WO2009090554A2 - Specific aptamers generated for suppression of cell migration and invasion by cancer cells, methods of selection for such aptamers and their usage - Google Patents

Abstract

The invention relates to a new method to generate aptamers selected using live metastatic cancer cell lines. The Inventors have shown that using their modified SELEX system it is possible to generate metastatic cell specific aptamer molecules and that some of the aptamer molecules they have developed prevent metastatic cell migration.

Description

Specific aptatners generated for suppression of cell migration and invasion by cancer cells, methods of selection for such aptamers and their usage

The invention relates to aptamers which specifically bind to metastatic cancer cells and which can suppress metastatic cancer cell migration and invasion, as well as methods of creating and improving such aptamers and the use of such aptamers in research, diagnostic and clinical applications.

Metastasis is the main factor in cancer mortality. Metastatic tumour cells are able to spread throughout the body and grow at distant sites increasing morbidity. Despite progress in oncology, there is still a lack of therapies that can efficiently block metastasis. If it was possible to prevent cancer cells from spreading, primary tumours would remain confined and could be more easily cured by surgical removal or other therapies.

Cell migration plays a crucial role in metastatic spread. The targeting of cell motility and invasiveness is considered as a promising alternative to more traditional methods of therapeutically treating tumours. Tumour cell migration and invasion within a three-dimensional tissue matrix are complex processes that include mobility of individual cells as well as collective cell movements and comprise diverse cellular and molecular mechanisms. It has turned out to be difficult to block cell migration effectively with pharmacological compounds. Current strategies aim at interrupting the cell-extracellular matrix contacts (Sawyer, 2004; Tucker, 2003) or reducing the protease activity of tumour cells (Zucker et al., 2000; Overall and Lopez- Otin, 2002; Coussens et al., 2002). Unfortunately, none of these compounds has reached the market for various reasons such as poor in vivo anti-tumour activity, an unsuitable therapeutic index or the fact that tumour cells develop mechanisms to overcome the activity of these drugs (Zucker et al., 2000; Friedl and Wolf, 2003).

The majority of current anticancer treatments target a rumour cells' ability to proliferate. However, this type of therapy has a limited success rate. Some cancer cells can stay dormant for a long period before generating new tumours (Naumov et al, 2002, Entschladen, 2004). Moreover, migrating cells are able to decrease their proliferation rate, becoming less sensitive to traditional chemotherapy, the most common form of antiproliferative treatment (Douma et al, 2004; Giese et al, 2003; Haga et al, 2003). A major aim of modern anticancer strategies is to inhibit or at least to reduce the dissemination of tumour cells by targeting factors or markers regulating their migratory activity.

In modern drug development, the identification of medicaments which can specifically inhibit a target proteins function, whilst not affecting more general cellular or biological processes is recognized as being an important goal. The targeting of cancer-specific macromolecules within tumour tissues should be more beneficial as opposed to traditional drugs, which tend to be toxic for both tumour and normal cells. Several classes of inhibitors have been employed, including monoclonal antibodies, peptides and small molecules.

The search for ligands/molecules capable of recognizing and interfering with the function of a molecular determinant or marker associated with a specific type of tumor, or else a given stage in its development, or alternatively signaling the metabolic state of a tumor, is therefore essential for better research, diagnosis and therapy of cancers. Unfortunately, these ligands are generally obtained from targets which have been purified and isolated out of their biological context, and which are therefore different from the targets in their natural environment.

Thus most commonly the ligands which are effective in vitro, are incapable of interacting with their target in vivo: - because they cannot cross tissue barriers, because they are unstable in the organism or are responsible for too many adverse interactions with other biomolecules, because the natural structure of the target, when out of its natural cell environment, is not conserved or because certain essential modifications of this structure, such as: (i) post-translational modifications of proteins or (ii) interactions with other proteins, cannot be reproduced in vitro.

The latter two limitations are particularly frequent in the case of targets such as transmembrane proteins comprising a lipophilic segment inserted into the lipid cell membrane; this lipophilic segment is not conserved in vitro, whereas the membrane insertion of these proteins determines their structure and is essential to their activity.

Furthermore, the problem arises of the specificity with which the available ligands recognize targets identified in tumors. It is therefore important to be able to provide specific ligands for diagnosing and/or treating certain cancers, in particular those related to metastasis.

Molecular medicine therefore needs new molecular recognition probes/ligands which are: specific, adjustable, and easy to produce at a reasonable cost.

Pharmacological research has set up novel strategies for discovering novel ligands effective against targets identified in tumors: combinatorial libraries of small molecules make it possible to increase the chances of finding a ligand against a specific protein (example: a subclass of combinatorial libraries, false substrates which inhibit enzymes, such as those which inhibit MMPs (matrix metalloproteases)). Their major drawback is that they are screened in vitro. Moreover, their selectivity in vivo is not guaranteed, hence the difficulty in obtaining with these agents a compound which is sufficiently selective to be effective and free of side effects. Exceptionally compounds are obtained which are specific for an abnormal protein form, which leads to non-specific binding and adverse effects and results in a poor therapeutic index; - monoclonal antibodies are excellent agents for specific targeting and have recently been used for therapeutic purposes (example: trastuzumab (Herceptin®) in breast cancer); however, they remain very difficult to use in vivo due to their size, idiotypy and inherent immunogenicity. They are also extremely expensive to produce and to optimize. Furthermore, the upper limit of specificity of monoclonal antibodies is limited to the recognition of a point mutation affecting a single amino acid on a protein is involved; aptamers, which constitute an alternative means of diagnosis and therapy, and which have a certain number of advantages compared with antibodies, as illustrated in Table I below. Table I

*theophylline versus caffeine, for example.

Technological improvements have made this novel class of potential inhibitors more readily available. Engineered aptamers are structured small oligonucleotides that bind tightly and specifically to a target molecule just like protein antibodies (Jayasena, 1999). In the case of proteins, high affinity oligonucleotide aptamers often inhibit function, presumably by interactions that overlap the binding site of natural ligands. Some properties of aptamers make them very attractive potential therapeutic agents, as compared to antibodies. Firstly they seem to lack immunogenicity in man (Eyetech Study Group, 2002), secondly they can be chemically modified for improved stability in body fluids and thirdly, due to there small size, they are able to penetrate tumours/tissue barriers more readily.

Aptamers of various types have previously been used for tumour imaging, diagnosis and to a limited extent cancer treatment. G-rich aptamers were demonstrated to have an antiproliferative effect in vitro and activity against human tumour xenografts in vivo (Bates et al, 1999). These G-rich aptamers consisted only of deoxy- guanidine and thymidine and contained runs of at least two guanosine residues. No selection system was used to generate these aptamers or improve there effects. Such G-rich aptamers were found to inherently inhibit tumour cell prolifera- tion by an interaction with a membrane bound G-rich oligonucleotide binding protein, thought to be nucleosin. Such aptamers are not therefore generally useful in the visualisation or treatment of cancer cells as their effects upon these cancer cells were found to be an effect of the polynucleotide structures they formed due to there G-rich nature rather than any engineered affinity for a suitable anticancer marker. The TTl aptamer to tumour matrix protein tenascin-C was reported to be taken up by a variety of solid tumours (Hicke et al, 2006). The TTl aptamer was isolated using SELEX, see below, to tumour cells expressing tenascin-C and purified tenascin-C. The problems inherent in the generation of materials reactive with isolated tumour cell markers as outlined above therefore apply. In addition such an aptamer and methods of generating it are limited to identifying aptamers to those genes which have previously been characterized as being involved in cancer cell development/differentiation such as tenascin-C.

Aptamers can be created by the combinatorial method for aptamer generation called SELEX (Systematic Evolution of Ligands by Exponential enrich- ment) (Tuerk and Gold, 1990, Ellington and Szostak, 1990).

Briefly, the principle of the SELEX method involves the selection, from a mixture of nucleic acids comprising random sequences, by successive reiterations of binding, separation and amplification steps, of nucleic acid molecules (aptamers) exhibiting a defined binding affinity and a defined specificity for a given target. Thus, starting from a mixture of random nucleic acids, the SELEX method comprises the following steps: bringing the mixture of nucleic acids into contact with the target element (natural or synthetic polymers: proteins, polysaccharides, glycoproteins, hormones, receptors, antigens, antibodies, cell surfaces; small molecules: medicament, metabolites, cofactors, substrates, transition state analogs; tissues and in particular whole cells; viruses, etc.), under conditions which promote binding, separating the unbound sequences, dissociating the nucleic acid-target element complexes, amplifying the dissociated nucleic acids which were bound to the target, so as to obtain a mixture enriched in ligands (aptamers), and repeating the binding, separation, dissociation and amplification steps, for the desired number of times.

High-affinity and high specificity aptamers are selected from a vast random sequence oligonucleotide library (normally 10¹⁴ initial molecules). Evolution is directed by the reduction of initial pool complexity during reiterative cycles of physical separation of target-binding sequences from inactive variants, followed by their reamplification. The binding of an aptamer strongly depends on the conforma- tional state of its target (Tuerk and Gold 1990).

Aptamers can theoretically be developed to any target, from a pure single molecule to complex systems like a whole cell ( M. Blank, et al, 2001, Daniels, et al, 2003, Cherchia et al, 2005). For instance in Morris et al, 1998 a group using SELEX was able to generate aptamers against targets in human red blood cell membranes. The workers used a standard SELEX methodology and successfully generated aptamers specific for several targets on human red blood cell membranes.

Several groups have generated aptamers against complex targets using an elaboration of the SELEX method called subtractive SELEX, for instance EP 1564290, Blank et al, 2001 and Wang et al, 2003. Subtractive SELEX uses a first counter selection step to eliminate aptamers to unimportant targets, for instance in EP

1564290 aptamers specific for peripheral blood mononuclear cells (PBMC), fibrin clots and carotid arteries were generated, by eliminating by counter-selection from a library, aptamers to vascular and organism markers by counter-selection against a normal artery and then a second selection with the screened library against an injured artery. Aptamers were collected which were specific for the injured artery but not for the majority of vascular or organism specific markers.

Subtractive SELEX has proved to be a useful tool in finding ligands to specific biological markers that distinguish a phenotypically distinct subtype of cells from cells of homologous origin. This strategy was used for the isolation of aptamers capable of distinguishing differentiated PC 12 cells (neurons) from normal PC 12 cells (Wang J et al. 2003) and tumour vasculature from those of the normal brain (Blank et al, 2001).

In these prior art studies therefore subtractive SELEX was used to generate aptamers specific for very different targets, for instance differentiated neurons versus precursor cells or markers present on normal vascular tissue versus markers present in a vascular wound.

As pointed out above metastatic cancer cell behaviour and the processes underlying these behaviours are extremely complex and after several decades of intensive research continue to not be fully understood or explained. The blocking of these processes has turned out to be extremely difficult using all available means and current strategies, such as using pharmacological compounds which attempt to interrupt the cell-extracellular matrix contacts or reduce the protease activity of metastatic tumour cells. Other strategies such as chemo- or radiotherapy also are not always successful with metastatic cancers as metastatic cancer cells are capable of adopting dynamic and adaptive phenotypes so as to remain unaffected by such therapies.

These dynamic and adaptive phenotypes and the various combinations of these which metastatic tumour cells can adopt to evade therapy, mean that metastatic cancer cells are overall a very complex and constantly shifting target, because the total number of potential phenotypic differences between one metastatic cancer cell line and another metastatic cancer cell line or a healthy cell line is enormous. Also because such phenotypes are normally transient unlike the specific and permanent phenotypic differences between differentiated neurons and precursor cells (Wang J et al. 2003), the generation of aptamers to such transient metastatic cancer cell targets also therefore presents further problems to any previous target against which aptamers have been generated using the SELEX method.

The Inventors have previously sought to address these problems by using a modified SELEX method to identify aptamers able to recognise or act as ligands to membrane receptors with tyrosine kinase activity, e.g. Receptor protein- tyrosine Kinases (RTKPs), (Wo05/093097). The Inventors were able to isolate aptamers specific for RTKPs, two groups of aptamers were generated, a first group which bound to these RTKPs and inhibited the activity of the bound RTKP and a second group of aptamers which only bound to the RTKP without affecting their activity. To do this the Inventors introduced specific activating mutations into the coding sequence of the RET (Rearranged During Transfection) receptor gene. The RET oncogene encodes an abnormal form of a receptor-type surface protein of the tyrosine kinase family; RET is located on chromosome 1OqI 1.2. Mutations in the RET protooncogene are associated with several diseases, in particular Hirschsprung's disease and multiple endocrine neoplasia type II (or MEN 2), which includes MEN type 2A (MEN 2A), MEN type 2B (MEN 2B) and familial medullary thyroid cancer (or FMTC).

The RET gene/protein in WO05/093097 had been activated by mutation at a cysteine located in the extracellular domain, preferably at one or more of codons 609, 61 1 , 618, 620 or 634. The coding sequence of this mutated gene was then transfected into a mammalian cell line and a subtractive SELEX method was performed using such transfected cells as the target element. This system also comprised an intermediary step of exposing the nucleic acid molecules to cells transformed with RET modified with an intracellular mutation, so further increasing the specificity of the aptamers to recognize only activated RET which is the oncogenic form of this protein.

Such a system however is limited to identifying aptamers to known oncogenes which have previously been characterized, as in the case of the proto- oncogene RET, as being involved in cancer cell development/differentiation. This prior art method also requires the cloning, suitable alteration of such a gene coding sequence and its transfection into cells so as to create the required cancer phenotype as a target element, against which aptamers can be generated.

Given the known pathological effects of the activated RET protein, for instance Hirschsprung's disease and MEN 2, the massive over expression of an activated RET protein in transformed cells had a significant effect upon the phenotype of these transformed cells and also this large concentration of extracellular activated RET targets allowed aptamers to be generated to the oncogenic version of the RET protein. Such transformed cells are very different from metastatic cancer cells which have spontaneously occurred and have been isolated from an in vivo source or which have been generated in vitro and then selected for their metastatic behaviour. In particular the phenotype of metastatic cancer cells would not be expected to comprise the massive overexpression of a single gene product and would be expected to be much more similar to an isogenic progenitor cell line from which it was derived or to an isogenic metastatic cancer cell line which exhibited a lower level of metastatic cancer cell behaviour.

The over expression of an oncogene (RET) provides a good model to create aptamers against this oncogene, but as a single genetic/phenotypic change is normally not responsible for the complex altered phenotype of metastatic cancer cells, such a simplified system can not be used to look for metastatic specific cancer cell markers and used as a target element to generate specific aptamers against these. Given the useful properties known for aptamers the Inventors have continued to pursue further means of using these molecules in the characterisation, diagnosis and potential treatment of metastatic cancer cells which are cancerous due to both known and unknown genetic changes. In particular the Inventors have now developed a new system to identify aptamers which target metastasis specific markers and in some cases also block the metastatic spreading of these cells making all such aptamers useful as research and diagnostic tools and a subset of these also potentially useful as anti- metastatic cancer agents. The Inventors have used a new modified SELEX approach to identify aptamers that recognise metastatic cancer cell markers from metastatic cancer cells which show a high level of metastatic cancer cell behaviour such as migration and/or invasiveness using an isogenic metastatic or non-metastatic cancer cell which shows a lower level of metastatic cancer cell behaviour as a counter selection target. They have also shown that some of the aptamers they have generated using this new method can block metastatic cell migration and/or cell invasion.

Therefore the present invention relates to a method for identifying aptamers specific for at least one metastatic cancer cell marker, using a mixture of nucleic acids, wherein said method comprises at least the following steps: (a) bringing a mixture of nucleic acids which form a combinatorial library into contact with cancer cells not expressing said at least one cancer cell marker (C_N Cells), said C_N cells being the same cell type as metastatic cancer cells expressing said at least one metastatic cancer cell marker (C_M cells);

(b) recovering a first subset Sl of nucleic acids which do not bind to the C_N cells, in step (a);

(c) bringing the first subset Sl of nucleic acids, into contact with the CM cells;

(d) recovering the nucleic acids which exhibit a high binding affinity with respect to said C_M cells, after dissociation of the C_M cell-nucleic acid complexes;

(e) amplifying said nucleic acids with high binding affinity for the CM cells, so as to obtain a mixture of nucleic acids, enriched in nucleic acids having a high binding affinity for said C_M cells, and

(f) identifying aptamers specific for the C_M cells, from the mixture obtained in (e).

Such a method is particularly advantageous as unlike prior art methods the current method allows the generation of the aptamers against specific metastatic cancer cell markers without the need to choose beforehand therapeutically meaningful target molecules. The use of the modified SELEX method developed by the Inventors can generate high affinity aptamers for multiple targets within a complex system such as a metastatic cancer cell in which numerous different corrupted cellular mechanisms all contribute to the disease state.

In particular the use of this modified SELEX method has been shown to generate functional aptamers to molecules which participate in the migratory and invasion phenotypes associated with metastatic cancer cells and which are responsible for the more deleterious aspects of such metastatic cancer cells when these occur in a patient.

In anti-cancer drug discovery, selection of aptamers using intact cancerous cells isolated from an in vivo source or selected from an in vitro population based upon their metastatic cancer cell behaviour has some indisputable advantages. Particularly such a system does not require a full understanding of the complex mechanisms of the cellular features targeted. Thus, there is no necessity to decide which molecular target has therapeutic importance at the outset of the study.

This method is not target-based, that is individual identified targets are not the basis for the selection process nor is it necessary to select these targets prior to the beginning of the selection process. Selection is instead made against a complex phenotype comprising and resulting from a multitude of interacting genes and gene products. This is an important difference as there has been a perceived failure in the field of target-based drug discovery approaches in the post-genomic era which has led to a renewed interest in and renaissance of techniques which allow the screening of collections of compounds against complex phenotypes with the objective of eliciting a specific desirable effect.

The invention relies upon the comparison of two or more isogenic cell lines with different metastatic potentials or levels of metastatic cancer cell behavior. Therefore in a preferred embodiment the C_N and CM cells are otherwise as genetically and physiologically identical as possible and are both metastatic cancer cell lines, except the CM cell line shows a higher level of a metastatic behaviour such as cell migration and/or invasion than the C_N cell line. Alternatively in another preferred embodiment the C_N cells do not show metastatic cancer cell behavior and are instead cancer cells.

In the present invention a cancer cell is one which undergoes uncontrolled growth and/or division and/or a cell which can not be eliminated by innate cell death pathways such as apoptosis. A metastatic cancer cell has some or all of the properties of a cancer cell in addition to metastatic specific behaviors such as migration and invasion.

In the present Patent Application therefore a low metastatic cancer cell or cell line, is one which exhibits a reduced amount of a metastatic cancer cell behavior such as migration and/or invasion either in vivo or in an in vitro assay. Conversely a high metastatic cancer cell or cell line, is one which exhibits a higher level of a metastatic cancer cell behavior such as migration and/or invasion.

As the SELEX method according to the present invention uses a set of two cancer cell lines, one cell line will always show a lower level of metastatic cancer cell behavior than the other. This lower level can be a percentage decrease in comparison to the other cell line in which case the cell line will be a low metastatic cancer cell line or can show no metastatic behaviour at all in which case the cell line will be a cancer cell line. In either situation the cancer cell line or low metastatic cancer cell line will be the CN cells, likewise the other cell line will be the high metastatic cancer cell line (C_M) which shows a higher level of metastatic cancer cell behaviour.

According to a preferred embodiment of the present Invention, starting with two or more isogenic cancer cell lines with different metastatic potential, this system allows the selection of aptamers with antimetastatic activity and/or more generally the selection of aptamers which specifically recognise cells which show a high level of metastatic behaviour.

The cellular model used to validate the modified subtractive SELEX method developed by the inventors was based upon two cell lines, that were obtained as an independent transformation of Syrian hamster embryo fibroblasts by Rous sarcoma virus (Deichman et al., a- 1989, b- 1992). Both were highly tumorigenic in vivo. However, a few C-terminal mutations in the transforming viral oncogene v-src produced remarkable differences in the spontaneous metastatic activity of some of the transformed cells in syngenic grafts in Syrian hamsters (Tatosyan et al, 1996). In vitro migratory capacities of low metastatic cells were inferior to those of high metastatic (Isachenko et al, 2006), but their proliferative rates were comparable. Interestingly, the spectrum of cellular proteins that interact with v-src in the high and low metastatic cell lines do not differ significantly (Mizenina et al., 2001). In particular the method is characterized in that said C_N cells are metastatic cancer cells.

Unlike prior art SELEX methods, the method described in the present Patent Application can use two essentially identical metastatic cancer cell lines which as pointed out above are identical in terms of their proteome (for instance the range of cellular proteins which interact with the v-src kinase) and their physiological properties (for instance proliferation rates) both in vivo and in vitro. These cell lines only differ in terms of their metastatic potential. These two isogenic metastatic cell lines therefore present a much more narrowly defined set of non-overlapping targets than has previously been used in subtractive SELEX methods. This elaboration of the SELEX method is therefore an important next step in the evolution of the SELEX method, if this method is to be used to generate aptamers specific for a phenotypic marker expressed by a small subset of an otherwise identical larger cell population, which as pointed out above is an essential property of new therapeutics to complex diseases phenotypes such as metastatic cancer. As with other SELEX methods the complexity of the pool decreases in each step by subtracting sequences, which are able to bind to the low metastatic cell line and by eliminating non-binding sequences by multiple washes. The use of a low metastatic cell line (C_N) for the counter selection step makes this method more able to increase the portion of aptamers which recognise targets from cells (C_M) showing a high level of metastatic activity, because it leads to elimination of both species and tumour-specific sequences, which are not of interest. Several categories of potential targets or markers include:

- Molecules with an established role in metastasis, such as Growth Factors and Receptors: CSFl (csf- 1), CSFl R (c-fms/MC-SF-R), FGFl (a-FGF), FGF2 (b-FGF2), HGF (Scatter factor), IGF2, NGFB, PDGFA, TGFA (TGF-a), TGFBl (TGF-b 1), VEGF, VEGFC; Cell-Cell and Cell-Matrix Interaction Molecules: CAV l (caveolin-1), CDHl (cadherin-1/ E-cadherin), COL4A2 (collagen a₂(!V)), ICAM5 (telencephalin), ITGA2, ITGA3, ITGA5, ITGA6, ITGBl , ITGB3, LAMBl (laminin bl), LAMCl (laminin b 2), MICA (MUC- 18), MUCl , NCAMl , PECAMl , VTN (vitronectin); Metastasis-Associated Proteases: Matrix Metalloproteinasesi MMPl , MMP2, MMP3, MMP7, MMP8, MMP9, MMPlO, MMPI l , MMP13, MMP14, MMP15, MMP16; Others: CASP8, CASP9, CST3 (cystatin C), CTSB (cathepsin B), CTSD (cathepsin D), CTSL (cathepsin L), ELA2 (elastase), HPSE (heparanase), MGEA5 (meningioma hyaluronidase 5), PLAU (uPA), TMPRSS4; Protease Inhibitors: SERPINB2 (PAI-2), SERPINB5 (maspin), SERPINEl (PAI-I), THBSl , THBS2, TIMPl , TIMP2, TIMP3; Signal Transduction Molecules: LIMKl (LIM kinase), PLAUR (uPAR), PIK3C2B, RACl ; Oncogenes: ERBB2 (c-erb-2/neu), ETSl (c-ets-1), ETS2 (c-ets-2), ETV4 (PEA3), FES, FOS (c-fos), HRAS (c-hRas), MDM2, MYC (c-myc), RAFl, SRC (c-src) ; Metastasis Suppressors: BRMSl (BrMSl), CD44, DCC, KAI l , KlSSl (KiSS-I), MAP2K4 (mkk4 (JNKKl), MTAl, NM23A (NM23), NME4, PTEN; Other Related Genes: API5 (apoptosis inhibitor 5), ARHC (Rho C), EHM2, ENPP2 (autotaxin/ ATX), MGAT3 (acetylglucosaminyl- transferase III), MGAT5 (acetylglucosaminyltransferase V), ODCl , PTGS2 (cox-2), S100A4 (mts-1), SNCG (BCSGl), SPPl (osteopontin).

- Or proteins with no established role in metastasis, such as genes with unknown or putative functions, but against which the current method has been able to raise specific aptamers implicating these genes in the metastatic phenotype.

The above list of potential targets for the aptamers of the current invention is intended to be non-limiting.

In particular the method is characterized in that steps (a) to (f) are repeated using the mixtures enriched in aptamers from the preceding cycle, until at least one aptamer is obtained, the affinity of which, defined by its dissociation constant (Kd), can be measured and is suitable for pharmaceutical use. In particular the aptamers have a binding affinity in the range 5- 10O nM.

In particular the method is characterized in that steps (a) to (0 are repeated several times. Preferably steps (a) to (e) are repeated between at least 10 times and

15 times.

The Inventors have shown that ten rounds of SELEX under gradually increasing selection pressure generates a restricted number of aptamers, which bind metastatic target cells with different binding affinities. Some of these aptamers were highly abundant, most could be classified within a few principal families according to sequence and structure similarities and few were found only as a single example. Further rounds of SELEX under increasing selection pressure modified the aptamers present, causing some families to be eliminated and others to increase in abundance. In addition new aptamers appeared which were apparently unrelated in structure or sequence to any of those present after ten rounds.

In particular the method is characterized in that the starting nucleic acid combinatorial library contains at least 10⁹ nucleic acids, preferably between IO¹² and 10¹ nucleic acids and advantageously consists of nucleic acids comprising random sequences flanked, respectively at their 5' and 3' ends, by fixed sequences for PCR amplification, preferably the sequences SEQ ID NO: 1 and SEQ ID NO:2 or a fragment of at least 8 nucleotides of these sequences.

In addition to amplifying the selected aptamers by PCR or some other nucleic acid amplification method, the aptamers can also be amplified by any other known method, such as sequencing the selected aptamers and synthesizing these synthetically using an oligonucleotide synthesizer for the next round of binding and selection.

In particular the method is characterized in that said random sequences each contain between 10 and 1000 nucleotides, preferably 40 nucleotides, and comprise deoxyribonucleic acid, ribonucleic acid or modified nucleic acids. In particular the method is characterised in that the cell populations in step (a) and step (c) are cultured under conditions mimicking a solid tumour. To mimic tumour conditions as far as possible, the method was carried out on 3-D cultures of both the high-metastatic and low-metastatic cell line. In various cell culture applications, it has been shown that the growth and function of cells as multi-cellular 3-D structures is significantly different to their growth as conventional 2-D monolayer cultures (Schmeichel and Bissell, 2003, Beningo et al, 2004, Cukierman, 2001). One can reconstitute natural conditions by using different materials that can support 3-D cell growth, for example biodegradable polymers (Dhiman et al, 2004), hydrogels (Fisher et al, 2004, Park et al, 2005) etc. This cellular model was excellent for the selection of aptamers able to bind target cells in 3-D growth conditions. The important feature in such a 3-D model is that the cells are capable of post-confluent growth, organizing high density multilayers with non- attached cellular aggregates, mimicking conditions of solid tumours.

In particular the method is characterized in that the identification of the aptamers specific for the C_M cells according to step (f) comprises an evaluation of the biological activity of said aptamers on said C_M cells.

In particular the method is characterized in that the biological activities which are evaluated are selected from the following:

(a) inhibition or activation of horizontal cell migration,

(b) inhibition or activation of vertical cell migration, (c) inhibition or activation of cell invasion.

Parallel screening of the aptamers isolated with high binding affinity for the metastatic cell line, for a particular effect of interest such as reducing cell migration in a suitable in vivo or in vitro assay allows the identification of aptamers which are both specific to the metastatic cell line and also have the desired biological effect.

The Inventors have used a reliable wound healing assay to determine the effects of an aptamer upon metastatic cancer cell migration. Using this robust and quick wound healing assay, the Inventors were able to identify aptamer modulators of cell migration. Of the total set of aptamers identified (see Table III below), only a few aptamers were shown to retard cell migration into wounds. Interestingly, the members of two large families containing highly represented strong binders did not show any effect on cells migration. The inventors have also used a reliable invasion assay which they have used to identify one aptamer of those they have generated which inhibits metastatic cancer cell invasion.

In particular the C_M and/or C_N cell lines were generated by one of the means selected from the group:

- oncovirus infection,

- mutagenesis,

- isolation from an existing source.

In the present Patent Application, the CN and/or C_M cell lines can be generated from a progenitor cell line which can be the C_N or C_M cell line or a non- metastatic cell line from which the C_N and/or C_M cell lines are derived separately.

In particular the oncovirus is selected from the group comprising: Rous sarcoma virus, Epstein Barr Virus, hepatitis B, hepatitis C, Human T- lymphotropic virus, Kaposi's sarcoma-associated herpesvirus, Human T cell leukaemia virus- 1.

In one example of the present invention cells are infected with Rous sarcoma virus with the oncoviral gene v-src (viral-src) transforming the cells into a metastatic state. In general the transforming gene v-src of Rous sarcoma virus, which has a tyrosine specific protein kinase activity, is sufficient to transform cells into a metastatic phenotype. The exact mechanism of such transformation is still unclear; however it appears to play an important role in aspects of tumour progression, including proliferation, disruption of cell/cell contacts, migration, invasiveness, resistance to apoptosis and angiogenesis. The cellular homolog of v-src, c-src is expressed and activated in a large number of human malignant tumours and has been linked to the development of cancer and progression to metastases.

Wild type Rous sarcoma virus has been shown to be highly metastatic and in Tatosyan et al (1996), a number of naturally occurring variants of the v-src gene were characterized which induce differing levels of metastatic activity in transformed cells. In the present application the cell line HETSR (C_N) was created by transformation of a starting cell line with a low metastatic v-src carrying variant of Rous sarcoma virus; whereas the cell line HETSRl (CM) was created by transformation of an identical cell line with a high metastatic v-src carrying variant of Rous sarcoma virus. These low and high metastatic v-src genes differ from each other in a number of mutations.

Many other types of viruses are known to be involved in oncogenesis and have been characterized much as Rous sarcoma virus. Each of these and engineered variants thereof is also considered to be suitable to put the present invention into practice.

In particular therefore the method is characterized in that it uses a first cell line transformed with a v-src gene with a low metastatic potential and a second cell line transformed with a v-src gene with a high metastatic potential. Alternatively the C_M and/or the C_N cell line is generated by mutagenesis, the mutagenesis of a progenitor cell line can be obtained by iterative in vivo passages or induced by an agent selected from the group comprising: ionizing radiation, X-rays, gamma rays, alpha particles, UV light, nucleotide analogs, deaminating agents, Nitrous acid, intercalating agents, Ethidium bromide, alkylating agents, Ethylnitrosourea, Mobile Genetic Elements, Transposons.

As well as mutating a cell line with a low metastatic potential (C_N) so as to generate a cell line with a high metastatic potential (C_M), the inverse approach is also possible and encompassed by the present invention.

Therefore the two or more isogenic cell lines with different metastatic potentials can be produced by any suitable method of mutation including random mutagenesis by a radiation source, mobile genetic element or a chemical mutagen. Or via a specific modification by gene knock out, gene knock in or site directed mutagenesis.

Alternatively the C_M and/or C_N cell lines can be isolated from a source selected from the group: a cultured cell line, a biopsy, a tumor.

The C_M and/or C_N and/or progenitor cell lines can be isolated from a source such as an established metastatic cell line, such cell lines are available from a number of sources such as ATCC (www.atcc.org), see Table II.

Alternatively the C_M and/or C_N cell lines can be isolated as a primary culture from a biopsy or from a tumor. Table II (source http://wwv.atcc.Org/Portals/l/Pdf7ntpmclp.pdf)

The present invention also relates to a method to determine whether an aptamer generated by a method according to the present invention has bound to its at least one metastatic cancer cell marker target, comprising the steps:

(a) the preparation of a labeled aptamer solution;

(b) placing into contact said labeled aptamer solution with a sample;

(c) visualizing said labeled aptamer in combination with said sample; (d) determining the binding of said labeled aptamer to said at least one metastatic cancer cell marker target in said sample.

The Inventors have demonstrated that the aptamers they have generated using their new method can be used to visualize the presence of the molecular target which they recognize, when these aptamers are labeled and allowed to recognize and bind with their targets.

In particular the sample comprises at least one cell or tissue maintained in vitro.

The Inventors have shown that the aptamers which they have generated are able to interact with and recognize molecular targets when present upon metastatic cells in cell or tissue culture conditions in vitro.

Alternatively the sample comprises a tumor.

In particular the sample comprises a tumor in situ within a patient.

The Inventors have also demonstrated that the aptamers they have generated can be used to visualize the interaction of these aptamers with their targets both in isolated tumor tissue and also interactions between the aptamers and targets inside intact organisms with one or more tumors.

In particular the labeled aptamer solution is administered intravenously to said patient. In particular the aptamer is selected from the group consisting of

SEQ ID NO: 3 to 36.

In particular the aptamer is labeled with a substance selected from the group comprising:

- a fluorescent dye; - an enzymatic marker;

- a radioactive atom.

In particular the fluorescent dye is selected from the group comprising: Alexa fluor 488 ULS and Alexa fluor 680 ULS. Several thousand other fluorescent dyes exist and these are included in the present invention. In particular the radioactive atom is ³²P. Several hundred other types of radioactive atoms exist and these are included in the present invention.

In particular the enzymatic marker is selected from the group Alkaline Phosphatase, Microbial Alkaline Phosphatase, Beta-Galactosidase, Horseradish Peroxidase. Several hundred other enzymatic markers exist and these are included in the present invention.

In particular steps (c) and (d) are repeated sequentially over a set time course and the results are pooled.

The present invention also relates to an aptamer, characterized in that it can be obtained by means of a method of identification as defined in the current application and in that it is selected from aptamers of formula (I):

in which:

Rι represents any nucleotide sequence which is able to be used to amplify the aptamer. In particular R, is 5' AGATTGCACTTACTCGAA 3¹ (SEQ ID

NO: 1 ) or a fragment of 1 to 18 nucleotides of said SEQ ID NO: 1 ;

R₂ represents any nucleotide sequence which is able to be used to amplify the aptamer.

In particular R₂ is 5' GGAATGAATAAGCTGGTATCTCCC 3¹ (SEQ ID NO:2) or a fragment of 1 to 24 nucleotides of said SEQ ID NO:2, and

R_c represents a random sequence of 10 to 1000 nucleotides, preferably 40 nucleotides.

SEQ ID NO: 1 and SEQ ID NO: 2 represent examples of sequences for Ri and/or R₂, which allow PCR amplification of the aptamer. Other sequences which allow the amplification of the aptamer are also encompassed within the present invention. The size of R| and R₂ can vary significantly and these fragments may be of any size so long as they allow the aptamer to be amplified.

In particular the aptamer is characterized in that it is selected from the following sequences listed in Table III below:

Table III

Aptamers obtained after 10 rounds of subtractive SELEX upon HETSRl

E37

A7 GGCAGATACCACCTATTCATTCOCOCGTCTCAAACGCCGGOTACCTCCCTTTCTCCGTTGCGOCTTCGAGTAAOTGCAATCT (SEQ ID NO S)

DJ2

GI I GGCAGATACCAGCTAπCATTC∞OTACCAΛfXKTACCTGAΛTACCCGACGCATTTTCCGGGrrCGAGTAAGTCCAATCT (SEQ ID NO 10)

GGOAGATACCAOCTATTCATTCCAGCCOCTGT AATGCCTTCATCCCATTCCCCCGCGCTOCTTCGAGTAAGTGCAATCT (SEQ ID NO 1 1 )

11/10 GGGAGATACCAGCTATTCATTCCCCOGCACACTGCTATCCTTACACCTCCCCATTCCCCCTGOTTCGAGTAACTCCAATCT (SEQ ID NO 13)

15/10

In particular, the aptamer is characterized in that the ribose of each purine have a hydroxyl group or fluorine atom on the carbon in the 2'-position, and/or the ribose of each pyrimidine have a fluorine atom on the carbon in the 2'-position. In accordance with the invention, aptamers may be modified such that the riboses of the purines have, as is the case in natural RNA, a hydroxyl (OH) function on the carbon in the 2'-position, while the riboses of the pyrimidines have a fluorine atom on the carbon in the 2'-position. This modification of the 2'-position is known to confer on the nucleic acids a greater resistance with respect to nucleases. In addition several other chemical and structural modifications are known in the art which increase nucleic acid stability in vivo, these include the addition of chemical groups to inhibit nuclease activity, such as PEG-Spacers, as well as using non-natural nucleotides and synthesizing nucleotides using non-natural chemical or enzymatic means. All such methods to increase nucleic acid stability/decrease nucleic acid degradation in vivo are encompassed by the present Patent Application.

The invention also relates to a reagent for diagnosing a tumor, characterized in that it consists of an aptamer as described in the current application and in particular one of the aptamers described in Table III above, labeled with a substance selected from the group comprising: - a fluorescent dye; an enzymatic marker;

- a radioactive atom.

The invention also relates to a medicament, characterized in that it comprises an aptamer selected from the group consisting of: SEQ ID NO: 3 to 36, which has the ability to inhibit metastatic cell migration.

Two aptamers, ElO (SEQ ID NO: 4) and E37 (SEQ ID NO: 3) have been found to decrease the horizontal migration (wound healing assay) and vertical cell migration (transwell assay) of target cells, apparently using two different modes of action. Both are able to distinguish high metastatic cells from low metastatic ones. Both are highly specific and able to bind their target cells growing in 3D-dimentional aggregates. Aptamer ElO (SEQ ID NO: 4) binds HETSR-I cells with high affinity (Kd 25nM). Fluorescent imaging showed that its binding sites are most probably at the cell surface. These cell surface targets are most probably responsible for not only cell migration but cell invasion as well. Alternatively these cell surface targets could be one component of a signalling pathway the modulation of which is achieved by the interaction of El O (SEQ ID NO: 4) with its target. The Inventors have shown that El O (SEQ ID NO: 4) is even more active in terms of suppressing cell invasion.

Aptamer E37 (SEQ ID NO: 3), although blocking migration more strongly than ElO (SEQ ID NO: 4), does not influence invasion and does not saturate its targets at concentrations of up to l μM. According to fluorescent images, this can be explained by its unexpected internalization into cells. E37 (SEQ ID NO: 3) can penetrate target cells in a non-saturable manner or saturation is achieved at a very high concentration.

The cellular uptake of oligonucleotides is a known phenomenon, it depends on several factors including cell division frequency and endocytic capacity of the cells (Audouy and Hoekstra 2001 ; Simberg et al. 2004.). It has been shown that naked DNA is internalized in vitro by sperm (Lavitrano et al, 1992), epithelial (Zabner et al, 1997), endothelial (Nakamura et a), 1998) and muscle cells (Wolff et al, 1990). Traditional interpretation of the uptake of naked oligonucleotides involves endocytic mechanism, although it is considered that additional pathways exist (Wu-Pong 2000). It is possible that SELEX, based on frequently dividing cancer cells could also lead to the generation of cellular internalization sequences.

The mechanism underlying the antimigratory effects of aptamer E37 (SEQ ID NO: 3) involves at least initial binding to the cell surface and subsequent internalization.

In a preferred embodiment of the present invention therefore the medicament comprises a pharmaceutically active quantity of aptamer E37 and/or ElO. In the present Patent Application a pharmaceutically active quantity of an aptamer is a dosage calculated either as a quantity per kg body mass of a patient or a total quantity, which is able to have a clinically significant effect upon metastatic cancer cells in a patient and/or a clinically significant effect upon a symptom associated with the metastatic cancer cells in the patient. Effects include cancer cell death rates, reduction in cancer cell division/invasion/migration rates as well as standard pathological features such as patient temperature, white blood cell count and fatigue. In particular the medicament comprises an aptamer conjugated with a toxin.

In particular the toxin is selected from the group comprising: radionuclides, plant holotoxins, bacterial toxins, venoms, fungi toxins, cytotoxins. As the inventors have shown that all the aptamers they have generated specifically recognize and bind with at least one metastatic cancer cell marker, in addition to their use as diagnostic reagents these aptamers can also be used to target a toxin to metastatic cancer cells expressing the metastatic cancer cell marker target. Such ligand-toxin conjugates are known in the art and a range of toxins have been proposed and successfully used. These include radionuclides such as ⁸⁹Sr, ¹³¹I,

Y Re. Plant holotoxins (also referred to as class II ribosome inactivating proteins) such as ricin, abrin, mistletoe lectin and modeccin. Hemitoxins, or class I ribosome inactivating proteins, include PAP, saporin, bryodin 1 , bouganin, and gelonin.

Bacterial toxins such as Diphtheria toxin and Pseudomonas exotoxin. In addition to invertebrate and animal venoms, fungi toxins and cytotoxins. All these various natural and non-natural products have in common a strong cytotoxic effect.

The invention also relates to a pharmaceutical composition, characterized in that it comprises: a medicament according to the present invention, which has the ability to inhibit metastatic cell migration, and at least one pharmaceutically acceptable vehicle. The invention also relates to the use of an aptamer as described in the current Patent Application, for screening products which interact with the at least one metastatic cancer cell marker target of the aptamer and which affect the migration or invasiveness of a cell expressing said at least one metastatic cancer cell marker target.

The invention also relates to a method for screening substances which interact with at least one metastatic cancer cell marker or targets forming a complex with said at least one metastatic cancer cell marker, wherein said method is characterized in that it comprises the steps: bringing cells expressing said at least one metastatic cancer cell marker into contact with the substance to be tested, adding before, at the same time as or after the substance to be tested, under suitable conditions, an aptamerwhich binds to at least one metastatic cancer cell marker, wherein the aptamer is selected from those according to the present invention, evaluating whether competitive binding between said aptamer and said substance has occurred.

In particular the method is characterized in that, after identification of said interacting substance which binds competitively with the aptamer to the cells expressing said at least one metastatic cancer cell marker, the effect of said substance on the biological activity of said cells can be evaluated in order to find substances which inhibit or activate said biological activities of the cells exhibiting said at least one metastatic cancer cell marker.

In particular the effects of said interacting substance are determined upon a biological activity which is selected from the following: (a) inhibition or activation of horizontal cell migration,

(b) inhibition or activation of vertical cell migration,

(c) inhibition or activation of cell invasion.

The invention also relates to a method for identifying at least one metastatic cancer cell marker target of an aptamer according to the present invention, comprising at least the steps of:

(a) bringing at least one aptamer into contact with cells expressing at least one metastatic cancer cell marker target;

(b) recovering said at least one aptamer whilst still in complex with said at least one one metastatic cancer cell marker target; and (c) identifying said at least one one metastatic cancer cell marker target.

The invention also relates to a method for identifying at least one gene whose expression level is altered following the interaction of an aptamer according to the present invention with its target, comprising at least the steps of: (a) bringing at least one aptamer into contact with cells expressing its target;

(b) recovering the total mRNA content of said cells; (c) comparing the mRNA sample of step (b) to that of a control mRNA sample from cells not expressing said target and which have been exposed to the aptamer; and

(d) identifying said at least one gene. Such a method can be performed using nucleotide microarray analysis or other suitable means.

The invention also relates to a method for identifying at least one protein whose expression level is altered following the interaction of an aptamer according to the present invention with its target, comprising at least the steps of: (a) bringing at least one aptamer into contact with cells expressing its target;

(b) recovering the total protein content of said cells;

(c) comparing the protein sample of step (b) to that of a control protein sample from cells not expressing said target and which have been exposed to the aptamer; and

(d) identifying said at least one protein.

Such a method can be performed using antibody mediated microarray analysis or other suitable means such as UV crosslinking and peptide sequencing. In addition to identifying genes and/or proteins which are altered following interaction between an aptamer and its target using samples from cells expressing the target and cells not expressing the target, studies can also be performed upon a single cell line in the presence or absence of the aptamer.

For a better understanding of the invention and to show how the same may be carried into effect, there will now be shown by way of example only, specific embodiments, methods and processes according to the present invention with reference to the accompanying drawings in which:

Figure 1. shows the folding of aptamer ElO (SEQ ID NO: 4) (A) and E37 (SEQ ID NO: 3) (B) Figure 2. shows the effect of the initial pool (A), aptamer ElO (SEQ

ID NO: 4) (B) and aptamer E37 (SEQ ID NO: 3) (C) on migration of HETSR-I cells into wound. Figure 3. shows the binding curves for aptamers ElO (SEQ ID NO: 4) (A) and E37 (SEQ ID NO: 3) (B).

Figure 4. shows the binding of aptamers ElO (SEQ ID NO: 4) and E37 to the high (HETSR-I) and low (HETSR) metastatic cell lines. Figure 5. shows the effects of the initial pool (A), aptamer ElO

(SEQ ID NO: 4) (B) and aptamer E37 (SEQ ID NO: 3) (C) on the migration of HETSR-I cells.

Figure 6. shows the effects of initial pool (A) and aptamer ElO (SEQ ID NO: 4) (B) on invasion of HETSR-I cells. Quantification of cell invasion shown in (C).

Figure 7. shows volumetric images of living HETSR-I cells growing in 3D-aggregates, taken after incubation with fluorescent aptamer ElO (SEQ ID NO: 4) (A), scramble 10 (B), aptamer 37 ElO (SEQ ID NO: 3) (C), scramble 37 (D). Figure 8. shows optical imaging of the in vivo distribution of Alexa

Fluor 680 - labelled aptamers, one hour post i.v. (intravenous) injection of 2 nmol of aptamer into nude mice bearing xenografts of HETSR-I . (A) non-injected mouse; (B) mouse injected with aptamer ElO; (C) mouse injected with aptamer E37; (D) control- injected mouse. Figure 9. shows aptamer ElO in complex with its target. 1- Protein extracts from HETSR- I cells after UV-crosslinking with the initial pool of oligonucleotides used for SELEX; 2 - Protein extracts from the HETSR-I cells after UV-crosslinking with aptamer ElO; 3 - Proteins extracts from HETSR-I cells after UV-crosslinking with aptamer ElO and subsequent treatment with 1 μg/μl of proteinase K.

Figure 10. shows inhibition of MMP 13 and MMPl by anti- migratory /anti-invasive aptamer ElO. (A) Expression of MMP 13 mRNA in HETSR-I cells; non-treated, control-treated and aptamer E- 10 treated. Data obtained by semiquantitative PCR represents mean values from at least three independent PCRs, each performed in triplicate. P<0.05. (B) Gelatin zymography showing proteolytic activity of MMPl in: 1-HETSR-l ; 2- HETSR-I treated with control sequence; 3- HETSR-I treated with aptamer ElO. Figure 11. shows aptamers ElO and E37 exhibiting specific profiles of inhibition of phosphor-receptor tyrosine kinases (RTKs). Data obtained from phosphor- RTK. antibody array analysis represents the mean values of two duplicates each from two different experiments. Figure 12. shows a western blot analysis of candidate RTK protein targets of anti-metastatic aptamers. A-D membranes were hybridised with antibodies of interest and reprobed with control antibodies. 1 - HETSR cells (low metastatic); 2- HETSR-I cells (highly metastatic); 3- HETSR-I cells treated with initial pool; 4- HETSR-I cells treated with aptamer ElO; 5- HETSR- I cells treated with aptamer E37. Figure 13. shows patterns of aptamer-responsive signalling molecules that are likely important for the achievement of invasive and/or migratory phenotypes in cancer cells. (A) Profile of suppression of migratory phenotype by aptamer E37. (B) Profile of suppression of migratory and invasive phenotype of aptamer ElO. There will now be described by way of example a specific mode contemplated by the Inventors. In the following description numerous specific details are set forth in order to provide a thorough understanding. It will be apparent however, to one skilled in the art, that the present invention may be practiced without limitation to these specific details. In other instances, well known methods and structures have not been described so as not to unnecessarily obscure the description.

EXAMPLE 1: MATERIALS AND METHODS 1.1 Cell cultures

HETSR-I and HETSR - cell lines belonging to the cell model that has been already described (Deichman et al 1989, Deichman et al 1992). Briefly, they were derived from Syrian hamster embryo fibroblasts after independent transformation in vitro by Schmidt-Ruppin D strain of Rous sarcoma virus. Both lines are highly tumorigenic in animals, but possess different metastatic activity. As a result, xenografts of HETSR-I cells produce up to 200 lung metastases, whereas HETSR cells usually do not metastasize. Cells were cultured in RPMI 1640, supplemented with 4mM L-glutamine and 10% fetal bovine serum. 1.2 Living cell SELEX

The starting pool was composed of 10¹⁴ of body-labelled 2'F-Py

RNAs of sequences AGATTGCACTTACTCGAA(N_4O)GGAATGAATAAGCTG

GTATCTCCC (SEQ ID NO: 38) with a central stretch of 40 randomised nucleotides. 2'F-Py signifies that the ribose of each pyrimidine have a fluorine atom on the carbon in the 2'-position.

The oligonucleotides AGATTGCACTTACTCGAA (SEQ ID NO:

1) and GGAATGAATAAGCTGGTATCTCCC (SEQ ID NO: 2) were included at either end of each oligonucleotide in the starting pool, so as to act as primer recogni- tion sites allowing the amplification of selected oligonucleotides which have shown affinity for the target element.

SELEX was performed as described (Cerchia et al, 2005). A pool of 2'F-Py RNAs (1 -5 nM) was heated at 85°C for 5 min in 3ml of RPMI medium, snapped on ice for 5 min and allowed to warm to 37°C. Counter-selection was performed by a 15 min incubation of the pool with post-confluent HETSR plated at a density of approximately 30 million cells per 75 square centimetre cell culture flask cells at 37⁰C. After incubation with HETSR cells, the pool was incubated with HETSR-I cells, which serve as the target element in the selection process. After 15min of incubation at 37°C in the presence of a non- specific competitor (50 mg/ml total yeast RNA), unbound sequences were eliminated by several consecutive washes with 5ml RPMI. The remaining RNAs were recovered by phenol extraction, reverse transcribed via specific primers to SEQ ID NO: 1 and SEQ ID NO: 2 and amplified by PCR. PCR-generated double stranded DNA templates were transcribed. Transcription was performed in the presence of ImM 2'F-Py and a mutant form of T7 RNA polymerase (T7Y639F). After subsequent gel-purification, the pool of RNA molecules was subjected to the next round of pre-counter-selec- tion/selection. Selective pressure was progressively augmented by increasing the number and time of washings (from one wash for 5 min in the first round to five washes for 10 min each in the last round) and decreasing the number of targeted cells (from 20⁶ to 10⁶ without changing cell density). Enrichment was followed by monitoring the appearance of four-base restriction sites in the population, which reveals the emergence of distinct families (Bartel and Szostak 1993). After 10 rounds of selection, the pool was cloned with a TOPO TA cloning kit (Invitrogen, Carlsbad, California, United States) and individual clones were analyzed.

1.3 Binding experiments Experiments of binding of individual aptamers or mixed population to HETSR-I and HETSR cells were performed in 24-well plates at the same cells density as during selection. 5'-P³² labelled RNAs at various concentrations in 200 μl of RPMI medium were incubated with the cells for 15min at 37°C in the presence of total yeast RNA (50mg/ml) as non-specific competitor. After extensive washings (5x5OOmkl RPMI), the remaining radioactivity was counted and normalized to the number of cells by measuring the protein content in each well.

For binding curves, values of non-specific binding of the scrambled control sequence were subtracted from the aptamer binding values. Dissociation constant (Kd) was determined by Scatchard analysis according to the equation: (bound aptamer)/(aptamer) = -(l/kd)x(bound aptamer)+((T),_ot/Kd where (T)_lot represents the total target concentration

1.4 Wound healing assay

Cells were cultured to a postconfluent multilayer in 24-well plates, serum starved for 24h in the presence of 10OnM aptamer or initial pool (as control). Wounds were made by scratching the cell multilayer with a pipette tip, followed by rinsing with PBS in order to remove floating or damaged cells. Migration in wounds was stimulated by addition of 5% fetal bovine serum. Cells were allowed to migrate for 9 hours in the presence of 100 nM aptamer or initial pool. Wound healing was monitored by phase contrast microscopy. 1.5 Transwell migration assay

Cells were serum starved in the presence of 10OnM aptamer or initial pool for 24 hours. Migration assays were performed using Boyden chambers with 8 μM pores (Transwell assay system, Costar, Corning Incorporated, USA). 100 000 cells were seeded into the inner chamber of tissue culture inserts Cells were allowed to migrate for 4 hours in the presence of 100 nM aptamer or initial pool in serum-free RPMI medium towards the outer chamber containing RPMI supplemented with 10% fetal bovine serum. Non-migrated cells were removed from the membrane top with a cotton swab. Cells migrated to the reverse side of membrane were fixed and stained with 20% methanol/0,1% crystal violet for 30 min and then extensively washed with PBS. The total number of cells of the membrane was counted in duplicate sets. 1.6 In vitro Matrigel invasion assay

Cells were serum starved in the presence of 10OnM aptamer or initial pool for 24 hours. Inserts with transwell membranes coated with Matrigel matrix (BD Biosciences, San Jose, CA) were used to measure cell invasion in vitro. Cells were plated at 100 000 per insert (upper well) in RPMI containing 100 nM of aptamer or mixed population. Invasion was carried out 20 hours. Medium was aspirated from the top and bottom wells and non-invading cells were removed from the membrane top with a cotton swab. Cells on the reverse side of membrane were fixed and stained with 20%methanol/0,l% crystal violet for 30 min and then extensively washed with PBS. The total number of cells on the membrane was counted in sets of duplicate membranes

1.7 Fluorescent imaging of living cells using Alexa fluor 488 RNA sequences were labelled with Alexa fluor 488 ULS reagent

(Invitrogen, Carlsbad, California, United States). The conjugation of aptamers with dyes followed the manufacturer's protocol. Extinction factor and correction factor (absorbance ratio A₂₆o/A_max for the free Alexa Fluor 488 dye) indicated by the provider allowed the Inventors to estimate the concentration of the fragments and the amount of dye per fragment.

For imaging, cells were plated on Lab-Tek glass slides with chambers (Nalge Nunc International, USA) and allowed to grow to a postconfluent multilayer. After 15 min of incubation of fluorescent aptamers or corresponding scrambled sequence at 10OnM in RPMI medium, cell were washed three times with

RPMI. Images were acquired with a Leica Inverted DMI6000B microscope with filters for FITC (excitation BP450-490, emission BP500-550).

1.8 in vivo Optical imaging using Alexa fluor 680 For in vivo imaging, aptamers were labelled with Alexa fluor 680

ULS reagent (Invitrogen) following the manufacturer's protocol. Extinction factor and correction factor (absorbance ratio A₂₆₀/A_max for the free Alexa Fluor 680 dye) indicated by the provider allowed to estimate the concentration of the fragments and the amount of dye per fragment. One molecule of fluorophore was attached to each molecule of oligonucleotide.

Before injection into mice bearing xenografts, aptamers and controls were denaturated at 85°C and renaturated on ice. 2 nM of oligonucleotide in a volume of 100 μL were injected into the tail vain of anesthetized mice. In vivo biodistribution was imaged using the Biospace optical imaging system.

Images were taken in integrative mode every two min during the first 20 min and every 10 min during the four following hours. Using the data acquisi- tion software M3-vision (Biospace) and Image J, 1.38r (National Institute of Health, USA), fluorescent images were constructed after background subtraction and superimposed on images obtained in a light acquisition mode.

1.9 Aptamer/protein complex visualization

Before binding with live cells, aptamers were radioactively labeled. Briefly, 1 nM of aptamers or corresponding controls were dephosphorylated by incubation with calf alkaline phosphatase (Amersham Biosciences). 5'-radiolabeling of dephosphorylated oligonucleotides was performed in 100 μL in T4 PNK kinase buffer (Invitrogen) containing 5 μM of T4 polynucleotide kinase (Invitrogen) and 5 μLof [γ-³²P]ATP ( >5000 Ci/mM, 10 mCi/ml (Perkin Elmer)). The radiolabeled oligonucleotides were purified on SP30 columns

(BioRad). Aptamers were incubated for 10 min with cell multilayers, followed by extensive washing until no radioactivity remained in the wash buffer. Crosslinking was conducted during 10 min in a Stratalinker UV Crosslinker (Stratagene) at 200,000-300,000 μJ/cm². Cells were lysed (see below) and 50 μg of protein extracts were separated on denaturing 15% PAGE. After drying, the gels were exposed to Kodak X-Omat AR Film (Kodak).

1.10 Cell lysis

Cells were washed twice with cold PBS (10 mM, pH 7.4), scraped and pelleted by centrifυgation. Lysis buffer (50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 0.25% DOC and Ix cocktail of protease inhibitors (Roche)) was added to the cell pellet and followed by 30 min incubation on ice. The lysate was cleared by centrifυgation at 14,000 g for 15 min at 4°C and the supernatant (total cell lysate) was collected. The protein content in the lysates was measured by the DC BioRad assay according to the manufacturer's protocol (BioRad).

1.10 Semi-quantitative RT-PCR analysis

Candidate gene expression levels were evaluated by semi-quantita- tive RT-PCR. Briefly, total cellular RNA was extracted by a single-step method using TRlzol (Invitrogen) according to manufacturer's protocol. 5 μg of total RNA were reverse transcribed using a mixed population of single strand oligo-dT primers ranging from 12-18 mers and the Reverse Transcription kit (Invitrogen). The resulting cDNA pool was amplified by qPCR in triplicates in an iCycler (BioRad) and the threshold cycle number was determined using iCycler software version 3.0. Primers for ribosomal protein large Po (SEQ ID NO: 39 and 40) were used as standards for normalization. PCR was performed using SYBR Green Supermix (BioRad) with a 2 min pre-incubation at 95°C followed by 45 cycles of amplification steps. PCR products were subjected to melting curve analysis to verify that no amplification of non-specific products had occurred.

1.11 DNA Microarray hybridization

Analysis of gene expression was performed using the OligoGEArray System, using the "Human Cancer" (OHS-802) and "Mouse extracellular Matrix and adhesion molecules" (EMM- 13) arrays (Superarray Bioscience Corporation)) according to the manufacturer's protocol.

Briefly, total RNA was isolated from cells using the kit "NucleoSpin RNA II" (Macherey Nagel). Total RNA was transcribed in vitro to produce biotin- labeled cRNA using TrueLabeling-AMP linear RNA amplification kit (SuperArray Bioscience Corporation). The biotin-labeled cRNA was purified using ArrayGrade cRNA Cleanup Kit (SuperArray Bioscience Corporation) and quantified by spectrophotometry. Pre-hybridization (2 h) was followed by hybridization (overnight) using exactly the same amounts of cRNA (6 μg) for each sample in a hybridization oven at 60°C. High stringency washing at 6O⁰C (0. IxSSC, 0.5% SDS) was followed by chemi-luminescence detection. Array images were recorded using X-ray film and a flatbed desktop scanner to create grayscale (16 bit) files and analyzed by Cell Profiler Software (Massachusetts Institute of Technology). The data was normalized by the use of custom probes spotted on both sides of each membrane. 1.12 Gelatin zymography

Serum-free conditioned media was collected from HETSR-I cells treated with either the specific aptamer or a control at a concentration of 10OnM. A 5 ml aliquot of conditioned media was concentrated using Amicon ultrafilters (Millipore) to a volume of 500 μL. Samples were supplemented with non-denaturing loading buffer and separated on a 10% SDS-polyacrylamide gel impregnated with 1 mg/ml gelatin.

Following electrophoresis, gels were washed twice in 2.5% Triton X-100 for 30 min, briefly rinsed with water and incubated for 3 h at 37⁰C in colla- genase buffer (5OmM Tris-HCl buffer, pH 7.5, 20OmM NaCl and 5mM CaCl₂). Gels were subsequently fixed and stained in Coomassie blue fixative solution (50% methanol and 10% acetic acid containing 0.25% Coomassie blue R250) for 2 h at room temperature. Finally, gels were destained by several rinses in distilled H₂O.

1.13 Phospho-RTK array Assay for Human RTK phosphorylation Antibody Array

(RayBiotechnology) was carried out according to the manufacturer's instructions. Briefly, antibody array chips were blocked with 5% BSA/TBS (0.01 M Tris HCl pH 7.6/0.15 M NaCl) for 1 h. Membranes were then incubated overnight with 200 μg of protein extracts from experimental samples. After extensive washing with TBS/0.1% v/v Tween-20 (3 times, 5 min each), the membranes were incubated overnight at 4°C with biotin-conjugated antibodies against phosphotyrosine. The membranes were then washed and incubated with Horse Radish Peroxidase (HRP) conjugated streptavidin for 2 h at room temperature. Unbound HRP-streptavidin was washed out with TBS/0.1% Tween-20. Finally, the phosphorylated RTKs were detected by the ECL system and densitometric values of spots were quantified using Image J 1.38r software (National Institute of Health USA).

1.14 Western blotting

For Western blot analysis, 15μg of protein were subjected to 12% PAGE electrophoresis and transferred onto a nitrocellulose membrane. Non-specific reactive sites were blocked by incubating the blot overnight at 4°C in 5% BSA in buffer containing 10 mM Tris, 100 mM NaCl, 0.1% Tween-20. The blot was washed with wash buffer (10 mM Tris, 100 mM NaCl, 0.1% Tween-20) three times for 10 min and then incubated overnight with the appropriate primary antibody specific for the protein to be assessed. The primary antibodies used in this study were obtained from: Cell Signaling Technology (for FAK, phospho-FAK, phospho-Syk/ZAP, phospho-ErbB2), Labvision (for ErbB2), Biosource (for Src Pan) Calbiochem (for v- Src).

The antibodies were used at the dilutions specified by the manufacturer. The blot was washed three times for 10 min and then incubated with the corresponding secondary antibody HRP conjugate (Santa Cruz Biotechnology) at a 1 : 2000 dilution during one hour at room temperature. The blot was washed three times for 10 min and the protein was detected by chemi-luminescent detection and autoradiography using the ECL kit (GE Healthcare) and ECL Hyperfilm (Amersham Life Science Inc). EXAMPLE 2: RESULTS 2.1 Cell-based SELEX

High metastatic cell line HETSR-I served for the aptamer selection and the low metastatic HETSR cell line served for counter-selection. The repertoire of the starting pool was composed of 10¹⁴ unique sequences of 82-mer T- fluoropyrimidine (2'F-Py) nuclease-resistant RNAs with randomized 40-nucleotide inserts flanked by primer binding sites. Selection was driven towards isolation of aptamers against some unidentified factors present on high metastasic cells as opposed to low metastatic cells.

In order to mimic the condition of solid tumours, cells were grown to post-confluent multilayers with the appearance of aggregates containing round shape cells attached to each others but not anymore to substrate. Low-metastatic cell line HETSR was used for counter-selection to subtract sequences that would bind equally low metastatic cells. After incubation with the post-confluent low metastatic cells, the recovered free RNA pool was applied to the post-confluent high metastatic cells. After several washings, bound sequences were recovered, amplified and subjected to the next round of enrichment. In order to accumulate only high-affinity aptamers, selective pressure was augmented steadily by increasing washing times and decreasing target cell numbers. Progress of the selection was monitored by RFLP (restriction fragment length polymorphism analysis). Distinct cleavage products appeared already at the 7-th round, indicating a reduction in the pool complexity (data not shown). After the 10-th round of selection, the population demonstrated a 10-fold increase in binding to the targeted HETSR-I cells in comparison with initial pool. DNA templates from the RNA pool of 10th round were cloned. The

Inventors obtained 40 clones in all. All clones were picked and sequenced. Sequence analysis showed that altogether 16 different sequences were isolated (upper portion of Table III above). Based on sequence similarity and energy minimised secondary structure analysis, the prediction of secondary and tertiary structure of the aptamers selected was carried out using the RNAstructure software written by David H. Mathews: http://rna.chem.rochester.edu. The algorithm used by this software is based on the searches described in the publication: D. H. Mathews et al., J. MoI. Biol., 1999, 288, 91 1-940. The same predictions can be obtained using the mfold algorithm, available on the site of the Michael Zuker laboratory: http://bioinfo.math.φi.edu/~zukerm/. The algorithm used by this software is also based on the searches described in the publication Mathews et al., 1999, mentioned above.

A majority of the sequences were grouped into five families. Some sequences were highly abundant in their families. Very few sequences were unique and showed no similarity with any of the family members. Relative binding efficiencies for the most abundant members of each family were determined: Individual aptamers showed a 6-15 fold increase in binding efficiencies as compared to the initial pool.

After 10 rounds of selection, five more rounds were performed under an increasing selection pressure in which:

(i) The amount of target was reduced five fold; (ii) The number of washes after binding was increased stepwise from ten washes in the 10^lh round to twenty washes in the 15^th round.

After the 15^lh round, the complete aptamer population was cloned and all clones were collected and sequenced. The aptamers sequences are shown in the lower half of table III above.

Sequence analysis showed a reduction in the number of sequences, representing the most abundant family at the 10^th round. Three other families survived selective pressure better and were enriched in the population. One new group of highly similar and very abundant sequences appeared (30% of mixed population). At the same time, several individual new sequences were found. This suggests that the five additional rounds of selection caused new evolutionary changes in the oligonucleotide population and gave rise to new aptamer types.

Analysis of the binding activity of major representatives of all groups showed their capacity to bind highly metastatic cells 6- 10 times more strongly than the initial pool. This suggests that sequences obtained after the 15^lh round of selection are also metastasis-specific aptamers.

2.2 Wound healing assay

In order to identify aptamers that modulate the migratory behaviour of HETSR-I cells, a parallel screen with 17 aptamers was performed, that tested the impact on HETSR-I cell migration of the aptamers. Wound healing was used as the assay to determine the effects of the aptamers upon cell migration.

After wounding a multilayer of postconfluent cells, cell migration and wound healing was monitored at regular intervals in the presence of serum and aptamer. A starvation step was performed in order to slow down proliferation activity, which may contribute to wound closure along with the migration. Initial experiments were performed at 500 nM of each aptamer in triplicate. Only in a few cases, did the Inventors observe an inhibition of cell migration in comparison with the initial pool. Surprisingly, sequences belonging to the largest families and having good binding characteristics did not modulate cell migration. Two aptamers, ElO (SEQ ID NO: 4) and E37 (SEQ ID NO: 3), which were potent inhibitors of cell migration, were taken for further analysis. These aptamers did not show similarity either in sequence or in structure (see Fig. IA and B).

Aptamer E37 (SEQ ID NO: 3) was the most abundant sequence of a small family, whereas ElO was an individual sequence. Fig.2 shows wound closure by cell migration in the case of the initial pool (Fig.2 A) and its inhibition by aptamer ElO (SEQ ID NO: 4) (Fig. 2B) and E37 (SEQ ID NO: 3) (Fig. 2C).

Wound healing assays were repeated with various concentrations of ElO (SEQ ID NO: 4) and E37 (SEQ ID NO: 3): the effective aptamer concentration could be as low as 50 nM for ElO (SEQ ID NO: 4) and 10OnM for E37 (SEQ ID NO: 3). It was necessary to perform serum starvation in the presence of these aptamers, otherwise the observed effect was much weaker. Proliferation tests proved that the inhibition of wound healing by aptamers ElO and E37 concerned cell migration only and was not due to modulation of proliferation rate (data not shown).

In figure 2, arrowheads show the size of the initial wound. Before wound healing, cells were incubated with 10OnM of corresponding aptamers overnight in serum-free RPMI medium. Migration was stimulated by addition of 5% of fetal bovine serum and carried out for 9 hours in the presence of each aptamer. 2.3 Binding affinities of analysed aptamers

The binding affinities of aptamers El O (SEQ ID NO: 4) and E37

(SEQ ID NO: 3) were quantified. Different concentrations of radioactively labelled aptamers and corresponding scrambled sequences were incubated with a constant number of cells grown to a post-confluent multilayer. As shown in Fig. 3A, the resulting binding curve of the aptamer ElO (SEQ ID NO: 4) shows saturation at 50 nM, meaning that it has a defined number of binding sites. Its dissociation constant

(Kd), calculated by Scatchard analysis was 25 nM, meaning a high affinity interaction.

Aptamer E37 (SEQ ID NO: 3) does not saturate its target within a 5nM- lμM concentration range (Fig.3B). However, it binds approximately 10 times stronger than its scrambled sequence (values were subtracted from each data point).

In figure 3 the slope represents -1/TCd. (B) Binding curve, based on different concentrations of E37 (SEQ ID NO: 3). For the binding experiments HETSRl cells were incubated with increasing concentrations of [³²P]-labelled aptamers at a constant cell density. After five washings, remaining radioactivity was measured. The background binding values for corresponding scrambled sequences were subtracted from each data point.

2.4 Binding specificities of analysed aptamers

In order to evaluate the capacity of aptamers ElO (SEQ ID NO: 4) and E37 (SEQ ID NO: 3) to distinguish between low and high metastatic cells, binding tests were performed with high metastatic HETSR-I cells and low metastatic

HETSR cells. As shown in Fig.4, both aptamers, ElO (SEQ ID NO: 4) and E37 (SEQ

ID NO: 3), bind approximately 10 times stronger to the high metastatic line HETSR-I than to its low metastatic counterpart. Binding values of both aptamers in the case of low metastatic line HETSR are similar to that of the corresponding scrambled sequences, i.e. at a background level. Thus, both aptamers are highly specific for high metastatic cells HETSR-I and fail to bind its low metastatic counterpart. In figure 4 HETSR-I and HETSR cells were incubated with 50 nM of [³²P]-labelled aptamers. After washing remaining radioactivity was counted and used for the calculation of molar values of aptamers, attached to the cells,

2.5 Transwell migration assay

To find out whether El O (SEQ ID NO: 4) and E37 (SEQ ID NO: 3) can inhibit 3D-dimentional cell migration, we performed a transwell migration assay, which analyses cell plasticity along with cell motility. HETSR-I cells after overnight starvation in the presence of aptamer or the initial pool were allowed to pass through the porous membrane of Boyden chambers. Migrated cells were counted. In agreement with the wound healing experiments, both aptamers suppressed cell migra- tion in this test. In comparison with the initial pool, E37 (SEQ ID NO: 3) caused an 8- fold decrease in the number of migrated cells and ElO a 2-fold decrease (Fig. 5).

In figure 5 quantification of cell migration is shown in (D). Data represents the mean of three independent experiments. Cells were incubated overnight with 100 nM of the mentioned aptamer or of the initial pool in serum-free RPMI. Migration was carried out for 4 hours in the presence of 100 nM of the aptamers or of the initial pool. After fixation and staining, all cells having crossed the membrane were counted. P>0.008

2.6 Matrigel invasion assay

To test whether ElO (SEQ ID NO: 4) and E37 (SEQ ID NO: 3) are able to modulate invasiveness of HETSR-I cells, the Inventors performed a Transwell invasion assay. Here the porous membrane of Boyden chambers are covered with Matrigel matrix, mimicking basal lamina and representing a real barrier for noninvasive cells. Due to the porous membrane of the chambers, the test takes into account cell migration together with cell invasion. HETSR-I cells were incubated overnight with the chosen aptamers or the initial pool in serum-free medium, then allowed to invade in the presence of aptamers or the initial pool. All cells that degraded the gel matrix and crossed the membrane were counted. Aptamer ElO showed a 4-fold suppression of the invasion of HETSR-I cells (compare Fig 6A and B) in comparison with the initial pool. Thus, it is more active as anti-invasive aptamer because it decreases cell migration only 2-fold. Interestingly, aptamer E37 (SEQ ID NO: 3), which inhibits migration much more strongly than aptamer ElO, did not influence cell invasive activity (data not shown).

In figure 6 cells were incubated overnight with 100 nM of aptamers or the initial pool. Invasion was carried out for 20 hours in the presence of 100 nM of each aptamer or the initial pool. After fixation and staining, cells having crossed the membrane were counted. Data represents the mean of three independent experiments. P>0.001

2.7 Fluorescent in vitro imaging

Imaging of living cells incubated with aptamers, fluorescently labelled with Alexa fluor 488 ULS reagent was performed. Time of binding was the same as for the radioactive binding tests and selection experiments. After incubation with fluorescently labelled ElO (SEQ ID NO: 4) or E37 (SEQ ID NO: 3), or corresponding scrambled control sequences, cells were washed to remove excess oligonucleotides, covered slightly with RPMI in order to avoid drying and imaged using a fluorescent microscope. As shown in Fig 6, the binding characteristics of both aptamers differs from their scrambled control sequences. The negligible residues of scrambled sequences remaining after washing were uniformly distributed all over cells (Fig. 7C and D). Aptamer ElO was clearly visible and bound to cell surface components, framing round-shape cells. Binding did not show evident preferences for the cell-cell contacts (Fig. 7A). Most surprising was the binding of aptamer E37 (SEQ ID NO: 3): it was visible in the cytoplasm, which means that it penetrated cells, but not into the nucleus. Image of the cell in the insert of Fig 7C shows the fluorescence within the cytoplasm and the dark non-fluorescent nucleus.

In figure 7 RNA-sequences were labelled with Ulysis Alexa Fluor 488 (Invitrogen) and incubated with the cells at 100 nM for 15 min. Images of living cells in RPMI medium were taken after three washes. Each image constructed from 18 stack slices, grouped by Z-projection in software Image J 1.38r (Wayne Rasband National Institutes of Health, USA). 2.8 Optical imaging of selected aptamers in vivo

Selected aptamers bind in vitro with high affinity and specificity to the highly metastatic cells (HETSR-I). In order to evaluate the capacity of aptamers to bind in vivo, ElO and E37 were labeled fluorescently with Alexa Fluor 680 and injected intravenously (i.v.) (2 nM) in nude mice bearing xenografted tumors of

HETSR-I cells. The initial (prior to SELEX) pool was used as a control (Fig.8).

The majority of injected oligonucleotides (both aptamers and control sequences) were rapidly extracted through the kidneys. The washout from tumour was also rapid (1 hour). Initial tumour uptake was registered 5-8 min post injection and was not different from that of a control. This could be explained by a high permeability of the tumour vasculature, facilitating penetration of small molecules in the tumour mass. At the same time, the distribution of the control sequences was more dispersed and less concentrated within the tumour area (Fig.8). This suggests a specific distribution of aptamer ElO and E37, in contrast to that of the initial pool that distributed randomly all over the body. The pharmacokinetics may further be improved by introducing end-modifications, for example by attaching PEG-spacers. This could help to increase blood retention of aptamers and allow them to act for a longer time.

2.9 Target identification of aptamer ElO Possible targets of aptamers developed using whole cell Selex include virtually any component of the cell surface (proteins, sugars, lipids). Figure 9 shows the UV-crosslinked complex of aptamer ElO with its target. The disappearance of the complex after treatment with proteinase K demonstrates that, for this aptamer, the target is a protein. 2.10 Molecular mechanism of inhibition of migration and invasion by specific aptamers

Anti-metastatic aptamers provide a new way of identifying new pathways/components in cancer cells which if inhibited or activated could produce a therapeutic effect. Key effectors that participate in the creation of phenotypes associated with motility and invasiveness were analysed. Anti-invasive aptamers modify the expression and activity of certain matrix metalloproteinases. Figure 10 shows that treatment with aptamer ElO induces a decrease in the level of MMP 13 messenger and in the activity of MMPl protein to digest its specific substrate Other active aptamers demonstrated similar capacities towards different types of MMPs

Analysis of gene expression by Oligo DNA microarrays (Superarray Bioscience Corporation), which contain the genes implicated in carcinogenesis and cell adhesion, did not show any alteration, in the cells treated with aptamers, of the transcription of circa 100 genes identified by this technology

Analysis of the phosphorylation state of membrane receptor tyrosine kinases (RTKs) by antibody microarray technology showed multiply changes associated with aptamer binding The RTK antibody microarrays (Superarray Bioscience Corporation) were applied to aptamer-treated, non-treated and control- treated HETSR-I cells, as well as to its low metastatic counterpart These microarrays enable analysis of 71 phospho-RTKs (active RTKs) at one time, providing a comprehensive and rapid detection of changes in protein levels for multiple protein targets A decrease in the levels of phosphorylated forms of different RTKs in HETSR-I cells as a result of treatment with specific aptamers (ElO and E37) was detected (see Fig 1 1) Interestingly, the levels of phosphorylated forms of given RTKs in low metastatic cells HET-SR are lower than in highly metastatic cells HET-SR-I Thus, anti- metastatic aptamers switch the level of phosphorylation of certain RTKs of high metastatic cells to the low level of phosphorylated forms of low metastatic cells

The data obtained by array hybridization was validated further by Western blotting for several RTKs (see Fig 12 A, B, C) The level of active v-Src protein was altered after aptamer treatment decreased strongly with aptamer E37 addition and slightly with ElO addition (Fig 12 D) Thus, aptamers inhibiting cell migration and invasion perturb expression of MMPs and the activity of signaling molecules, such as RTKs and PTKs (Protein Tyrosine Kinase) such as Src

These changes are complex, specific for each aptamer and provide a comprehensive view on the mechanism of their action The response of a complex network of signaling molecules to treatment by an aptamer provides a new method to shed light on active networks and links between different pathways that have not been detected before Cross comparison of profiles of signaling molecules altered by aptamers E37 and ElO reveals the role of key elements in metastatic pathways.

Figure 13 shows the mechanism of action of anti-migratory aptamer E37 and anti-migratory/invasive aptamer ElO. Comparison of E37 and ElO profiles offers a way to distinguish between molecules participating in migration and invasion. For example, treatment with anti-migratory aptamer E37 is associated with a decrease in the level of phospho-FAK - one of the most important adhesion molecules involved in Src signaling pathway. FAK (Focal Adhesion Kinase) is known to play an active role in cell migration. Thus, E37 apparently inhibits migration through the FAK-Src signaling pathway. Since aptamers act locally, there is a high probability that other molecules such as Frk (Fyn-related kinase), AIk (anaplastic lymphoma kinase), Zap70 (Zeta-chain-associated protein kinase 70), that the antibody microarray experiments showed to be altered in response to E37 treatment, are also connected to the Src- pathway. Kinases Frk and AIk are inhibited not only by anti-migratory aptamer E37, but also by anti-migratory and anti-invasive aptamer ElO. This suggests that Frk and AIk are key elements of migration in the studied system and link different migration-related pathways.

These results demonstrate that the aptamers generated have the potential to be used not only as drugs, but also as revelators of metastasis-related pathways and are useful both for therapy and identification of metastatic signaling pathways.

2.11 Characterisation of Aptamer Targets

The identification of the molecular targets of the aptamers developed and in particular the targets of aptamers ElO and E37 can be performed by a number of different methods, some of which are detailed in section 2.10 above. A number of methods are suitable for determining the molecular targets of the aptamers including: Affinity chromatography; Transcriptome analysis; Proteome analysis.

An affinity chromatography based method is a good way of separating the oligonucleotide/protein complexes and so by peptide sequencing the resulting proteins and comparing this to the nucleotide sequence of the oligonucleotide determining the target protein. A potential problem with this approach is that if the target protein is in low abundance it is likely that the small aptamer ligand will be in substantial excess relative to the target and so this could lead to non specific protein binding which in turn could lead to false positives with these non-specifically bound non-target proteins.

Transcriptome or proteome analysis using a micro array system is another approach. The transcriptome is the total mRNA content of a cell and likewise the proteome is the total protein content of a cell. By comparing the levels of mRNA transcript or protein in cell populations exposed to the aptamer versus those not exposed it will be possible to identify the transcripts/proteins which are perturbed and hence investigate these further as potential targets of the aptamers. These techniques have been used in section 2.10 above to identify the genes affected by aptamers ElO and E37. When the aptamer has been shown to have a specific biological effect such as reducing metastatic cell migration, the differences in transcript/protein levels could prove particularly interesting as at the present time even though metastasis is of great clinical importance the actual mechanisms of metastasis are still not fully understood. Therefore this new technique will also prove to be an important research tool in the fundamental elucidation of complex biological processes such as metastasis which so far have only been partially explained due to their enormously complex and interrelated genetic and biological nature. The design of the subtractive living cell SELEX approach that the Inventors have used is therefore suitable for developing aptamers against factors potentially associated with metastasis and more generally as a means to develop aptamers which are specific to metastasis cells.

The Inventors have shown that the in vivo high metastatic cell line of v-src-transformed fibroblasts HETSR-I can be used as target element in the modified SELEX method. Using a low-metastatic cell line HETSR, derived from the same origin, but transformed with mutated low-metastatic v-src variant, for counter selec- tion, the Inventors have shown that specific aptamers can be generated from the vast library of random nuclease-resistant RNA-sequences present in the original pool. REFERENCES

1. Naumov, G., MacDonald, I., Weinmeister, P., Kerkvliet, N., Nadkami,K.V., Wilson, S.M., Morris, V. L., Groom, A.C., Chambers, A.F., 2002. Persistence of solitary mammary carcinoma cells in a secondary site: a possible contributor to dormancy. Cancer Res. 62, 2162- 2168.

2. Entschladen, F., Drell IV, T., Lang, K., Joseph, J., Zaenker, K., 2004. Cellcell migration, invasion, and metastasis: navigation by eurotransmitters. Lancet Oncol. 5, 254-258.

3. Douma, S., Van Laar, T., Zevenhoven, J., Meuwissen, R., Van Garderen, E., Peeper, D. S., 2004. Suppression of anoikis and induction of metastasis by the neurotrophic receptor TrkB. Nature 430, 1034- 1039.

4. Giese, A., Bjerkvig, R., Berens, M.E., Westphal, M., 2003. Cost of migration: invasion of malignant gliomas and implications for treatment. J. Clin. Oncol. 21 , 1624- 1636. 5. Haga, A., Funasaka, T., Niinaka, Y., Raz, A., Nagase, H., 2003.

Autocrine motility factor signaling induces tumor apoptotic resistance by regulations Apaf-1 and Caspase-9 apoptosome expression. Int. J. Cancer 107, 707- 714.

6. Jayasena, S. D. Aptamers: an emerging class of molecules that rival antibodies in diagnostics. Clin.Chem. 9, 1628-1650 (1999). 7. Eyetech Study Group. Preclinical and phase IA clinical evaluation of an anti-VEGF pegylated aptamer (EYEOOl) for the treatment of exudative age- related macular degeneration. Retina 2002;22: 143-52.

8. Hicke BJ, Stephens AW, Gould T, Chang YF, Lynott CK, Heil J, Borkowski S, Hilger CS, Cook G, Warren S, Schmidt PG. Tumor targeting by an aptamer. J Nucl Med. 2006 Apr;47(4):668-78.

9. Bates PJ, Kahlon JB, Thomas SD, Trent JO, Miller DM. Antiproliferative activity of G-rich oligonucleotides correlates with protein binding. J Biol Chem 1999;274:26369-77.

10. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase C Tuerk and L Gold Science 3

August 1990 249: 505-510.

1 1. Ellington AD, Szostak JW. In vitro selection of RNA molecules that bind specific ligands. Nature. 1990 Aug 30;346(6287):818-22.

12. K.N. Morris, et al., High affinity ligands from in vitro selection: complex targets, Proc. Natl. Acad. Sci. USA 95 (6) (1998) 2902-2907.

13. M. Blank, et al., Systematic evolution of a DNA aptamer binding to rat brain tumor microvessels. Selective targeting of endothelial regulatory protein pigpen, J. Biol. Chem. 276 (19) (2001) 16464-16468.

14. D. A. Daniels, et al., A tenascin-C aptamer identified by tumor cell SELEX: systematic evolution of ligands by exponential enrichment, Proc. Natl. Acad. Sci. USA 100 (26) (2003) 15416-15421. 15. Cerchia L, Duconge F, Pestourie C, Boulay J, Aissouni Y,

Gombert K, Tavitian B, de Franciscis V, Libri D. Neutralizing aptamers from whole- cell SELEX inhibit the RET receptor tyrosine kinase. PLoS Biol. 2005 Apr;3(4):el23. Epub 2005 Mar 22.

16. Wang C, Zhang M, Yang G, Zhang D, Ding H, et al. (2003) Single-stranded DNA aptamers that bind differentiated but not parental cells:

Subtractive systematic evolution of ligands by exponential enrichment. J Biotechnol 102: 15-22.

17. Blank M, Weinschenk T, Priemer M, Schluesener H (2001) Systematic evolution of a DNA aptamer binding to rat brain tumor microvessels. Selective targeting of endothelial regulatory protein pigpen. J Biol Chem 276: 16464- 16468.

18. Deichman GI, Topol LZ, Kluchareva TE, Matveeva VA, Zakamaldina TA, Uvarova EN, Tatosyan AG. Clustering of discrete cell properties essential for tumorigenicity and metastasis. III. Dissociation of the properties in N-ras- transfected RSV-SR-transformed cells. Int J Cancer. 1992 JuI 30;51(6):903-8.

19. Deichman GI, Kashleva HA, Kluchareva TE, Matveeva VA. Clustering of discrete cell properties essential for tumorigenicity and metastasis. II. Studies of Syrian hamster embryo fibroblasts transformed by Rous sarcoma virus. Int J Cancer. 1989 Nov 15;44(5):908-10. 20. Bartel DP, Szostak JW ( 1993) Isolation of new ribozymes from a large pool of random sequences. Science 261 : 141 1-1418. 21. Tatosyan A, Yatsula B, Shtυtman M, Moinova E, Kaverina I, Musatkina E, Leskov K, Mizenina O, Zueva E, Calothy G, Dezelee P. Two novel variants of the v-src oncogene isolated from low and high metastatic RSV- transformed hamster cells. Virology. 1996 Feb 15;216(2):347-56. 22. Isachenko N, Dyakova N, Aushev V, Chepurnych T, Gurova K,

Tatosyan A. High expression of shMDGl gene is associated with low metastatic potential of tumor cells. Oncogene. 2006 Jan 12;25(2):317-22.

23. Mizenina O, Musatkina E, Yanushevich Y, Rodina A, Krasilnikov M, de Gunzburg J, Camonis JH, Tavitian A, Tatosyan A. A novel group HA phospholipase A2 interacts with v-Src oncoprotein from RSV-transformed hamster cells. J Biol Chem. 2001 Sep 7;276(36):34006-12. Epub 2001 Jun 26.

24. Sawyer, T. K., 2004. Cancer metastasis therapeutic targets and drug discovery: emerging small-molecule protein kinase inhibitors. Expert. Opin. Invest. Drugs 13, 1- 19. 25. Tucker, G. C, 2003. Alpha v integrin inhibitors and cancer therapy. Curr. Opin. Invest. Drugs 4, 722- 731.

26. Zucker, S., Cao, J., Chen, W., 2000. Critical appraisal of the use of matrix metalloproteinase inhibitors in cancer treatment. Oncogene 19, 6642- 6650.

27. Overall, C, Lopez-Otin, C, 2002. Strategies for MMP inhibition in cancer: innovations for the post-trial era. Nat. Rev., Cancer 2, 657-672.

28. Coussens, L., Fingleton, B., Matrisian, L., 2002. Matrix metalloproteinase inhibitors and cancer: trials and tribulations. Science 295, 2387-2392.

29. Friedl, P., Wolf, K., 2003. Cell -cell invasion and migration: diversity and escape mechanisms. Nature 3, 362-374. 30. K. L. Schmeichel, MJ. Bissell, Modeling tissue-specific signaling and organ function in three dimensions, J. Cell Sci. 1 16 (2003) 2377-2388.

31. K. A. Beningo, M. Dembo, Y. L. Wang, Responses of fibroblasts to anchorage of dorsal extracellular matrix receptors, Proc. Natl. Acad. Sci. USA 101 (2004) 18024-18029. 32. E. Cukierman, R. Pankov, D.R. Stevens, K.M. Yamada, Taking cellmatrix adhesions to the third dimension, Science 294 (2001) 1708-1712.

33. Dhiman HK, Ray AR, Panda AK. Characterization and evalua- tion of chitosan matrix for in vitro growth of MCF-7 breast cancer cell lines. Biomaterials. 2004 Sep;25(21):5147-54. PMID: 15109838 [PubMed - indexed for MEDLINE].

34. J. P. Fisher, S. Jo, A. G. Mikos, A. H. Reddi, Thermoreversible hydrogel scaffolds for articular cartilage engineering, J. Biomed. Mater. Res. A 71

(2004) 268-274.

35. Y. Park, M. Sugimoto, A. Watrin, M. Chiquet, E.B. Hunziker, BMP-2 induces the expression of chondrocyte-specific genes in bovine synovium- derived progenitor cells cultured in three-dimensional alginate hydrogel, Osteoarthritis Cartilage 13 (2005) 527-536.

36. Audouy S, Hoekstra D. Cationic lipid-mediated transfection in vitro and in vivo (review). MoI Membr Biol. 2001 Apr-Jun; 18(2): 129-43. Review.

37. Audouy S, Hoekstra D. Cationic lipid-mediated transfection in vitro and in vivo (review). MoI Membr Biol. 2001 Apr-Jun; 18(2): 129-43. Review. Audouy and Hoekstra 2001 ; Simberg et al. 2004.

38. M. Lavitrano, D. French, M. Zani, L. Frati, C. Spadafora, The interaction between exogenous DNA and sperm cells, MoI. Reprod. Dev. 31 (1992) 161-169.

39. J. Zabner, S. H. Cheng, D. Meeker, J. Launspach, R. Balfour, M. A. Perricone, J. E. Morris, J. Marshall, A. Fasbender, A. E. Smitha, MJ. Welsh,

Comparison of DNA-lipid complexes and DNA alone for gene transfer to cystic fibrosis airway epithelia in vivo, J. Clin. Invest. 15 (1997) 1529-1537.

40. M. Nakamura, P. Davila-Zavala, H. Tokuda, Y. Takakura, M. Hashida, Uptake and gene expression of naked plasmid DNA in cltured brain microvessel endothelial cells, Biochem. Biophys. Res. Commun. 245 (1998) 235-239.

41. J.A. Wolff, R.W. Malone, P. Williams, P. W. Chong, G. Acsadi, A. Jani, P.L. Feigner, Direct gene transfer into mouse muscle in vivo, Science 247 (1990) 1465-1468.

42. Wu-Pong S. Alternative interpretations of the oligonucleotide transport literature: insights from nature. Adv Drug Deliv Rev. 2000 Oct 31 ;44(1):59-

70. Review.

43. Ireson CR, Kelland LR. Discovery and development of anti- cancer aptamers. MoI Cancer Ther. 2006 Dec;5(12):2957-62. Review.

44. Mathews, DH; Sabina, J; Zuker, M; Turner, DH. Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J MoI Biol. 1999 May 21 ;288(5):91 1-940.

45. Morris, K.N., Jensen, K.B., Julin, CM., Weil, M, Gold, L. PNAS, Vol. 95 pp.2902-2907, March 1998.

Claims

1. A method for identifying aptamers specific for at least one metastatic cancer cell marker, using a mixture of nucleic acids, wherein said method comprises at least the following steps: (a) bringing a mixture of nucleic acids which form a combinatorial library into contact with cancer cells not expressing said at least one metastatic cancer cell marker (C_N Cells), said C_N cells being the same cell type as metastatic cancer cells expressing said at least one metastatic cancer cell marker (C_M cells); (b) recovering a first subset S l of nucleic acids which do not bind to the C_N cells, in step (a);

(c) bringing the first subset Sl of nucleic acids into contact with the C_M cells;

(d) recovering the nucleic acids which exhibit a high binding affinity with respect to said C_M cells, after dissociation of the C_M cell-nucleic acid complexes;

(e) amplifying said nucleic acids with high binding affinity for the C_M cells, so as to obtain a mixture of nucleic acids, enriched in nucleic acids having a high binding affinity for said C_M cells, and (f) identifying aptamers specific for the C_M cells, from the mixture obtained in (e).

2. The method as claimed in claim 1 , characterized in that said C_N cells are metastatic cancer cells.

3. The method as claimed in claim 1 or 2, characterized in that steps (a) to (e) are repeated using mixtures enriched in aptamers from the preceding cycle, until at least one aptamer is obtained, the affinity of which, defined by its dissociation constant (Kd), can be measured and is suitable for pharmaceutical use.

4. The method as claimed in claim 3, characterized in that the aptamers generated have a dissociation constant (Kd) in the range 5-100 nM.

5. The method as claimed in claim 3 or 4, characterized in that steps (a) to (f) are repeated between at least 10 times and 15 times.

6. The method as claimed in any one of claims 1 to 5, charac- terized in that the starting nucleic acid combinatorial library contains at least 10⁹ nucleic acids, preferably between 10¹² and 10¹⁶ nucleic acids, and advantageously consists of nucleic acids comprising random sequences comprising, respectively at their 5' and 3' ends, fixed sequences for PCR amplification, wherein preferably said fixed sequences for PCR amplification are selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO:2 or a fragment of at least 8 nucleotides of these sequences.

7. The method as claimed in any one of claims 1 to 6, characterized in that said random sequences each contain between 10 and 1000 nucleotides, preferably 40 nucleotides, and comprise deoxyribonucleic acid, ribonucleic acid or modified nucleic acids.

8. The method according to any one of claims 1 to 7, characterized in that the cell populations in step (a) and step (c) are cultured under conditions mimicking a solid tumour.

9. The method as claimed in any one of claims 1 to 8, charac- terized in that the identification of the aptamers specific for the C_M cells according to step (f) comprises an evaluation of the biological activity of said aptamers on said C_M cells.

10. The method as claimed in claim 9, characterized in that the biological activities which are evaluated, are selected from the following: (a) inhibition or activation of horizontal cell migration,

(b) inhibition or activation of vertical cell migration,

(c) inhibition or activation of cell invasion.

1 1. The method as claimed in any one of claims 1 to 10, characterized in that said C_M and/or C_N cell lines were generated by one of the means selected from the group:

- oncovirus infection,

- mutagenesis,

- isolation from an existing source.

12. The method as claimed in claim 1 1, characterized in that said oncovirus is selected from the group comprising: Rous sarcoma virus, Epstein Barr

Virus, hepatitis B, hepatitis C, Human T-lymphotropic virus, Kaposi's sarcoma-associated herpesvirus, Human T cell leukaemia virus- 1.

13. The method as claimed in claim 1 1, characterized in that said mutagenesis is induced by an agent selected from the group comprising: ionizing radiation, X-rays, gamma rays, alpha particles, UV light, nucleotide analogs, deaminating agents, Nitrous acid, intercalating agents, Ethidium bromide, alkylating agents, Ethylnitrosourea, Mobile Genetic Elements, Transposons.

14. The method as claimed in claim 1 1 , characterized in that said C_M and7or C^ cell lines are isolated from a source selected from the group: a cultured cell line, a biopsy, a tumor.

15. A method to determine whether an aptamer generated by a method according to any one of claims 1 to 14 has bound to its at least one metastatic cancer cell marker target, comprising the steps:

(a) the preparation of a labeled aptamer solution;

(b) placing into contact said labeled aptamer solution with a sample;

(c) visualizing said labeled aptamer in combination with said sample;

(d) determining the binding of said labeled aptamer to said at least one metastatic cancer cell marker target in said sample.

16. The method according to claim 15, wherein said sample comprises at least one cell or tissue maintained in vitro.

17. The method according to any one of claims 15 or 16, wherein said sample comprises a tumor.

18. The method according to any one of claims 15 to 17, wherein said aptamer is selected from the group consisting of SEQ ID NO: 3 to 36.

19. The method according to any one of claims 15 to 18, wherein said aptamer is labeled with a substance selected from the group comprising:

- a fluorescent dye;

- an enzymatic marker;

- a radioactive atom.

20. The method according to claim 19, wherein said fluorescent dye is selected from the group comprising: Alexa fluor 488 ULS and Alexa fluor 680

ULS.

21. The method according to claim 19, wherein said radioactive atom is ³²P.

22. The method according to anyone of claims 15 to 21 , wherein steps (c) and (d) are repeated sequentially over a set time course and the results are pooled.

23. An aptamer, characterized in that it can be obtained by the method as defined in claims 1 to 14 and in that it is of the formula (I):

in which:

Ri represents 5¹ AGATTGCACTTACTCGAA 3' (SEQ ID NO: 1 ) or a fragment of 1 to 18 nucleotides of said SEQ ID NO: 1 ;

R₂ represents 5' GGAATGAATAAGCTGGTATCTCCC 3" (SEQ ID NO: 2) or a fragment of 1 to 24 nucleotides of said SEQ ID NO: 2, and

R^ represents a random sequence of 10 to 1000 nucleotides, preferably 40 nucleotides.

24. The aptamer as claimed in claim 223, characterized in that it is selected from the group of sequences SEQ ID NO: 3-36.

25. The aptamer as claimed in anyone of claims 23 or 24, characterized in that the ribose of each purine have a hydroxyl group or a fluorine atom on the carbon in the 2'-position, while the ribose of each pyrimidine have a fluorine atom on the carbon in the 2'-position.

26. A reagent for diagnosing a tumor, characterized in that it consists of an aptamer as claimed in any one of claims 23 to 25, labeled with a substance selected from the group comprising:

- a fluorescent dye; - an enzymatic marker;

- a radioactive atom.

27. A medicament, characterized in that it comprises an aptamer selected from the group consisting of: SEQ ID NO: 3 to 36, which has the ability to inhibit metastatic cell migration.

28. The medicament according to claim 27, characterized in that said aptamer is conjugated with a toxin.

29. The medicament according to claim 28, characterized in that said toxin is selected from the group comprising radionuclides, plant holotoxins, bacterial toxins, venoms, fungi toxins, cytotoxins

30 A pharmaceutical composition, characterized in that it comprises a medicament according to any one of claims 27 to 29, which has the ability to inhibit metastatic cell migration, and at least one pharmaceutically acceptable vehicle

31 The use of an aptamer as claimed in any one of claims 23 to 25, for screening products which interact with the at least one metastatic cancer cell marker target of said aptamer and which affect the migration or invasiveness of a cell expressing said at least one metastatic cancer cell marker target

32 A method for screening substances which interact with at least one metastatic cancer cell marker or targets forming a complex with said at least one metastatic cancer cell marker, wherein said method is characterized in that it comprises the steps bπnging metastatic cancer cells expressing said at least one metastatic cancer cell marker into contact with the substance to be tested, adding before, at the same time as or after the substance to be tested, under suitable conditions, an aptamer which binds to said at least one metastatic cancer cell marker, wherein said aptamer is selected from those claimed in any one of claims 23 to 25, evaluating whether competitive binding between said aptamer and said substance has occurred

33 The method as claimed in claim 32, characteπzed in that, after identification of an interacting substance which binds competitively with said aptamer, the effect of said interacting substance upon at least one biological activity of said metastatic cancer cells is evaluated

34 The method as claimed in claim 33, characterized in that the effects of said interacting substance are determined upon a biological activity which is selected from the following group

(a) inhibition or activation of horizontal cell migration,

(b) inhibition or activation of vertical cell migration, (c) inhibition or activation of cell invasion, in order to find substances which inhibit or activate said biological activities of the cells expressing said at least one metastatic cancer cell marker.

35. A method for identifying at least one metastatic cancer cell marker target of an aptamer according to any one of claims 23 to 25, comprising at least the steps of:

(a) bringing at least one aptamer into contact with cells expressing at least one metastatic cancer cell markertarget;

(b) recovering said at least one aptamer whilst still in complex with said at least one metastatic cancer cell marker target; and

(c) identifying said at least one metastatic cancer cell marker target.

36. A method for identifying at least one gene whose expression level is altered following the interaction of an aptamer according to any one of claims 23 to 25 with its target, comprising at least the steps of:

(a) bringing at least one aptamer into contact with cells expressing its target;

(b) recovering the total mRN A content of said cells;

(c) comparing the mRNA sample of step (b) to that of a control mRNA sample from cells not expressing said target and which have been exposed to the aptamer; and

(d) identifying said at least one gene.

37. A method for identifying at least one protein whose expression level is altered following the interaction of an aptamer according to any one of claims 23 to 25 with its target, comprising at least the steps of:

(a) bringing at least one aptamer into contact with cells expressing its target;

(b) recovering the total protein content of said cells;

(c) comparing the protein sample of step (b) to that of a control protein sample from cells not expressing said target and which have been exposed to the aptamer; and

(d) identifying said at least one protein.