor efficacy in humans with respect to antibody induction (Wang et al. (2001 ) PNAS 98: 10817-10822).

To be effective, a malaria vaccine could prevent infection altogether or mitigate against severe disease and death in those who become infected despite vaccination. Four stages of the malaria parasite's life cycle have been the targets of vaccine development efforts. In brief, the lifecycle of Plasmodium falciparum commences when haploid sporozoites are injected into the human host by an infected female Anopheles mosquito taking a blood meal. The sporozoites invade hepatocytes in the liver and undergo schizogony (asexual division), resulting in the production of large numbers of merozoites. These merozoites subsequently invade red blood cells and undergo maturation within the erythrocyte through the ring, trophozoite and schizont stages. Merozoites are then released upon rupture of the erythrocyte to reinvade other, uninfected, red blood cells. This asexual replication may then be repeated or sexual differentiation may occur to form immature macro- (female) and micro- gametocytes (male). The exoerythrocytic mature macro- and micro-gametocytes are taken up by a feeding mosquito, signifying the beginning of the sexual lifecycle within the mosquito. Within the mosquito, the microgametocyte undergoes rapid DNA replication followed by cell division, resulting in the formation of flagellated cells. These flagellated cells invade the macrogametocyte to form the diploid zygote that subsequently undergoes meiosis and develops into the ookinete. The ookinete embeds itself in the mosquito midgut wall, becoming an oocyst that undergoes sporogony resulting in the production of large numbers of haploid sporozoites that migrate to the salivary glands of the mosquito. Sporozoites are then injected into a new human host during feeding of the mosquito vector.

The first two life cycle stages are often grouped as 'pre-erythrocytic stages' (i.e. before the parasite invades the human red blood cells): these are the sporozoites inoculated by the mosquito into the human bloodstream, and the parasites developing inside human liver cells (hepatocytes). The other two targets are the stage when the parasite is invading or growing in the red blood cells (the asexual stage); and the gametocyte stage, when the parasites emerge from red blood cells and fuse to form a zygote inside the mosquito vector (gametocyte, gamete, or sexual stage). Vaccines based on the pre-erythrocytic stages usually aim to completely prevent infection. For asexual, blood stage vaccines, because the level of parasitaemia is in general proportional to the severity of disease (Miller, et al. (1994) Science 264, 1878-1883), vaccines aim to reduce or eliminate (e.g. induce sterile immunity) the parasite load once a person has been infected. However, most adults in malaria-endemic settings are clinically immune (e.g. do not suffer symptoms associated with malaria), but have parasites at low density in their blood. Gametocyte vaccines aim towards preventing the parasite being transmitted to others through mosquitoes. Ideally, a vaccine effective at all these parasite stages is desirable (Richie and Saul, Nature. (2002) 415(6872):694-701 ).

The SPf66 vaccine (Patorroyo et al. (1988) Nature 332:158-161 ) is a synthetic hybrid peptide polymer containing amino acid sequences derived from three Plasmodium falciparum asexual blood stage proteins (83, 55, and 35 kilodaltons; the 83 kD protein corresponding to merozoite surface protein (MSP)-I ) linked by repeat sequences from a protein found on the Plasmodium falciparum sporozoite surface (circumsporozoite protein). Therefore it is technically a multistage vaccine. SPf66 was one of the first types of vaccine to be tested in randomized controlled trials in endemic areas and is the vaccine that has undergone the most extensive field testing to date. While having marginal efficacy in four trials in South America (Valero et al. (1993) Lancet 341 (8847):705-10. Valero et al. (1996) Lancet 348(9029):701-7; Sempertegui et al. (1994) Vaccine 12(4):337-42; Urdaneta et al. (1998) American Journal of Tropical Medicine and Hygiene 58(3):378-85.), these trials suggested a slightly elevated incidence of Plasmodium vivax in the vaccine groups. The vaccine has also been demonstrated to be ineffective for reducing new malaria episodes, malaria prevalence, or serious outcomes (severe morbidity and mortality) in Africa (Alonso et al. Lancet 1994;344(8931 ):1175-81 and Alonso et al Vaccine 12(2):181-6); D'Alessandro et al. (1995) Lancet 346(8973):462-7.; Leach et al. (1995) Parasite Immunology 1995; 17(8): 441-4.; Masinde et al. (1998) American Journal of Tropical Medicine and Hygiene 59(4):600-5; Acosta 1999 Tropical Medicine and International Health 1999;4(5):368-76) and Asia (Nosten et al. (1996) Lancet; 348(9029):701-7.), and is consequently no longer being tested.

Four types of pre-erythrocytic vaccines (CS-NANP; CS102; RTS₁S; and ME-TRAP) have been trialled. The CS-NANP-based pre-erythrocytic vaccines were the first to be tested, beginning in the 1980s. The vaccines used in the first trials comprised three different formulations of the four amino acid B cell epitope NANP, which is present as multiple repeats in the circumsporozoite protein covering the surface of the sporozoites of Plasmodium falciparum. The number of NANP repeats in these vaccines varied from three to 19, and three different carrier proteins were used. The CS-NANP epitope alone appears to be ineffective in a vaccine, with no evidence for effectiveness of CS-NANP vaccines in three trials (Guiguemde et al. (1990) Bulletin de Ia Societe de Pathologie Exotique 83(2):217-27; Brown et al. (1994) Vaccine 12(2):102-7; Sherwood et al. (1996) Vaccine 14(8):817-27).

The CS102 vaccine is also based on the sporozoite CS protein, but it does not include the NANP epitope. It is a synthetic peptide consisting of a stretch of 102 amino acids containing T-cell epitopes from the C-terminal end of the molecule. All 14 participants in this small trial of non-immune individuals had malaria infection as detectable by PCR (Genton et al. (2005) Acta Tropica Suppl 95:84).

The RTS₁S recombinant vaccine also includes the NANP epitope. It contains 19 NANP repeats plus the C terminus of the CS protein fused to hepatitis B surface antigen (HBsAg), expressed together with un-fused HBsAg in yeast. The resulting construct is formulated with the adjuvant ASO2/A. Thus the vaccine contains a large portion of the CS protein in addition to the NANP region, as well as the hepatitis B carrier. The RTS₁S pre-erythrocytic vaccine has shown some modest efficacy, in particular with regard to prevention of severe malaria in children and duration of protection of 18 months (Kester et al. (2001 ) Journal of Infectious Diseases 2001 ;183(4):640-7.1 ; Bojang et al. (2001 ) Lancet 358(9297): 1927-34; Alonso et al.

(2005) Lancet 366(9502):2012 Alonso et al. (2005) Lancet 366(9502):2012-8), Bojang et al. (2005) Vaccine 23(32):4148-57). In four trials, it was effective in preventing a significant number of clinical malaria episodes, including good protection against severe malaria in children, with no serious adverse effects (Graves et al.

(2006) Cochrane Database of Systematic Reviews 4: CD006199). The RTS₁S vaccine has shown significant efficacy against both experimental challenge (in non-immunes) and natural challenge (in participants living in endemic areas) with malaria. Although no evidence was found for efficacy of RTS₁S against clinical malaria in adults in The Gambia in the first year of follow up, efficacy was observed in the second year after immunization, after a booster dose. However, there was no reduction in parasite densities (which positively associate with pathology). Nonetheless, in a recent study in Mozambique, the vaccine appeared to have efficacy in infants (Aponte et al. (2007) 370(9598) 1543-1551 ).

The ME-TRAP pre-erythrocytic vaccine is a DNA vaccine that uses the prime boost approach to immunization. It uses a malaria DNA sequence known as ME (multiple epitope)-TRAP (thrombospondin-related protein). The ME string contains 15 T-cell epitopes, 14 of which stimulate CD8 T-cells and the other of which stimulates CD4 T- cells, plus two B-cell epitopes from six pre-erythrocytic antigens of Plasmodium falciparum. It also contains two non-malarial CD4 T-cell epitopes and is fused in frame to the TRAP sequence. This sequence is given first as DNA (two doses) followed by one dose of the same DNA sequence in the viral vector MVA (modified vaccinia virus Ankara). There was no evidence for effectiveness of ME-TRAP vaccine in preventing new infections or clinical malaria episodes, and the vaccine did not reduce the density of parasites or increase mean packed cell volume (a measure of anaemia) in semi- immune adult males (Moorthy et al. (2004) Nature 363(9403): 150-6).

The first blood-stage vaccine to be tested in challenge trials is Combination B, which is a mixture of three recombinant asexual blood-stage antigens: parts of two merozoite surface proteins (MSP-1 and MSP-2) together with a part of the ring- infected erythrocyte surface antigen (RESA), which is found on the inner surface of the infected red cell membrane. The MSP-1 antigen is a 175 amino acid fragment of the relatively conserved blocks 3 and 4 of the K1 parasite line; it also includes a T-cell epitope from the Plasmodium falciparum circumsporozoite (CS) protein as part of the MSP1 fusion protein. The MSP2 protein includes the nearly complete sequence from one allelic form (3D7) of the polymorphic MSP-2 protein. The RESA antigen consists of 70% of the native protein from the C-terminal end of the molecule. A small efficacy trial of Combination B in non-immune adults with experimental challenge showed no effect (Lawrence (2000) Vaccine 18(18):1925-31 ). In the single natural-challenge efficacy trial of in semi-immune children (Genton (2002) Journal of Infectious Diseases 185(6):820-7), no effect on clinical malaria infections was detected. In this trial, significant efficacy (measure by reduction in parasite density) was only observable in the group who were not pretreated with sulfadoxine-pyrimethamine. Also, in these children there was a reduction in the proportion of children with medium and high parasitaemia levels. Vaccinees in the Genton et al. (2002) trial had a lower incidence and prevalence of parasites with the 3D7 type of MSP2 (the type included in the vaccine) than the placebo group, and a higher incidence of malaria episodes were associated with the FC27 type of MSP2, suggesting specific immunity. Importantly, there was no statistically significant change in prevalence of parasitemia, nor was there evidence for an effect of combination B against episodes of clinical malaria in either the group pretreated with the antimalarial or the group with no antimalarial, in fact the results for these subgroups tended in the opposite direction. Furthermore, the relative role of the three vaccine constituents cannot be assessed when based on the trials that have been carried out to date.

In addition to the asexual-stage components of Combination B, many other potential asexual stage vaccines have been under preclinical evaluation, such as regions of apical membrane antigen 1 (AMA1 ), the merozoite surface proteins MSP1 , MSP2, MSP3, MSP4, and MSP5,: glutamate-rich protein (GLURP), rhoptry associated protein-2 (RAP2), EBA-175, EBP2, MAEBL, and DBP, and Plasmodium falciparum (erythrocyte membrane protein-1 (PfEMPI ). Importantly however, a recent examination of the vaccine candidate still under consideration (Moran et al. (2007) The Malaria Product Pipeline, The George Institute for International Health, September 2007) has shown that many preclinical vaccine projects are inactive; in particular vaccine projects using the F1 domain of EBA-175 (e.g. by ICGEB), EBA- 140 (also known as BAEBL), and RAP-2 are inactive. The inactivity of these projects highlights that much work is needed to find blood stage antigens that will afford a protective immune response.

There are many problems faced in the selection of antigens for malaria vaccine development, including antigenic variation, antigen polymorphism, and original antigenic sin, and further problems such as MHC-limited non-responsiveness to malarial antigens, inhibition of antigen presentation, and the influence of maternal antibodies on the development of the immune system in infants.

Many blood stage vaccine candidates, such as MSP-1 , MSP-2, MSP-3 and AMA-1 , have substantial polymorphisms that may have an impact on both immunogenicity and protective effects, and in the case of MSP-1 , and MSP-2, immune responses to particular allelic forms has been observed in vaccine trials (and also for MSP-3 and AMA-1 in mice). Molecular epidemiological studies can guide antigen selection and vaccine design as well as provide information that is needed to measure and interpret population responses to vaccines, both during efficacy trials and after introduction of vaccines into the population. They also may provide insight into the selective forces acting on antigen genes and potential implications of allele specific immunity. Consequently the different allelic forms would need to be included in any vaccine to counter the affect of antigenic polymorphism at immunogenic residues.

The cyclical recrudescences of malaria parasites in humans is thought to be due to the selective pressure placed upon parasitized red cells by antibodies to variant antigens, such as PfEMPI . Expression of variant receptor properties mediating adherence to endothelial cells is also associated with PfEMP-1 expression which localized on the infected erythrocyte plasma membrane at knob-like protrusions ("knobs") which are small (<100 nm) electron-dense cup-shaped excrescences, or knobs, which underlie protrusions of the erythrocyte plasma membrane following the contour of the cup, and appear to serve as the attachment points between sequestered parasites and endothelial cells. Plasmodium falciparum possesses about 50 variant copies of PfEMPI which are expressed clonally such that only one is expressed at a time, and the development of antibodies against the expanding clonal type then reduce this clone from the affected individual, and subsequently a different variant, not recognized by antibodies, emerges and cycling continues. This antigenic variation also poses a problem for vaccines containing clonally expressed antigens. The identification of the var gene family that encodes PfEMPI has facilitated the examination of PfEMPI as a vaccine candidate. Importantly, immunization studies with recombinant conserved CD36-binding portion of PfEMPI failed to confer protection in Aotus monkeys (Makobongo et al. (2006) JID 193:731-740).

A third problem confounding malaria vaccine initiatives is original antigenic sin; a phenomenon in which individuals tend to make antibodies only to epitopes expressed on antigenic types to which they have been exposed (or cross-reactive antigens), even in subsequent infections carrying additional, highly immunogenic epitopes (Good, et al. (1993) Parasite Immunol. 15, 187-193. Taylor et al. (1996) Int. Immunol. 8, 905-915, Riley, (1996) Parasitology 112, S39-S51 (1996)).

It has also been proposed that immunity to malaria relies on maintaining high levels of immune effector cells, rather than in the generation of effectors from resting memory cells (Struck and Riley (2004) Immunological Reviews 201 : 268-290). Consequently, the time taken to generate sufficient levels of effector cells may be crucial in determining whether a protective memory response can be mounted to prevent disease. Also, malaria parasites may interfere directly with memory responses by interfering with antigen presentation by dendritic cells (Urban et al. (1999) Nature 400:73-77, Urban et al.(2001 ) PNAS 98:8750-8755), and premature apoptosis of memory cells (Toure-Balde et al.(1996) Infection and Immunity 64: 744-750, Balde et al. (2000) Parasite Immunology 22:307-318). Furthermore, it has been demonstrated that antibodies to particular malarial antigens (such as MSP-1 ) may inhibit the activity of malaria-protective antibodies (Holder et al (1999) Parassitologica 41 :409-14), and that there may be MHC-limited non- responsiveness to malarial antigens (Tian et al (1996) J Immunol 157:1 176-1183, Stanisic et al. (2003) Infection and Immunity 71 : 5700-5713). Maternally derived antibodies have also been shown to interfere with the development of antibody responses in infants, and has been implicated for malaria in mice (Hirunpetcharat and Good (1998) PNAS 95:1715-1720), consequently these problems need to be addressed for vaccination of children against malaria.

As will be apparent from the foregoing review of the prior art, there remain significant problems to be overcome in the design of an efficacious vaccine against malaria. It is an aspect of the present invention to overcome or ameliorate a problem of the prior art by providing genes and proteins found to be essential for blood stage growth to prevent malaria. It is a further aspect of the present invention to overcome or ameliorate a problem of the prior art by providing genes and proteins involved in Plasmodium falciparum modification of the infected erythrocyte to prevent malaria.

A reference herein to a patent document or other matter which is given as prior art is not to be taken as an admission that that document or matter was known or that the information it contains was part of the common general knowledge as at the priority date of any of the claims.

SUMMARY OF THE INVENTION

The present invention is related to the Applicant's discovery of a number of genes of Plasmodium having defined, and in some cases essential biological functions. The genes include those involved in the display and function of the major virulence protein PfEMPI on the surface of the Plasmodium falciparum-] nfected erythrocyte, modulate the rigidity or adhesion of erythrocytes, or are involved in the export of parasite- specific proteins. Accordingly, in one aspect the present invention provides a polynucleotide comprising or consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, and 22, or a protein comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 , 3, 5, 7, 9, 1 1 , 13, 15, 17, 19 and 21 , wherein the polynucleotide and/or protein have a biological function in a Plasmodium. In a further aspect, the present invention provides a polynucleotide comprising or consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and 82, or a protein comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NOS: 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 75, 77, 79, and 81 wherein the polynucleotides and/or protein have an essential function in a Plasmodium. Applicant has ascribed various biological functions to gene and protein sequences of Plasmodium (including the falciparum species), thereby providing new methods of treatment and prevention for infections such as malaria.

In a further aspect, the present invention provides a method for decreasing the adherence of a cell infected with a Plasmodium comprising or consisting of the step of interfering with the expression of a polynucleotide comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, and 16, or interfering with the function of a protein comprising or consisting of a sequence selected from the group consisting of SEQ ID Nos: 1 , 3, 5, 7, 9, 1 1 , 13 and 15.

In a further aspect, the present invention provides a method for decreasing the export of a Plasmodium protein into a cell infected with a Plasmodium comprising or consisting of the step of interfering with the expression of a polynucleotide comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 2, 8, and 10 or interfering with the function of a protein comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 1 , 7 and 9.

In a further aspect, the present invention provides a method for decreasing the display of a Plasmodium protein in a cell infected with a Plasmodium comprising or consisting of the step of interfering with the expression of a polynucleotide comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 4, 6, and 12, or interfering with the function of a protein comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 3, 5 and 1 1.

In a further aspect, the present invention provides a method for altering knob morphology in a cell infected with a Plasmodium comprising or consisting of the step of interfering with the expression of a polynucleotide comprising or consisting of a acid sequence selected from the group consisting of SEQ ID Nos: 14 and 16, or interfering with the function of a protein comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 13 and 15.

In a further aspect, the present invention provides a method for altering the rigidity of a cell infected with a Plasmodium comprising or consisting of the step of interfering with the expression of a polynucleotide comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 6, 18, 20, and 22, or interfering with the function of a protein comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 5, 17, 19 and 21.

In a further aspect, the present invention providess a method for decreasing the viability of a Plasmodium, comprising or consisting of the step of interfering with the expression of a polynucleotide comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and 82, or interfering with the function of a protein comprising or consisting of a sequence selected from the group consisting of 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 73, 75, 77, 79 and 81.

In a further aspect, the present invention provides a method for producing a vaccine strain of a Plasmodium, comprising or consisting of the step of genetically engineering the Plasmodium such that the expression of a polynucleotide comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 24, 26, 28, 30, 32,

34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and 82 is altered, or the function of a protein comprising or consisting of a sequence selected from the group consisting of SEQ ID NOS: 23, 25, 27, 29, 31 , 33,

35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 75, 77, 79, and 81 is altered, wherein the vaccine strain has a diminished virulence as compared with a non-engineered Plasmodium.

In a further form, the present invention provides a Plasmodium vaccine strain produced according to the methods described herein.

In a further form, the present invention provides a composition comprising or consisting of a Plasmodium vaccine strain as described herein and a pharmaceutically acceptable excipient. One form of the composition further comprises an adjuvant.

In a further aspect, the present invention provides a composition comprising or consisting of a Plasmodium vaccine strain as described herein and/or an immunogenic protein, the protein comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 75, 77, 79, and 81 and functional equivalents thereof, and a pharmaceutically acceptable excipient.

In a further aspect, the present invention provides a method for treating or preventing Plasmodium infection, comprising or consisting of administering to a subject in need thereof an effective amount of a Plasmodium vaccine strain as described herein, or a composition as described herein. In one form of the method, the Plasmodium infection is malaria.

In a further aspect, the present invention provides a polynucleotide comprising or consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, and 6 and functional equivalents thereof, or a protein comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 , 3, and 5 and functional equivalents thereof, wherein the polynucleotide and/or protein have a biological function in a Plasmodium.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Genetic disruption of genes encoding exported proteins.

Schematic of the strategy to delete the candidate genes as exemplified for SEQ ID NO:6. The vectors used were either pHHT-Tk or pCC1. pHHT-Tk used the gene thymidine kinase for negative selection whereas pCC1 used yeast cytosine deaminase /uracil phosphoribosyl transferase (CDUP) to select parasites in which the construct had integrated by homologous double crossover recombination. The restriction enzymes used to map the integration event varied with respect to the gene but in the case of SEQ ID NO:6 Eco Rl was used. The homologous flanks for recombination are shown as grey and black shaded regions. These flanks were used as the probes for Southern blots and the expected DNA fragments based on the 3D7 sequence are indicated in kilobases (kb). (B) An example of a Southern blot to verify the successful disruption of the target SEQ ID NO:6 gene. All other Southern blots for each gene disrupted are shown in Figure 7. (C) Western blots to confirm the absence of protein expression for parasite lines in which the genes PFAOH Ow, SEQ ID NO:2, PFEOOΘOw, SEQ ID NO:4, SEQ ID NO:20, PF1 1_0037, PF13_0275, PF14_0018 and SEQ ID NO:6 had been disrupted. The parental parasite CS2 is shown and equal loading was shown using antibodies to Hsp70 as shown in the bottom panels.

Figure 2. Essentiality of genes in Plasmodium falciparum.

Annotation of the exported and PEXEL containing proteins compared to those not exported. The proteins are divided into hypothetical proteins (blue), proteins with an annotated name (red) and proteins assigned to a metabolic pathway (white). (B) Comparison of essentiality of genes as judged by the ability to genetically disrupt them. The comparison is shown for all of the genes (Overall), the exported and PEXEL containing proteins (Exported/PEXEL) and those not exported (Non-PEXEL). Those unable to be disrupted are in grey whilst the proportion that can be disrupted is shown in green. (C) Comparison of essentiality for genes that can and cannot be disrupted with respect to their annotation. (D) Essentiality of different gene groups. The essentiality of the genes was compared with respect to their transcription profile, homologies, chromosomal position and allelic variability. The bars show essentiality (as determined by the percentage of unsuccessful gene knock-outs for each group). The overall value (blue) was further subdivided in PEXEL containing genes (red) and non-PEXEL genes (yellow). (E) The essentiality of gene families as shown by the ability to generate a genetic disruption.

Figure 3. Identification of proteins required for display and function of the major virulence protein PfEMPI on the surface of the Plasmodium falciparum-\ nfected erythrocyte.

Screening of mutant parasite strains with specific gene disruptions via FACS analysis to identify those that have altered reactivity to surface PfEMPI using anti-var2csa antibodies. Plasmodium falciparum-\ nfected erythrocytes were either labelled with IgG antibodies reactive to the var2csa PfEMPI or control sera from non-exposed individuals. The parental CS2 strain was set at 100% for comparison with the mutant parasite-infected erythrocytes. Error bars indicate % range. (B) Trypsin treatment of Plasmodium /a/c/param-infected erythrocytes to determine the presence of PfEMPI on the host erythrocyte surface. The full-length var2csa PfEMPI and the cytoplasmic tail were detected using antibodies to the cytoplasmic acidic terminal segment (ATS). The full length PfEMPI was detected as a band of >300 kDa. The surface pool of PfEMPI is detected by appearance of a trypsin-resistant band between 70 and 90 kDa. The lanes in each panel show parasite-infected erythrocytes: first lane, not treated with trypsin; second lane, trypsin-treated; third lane, trypsin plus soybean trypsin inhibitor. The parasite lines shown are those that when screened by antibodies they reacted with var2csa PfEMPI were less than >70 % reactive compared to the CS2 parent (panel A). The red blood cell control is shown in the last panel. The anti- ATS antibody shows a cross-reaction with spectrin that has been described previously (Maier et al. (2007) Blood 109, 1289-1297). Lack of a band between 70 and 90 kDa in the trypsin-treated lanes suggests the absence of PfEMPI on the erythrocyte surface. Full-length PfEMPI is still observed because there is a large pool of internal protein that is resistant to trypsin. (C) Adherence of mutant Plasmodium /a/c/parum-infected erythrocytes to CSA under physiological flow conditions. Each of the Plasmodium falciparum mutant strains were tested for their ability to bind to CSA under flow conditions. The number of parasitised cells was counted as bound infected red blood cells/mm².

Figure 4. Identification of genes that alter the rigidity of Plasmodium falciparum- infected erythrocytes.

Rigidity as measured using the LORCA for all generated mutants compared to CS2. The four highest shear stress points (see Figure 5B) for each cell line was used to calculate the deformability ratio and compared to the ratio of CS2. Parasites were tightly synchronised and concentrated to 40% parasitaemia to increase the sensitivity of the measurement. (B) Examples of LORCA measurements comparing membrane rigidity of P. /a/c/param-infected erythrocytes. The erythrocyte rigidity (expressed as elongation index [El]) conferred on the host cell by each mutant P. falciparum line (green) compared to parent CS2 (blue) and uninfected red cells (red) at increasing shear stress measured in pascal (Pa). Parasites were synchronised and concentrated to 40% parasitaemia to increase sensitivity of the measurement. Error bars indicate standard deviation. All parasite lines compared to CS2 parasites.

Figure 5. Microscopic analysis of mutants with export defects.

Localisation of PfEMPI and KAHRP in mutant Plasmodium falciparum-\ nfected erythrocytes. The parasite lines shown are those that have either no PfEMPI or reduced levels on the surface of the infected erythrocyte determined by FACS and trypsin analysis. The first panel depicts localisation of PfEMPI , whereas the second panel shows the localisation of KAHRP. The first column of each panel shows a bright-field image, the second panel the specific antibody (either PfEMPI or KAHRP) and the third panel an overlay of the previous two. (B) Localisation pattern of three proteins which when deleted ablate surface exposure of PfEMPL These proteins were detected with specific antibodies raised against the gene products of SEQ ID NO:2, SEQ ID NO:4 and SEQ ID NO:6. The first panel shows a bright-field image, followed by a DAPI image (blue), then the specific antibody (green), then antibodies against the Maurer's cleft resident protein anti-SBP1 antibody (red) and an overlay of the specific antibody with SBP1 localisation. (C) Localisation of PfEMPI and KHARP for parasite lines CS2ΔSEQ ID NO:16 and CS2ΔSEQ ID NO:14. Shown in the first column of images is localisation of PfEMPL In the second panel is the localisation of KAHRP. Shown are a brightfield image, specific antibody (either PFEMP1 or KAHRP) and an overlay of each. (D) Scanning electron microscopy of CS2ΔSEQ ID NO:16 and CS2ΔSEQ ID NO:14 infected erythrocytes. The first panel shows parental CS2- infected erythrocytes with normal knobs compared to the two mutant lines in which knobs are absent or greatly reduced in size. The scale bar represents 2 μm.

Figure 6. Structure, localization and effect on PfEMPI trafficking of identified PfEMPI transport mutants.

Structure of the proteins that play a role in trafficking and function of the virulence protein PfEMPI in Plasmodium falciparum.. Yellow refers to a proposed signal sequence whilst red signifies the presence of a PEXEL required for export. Black shading corresponds to a proposed transmembrane region. Green refers to a DNAj domain and blue a TIGR FAM 01639 domain. (B) Diagrammatic representation of a Plasmodium falciparum-\ nfected erythrocyte signifying the functional position of each identified protein (yellow letters) or the localisation of the protein (green symbols).

Figure 7. Southern blot analysis for obtained gene knock-outs.

Genomic DNA from parental CS2 and transfected cell lines was digested with indicated combinations of restriction enzymes and hybridised with the 5' or 3' targeting region of the deleted gene. Expected sizes for parental (WT) locus (3D7 strain), for the locus with integration of the hDHFR cassette via double recombination (KO) and for the plasmid are indicated in kilobases (kb).

Figure 8. Quantitative Southern for SEQ ID NO:28, SEQ ID NO:78, SEQ ID NO:58. Genomic DNA for parental cell lines (CS2 WT) and 2 clones of the transgenic cell lines was digested by the indicated restriction enzymes. The subsequent Southern Blot was hybridised with a probe for the 5' targeting sequence. To ensure equal loading the Southern blot was stripped and reprobed with a probe against the single copy gene dihydropteroate synthase (DHPS). Sizes are indicate in kilobases (kb).

Figure 9. Trypsin cleavage assay of upselected cell lines.

To ensure that the reduced binding of the RBC infected with the transgenic lines PF0620C, PFB0090c and PFEOOΘOw is due to a switch to the expression of another var gene (encoding PfEMPI ) these cultures were subjected to "panning" on CSA. After 3 rounds of selection these cell lines were referred to as PF0620c up, PFB0090c up and PFEOOΘOw up, respectively, and a trypsin cleavage assay was performed. The full-length PfEMPI and the cytoplasmic tail were detected using antibodies to the acidic terminal segment (ATS) at the C-terminus of PfEMPL The lanes in for each parasite infected red blood cell show: no treatment with trypsin (-), trypsin treated (+) and treated with trypsin and soybean trypsin inhibitor (i). As a comparison CS2 wild- type infected erythrocytes (CS2) (which express var2CSA PfEMPI ) and uninfected red blood cells (RBC) were subjected to trypsin cleavage too. Full length var2CSA PfEMPI and the two trypsin-resistant bends at 70 and 9OkDa are indicated by arrows. After 3 rounds of CSA panning the majority of cells had been selected for the expression of var2CSA, although (especially in RBC infected with PFA0620c up and PFEOOΘOw up) there was still a detectable subpopulation expressing another PfEMPI as indicated by additional trypsin-resistant bands at 80-9OkDa and additional full length bands of different sizes. However, these experiments show that the deletion of these genes are neither responsible for the switch in the PfEMPI nor that this prevents the cells from reverting to the expression of var2CSA. In addition it shows that in these cells - independent from the var gene expressed - PfEMPI is still exported to the surface of the infected red blood cell. Functionally erythrocytes infected with these CSA upselected parasite lines display an increased ability to bind to CSA (Figure 3C) and are being increasingly recognised by var2CSA specific antibodies by FACS assays (Figure 3A). The degree of increase in both assays correlates with the purity of the culture expressing var2CSA.

Figure 10. Adhesion assay under static conditions. Adherence of each of the P. falciparum mutant strains was tested for its ability to bind to CSA under static conditions. The number of parasitised cells bound to surface coated with 50 μg/ml CSA was counted as bound infected red blood cells/mm². Shown is the mean of at least 2 independent experiments done in triplicates for each cell line. Values lying below the standard deviation of CS2 WT binding (mean = 281 bound infected red blood cell/mm²) are depicted in green and values lying above are shown in red.

Figure 11. Screen for transport defect of PfEMP3 and the Maurer's cleft marker SBP1 via immunofluorescence assay on cell lines deficient in the expression of molecules involved in PfEMPI trafficking.

The first panel shows a bright field image, the second the DAPI nuclear stain, the third the PfEMP3 or SBP1 fluorescence and the fourth an overlay of the previous images. No major differences were observed in these cell lines.

Figure 12. Scanning electron micrographs to detect knobs on surface of RBC infected with Plasmodium falciparum cell lines deficient in the expression of molecules involved in PfEMPI trafficking. One representative cell of >30 examined is shown.

Figure 13. Immunofluorescence analysis of all mutant cell lines generated.

Mutants were screened for defects in PfEMPI , PfEMP3, KAHRP and SBP1 trafficking with no major differences observed. Mutants were screened for defects in PfEMPI , PfEMP3, KAHRP and SBP1 trafficking with no major differences observed. The first column in each panel shows a bright field image, the second the DAPI nuclear stain, the third PfEMPI (Maier et al. (2007) Blood 109, 1289-1297), KAHRP (Rug et al. (2006) Blood 108, 370-378), PfEMP3 (Waterkeyn et al. (2000) EMBO J 19, 2813- 2823) or SBP1 (Cooke et al. (2006) J Cell Biol 172, 899-908; Maier et al. (2007) Blood 109, 1289-1297) fluorescence, respectively, and the fourth an overlay of the previous images.

DETAILED DESCRIPTION OF THE INVENTION

The present invention is predicated at least in part on the identification of Plasmodia/ genes, and proteins encoded by those genes that are essential or at least influential in the growth, development or survival of a Plasmodium species inside a host cell, such as an erythrocyte. Accordingly, in a first aspect, the present invention provides a polynucleotide comprising or consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, and 22, or a protein comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 , 3, 5, 7, 9, 1 1 , 13, 15, 17, 19 and 21 , wherein the polynucleotide and/or protein have a biological function in a Plasmodium. In a further aspect the present invention provides a polynucleotide comprising or consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and 82, or a protein comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NOS: 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 75, 77, 79, and 81 wherein the polynucleotides and/or protein have an essential function in a Plasmodium.

Some polynucleotides and proteins have been found to be involved in the adherence of Plasmodium-\ nfected cells. A further aspect of the invention therefore provides a method for decreasing the adherence of a cell infected with a Plasmodium comprising or consisting of the step of interfering with the expression of a polynucleotide comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, and 16, or interfering with the function of a protein comprising or consisting of a sequence selected from the group consisting of SEQ ID Nos: 1 , 3, 5, 7, 9, 11 , 13 and 15.

Other polynucleotides and proteins (such as those defined by SEQ ID NOs: 2, 8, and 10 and SEQ ID NOs: 1 , 7 and 9), have been identified as important in the export of Plasmodium proteins. Polynucleotides and proteins defined by SEQ ID NOs: 4, 6, and 12 and SEQ ID NOs: 3, 5 and 1 1 have been found to be involved in decreasing the display of Plasmodium proteins on infected cells.

Applicant has further discovered that knob morphology in a cell infected with a Plasmodium can be affected by interfering with the expression of a polynucleotide comprising or consisting of a acid sequence selected from the group consisting of SEQ ID Nos: 14 and 16, or interfering with the function of a protein comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 13 and 15.

Another important aspect of pathogenesis in Plasmodium infection is the resultant rigidity of infected cells, and especially infected erythrocytes. The present invention provides that rigidity can be altered by interfering with the expression of a polynucleotide comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 6, 18, 20, and 22, or interfering with the function of a protein comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 5, 17, 19 and 21.

Applicant has further found that some genes are essential for the viability of a Plasmodial cell. Accordingly, a further aspect of the present invention provides a method for decreasing the viability of a Plasmodium, comprising or consisting of the step of interfering with the expression of a polynucleotide comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and 82, or interfering with the function of a protein comprising or consisting of a sequence selected from the group consisting of 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 73, 75, 77, 79 and 81.

Without wishing to be limited by theory it is proposed that Plasmodium genes, and their encoded proteins as described herein are required for or contribute to the normal growth, development and survival of Plasmodium inside the host erythrocyte. A key part of the life cycle of Plasmodium occurs in the erythrocytes of the host, with infection causing adverse effects on the blood cell.

The skilled person understands that strict compliance with the polynucleotide and protein sequences defined herein is not necessary, and functional equivalents are included in the scope of the invention. Various strains and species of Plasmodium may have differences at various amino acid and/or nucleotide residues without substantially affecting the biological activity or structure of the protein For example, in respect of proteins it is known that the certain amino acid substitutions can be made without substantially affecting the structure or function of the protein. Such

"conservative substitutions" are well known to the skilled partisan and will not be repeated herein. It is also understood that a protein may be truncated, or have internal deletions without substantially affecting structure or function. Furthermore, certain fragments of a protein may retain important structure and function.

The degeneracy of the genetic code is such that the same protein may be encoded by a number of different polynucleotide sequences. The present invention includes any alterations that are available by virtue of the degeneracy of the genetic code. Furthermore, the invention provides nucleic acid which can hybridise to these nucleic acid molecules, preferably under "high stringency" conditions (e.g. 65°C in a 0.1 x SSC, 0.5% SDS solution). Nucleic acid according to the invention can be prepared in many ways (e.g. by chemical synthesis, from genomic or cDNA libraries, from the organism itself, etc.) and can take various forms (e.g. single stranded, double stranded, vectors, probes, etc.). They are preferably prepared in substantially pure form (i.e. substantially free from other Plasmodial or host cell nucleic acids).

The term "polynucleotide" includes DNA and RNA, and also their analogues, such as those containing modified backbones (e.g. phosphorothioates, etc.), and also peptide nucleic acids (PNA), etc. The invention includes nucleic acid comprising or consisting of sequences complementary to those described above (e.g. for antisense or probing purposes).

Applicant has herein identified genes, and proteins encoded by those genes, that are required for PfEMPI expression at the erythrocyte plasma membrane surface. The remodelling of infected red blood cells (erythrocytes) is a key event in the infection of a subject with the malaria parasite. Furthermore, it is proposed that genes encoding proteins that are required for, or contribute to PfEMPI expression at the erythrocyte plasma membrane surface, are important novel targets of compositions for the treatment and/or prevention of malaria.

Previous work has demonstrated that profound structural and morphological changes occur in erythrocytes after invasion by the parasite, dramatically altering their physical properties and grossly impairing their ability to circulate in vivo. In stark contrast to normal erythrocytes, parasitised cells are rigid, poorly deformable and show a propensity to adhere to a variety of other cell types, including vascular endothelial cells. Taken together, increased red cell rigidity, reduced cell deformability and increased adhesiveness result in dramatically increased haemodynamic resistance in the microvasculature of Plasmodium /a/c/parum-infected erythrocytes and avoidance of host defences such as the reticuloendothelial system of the spleen. These altered rheological and adhesive properties of infected erythrocytes are believed to play an important role in the pathogenesis of malaria.

Altered cellular characteristics of infected red cells are consequent on export to the red cell cytoplasm, membrane skeleton and surface of a large number of parasite- encoded polypeptides. For example, adherence of infected red cells to the vascular endothelium and subsequent sequestration in internal organs is caused by binding to receptors on vascular endothelium of the parasite adhesin PfEMPI , an antigenically diverse protein trafficked to the infected red cell surface. This in turn is anchored at the red cell membrane skeleton by knob structures, macromolecular complexes consisting primarily of the knob associated histidine-rich protein (KHARP). In the absence of knobs, PfEMPI is unable to form adhesive interactions of sufficient strength to withstand disruption by forces of normal blood flow. KAHRP binding with the membrane skeleton in turn leads to an increase in rigidity of the cell and blockage of blood vessels and resistance to flow. The parasite proteins involved must be transported within a host cell, in which all protein trafficking machinery has been lost, and perturb and be inserted into a highly organized membrane skeleton structure. This formation of a de novo transport system and trafficking of parasite proteins to diverse locations in the host cell is unique in cell biology and will likely involve proteins and structures that are without parallel.

Parasite proteins such as PfEMPI and KAHRP reach their final destination after traversing the parasite membrane as well as the parasitophorous vacuole and membrane that envelope the parasite after invasion of the host cell. A pentameric sequence is required for the translocation of proteins across the parasitophorous vacuole membrane and it has been termed the Plasmodium falciparum Export Element (PEXEL) or Vacuolar Targeting Signal (VTS).

Translocation across the parasitophorous vacuole membrane via a PEXEL motif is functionally conserved across all Plasmodium species. Once across the parasitophorous vacuole, many exported proteins interact with novel structures in the red cell cytoplasm including Maurer's clefts that serve as a sorting and/or assembly point from which Plasmodium falciparum proteins are deposited underneath or into the erythrocyte membrane.

In order to identify proteins that play an important role in remodelling of infected erythrocytes and provide the infrastructure for protein trafficking and other changes such as increased rigidity, Applicant used functional screens by constructing loss-of- function mutants of genes. In contrast to the prior art, the present invention provides Plasmodium genes and proteins required for trafficking of PfEMPI to the infected erythrocyte surface, correct assembly of the knob structures and those involved in establishing rigidity of the infected red cell. Furthermore, Applicant provides multiple proteins exported to the Plasmodium-\ nfected erythrocyte that allow the establishment of the parasite in its intracellular environment providing essential functions for assembly and localisation of virulence determinants. Furthermore, Applicant provides Plasmodium molecules that are essential for the growth, development and survival of Plasmodium falciparum inside the host erythrocyte.

The Plasmodium falciparum genome was investigated to identify certain exported proteins, as well as those with a PEXEL, a motif important for trafficking of proteins to the erythrocyte cytoplasm, to compile a list of 83 candidate genes of which 46 had PEXEL motifs (Figure 1 , shaded blue). Five exported genes were included that do not have an obvious PEXEL (PFD1160w, PFE0070w, MAL7P1.91 , SEQ ID NO:46 and PF11_0507 (Figure 1 , shaded grey)). Together, these 51 exported proteins constitute a representative subset of the exportome manageable in terms of a gene knockout screen. In addition, 32 genes encoding proteins that were unlikely to be exported but that had a signal sequence and gene transcription in blood-stages were included to provide a comparison with respect to the essentiality of each group (Figure 1 , shaded green). Most genes within the exported set were transcribed either in early ring stages soon after invasion and/or in late schizont stages when the invasive merozoite is being formed (Figure 1 ).

To disrupt the function of these candidate genes in Plasmodium falciparum (Crabb et al. (1997) Cell 89, 287-296) plasmids that would integrate into the targeted gene by double crossover homologous recombination using the plasmid pHT-Tk (Duraisingh, et al. (2002) lnt J Parasitol 32, 81-89). were constructed (Figure 1A). During the course of this work Applicant developed improved plasmids (pCC1 and pCC4) for negative selection using the Saccharomyces cerevisiae cytosine deaminase/uracil phosphoribosyl transferase gene (Figure 1 B) (Maier et al. (2006) Molecular & Biochemical Parasitology 150, 118-121 ) and these were also used. The plasmids were transfected into CS2, a strain of Plasmodium falciparum that confers the ability of the infected erythrocyte to adhere to CSA via a specific PfEMPI encoded by the var2csa gene. This parasite line was chosen because expression of PfEMPI encoded by var2csa is very stable over time. As most PfEMPI genes undergo rapid transcriptional switches to other family members as a means of immune evasion these switching events could confound subsequent analysis, the Applicant's choice of var2csa minimizes this problem. In P. falciparum transfected plasmids are maintained as episomal circles and integration by double crossover homologous recombination occurs at low frequency. Growth on WR99210 (positive selection) and 5'- fluorocytosine (negative selection) favors the survival of transfected parasites with homologous integration into the target gene and loss of episomal plasmids. Gene disruption was analysed by Southern blotting and of the 83 genes attempted 53 were confirmed and the plasmid integrated by double-crossover homologous recombination (Figure 1 B and Figure 7). To verify that the gene disruption strategy results in loss of protein expression Applicant generated antibodies to a subset of the protein products. Lack of protein expression in knockout lines was verified by western blots as shown by loss of a specific signal in the mutant lines compared to the parental parasite CS2 (Figure 1 C). Although transfection of the plasmids was successful for the other 30 genes it was not possible to select parasites in which these constructs had integrated, suggesting that these genes are essential and serve an important function in growth and development of the parasite inside the host erythrocyte.

In this study, Applicant propagated Plasmodium in human erythrocytes, which removes selection for maintenance of genes required for survival in the host such as expression of PfEMPI on the parasite-infected erythrocyte surface. Overall, 64% of the Plasmodium genes tested could be disrupted and classified as non-essential for erythrocytic growth (Figure 2A).

For the candidate genes chosen, Applicant demonstrate that 36% of genes appear to be essential. The genes identified are essential for the growth, development and survival of Plasmodium inside the host erythrocyte provide novel targets for agents capable of treating or preventing malaria.

As discussed supra, the present invention is predicated at least in part on the identification of Plasmodium genes encoding proteins that are essential for the growth, development and survival of Plasmodium inside the host erythrocyte, and genes encoding proteins that are required for PfEMPI expression and display at the erythrocyte plasma membrane surface. In order to address the function of exported proteins the Applicant has used a gene knockout strategy as a screen to identify proteins that are required for important aspects of the remodeling process such as cytoadherence, knob formation and erythrocyte rigidity, properties that are important in the pathogenesis of malaria. The present invention provides exported proteins required for trafficking, display and function of the cytoadherence protein PfEMPI , assembly of knobs and rigidification of the infected red cell. The virulence protein PfEMPI is expressed early post invasion; however, it does not appear on the Plasmodium falciparum-\ nfected erythrocyte surface until 16 hours after merozoite invasion when the more mature cells become adherent. Prior to the present invention the mechanism and proteins required for trafficking of PfEMPI through the parasitophorous vacuole membrane into Maurer's clefts and from these structures to the erythrocyte membrane were unknown. Applicant has identified six proteins required for normal trafficking of PfEMPL Disruption of function for SEQ ID NO:1 , SEQ ID NO:3, SEQ ID NO:5 and SEQ ID NO:11 resulted in complete lack of PfEMPI on the parasite-infected erythrocyte suggesting that they are required for subcellular localisation of this important virulence protein. Trafficking of other exported proteins such as KAHRP, SBP1 and PfEMP3 is not affected in these lines suggesting that these proteins are specifically required for localization of PfEMPL Without wishing to be limited by theory, in the parasite lines with SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO: 12 disrupted PfEMPI was trafficked to Maurer's clefts suggesting that the function of the relevant proteins is in transfer from this parasite structure to the erythrocyte membrane. Previous studies have identified a possible role for SBP1 as functioning at or just prior to this step. The present invention provides molecular players in this step. In contrast, PfEMPI in the CS2ΔSEQ ID NO:1 line does not appear to be transferred to Maurer's clefts suggesting that this protein functions early when PfEMPI is loaded into these structures. Interestingly, for the mutant line CS2ΔSEQ ID NO:3 PfEMPI was not readily detected on western blots using SDS solubilization of Triton X100 insoluble proteins, which is the standard procedure for detection of this protein. This suggests that PfEMPI has different solubility characteristics due to its blockage at Maurer's clefts in its trafficking route.

The adhesion protein PfEMPI accumulates in electron-dense protrusions of the infected erythrocyte membrane, known as knob structures, the major component being the knob-associated histidine rich protein (KAHRP). Genetic disruption of KAHRP leads to the absence of knobs resulting in decreased cytoadherence under flow conditions. The knob structures are required for PfEMPI -mediated adhesion of parasitized erythrocytes under physiological conditions and allow strengthening of the interaction to withstand detachment by shear stress created by the hydrodynamic flow in the blood vessels. The elevated position of PfEMPI on knobs together with an overall positive charge may allow PfEMPI to bind to the receptors on the negatively charged endothelial plasma membrane and this together with interaction of KAHRP and the cytoplasmic tail of PfEMPI with cytoskeleton components such as spectrin, actin and band 4.1 provides an anchored platform of clustered PfEMPI for strong cytoadherence under flow conditions. Although several molecules have been shown to reside in knobs, KAHRP is the only one that has been described to have an influence on the biogenesis of knobs. Applicant proposes that disruption of SEQ ID NO:13 and SEQ ID NO:15 protein function leads to absence or greatly decreased knob structures with an abnormal distribution as well as reduced cytoadherence. The distribution of KAHRP was altered in erythrocytes infected with CS2ΔSEQ ID NO:13 and CS2ΔSEQ ID NO: 15 suggesting the corresponding proteins are required for correct assembly of KHARP into knobs. Increased expression of the SEQ ID NO:13 protein results in a higher density of knob structures and therefore increased adherence.

Interestingly, the SEQ ID NO:15 protein has a Dnaj type III domain and has been classified as HSP40-like, and this might provide a clue to its function in the assembly of knobs. DnaJ proteins have been classified into type l/ll DnaJ proteins which contain all necessary domains to stimulate ATP hydrolysis in HSP70 and DnaJ type III proteins which only have homology to the core DnaJ domain with possible variations in a triptych HDP catalytic sequence. Recently, it has been suggested that the type III class of Hsp40 proteins should be divided into a new type IV class that exhibit variations in the HDP motif within the conserved J domain, and SEQ ID NO:15 can be classified in this group. In general Hsp40 proteins can serve two roles; firstly, targeting protein substrates to Hsp70 for folding and secondly, stabilisation of Hsp70 in a substrate-bound form. However, as yet type III and IV Hsp40 proteins have not been shown to bind polypeptide substrates and it has been suggested they may not have chaperone activity. They may serve more functionally specialised roles in recruitment of Hsp70 for folding of specific substrates. In this way SEQ ID NO:15 protein plays a direct role in assembly of KHARP within the knob structure under the erythrocyte membrane.

Severe malaria caused by Plasmodium can involve multiple organ failure and this is associated with increased rigidity of parasite-infected erythrocytes that can contribute to blockage of micro-capillaries. Normal erythrocytes are highly deformable allowing them to flow through the smallest capillaries and this property is due to their low internal viscosity, high-surface-area to volume ratio, and the elastic nature of the erythrocyte membrane and underlying cytoskeleton. As the Plasmodium parasite grows within the erythrocyte it loses its deformability and becomes spherocytic and more rigid. This altered deformability is manifested by export of proteins into erythrocytes that interact with the host cell cytoskeleton and insert into the membrane.. KAHRP and PfEMP3 negative parasite-infected erythrocytes have a significantly decreased membrane shear elastic modulus, a measure of rigidity, compared to red blood cells infected with wild type parasites. It was clear that a number of mutant cell lines had changes in rigidification of the host erythrocyte compared to the parental line CS2. This suggests a large number of exported proteins contribute to the overall rigidity of the erythrocyte.

For cell lines deficient in PfEMPI transport a clear correlation could be observed: cell lines in which PfEMPI was transported across the parasitophorous membrane and reached Maurer's clefts (CS2ΔSEQ ID NO:3, CS2ΔSEQ ID NO:5, CS2ΔSEQ ID

NO:1 1 ) had an increase in erythrocyte rigidity. Cell lines in which PfEMPI did not cross or had only a reduced transport across the parasitophorous vacuole caused a less rigid erythrocyte membrane (CS2ΔSEQ ID NO:1 , CS2ΔPFE0065w, CS2ΔSEQ ID NO:7, CS2ΔSEQ ID NO:9). This is unlikely to be a direct effect caused by the pool of

PfEMPI normally inserted into the red blood cell membrane, suggesting that the small differences observed in a number of mutant cell lines is influenced by the lack of these proteins and their potential interaction with the host cell cytoskeleton rather than the absence of PfEMPI inserted into the erythrocyte surface membrane.

Any type of nucleic acid-based therapeutics that modulates expression of a gene may be used in the context of the present invention for the interference of expression. These include antisense oligonucleotides, ribozymes, interfering RNA (RNAi), micro RNA (miRNA), and DNAzymes. Each of these approaches has one central theme in common, that is, the recognition of their target DNA or mRNA sequences via Watson- Crick base-pairing. The present invention thus relates to one or more polynucleotides each of which hybridizes to one of the gene sequences described herein, preferably under stringent conditions. A stringent condition refers to a condition that allows nucleic acid duplexes to be distinguished based on their degree of mismatch, e.g., conditions of temperature and salt concentrations which yield the desired level of discrimination in the hybridization. Such polynucleotides (e.g., antisense, micro RNA ( miRNA), and RNAi) can be used to inhibit the expression of Plasmodium-associated gene products. Such polynucleotides can also serve as probes and primers for research and diagnostic purposes. The term "oligonucleotides" as used herein, refers to a molecule comprising or consisting of nucleotides (i.e., ribonucleotides, deoxyribonucleotides, or both). The term includes monomers and polymers of ribonucleotides and deoxyribonucleotides, or mixtures thereof, with the nucleotides being connected together via, for example 5' to 3' linkages, 5' to 2' linkages, etc. The nucleotides used in the oligonucleotides may be naturally occurring or may be synthetically produced analogues that are capable of forming base-pair relationships with naturally occurring base pairing nucleotides. Examples of non-naturally occurring bases that are capable of forming base-pairing relationships include, but are not limited to, aza and deaza pyrimidine analogues, aza and deaza purine analogues, and other heterocyclic base analogues, wherein one or more of the carbon and nitrogen atoms of the purine and pyrimidine rings have been substituted by heteroatoms, e.g., oxygen, sulfur, selenium, phosphorus, and the like.

Antisense oligonucleotides contain short, chemically synthesized DNA or RNA oligonucleotides with base- pair complementarity against the mRNA target of interest. Without wishing to be limited by theory, it is generally believed that antisense oligonucleotides act to inhibit gene expression by blocking translation of mRNA or by targeting the RNA for degradation by RNase H. Antisense oligonucleotides can block splicing, translation, or nuclear-cytoplasmic transport. The mechanisms of action of antisense oligonucleotides vary depending on the backbone of the oligonucleotide. Antisense oligonucleotides can be complementary to an entire coding region or only to a portion thereof. An antisense oligonucleotide herein can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, or more than 100 nucleotides in length. Preferably, the oligonucleotide is about five to about 75 nucleotides in length. The oligonucleotide can also be about eight to about 40, or about 10 to about 30, or about 15 to about 30 sequential nucleotides in length. In one embodiment, the oligonucleotide is about 12 to about 26 nucleotides in length.

Methods for interfering with the expression of a nucleic acid sequence of the present invention include RNA interference. RNA interference has been demonstrated previously in Plasmodium falciparum (e.g. McRobert and McKonkey 2002 MoI Biochem Parasitol.;119(2):273-8, Malhotra et al. 2002 MoI Microbiol., 45(5):1245-54, Gissot et al. (2005) J MoI. Biol. 346(1 ):29-42). RNA interference refers to the process of sequence-specific post- transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Zamore et al, 2000, Cell, 101 , 25-33; Fire et al, 1998, Nature, 391 , 806; Hamilton et al, 1999, Science, 286, 950-951 ; Lin et al, 1999, Nature, 402, 128-129; Sharp, 1999, Genes & Dev., 13: 139-141 ; and Strauss, 1999, Science, 286, 886). The corresponding process in plants (Heifetz et al, International PCT Publication No. WO 99/61631 ) is commonly referred to as post-transcriptional gene silencing or RNA silencing and is also referred to as quelling in fungi. The process of post-transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defence mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla (Fire et al, 1999, Trends Genet, 15, 358). Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or from the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA. The presence of dsRNA in cells triggers the RNAi response through a mechanism that has yet to be fully characterized. This mechanism appears to be different from other known mechanisms involving double stranded RNA-specific ribonucleases, such as the interferon response that results from dsRNA-mediated activation of protein kinase PKR and 2',5'-oligoadenylate synthetase resulting in nonspecific cleavage of mRNA by ribonuclease L (see for example US Patent Nos. 6,107,094; 5,898,031 ; Clemens et al, 1997, J. Interferon & Cytokine Res., 17, 503-524).

The presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme referred to as dicer (Bass, 2000, Cell, 101 , 235; Zamore et al, 2000, Cell, 101 , 25-33; Hammond et al, 2000, Nature, 404, 293). Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Zamore et al, 2000, Cell, 101 , 25-33; Bass, 2000, Cell, 101 , 235; Berstein et al, 2001 , Nature, 409, 363). Short interfering RNAs derived from dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes (Zamore et al, 2000, Cell, 101 , 25-33; Elbashir et al, 2001 , Genes Dev., 15, 188). Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control (Hutvagner et al, 2001 , Science, 293, 834). The RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex (Elbashir et al, 2001 , Genes Dev., 15, 188).

RNAi has been studied in a variety of systems. Fire et al, 1998, Nature, 391 , 806, were the first to observe RNAi in C. elegans. Bahramian and Zarbl, 1999, Molecular and Cellular Biology, 19, 274-283 and Wianny and Goetz, 1999, Nature Cell Biol, 2, 70, describe RNAi mediated by dsRNA in mammalian systems. Hammond et al, 2000, Nature, 404, 293, describe RNAi in Drosophila cells transfected with dsRNA. Elbashir et al, 2001 , Nature, 41 1 , 494 and Tuschl et al, International PCT Publication No. WO 01/75164, describe RNAi induced by introduction of duplexes of synthetic 21- nucleotide RNAs in cultured mammalian cells including human embryonic kidney and HeLa cells. Recent work in Drosophila embryonic lysates (Elbashir et al, 2001 , EMBO J., 20, 6877 and Tuschl et al, International PCT Publication No. WO 01/75164) has revealed certain requirements for siRNA length, structure, chemical composition, and sequence that are essential to mediate efficient RNAi activity. These studies have shown that 21 -nucleotide siRNA duplexes are most active when containing 3'- terminal dinucleotide overhangs. Furthermore, complete substitution of one or both siRNA strands with 2'-deoxy (2'-H) or 2'-O-methyl nucleotides abolishes RNAi activity, whereas substitution of the 3 '-terminal siRNA overhang nucleotides with 2'-deoxy nucleotides (2'-H) was shown to be tolerated. Single mismatch sequences in the center of the siRNA duplex were also shown to abolish RNAi activity. In addition, these studies also indicate that the position of the cleavage site in the target RNA is defined by the 5'-end of the siRNA guide sequence rather than the 3'-end of the guide sequence (Elbashir et al, 2001 , EMBO J., 20, 6877). Other studies have indicated that a 5'- phosphate on the target-complementary strand of a siRNA duplex is required for siRNA activity and that ATP is utilized to maintain the 5 '-phosphate moiety on the siRNA (Nykanen et al, 2001 , Cell, 107, 309).

Studies have shown that replacing the 3 '-terminal nucleotide overhanging segments of a 21-mer siRNA duplex having two-nucleotide 3'-overhangs with deoxyribonucleotides does not have an adverse effect on RNAi activity. Replacing up to four nucleotides on each end of the siRNA with deoxyribonucleotides has been reported to be well tolerated, whereas complete substitution with deoxyribonucleotides results in no RNAi activity (Elbashir et al, 2001 , EMBO J., 20, 6877 and Tuschl et al, International PCT Publication No. WO 01/75164). In addition, Elbashir et al, supra, also report that substitution of siRNA with 2'-O-methyl nucleotides completely abolishes RNAi activity. Li et al, International PCT Publication No. WO 00/44914, and

Beach et al, International PCT Publication No. WO 01/68836 preliminarily suggest that siRNA may include modifications to either the phosphate-sugar backbone or the nucleoside to include at least one of a nitrogen or sulfur heteroatom, however, neither application postulates to what extent such modifications would be tolerated in siRNA molecules, nor provides any further guidance or examples of such modified siRNA. Kreutzer et al, Canadian Patent Application No. 2,359,180, also describe certain chemical modifications for use in dsRNA constructs in order to counteract activation of double-stranded RNA-dependent protein kinase PKR, specifically 2'-amino or 2'-O- methyl nucleotides, and nucleotides containing a 2'-0 or 4'-C methylene bridge. However, Kreutzer et al. similarly fails to provide examples or guidance as to what extent these modifications would be tolerated in dsRNA molecules.

Parrish et al, 2000, Molecular Cell, 6, 1077-1087, tested certain chemical modifications targeting the unc-22 gene in C. elegans using long (>25 nt) siRNA transcripts. The authors describe the introduction of thiophosphate residues into these siRNA transcripts by incorporating thiophosphate nucleotide analogs with T7 and T3 RNA polymerase and observed that RNAs with two phosphorothioate modified bases also had substantial decreases in effectiveness as RNAi. Further, Parrish et al. reported that phosphorothioate modification of more than two residues greatly destabilized the RNAs in vitro such that interference activities could not be assayed. Id. at 1081. The authors also tested certain modifications at the 2'-position of the nucleotide sugar in the long siRNA transcripts and found that substituting deoxynucleotides for ribonucleotides produced a substantial decrease in interference activity, especially in the case of Uridine to Thymidine and/or Cytidine to deoxy- Cytidine substitutions. Id. In addition, the authors tested certain base modifications, including substituting, in sense and antisense strands of the siRNA, 4-thiouracil, 5- bromouracil, 5-iodouracil, and 3-(aminoallyl)uracil for uracil, and inosine for guanosine. Whereas 4-thiouracil and 5-bromouracil substitution appeared to be tolerated, Parrish reported that inosine produced a substantial decrease in interference activity when incorporated in either strand. Parrish also reported that incorporation of 5-iodouracil and 3-(aminoallyl)uracil in the antisense strand resulted in a substantial decrease in RNAi activity as well.

The use of longer dsRNA has been described. For example, Beach et al, International PCT Publication No. WO 01/68836, describes specific methods for attenuating gene expression using endogenously-derived dsRNA. Tuschl et al, International PCT

Publication No. WO 01/75164, describe a Drosophila in vitro RNAi system and the use of specific siRNA molecules for certain functional genomic and certain therapeutic applications. Li et al., International PCT Publication No. WO 00/44914, describe the use of specific long (141 bp-488 bp) enzymatically synthesized or vector expressed dsRNAs for attenuating the expression of certain target genes. Zernicka-Goetz et al.,

International PCT Publication No. WO 01/36646, describe certain methods for inhibiting the expression of particular genes in mammalian cells using certain long (550 bp-714 bp), enzymatically synthesized or vector expressed dsRNA molecules. Fire et al., International PCT Publication No. WO 99/32619, describe particular methods for introducing certain long dsRNA molecules into cells for use in inhibiting gene expression in nematodes. Plaetinck et al., International PCT Publication No. WO 00/01846, describe certain methods for identifying specific genes responsible for conferring a particular phenotype in a cell using specific long dsRNA molecules. MeIIo et al., International PCT Publication No. WO 01/29058, describe the identification of specific genes involved in dsRNA-mediated RNAi. Pachuck et al., International PCT Publication No. WO 00/63364, describe certain long (at least 200 nucleotide) dsRNA constructs. Deschamps Depaillette et al., International PCT Publication No. WO 99/07409, describe specific compositions consisting of particular dsRNA molecules combined with certain anti-viral agents. Waterhouse et al., International PCT Publication No. 99/53050 and 1998, PNAS, 95, 13959-13964, describe certain methods for decreasing the phenotypic expression of a nucleic acid in plant cells using certain dsRNAs. Driscoll et al., International PCT Publication No. WO 01/49844, describe specific DNA expression constructs for use in facilitating gene silencing in targeted organisms.

Others have reported on various RNAi and gene-silencing systems. For example, Parrish et al., 2000, Molecular Cell, 6, 1077-1087, describe specific chemically- modified dsRNA constructs targeting the unc-22 gene of C. elegans. Grossniklaus, International PCT Publication No. WO 01/38551 , describes certain methods for regulating polycomb gene expression in plants using certain dsRNAs. Churikov et al., International PCT Publication No. WO 01/42443, describe certain methods for modifying genetic characteristics of an organism using certain dsRNAs.

Cogoni et al, International PCT Publication No. WO 01/53475, describe certain methods for isolating a Neurospora silencing gene and uses thereof. Reed et al, International PCT Publication No. WO 01/68836, describe certain methods for gene silencing in plants. Honer et al, International PCT Publication No. WO 01/70944, describe certain methods of drug screening using transgenic nematodes as Parkinson's Disease models using certain dsRNAs. Deak et al, International PCT Publication No. WO 01/72774, describe certain Drosophila-deήYed gene products that may be related to RNAi in Drosophila. Arndt et al, International PCT Publication No. WO 01/92513 describe certain methods for mediating gene suppression by using factors that enhance RNAi. Tuschl et al, International PCT Publication No. WO 02/44321 , describe certain synthetic siRNA constructs. Pachuk et al, International PCT Publication No. WO 00/63364, and Satishchandran et al, International PCT Publication No. WO 01/04313, describe certain methods and compositions for inhibiting the function of certain polynucleotide sequences using certain long (over 250 bp), vector expressed dsRNAs. Echeverri et al, International PCT Publication No. WO 02/38805, describe certain C. elegans genes identified via RNAi. Kreutzer et al, International PCT Publications Nos. WO 02/055692, WO 02/055693, and EP 1144623 BI describes certain methods for inhibiting gene expression using dsRNA. Graham et al, International PCT Publications Nos. WO 99/49029 and WO 01/70949, and AU 4037501 describe certain vector expressed siRNA molecules. Fire et al, US 6,506,559, describe certain methods for inhibiting gene expression in vitro using certain long dsRNA (299 bp-1033 bp) constructs that mediate RNAi. Martinez et al, 2002, Cell, 110, 563-574, describe certain single stranded siRNA constructs, including certain 5'-phosphorylated single stranded siRNAs that mediate RNA interference in HeIa cells. Harborth et al, 2003, Antisense & Nucleic Acid Drug Development, 13, 83- 105, describe certain chemically and structurally modified siRNA molecules. Chiu and Rana, 2003, RNA, 9, 1034-1048, describe certain chemically and structurally modified siRNA molecules. Woolf et al, International PCT Publication Nos. WO 03/064626 and WO 03/064625 describe certain chemically modified dsRNA constructs. Hornung et al, 2005, Nature Medicine, 1 1 , 263 - 270, describe the sequence-specific potent induction of IFN-alpha by short interfering RNA in plasmacytoid dendritic cells through TLR7. Judge et al, 2005, Nature Biotechnology, 23, 457-462. Published online: 20 March 2005, describe the sequence-dependent stimulation of the mammalian innate immune response by synthetic siRNA. Yuki et al, International PCT Publication Nos. WO 05/049821 and WO 04/048566, describe certain methods for designing short interfering RNA sequences and certain short interfering RNA sequences with optimized activity. Saigo et al, US Patent Application Publication No. US20040539332, describe certain methods of designing oligo- or polynucleotide sequences, including short interfering RNA sequences, for achieving RNA interference. Tei et al, International PCT Publication No. WO 03/044188, describe certain methods for inhibiting expression of a target gene, which comprises transfecting a cell, tissue, or individual organism with a double-stranded polynucleotide comprising or consisting of DNA and RNA having a substantially identical nucleotide sequence with at least a partial nucleotide sequence of the target gene.

Mattick, 2005, Science, 309, 1527-1528; Claverie, 2005, Science, 309, 1529- 1530; Sethupathy et al, 2006, RNA, 12, 192-197; and Czech, 2006 NEJM, 354, 11 : 1 194- 1195; Hutvagner et al, US 20050227256, and Tuschl et al, US 20050182005, all describe antisense molecules that can inhibit miRNA function via steric blocking and are all incorporated by reference herein in their entirety.

In a further aspect the present invention provides a method for producing a vaccine strain of a Plasmodium, comprising or consisting of the step of genetically engineering the Plasmodium such the expression of a polynucleotide comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and 82 is altered, or the function of a protein comprising or consisting of a sequence selected from the group consisting of SEQ ID NOS: 1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 75, 77, 79, and 81 is altered, wherein the vaccine strain has a diminished virulence as compared with a non-engineered Plasmodium. In a further aspect the present invention provides a Plasmodium vaccine strain produced according to this method.

The skilled person understands that the genetic disruptions recited herein can be applied to known strains of Plasmodium, to produce a vaccine strain such as the CS2 strain of Plasmodium falciparum. Applicant demonstrates such vaccine strains herein (see Example 2). Accordingly, in some embodiments the vaccine strain is a strain of Plasmodium selected from the group consisting of CS2ΔSEQ ID NO: 2, CS2ΔSEQ ID NO: 4, CS2ΔSEQ ID NO: 6, CS2ΔSEQ ID NO: 8, CS2ΔSEQ ID NO: 10, CS2ΔSEQ ID NO: 12, CS2ΔSEQ ID NO: 14, CS2ΔSEQ ID NO: 16, CS2ΔSEQ ID NO: 18, CS2ΔSEQ ID NO: 20, CS2ΔSEQ ID NO: 22, CS2ΔSEQ ID NO: 24, CS2ΔSEQ ID NO: 26, CS2ΔSEQ ID NO: 28, CS2ΔSEQ ID NO: 30, CS2ΔSEQ ID NO: 32, CS2ΔSEQ ID NO: 34, CS2ΔSEQ ID NO: 36, CS2ΔSEQ ID NO: 38, CS2ΔSEQ ID NO: 40, CS2ΔSEQ ID NO: 42, CS2ΔSEQ ID NO: 44, CS2ΔSEQ ID NO: 46, CS2ΔSEQ ID NO: 48, CS2ΔSEQ ID NO: 50, CS2ΔSEQ ID NO: 52, CS2ΔSEQ ID NO: 54, CS2ΔSEQ ID NO: 56, CS2ΔSEQ ID NO: 58, CS2ΔSEQ ID NO: 60, CS2ΔSEQ ID NO: 62, CS2ΔSEQ ID NO: 64, CS2ΔSEQ ID NO: 66, CS2ΔSEQ ID NO: 68, CS2ΔSEQ ID NO: 70, CS2ΔSEQ ID NO: 72, CS2ΔSEQ ID NO: 74, CS2ΔSEQ ID NO: 76, CS2ΔSEQ ID NO: 78, CS2ΔSEQ ID NO: 80 and CS2ΔSEQ ID NO: 82. It is to be understood that reference to SEQ ID Nos in the aforementioned strains are for the purposes of nomenclature. Thus, the format "CS2ΔSEQ ID NO: X" means that the strain is a CS2 strain that is genetically disrupted in repsect of a certain nucleotide sequence.

Given these teachings, the skilled person is able to effect these disruptions in other known strains of Plasmodium such as 3D7, W2MEF, GHANA1 , V1_S, RO-33, PREICH, HB3, SANTALUCIA, 7G8, SENEGAL3404, FCC-2, K1 , RO-33, D6, DD2, or D10, or any other known or newly isolated strain of Plasmodium falciparum. Vaccine strains originating from these known and newly isolated strains are included in the scope of this invention.

In a further form, the present invention provides a composition comprising or consisting of a Plasmodium vaccine strain as described herein and/or an immunogenic protein, the protein comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 75, 77, 79, and 81 and functional equivalents thereof, and a pharmaceutically acceptable excipient.

The invention may involve introducing a mutation into a gene of a pathogenic strain of Plasmodium falciparum, wherein the mutation results in altered cytoadherence of erythrocytes infected with the strain of Plasmodium falciparum. In a further embodiment, the mutation of the gene affects surface expression of PfEMPL In a further embodiment, the mutation of the gene affects trafficking of PfEMPI into erythrocytes infected with the strain. In a further embodiment, the mutation of the gene affects display of PfEMPI at the surface of erythrocytes infected with the strain. In a further embodiment, the mutation of the gene affects erythrocyte membrane rigidity of erythrocytes infected with the strain. In a further embodiment, the mutation of the gene affects knob morphology at erythrocyte membrane of erythrocytes infected with the strain.

It will be understood by the skilled person that the Plasmodium falciparum strains of the present invention may be made using the methods of the examples, in addition to other methods of insertional or physiochemical mutagenesis. As used herein, the term

"physicochemical mutagenesis" means any method of mutating genes that is not insertional mutagenesis (i.e. by an insertional mutagen as defined below), such as ionizing radiation and/or chemical approaches to induce one or more mutations in a cell or organism. Physicochemical mutagenesis, therefore, encompasses use of chemical mutagens, radiation (e. g., UV, a radiation, P radiation, y radiation, x-rays), error prone replication proteins (for example, without limitation, mutant DNA polymerases, such as those that lack a proofreading function), restriction enzymes (used to create DNA breaks and deletions upon introduction into a host cell), and DNA repair mutants and inhibitors (used to enhance mutation from spontaneous and induced mutation). Any physicochemical mutagen can be used alone or in combination with one or more other physicochemical mutagens. "Insertional mutagenesis", as it relates to the invention, means a process in which a polynucleotide is inserted into the genome of a Plasmodium falciparum cell in such a way so as to mutate an endogenous gene. As used herein the terms "incorporation" or "integration" or "insertion" into an endogenous gene are used synonymously.

Insertional mutagenesis can occur when an insertional mutagen is introduced into a cell exogenously and as a result of the exogenous introduction becomes incorporated into the genome so as to mutate one or more endogenous genes. The invention, however, is also directed to mutagenesis events that occur when an endogenous insertional mutagen is caused to insert into locations that are different from the original location. Such is the case when an endogenous transposable element which is induced to further transposition by the action of a transposase. Accordingly, in one embodiment of the invention, insertional mutation of an allele or a gene results from transposition of an endogenous insertional mutagen. This endogenous insertional mutagen may be naturally-occurring in the cell or may have been introduced into the cellular genome or the genome of a precursor cell such as a precursor cell in vitro or precursor cell in vivo.

In one aspect of simultaneous introduction of different mutagens to a cell, one or more of the mutagens is produced endogenously. One or more mutagens is present in the genome of the cell and can provide for further insertion into the genome at one or more new locations. Thus, simultaneous mutagenesis can occur by causing the new insertions of one or more different mutagens from within the cell and can also occur when this endogenous introduction is concurrent in time with the introduction of an exogenous mutagen.

The mutation can result in a change in the expression level of a gene or level of activity of a gene product. "Activity" encompasses all functions of a gene product, e. g. structural, enzymatic, catalytic, allosteric, and signaling. In one embodiment, mutation results in a decrease or elimination of gene expression levels (RNA and/or protein) or a decrease or elimination of gene product activity (RNA and/or protein). Most mutations will decrease the activity of mutated genes. However, both the insertional and physicochemical mutagens can also act to increase or to qualitatively change (e.g. altered substrate on binding specificity, or regulation of protein activity) the activity of the product of the mutated gene. Although mutations will often generate phenotypes that maybe difficult to detect, most phenotypically detectable mutations change the level or activity of mutated genes in ways that are deleterious to the cell or organism.

The administration can be by any conventional means, including delivery by a mosquito vector, as described in greater detail below. The antibodies and/or cytotoxic lymphocytes can be identified and isolated by any conventional means well known to those of ordinary skill in the art.

Live attenuated vaccines, which reproduce natural immunity, have been used for the development of vaccines against many diseases. The advantages of live-attenuated vaccines are their capacity of replication and induction of both humoral and cellular immune responses. In addition, the immune response induced by a whole parasite vaccine against both the different components of the infected erythrocyte and the parasite itself reproduces those induced by natural infection.

The provision of attenuated vaccine strains of Plasmodium relates, at least in part, to the discovery by Applicant that genetic mutations affecting the genes responsible for the surface expression of PfEMPI can yield attenuated avirulent strains of Plasmodium falciparum which are immunogenic and protective against infection. In experiments described infra, gene disruption was used to generate mutants of Plasmodium falciparum, in particular mutants characterized by altered (e.g. increased or reduced) surface expression of PfEMPL Strains so produced are altered for wild- type surface expression of PfEMPI , a major virulence determinant of Plasmodium falciparum. The strains are demonstrated to be impaired in their ability to adhere to ligands (e.g. chondroitin sulfate (CSA)), and antibodies to PfEMPI from multigravid human females infected with Plasmodium falciparum exhibit reducted reactivity to these strains, demonstrating these lines have decreased expression of PfEMPI at the surface.

In some embodiments, the vaccine strains have a mutation to a gene wherein the mutation results in altered cytoadherence of erythrocytes infected with the strain of

Plasmodium falciparum. In a further embodiment, the mutation of the gene affects surface expression of PfEMPI In a further embodiment, the mutation of the gene affects trafficking of PfEMPI into erythrocytes infected with the strain. In a further embodiment, the mutation of the gene affects display of PfEMPI at the surface of erythrocytes infected with the strain. In a further embodiment, the mutation of the gene affects erythrocyte membrane rigidity of erythrocytes infected with the strain. In a further embodiment, the mutation of the gene affects knob morphology at erythrocyte membrane of erythrocytes infected with the strain. The administration can be by any conventional means, including delivery by a mosquito vector, as described in greater detail below.

The present invention provides compositions, and particularly vaccine compositions for therapeutic and prophylactic use. The compositions include an effective amount of a viable attenuated strain of Plasmodium. In one form of the composition, Plasmodium has altered (e.g. increased or reduced) surface expression of PfEMPI as compared to a non-engineered Plasmodium. The composition also includes a pharmaceutically acceptable excipient, and optionally an adjuvant. The vaccine strains and compositions containing vaccine strains are useful in methods for treating or preventing Plasmodium infections (such as malaria), comprising or consisting of administering to a subject in need thereof an effective amount of a Plasmodium vaccine as described herein, or a composition as described herein.

It will be appreciated that the present invention may be used to generate antibodies or cytotoxic lymphocytes to a pathogenic strain of Plasmodium falciparum. The method involves administering to a mammal an effective amount of an engineered vaccine strain of a Plasmodium falciparum as described herein. In particular, the strain may have an altered (e.g. increased or reduced) surface expression of PfEMPI as compared to a non-engineered Plasmodium.

In one embodiment, the altered surface expression results from a mutation of a gene affecting adherence of erythrocytes infected with the strain. In a further embodiment, the altered surface expression results from a mutation of a gene affecting trafficking of PfEMPI into erythrocytes infected with the strain. In a further embodiment, the reduced expression results from a mutation of a gene affecting display of PfEMPI at the surface of erythrocytes infected with the strain. In a further embodiment, the reduced expression results from a mutation of a gene affecting erythrocyte membrane rigidity of erythrocytes infected with the strain. In a further embodiment, the reduced expression results from a mutation of a gene affecting knob morphology at erythrocyte membrane of erythrocytes infected with the strain. The administration can be by any conventional means, including delivery by a mosquito vector, as described in greater detail below. The antibodies and/or cytotoxic lymphocytes can be identified and isolated by any conventional means well known to those of ordinary skill in the art.

It will also be apparent to the skilled person that Applicant's identification of the functions of Plasmodium polynucleotides and proteins provides new therapeutic targets. Accordingly, the present invention further provides methods for screening for agents capable of interfering with the expression or function of a polynucleotide or protein as described herein. As an example, the method may be used for identifying an agent that binds to and/or inhibits surface expression of PfEMPI in erythrocytes infected with Plasmodium falciparum. The method involves contacting a strain of Plasmodium falciparum containing a mutation into a gene affecting surface expression of PfEMPI and wild type Plasmodium falciparum with a test agent; measuring the activity (e.g. binding) of the test agent; and determining whether the test agent binds to and inhibits surface expression of PfEMPL In some embodiments, the strains have a mutation to a gene wherein the mutation results in altered cytoadherence of erythrocytes infected with the strain of Plasmodium falciparum. In a further embodiment, the mutation of the gene affects surface expression of PfEMPL In a further embodiment, the mutation of the gene affects trafficking of PfEMPI into erythrocytes infected with the strain. In a further embodiment, the mutation of the gene affects display of PfEMPI at the surface of erythrocytes infected with the strain. In a further embodiment, the mutation of the gene affects erythrocyte membrane rigidity of erythrocytes infected with the strain. In a further embodiment, the mutation of the gene affects knob morphology at erythrocyte membrane of erythrocytes infected with the strain.

It will also be apparent from the disclosure herein that the skilled person is provided with methods for identifying a candidate vaccine of a viable attenuated strain of Plasmodium falciparum. The method involves comparing PfEMPI expression of wild- type Plasmodium falciparum to PfEMPI expression of a mutant strain of Plasmodium falciparum and identifying the mutant strain of Plasmodium falciparum as a candidate vaccine when the mutant strain has reduced expression of PfEMPI compared to the wild-type strain. In one embodiment, the altered surface expression results from a mutation of a gene affecting adherence of erythrocytes infected with the strain. In a further embodiment, the altered surface expression results from a mutation of a gene affecting trafficking of PfEMPI into erythrocytes infected with the strain. In a further embodiment, the reduced expression results from a mutation of a gene affecting display of PfEMPI at the surface of erythrocytes infected with the strain. In a further embodiment, the reduced expression results from a mutation of a gene affecting erythrocyte membrane rigidity of erythrocytes infected with the strain. In a further embodiment, the reduced expression results from a mutation of a gene affecting knob morphology at erythrocyte membrane of erythrocytes infected with the strain.

The present invention further includes immunogenic molecules capable of eliciting an immune response against a wild-type strain of Plasmodium falciparum, or any of the following strains: 3D7, W2MEF, GHANA1 , V1_S, RO-33, PREICH, HB3, SANTALUCIA, 7G8, SENEGAL3404, FCC-2, K1 , RO-33, D6, DD2, or D10, or any other known or newly isolated strain of Plasmodium falciparum. The immunogenic molecules may be proteins comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 75, 77, 79, and 81.

While the immunogenic molecule will typically include amino acid sequences found in a protein of the strain for which protection is desired, this is not necessarily required. An isolate or strain of Plasmodium falciparum is a sample of parasites taken from an infected individual on a unique occasion. Typically, an isolate is uncloned, and may therefore contain more than one genetically distinct parasite clone. A Plasmodium falciparum line is a lineage of parasites derived from a single isolate, not necessarily cloned, which have some common phenotype (e.g. drug-resistance, ability to invade enzyme treated red cells etc.). A Plasmodium falciparum clone is the progeny of a single parasite, normally obtained by manipulation or serial dilution of uncloned parasites and then maintained in the laboratory. All the members of a clone have been classically defined as genetically identical, but this is not necessarily the case, since members of the clone may undergo mutations, chromosomal rearrangements, etc, which may survive in in vitro culture conditions.

Functional equivalents of the immunogenic proteins are included within the scope of the invention. The protein may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included are, for example, proteins containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), as well as other modifications known in the art. Proteins can occur as single chains or associated chains.

In one form of the invention, the functional equivalent is a contiguous amino acid sequence comprising or consisting of about 5 or more amino acids. In another form, the contiguous amino acid sequence molecule comprises about 8, 10, 20, 50, or 100 amino acids. The skilled person is capable of routine experimentation designed to identify the shortest efficacious sequence, or the length of sequence that provides the greatest or most effective immune response in the subject.

Similarly, the skilled person understands that strict compliance with any amino acid sequence disclosed herein is not necessarily required, and he or she could decide by a matter of routine whether any further mutation is deleterious or preferred. For example, where the protein has a given biological activity that can be assayed (such as promoting the adherence of an infected erythrocyte) the effect of any mutation on that biological activity may be directly observed. Thus, the immunogenic molecules of the present invention include sequences having 50% or more identity (e.g. 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or more) to any protein disclosed herein. The immunogenic molecules also include variants (e.g. allelic variants, homologs, orthologs, paralogs, mutants, etc.). The molecules may lack one or more amino acids (e.g. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 or more) from the C-terminus and/or one or more amino acids (e.g. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 or more) from the N-terminus.

Expression of the immunogenic molecules of the invention may take place in Plasmodium, however other heterologous hosts may be utilised. The heterologous host may be prokaryotic (e.g. a bacterium) or eukaryotic. It is preferably E. coli, but other suitable hosts include Bacillus subtilis, Vibrio cholerae, Salmonella typhi, Salmonella typhimurium, Neisseria lactamica, Neisseria cinerea, Mycobacteria (e.g. M. tuberculosis), yeasts, etc. The immunogenic molecules of the present invention may be present in the composition as individual separate polypeptides. Generally, the recombinant fusion proteins of the present invention are prepared as a GST-fusion protein and/or a His-tagged fusion protein.

Polypeptides of the invention can be prepared by various means (e.g. recombinant expression, purification from cell culture, chemical synthesis, etc.) and in various forms (e.g. native, fusions, non-glycosylated, lipidated, etc.). They are preferably prepared in substantially pure form (i.e. substantially free from other Plasmodial or host cell proteins).

While the immunogenic molecule may comprise a single antigenic region, by the use of well-known recombinant DNA methods, more than one antigenic region may be included in a single immunogenic molecule. At least two (i.e. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) antigens can be expressed as a single polypeptide chain (a 'hybrid' polypeptide). Hybrid polypeptides offer two principal advantages: first, a polypeptide that may be unstable or poorly expressed on its own can be assisted by adding a suitable hybrid partner that overcomes the problem; second, commercial manufacture is simplified as only one expression and purification need be employed in order to produce two polypeptides which are both antigenically useful.

Hybrid polypeptides can be represented by the formula NH₂-A-(-X-L-)_n-B-COOH, wherein: X is an amino acid sequence of a Plasmodium falciparum antigen as defined herein; L is an optional linker amino acid sequence; A is an optional N-terminal amino acid sequence; B is an optional C-terminal amino acid sequence; and n is 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14 or 15.

If a -X- moiety has a leader peptide sequence in its wild-type form, this may be included or omitted in the hybrid protein. In some embodiments, leader peptides (if present) will be deleted except for that of the -X- moiety located at the N-terminus of the hybrid protein i.e. a leader peptide of Xi will be retained, but the leader peptides of X₂ ... X_n will be omitted. This is equivalent to deleting all leader peptides and using the leader peptide of Xi as moiety -A-.

For each n instances of (-X-L-), linker amino acid sequence -L- may be present or absent. For instance, when n=2 the hybrid may be NH₂-XrL₁-X₂-L₂-COOH, NH₂-X₁- X₂-COOH₅ NH₂-X₁-L₁-X₂-COOH, NH₂-XI -X2-L2-COO H, etc. Linker amino acid sequence(s) -L- will typically be short (e.g. 20 or fewer amino acids i.e. 19, 18, 17, 16, 15, 14, 13, 12, 1 1 , 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 ). Examples comprise short peptide sequences which facilitate cloning, poly-glycine linkers (i.e. comprising or consisting of GIy_n where n = 2, 3, 4, 5, 6, 7, 8, 9, 10 or more), and histidine tags (i.e. His_n where n = 3, 4, 5, 6, 7, 8, 9, 10 or more). Other suitable linker amino acid sequences will be apparent to those skilled in the art. A useful linker is GSGGGG, with the Gly-Ser dipeptide being formed from a BamHI restriction site, thus aiding cloning and manipulation, and the (GIy)₄ tetrapeptide being a typical poly-glycine linker. The same variants apply to (-Y-L-). Therefore, for each m instances of (-Y-L-), linker amino acid sequence -L- may be present or absent.

-A- is an optional N-terminal amino acid sequence. This will typically be short (e.g. 40 or fewer amino acids i.e. 39, 38, 37, 36, 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 , 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 ). Examples include leader sequences to direct protein trafficking, or short peptide sequences which facilitate cloning or purification (e.g. histidine tags i.e. His_n where n = 3, 4, 5, 6, 7, 8, 9, 10 or more). Other suitable N-terminal amino acid sequences will be apparent to those skilled in the art. If Xi lacks its own N-terminus methionine, -A- is preferably an oligopeptide (e.g. with 1 , 2, 3, 4, 5, 6, 7 or 8 amino acids) which provides an N- terminus methionine.

-B- is an optional C-terminal amino acid sequence. This will typically be short (e.g. 40 or fewer amino acids i.e. 39, 38, 37, 36, 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 , 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 ). Examples include sequences to direct protein trafficking, short peptide sequences which facilitate cloning or purification (e.g. comprising or consisting of histidine tags i.e. His_n, where n = 3, 4, 5, 6, 7, 8, 9, 10 or more), or sequences which enhance protein stability. Other suitable C-terminal amino acid sequences will be apparent to those skilled in the art. Most preferably, n is 2 or 3.

The invention provides a process for producing an immunogenic molecule of the invention, comprising or consisting of the step of synthesising at least part of the immunogenic molecule by chemical means.

Polypeptides used with the invention can be prepared by various means (e.g. recombinant expression, purification from cell culture, chemical synthesis, etc.). Recombinantly-expressed proteins are preferred, particularly for hybrid polypeptides.

Polypeptides used with the invention are preferably provided in purified or substantially purified form i.e. substantially free from other polypeptides (e.g. free from naturally-occurring polypeptides), particularly from other Plasmodium or host cell polypeptides, and are generally at least about 50% pure (by weight), and usually at least about 90% pure i.e. less than about 50%, and more preferably less than about 10% (e.g. 5%) of a composition is made up of other expressed polypeptides. Thus the antigens in the compositions are separated from the whole organism with which the molecule is expressed.

The present invention provides compositions comprising or consisting of an immunogenic protein molecule as described herein. Compositions of the invention can be combined with pharmaceutically acceptable excipient. Such excipients include any excipient that does not itself induce the production of antibodies harmful to the individual receiving the composition. Suitable carriers are typically large, slowly metabolised macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, sucrose, trehalose, lactose, and lipid aggregates (such as oil droplets or liposomes). Such carriers are well known to those of ordinary skill in the art. The vaccines may also contain diluents, such as water, saline, glycerol, etc. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present. Sterile pyrogen-free, phosphate-buffered physiologic saline is a typical carrier.

The pH of the composition is preferably between 6 and 8, preferably about 7. The pH may be maintained by the use of a buffer. A phosphate buffer is typical. The composition may be sterile and/or pyrogen-free. The composition may be isotonic with respect to humans. Compositions may include sodium salts (e.g. sodium chloride) to give tonicity. A concentration of 10+/-2 mg/ml NaCI is typical. Compositions may also comprise a detergent e.g. a Tween (polysorbate), such as Tween 80. Detergents are generally present at low levels e.g. <0.01 %.

Compositions may comprise a sugar alcohol (e.g. mannitol) or a disaccharide (e.g. sucrose or trehalose) e.g. at around 15-30 mg/ml (e.g. 25 mg/ml), particularly if they are to be lyophilised or if they include material which has been reconstituted from lyophilised material. The pH of a composition for lyophilisation may be adjusted to around 6.1 prior to lyophilisation.

The composition may further comprise an antimalarial that is useful for the treatment of Plasmodial infection. Preferred antimalarials for use in the compositions include the chloroquine phosphate, proguanil, primaquine, doxycycline, mefloquine, clindamycin, halofantrine, quinine sulphate, quinine dihydrochloride, gluconate, primaquine phosphate and sulfadoxine.

The compositions of the invention may also comprise one or more immunoregulatory agents. Preferably, one or more of the immunoregulatory agents include(s) an adjuvant. The adjuvant may be selected from one or more of the group consisting of a TH1 adjuvant and TH2 adjuvant, further discussed below.

Adjuvants which may be used in compositions of the invention include, but are not limited to those described in the following passages.

Mineral containing compositions suitable for use as adjuvants in the invention include mineral salts, such as aluminium salts and calcium salts. The invention includes mineral salts such as hydroxides (e.g. oxyhydroxides), phosphates (e.g. hydroxyphosphates, orthophosphates), sulphates, etc. (e.g. see chapters 8 & 9 of Powell & Newman (eds.) Vaccine Design (1995) Plenum), or mixtures of different mineral compounds, with the compounds taking any suitable form (e.g. gel, crystalline, amorphous, etc.), and with adsorption being preferred. The mineral containing compositions may also be formulated as a particle of metal salt (WO00/23105).

A typical aluminium phosphate adjuvant is amorphous aluminium hydroxyphosphate with PO₄/AI molar ratio between 0.84 and 0.92, included at 0.6 mg AI³⁺AnI. Adsorption with a low dose of aluminium phosphate may be used e.g. between 50 and 100 μg Al³⁺ per conjugate per dose. Where an aluminium phosphate it used and it is desired not to adsorb an antigen to the adjuvant, this is favoured by including free phosphate ions in solution (e.g. by the use of a phosphate buffer).

Oil emulsion compositions suitable for use as adjuvants in the invention include oil-in- water emulsions and water-in-oil emulsions.

A submicron oil-in-water emulsion may include squalene, Tween 80, and Span 85 e.g. with a composition by volume of about 5% squalene, about 0.5% polysorbate 80 and about 0.5% Span 85 (in weight terms, 4.3% squalene, 0.5% polysorbate 80 and 0.48% Span 85), known as 'MF595' (57-59 chapter 10 of Powell & Newman (eds.) Vaccine Design (1995) Plenum; chapter 12 of O'Hagen (ed.) Vaccine Adjuvants: Preparation Methods and Research Protocols (Volume 42 of Methods in Molecular Medicine series)). The MF59 emulsion advantageously includes citrate ions e.g. 10 mM sodium citrate buffer.

An emulsion of squalene, a tocopherol, and Tween 80 can be used. The emulsion may include phosphate buffered saline. It may also include Span 85 (e.g. at 1 %) and/or lecithin. These emulsions may have from 2 to 10% squalene, from 2 to 10% tocopherol and from 0.3 to 3% Tween 80, and the weight ratio of squalene tocopherol is preferably <1 as this provides a more stable emulsion. One such emulsion can be made by dissolving Tween 80 in PBS to give a 2% solution, then mixing 90ml of this solution with a mixture of (5 g of DL-α-tocopherol and 5ml squalene), then microfluidising the mixture. The resulting emulsion may have submicron oil droplets e.g. with an average diameter of between 100 and 250nm, preferably about 180nm.

An emulsion of squalene, a tocopherol, and a Triton detergent (e.g. Triton X-100) can be used.

An emulsion of squalane, polysorbate 80 and poloxamer 401 ("Pluronic™ L 121") can be used. The emulsion can be formulated in phosphate buffered saline, pH 7.4. This emulsion is a useful delivery vehicle for muramyl dipeptides, and has been used with threonyl-MDP in the "SAF-I" adjuvant, (0.05-1% Thr-MDP, 5% squalane, 2.5% Pluronic L121 and 0.2% polysorbate 80). It can also be used without the Thr-MDP, as in the "AF" adjuvant (Hariharan et al. (1995) Cancer Res 55:3486-9) (5% squalane, 1.25% Pluronic L121 and 0.2% polysorbate 80). Microfluidisation is preferred.

Complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA) may also be used.

Saponin formulations may also be used as adjuvants in the invention (see for example Chapter 22 of Powell & Newman (eds.) Vaccine Design (1995) Plenum). Saponins are a heterologous group of sterol glycosides and triterpenoid glycosides that are found in the bark, leaves, stems, roots and even flowers of a wide range of plant species.

Saponin from the bark of the Quillaia saponaria Molina tree have been widely studied as adjuvants. Saponin can also be commercially obtained from Smilax ornata (sarsaprilla), Gypsophilla paniculata (brides veil), and Saponaria officianalis (soap root). Saponin adjuvant formulations include purified formulations, such as QS21 , as well as lipid formulations, such as ISCOMs. QS21 is marketed as Stimulon™.

Saponin compositions have been purified using HPLC and RP-HPLC. Specific purified fractions using these techniques have been identified, including QS7, QS 17, QSI 8,

QS21 , QH-A, QH-B and QH-C. Preferably, the saponin is QS21. A method of production of QS21 is disclosed in ref. 63. Saponin formulations may also comprise a sterol, such as cholesterol (WO96/33739).

As discussed supra, combinations of saponins and cholesterols can be used to form unique particles called immunostimulating complexs (ISCOMs) (see for example Chapter 23 of Powell & Newman (eds.) Vaccine Design (1995) Plenum). ISCOMs typically also include a phospholipid such as phosphatidylethanolamine or phosphatidylcholine. Any known saponin can be used in ISCOMs. Preferably, the

ISCOM includes one or more of QuilA, QHA and QHC. ISCOMs are further described in WO96/33739, EP-A-0109942, WO96/1171 1 ). Optionally, the ISCOMS may be devoid of additional detergent WO00/07621.

A review of the development of saponin based adjuvants can be found in Barr et al. (1998) Advanced Drug Delivery Reviews 32:247-271 and Sjolanderet et al. (1998) Advanced Drug Delivery Reviews 32:321-338.

Virosomes and virus-like particles (VLPs) can also be used as adjuvants in the invention. These structures generally contain one or more proteins from a virus optionally combined or formulated with a phospholipid. They are generally nonpathogenic, non-replicating and generally do not contain any of the native viral genome. The viral proteins may be recombinantly produced or isolated from whole viruses. These viral proteins suitable for use in virosomes or VLPs include proteins derived from influenza virus (such as HA or NA), Hepatitis B virus (such as core or capsid proteins), Hepatitis E virus, measles virus, Sindbis virus, Rotavirus, Foot-and- Mouth Disease virus, Retrovirus, Norwalk virus, human Papilloma virus, HIV, RNA- phages, Qβ-phage (such as coat proteins), GA-phage, fr-phage, AP205 phage, and Ty (such as retrotransposon Ty protein pi). VLPs are discussed further in (Niikura et al. (2002) Virology 293:273-280, Lenz et al. (2001 ) J Immunol 166:5346-5355, Pinto et al. (2003) J Infect Dis 188:327-338, Gerber et al. (2001 ) Virol 75:4752-4760, WO03/024480 and WO03/024481 ). Virosomes are discussed further in, for example, Gluck et al. (2002) Vaccine 20:B10-B16.

Adjuvants suitable for use in the invention include bacterial or microbial derivatives such as non-toxic derivatives of enterobacterial lipopolysaccharide (LPS), Lipid A derivatives, immunostiinulatory oligonucleotides and ADP-ribosylating toxins and detoxified derivatives thereof.

Non-toxic derivatives of LPS include monophosphoryl lipid A (MPL) and 3-0- deacylated MPL (3dMPL). 3dMPL is a mixture of 3 de-O-acylated monophosphoryl lipid A with 4, 5 or 6 acylated chains. A preferred "small particle" form of 3 De-O- acylated monophosphoryl lipid A is disclosed in ref. 77. Such "small particles" of 3dMPL are small enough to be sterile filtered through a 0.22 μm membrane (EP-A- 0689454v). Other non-toxic LPS derivatives include monophosphoryl lipid A mimics, such as aminoalkyl glucosamine de phosphate derivatives e.g. RC-529 (Johnson et al (1999) Bioorg Med Chem Lett 9:2273-2278, Evans et al. (2003) Expert Rev Vaccines 2:219-229).

Lipid A derivatives include derivatives of lipid A from Escherichia coli such as OM-174. OM- 174 is described for example in Meraldi et al. (2003) Vaccine 21 :2485-2491 , Pajak et al. (2003) Vaccine 21 :836-842.

lmmunostimulatory oligonucleotides suitable for use as adjuvants in the invention include nucleotide sequences containing a CpG motif (a dinucleotide sequence containing an unmethylated cytosine linked by a phosphate bond to a guanosine). Double-stranded RNAs and oligonucleotides containing palindromic or poly(dG) sequences have also been shown to be immunostimulatory.

The CpG's can include nucleotide modifications/analogs such as phosphorothioate modifications and can be double-stranded or single-stranded. Kandimalla et al (2003) Nucleic Acids Research 31 : 2393-2400, WO02/26757 and WO99/62923 disclose possible analog substitutions e.g. replacement of guanosine with 2'-deoxy-7- deazaguanosine. The adjuvant effect of CpG oligonucleotides is further discussed in Krieg (2003) Nature Medicine 9:831-835, McCluskie et al. (2002) FEMS Immunology and Medical Microbiology 32:179-185, WO98/40100, US patent 6,207,646, US patent 6,239,1 16 and US patent 6,429,199.

The CpG sequence may be directed to TLR9, such as the motif GTCGTT or TTCGTT (Kandimalla et al. (2003) Biochemical Society Transactions 31 (part 3):654-658). The

CpG sequence may be specific for inducing a TH1 immune response, such as a CpG-

A ODN, or it may be more specific for inducing a B cell response, such a CpG-B ODN.

CpG-A and CpG-B ODNs are discussed in refs. Blackwell et al. (2003) J Immunol

170:4061-4068, Krieg (2002) Trends Immunol 23:64-65. Preferably, the CpG is a CpG-A ODN.

Preferably, the CpG oligonucleotide is constructed so that the 5' end is accessible for receptor recognition. Optionally, two CpG oligonucleotide sequences may be attached at their 3' ends to form "immunomers". See, for example, Kandimalla et al. (2003) Biochemical Society Transactions 31 (part 3):654-658, Kandimalla et al (2003), BBRC 306:948-953, Bhagat et al. (2003) BBRC 300:853-861 and WO03/035836.

Other immunostimulatory oligonucleotides include a double-stranded RNA or an oligonucleotide containing a palindromic sequence, or an oligonucleotide containing a poly(dG) sequence.

Bacterial ADP-ribosylating toxins and detoxified derivatives thereof may be used as adjuvants in the invention. Preferably, the protein is derived from E.coli (E.coli heat labile enterotoxin "LT"), cholera ("CT"), or pertussis ("PT"). The use of detoxified ADP- ribosylating toxins as mucosal adjuvants is described in WO95/17211 and as parenteral adjuvants in WO98/42375. The toxin or toxoid is preferably in the form of a holotoxin, comprising or consisting of both A and B subunits. Preferably, the A subunit contains a detoxifying mutation; preferably the B subunit is not mutated. Preferably, the adjuvant is a detoxified LT mutant such as LT-K63, LT-R72, and LT-G192. The use of ADP-ribosylating toxins and detoxified derivatives thereof, particularly LT-K63 and LT-R72, as adjuvants can be found in Beignon et al. (2002) Infect lmmun 70:3012-3019, Pizza et al. (2001 ) Vaccine 19:2534-2541 , Pizza et al. (2000) lnt J Med Microbiol 290:455-461 , Scharton-Kersten et al. (2000) Infect lmmun 68:5306-5313, Ryan et al. (1999) Infect lmmun 67:6270-6280, Partidos et al. (1999) Immunol Lett 67:209-216, Peppoloni et al. (2003) Expert Rev Vaccines 2:285-293, Pine et al. (2002) J Control Release 85:263-270. Numerical reference for amino acid substitutions is preferably based on the alignments of the A and B subunits of ADP- ribosylating toxins set forth in Domenighini et al. (1995) MoI Microbiol 15:1 165-1 167, specifically incorporated herein by reference in its entirety.

Human immunomodulators suitable for use as adjuvants in the invention include cytokines, such as interleukins (e.g. IL-I5 IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, IL-17, IL-18

(WO99/40936), IL-23, IL27 (Matsui M. et al. (2004) J. Virol 78: 9093) etc.)

(WO99/44636), interferons (e.g. interferon-γ), macrophage colony stimulating factor, tumor necrosis factor and macrophage inflammatory protein-1 alpha (MIP-1 alpha) and MIP-1 beta (Lillard JW et al, (2003) Blood 101 (3):807-14).

Bioadhesives and mucoadhesives may also be used as adjuvants in the invention.

Suitable bioadhesives include esterified hyaluronic acid microspheres (Singh et al) (2001 ) JCont Release 70:267-276) or mucoadhesives such as cross-linked derivatives of poly(acrylic acid), polyvinyl alcohol, polyvinyl pyrollidone, polysaccharides and carboxymethylcellulose. Chitosan and derivatives thereof may also be used as adjuvants in the invention (WO99/27960).

Microparticles may also be used as adjuvants in the invention. Microparticles (i.e. a particle of ~100nm to ~150μm in diameter, more preferably ~200nm to ~30μm in diameter, and most preferably ~500nm to ~10μm in diameter) formed from materials that are biodegradable and non-toxic (e.g. a poly(α-hydroxy acid), a polyhydroxybutyric acid, a polyorthoester, a polyanhydride, a polycaprolactone, etc.), with poly(lactide-co-glycolide) are preferred, optionally treated to have a negatively- charged surface (e.g. with SDS) or a positively-charged surface (e.g. with a cationic detergent, such as CTAB).

Examples of liposome formulations suitable for use as adjuvants are described in US patent 6,090,406, US patent 5,916,588, EP-A-0626169.

Adjuvants suitable for use in the invention include polyoxyethylene ethers and polyoxyethylene esters (WO99/52549). Such formulations further include polyoxyethylene sorbitan ester surfactants in combination with an octoxynol (WO01/21207) as well as polyoxyethylene alkyl ethers or ester surfactants in combination with at least one additional non-ionic surfactant such as an octoxynol (WO01/21 152). Preferred polyoxyethylene ethers are selected from the following group: polyoxyethylene-9-lauryl ether (laureth 9), polyoxyethylene-9-steoryl ether, polyoxytheylene-8-steoryl ether, polyoxyethylene-4-lauryl ether, polyoxyethylene-35- lauryl ether, and polyoxyethylene-23-lauryl ether.

Phosphazene adjuvants include poly(di(carboxylatophenoxy)phosphazene) ("PCPP") as described, for example, in references Andrianov et al. (1998) Biomaterials 19:109- 115 and Payne et al. (1998) Adv Drug Delivery Review 31 :185-196.

Examples of muramyl peptides suitable for use as adjuvants in the invention include

N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-normuramyl-L- alanyl-D-isoglutamine (nor-MDP), and N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L- alanine-2-(1 '-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine MTP-PE).

Imidazoquinoline adjuvants include Imiquimod ("R-837") (US 4,680,338 and US 4,988,815), Resiquimod ("R-848") (WO92/15582), and their analogs; and salts thereof (e.g. the hydrochloride salts). Further details about immunostimulatory imidazoquinolines can be found in references Stanley (2002) Clin Exp Dermatol 27:571-577, Wu et al. (2004) Antiviral Res. 64(2):79-83, Vasilakos et al. (2000) Cell Immunol. 204(l):64-74, US patents 4689338, 4929624, 5238944, 5266575, 5268376, 5346905, 5352784, 5389640, 5395937, 5482936, 5494916, 5525612, 6083505, 6440992, 6627640, 6656938, 6660735, 6660747, 6664260, 6664264, 6664265, 6667312, 6670372, 6677347, 6677348, 6677349, 6683088, 6703402, 6743920, 6800624, 6809203, 6888000 and 6924293 and Jones (2003) Curr Opin Investig Drugs 4:214-218.

Thiosemicarbazone adjuvants include those disclosed in WO2004/060308. Methods of formulating, manufacturing, and screening for active compounds are also described in WO2004/060308. The thiosemicarbazones are particularly effective in the stimulation of human peripheral blood mononuclear cells for the production of cytokines, such as TNF-α.

Tryptanthrin adjuvants include those disclosed in WO2004/064759. Methods of formulating, manufacturing, and screening for active compounds are also described in WO2004/064759. The thiosemicarbazones are particularly effective in the stimulation of human peripheral blood mononuclear cells for the production of cytokines, such as TNF-α.

Various nucleoside analogs can be used as adjuvants, such as (a) lsatorabine (ANA- 245; 7-thia- 8-oxoguanosine) and prodrugs thereof; (b) ANA975; (c) ANA-025-1 ; (d) ANA380; (e) the compounds disclosed in US 6,924,271 , US2005/0070556 and US 5,658,731 , or (f) a pharmaceutically acceptable salt of any of (a) to (e), a tautomer of any of (a) to (e), or a pharmaceutically acceptable salt of the tautomer.

Q. Lipids linked to a phosphate-containing acyclic backbone Adjuvants containing lipids linked to a phosphate-containing acyclic backbone include the TLR4 antagonist E5564 (Wong et al. (2003) J Clin Pharmacol 43(7):735-42 and US2005/0215517).

Small molecule immunopotentiators useful ad adjuvants include N2-methyl-1-(2- methylpropyl)-1 H-imidazo(4,5-c)quinoline-2,4-diamine; N2,N2-dimethyl-1-(2- methylpropyl)-1 H-imidazo(4,5-c)quinoline-2,4-diamine; N2-ethyl-N2-methyl-1 -(2- methylpropyl)-1 H-imidazo(4,5-c)quinoline-2,4-diamine; N2-methyl-1-(2-methylpropyl)- N2-propyl-1 H-imidazo(4,5-c)quinoline-2,4-diamine; 1 -(2-methylpropyl)-N2-propyl-1 H- imidazo(4,5-c)quinoline-2,4-diamine; N2-butyl-1 -(2-methylpropyl)-1 H-imidazo(4,5- c)quinoline-2,4-diamine; N2-butyl-N2-methyl-1-(2-methylpropyl)-1 H-imidazo(4,5- c)quinorme-2,4-diamine; N2-methyl-1 -(2-methylpropyl)-N2-pentyl-1 H-imidazo(4,5- c)quinoline-2,4-diamine; N2-methyl-1 -(2-methylpropyl)-N2-prop-2-enyl-1 H- imidazo(4,5-c)quinoline-2,4- diamine; 1 -(2-methylpropyl)-2-((phenylmethyl)thio)-1 H- imidazo (4,5-c)quinolin-4-amine; 1-(2-methylpropyl)-2-(propylthio)-1 H-imidazo(4,5- c)quinolin-4-amine; 2-((4-amino-1 -(2-methylpropyl)-1 H-imidazo(4,5-c)quinolin-2- yl)(methyl)amino)ethanol; 2-((4-amino-1 -(2-methylpropyl)-1 H-imidazo(455-c)quinolin- 2-yl)(methyl)amino)ethyl acetate; 4-amino-1-(2-methylpropyl)-1 ,3-dihydro-2H- imidazo(4,5-c)quinolin-2-one; N2-butyl-1-(2-methylpropyl)-N4,N4-bis(phenylmethyl)- 1 H-imidazo(4,5-c)quinoline-2,4-diamine; N2-butyl-N2-methyl-1 -(2-methylpropyl)-

N4,N4-bis(phenylmethyl)-1 H-imidazo(4,5- c)quinoline-2,4-diamine; N2-methyl-1-(2- methylpropyl)-N4,N4-bis(phenylmethyl)-1 H-imidazo(4,5-c)quinolne-2,4-diamine; N2,N2-dimethyl-1-(2-methylpropyl)-N4,N4-bis(phenylmethyl)-1 H-imidazo(4,5- c)quinoline-2,4-diamine; 1- (4-amino-2-(methyl(propyl)amino)-1 H-imidazo(4,5- c)quinolin-1 -yl}-2-methylpropan-2-ol; 1 -(4-amino-2-(propylaniino)-1 H-imidazo(4,5- c)quinolin-1-yl)-2-methylpropan-2-ol; N43N4-dibenzyl-1-(2-methoxy-2-methylpropyl)- N2propyl-1 H-imidazo(4,5-c)quinoline-2,4-diamine.

One potentailly useful adjuvant is an outer membrane protein proteosome preparation prepared from a first Gram- negative bacterium in combination with a liposaccharide preparation derived from a second Gram-negative bacterium, wherein the outer membrane protein proteosome and liposaccharide preparations form a stable non- covalent adjuvant complex. Such complexes include "IVX-908", a complex comprised of Neisseria meningitidis outer membrane and lipopolysaccharides. They have been used as adjuvants for influenza vaccines (WO02/072012).

Other substances that act as immunostimulating agents are disclosed in Vaccine Design ((1995) eds. Powell & Newman. ISBN: 030644867X. Plenum) and Vaccine

Adjuvants: Preparation Methods and Research Protocols (Volume 42 of Methods in

Molecular Medicine series) (ISBN: 1-59259-083-7. Ed. O'Hagan). Further useful adjuvant substances include: Methyl inosine 5 '-monophosphate ("MIMP") Signorelli

& Hadden (2003) lnt lmmunopharmacol 3(8):1177); a polyhydroxlated pyrrolizidine compound (WO2004/064715), examples include, but are not limited to: casuarine, casuarine-6-α-D-glucopyranose, 3-epz-casuarine, 7-epz-casuarine, 3,7-diepz- casuarine, etc; a gamma inulin (Cooper (1995) Phar Biotechnol 6:559) or derivative thereof, such as algammulin; compounds disclosed in PCT/US2005/022769; compounds disclosed in WO2004/87153, including: Acylpiperazine compounds, lndoledione compounds, Tetrahydraisoquinoline (THIQ) compounds, Benzocyclodione compounds, Aminoazavinyl compounds, Aminobenzimidazole quinolinone (ABIQ) compounds (US6,606617, WO02/018383), Hydrapthalamide compounds, Benzophenone compounds, Isoxazole compounds, Sterol compounds, Quinazilinone compounds, Pyrrole compounds (WO/04/018455), Anthraquinone compounds, Quinoxaline compounds, Triazine compounds, Pyrazalopyrimidine compounds, and Benzazole compounds (WO03/082272); loxoribine (7-allyl-8- oxoguanosine) (US 5,011 ,828); a formulation of a cationic lipid and a (usually neutral) co-lipid, such as aminopropyl- dimethyl-myristoleyloxy-propanaminium bromide- diphytanoylphosphatidyl- ethanolamine ("Vaxfectin™") or aminopropyl-dimethyl-bis- dodecyloxy-propanaminium bromide-dioleoylphosphatidyl-ethanolamine ("GAP- DLRIE:DOPE"). Formulations containing (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3- bis(syn-9-tetradeceneyloxy)-l- propanaminium salts are preferred (US6,586,409).

The invention may also comprise combinations of aspects of one or more of the adjuvants identified above. For example, the following adjuvant compositions may be used in the invention: (1 ) a saponin and an oil-in-water emulsion (WO99/1 1241 ); (2) a saponin (e.g. QS21 ) + a nontoxic LPS derivative (e.g. 3dMPL) (WO94/00153); (3) a saponin (e.g. QS21 ) + a non-toxic LPS derivative (e.g. 3dMPL) + a cholesterol; (4) a saponin (e.g. QS21 ) + 3dMPL + IL-12 (optionally + a sterol) (WO98/57659); (5) combinations of 3dMPL with, for example, QS21 and/or oil-in-water emulsions (EP0835318, EP0735898, EP0761231 ); (6) RibiTM adjuvant system (RAS), (Ribi Imrnunochern) containing 2% squalene, 0.2% Tween 80, and one or more bacterial cell wall components from the group consisting of monophosphorylipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL + CWS (Detox™); and (7) one or more mineral salts (such as an aluminum salt) + a non-toxic derivative of LPS (such as 3dMPL).

Some forms of the composition contain more than one Plasmodium falciparum- derived immunogenic molecule. It is further contemplated that any combination of essential Plasmodium falcaiprum immunogenic molecules with other Plasmodium falcaiprum immunogenic molecules may be present in the composition.

Similarly, the skilled person understands that strict compliance with any amino acid sequence disclosed herein is not necessarily required, and he or she could decide by a matter of routine whether any further mutation is deleterious or preferred. Thus, the immunogenic molecules of the present invention include sequences having 50% or more identity (e.g. 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or more) to any protein disclosed herein. The immunogenic molecules also include variants (e.g. allelic variants, homologs, orthologs, paralogs, mutants, etc.). The molecules may lack one or more amino acids (e.g. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 or more) from the C-terminus and/or one or more amino acids (e.g. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 or more) from the N-terminus.

Vaccines according to the present invention may either be prophylactic (i.e. to prevent infection) or therapeutic (i.e. to treat infection), but will typically be prophylactic. Accordingly, the invention includes a method for the therapeutic or prophylactic treatment of Plasmodium infection in an animal susceptible to Plasmodium infection comprising or consisting of administering to said animal a therapeutic or prophylactic amount of the immunogenic compositions of the invention.

The compositions of the invention may elicit both a cell mediated immune response as well as a humoral immune response in order to effectively address a Plasmodium intracellular infection. This immune response will preferably induce long lasting antibodies and a cell mediated immunity that can quickly respond upon exposure to Plasmodium.

Two types of T cells, CD4 and CD8 cells, are generally thought necessary to initiate and/or enhance cell mediated immunity and humoral immunity. CD8 T cells can express a CD8 co- receptor and are commonly referred to as Cytotoxic T lymphocytes (CTLs). CD8 T cells are able to recognized or interact with antigens displayed on MHC Class I molecules.

CD4 T cells can express a CD4 co-receptor and are commonly referred to as T helper cells. CD4 T cells are able to recognize antigenic peptides bound to MHC class Il molecules. Upon interaction with a MHC class Il molecule, the CD4 cells can secrete factors such as cytokines. These secreted cytokines can activate B cells, cytotoxic T cells, macrophages, and other cells that participate in an immune response. Helper T cells or CD4+ cells can be further divided into two functionally distinct subsets: TH1 phenotype and TH2 phenotypes which differ in their cytokine and effector function. Activated TH1 cells enhance cellular immunity (including an increase in antigen- specific CTL production) and are therefore of particular value in responding to intracellular infections. Activated TH1 cells may secrete one or more of IL-2, IFN- gamma, and TNF-beta. A TH1 immune response may result in local inflammatory reactions by activating macrophages, NK (natural killer) cells, and CD8 cytotoxic T cells (CTLs). A TH1 immune response may also act to expand the immune response by stimulating growth of B and T cells with IL-12. TH1 stimulated B cells may secrete lgG2a.

Activated TH2 cells enhance antibody production and are therefore of value in responding to extracellular infections. Activated TH2 cells may secrete one or more of IL-4, IL-5, IL-6, and IL- 10. A TH2 immune response may result in the production of IgGI. IgE, IgA and memory B cells for future protection.

An enhanced immune response may include one or more of an enhanced TH1 immune response and a TH2 immune response.

An enhanced TH1 immune response may include one or more of an increase in CTLs, an increase in one or more of the cytokines associated with a TH1 immune response (such as IL-2, IFN-gamma, and TNF-beta), an increase in activated macrophages, an increase in NK activity, or an increase in the production of lgG2a. Preferably, the enhanced TH1 immune response will include an increase in lgG2a production.

A TH1 immune response may be elicited using a TH1 adjuvant. A TH1 adjuvant will generally elicit increased levels of lgG2a production relative to immunization of the antigen without adjuvant. TH1 adjuvants suitable for use in the invention may include for example saponin formulations, virosomes and virus like particles, non-toxic derivatives of enterobacterial lipopolysaccharide (LPS), immunostimulatory oligonucleotides. Immunostimulatory oligonucleotides, such as oligonucleotides containing a CpG motif, are preferred TH1 adjuvants for use in the invention.

An enhanced TH2 immune response may include one or more of an increase in one or more of the cytokines associated with a TH2 immune response (such as IL-4, IL-5, IL-6 and IL-10), or an increase in the production of IgGI, IgE, IgA and memory B cells. Preferably, the enhanced TH2 immune response will include an increase in IgGI production. A TH2 immune response may be elicited using a TH2 adjuvant. A TH2 adjuvant will generally elicit increased levels of IgGI production relative to immunization of the antigen without adjuvant. TH2 adjuvants suitable for use in the invention include, for example, mineral containing compositions, oil-emulsions, and ADP-ribosylating toxins and detoxified derivatives thereof. Mineral containing compositions, such as aluminium salts are preferred TH2 adjuvants for use in the invention.

The invention includes a composition comprising or consisting of a combination of a TH1 adjuvant and a TH2 adjuvant. Such a composition may elicit an enhanced TH1 and an enhanced TH2 response, i.e., an increase in the production of both IgGI and lgG2a production relative to immunization without an adjuvant. The composition may comprise a combination of a TH 1 and a TH2 adjuvant elicits an increased TH1 and/or an increased TH2 immune response relative to immunization with a single adjuvant (i.e., relative to immunization with a TH1 adjuvant alone or immunization with a TH2 adjuvant alone).

The immune response may be one or both of a TH1 immune response and a TH2 response. Preferably, immune response provides for one or both of an enhanced TH1 response and an enhanced TH2 response. The TH1/TH2 response in mice may be measured by comparing lgG2a and IgGI titres, while the TH1/TH2 response in man may be measured by comparing the levels of cytokines specific for the two types of response (e.g. the IFN-γ/IL-4 ratio).

In one form of the method of treatment or prevention the subject is a human. The human may be an infant, a child, an adolescent, or an adult. Use of the vaccine may be especially important in women in child-bearing years. Pregnant women, particularly in the second and third trimesters of pregnancy are more likely to develop severe malaria than other adults, often complicated by pulmonary oedema and hypoglycaemia. Maternal mortality is approximately 50%, which is higher than in non- pregnant adults. Fetal death and premature labor are common.

One way of monitoring vaccine efficacy for therapeutic treatment involves monitoring Plasmodium falciparum infection after administration of the compositions of the invention. One way of checking efficacy of prophylactic treatment involves monitoring immune responses systemically (such as monitoring the level of IgGI and lgG2a production) against the Plasmodium antigens in the compositions of the invention after administration of the composition. Serum Plasmodium specific antibody responses may be determined post-immunisation and post-challenge.

The uses and methods are for the prevention and/or treatment of a disease caused by Plasmodium (e.g. malaria) and/or its clinical manifestations (e.g. prostration, impaired consciousness, respiratory distress (acidotic breathing), multiple convulsions, circulatory collapse, pulmonary oedema (radiological), abnormal bleeding, jaundice, haemoglobinuria, etc.).

The compositions of the present invention can be evaluated in in vitro and in vivo animal models prior to host, e.g., human, administration. For example, in vitro neutralization an/or invasion inhibition is suitable for testing vaccine compositions (such as immunogenic/immunoprotective compositions) directed toward Plasmodium.

Reaction to the vaccine may be evaluated in vitro and in vivo following host e.g. human, administration. For example, response to vaccine compositions may examined by Enzyme-Linked Immunosorbent Assay (ELISA). For example, ELISA may be conducted as follows: Plates (e.g. flat-bottomed microtiter plates (Maxisorp from Nunc A/S or High Binding from Costar, Cat. No. 3590) may be coated with 50 μL of peptide solution or crude parasite antigen at 10 μg/mL in coating buffer. Keep the plate at 4⁰C overnight. With many proteins or peptides, PBS can be used as a coating solution. Block with 100 μL of 0.5% BSA in coating buffer for 3 to 4 h at 37⁰C. Wash 4 times with 0.9% NaCI plus 0.05% Tween. Add 50 μL of serum samples diluted 1 :1000; leave them for 1 h at 37⁰C. Wash 4 times with 0.9% NaCI plus 0.05% Tween. Add 50 μL of ALP-conjugated or biotinylated anti-lg of appropriate specificity at the recommended concentration in Tween-buffer; leave for 1 h at 37⁰C. Wash the sample 4 times with 0.9% NaCI plus 0.05% Tween. If biotinylated antibody has been used, add 50 μL of streptavidin-ALP diluted 1 :2000 in Tween-buffer; leave the sample for 1 h at 37⁰C. Wash the sample 4 times with 0.9% NaCI plus 0.05% Tween. Develop the sample with 50 μL of NPP (1 tablet/5 mL of substrate buffer) and read at OD₄₀S.

Infection may be established using typical signs and symptoms of malaria. The signs and symptoms of malaria, such as fever, chills, headache and anorexia. Preferably, more specific methods of diagnosis are preferred e.g. using a scoring matrix of clinical symptoms, light microscopy which allows quantification of malaria parasites (e.g. thick or thin film blood smears from patients stained with acridine orange or Giemsa, rapid diagnostic tests (e.g. immunochromatographic tests that detect parasite-specific antigens e.g. HRP2, parasite lactate dehydrogenase (pLDH), aldolase etc) in a finger- prick blood sample, and polymerase-chain reaction.

Vaccine efficacy may be measured e.g. by examining the number and frequency of cases of malaria (e.g. asexual Plasmodium falciparum at any level plus a temperature greater than or equal to 37.5°C and headache, myalgia, arthralgia, malaise, nausea, dizziness, or abdominal pain), time to first infection with Plasmodium falciparum, parasitemia, geometric mean parasite density in first clinical episode, adverse events, anaemia (measured by for example packed cell volume less than 25% or less than 15%), absence of parasites at the end of immunization, proportion of individuals with seroconversion to the antigens of the present invention at e.g. day 75 post immunization, proportion with "efficacious seroconversion" to the antigens of the present invention (4-fold elevation in antibody titre) at day 75, number of symptomatic Plasmodium falciparum cases after 1 , 2, or 3 doses, number of days until Plasmodium falciparum positive blood slide, density of Plasmodium falciparum, prevalence of Plasmodium falciparum, Plasmodium vivax, and Plasmodium malariae, levels of antimalarial antibodies by ELISA, geometric mean parasite density in first clinical episode, lymphocyte proliferation to malarial proteins, T-cell responses to antigen frequency of fever, malaise, nausea, malaria requiring hospital admission, cerebral malaria (e.g. Blantyre coma score <2) etc.

The vaccine may be administered using a variety of vaccination regimes familiar to the skilled person. In one form of the invention, the vaccine composition may be administered post antimalarial treatment. Preferred antimalarials for use include the chloroquine phosphate, proguanil, primaquine, doxycycline, mefloquine, clindamycin, halofantrine, quinine sulphate, quinine dihydrochloride, gluconate, primaquine phosphate and sulfadoxine. For example, blood stage parasitaemia may be cleared with Fansidar (25 mg sulfadoxine/0.75 mg pyrimethamine per kg body weight) before each vaccination. In another form of the invention antimalarial (e.g. Fansidar) treatment is given 1 to 2 weeks before the doses (e.g. first and third doses). In another form of the invention antimalarial (e.g. Fansidar) treatment is given before the first dose.

In another form of the invention, 3 doses of vaccine composition (e.g. 0.5 mg adsorbed onto 0.312 g alum in 0.125 ml.) is administered in 3 doses, 2 mg per dose to > 5 year olds, 1 mg to under 5 year olds, at weeks 0, 4, and 25. In another form of the invention, 3 doses of vaccine composition (e.g. 1 mg per dose) are given subcutaneously at weeks 0, 4, and 26. In another form of the invention, 3 doses of vaccine composition is administered on days 0, 30, and 180 at different doses (e.g. 1 mg; 0.5 mg). In another form of the invention, 3 doses of vaccine composition is administered at 3 to 4 month intervals either intramuscularly or subcutaneously. In another form of the invention 3 doses of vaccine composition is administered subcutaneously on days 0, 30, and about day 180. In another form of the invention, the vaccine composition is administered in 2 doses at 4-week intervals (e.g. 0.55 ml_ per dose containing 4 μg or 15 μg or 13.3 μg of each antigen). In another form of the invention, 3 doses of the vaccine composition is administered (e.g. 25 μg in 250 μl_ AS02A adjuvant) intramuscularly in deltoid (in alternating arms) at 0, 1 , and 2 months. In another form of the invention 4 doses of the vaccine composition is given (e.g. 50 μg per 0.5 ml. dose) on days 0, 28, and 150; and dose 4 given in the following year. In another form of the invention, where the vaccine is a DNA vaccine, the vaccine composition is administered in two doses (e.g. 2 mg on days 0 and 21 (2 intramuscular injections each time, 1 into each deltoid muscle). In another form of the invention, where the vaccine composition comprises an immunogenic molecule covalently linked to another molecule (e.g. Pseudomonas aeruginosa toxin A) the composition is administered in 3 doses (e.g. at 1 , 8, and 24 weeks). In another form of the invention the compositions may also comprise live Plasmodium falciparum organisms (e.g. asexual stage parasites, sexual stage parasites, sporozoites etc.) in a pharmaceutically acceptable carrier, and may be administered (e.g. intradermal^, subcutaneously, intramuscularly, intraperitoneal^, and intravenously) in multiple doses (e.g. 10,000 viable Plasmodium falciparum sporozoites per dose).

The present invention may be used to generate antibodies useful as in vitro diagnostic reagents, or as therapeutics for passive immunization. The term "antibody" includes intact immunoglobulin molecules, as well as fragments thereof which are capable of binding an antigen. These include hybrid (chimeric) antibody molecules; F(ab')2 and F(ab) fragments and Fv molecules; non-covalent heterodimers; single-chain Fv molecules (sFv); dimeric and trimeric antibody fragment constructs; minibodies; humanized antibody molecules; and any functional fragments obtained from such molecules, as well as antibodies obtained through non-conventional processes such as phage display. Preferably, the antibodies are monoclonal antibodies. Methods of obtaining monoclonal antibodies are well known in the art.

Various immunoassays (e.g., Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, invasion-inhibition assays, or other immunochemical assays known in the art) can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody which specifically binds to the immunogen. A preparation of antibodies which specifically bind to a particular antigen typically provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay. Preferably, the antibodies do not detect other proteins in immunochemical assays and can inimunoprecipitate the particular antigen from solution.

The antigens of the invention can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies. If desired, an antigen can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin. Depending on the host species, various adjuvants can be used to increase the immunological response. Such adjuvants include those described above, as well as those not used in humans, for example, Freund's adjuvant.

The antigens of the invention include a polynucleotide comprising or consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8,

10, 12, 14, 16, 18, 20, and 22 and functional equivalents thereof, or a protein comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 , 3, 5, 7, 9, 1 1 , 13, 15, 17, 19 and 21 and functional equivalents thereof, wherein the polynucleotide and/or protein have a biological function in a Plasmodium.

The antigens of the invention a polynucleotide comprising or consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and 82 and functional equivalents thereof, or a protein comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NOS: 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 75, 77, 79, and 81 and functional equivalents thereof wherein the polynucleotides and/or protein have an essential function in a Plasmodium.

The antigens of the invention include antigens comprising or consisting of a Plasmodium vaccine strain produced by a method for producing a vaccine strain of a Plasmodium, comprising or consisting of the step of genetically engineering the Plasmodium such that the expression of a polynucleotide comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and 82 and functional equivalents thereof is altered, or the function of a protein comprising or consisting of a sequence selected from the group consisting of SEQ ID NOS: 1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 75, 77, 79, and 81 and functional equivalents thereof is altered, wherein the vaccine strain has a diminished virulence as compared with a non-engineered Plasmodium.

The antigens of the invention include an immunogenic protein, the protein comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 75, 77, 79, and 81 and functional equivalents thereof, and a pharmaceutically acceptable excipient.

Monoclonal antibodies which specifically bind to an antigen can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique.

In addition, techniques developed for the production of "chimeric antibodies," the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used. Monoclonal and other antibodies also can be "humanized" to prevent a patient from mounting an immune response against the antibody when it is used therapeutically. Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions.

Alternatively, humanized antibodies can be produced using recombinant methods, as described below. Antibodies which specifically bind to a particular antigen can contain antigen binding sites which are either partially or fully humanized. Alternatively, techniques described for the production of single chain antibodies can be adapted using methods known in the art to produce single chain antibodies which specifically bind to a particular antigen. Antibodies with related specificity, but of distinct idiotypic composition, can be generated by chain shuffling from random combinatorial immunoglobin libraries.

Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template. Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent.

A nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below. Alternatively, single-chain antibodies can be produced directly using, for example, filamentous phage technology.

Antibodies which specifically bind to a particular antigen also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents.

Chimeric antibodies can be constructed. Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as "diabodies" can also be prepared.

Antibodies can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which the relevant antigen is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.

In a further aspect the present invention provides use of a composition or vaccine strain of Plasmodium as described herein in the manufacture of a medicament for the treatment or prevention of a condition caused by or associated with infection by Plasmodium.

The present invention will now be more fully described by reference to the following non-limiting Examples. EXAMPLE 1 : MATERIALS AND METHODS

Culture conditions and parasite strain

Erythrocytic stages of Plasmodium falciparum were maintained in human 0+ erythrocytes. CS2 wild-type parasites, a clone of the It isolate, adheres to chondroitin sulphate A (CSA) and hualuronic acid in vitro. Parasites were selected for the adherence to bovine trachea CSA (Sigma, ST Louis, MO, USA) prior to transfection.

Plasmid constructs, parasite strains, culture conditions, transfection and Southern blotting.

Constructs were assembled either in pHHT-TK (Duraisingh et al. (2002) lnt J Parasitol 32, 81-89) or pCC-1 (Maier et al. (2006) Molecular & Biochemical Parasitology 150, 118-121 ) vectors. The vectors contains a hDHFR cassette (driven by a calmodulin promoter) flanked by 2 multiple cloning sites to accept targeting sequence of the relevant gene. The vector also includes a negative selection cassette (driven by an Hsp86 promoter region) to select parasites in which double recombination events had occurred. Plasmid DNA was extracted using Maxiprep kits from either Qiagen or Invitrogen (Purelink). 80 μg DNA was tranfected using standard protocols (Crabb et al. (1997) Cell 89, 287-296). After positive selection on WR99210 the cells were placed under negative selection using either Ganciclovir (Roche, 20 μM, pHHT-TK) or 5-Fluorocytosine (ICN, 100 nM, pCC-1 ). If no cells were recovered the negative selection was repeated at least twice. Any resulting cell populations underwent Southern blot analysis. Genomic DNA was prepared with the Dneasy Tissue Kit (Qiagen) and Southern Blot analysis performed using the DIG system (Roche) according to manufacturer's instructions to confirm disruption of the targeted genes.

Primer sequences used for the construction of pCC1 :

SEQ ID NO: 83 ctagagtagatctgtcttaaggtggatccgtaagcttgtgaattcgtgagct SEQ ID NO: 84 cacgaattcacaagcttacggatccaccttaagacagatctact

SEQ ID NO: 85 atcggatcctttttatggaagacgccaaaaacataaagaaaggcccgg

SEQ ID NO: 86 gatgataagcttacacggcgatctttccgccc

SEQ ID NO: 87 caatggcccctttcttaagcattttg

SEQ ID NO: 88 gcatggatcctgatatatttctattagg SEQ ID NO: 89 atcccccgggggtaccctgcaggtcgacttaattaaggatatggcagcttaatgttcgtttttc SEQ ID NO: 90 tactactagcggccgcctaccctgaagaag SEQ ID NO: 91 atcctcgagatggtgacagggggaatg SEQ ID NO: 92 ggatcccgggttaaacacagtagta

In assembling pCC1 the goal was to construct a modular vector with gene cassettes for negative and positive selection and multiple cloning sites for the incorporation of gene-specific targeting sequences. Applicant modified pGEM7Z(+) (Promega) by annealing a polylinker consisting of oligonucleotides SEQ ID NO: 83 and SEQ ID NO: 84 into the Xbal/Sacl sites of pGEM7Z(+). This yielded the cloning vector LT-1. Applicant then amplified firefly luciferase from pPf86 (kindly provided by Kevin Militello, Harvard School of Public Health) with the primer pair SEQ ID NO: 85/ SEQ ID NO: 86 and cloned it into the BamH I/Hind III sites of LT-1 creating the vector LT-2. The 3' UTR of the gene encoding the histidine rich protein 2 (HRP2 3') was cut out of the vector pHHT-TK (Duraisingh et al., (2002) lnt J Parasitol 32, 81-89) with Hind lll/EcoR I and annealed into LT-2. The 5' UTR of the P. falciparum calmodulin (CAM) gene was amplified with the primer pair SEQ ID NO: 87/ SEQ ID NO: 88 from pHHT- TK and ligated into the HRP2 3' containing LT-2. This plasmid was named LT-3.

The 3' UTR of the P.berghei dihydrofolate reductase/thymidylate synthase (PbDT 3') was amplified with the oligonucleotides SEQ ID NO: 89/ SEQ ID NO: 90 and ligated into the Not I/Xma I cut plasmid pHHT-TK resulting in pHHT-TK-3'. The firefly luciferase was cut out of LT-3 with BamH I/Hind III and replaced with the human dihydrofolate reductase gene (hDHFR) from pHHT-TK. The hDHFR containing LT-3 was then cut with EcoR I/Afl Il to release the whole hDHFR gene cassette (with the CAM5' and HRP2 3') and cloned into EcoR I/Afl Il cut pHHT-TK-3'.

The resulting vector was named pDC1 and contains a CAM5'-hDHFR-HRP2 3' gene cassette for positive selection and a HSP86 5'-Herpex simplex TK-PbDT 3' gene cassette for negative selection. The component of each gene cassette can be individually cut out and replaced (hence the vector is modular). Each gene cassette is flanked by a multiple cloning site. In addition the vector contains a plasmid backbone, which enables ampicillin selection in E. coli and replication both in E.coli and P.falciparum. Finally the ScCDUP gene was amplified with the primers SEQ ID NO: 91 and SEQ ID NO: 92 from the plasmid pHHT-CDUP-ΔPF1 1_0037 (Maier et al. (2006) Molecular & Biochemical Parasitology 150, 118-121 ) and cloned Xho I/Xma I into the cut pDC-1 to replace the HsTK gene with the ScCDUP gene. The final vector was then called pCC-1. Generation of antibodies

To generate antibodies either GST-fusion proteins or KLH-coupled fusion peptides were synthesized (Invitrogen) and injected into rabbits and IgG purified. The following KLH-coupled fusion peptides were synthesised (Invitrogen) and injected into rabbits: SEQ ID NO:1 , amino acid 164-177, R878; SEQ ID NO:3, amino acid 1 17-130, R883; SEQ ID NO:5, amino acid 780-793; R884; PFE0060w, amino acid 128-147, R679; SEQ ID NO:19, amino acid 808-821 , KW51-1 ; PF13_0275, amino acid 266-279, KW59-2. GST-fusion protein for the genes PF14_0018 (amino acid 217-304; R688), PF11_0037 (amino acid 150-216; R687) were expressed and rabbits immunized. IgG from the rabbit sera were purified via a protein G sepharose column and eluted with 100 mM glycine-HCI, pH 2.5, dialysed against PBS and their concentration adjusted to ~5 mg/ml.

SDS-PAGE (polyacrylamide gel electrophoresis) and immunoblot analysis

Synchronised trophozoite cultures were saponin lysed, the pellet was washed 3 times in PBS and taken up in reducing SDS sample buffer (Invitrogen). Proteins were separated on 3-8% Tris-Acetate or 10% Bis-Tris gels (Invitrogen, Carlsbad, CA, USA). Western blotting to nitrocellulose (0.45μm; Schleicher and Schuell, Dassel, Germany) was performed according to standard protocols. In addition to the already mentioned antibodies mouse monoclonal anti-ATS 1 B/98-6H1-1 (1 :200) (preabsorbed on erythrocyte ghosts) were used Maier, et al. (2007) Blood 109, 1289-1297. Horseradish peroxidase-coupled sheep anti-rabbit Ig (1 :1000) or anti-mouse Ig (1 :2000) (Chemicon, Melbourne, Australia) were used as secondary antibodies.

CSA binding assays

Static binding assays (50 μg/ml) and binding under physiological flow condition to CSA (100 μg/ml) were performed using Plasmodium falciparum -infected erythrocytes at 3% parasitemia and 1% hematocrit (Crabb et al. (1997) Cell 89, 287-296). For panning purposes plastic petri dishes were coated with 100 μg/ml CSA overnight and blocked with 10% human serum in RPMI-HEPES. Synchronised cultures at the trophozoite stage were enriched via gelatine flotation and added to the CSA coated petri dishes, where adhesion was allowed to occur for 1 h at 37⁰C. Unbound cells were washed off with three washes with RPMI-HEPES, pH6.8. Bound cells were resuspended and taken into culture to expand, before another round of selection commenced. After 3 rounds of selection the cultures were analysed for the expression of PfEMPI via a trypsin cleavage assay.

Flow based cytoadherence assays. Flow assays on protein-coated microslides were performed using standard conditions (Tse et al. (2004) MoI Micro 51 , 1039-1049), with a coating concentration of CSA of 100 μg/ml. All cell lines were tested in duplicate in three separate experiments. The results are expressed as number of bound infected red blood cells per mm². Cell lines displaying binding values outside of the 95% confidence interval of the CS2 parental line were regarded as having a different binding phenotype

Trypsin cleavage assays

For trypsin cleavage, trophozoite stage parasites were either incubated in TPCK- treated trypsin (Sigma) (1 mg/ml in PBS), in PBS alone or in trypsin plus soybean trypsin inhibitor (5 mg/ml in PBS, Worthington, Lakewood, NJ, USA) at 37°C for 1 hr and analyzed as described (Waterkeyn et al. (2000) EFor trypsin cleavage sorbitol synchronised parasites were grown to trophozoite stage and enriched via gelatine [Gelofusine, Braun, Bella Vista, Australia] flotation. Infected red blood cells were then either incubated in TPCK-treated trypsin (Sigma) (1 mg/ml in PBS), in PBS alone or in trypsin plus soybean trypsin inhibitor (5mg/ml in PBS, Worthington, Lakewood, NJ, USA) at 37⁰C for 1 h. Trypsin inhibitor was then added to the trypsin and PBS aliquot to be incubated at room temperature for 10 min. Cell pellets were extracted in the presence of protease inhibitors (Complete, Roche) with Triton X-100 (1%) and subsequently with sodium dodecylsulfate (SDS, 2%) as previously described (Baruch et al. (1995) Cell 82, 77-87).

Laser-assisted optical rotational cell analysis.

To measure deformability the infected red blood cells were subjected to analysis via a laser-assisted optical rotational cell analyser (LORCA). In this assay erythrocytes are taken up in a polymer solution sitting in a gap between an inner cylinder and an outer cup. By rotating the cup shear stress is created, which in turn forces the erythrocytes to change from a biconcave to an ellipsoid morphology. The change in morphology can be detected via changes in the diffraction pattern created by a laser-beam shining through the solution. The amount of shear stress applied is regulated by the speed of the spinning cup and each observed value per measurement is the equivalent of 25,000 cells. Synchronised cultures with >4% parasitemia at trophozoite stage were enriched via gelatine flotation, washed twice in RPMI-HEPES buffer and then adjusted to a final parasitemia of 40% and 50% hematocrit with uninfected gelatine mock- treated red blood cells. 25μl of this mixture was added to 5ml of 50 mg/l polyvinylpyrrolidone (PVP) in PBS pH7.4 and measurements were taken at shear stresses between 0 and 30 Pa at 37⁰C. At each measure point 50 determinations took place, assessing approximately 500 cells per determination, therefore each measure point represents 25,000 cells. Two independent measurements were taken and repeated in an independent set of experiments. Each set of experiments included the measurement of CS2 wild-type cells and uninfected red blood cells of the same batch the parasites were cultured in.

Electron microscopy and Immunofluorescence microscopy

For scanning electron microscopy parasite-infected red blood cells were tightly synchronised and processed by standard methods (Rug, et al. (2006) Blood 108, 370- 378). Scanning electron microscopy (SEM) was performed with trophozoites (20-28 h) harvested by magnetic cell sorting (CS columns; Miltenyi Biotec) followed by glutaraldehyde fixation (2% in PBS, Electron Microscopy Sciences), for 30 minutes at room temperature. Cells were washed 3 times in PBS, transferred to polyethylinamine-coated coverslips (Sigma, St Louis, MO), immersed in 10% ethanol, and dehydrated (25%, 50%, 70%, 90%, 2x100%; 10 minutes each). Cells were subjected to critical point drying (CPD030; Bal-Tech), coated with platinum in a sputter coater (S150B Sputter Coater; Edwards), and viewed in a Philips XL30 FEG scanning electron microscope at 120 kV.

Immunofluorescence microscopy

For immunofluoresence analysis, acetone/methanol (90%/10%) fixed smears of asynchronous parasites of CS2Δ- and/or CS2-infected erythrocytes were probed with rabbit anti-ATS (1 :50), preabsorbed mouse anti-ATS (1 :50), rabbit anit-ATS (1 :50), rabbit anti-KAHRP (1 :200), mouse anti-KAHRP (His; 1 :50), rabbit anti-SBP1 (1 :500), mouse anti-SBP1 (1 :500), mouse anti-PfEMP3 (1 :2000), rabbit anti-PfEMP3 (1 :1000), rabbit anti-SEQ ID NO:5 (1 :125), rabbit anti-SEQ ID NO:3 (1 :250), rabbit anti-SEQ ID NO:1 (1 :50) and consequently incubated with secondary antibodies Alexa Fluor 488 conjugated anti-rabbit IgG (Molecular Probes) and Alexa Fluor 488 conjugated anti- mouse IgG (Molecular Probes). To avoid photobleaching cells were covered with Vectashield (Vector Laboratories, Burlingame, CA) containing 0.2 ng/ul DAPI (Roche) to stain for parasite DNA. Rabbit and mouse antibodies against the same antigen were used to verify the pattern observed in each cell line and only one representative of each is shown in the figures. Cells were viewed with a Plan-Neofluar 10Ox 1.3 oil objective on a Zeiss Axiovert 200M Live Cell Imaging Inverted Microscope equipped with a AxioCam MRm camera and primarily processed with AxioVision 4.4 deconvolution software package. Captured images were then further processed using Photoshop and ImageJ software (available from http://rsb.info.nih.gov/ij). Pictures were adjusted to gain optimal contrast to visualize features of interest. For the supplementary data movies, cells were treated as described above and viewed with an Apochromat 100x/1.4 oil DIC lense on a Leica TCS SP5 Broadband Confocal Microscope equipped with an AxioCam MRm camera and the z-stacks were processed using the AxioVision 4.4 software package. Captured images were then further processed using Photoshop and ImageJ software (available from http://rsb.info.nih.gov/ij). Pictures were adjusted to gain optimal contrast to visualize features of interest.

Antibodies to the surface of Plasmodium falciparum infected erythrocytes

Serum samples were tested for specific IgG to the surface of pigmented trophozoite- infected erythrocytes at 3-4% parasitemia, 0.2% hematocrit, using flow cytometry, as described (Duffy et al. (2005) MoI Microbiol 56, 774-788; Beeson et al. (2007) Am. J. Trop. Med. Hyg. 77, pp. 22-28). Cells were sequentially incubated with test serum diluted 1/20, rabbit anti-human IgG (Fc-specific, Dako; 1 :100), and Alexa-Fluor-488- conjugated anti-rabbit Ig (Molecular Probes; 1 :1000), with ethidium bromide 10 μg/ml in darkness. Incubations were 30 min each, performed at room temperature. Samples were analysed using a FACSCalibur flow cytometer (Becton-Dickinson, USA) and Flowjo software (TreeStar, USA). Fluorescence in channel FL1 was used as a measure of IgG binding and for each sample the geometric mean fluorescence of uninfected red blood cells was deducted from the geometric mean fluorescence of infected erythrocytes. All samples were tested in duplicate.

Serum samples

Sera were collected from malaria-exposed pregnant residents of the Madang Province, Papua New Guinea (PNG), presenting for routine antenatal care at the Modilon Hospital, Madang (Beeson et al. (2007) Am. J. Trop. Med. Hyg. 77, pp. 22- 28). This population experiences year-round transmission of Plasmodium falciparum. Sera from non-malaria exposed Australian residents were included as controls. Written informed consent was given by all donors and ethical clearance was obtained from the Medical Research Advisory Committee, Department of Health, PNG, and the Walter and Eliza Hall Institute Ethics Committee.

EXAMPLE 2: Generation of loss-of-function parasites lacking expression of predicted exported proteins

The Plasmodium falciparum genome was scanned to generate a list that included known exported proteins, as well as those with a PEXEL, a motif important for trafficking of proteins to the erythrocyte cytoplasm, to compile a list of 83 candidate genes of which 46 had PEXEL motifs (Figure 1 , shaded blue). Five exported genes were included that do not have an obvious PEXEL (PFD1 160w, PFE0070w, MAL7P1.91 , SEQ ID NO:46 and PF11_0507 (Figure 1 , shaded grey)). Together, these 51 exported proteins constitute a representative subset of the exportome manageable in terms of a gene knockout screen. In addition, 32 genes encoding proteins that were unlikely to be exported but that had a signal sequence and gene transcription in blood-stages were included to provide a comparison with respect to the essentiality of each group (Figure 1 , shaded green). Most genes within the exported set were transcribed either in early ring stages soon after invasion and/or in late schizont stages when the invasive merozoite is being formed (Figure 1 ). This is consistent with the proteins encoded by these genes playing a role in repairing or remodelling the host erythrocyte after invasion of the merozoite.

To disrupt the function of these candidate genes in Plasmodium falciparum (Crabb et al. (1997) Cell 89, 287-296) plasmids that would integrate into the targeted gene by double crossover homologous recombination using the plasmid pHHT-Tk (Duraisingh, et al. (2002) lnt J Parasitol 32, 81-89) were constructed (Figure 1A). During the course of this work Applicant developed improved plasmids (pCC1 and pCC4) for negative selection using the Saccharomyces cerevisiae cytosine deaminase/uracil phosphoribosyl transferase gene (Figure 1 B) (Maier et al. (2006) Molecular & Biochemical Parasitology 150, 118-121 ) and these were also used. The plasmids were transfected into CS2, a strain of Plasmodium falciparum that confers the ability of the infected erythrocyte to adhere to CSA via a specific PfEMPI encoded by the var2csa gene. This parasite line was chosen because expression of PfEMPI encoded by var2csa is very stable over time. As most PfEMPI genes undergo rapid transcriptional switches to other family members as a means of immune evasion these switching events could confound subsequent analysis, the Applicant's choice of var2csa minimizes this problem. In P. falciparum the transfected plasmids are maintained as episomal circles and integration by double crossover homologous recombination occurs at low frequency. Growth on WR99210 (positive selection) and 5'-fluorocytosine (negative selection) favors the survival of transfected parasites with homologous integration into the target gene and loss of episomal plasmids. Gene disruption was analysed by Southern blotting and of the 83 genes attempted 53 were confirmed and the plasmid integrated by double-crossover homologous recombination (Figure 1 B and Figure 7). To verify that the gene disruption strategy results in loss of protein expression Applicant generated antibodies to a subset of the protein products. Lack of protein expression in knockout lines was verified by western blots as shown by loss of a specific signal in the mutant lines compared to the parental parasite CS2 (Figure 1 C). Although transfection of the plasmids was successful for the other 30 genes it was not possible to select parasites in which these constructs had integrated, suggesting that these genes may be essential and serve an important function in growth and development of the parasite inside the host erythrocyte.

EXAMPLE 3. Essentiality of exported proteins in Plasmodium falciparum.

In this study Applicant propagated Plasmodium falciparum in human erythrocytes, which removes selection for maintenance of genes required for survival in the host such as expression of PfEMPI on the parasite-infected erythrocyte surface. Overall, 64% of the Plasmodium falciparum genes tested could be disrupted and classified as non-essential for erythrocytic growth (Figure 2A).

EXAMPLE 4: Identification of genes required for PfEMPI surface expression. In order to identify genes that are required for trafficking, display and function of the major virulence protein PfEMPI on the surface of the Plasmodium falciparum-\ nfected erythrocyte Applicant performed a FACS based screen with antibodies to detect surface protein. Applicant chose the CS2 strain as it expresses the var2CSA (PFL0030c), which encodes a PfEMPI that confers adhesion to CSA and also this parasite line has a reduced propensity to switch to other var genes. Multigravid malaria-infected women develop antibodies specific for the var2CSA PfEMPI and these sera detect surface expressed PfEMPI in CS2 parasites. An initial screen using sera from multigravid females that detected the var2csa PfEMPI showed that 10 of the 55 parasite-infected erythrocytes had a reactivity 30% below that of parental CS2- infected red blood cells (Figure 3A). These were chosen as a cut off for further analysis to determine if PfEMPI display on the parasite-infected erythrocyte surface had been altered.

To determine if PfEMPI was present on the surface of the parasite infected erythrocytes that had reduced reactivity to var2csa antibodies, Applicant used an assay in which surface exposed protein is cleaved by trypsin and the conserved C- terminus of the protein detected by Western blot with antibodies against the acidic terminal segment (ATS). This differentiates surface exposed PfEMPI from the intracellular pool. Surface exposed var2CSA encoded PfEMPI in the parental line CS2 results in two bands of 90 and 70 kDa (Figure 2B). There is a substantial pool of internal PfEMPI in CS2 infected erythrocytes resulting in detection of full length PfEMPI that migrates at approximately 300 kDa. Four of the mutant cell lines, in which the genes encoding SEQ ID NO:1 , SEQ ID NO:3, SEQ ID NO:1 1 and SEQ ID NO:5 (SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:12 and SEQ ID NO:6, respectively) had been disrupted, showed no surface expression of PfEMPL The ΔSEQ ID NO:3 cells also showed greatly reduced levels of total detectable PfEMPI under the solubilization conditions used. The parasite lines ΔSEQ ID NO:7 and ΔSEQ ID NO:9 showed reduced surface expression of PfEMPI , in multiple independent experiments, in comparison with parental wild-type cells. These results indicate that proteins SEQ ID NO:1 , SEQ ID NO:3, SEQ ID NO:1 1 , SEQ ID NO:5, SEQ ID NO:7 and SEQ ID NO:9 (encoded by SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:12, SEQ ID NO:6, SEQ ID NO:8, and SEQ ID NO:10, respectively) play a role in trafficking and display of the virulence protein PfEMPI on the surface of the Plasmodium falciparum-\ nfected erythrocyte.

EXAMPLE 5: Identification of mutant Plasmodium falciparum lines that show altered adherence properties.

To confirm that the transfected CS2 strains in which the genes encoding either SEQ ID NO:1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 or SEQ ID NO:11

(SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID

NO:12, and respectively) were disrupted, had altered adherence properties due to lack or reduced PfEMPI surface expression, and to identify other lines in which the function of this adherence protein had been altered, Applicant used cytoadherance based assays under physiological flow conditions with CSA as the receptor. The parasite lines CS2ΔSEQ ID NO:1 , CS2ΔSEQ ID NO:3, CS2ΔSEQ ID NO:5 show no adherence to CSA under flow conditions (Figure 3C) consistent with the absence of PfEMPI on the surface of the parasite-infected host cell (Figure 3B). Additionally, the parasite lines CS2ΔSEQ ID NO:7, CS2ΔSEQ ID NO:9 and CS2ΔSEQ ID NO:1 1 showed greatly reduced levels of adherence which provides functional evidence of decreased levels of PfEMPI on the infected erythrocyte surface (Figure 3B). Similar results were obtained when using static adhesion assays to CSA for these parasite infected cell lines (Figure 10). These results provide further evidence that the proteins SEQ ID NO:1 , SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 and SEQ ID NO:1 1 play a role in the trafficking and display of PfEMPI on the surface of the Plasmodium /a/c/param-infected erythrocyte.

To determine if loss of protein function in the mutant parasite lines had an effect on the distribution of PfEMPI , KAHRP, PfEMP3 or SBP1 in the host erythrocyte Applicant performed immunoflorescence experiments with anti-PfEMP1 and anti- KAHRP antibodies. CS2ΔSEQ ID NO:1 and CS2ΔSEQ ID NO:7 infected erythrocytes showed normal KAHRP distribution; PfEMPI was primarily concentrated in the parasite with little detected within the infected-erythrocyte (Figure 5A) suggesting that loss of their function has decreased the efficiency of transfer for PfEMPI to Maurer's clefts. The SEQ ID NO:1 protein in parental CS2-infected erythrocytes is distributed in the erythrocyte cytoplasm but also localises to Maurer's clefts suggesting that it is exported to the erythrocyte cytoplasm and then interacts with the external face of Maurer's clefts as has been reported for KAHRP and PfEMP3 (Figure 5B). The localisation of the SEQ ID NO:1 protein to Maurer's clefts and the fact that PfEMPI trafficking is blocked early within the parasite indicates that this protein plays a role in transfer of this virulence protein to Maurer's clefts. The protein SEQ ID NO:7 is likely to play a similar role.

In contrast, localisation of PfEMPI in both CS2ΔSEQ ID NO:3 and CS2ΔSEQ ID NO:5 infected erythrocytes shows that it is localised to Maurer's clefts, but does not reach the surface of the infected erythrocyte. The SEQ ID NO:4 encoded protein is localised at Maurer's clefts whereas SEQ ID NO:5 is within the host erythrocyte as punctate dots with perhaps a greater concentration at the erythrocyte membrane. The subcellular localisation of both SEQ ID NO:3 and SEQ ID NO:5 is consistent with them playing a role in transfer of PfEMPI from Maurer's clefts to the host membrane. The mutant parasite lines CS2ΔSEQ ID NO:9 and CS2ΔSEQ ID NO:1 1 showed a normal distribution of PfEMPI in the infected erythrocyte suggesting that any effect on trafficking of PfEMPI is occurring at the transfer from Maurer's clefts to the erythrocyte membrane. Overall these results have identified exported proteins that play a role in trafficking of the major virulence protein PfEMPI to the host erythrocyte and provided evidence that these proteins function at specific points in the pathway of PfEMPI trafficking.

EXAMPLE 6: SEQ ID NO:13 and SEQ ID NO:15 are required for formation of knobs.

Two mutant parasite lines CS2ΔSEQ ID NO: 13 and CS2ΔSEQ ID NO: 15 had reduced binding to CSA under both static (Figure 10) and physiological flow conditions (Figure 3C). Interestingly, both of these lines expressed wild type levels of var2csa PfEMPI , as shown using multigravid human antibodies in FACS assays (Figure 3C). Additionally, transport of PfEMPI to the erythrocyte surface was normal as measured by sensitivity of the exposed ectodomain to trypsin cleavage (Figure 3B). This behaviour of decreased cytoadherence capacity in the presence of normal amounts of PfEMPI at the surface has previously been described in knob negative parasites in which the KAHRP gene has been disrupted. To test whether some form of knob disruption may be responsible for decreased cytoadherence of the ΔSEQ ID NO: 13 and ΔSEQ ID NO:15 lines, Applicant determined the subcellular localization of PfEMPI and KAHRP, a protein that is the major structural component of knobs. The ΔSEQ ID NO:15 infected erythrocytes showed similar localization of PfEMPI compared to the parent CS2 consistent with normal expression of this protein on the surface of the host cell. KAHRP appeared to be collected in more localised punctate collections in ΔSEQ ID NO:15 compared to the more uniform pattern observed in parental parasites. In contrast, ΔSEQ ID NO:13 infected erythrocytes did not show the typical rim fluorescence when compared to parental cells suggesting there were defects in movement of KAHRP from Maurer's clefts to the underside of the erythrocyte and assembly of the knob structure.

Knob morphology was examined by scanning electron microscopy in the two mutant lines (Figure 5B). Both CS2ΔSEQ ID NO:15 and CS2ΔSEQ ID NO:13 parasite- infected red cells displayed dramatically altered knob morphology. CS2ΔSEQ ID NO: 13 showed a lack of knobs on the surface of infected red blood cells despite the fact that KAHRP was expressed and exported to the host erythrocyte. In contrast, erythrocytes parasitized with CS2ΔSEQ ID NO: 15 had rudimentary knobs, but they are significantly smaller and less protrusive compared to wild-type knobs. The results obtained with CS2ΔSEQ ID NO:13 and CS2ΔSEQ ID NO:15 is in direct contrast to the other mutant parasite lines identified in which PfEMPI transport to the erythrocyte surface was altered where knob structures were unaltered with respect to the parental line (Figure 12). Therefore the function of the proteins SEQ ID NO: 13 and SEQ ID NO:15 are required for knob formation in Plasmodium falciparum-\ nfected erythrocytes.

EXAMPLE 7: Identification of genes that affect deformability of P. falciparum- infected erythrocytes

Upon infection with P. falciparum, the erythrocyte becomes more rigid, most likely due to export of parasite-derived proteins and cross-linking with the red blood cell cytoskeleton (Cooke et al., (2001 ) Adv. Parasitol. 50 1-86; Nash, (1991 ) Blood 74, 855-861 ). To determine if proteins encoded by the targeted genes have any influence on erythrocyte membrane rigidity, Applicant assessed the deformability of infected red blood cells with a laser-assisted optical rotational cell analyzer (LORCA) (Hardeman et al., (1998) Scand. J. Clin. Lab. Invest. 58 617-623) (Fig. 4). The deformability ratio of erythrocytes infected with wild-type parasite to erythrocytes infected with mutant parasites for the four highest shear stresses was calculated and plotted to compare the influence of the deleted protein on the rigidity of the infected erythrocyte (Fig. 4A). The average ratio for uninfected erythrocytes was 0.67. Many of the mutant lines demonstrated small alterations in rigidity of the infected erythrocyte suggesting a large number of proteins can potentially have a minor effect on this host cell property. However, the four cell lines CS2ΔSEQ ID NO:17, CS2ΔSEQ ID NO:19, CS2ΔSEQ ID NO:21 and CS2ΔSEQ ID NO:5 showed a significant increase in membrane rigidity (Fig. 4B). Interestingly, CS2ΔSEQ ID NO:17, CS2ΔSEQ ID NO:19 and CS2ΔSEQ ID NO:21 were also high binders in the CS2 adhesion assay and in contrast, CS2ΔSEQ ID NO:5 lacked erythrocyte surface PfEMPL These results suggest that the proteins SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21 and SEQ ID NO:5 play a role in determining the overall rigidity of the P. falciparum-infected erythrocyte.

EXAMPLE 8: Genetic disruption of a polynucleotide comprising a nucleic acid sequence from a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, and 22.

To disrupt the function of genes in Plasmodium falciparum including SEQ ID NOs: 2,

4, 6, 8, 10, 12, 14, 16, 18, 20, and 22, plasmids are constructed that can integrate into targeted genes by double crossover homologous recombination using plasmids pH HT-Tk, pCC1 and pCC4 for negative selection using either thymidine kinase (Tk), or the Saccharomyces cerevisiae cytosine deaminase/uracil phosphoribosyl transferase gene [CDUP).

The vectors pCC1-SEQ ID NO: 2 pCC1-SEQ ID NO: 4, pCC1-SEQ ID NO: 6, pCC1- pCd-SEQ ID NO: 8, pCC1- pCC1-SEQ ID NO: 10, pCC1- pCC1-SEQ ID NO: 12, or pCC1- pCCI-SEQ ID NO: 14, pCC1-SEQ ID NO: 16, pCC1-SEQ ID NO: 18, pCC1- SEQ ID NO: 20, and pCC1-SEQ ID NO: 22 respectively, are constructed. These vectors contain two cassettes the first containing hDHFR for positive selection using WR99210 driven by the calmodulin promoter (5' CAM) and has the histidine rich protein 2 terminator (3' hrp2). The second cassette has the CDUP gene for negative selection with 5-FC and is driven by the heat shock protein 86 promoter (5' hsp86) and flanked by the Plasmodium berghei dhfr terminator (3' PbDT). Alternate vectors may be used, including those that utilize thymidine kinase (Tk), pHHT-Tk.

The plasmid backbone contains the cassette for bacterial expression and selection (AMP).

Vectors pHHT-Tk and pCC1 contain a hDHFR cassette (driven by a calmodulin promoter) flanked by 2 multiple cloning sites to accept targeting sequence of the relevant gene, whereas vector pCC4 contains a blasticidin deaminase (bsd) cassette (driven by a calmodulin promoter) flanked by 2 multiple cloning sites to accept targeting sequence of the relevant gene. They also include a negative selection cassette (driven by an Hsp86 promoter region) to select parasites in which double recombination events occur.

To construct vector pHH-Tk, Applicant amplified the cytosine deaminase (CD) gene from E.coli was amplified using the primers 5'-

GGACCGCTCGAGTTTTTATGTCGAATAACGCTTTACAAACAATT-S' (SEQ ID NO: 93) and 5'-GGACCCTCGAGTCAACGTTTGTAGTCGATGGCTTCTGG-S'. (SEQ ID NO: 94) Following digestion of the PCR product with Xho I CD was inserted into the Xho I site of the plasmid transfection vector pHH1 , between the Plasmodium falciparum hsp86 promoter and the Plasmodium berghei dhfr-thymidilate synthase gene terminator, to give the construct pHCD. Two DNA segments of approximately 1 kb from the Pfrh3 pseudogene (Accession no. AF324831 ) were amplified from Plasmodium falciparum 3D7 genomic DNA and introduced into the flanking regions of the human dhfr cassette to mediate the integration of the plasmid into the parasite genome (e.g. Figure 1 ). The 5' segment of Pfrh3 was amplified from genomic DNA of 3D7 parasites with the primers δ'-GGACCCCGCGGAAAACTTTCAGTTTTCAC-S' (SEQ ID NO: 95) and 5'-GGACCGTTAACCTCCCAATATTCTCTTGTCC-S' (SEQ ID NO: 96). This was introduced 5' of the hdhfr cassette between the Sac Il and Hpa I sites of pHCD. The 3' segment of the Pfrh3 gene was amplified with the primers 5'- GGACCACCGGTAGCCTAGGGACGGATTAGTTGAAAATAAATCC-S' (SEQ ID NO: 100) and 5'-GGACCGGGCGCCCGGGTTTCCCATCAACTAAGG-S' (SEQ ID NO: 97). An Xma I site was introduced instead of the Kas I site and the 3' fragment cloned into this to give the plasmid pHCD-rh3. The thymidine kinase (Tk) gene from Herpes simplex virus was amplified from the vector pTCTK (obtained from Dr. Michael White, Montana State University) using the primers 5'-

GGACCGCTCGAGTTTTTATGGCTTCGTACCCCTGCCATCAAC-S' (SEQ ID NO: 98) and 5' -GGACCGCTCGAGTCAGTTAGCCTCCCCCATCTCCC-S' (SEQ ID NO: 99) and cloned into the pHCD-rh3 vector in place of the cytosine deaminase (CD) gene to give the plasmid pHTK-rh3. Both the Tk and CD genes were sequenced prior to transfection.

To generate vectors pCC1 and pCC4, Applicant inserted the gene encoding a bifunctional chimeric protein, consisting of CDUP (amplified from the pCI-neoFCUI plasmid) in the Xho I site of vector pHHI such that that it was transcribed from the Plasmodium falciparum hsp86 promoter with the P. berghei dhfr terminator region (PbDT). Applicant was subsequently able to add two targeting regions from the gene/genes to be targeted (e.g. a 5' flank into Eco RI/Λ/co I sites, and a 3' flank into Spe I/Sac II). pCC1 contains hDHFR as a positive selectable marker driven by the calmodulin promoter. Applicant generated pCC4 by inserting the bsd gene in place of the hDHFR gene.

Plasmid DNA was extracted using Maxiprep kits from either Qiagen or Invitrogen (Purelink). 80μg DNA was transfected using standard protocols. After positive selection on WR99210 or blasticidin, the cells were placed under negative selection using either Ganciclovir (Roche, 20μM, pHHT-TK) or 5-Fluorocytosine (ICN, 100 nM, pCC1 and pCC4). If no cells were recovered the negative selection was repeated at least twice. Any resulting cell populations underwent Southern blot analysis. Genomic DNA was prepared with the Dneasy Tissue Kit (Qiagen) and Southern Blot analysis performed using the DIG system (Roche) according to manufacturer's instructions to confirm disruption of the targeted genes. To disrupt the function of genes in Plasmodium falciparum includingSEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, and 22, derivatives of pCC1 containing FRT sequences to catalyse recombination for deletion of the positive selectable marker (e.g. hDHFR) are used. pCC1 -derivatives use CDUP to select parasites in which the construct integrates by homologous double crossover recombination. pCC1 uses the positive selectable marker hDHFR.

Furthermore, to disrupt the function of genes in Plasmodium falciparum inlcuding SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, and 22, derivatives of pCC1 containing loxP sequences to catalyse recombination for deletion of the positive selectable marker (e.g. hDHFR) are used. To disrupt the function of SEQ ID NOs: 1 , 3, 5, 7, 9, 1 1 , 13, 15, 17, 19 and 21 , and remove the positive selectable marker following genetic disruption, vector derivatives of pCC1 containing loxP sequences (pCC1-loxP-SEQ ID NO: 2, pCC1-loxP-SEQ ID NO: 4, pCC1-loxP-SEQ ID NO: 6, pCC1-loxP-SEQ ID NO: 8, pCC1-loxP-SEQ ID NO: 10, pCC1-loxP-SEQ ID NO: 12, pCC1-loxP-SEQ ID NO: 14, pCC1-loxP-SEQ ID NO: 16, pCC1-loxP- EQ ID NO: 18, pCC1-loxP-SEQ ID NO: 20, or pCC1-loxP-SEQ ID NO: 22) to catalyse recombination for deletion of the positive selectable marker following genetic disruption are constructed. Targeting sequences (e.g. 5' flanks and 3' flanks) for homologous recombination into SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, or 22 are also cloned into the vectors.

Plasmid DNA is extracted using Maxiprep kits from either Qiagen or Invitrogen (Purelink). 80μg DNA is transfected using standard protocols. The pCC1-SEQ ID NO: 2 pCCI-SEQ ID NO: 4, pCC1-SEQ ID NO: 6, pCC1- pCC1-SEQ ID NO: 8, pCC1- pCCI-SEQ ID NO: 10, pCC1- pCC1-SEQ ID NO: 12, or pCC1- pCC1-SEQ ID NO: 14, pCCI-SEQ ID NO: 16, pCC1-SEQ ID NO: 18, pCC1-SEQ ID NO: 20, and pCC1-SEQ ID NO: 22 plasmids are introduced into Plasmodium falciparum parasites by transfection of ring-stage parasites (-5% parasitemia) with 80 μg of purified plasmid DNA (Qiagen) using standard procedures. The pCC1-loxP-SEQ ID NO: 2, pCC1-loxP- SEQ ID NO: 4, pCC1-loxP-SEQ ID NO: 6, pCC1-loxP-SEQ ID NO: 8, pCC1-loxP-SEQ ID NO: 10, pCC1-loxP-SEQ ID NO: 12, pCC1-loxP-SEQ ID NO: 14, pCC1-loxP-SEQ ID NO: 16, pCC1-loxP- EQ ID NO: 18, pCC1-loxP-SEQ ID NO: 20, or pCC1-loxP- SEQ ID NO: 22 plasmids are similarly introduced into separate populations of Plasmodium falciparum parasites. After 6 h the culture medium (RPMI-HEPES with 5% Albumaxll (Invitrogen) and 5% heat inactivated human serum) is changed and the cells are placed under positive selection, e.g. using 6 nM WR99210 (Jacobus Pharmaceuticals) or blasticidin. Fresh media and WR99210 is added every 24 h for the next 5 days and every 48 h thereafter. After the establishment of (e.g. WR99210 or blasticidin) resistant parasites (25-32 days) 5-FC (Ancotil ® ICN) is added while maintaining selection with WR99210. This procedure allows positive selection for parasites that had integrated this cassette by double crossover recombination with WR99210 and negative selection with 5-FC against those that retained the episomal plasmid.

To determine if parasites have integrated the hDHFR selection cassette into the SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, or 22 loci, Southern blot hybridisation on genomic DNA cut with restriction enzymes is used to examine sizes of the digested fragments wild-type (e.g. untransfected) Plasmodium falciparum (WT), and the transfected lines (3D7ΔSEQ ID NO: 2, 3D7ΔSEQ ID NO: 4, 3D7ΔSEQ ID NO: 6, 3D7ΔSEQ ID NO: 8, 3D7ΔSEQ ID NO: 10, 3D7ΔSEQ ID NO: 12, 3D7ΔSEQ ID NO: 14, 3D7ΔSEQ ID NO: 16, 3D7ΔSEQ ID NO: 18, 3D7ΔSEQ ID NO: 20, or 3D7ΔSEQ ID NO: 22) when probed with DNA corresponding to either the 5' or 3' flanks. This analysis allows examination of disruption of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, or 22 loci with the hDHFR cassette integrated by homologous double crossover recombination across the 5' and 3' flanks using the vectors.

EXAMPLE 9: Removal of positive selectable marker from genetic disruption following disruption of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, or 22.

Following genetic disruption, to remove the positive selectable marker, a second vector based on pCC4 (e.g. pCC4-FLP or pCC4-CRE) containing the positive selectable marker bsd as described supra and flp or ere recombinase, driven by an Hsp86 promoter region is introduced to the parasites (e.g. by transfection), to catalyse deletion of the positive selectable marker genes in Plasmodium falciparum. Following positive selection for the ere- or //p-recombinase containing-vector on blasticidin, recovered cell populations undergo Southern blot analysis. Genomic DNA is prepared with the Dneasy Tissue Kit (Qiagen) and Southern Blot analysis performed using the DIG system (Roche) according to manufacturer's instructions to confirm removal of the positive selectable marker (e.g. hDHFR) from the confirmed disruption of targeted genes. The resulting parasite population lacking the sequences between the loxP or FRT sites (e.g. the positive selectable marker) is genetically disrupted for SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, or 22.

EXAMPLE 10: Safety and efficacy of compositions and vaccine strains To assess the safety of the compositions and vaccine strains of the present invention in humans and evaluate its ability to produce an immune response, phase 1 clinical trials are conducted. Typically, about 100 volunteers in a non-endemic country are enrolled, and trials conducted in non-endemic countries are conducted. Furthermore, trials are conducted among malaria-exposed populations in endemic countries. Primary outcome measures such as safety (e.g. number of adverse events), and reactogenicity, tolerability are measured. Secondary outcome measures are also examined, such as antibody response and efficacy measures, such as those discussed supra.

Healthy, malaria-naive adults aged 18 - 50 years are enrolled and splint into 3 groups, 5 subjects in group A (low dose), 15 subjects in group B (medium dose) and 15 subjects in group C (high dose). Infectivity controls (control individuals) are enrolled for challenge and rechallenge phases. Six infectivity controls per day of challenge are enrolled for the challenge phases, with 3 alternate individuals available for challenge if needed. A vaccination schedule of 0 and 1 months, is undertaken, with challenge of up to 15 subjects in Group B and Group C. Contingent upon short term efficacy, rechallenge of initially protected subjects 6 months (+/- 2 months) after second dose of the compositions and vaccine strains of the present invention. The duration of the study, per subject is approximately 15 months (screening, enrolment, vaccination, challenge and rechallenge).

EXAMPLE 11 : Phase 2 clinical trials of compositions and vaccine strains of the present invention. Phase 2 clinical trials are conducted to monitor safety, potential side effects, immune response, preliminary efficacy against infection and clinical disease, and determine optimum dosage and schedule. Several hundred to a few thousand malaria-naϊve volunteers in non-endemic countries are vaccinated and subsequently exposed to malaria carrying mosquitoes, and efficacy measured. At the first sign of infection, volunteers are treated with an antimalarial drug.

Phase 2 trials are also conducted in malaria endemic countries.

Children less than 10 years of age and are in general good health are eligible for enrolment. Candidates are screened with a medical history, physical examination, and blood and urine tests. Participants (between 100 and 300) are randomly assigned to receive two injections of the compositions and vaccine strains of the present invention.

One third of trial participants are administered the vaccine composition intramuscularly, one third are administered by mosquito bite, and one third are administered intravenously.

The strains of the present invention are administered to mosquitoes (e.g. by blood- feeding) and these infected mosquitoes subsequently used to administer sporozoites of the strains of the present invention to individuals, or sporozoites extracted from infected mosquitoes, at days 10, 14 and 18 post-infection for intravenous administration. Sporozoites are administered at different doses, including doses of greater than 10 sporozoites, greater that 1000 sporozoites, greater than 1000 sporozoites, greater than 10000 sporozoites, greater than 100000 sporozoites, or greater than 1000000 sporozoites.

The amount of the compositions of the present invention present in each vaccine dose is selected as an amount which induces an immunoprotective response without significant, adverse side effects in typical vaccines.

Before delivery, a small blood sample is obtained to make sure the individual is well and to see if he or she has immune responses, including antibodies or cellular responses, to the malaria parasite.

As discussed supra, the compositions and vaccine strains of the present invention are administered to the vaccinated group at different doses and different routes. Furthermore, different vaccination regimes are undertaken; a single dose, prime-boost strategies, and multiple vaccination strategies. Alternative adjuvants may be used, and adjunct drug therapy may be used. In one regime, following an initial vaccination, subjects will receive a boost in about 4 weeks, followed by repeated boosts every six months for as long as a risk of infection exists. The immune response to the protein of this invention is enhanced by the use of adjuvant and or an immunostimulant.

In another regime, the second vaccination is given 4 weeks after the first. After each vaccination, participants are observed in the clinic for 30 minutes. Participants return to the clinic 1 , 2, 3, 7 and 14 days after each shot for a physical examination. Blood samples are drawn at visits to check for side effects of the vaccine and to measure efficacy against malaria.

In a further regime, following second vaccination, subjects come to the clinic once a month for an examination. Children who have been ill with a disease that could be malaria have a blood sample collected by fingerstick to test for malaria, and to measure outcomes such as parasite density, load, etc. Every fourth visit a fingerstick sample is taken regardless of whether the child has been sick. If a child becomes sick at any time during the study, he or she will be brought to the clinic for examination.

Primary outcome measures include the occurrence of serious adverse events over a period 1 day to 45 months post first dose of the compositions and vaccine strains of the present invention. Secondary outcome measures include antibody titers, first clinical episode of symptomatic P. falciparum malaria, total number of clinical episodes of symptomatic P. falciparum malaria, presence of anemia in children, number of asexual stage falciparum parasites per μl_ of blood for each subject etc.

EXAMPLE 12: Phase 3 clinical trials of compositions and vaccine strains.

To monitor safety and potential side effects and evaluate efficacy of the compositions and vaccine strains of the present invention, phase 3 clinical trials are conducted on a large scale and under varied conditions including different malaria-transmission patterns.

A primary clinical malaria endpoint is those individuals with documented fever, defined as an axiliary temperature measurement of ≥37.5 ⁰C (oral, tympanic or rectal temperature measurements may also be used) and parasite density above threshold derived using recent historical data appropriate to age by logistic regression method with sufficiently high specificity for all sites in a multi-site trial (a minimum of 80%). A parasite density cut-off that provides high specificity for the diagnosis of malaria is determined and selected. In one approach, because risk of fever is modelled as a continuous function of parasite density, two groups of community controls and clinically suspected cases are used to estimate both the malaria attributable fraction and the sensitivity and specificity of different parasite density cut-offs; a specificity of >80% for a case definition. Recent historical data from the trial site(s) corresponding to trial conditions in terms of age group and site, surveillance mechanism and seasonality are used in the calculation. Cut-off levels are selected according to sitefor studies conducted across sites with greatly varying levels of malaria endemicity.

A case definition of P. falciparum parasitaemia and one or more of the following criteria: prostration, respiratory distress, Blantyre coma score ≤2, seizures (two or more), hypoglycaemia <2.2 mMol, anaemia <5 g/dl, and without any of the following pneumonia (clinical assessment and chest x-ray), meningitis (based on CSF examination), bacteraemia (based on blood culture) or gastroenteritis (based on clinical assessment).

Because natural immunity does not provide complete protection from malaria, in addition to examining the number and frequency of malaria events that either do or do not occur in both an individual and populations (e.g. a vaccinated population relative to an unvaccinated population, or populations given different treatments, e.g. different doses, formulations, adjuvant therapy, drug therapy etc.) alternate events are measured. As discussed supra, these include other measures of vaccine efficacy, such as parasite density in blood, parasite load, parasite growth rates, delay in appearance of blood stage infection, measures of numbers of individuals that remain parasite free for specified periods of time, time to detection of infection (time to first parasitemia), time to first clinical episode, total number of episodes, morbidity (number of clinical episodes, for example any signs or symptoms of malaria accompanied by any parasitemia, or fever accompanied by parasitemia, or fever accompanied by parasitemia in excess of a particular threshold value).

Anti-malarial and bed net use in the study sites is documented. Similar numbers of individuals (approximately 2000) are randomized to vaccinated and placebo groups. Candidates are screened with a medical history, physical examination, and blood and urine tests. In the case of children, written informed consent in an appropriate language is obtained from each child's parent (or parents) or guardian before the study procedures are initiated (non-literate parents indicate consent using a thumbprint, and a signature is obtained from a literate witness).

The strains of the present invention are administered to mosquitoes (by blood- feeding) and these infected mosquitoes subsequently used to administer sporozoites of the strains of the present invention to individuals, or sporozoites extracted from infected mosquitoes, at days 10, 14 and 18 post-infection for intravenous administration. Sporozoites are administered at different doses, including doses of greater than 10 sporozoites, greater that 1000 sporozoites, greater than 1000 sporozoites, greater than 10000 sporozoites, greater than 100000 sporozoites, or greater than 1000000 sporozoites.

As discussed supra, the compositions and vaccine strains of the present invention are administered to the vaccinated group at different doses and different routes. Furthermore, different vaccination regimes are undertaken a single dose, prime-boost strategies, and multiple vaccination strategies. Alternative adjuvants may be used, and adjunct drug therapy may be used. In one regime, individuals are randomly assigned to receive three doses of the compositions and vaccine strains of the present invention or three doses of a human diploid-cell rabies vaccine. The compositions and vaccine strains of the present invention or a visually indistinguishable placebo are administered.

Following each vaccination individuals are observed for one hour following which solicited adverse events are recorded by trained fieldworkers. Fieldworkers visit subjects daily for the first 6 days after vaccination to record solicited and unsolicited adverse events. All severe adverse events are assessed by a study clinician. Data relating to all malaria admissions to hospital are reviewed to define cases of severe malaria disease by five clinically qualified investigators prior to unblinding. Episodes of clinical malaria detected in surveillance to determine efficacy are not considered to be adverse events. Severe adverse events are categorised according to the preferred term from the MedDRA database, and allocated before unblinding. Non-malaria SAEs are defined as those which excluded the MedDRA terms "Plasmodium falciparum infection", "Malaria" and "Cerebral malaria". A grade is assigned to all adverse events as follows; grade 1 (easily tolerated), grade 2 (interference with everyday activities) and grade 3 (prevents everyday activities). Blood tests for routine biochemistry (plasma alanine aminotransferase and creatinine) and hematology (full blood counts) are conducted at all cross-sectional bleeds.

Both active and passive case detection is established. For active case detection, individuals are visited every week by fieldworkers. In the case of children, the parent/guardian are asked whether they think the child has fever, and the axillary temperature is measured. When the temperature is greater than or equal to 37.5 degrees, a blood film is made and a rapid near-patient test (Optimal®) for malaria is conducted. Rapid test results are used to determine treatment decisions, but blood film results or quantitative-PCR results (read in duplicate) are used to define the study endpoint. Treatment for episodes of malaria is with anti-malarial drugs (e.g. artemether-lumefantrine). Individuals requiring admission and too unwell to take oral medication are treated with intravenous quinine.

Passive case detection is also established in local dispensaries providing care to the population. Immune responses, including antibodies, to the compositions and vaccine strains of the present invention are assessed by the methods discussed supra, e.g. by ELISA.

Thick and thin films for parasite density readings are made and stained with giemsa. Parasite densities are calculated using contemporaneous full blood counts. Films are read in duplicate, and by a third reader if one film is positive and the other negative or if the calculated densities differ by more than tenfold when one density is below 400 parasites/μl or if the calculated densities differed by twofold when both densities are above 400 parasite/μl. The final result is the geometric mean density of two readings. Where three positive readings are available, the geometric mean of the closest two readings is taken as the final result. Where there is a discrepancy between positive and negative readings, the majority result is taken as final. Final density results are calculated for all films before unblinding the study. An external quality assurance process is used to accredit slide readers throughout the trial. Blood films are made for febrile individuals, and for all individuals on the second cross-sectional bleed.

Analysis methods appropriate to the particular endpoint measured are used, for example, for the endpoint time to first episode, Cox regression based upon proportional hazards models is used. Secondary analyses include other analytic approaches.

While the foregoing written description of the invention enables one of ordinary skill to make and use what is considered presently to be the best mode thereof, those of ordinary skill will understand and appreciate the existence of variations, combinations, and equivalents of the specific embodiment, method, and examples herein. The invention should therefore not be limited by the above described embodiment, method, and examples, but by all embodiments and methods within the scope and spirit of the invention as broadly described herein.

Claims

CLAIMS:

I . A polynucleotide comprising or consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, and 22 and functional equivalents thereof, or a protein comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 , 3, 5, 7, 9,

I I , 13, 15, 17, 19 and 21 and functional equivalents thereof, wherein the polynucleotide and/or protein have a biological function in a Plasmodium.

2. A polynucleotide comprising or consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and 82 and functional equivalents thereof, or a protein comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NOS: 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 75, 77, 79, and 81 and functional equivalents thereof wherein the polynucleotides and/or protein have an essential function in a Plasmodium.

3. A polynucleotide of protein according to claim 1 or 2 wherein the Plasmodium is Plasmodium falciparum.

4. A method for decreasing the adherence of a cell infected with a Plasmodium comprising or consisting of the step of interfering with the expression of a polynucleotide comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, and 16 and functional equivalents thereof, or interfering with the function of a protein comprising or consisting of a sequence selected from the group consisting of SEQ ID Nos: 1 , 3, 5, 7, 9, 1 1 , 13 and 15 and functional equivalents thereof.

5. A method according to claim 4 wherein the Plasmodium is Plasmodium falciparum.

6. A method for decreasing the export of a Plasmodium protein into a cell infected with a Plasmodium comprising or consisting of the step of interfering with the expression of a polynucleotide comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 2, 8, and 10 and functional equivalents thereof or interfering with the function of a protein comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 1 , 7 and 9 and functional equivalents thereof.

7. A method according to claim 6 wherein the Plasmodium is Plasmodium falciparum.

8. A method for decreasing the display of a Plasmodium protein in a cell infected with a Plasmodium comprising or consisting of the step of interfering with the expression of a polynucleotide comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 4, 6, and 12 and functional equivalents thereof, or interfering with the function of a protein comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 3, 5 and 1 1 and functional equivalents thereof.

9. A method according to claim 8 wherein the Plasmodium is Plasmodium falciparum.

10. A method for altering knob morphology in a cell infected with a Plasmodium comprising or consisting of the step of interfering with the expression of a polynucleotide comprising or consisting of a acid sequence selected from the group consisting of SEQ ID Nos: 14 and 16 and functional equivalents thereof, or interfering with the function of a protein comprising or consisting of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 13 and 15 and functional equivalents thereof.

1 1 . A method according to claim 10 wherein the Plasmodium is Plasmodium falciparum.

12. A method for altering the rigidity of a cell infected with a Plasmodium comprising or consisting of the step of interfering with the expression of a polynucleotide comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 6, 18, 20, and 22 and functional equivalents thereof, or interfering with the function of a protein comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 5, 17, 19 and 21 and functional equivalents thereof.

13. A method according to claim 12 wherein the Plasmodium is Plasmodium falciparum.

14. A method for decreasing the viability of a Plasmodium, comprising or consisting of the step of interfering with the expression of a polynucleotide comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and 82 and functional equivalents thereof, or interfering with the function of a protein comprising or consisting of a sequence selected from the group consisting of 1 , 3, 5, 7, 9, 1 1 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 73, 75, 77, 79 and 81 and functional equivalents thereof.

15. A method according to claim 14 wherein the Plasmodium is Plasmodium falciparum.

16. A method for producing a vaccine strain of a Plasmodium, comprising or consisting of the step of genetically engineering the Plasmodium such that the expression of a polynucleotide comprising or consisting of a sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and 82 and functional equivalents thereof is altered, or the function of a protein comprising or consisting of a sequence selected from the group consisting of SEQ ID NOS: 1 , 3, 5, 7, 9, 1 1 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 75, 77, 79, and 81 and functional equivalents thereof is altered, wherein the vaccine strain has a diminished virulence as compared with a non-engineered Plasmodium.

17. A method according to claim 16 wherein the Plasmodium is Plasmodium falciparum.

18. A Plasmodium vaccine strain produced according to the method of claim 16 or claim 17.

19. A composition comprising or consisting of a Plasmodium vaccine strain according to claim 18 and/or an immunogenic protein, the protein comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 , 3, 5, 7, 9, 1 1 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 , 53, 55, 57, 59, 61 , 63, 65, 67, 69, 71 , 75, 77, 79, and 81 and functional equivalents thereof, and a pharmaceutically acceptable excipient.

20. A composition according to claim 19 further comprising or consisting of an adjuvant.

21 . A method for treating or preventing Plasmodium infection, comprising or consisting of administering to a subject in need thereof an effective amount of a Plasmodium vaccine strain according to claim 18, or a composition according to claim 19 or claim 20.

22. A method according to claim 21 wherein the Plasmodium is Plasmodium falciparum.

23. A method according to claim 21 or claim 22 wherein the Plasmodium infection is malaria.

24. A polynucleotide comprising or consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, and 6 and functional equivalents thereof, or a protein comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 , 3, and 5 and functional equivalents thereof, wherein the polynucleotide and/or protein have a biological function in a Plasmodium.