WO2009089401A2 - Compositions comprising toll-like receptor or coreceptor antagonists and methods for treating or controlling ocular allergy using same - Google Patents

Abstract

Compositions for treating or controlling ocular allergy comprise an antagonist to a toll-like receptor, a coreceptor thereof, or a combination thereof. The compositions can also include an anti-allergic medicament. The anti-allergic medicament can comprise an antihistamine, a mast-cell stabilizer, a leukotriene inhibitor, an immunomodulator, an anti-IgE agent, or a combination thereof. Such compositions can be used to treat or control seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, giant papillary conjunctivitis, toxic conjunctivitis, or contact ocular allergy.

Description

COMPOSITIONS COMPRISING TOLL-LIKE RECEPTOR OR CORECEPTOR ANTAGONISTS AND METHODS FOR TREATING OR CONTROLLING OCULAR

ALLERGY USING SAME

BACKGROUND

The present invention relates to compositions and methods for treating or controlling ocular allergy. In particular, the present invention relates to compositions that comprise inhibitors of, or antagonists to, a Toll-like receptor ("TLR") or a TLR coreceptors, and to methods for the treatment or control of ocular allergy using such compositions.

Allergy is an over-reaction of the body's immune system to foreign substances (known as allergens). The inflammatory responses mediated by the immune system are typically classified into four categories: I, II, II, and IV. Allergic responses belong to reactions of Type I immediate hypersensitivity in which a person's body is hypersensitized and develops IgE-type antibodies to typical allergens. Mast cells are a key component in the cascade of allergic responses. Mast cells are resident cells of connective tissues and contain many different allergenic compounds in their cytoplasmic granules, the best known of which is histamine.

Immediate hypersensitivity results from the following sequence of events: production of IgE by B cells in response to an allergen, binding of the IgE molecules to FcεRI receptors on the surface of mast cells, interaction of a later-introduced allergen of the same type with the bound IgE and activation of the mast cells, and release of mediators of allergy (a process known as degranulation), including histamine. Histamine dilates blood vessels, renders them leaky, and activates the endothelium. This leads to local edema, warmth, redness, and the attraction and accumulation of other inflammatory cells to the site of the release of histamine. Histamine also irritates nerve endings (leading to itching or pain).

Other inflammatory mediators released by activated mast cells include prostaglandins (such as prostaglandin D₂ ("PGD₂"), prostaglandin E₂ ("PGE₂"), and prostaglandin F₂ ("PGF₂")), leukotrienes (such as leukotriene C₄ ("LTC₄"), leukotriene D₄ ("LTD₄"), leukotriene E₄ ("LTE₄")), chemoattractants (such as platelet activating factors ("PAFs"), glycoprotein Cs₃), and cytokines (such as IL-I, IL-4, IL-6, and TNF-α). PAFs are potent chemoattractants and stimuli of lysosomal enzyme release and reactive oxygen product formation by neutrophils, eosinophils, and macrophages. In addition, PAFs increase the stickiness of endothelial cells for leukocytes, promoting their accumulation at the site of inflammation. Cs_a is a powerful chemoattractant for eosinophils. TNF-α is a major proinflammatory cytokine, the activities of which include chemotaxis for eosinophils. The recruited eosinophils in turn secrete many cytokines such as IL-3, GM-CSF (granulocyte-macrophage colony-stimulating factor), TNF-α, and IL- 1 when activated. Any of these cytokines serves to enhance and sustain the allergic inflammatory process. For example, IL-3 secreted by eosinophils can serve as a growth factor for mast cells, and thus enhance a release of proinflammatory compounds from them. Therefore, an uncontrolled amplification of the allergic inflammatory process quickly can become damaging to the host tissue surrounding the site of inflammation.

Host defense against challenge by foreign materials, including allergens and whole or fragments of microorganisms, is elicited by the immune system, which consists of innate immunity and acquired (adaptive) immunity. Acquired immunity is mediated by T and B lymphocytes that proliferate clonally in response to a specific pathogen or antigen. The generation of acquired immune responses requires a number of days after the host is exposed to the challenge. In contrast, the innate immune system is activated soon after such pathogenic or antigenic challenge to provide nonspecific protection before the acquired immunity system becomes fully effective.

It was recently discovered that the rapid innate immune response is due in part to a family of cellular receptors termed "Toll-like receptors" ("TLRs") that have evolved to recognize some common structural features of the diverse microorganisms, which features are referred to as "pathogen-associated molecular patterns" (or "PAMPs"). To date, at least ten mammalian TLRs (TLRl-TLRlO) have been identified, and ligands that activate some of these TLRs have been ascertained. K. Takeda et al., Annual Rev. Immunol, Vol. 21, 335 (2003). Some TLRs act in concert with other TLRs or coreceptors (such as CD 14 or MD-2) to initiate intracellular inflammatory cascades, which have the ultimate goal of elimination of the foreign materials from the body. Among the most prominent and best characterized of these cascades is that leading to the activation of the transcription factor NF-κB, which, in turn, activates the genes for production of many proinflammatory factors (such as TNF -α, IL-I, and IL-12). In addition, TLRs can also initiate mitogen- activated protein kinase ("MAPK") signaling cascades and thus activate other transcription factors, including activator protein 1 ("AP-I") and EIk-I. G. Zhang et al., J. Clin. Invest, Vol. 107, No. 1, 13 (2001).

The body's innate cascade is activated soon after invasion by a foreign pathogen begins. Circulating leukocytes (neutrophils, eosinophils, basophils, monocytes, and macrophages), which express TLRl-TLRlO; and mast cells, which reside in connective tissues in close proximity to epithelial surfaces and express TLR2, TLR3, TLR4, TLr6, TLR7, and TLR9, comprise the first line of host defense against invading pathogens. See; e.g., Hayashi et al., Blood, Vol. 102, 2660 (2003); Muzio et al., J. Immunol, Vol. 164, 5998 (2000); V. Supajatura et al., J. Clin. Invest., Vol. 109, No. 10, 1351 (2002); and H. Matsushima et al., J. Immunol, Vol. 173, No. 1, 531-541 (2004).

Pathogenic ligands bound to TLRs of basophils and mast cells activate them to release histamine and a wide range of preformed or newly synthesized cytokines, such as TNF-α, IL- lβ, IL-4, IL-5, IL-6, and IL- 13, or to stimulate additional production and release of these cytokines. See V. Supajatura et al., supra. Activation of TLRs on human mast cells also elicits upregulation of leukotriene LTC₄, a mediator of the anaphylactic reaction, and pro-inflammatory COX-2. J.S. Marshall et al., Int. Arch. Allergy Immunol, Vol. 132, 87 (2003).

Moreover, leukocytes and some affected tissue cells are activated by pathogens, bound to their TLRs, to synthesize and release pro-inflammatory cytokines such as IL-I β, IL-3, IL-5, IL-6, IL-8, TNF-α (tumor necrosis factor-α), GM-CSF (granulocyte-macrophage colony-stimulating factor), and MCP-I (monocyte chemotactic protein- 1). These released cytokines then further attract more immune cells to the infected site, amplifying the response of the immune system to defend the host against the foreign pathogen by attempting to eliminate the foreign pathogen through phagocytosis. For example, IL-8 and MCP-I are potent chemoattractants for, and activators of, neutrophils and monocytes, respectively, while GM-CSF prolongs the survival of these cells and increases their response to other proinflammatory agonists. TNF-α can activate both types of cells and can stimulate further release of IL-8 and MCP-I from them. IL-I and TNF-α are potent chemoattractants for T and B lymphocytes, which are activated to produce antibodies against the foreign pathogen.

Although an inflammatory response is essential to clear invading pathogens, a prolonged or overactive inflammatory response can be damaging to the surrounding tissues. For example, inflammation causes the blood vessels at the infected site to dilate to increase blood flow to the site. As a result, these dilated vessels become leaky. After prolonged inflammation, the leaky vessels can produce serious edema in, and impair the proper functioning of, the surrounding tissues (see; e.g., V.W.M. van Hinsbergh, Arteriosclerosis, Thrombosis, and Vascular Biology, Vol. 17, 1018 (1997)). In addition, a continued dominating presence of macrophages at the injured site continues the production of toxins (such as reactive oxygen species) and matrix-degrading enzymes (such as matrix metalloproteinases) by these cells, which are injurious to both the pathogen and the host's tissues. Therefore, a prolonged or overactive inflammation that could result from the initial allergy should be controlled to limit the um^'ntended damages to the body and to hasten the body's recovery process.

Traditional therapies for allergy have included antihistamines, mast cell stabilizers, non-steroidal anti-inflammatory drugs ("NSAIDs") for moderate cases, and glucocorticoids for more severe cases.

Glucocorticoids (also referred to herein as "corticosteroids") represent one of the most effective clinical treatment for a range of inflammatory conditions, including acute inflammation. However, steroidal drugs can have side effects that threaten the overall health of the patient. Chronic administration of glucocorticoids can lead to drug- induced osteoporosis by suppressing intestinal calcium absorption and inhibiting bone formation. Other adverse side effects of chronic administration of glucocorticoids include hypertension, hyperglycemia, hyperlipidemia (increased levels of triglycerides) and hypercholesterolemia (increased levels of cholesterol) because of the effects of these drugs on the body metabolic processes.

In addition, it is known that certain glucocorticoids have a greater potential for elevating intraocular pressure ("IOP") than other compounds in this class. For example, it is known that prednisolone, which is a very potent ocular anti-inflammatory agent, has a greater tendency to elevate IOP than fluorometholone, which has moderate ocular anti-inflammatory activity. It is also known that the risk of IOP elevations associated with the topical ophthalmic use of glucocorticoids increases over time. In other words, the chronic (i.e., long-term) use of these agents increases the risk of significant IOP elevations. Therefore, glucocorticoids may not be appropriate for the long-term treatment of allergy of the eye.

Therefore, there is a continued need to provide compounds, compositions, and methods for treating or controlling allergy. In addition, it is also very desirable to provide such compounds, compositions, and methods that at least have few or only low levels of side effects. Moreover, it is also very desirable to provide such compounds, compositions, and methods for treating or controlling allergy of the eye.

SUMMARY

In general, the present invention provides compounds, compositions, and methods for treating or controlling allergy.

In one aspect, such allergy is allergy of the eye.

In another aspect, such allergy of the eye is selected from the group consisting of seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, giant papillary conjunctivitis, toxic conjunctivitis (or toxic follicular conjunctivitis), contact ocular allergy, and combinations thereof. In still another aspect, a composition of the present invention comprises an inhibitor of an activity of, or an antagonist to, at least a toll-like receptor ("TLR") (such an inhibitor or antagonist hereinafter sometimes referred to as "TLR antagonist"); or an inhibitor of, or an antagonist to, coreceptor of a TLR (such an inhibitor or antagonist hereinafter sometimes referred to as "TLR-coreceptor antagonist"), in an amount effective for treating or controlling allergy in a subject.

In still another aspect, such a TLR is a human TLR.

In still another aspect, such a TLR is expressed in or on a cell associated with an ocular tissue or a tissue adjacent to an eye.

In still another aspect, such an inhibitor of, or antagonist to, at least one human TLR or a coreceptor of a human TLR is capable of down regulating a TLR signaling pathway.

In yet another aspect, a composition of the present invention comprises a compound that is capable of inhibiting an activation of a human TLR signaling pathway.

In a further aspect, a composition of the present invention comprises a TLR antagonist or a TLR-coreceptor antagonist and an anti-allergic medicament.

In still another aspect, such an anti-allergic medicament is selected from the group consisting of antihistamines (including, without limitation, compounds that bind to histamine (histamine binders), Hi -receptor antagonists, H₃-receptor antagonists, and H₄- receptor antagonists), leukotriene antagonists, mast-cell stabilizers, immunomodulators, anti-IgE agents, and combinations thereof.

In yet another aspect, the present invention provides a method for treating or controlling ocular allergy in a subject. The method comprises applying a composition to an affected eye, which composition comprises an inhibitor of, or an antagonist to, at least one human TLR; an inhibitor of, or an antagonist to, a coreceptor of a human TLR; or a compound that is capable of inhibiting an activation of a human TLR signaling pathway; or a combination thereof.

Other features and advantages of the present invention will become apparent from the following detailed description and claims and appended figures.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows ODN 2088 inhibition of neutrophil MIP-2 response.

Figure 2 shows ODN 2088 inhibition of neutrophil KC response.

Figure 3 shows ODN 2088 inhibition of neutrophil TNF -α response.

Figure 4 ODN 2088 inhibition of neutrophil IL-6 response.

Figure 5 shows the effect of the inhibitory ODN 2088 on neutrophil infiltrate after a compromised mouse cornea has been exposed to stimulatory ODN 1826, bacterial DNA, Pam3Cys, or LPS.

Figure 6 shows ODN 2088 inhibition of corneal MIP-2, KC, and IP-IO response.

Figure 7 shows the effect of the inhibitory ODN (having sequence TTAGGG) on the TLR activation of human cell lines by Pam3Cys, flagellin, or CpGB.

DETAILED DESCRIPTION

As used herein, the term "control" also includes reduction, alleviation, amelioration, and prevention.

In general, the present invention provides pharmaceutical compositions and methods for treating or controlling allergy in a subject. In one aspect, a pharmaceutical composition of the present invention comprises an inhibitor of an activity of, or an antagonist to, at least a TLR (such an inhibitor or antagonist hereinafter sometimes referred to as "TLR antagonist"); or an inhibitor of, or an antagonist to, coreceptor of a TLR (such an inhibitor or antagonist hereinafter sometimes referred to as "TLR-coreceptor antagonist"), in an amount effective for treating or controlling allergy in a subject.

As used herein, the term "TLR antagonists" or "TLR-coreceptor antagonist" also includes compounds that inhibit or impede the expression of such receptor or coreceptors, respectively. In one embodiment, such antagonist is present in the composition at concentrations such that the composition is capable of treating or controlling allergy in a subject.

In another aspect, such a TLR is a human TLR.

In still another aspect, such a TLR is expressed in or on a cell associated with an ocular tissue or a tissue adjacent to an eye.

Toll-like receptors have been identified in donor ocular tissues and cultured cells of the retinal pigment epithelium ("RPE") and cornea. The normal human uvea, retina, and sclera are known to express TLR4 mRNA. In addition, TLR2, TLR4, and TLR9 mRNA and proteins were identified in the conjunctiva of healthy subjects. S. Bonini et al., Ophthalmol, Vol. 112, 1528 (2005). Similarly, cultured cells of the corneal epithelium express TLR4 and TLR5, whereas cells of the RPE highly express TLR3 as well as TLRl, TLR7, TLR9, and TLRlO.

As mentioned above, TLRs play a crucial role in the activation of several immune cell types, such as neutrophils, eosinophils, basophils, monocytes, macrophages, and mast cells. Allergic inflammation of many etiologies is characterized by activation of mast cells and basophils, and infiltration of eosinophils, and lymphocytes in the conjunctival epithelium and stroma, which can be activated by ligand binding to their TLRs, leading to increased production of cytokines and inflammatory mediators. It has been hypothesized that TLRs also modulate the Thl/Th2 lymphocyte equilibrium. It is commonly held that allergic diseases are predominantly associated with increased Th2 cell type and decreased ThI cytokine secretion. Stimulation of human dendritic cells with TLR2 ligands shows an increase in Th2 response, exacerbating the acute phase of allergic response. A. Bellou et al., Curr. Opin. Allergy Clin. Immunol, Vol. 3, No.6, 487 (2003). Activation of mast cells by TLR ligand binding (e.g., peptidoglycan from Staphylococcus aureus or other TLR2 ligands) induces degranulation of human mast cells. J.S. Marshall et al., suppra. Allergen induction via dendritic cells and T cells can also prime mast cells to express TLR4, and subsequent endotoxin exposure can lead to increased allergic inflammation.

The various TLRs have evolved to recognize different structural features of the diverse microorganisms, referred to as "pathogen-associated molecular patterns" (or "PAMPs"), which are highly conserved across species of microorganisms. Due to this ready recognition of PAMPs, the innate immune system can mount a rapid host defense response to invading pathogens. For example, TLRl recognizes tri-acyl lipopeptides of bacteria and Mycobacteria. TLR2 recognizes lipoproteins and lipopeptides of a variety of Gram-negative bacteria, peptidoglycan and lipoteicholic acid of Gram-positive bacteria, lipoarabinomannan of Mycobacteria, and several types of atypical lipopolysaccharides ("LPSs") of Leptospira interrogans and Porphyromonas gingivalis . TLR3 recognizes double-stranded RNA ("dsRNA") of viruses. TLR4 recognizes LPSs, which are outer-membrane components of Gram-negative bacteria and are structurally different from the atypical LPSs recognized by TLR2. TLR5 recognizes flagellin of Gram-negative bacteria. TLR6 recognizes di-acyl lipopeptides. Id. Human TLR7 and TLR8 recognize imidazoquinoline compounds, which are structurally related to guanosine nucleoside. Thus, they are predicted to recognize nucleic acid-like structure of viruses or bacteria. K. Takeda et al., Int. Immunol, Vol. 17, No. 1, 1 (2005). In fact, TLR8 recently has been indicated to recognize single-stranded RNA of viruses ("ssRNA"). TLR9 recognizes the unmethylated CpG motifs of bacterial DNA. To date, ligands of TLRlO have not been ascertained. Additional TLRs may be discovered in the future as knowledge of the immune system continues to expand. TLR expression and function have been demonstrated in the eye. See; e.g., J.H. Chang et al., Br. J. Ophthalmol, Vol. 90, 103 (2006). It has been shown that some TLRs act in concert with other TLRs or coreceptors (such as CD 14 or MD-2) to initiate intracellular inflammatory cascades, which have the ultimate goal of elimination of the foreign materials from the body. Among the most prominent and best characterized of these cascades is that leading to the activation of the transcription factor NF-κB, which, in turn, activates the genes for production of many proinflammatory factors (such as TNF-α, IL-I, and IL- 12). In addition, TLRs can also initiate mitogen-activated protein kinase ("MAPK") signaling cascades and thus activate other transcription factors, including activator protein 1 ("AP- 1") and EIk-I . G. Zhang et al., J. Clin. Invest., Vol. 107, No. 1, 13 (2001).

Therefore, allergen exposure elicits an initial innate immune response in otherwise healthy persons, resulting in the recruitment of immune cells to ocular sites. These immune cells further synthesize and release proinflammatory cytokines such as IL-I β, IL-3, IL-5, IL-6, IL-8, TNF-α (tumor necrosis factor-α), GM-CSF (granulocyte- macrophage colony-stimulating factor), and MCP-I (monocyte chemotactic protein-1). These released cytokines then further attract more immune cells to the affected site, amplifying the response of the immune system to defend the host against the foreign pathogen or insult. For example, IL-8 and MCP-I are potent chemoattractants for, and activators of, neutrophils and monocytes, respectively, while GM-CSF prolongs the survival of these cells and increases their response to other proinflammatory agonists. TNF-α can activate both types of cell and can stimulate further release of IL-8 and MCP- 1 from them. IL-I and TNF-α are potent chemoattractants for T and B lymphocytes, which are activated to produce antibodies against the foreign pathogen.

Although an inflammatory response is essential to clear foreign materials from the site of invasion, a prolonged or overactive allergic inflammatory response can be damaging to the surrounding tissues. For example, inflammation causes the blood vessels at the infected site to dilate to increase blood flow to the site. As a result, these dilated vessels become leaky. After prolonged inflammation, the leaky vessels can produce serious edema in, and impair the proper functioning of, the surrounding tissues (see; e.g., V.W.M. van Hinsbergh, Arteriosclerosis, Thrombosis, and Vascular Biology, Vol. 17, 1018 (1997)). In addition, a continued dominating presence of macrophages at the site of invasion continues the production of toxins (such as reactive oxygen species) and matrix -degrading enzymes (such as matrix metalloproteinases) by these cells, which are injurious to both the pathogen and the host's tissues. An unchecked inflammatory condition can eventually lead to death of the tissue. Therefore, an inappropriately vigorous activation of the immune system in response to non-infectious foreign materials should be controlled to limit the unintended damages to an otherwise healthy tissue.

Therefore, in one aspect, the present invention provides compositions and methods for treating or controlling allergy in a subject.

In one aspect, such compositions provide attenuation of an allergic response in the subject through inhibiting or antagonizing activity of one or more human TLRs.

In another aspect, a composition of the present invention comprises an inhibitor of, or antagonist to, at least one human TLR or a coreceptor of a human TLR is capable of down regulating a TLR signaling pathway.

In still another aspect, a composition of the present invention comprises a compound that is capable of inhibiting an activation of a human TLR signaling pathway.

In yet another aspect, a composition of the present invention comprises a TLR antagonist or a TLR-coreceptor antagonist and an anti-allergic medicament. Preferably, such an anti-allergic medicament comprises a nonsteroidal compound.

In a further aspect, such an anti-allergic medicament is selected from the group consisting of antihistamines (including, without limitation, compounds that bind to histamine (histamine binders), Hpreceptor antagonists, tb-receptor antagonists, and H₄- receptor antagonists), leukotriene antagonists, mast-cell stabilizers, immunomodulators, anti-IgE agents, and combinations thereof.

In another aspect, a TLR antagonist or TLR-coreceptor antagonist, included in a composition of the present invention, inhibits the binding of ligands to such TLR or TLR coreceptor, respectively, which ligands are capable of activating such TLR or coreceptor, or the binding of such coreceptor to such TLR.

In yet another aspect, said at least one human TLR is selected from the group consisting of TLRl, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLRlO, and combinations thereof.

In a further aspect, said coreceptor of a human TLR is selected from the group consisting of CD 14, MD-2, and a combination thereof. CD 14 has been shown to be an essential coreceptor for TLR2 and TLR4 activation due to the required formation of the receptor complex comprising CD 14 and TLR2 or TLR4 before the signaling cascades involving these TLRs are initiated. G. Zhang et al., J. Clin. Invest, Vol. 107, No. 1, 113 (2001); R. Arroyo-Espliguero et al., Heart, Vol. 90, 983 (2004). Growing evidence has suggested that an association of MD-2, a lipid binding protein, with the leucine-rich repeats ("LRRs") of the extracellular domain of TLR4 or TLR2 is necessary for the initiation of the signaling cascade involving this TLR by LPS components of bacteria. See; e.g., T.L. Gioannini et al., PNAS, Vol. 101, No. 2, 4186 (2004); R. Dziarski et al., J. Immunol, Vol. 166, 1938 (2001).

In one aspect, a composition of the present invention comprises an anti- human antibody of TLRl, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLRlO, CD14, MD-2, or combinations thereof. Many of these antibodies are available from eBioscience, San Diego, California. In one embodiment, such an antagonist is a monoclonal antibody. In another embodiment, such an antagonist is a recombinant antibody of TLRl, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLRlO, CD 14, MD-2, or combinations thereof.

In another aspect, a composition of the present invention comprises a soluble form of an extracellular domain of a TLR ("sTLR") that recognizes a microbe-expressed molecular structure ("MEMS"). By binding to an MEMS, a sTLR renders it unavailable for binding to the corresponding TLR and activating the signaling cascade involving the same. Soluble TLRs are available from, for example, eBioscience, San Diego, California. These molecules may be cleaved into smaller fragments, for example, using enzymatic digestion, and those fragments that recognize a particular MEM at high affinity may be identified through binding assays that are well known in the art. In still another aspect, a composition of the present invention comprises a soluble form of a CD14-binding extracellular domain of TLR4 ("sTLR4"), a soluble form of CD 14 molecule ("sCD14"), or a soluble form of MD-2 ("sMD-2"). Such sTLR4 binds to CD 14 and prevents it from binding to membrane-bound TLR4 and assisting in activating the signaling cascade involving the same. On the other hand, sCD14 and sMD-2 bind to LPS components of bacteria and prevent its binding to TLR4 and subsequent activation of this TLR. Soluble forms of extracellular domain of TLR4 and MD-2 have been shown to be effective in inhibiting LPS-elicited IL-8 release from U937 cells and NF-κB activation. H. Mitsuzawa et al., J. Immunol, Vol. 177, 8133 (2006). Soluble CD14 and MD-2 are available from, for example, IMGENEX, Corp., San Diego, California.

In another aspect, a composition of the present invention comprises a TLR- inhibiting oligodeoxynucleoside ("ODN") that comprises at least three consecutive guanosine deoxynucleotides. In one embodiment, a composition of the present invention comprises a TLR-inhibiting ODN that comprises at least a GGG ("G-triplet") or GGGG ("G-tetrad") motif. In another embodiment, a composition of the present invention comprises a TLR-inhibiting single-stranded ODN that comprises multiple TTAGGG motifs (SEQ. NO. 1) or a sequence of TCCTGGCGGGGAAGT (SEQ. NO. 2). SEQ. NO. 1 is ubiquitously found in human telomeres. SEQ. NO. 2 is a synthetic ODN, known as ODN 2088, available from InvivoGen, San Diego, California. These ODNs have been shown to block the colocalization of CpG DNA, which is ubiquitously found in bacterial products, with TLR9 within endosomal vesicles. I. Gursel et al., J. Immunol, Vol. 171, 1393 (2003); L.L. Stunz et al., Eur. J. Immunol, Vol. 171, No. 3, 1212 (2002). Preferably, a TLR-inhibiting ODN comprises at least one G-tetrad. Alternatively, a TLR-inhibiting ODN comprises one, two, three, four, or more G-tetrads. When a TLR-inhibiting ODN comprises more than one G-tetrad, the G-tetrads can be arranged contiguously. Alternatively, the G-tetrads can be separated by one or more different deoxynucleotides, such as one, two, three, four, five, ten, fifteen, twenty, or more deoxynucleoties. In one embodiment, the G-tetrads are separated by fewer than 20 other deoxynucleotides. Other suitable inhibiting ODNs include the synthetic ODNs having the sequences: TCCTAACGGGGAAGT (SEQ. NO. 3), TCCTGGAGGGGTTGT (SEQ. NO. 4) (see O. Duramad et al., J. Immunol, Vol. 174, 5193 (2005)), TCCTGGCGGGCAAGT (SEQ. NO. 5), TCCTGGCGGGTAAGT (SEQ. NO. 6), TCCTGGCGGGAAAGT (SEQ. NO. 7), TCCTGCAGGGTAAGT (SEQ. NO. 8) (see L.L. Stunz et al., Eur. J. Immunol, Vol. 32, 1212 (2002).

In one embodiment, ODNs comprising one or more G-tetrads can self- assemble into four-stranded helices stabilized by planar Hoogsteen base-paired quartets of guanosine. Such four-stranded ODNs are also within the scope of the present invention.

In other embodiments, a composition of the present invention comprises one or more inhibiting ODNs having SEQ. NO. 21 - SEQ. NO. 29: TCCTGGCGGGGAAGT (SEQ. NO. 21); GCCTGGCGGGGAAGT (SEQ. NO. 22); ACCTGGCGGGGAAGT (SEQ. NO. 23); CCCTGGCGGGGAAGT (SEQ. NO. 24); TCCCGGCGGGGAAGT (SEQ. NO. 25); TCCAGGCGGGGAAGT (SEQ. NO. 26); CCTGGCGGGGAAGT (SEQ. NO. 27); TCCTAGCGGGAAGT (SEQ. NO. 28); and TCCTGGAGGGGAAGT (SEQ. NO. 29). These inhibiting ODNs are disclosed in US Patent Application Publication 2005/0239733, which is incorporated herein by reference, and are shown to inhibit activity of at least one of TLR8 and TLR9.

In another embodiment, a composition of the present invention comprises a TLR-inhibiting ODN that comprises two, three, four, five, or more TTAGGG motifs. In a preferred embodiment, a TLR-inhibiting ODN comprises four TTAGGG motifs. In another embodiment, four TTAGGG motifs are arranged contiguously.

In still another embodiment, a composition of the present invention comprises a TLR-inhibiting ODN that comprises two, three, four, five, or more repeats of any one of SEQ. NO. 2 - SEQ. NO. 8, SEQ. NO. 21 - SEQ. NO. 29, or a combination thereof.

In yet another aspect, a composition of the present invention comprises an effective amount of chloroquine, hydroxychloroquine, quinacrine, 9-aminoacridine, 4- aminoquinoline, or a mixture thereof, for inhibiting the activity of TLR9. These compounds have been shown to block the immunostimulatory action of CpG ODN and induce remission of rheumatoid arthritis ("RA") and systemic lupus erythematosus ("SLE"). R.N. Bhattacharjee et al., Mini Rev. Med. Chem., Vol. 5, 287 (2006); D.E. Macfarlane et al., J. Immunol., Vol. 160, 1 122 (1998). Specifically, chloroquine has been used clinically for the treatment of RA and SLE. Chloroquine blocks TLR9- dependent signaling through inhibition of the pH-dependent maturation of endosomes by acting as a basic substance to neutralize acidification in the vesicles. H. Hacker et al., EMBO J., Vol. 17, 6230 (1998). Therefore, chloroquine can act in a composition of the present invention as a TLR9 immunomodulatory agent.

In a further aspect, a composition of the present invention comprises an inhibitor to an expression of a human TLR. In one embodiment, such an inhibitor comprises a ligand of vitamin D receptor ("VDR") or a VDR agonist. In another embodiment, such a ligand of VDR or VDR agonist comprises vitamin D or a vitamin-D analogue. A suitable vitamin-D analogue is calcipotriol ((li?,3<S)-5-[2-[(li?,3ai?,7a₁S)-l- [(2,S)-5-cyclopropyl-5-hydroxy-pent-3-en-2-yl]-7a-methyl-2,3,3a,5,6,7-hexahydro-lH- inden-4-ylidene]ethylidene]-4-methylidene-cyclohexane-l,3-diol). In still another embodiment, such a ligand is vitamin D₂ (ergocalciferol or calciferol) or vitamin D₃ (1,25-dihydroxycholeciciferol or calcitriol). In yet another embodiment, such a ligand is vitamin D₃. It has been accepted that vitamin D₃ is a bona-fide hormone involved in cell growth, differentiation, and immunomodulation. The active form of vitamin D mediates immunological effects by binding to nuclear VDR, which is present in virtually all tissues and cell types, including both innate and acquired immune cells. Y. Y. Yee et al., Mini Rev. Med. Chem., Vol. 5, 761 (2005). Activated VDR can antagonize the action of transcription factors NF-AT and NF-κB. Id. Thus, activated VDR or vitamin D₃ have been shown to inhibit the expression of proinflammatory cytokines, such as IL-2, IL-6, IL-8, IL-12, TNF-α, IFN-γ, and GM-CSF. In addition, vitamin D₃ enhances the production of IL-10 and promotes dendritic cell ("DC") apoptosis, and, thus, inhibits DC-dependent activation of T cells. E. van Etten et al., J. Steroid Biochem. MoI. Biol, Vol. 97, No. 1-2, 93 (2005). Moreover, there is evidence indicating that vitamin D₃ diminishes the expression of TLR2 and TLR4 in monocytes. K. Sadeghi et al., Eur. J. Immunol, Vol. 36, 361 (2006). Thus, vitamin D₃ or its analogues, or other VDR agonists can reduce the sensitization of these cells to MEMs, such as lipoproteins and lipopeptides of a variety of Gram-negative bacteria, peptidoglycan and lipoteicholic acid of Gram -positive bacteria, lipoarabinomannan of Mycobacteria, and other atypical lipopolysaccharides. Consequently, application of a composition of the present invention containing a vitamin D, a vitamin-D analogue, or a VDR agonist can reduce the risk of development, or the severity, of an inappropriate immune response. As used herein, the term "inappropriate immune response" means a response of the body's immune system to an inciting stimulus, which response is at an unwanted high level that results in a pathological condition.

In another aspect, an antagonist to one or more TLR receptors included in a composition of the present invention comprises a quinazoline derivative, as disclosed in US Patent Application Publication 2005/0119273, which is incorporated herein by reference. Such a quinazoline derivative has a general Formula I.

wherein X is a substituted or unsubstiruted aryl, alkyl, heterocyclic, or styryl group, optionally attached to the quinazoline by a nitrogen, oxygen, or sulfur atom or by a SO or SO₂ group; Y is absent or is an oxygen atom, a sulfur atom, CR 9τ R_> 10 , or NR , wherein

R⁹, R¹⁰, and R are each independently a hydrogen atom or an alkyl, alkenyl, or aryl group, wherein any one of R⁹, R¹⁰, and R¹ ' optionally is combined with R³ or R⁴ to form a heterocycle; L is absent or is a hydrogen atom, an alkyl or alkenyl group containing from 1 to 10 carbons, or an aryl group; R and R are each independently a hydrogen atom or an alkyl, alkenyl, or aryl group, wherein R³ and R⁴ optionally are combined to form a heterocycle; and R⁵, R , R⁷, and R⁸ are each independently a hydrogen atom, a halogen atom, or an alkyl, alkenyl, aryl, heterocyclic, nitro, cyano, carboxy, ester, ketone, amino, amido, hydroxy, alkoxy, mercapto, thio, sulfoxide, sulfone, or sulfonamido group, wherein any pair of R , R , R⁷, and R which are adjacent one another optionally are combined to form a heterocycle or a carbocycle.

Non-limiting examples of such quinazoline derivatives, which are effective in inhibiting one or more of TLR3, TLR7, TLR8, and TLR9, include:

In still another aspect, a composition of the present invention comprises an antagonist to TLR2 receptor, as disclosed in US Patent Application Publication 2005/01 13345, which is incorporated herein by reference. Non-limiting examples of such an antagonist include the following compounds.

(XVIII)

In still another aspect, a composition of the present invention comprises an antibody that binds to and inhibits the activity of TLR4/MD2 complex in the production of inflammatory cytokines. Non-limiting examples of such antibodies comprise heavy chains comprising one of the following non-limiting examples of complimentary determining regions ("CDRs"): DSYIH (SEQ. NO. 9); WTDPENVNSIYDPRFQG (SEQ. NO. 10); GYNGVYYAMDY (SEQ. NO. 11); DYWIE (SEQ. NO. 12); EILPGSGSTNYNEDFKD (SEQ. NO. 13); EERAYYFGY (SEQ. NO. 14); GGYSWH (SEQ. NO. 15); YIHYSGYTDFNPSLKT (SEQ. NO. 16); KDPSDGFPY (SEQ. NO. 17); TYNIGVG (SEQ. NO. 18); HIWWNDNIYYNTVLKS (SEQ. NO. 19); and MAEGRYDAMDY (SEQ. NO. 20), as disclosed in US Patent Application Publication 2005/0265998, which is incorporated herein by reference. Such a CDR may comprise a combination of SEQ. No. 9 - SEQ. NO. 20.

In still another aspect, a composition of the present invention comprises an antibody that binds to and inhibits the activity of TLR4/CD14 complex in the production of inflammatory cytokines, as disclosed in US Patent Application Publication 2006/0257411 , which is incorporated herein by reference.

In yet another aspect, an antagonist to a human TLR, an antagonist to a coreceptor of a human TLR, or a compound capable of inhibiting activation of a human TLR signaling pathway ("inhibitor of a TLR") is included in a composition of the present invention in an amount from about 0.0001 to about 10 percent by weight of the composition. Alternatively, such an antagonist or an inhibitor of a TLR is present in a composition of the present invention in an amount from about 0.001 to about 5 percent (from about 0.001 to about 2, or from about 0.001 to about 1, or from about 0.001 to about 0.5, or from about 0.001 to about 0.2, or from about 0.001 to about 0.1, or from about 0.01 to about 0.1, or from about 0.01 to about 0.5, or from about 0.001 to about 0.01, or from about 0.001 to about 0.1 percent) by weight of the composition.

In another aspect, such an anti-allergic medicament is selected from the group consisting of antihistamines (including, without limitation, compounds that bind to histamine (histamine binders), Hi-receptor antagonists, H₃-receptor antagonists, and H₄- receptor antagonists), leukotriene antagonists, mast-cell stabilizers, immunomodulators (such as immunosuppressants), anti-IgE agents, and combinations thereof. In one embodiment, such an anti-allergic medicament is selected from the group consisting of antihistamines (including Hi-receptor antagonists), mast-cell stabilizers, immunosuppressants, and combinations thereof. In another embodiment, such an antiallergic medicament is selected from the group consisting of antihistamines (including Hi -receptor antagonists), mast-cell stabilizers, anti-IgE agents, and combinations thereof.

Non-limiting examples of antihistamines include bromazine, carbinoxamine, clemastine, chlorphenoxamine, diphenyl, pyraline, diphenhydramine, doxylamine, brompheniramine, chlorpheniramine, dexbrompheniramine, dexchlorpheniramine, dimetindene, pheniramine, talastine, chloropyramine, histapyrrodine, mepyramine, methapyrilene, pyrilamine, tripelennamine, alimemazine, hydroxyethylpromethazine, isothipendyl, mequitazine, methdilazine, oxomemazine, promethazine, buclizine, cetirizine, chlorcyclizine, cyclizine, levocetirizine, meclizine, oxatomide, acrivastine, antazoline, astemizole, azatidine, azelastine, bamipine, cyproheptadine, deptropine, desloratidine, ebastine, epinastine, ketotifen, levocabastine, loratadine, mebhydrolin, mizolastine, phenindamine, pimethixene, pyrrobutamine, rupatadine, terfenadine, tripolidine, thenalidine, fexofenadine, emedastine, and olopatadine. Some well-known anti-histaminic drugs include Patanol® (olopatadine), Emadine® (emedastine), and Livostin® (levocabastine).

Non-limiting examples of leukotriene antagonists (e.g., leukotriene C₄, D₄, or E₄ antagonists) suitable for inclusion in the present compositions include, but are not limited to, albuterol sulfate, aminophylline, amoxicillin, ampicillin, astemizole, attenuated tubercle bacillus, azithromycin, bacampicillin, beclomethasone dipropionate, budesonide, bupropion hydrochloride, cefaclor, cefadroxil, cefbάme, cefprozil, cefuroxime axetil, cephalexin, ciprofloxacin hydrochloride, clarithromycin, clindamycin, cloxacillin, doxycycline, erythromycin, ethambutol, fenoterol hydrobromide, fluconazole, flunisolide, fluticasone propionate, fornoterol fumarate, gatifioxacin, influenza virus vaccine, ipratropium bromide, isoniazid, isoproterenol hydrochloride, itraconazole, ketoconazole, ketotifen, levofloxacin, minocycline, montelukast (e.g., montelukast sodium), moxifloxacin, nedocromil sodium, nicotine, nystatin, ofloxacin, orciprenaline, oseltamivir, oseltamivir sulfate, oxtriphylline, penicillin, pirbuterol acetate, pivampicillin, pneumococcal conjugate vaccine, pneumococcal polysaccharide vaccine, prednisone, pyrazinamide, rifampin, salbutamol, salmeterol xinafoate, sodium cromoglycate (cromolyn sodium), terbutaline sulfate, terfenadine, theophylline, triamcinolone acetonide, zafirlukast, and zanamivir.

Non-limiting examples of mast-cell stabilizers include cromolyn (and its sodium salt), lodoxamide tromethamine, pemirolast, nedocromil, olopatadine, olopatadine hydrochloride, ketotifen, ketotifen fumarate, azelastine, and epinastine.

An immunomodulatory agent may be selected to interfere with the function of T cells and/or B cells. An immunomodulatory agent may also be selected to interfere with the interactions between T cells and B cells, e.g., interactions between the T helper subsets (ThI or Th2) and B cells to inhibit neutralizing antibody formation. An immunomodulatory agent may be selected to inhibit the interaction between ThI cells and cytotoxic lymphocytes ("CTLs") to reduce the occurrence of CTL-mediated killing. An immunomodulatory agent may be selected to alter (e.g., inhibit or suppress) the proliferation, differentiation, activity and/or function of CD4⁺ and/or CD8⁺ T cells. For example, antibodies specific for T cells can be used as immunomodulatory agents to deplete, or alter the proliferation, differentiation, activity and/or function of CD4⁺ and/or CD8⁺ T cells. Examples of immunomodulatory agents include, but are not limited to, proteinaceous agents such as cytokines, peptide mimetics, and antibodies (e.g., human antibodies, humanized antibodies, chimeric antibodies, monoclonal antibodies, polyclonal antibodies, single domain antibodies, Fvs, scFvs, Fab or F(ab)₂ fragments or epitope binding fragments), nucleic acid molecules (e.g., antisense nucleic acid molecules and triple helices), small molecules, organic compounds, and inorganic compounds. In particular, immunomodulatory agents include, but are not limited to, methotrexate, leflunomide, cyclophosphamide (Cytoxan®), azathioprine (Immuran), cyclosporine, minocycline, antibiotics, tacrolimus (FK506), methylprednisolone, corticosteroids, steroids, mycophenolate mofetil (CellCept), rapamycin (sirolimus), chlorambucil, mizoribine, deoxyspergualin, brequinar, malononitriloamides, T cell modulators, B cell modulators, and cytokine receptor modulators. Examples of T cell modulators include, but are not limited to, anti-T cell receptor antibodies (e.g., anti-CD4 antibodies (e.g., cM-T412 (Boehringer), IDEC-CE9.1 (IDEC and SKB), rnAB 4162W94, Orthoclone and OKTcdr4a (Janssen-Cilag)), anti-CD3 antibodies (e.g., Nuvion (Product Design Labs), OKT3 (Johnson & Johnson)), anti-CD5 antibodies (e.g., an anti-CD5 ricin-linked immunoconjugate), anti-CD7 antibodies (e.g., CHH-380 (Novartis)), anti- CD8 antibodies, anti-CD40 ligand monoclonal antibodies (e.g., IDEC-131 (IDEC)), anti- CD52 antibodies (e.g., CAMPATH IH (Ilex)), anti-CD2 antibodies, anti-CDl Ia antibodies (e.g., Xanelim® (Genentech)), and anti-B7 antibodies (e.g., IDEC-114) (IDEC))) and CTLA4-immunoglobulin (CTLA4-Ig). Examples of B cell modulators include, but are not limited to, anti-B cell receptor antibodies, anti-CD 19 antibodies, and anti-CD20 antibodies (e.g., Rituxan® (IDEC), Bexxar®).

Anti-IgE agents include compounds that inhibit IgE activity and preferably inhibit anaphylaxis (or lowers to eliminates the risk of anaphylaxis), particularly ocular anaphylaxis. For example, such a compound can interact with IgE to inhibit the activity thereof. Preferably, and as discussed below, an anti-IgE antibody is used, more preferably a humanized antibody. A suitable anti-IgE antibody is omalizumab, a recombinant humanized monoclonal antibody commonly used in anti-IgE therapy. Several inhibitors of IgE activity are known in the art and, include, but are not limited to, anti-IgE antibodies, IgE binding fragments (including antibody fragments), receptors, or fragments thereof. For example, some inhibitors of IgE activity act by blocking the binding of IgE to its receptors on B cells, mast cells or basophils, either by blocking the receptor binding site on the IgE molecule or by blocking the IgE binding site on the receptor. Through the binding to IgE on the surface of B cells, an anti-IgE antibody may lead to the clonal elimination of the IgE -producing B cells and so, to a decrease in IgE production. Also, inhibitors of IgE activity also may act by binding soluble IgE and thereby removing it from circulation. U.S. Patent 5,614,611, which is incorporated herein by reference, discloses humanized anti-IgE monoclonal antibodies specific for IgE-bearing B cells. By specifically binding to B cells and not to basophils or mast cells, these anti-IgE antibodies do not induce the release of histamine from basophils or mast cells.

U.S. Patent 5,449,760, which is incorporated herein by reference, describes anti-IgE antibodies that bind soluble IgE but not IgE on the surface of B cells or basophils. Antibodies such as these bind to soluble IgE and inhibit IgE activity by, for example, blocking the IgE receptor binding site, by blocking the antigen binding site and/or by simply removing the IgE from circulation. Additional anti-IgE antibodies and IgE-binding fragments derived from the anti-IgE antibodies are described in U.S. Patent 5,656,273, which is incorporated herein by reference. U.S. Patent 5,543,144, which is incorporated herein by reference, describes anti-IgE antibodies that bind soluble IgE and membrane-bound IgE on IgE-expressing B cells but not to IgE bound to basophils.

In another aspect, a composition of the present invention can further comprise an additional medicament selected from the group consisting of immunosuppressants, cyclooxygenase-2 inhibitors, NSAIDs (non-steroidal antiinflammatory drugs), DMARDS (disease-modifying anti-rheumatic drugs), antibiotics, 5 -lipoxygenase inhibitors, LTB₄ antagonists, LTA₄ hydrolase inhibitors, anti-cell adhesion molecules (such as anti E-selectin), and combinations thereof.

In another aspect, a composition of the present invention further comprises an immunosuppressant. Non-limiting examples of immunosuppressants include cyclosporine, tacrolimus, rapamycin, azathioprine, 6-mercaptopurine, and combinations thereof.

Each of said anti-allergic or additional medicaments, when included in a composition, is present in a composition of the present invention in an amount from about 0.001 to about 5 percent (or from about 0.001 to about 2, or from about 0.001 to about 1, or from about 0.001 to about 0.5, or from about 0.001 to about 0.2, or from about 0.001 to about 0.1, or from about 0.01 to about 0.1, or from about 0.01 to about 0.5, or from about 0.001 to about 0.01, or from about 0.001 to about 0.1 percent) by weight of the composition.

Other Suitable Ingredients in a Composition of the Present Invention

In addition to an antagonist to at least a human TLR, an antagonist to a coreceptor of a human TLR, or an inhibitor to a human TLR or a coreceptor thereof, a composition of the present invention comprises a liquid medium. In one embodiment, the liquid medium comprises an aqueous solution.

In another aspect, a composition of the present invention further comprises a material selected from the group consisting of preservatives, antimicrobial agents, surfactants, buffers, tonicity-modifying agents, chelating agents, viscosity-modifying agents, co-solvents, oils, humectants, emollients, stabilizers, antioxidants and combinations thereof.

Water-soluble preservatives that may be employed in a composition of the present invention include benzalkonium chloride, benzoic acid, benzoyl chloride, benzyl alcohol, chlorobutanol, calcium ascorbate, ethyl alcohol, potassium sulfite, sodium ascorbate, sodium benzoate, sodium bisulfite, sodium bisulfate, sodium thiosulfate, thimerosal, methylparaben, ethylparaben, propylparaben, polyvinyl alcohol, phenylethyl alcohol, quaternary alkyl ammonium salts (such as Polyquaternium-1 or Polyquaternium-10), hydrogen peroxide, and urea peroxide, and biguanides. Other preservatives useful in the present invention include, but are not limited to, the FDA- approved preservative systems for food, cosmetics, and pharmaceutical preparations. These agents may be present in individual amounts of from about 0.001 to about 5 percent by weight (preferably, about 0.01 percent to about 2 percent by weight).

In one embodiment, a composition of the present invention comprises an anti-microbial agent. Non-limiting examples of antimicrobial agents include the quaternary ammonium compounds and bisbiguanides. Representative examples of quaternary ammonium compounds include benzalkonium halides and balanced mixtures of n-alkyl dimethyl benzyl ammonium chlorides. Other examples of antimicrobial agents include polymeric quaternary ammonium salts used in ophthalmic applications such as poly[(dimethyliminio)-2-butene-l,4-diyl chloride], [4-tris(2- hydroxyethyl)ammonio] -2-butenyl-w- [tris(2-hydroxyethyl)ammonio] dichloride (chemical registry number 75345-27-6) generally available as Polyquaternium-1^® from ONYX Corporation.

Non-limiting examples of antimicrobial biguanides include the bis(biguanides), such as alexidine or chlorhexidine or salts thereof, and polymeric biguanides such as polymeric hexamethylene biguanides ("PHMB") and their water- soluble salts, which are available, for example, from Zeneca, Wilmington, Delaware.

In one aspect, a composition of the present invention includes a disinfecting amount of an antimicrobial agent that will at least reduce the microorganism population in the formulations employed. Preferably, a disinfecting amount is that which will reduce the microbial burden by two log orders in four hours and more preferably by one log order in one hour. Typically, such agents are present in concentrations ranging from about 0.00001 to about 0.5 percent (w/v); preferably, from about 0.00003 to about 0.5 percent (w/v); and more preferably, from about 0.0003 to about 0.1 percent (w/v).

In another aspect, a composition of the present invention comprises a surfactant. Suitable surfactants can be amphoteric, cationic, anionic, or non-ionic, which may be present (individually or in combination) in amounts up to 15 percent, preferably up to 5 percent weight by volume (w/v) of the total composition (solution). In one embodiment, the surfactant is an amphoteric or non-ionic surfactant, which when used imparts cleaning and conditioning properties. The surfactant should be soluble in the lens care solution and non-irritating to eye tissues. Many non-ionic surfactants comprise one or more chains or polymeric components having oxyalkylene (-O-R-) repeating units wherein R has 2 to 6 carbon atoms. Preferred non-ionic surfactants comprise block polymers of two or more different kinds of oxyalkylene repeat units. Satisfactory non- ionic surfactants include polyethylene glycol esters of fatty acids, polysorbates, polyoxyethylene, or polyoxypropylene ethers of higher alkanes (Cn-C is). Non-limiting examples of the preferred class include polysorbate 80 (polyoxyethylene sorbitan monooleate), polysorbate 60 (polyoxyethylene sorbitan monostearate), polysorbate 20 (polyoxyethylene sorbitan monolaurate), commonly known by their trade names of Tween® 80, Tween® 60, Tween® 20), poloxamers (synthetic block polymers of ethylene oxide and propylene oxide, such as those commonly known by their trade names of Pluronic®; e.g., Pluronic® F127 or Pluronic® F108) ), or poloxamines (synthetic block polymers of ethylene oxide and propylene oxide attached to ethylene diamine, such as those commonly known by their trade names of Tetronic®; e.g., Tetronic® 1508 or Tetronic® 908, etc., other nonionic surfactants such as Brij®, Myrj®, and long chain fatty alcohols (i.e., oleyl alcohol, stearyl alcohol, myristyl alcohol, docosohexanoyl alcohol, etc.) with carbon chains having about 12 or more carbon atoms (e.g., such as from about 12 to about 24 carbon atoms). Such compounds are delineated in Martindale, 34^th ed., pp 1411-1416 (Martindale, "The Complete Drug Reference," S. C. Sweetman (Ed.), Pharmaceutical Press, London, 2005) and in Remington, "The Science and Practice of Pharmacy," 21^st Ed., p. 291 and the contents of chapter 22, Lippincott Williams & Wilkins, New York, 2006). The concentration of a non-ionic surfactant, when present, in a composition of the present invention can be in the range from about 0.001 to about 5 weight percent (or alternatively, from about 0.01 to about 4, or from about 0.01 to about 2, or from about 0.01 to about 1 weight percent).

Various other ionic as well as amphoteric and anionic surfactants suitable for in the invention can be readily ascertained, in view of the foregoing description, from McCutcheon's Detergents and Emulsifiers, North American Edition, McCutcheon Division, MC Publishing Co., Glen Rock, NJ. 07452 and the CTFA International Cosmetic Ingredient Handbook, Published by The Cosmetic, Toiletry, and Fragrance Association, Washington, D. C. Amphoteric surfactants suitable for use in a composition according to the present invention include materials of the type offered commercially under the trade name "Miranol." Another useful class of amphoteric surfactants is exemplified by cocoamidopropyl betaine, commercially available from various sources.

The foregoing surfactants will generally be present in a total amount from 0.001 to 5 percent weight by volume (w/v), or 0.01 to 5 percent, or 0.01 to 2 percent, or 0.1 to 1.5 percent (w/v).

In another aspect, the pH of a composition of the present invention is maintained within the range of 5 to 8, preferably about 6 to 8, more preferably about 6.5 to 7.8. Non-limiting examples of suitable buffers include boric acid, sodium borate, potassium citrate, citric acid, sodium bicarbonate, TRIS, and various mixed phosphate buffers (including combinations OfNa₂HPO₄, NaH₂PO₄ and KH₂PO₄) and mixtures thereof. Borate buffers are preferred, particularly for enhancing the efficacy of biguanides, when they are used in compositions of the present invention. Generally, buffers will be used in amounts ranging from about 0.05 to 2.5 percent by weight, and preferably, from 0.1 to 1.5 percent. In certain embodiments of this invention, the compositions comprise a borate or mixed phosphate buffer, containing one or more of boric acid, sodium borate, potassium tetraborate, potassium metaborate, or mixtures of the same.

In addition to buffering agents, in some instances it may be desirable to include chelating or sequestering agents in the present compositions in order to bind metal ions, which might otherwise react with the lens and/or protein deposits and collect on the lens. Ethylene-diaminetetraacetic acid ("EDTA") and its salts (disodium) are preferred examples. They are usually added in amounts ranging from about 0.01 to about 0.3 weight percent. Other suitable sequestering agents include phosphonic acids, gluconic acid, citric acid, tartaric acid, and their salts; e.g., sodium salts.

In another aspect, compositions of the present invention comprise a tonicity- adjusting agent, to approximate the osmotic pressure of normal lacrimal fluid, which is equivalent to a 0.9 percent solution of sodium chloride or 2.5 percent of glycerol solution. Non-limiting examples of suitable tonicity-adjusting agents include, but are not limited to, sodium and potassium chloride, calcium and magnesium chloride, dextrose, glycerin, mannitol, and sorbitol. These agents are typically used individually in amounts ranging from about 0.01 to 2.5 percent (w/v) and preferably, form about 0.2 to about 1.5 percent (w/v). Preferably, the tonicity-adjusting agent will be employed in an amount to provide a final osmotic value of 200 to 450 mOsm/kg, more preferably between about 250 to about 350 mθsm/kg, and most preferably between about 280 to about 320 mOsm/Kg.

In another aspect, it may be desirable to include one or more water-soluble viscosity-modifying agents in the compositions of the present invention. Because of their demulcent effect, viscosity-modifying agents have a tendency to enhance the patient's comfort by means of a lubricating film on the eye. Included among the water- soluble viscosity-modifying agents are the cellulose polymers like hydroxyethyl or hydroxypropyl cellulose, carboxymethyl cellulose and the like. Such viscosity- modifying agents may be employed in amounts ranging from about 0.01 to about 4 weight percent or less. The present compositions may also include optional demulcents.

In addition, a composition of the present invention can include additives such as co-solvents, oils, humectants, emollients, stabilizers, or antioxidants for a variety of purposes. These additives may be present in amounts sufficient to provide the desired effects, without impacting the performance of other ingredients.

DEMONSTRATION OF INHIBITION OF PRODUCTION OF PROINFLAMMATORY CHEMOKTNES

EXPERIMENT 1 : Inhibitory ODN suppression of neutrophils activated by synthetic stimulatory ODN sequence, bacterial DNA, and whole bacteria, but not by specific TLR ligand Pam3Cys or LPS.

In one experiment, mouse peritoneal neutrophils were isolated from C57BL/6 mice that had received intraperitoneal injection of 1% casein solution containing 0.5mM MgCl₂ and 0.99mM CaCl₂ 16 hours and 3 hours prior to harvesting in Hank's balanced salt solution ("HBSS") lavage. Collected cells were centrifuged (2000rpm, 10 min) and washed twice in HBSS, prior to separation of granulocytes by Percol gradient at 31 ,500 rpm for 20 min. Cells were washed twice and resuspended in Dubelco's modified eagle's medium ("DMEM") containing 10% fetal calf serum (Invitrogen, Basel Switzerland). Purity of 98% neutrophils was verified by Diff-Quik stain (VWR, Bridgeport, NJ). Neutrophils (IXlO⁵ /well) were pre-incubated with lOOng/ml GM-CSF at 37°C for 1 hour prior to exposure to compositions of the present invention comprising 0.08 - 10 μg/ml of inhibitory ODN 2088 (InvivoGen, San Diego, CA; sequence disclosed above) or a control composition containing 20μg/ml of the control ODN 1911 (Operon Qiagen, Valencia, California; having a sequence of TCCAGGACTTTCCTCAGGTT), or the medium only, for 30 minutes prior to activation with 20 μg/ml of stimulatory ODN 1826 (Operon Qiagen, Valencia, California; having a sequence of TCCATGACGTTCCTGACGTT); 20 μg/ml of endotoxin-free DNA from E. coli Kl 2 (InvivoGen, San Diego, CA); killed Staphylococcus aureus strain E2061740 (3x10⁵ cfu/ml); 100 ng/ml of Pam3Cys (synthetic lipopeptide (S)-(2,3-bis(palmitoyloxy)- (2RS)-propyl)-N-palmitoyl-(R)-Cys-(S)-Ser-(S)-Lys₄-OH, EMC Microcollections, Tubingen, Germany); or 200 ng/ml of LPS (ultra pure lipopolysaccharide from E. coli 0111 :B4 strain, InvivoGen, San Diego, California). After 15 hours at 37°C, supernates were collected for ELISA assay (R&D Systems, Minneapolis, MN) for pro-inflammatory cytokines macrophage inflammatory protein-2 ("MIP-2"), keratinocyte-derived chemokines ("KC"), IL-6, and TNF-α. Results of cytokine concentrations are shown in Figures 1-4. The composition containing the inhibitory ODN 2088 inhibited pro- inflammatory cytokine production by neutrophils upon exposure to the synthetic stimulatory ODN 1826 or bacterial DNA in a dose dependent manner Furthermore, the composition containing the inhibitory ODN 2088 prevented the production of proinflammatory cytokines, as exhibited by the nondetectable levels of these four cytokines, when neutrophils were activated with killed Staphylococcus aureus. The production of these pro-inflammatory cytokines was not affected when neutrophils activated by Pam3Cys or LPS were treated with a composition comprising the inhibitory ODN 2088. This not surprising in view of the fact that the inhibitory ODN 2088 inhibits the activation of TLR9 while LPS and Pam3Cys activate TLR4 and TLR2, respectively. Other inhibitors of TLR2 and TLR4 activation should be effective in suppressing corneal infiltrate induced by LPS and Pam3Cys, respectively.

EXPERIMENT 2-1 : Inhibitory ODN suppression of mouse keratitis induced by synthetic stimulatory ODN sequence or bacterial DNA, but not by TLR ligand Pam3Cys or LPS.

In this experiment, 1 μl of test solution containing 20 μg/ml of the synthetic stimulatory ODN 1826, 10 μg/ml of endotoxin-free DNA from E. coli Kl 2, 20 μg/ml of Pam3Cys, or 20 μg/ml LPS, along with a composition of the present invention containing the inhibitory ODN 2088, the control composition containing 20 μg/ml of ODN 1911, or medium only, was applied to a 1 mm² abraded area of central C57BL/6 mouse cornea that had been marked by sterile trephine (Miltex, Tuttlingen, Germany) and abraded with an Alger brush II (Alger, Pago Vista, Texas). After 24 hours, the corneal infiltrate was determined as the number of neutrophils per corneal section. The results are shown in Figure 5. The inhibitory ODN 2088 reduced the number of infiltrating neutrophils in response to the stimulatory ODN 1826 or bacterial DNA. The inhibitory ODN 2088 was not effective in suppressing corneal infiltrates in response to Pam3Cys or LPS activation because ODN 2088 inhibits TLR 9 activation while LPS and Pame3Cys activate TLR2 and TLR4, respectively. Other inhibitors of TLR2 and TLR4 activation should be effective in suppressing corneal infiltrate induced by Pam3Cys and LPS, respectively.

EXPERIMENT 2-2: Inhibitory ODN suppression of mouse pro-inflammatory cytokines induced by stimulatory ODN.

In this experiment, 1 μl of test solution containing 20 μg/ml of the synthetic stimulatory ODN 1826, along with a composition of the present invention containing 20 μg/ml of the inhibitory ODN 2088, or a control composition containing 20 μg/ml of the control ODN 1911, or the medium only, was applied to a 1 mm² abraded area of central C57BL/6 mouse cornea that had been marked by sterile trephine (Miltex, Tuttlingen, Germany) and abraded with an Alger brush II (Alger, Pago Vista, TX). After 5 hours, the corneal epithelium was separated after 20 minutes in 2OmM EDTA at 37°C and placed into RPMI 1640 medium. Samples were disrupted by sonication for 88 seconds with 40% duty cycle (Vibracell; Sonics and Material, Danbury, Connecticut). Cytokines were measured by ELISA assay (R&D Systems, Minneapolis, MN) for the pro-inflammatory cytokines MIP-2, KC, and human interferon-inducible protein 10 ("IP-IO"). The results are shown in Figure 6. The inhibitory ODN 2088 reduced cytokine response to the stimulatory ODN 1826 for all three cytokines measured.

EXPERIMENT 3 : Inhibitory ODN and vitamin D suppression of TLR ligand activation of human cell lines.

Three human cell lines representative of immune responsive cells of the ocular surface (HCEL, a human corneal epithelial cell line representative of cells present on the ocular surface; HL-60, a neutrophil-like cell line representative of neutrophils present in the tear layer, especially in the closed eye; and U937, a macrophage cell line representative of dendritic cells of the cornea, especially of those at the limbus) were exposed to various concentrations of compositions of the present invention containing the inhibitory ODN TTAGGG (InvivoGen, San Diego, CA) and vitamin D (lα,25- Dihydroxyvitamin D₃, Sigma-Aldrich, St. Louis, Missouri) and control compositions containing prednisolone (1,4-Pregnadiene-l lβ,17α,21-triol-3,20-dione, Sigma-Aldrich, St. Louis, MO) for 1 hour prior to activation by the TLR ligand Pam3Cys for 6 hour, flagellin (flagellin purified from Salmonella typhimurium, InvivoGen, San Diego, California) for 24 hr, or the stimulatory CpG type B ODN 2006 (Invivogen, San Diego, California) for 24 hours. After incubation at 37°C, supernates were collected for ELISA assay (R&D Systems, Minneapolis, Minnesota) for the pro-inflammatory cytokine CXCL8 ("IL-8"). Results of cytokine concentrations are shown in Figure 7. Both the inhibitory ODN TTAGGG and vitamin D inhibited cytokine response to TLR ligand activation of each cell line in an inhibitor-specific manner. The inhibitory ODN TTTAGGG reduced the cytokine response of each cell type to Pam3Cys, and of the U937 cell line to the stimulatory CpGB ODN 2006 activation. Vitamin D reduced the cytokine response to Pam3Cys activation of HCEL line and the flagellin activation of HL-60 and U937 lines. Prednisolone inhibited Pam3Cys and flagellin activation of each cell line, except Pam3Cys activation of U937 cell line. Inhibition of the stimulatory ODN CpGB ODN 2006 was only tested with inhibitory ODN TTAGGG on U937 cells.

The following examples serve to illustrate some non-limiting compositions of the present invention. The ingredients shown in each of Tables 1-10 are mixed to form a pharmaceutical composition for treating, reducing, ameliorating, alleviating, or preventing a dry eye condition or an ophthalmic disorder that requires rewetting of the eye.

EXAMPLE l :

Table 1

EXAMPLE 2:

Table 2

EXAMPLE 3:

Table 3

EXAMPLE 4:

Table 4

EXAMPLE 5:

Table 5

EXAMPLE 6:

Table 6

EXAMPLE 7:

Table 7

EXAMPLE 8:

Table 8

EXAMPLE 9:

Table 9

EXAMPLE 10:

Table 10

In another aspect, a preservative other than polyhexamethylenebiguanide HCl may be used in any one of the foregoing formulation, in a suitably effective amount.

In still another aspect, a composition can be free of preservative if it is formulated to be used as a unit-dose composition. In such a case, the composition is packaged in an individual container that is opened and the contents of the container are used only once.

In another aspect, a composition of the present invention is formulated as an eye drop, which is applied in the ocular environment on a periodic basis (for example, daily, once every other day, weekly, bimonthly, or monthly) to provide a treatment, reduction, amelioration, alleviation, or prevention of a dry eye condition or an ophthalmic disorder that requires rewetting of the eye. The present invention also provides a method for reducing risk of development, or severity, of an inappropriate immune response in an eye. The method comprises applying a composition to the eye, wherein the composition comprises an antagonist to at least one human TLR, an antagonist to a coreceptor of a human TLR, or a compound that is capable of inhibiting an activation of a human TLR signaling pathway.

In another aspect, the concentration of an antagonist to at least one human TLR, an antagonist to a coreceptor of a human TLR, or a compound that is capable of inhibiting an activation of a human TLR signaling pathway in a composition of the present invention is in any one of the ranges disclosed herein.

In still another aspect, the present invention provides a method for preparing a composition for the treatment, reduction, amelioration, alleviation, or prevention of an ophthalmic condition in a subject, which has an etiology in inflammation. The method comprises combining at least an antagonist to one human TLR, an antagonist to a coreceptor of a human TLR, or a compound that is capable of inhibiting an activation of a human TLR signaling pathway with a pharmaceutically acceptable carrier, diluent, excipient, additive, or combination thereof.

In one embodiment, a composition of the present invention is in a form of an emulsion, suspension, or dispersion. In another embodiment, the suspension or dispersion is based on an aqueous solution. For example, a composition of the present invention can comprise sterile saline solution.

A composition of the present invention can avoid one or more of the side effects of glucocorticoid therapy.

Glucocorticoids ("GCs") are among the most potent drugs used for the treatment of allergic and chronic inflammatory diseases. However, as mentioned above, long-term treatment with GCs is often associated with numerous adverse side effects, such as diabetes, osteoporosis, hypertension, glaucoma, or cataract. These side effects, like other physiological manifestations, are results of aberrant expression of genes responsible for such diseases. Research in the last decade has provided important insights into the molecular basis of GC-mediated actions on the expression of GC- responsive genes. GCs exert most of their genomic effects by binding to the cytoplasmic GC receptor ("GR"). The binding of GC to GR induces the translocation of the GC-GR complex to the cell nucleus where it modulates gene transcription either by a positive (transactivation) or negative (transrepression) mode of regulation. There has been growing evidence that both beneficial and undesirable effects of GC treatment are the results of undifferentiated levels of expression of these two mechanisms; in other words, they proceed at similar levels of effectiveness. Although it has not yet been possible to ascertain the most critical aspects of action of GCs in chronic inflammatory diseases, there has been evidence that it is likely that the inhibitory effects of GCs on cytokine synthesis are of particular importance. GCs inhibit the transcription, through the transrepression mechanism, of several cytokines that are relevant in inflammatory diseases, including IL- lβ (interleukin-lβ), IL-2, IL-3, IL-6, IL-11, TNF-α (tumor necrosis factor-α), GM-CSF (granulocyte-macrophage colony-stimulating factor), and chemokines that attract inflammatory cells to the site of inflammation, including IL-8, RANTES, MCP-I (monocyte chemotactic protein- 1), MCP-3, MCP-4, MIP- lα (macrophage-inflammatory protein- 1 α), and eotaxin. PJ. Barnes, CHn. Sci., Vol., Vol. 94, 557-572 (1998). On the other hand, there is persuasive evidence that the synthesis of IKB kinases, which are proteins having inhibitory effects on the NF-κB pro-inflammatory transcription factors, is increased by GCs. These pro-inflammatory transcription factors regulate the expression of genes that code for many inflammatory proteins, such as cytokines, inflammatory enzymes, adhesion molecules, and inflammatory receptors. S. Wissink et al., MoI. Endocrinol, Vol. 12, No. 3, 354-363 (1998); PJ. Barnes and M. Karin, New Engl. J. Med., Vol. 336, 1066-1077 (1997). Thus, both the transrepression and transactivation functions of GCs directed to different genes produce the beneficial effect of inflammatory inhibition. On the other hand, steroid-induced diabetes and glaucoma appear to be produced by the transactivation action of GCs on genes responsible for these diseases. H. Schacke et al., Pharmacol. Ther., Vol. 96, 23-43 (2002). Thus, while the transactivation of certain genes by GCs produces beneficial effects, the transactivation of other genes by the same GCs can produce undesired side effects. Therefore, in another aspect, the present invention provides pharmaceutical compositions for the treatment, reduction, alleviation, or amelioration of a pathological condition having an etiology in inflammation, which compositions avoid generation of one or more adverse side effects of GCs. In one aspect, an adverse side effect of GCs is selected from the group consisting of glaucoma, cataract, hypertension, hyperglycemia, hyperlipidemia (increased levels of triglycerides), and hypercholesterolemia (increased levels of cholesterol). In one embodiment, a level of said at least an adverse side effect is determined at about one day after said compounds or compositions are first administered to, and are present in, said subject. In another embodiment, a level of said at least an adverse side effect is determined about 30 days after said compounds or compositions are first administered to, and are present in, said subject. Alternatively, a level of said at least an adverse side effect is determined about 2, 3, 4, 5, or 6 months after said compounds or compositions are first administered to, and are present in, said subject.

In another aspect, said at least a prior-art glucocorticoid used to treat or reduce the same condition or disorder is administered to said subject at a dose and a frequency sufficient to produce the same beneficial effect on said condition or disorder as a compound or composition of the present invention after about the same elapsed time.

In still another aspect, said at least a prior-art glucocorticoid is selected from the group consisting of 21 -acetoxypregnenolone, alclometasone, algestone, amcinonide, beclomethasone, betamethasone, budesonide, chloroprednisone, clobetasol, clobetasone, clocortolone, cloprednol, corticosterone, cortisone, cortivazol, deflazacort, desonide, desoximetasone, dexamethasone, diflorasone, diflucortolone, difluprednate, enoxolone, fluazacort, flucloronide, flumethasone, flunisolide, fluocinolone acetonide, fluocinonide, fluocortin butyl, fluocortolone, fluorometholone, fluperolone acetate, fluprednidene acetate, fluprednisolone, flurandrenolide, fluticasone propionate, formocortal, halcinonide, halobetasol propionate, halometasone, halopredone acetate, hydrocortarnate, hydrocortisone, loteprednol etabonate, mazipredone, medrysone, meprednisone, methylprednisolone, mometasone furoate, paramethasone, prednicarbate, prednisolone, prednisolone 25-diethylamino-acetate, prednisolone sodium phosphate, prednisone, prednival, prednylidene, rimexolone, tixocortol, triamcinolone, triamcinolone acetonide, triamcinolone benetonide, triamcinolone hexacetonide, their physiologically acceptable salts, combinations thereof, and mixtures thereof. In one embodiment, said at least a prior-art glucocorticoid is selected from the group consisting of dexamethasone, prednisone, prednisolone, methylprednisolone, medrysone, triamcinolone, loteprednol etabonate, physiologically acceptable salts thereof, combinations thereof, and mixtures thereof. In another embodiment, said at least a prior-art glucocorticoid is acceptable for ophthalmic uses.

TESTING FOR POTENTIAL SIDE EFFECTS

TLR or TLR coreceptor antagonists are not expected to generate side effects that have been seen with glucocorticoid therapy. However, such effects may still be assessed by a test disclosed below. One of the most frequent undesirable actions of a glucocorticoid therapy is steroid diabetes. The reason for this is the stimulation of gluconeogenesis in the liver by the induction of the transcription of hepatic enzymes involved in gluconeogenesis and metabolism of free amino acids that are produced from the degradation of proteins (catabolic action of glucocorticoids). A key enzyme of the catabolic metabolism in the liver is the tyrosine aminotransferase ("TAT"). The activity of this enzyme can be determined photometrically from cell cultures of treated rat hepatoma cells. Thus, the gluconeogenesis by a glucocorticoid can be compared to that of a TLR or TLR coreceptor antagonist by measuring the activity of this enzyme. For example, in one procedure, the cells are treated for 24 hours with the test substance (a TLR or TLR coreceptors antagonist, or a glucocorticoid), and then the TAT activity is measured. The TAT activities for the selected TLR or TLR coreceptor antagonist and glucocorticoid are then compared. Other hepatic enzymes can be used in place of TAT, such as phosphoenolpyruvate carboxykinase, glucose-6-phosphatase, or fructose-2,6- biphosphatase. Alternatively, the levels of blood glucose in an animal model may be measured directly and compared for individual subjects that are treated with a glucocorticoid for a selected condition and those that are treated with a TLR or TLR coreceptor antagonist for the same condition.

Another undesirable result of glucocorticoid therapy is increased IOP in the subject. IOP of subjects treated with a glucocorticoid or a TLR or TLR coreceptor antagonist for a condition may be measured directly and compared. SEQUENCE LISTING <110> Bausch & Lomb Incorporated

<120> Compositions Comprising Toll -Like Receptor Or Coreceptor

Antagonists and Methods For Treating or Controlling Ocular Allergy Using Same

<130> P04589

<160> 29

<170> Patentln ver

<210> 1 <211> 6 <212> DNA <213> Homo sapiens

<400> 1 ttaggς I

<210> 2 <211> 15 <212> DNA <213> Synthetic

<400> 2 tcctggcggg gaagt 15

<210> 3 <211> 15 <212> DNA <213> Synthetic

<400> 3 tcctaacggg gaagt 15

<210> 4 <211> 15 <212> DNA <213> Synthetic

<400> 4 tcctggaggg gttgt 15

<210> 5 <211> 15 <212> DNA <213> Synthetic

<400> 5 tcctggcggg caagt 15

<210> 6 <211> 15 <212> DNA <213> Synthetic

<400> 6 tcctggcggg taagt 15

<210> 7

<211> 15

<212> DNA

<213> Syntheti c

<400> 7 tcctggcggg aaagt 15

<210> 8

<211> 15

<212> DNA

<213> Synthetic

<400> 8 tcctgcaggg taagt 15

<210> 9

<211> 5

<212> PRT

<213> Mus musculus

<400> 9

Asp Ser Tyr lie His 1 5

<210> 10

<211> 17

<212> PRT

<213> Mus musculus

<400> 10

Trp Thr Asp Pro Glu Asn VaI Asn Ser lie Tyr Asp Pro Arg Phe Gin 1 5 10 15

Gly

<210> 11

<211> 11

<212> PRT

<213> Mus musculus

<400> 11

Gly Tyr Asn Gly VaI Tyr Tyr Ala Met Asp Tyr 1 5 10

<210> 12

<211> 5

<212> PRT

<213> Mus musculus

<400> 12

Asp Tyr Trp lie Glu 1 5 <210> 13

<211> 17

<212> PRT

<213> Mus muscul us

<400> 13

Glu lie Leu Pro Gly Ser Gly Ser Thr Asn Tyr Asn Glu Asp Phe Lys 1 5 10 15

Asp

<210> 14

<211> 9

<212> PRT

<213> Mus musculus

<400> 14

Glu Glu Arg Ala Tyr Tyr Phe Gly Tyr 1 5

<210> 15

<211> 6

<212> PRT

<213> Mus musculus

<400> 15

Gly Gly Tyr Ser Trp His 1 5

<210> 16

<211> 16

<212> PRT

<213> Mus musculus

<400> 16

Tyr lie His Tyr Ser Gly Tyr Thr Asp Phe Asn pro Ser Leu Lys Thr 1 5 10 15

<210> 17

<211> 9

<212> PRT

<213> Mus musculus

<400> 17

Lys Asp Pro Ser Asp Gly Phe Pro Tyr 1 5

<210> 18

<211> 7

<212> PRT

<213> Mus musculus

<400> 18

Thr Tyr Asn lie Gly VaI Gly <210> 19

<211> 16

<212> PRT

<213> Mus muscul us

<400> 19

His lie Trp Trp Asn Asp Asn lie Tyr Tyr Asn Thr VaI Leu Lys Ser 1 5 10 15

<210> 20

<211> 11

<212> PRT

<213> Mus musculus

<400> 20

Met Al a Gl u Gly Arg Tyr Asp Al a Met Asp Tyr 1 5 10

<210> 21

<211> 15

<212> DNA

<213> Arti fi cial Sequence

<22O>

<223> Synthetic oligonucleotide

<400> 21 tcctggcggg gaagt 15

<210> 22

<211> 15

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthetic oligonucleotide

<400> 22 gcctggcggg gaagt 15

<210> 23

<211> 15

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthetic oligonucleotide

<400> 23 acctggcggg gaagt 15

<210> 24

<211> 15

<212> DNA

<213> Artificial Sequence

<22O> <223> Synthetic ol igonucleotide

<400> 24 ccctggcggg gaagt 15

<210> 25

<211> 15

<212> DNA

<213> Artificial Sequence

<400> 25 tcccggcggg gaagt 15

<210> 26

<211> 15

<212> DNA

<213> Artificial Sequence

<22O>

<223> Synthetic oligonucleotide

<400> 26 tccaccaccc caagt 15

<210> 27

<211> 14

<212> DNA

<213> Artificial Sequence

<22O>

<223> Synthetic oligonucleotide

<400> 27 cctggcgggg aagt 14

<210> 28

<211> 15

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthetic oligonucleotide

<400> 28 tcctagcggg gaagt 15

<210> 29

<211> 15

<212> DNA

<213> Artificial Sequence

<22O>

<223> Synthetic oligonucleotide

<400> 29 tcctggaggg gaagt 15 While specific embodiments of the present invention have been described in the foregoing, it will be appreciated by those skilled in the art that many equivalents, modifications, substitutions, and variations may be made thereto without departing from the spirit and scope of the invention as defined in the appended claims.

Claims

WHAT IS CLAIMED IS:

1. A composition comprising an antagonist to at least a human TLR, an antagonist to at least a coreceptor of human TLR, a compound that is capable of inhibiting an activation of a human TLR signaling pathway, or a combination thereof; wherein said antagonist, compound, or combination thereof is present at a concentration such that the composition is capable of treating or controlling ocular allergy in a subject.

2. The composition of claim 1, further comprising an anti-allergic medicament.

3. The composition of claim 2, wherein said allergy is selected from the group consisting of seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, giant papillary conjunctivitis, toxic conjunctivitis, contact ocular allergy, and combinations thereof.

4. The composition of claim 1, wherein said at least a human TLR is selected from the group consisting of TLRl, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLRlO, and combinations thereof.

5. The composition of claim 1, wherein said at least a coreceptor of human TLR comprises CD 14, MD-2, a combination thereof, or a mixture thereof.

6. The composition of claim 1, wherein said antagonist or said compound is selected from the group consisting of anti-human antibodies of TLRl, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLRlO, CD14, or MD-2; and combinations thereof.

7. The composition of claim 1, wherein said compound that is capable of inhibiting an activation of a human TLR signaling pathway comprises a soluble form of an extracellular domain of a human TLR that recognizes a microbe-expressed molecular structure.

8. The composition of claim 1, wherein said compound that is capable of inhibiting an activation of a human TLR signaling pathway comprises at least a soluble form of CD14 or MD-2.

9. The composition of claim 1, wherein said antagonist or said compound comprises an antibody of a TLR, wherein said antibody comprises a heavy-chain complimentary determining region having an amino acid sequence selected from the group consisting of SEQ. NO. 9 - SEQ .NO. 20 and combinations thereof.

10. The composition of claim 1, wherein said antagonist or compound comprises a nucleotide sequence selected from the group consisting of SEQ. NO. 1 - SEQ. NO. 8, SEQ. NO. 21 - SEQ. NO. 29, and combinations thereof.

11. The composition of claim 1 , wherein said antagonist or compound comprises a nucleotide sequences comprising multiple repeats of any one of SEQ. NO. 1 - SEQ. NO. 8, SEQ. NO. 21 - SEQ. NO. 29, and combinations thereof.

12. The composition of claim 9, wherein said nucleotide sequence comprises two, three, four, or five repeats of any one of SEQ. NO. 1 - SEQ. NO. 8, SEQ. NO. 21 - SEQ. NO. 29, and combinations thereof.

13. The composition of claim 1 , wherein said antagonist or compound comprises a material selected from the group consisting of chloroquine, hydroxychloroquine, quinacrine, 9-aminoacridine, 4-aminoquinoline, and a mixture thereof.

14. The composition of claim 1, wherein said antagonist or compound comprises a ligand of vitamin D receptor.

15. The composition of claim 14, wherein said ligand of vitamin D receptor comprises vitamin D or an analogue thereof.

16. The composition of claim 14, wherein said ligand of vitamin D receptor comprises vitamin D₂, vitamin D₃, or a mixture thereof.

17. The composition of claim 1, wherein said antagonist or compound comprises a compound having one of Formulae I through XXII.

18. The composition of claim 1 , wherein said antagonist or said compound is present in an amount in a range from about 0.0001 to about 10 percent by weight of said composition.

19. The composition of claim 2, wherein said anti-allergic medicament comprises a material selected from the group consisting of antihistamines, histamine binders, Hi- receptor antagonists, E^-receptor antagonists, and EU-receptor antagonists), leukotriene antagonists, mast-cell stabilizers, immunomodulators, anti-IgE agents, and combinations thereof.

20. The composition of claim 19, wherein said anti-allergic medicament comprises an antihistamine selected from the group consisting of olopatadine, emedastine, levocabastine, and combinations thereof.

21. The composition of claim 19, wherein said anti-allergic medicament comprises mast-cell stabilizers selected from the group consisting of cromolyn, lodoxamide tromethamine, pemirolast, nedocromil, olopatadine, ketotifen, azelastine, epinastine, salts thereof, and combinations thereof.

22. The composition of claim 1, further comprises a medicament selected from the group consisting of immunosuppressants, cyclooxygenase-2 inhibitors, NSAIDs (nonsteroidal anti-inflammatory drugs), DMARDS (disease-modifying anti-rheumatic drugs), antibiotics, 5-lipoxygenase inhibitors, LTB₄ antagonists, LTC₄ antagonists, LTD₄ antagonists, LTE₄ antagonists, LTA₄ hydrolase inhibitors, anti-cell adhesion molecules, and combinations thereof.

23. The composition of claim 22, wherein said immunosuppressants are selected from the group consisting of cyclosporine, tacrolimus, rapamycinazathioprine, 6- mercaptopurine, and combinations thereof.

24. The composition of claim 19, further comprising a material selected from the group consisting of carriers, preservatives, antimicrobial agents, surfactants, buffers, tonic ity-modifying agents, chelating agents, viscosity-modifying agents, co-solvents, oils, humectants, emollients, stabilizers, antioxidants, and combinations thereof.

25. The composition of claim 24, wherein the composition has a pH in a range from about 5 to about 8.

26. The composition of claim 24, wherein the composition has a pH in a range from about 6.5 to about 7.8.

27. A composition comprising: (a) an antagonist to at least a human TLR, an antagonist to at least a coreceptors of human TLR, a compound that is capable of inhibiting an activation of a human TLR signaling pathway, or a combinations thereof; and (2) an anti-allergic medicament selected from the group consisting of antihistamines, histamine binders, Hi-receptor antagonists, H3-receptor antagonists, and EL^-receptor antagonists), leukotriene antagonists, mast-cell stabilizers, immunomodulators, anti-IgE agents, and combinations thereof; wherein the composition is capable of treating, reducing, ameliorating, alleviating, or preventing a dry eye condition; wherein each of said at least a human TLR comprises TLRl, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLRlO, or a combination thereof; said at least a coreceptors of human TLR comprises CD 14, MD-2, a combination thereof, or a mixture thereof; said antagonist or compound; and said anti-allergic medicament, when present, is present in an amount from about 0.0001 to about 5 percent by weight of said composition; and said composition has a pH of about 5-8.

28. The composition of claim 27, further comprises an additional medicament selected from the group consisting of immunosuppressants, cyclooxygenase-2 inhibitors, NSAIDs (non-steroidal anti-inflammatory drugs), DMARDS (disease-modifying antirheumatic drugs), antibiotics, 5 -lipoxygenase inhibitors, LTB₄ antagonists, LTA₄ hydrolase inhibitors, anti-cell adhesion molecules, and combinations thereof; wherein said additional medicament is present in an amount from about 0.0001 to about 5 weight percent.

29. A method for treating or controlling ocular allergy in a subject, the method comprising administering to an environment of an affected eye a pharmaceutically effective amount of a composition that comprises an antagonist to at least a human TLR, an antagonist to at least a coreceptor of human TLR, a compound that is capable of inhibiting an activation of a human TLR signaling pathway, or a combination thereof.

30. The method of claim 29, wherein said allergy is selected from the group consisting of seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, giant papillary conjunctivitis, toxic conjunctivitis, contact ocular allergy, and combinations thereof.

31. The method of claim 29; wherein said at least a human TLR comprises TLRl , TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLRlO, or a combination thereof; and said at least a coreceptor of human TLR comprises CD14, MD-2, a combination thereof, or a mixture thereof.

32. The method of claim 29, wherein said antagonist or said compound is selected from the group consisting of anti-human antibodies of TLRl, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLRlO, CD14, or MD-2; and combinations thereof.

33. The method of claim 29, wherein said compound that is capable of inhibiting an activation of a human TLR signaling pathway comprises a soluble form of an extracellular domain of a human TLR that recognizes a microbe-expressed molecular structure, or a soluble form of CD 14 or MD-2.

34. The method of claim 29, wherein said antagonist or compound comprises a nucleotide sequence selected from the group consisting of SEQ. NO. 1 - SEQ. NO. 8, SEQ. NO. 21 - SEQ. NO. 29, and combinations thereof.

35. The method of claim 29, wherein said antagonist or compound comprises a nucleotide sequences comprising multiple repeats of any one of SEQ. NO. 1 - SEQ. NO. 8, SEQ. NO. 21 - SEQ. NO. 29, and combinations thereof.

36. The method of claim 35, wherein said nucleotide sequence comprises two, three, four, or five repeats of any one of SEQ. NO. 1 - SEQ. NO. 8, SEQ. NO. 21 - SEQ. NO. 29, and combinations thereof.

37. The method of claim 29, wherein said antagonist or said compound comprises a compound having one of Formulae I through XXII.

38. The method of claim 29, wherein said antagonist or said compound comprises an antibody of a TLR, wherein said antibody comprises a heavy-chain complimentary determining region having an amino acid sequence selected from the group consisting of SEQ. NO. 9 - SEQ.NO. 20 and combinations thereof.

39. The method of claim 29, wherein said antagonist or compound comprises a material selected from the group consisting of chloroquine, hydroxychloroquine, quinacrine, 9-aminoacridine, 4-aminoquinoline, and a mixture thereof.

40. The method of claim 29, wherein said antagonist or compound comprises a ligand of vitamin D receptor.

41. The method of claim 40, wherein said ligand of vitamin D receptor comprises vitamin D or an analogue thereof.

42. The method of claim 40, wherein said ligand of vitamin D receptor comprises vitamin D₂, vitamin D₃, or a mixture thereof.

43. The method of claim 29, wherein said antagonist or said compound is present in an amount in a range from about 0.0001 to about 5 percent by weight of said composition.

44. The method of claim 29, wherein the composition further comprises an additional medicament selected from the group consisting of anti-allergic medicaments, immunosuppressants, cyclooxygenase-2 inhibitors, NSAIDs, DMARDS, antibiotics, 5- lipoxygenase inhibitors, LTB₄ antagonists, LTC₄ antagonists, LTD₄ antagonists, LTE₄ antagonists, LTA₄ hydrolase inhibitors, anti-cell adhesion molecules, and combinations thereof; wherein said additional medicament is present in an amount from about 0.0001 to about 5 weight percent.

45. The method of claim 29, wherein the composition further comprises an antiallergic medicaments wherein said anti-allergic medicament selected from the group consisting of antihistamines, histamine binders, Hi-receptor antagonists, H₃-receptor antagonists, and tLt-receptor antagonists), leukotriene antagonists, mast-cell stabilizers, immunomodulators, anti-IgE agents, and combinations thereof.

46. The method of claim 45, wherein said anti-allergic medicament comprises an antihistamine selected from the group consisting of olopatadine, emedastine, levocabastine, and combinations thereof.

47. The composition of claim 45, wherein said anti-allergic medicament comprises mast-cell stabilizers selected from the group consisting of cromolyn, lodoxamide tromethamine, pemirolast, nedocromil, olopatadine, ketotifen, azelastine, epinastine, salts thereof, and combinations thereof.

48. The method of claim 29, wherein said composition further comprises an immunosuppressant selected from the group consisting of cyclosporine, tacrolimus, rapamycinazathioprine, 6-mercaptopurine, and combinations thereof.

49. A method for preparing a composition for treating or controlling ocular allergy, the method comprising combining an antagonist to at least a human TLR, an antagonist to at least a coreceptor of human TLR, a compound that is capable of inhibiting an activation of a human TLR signaling pathway, or a combination thereof with a pharmaceutically acceptable carrier; wherein said antagonist, compound, or combination thereof is present at a concentration such that the composition is capable of treating, reducing, ameliorating, alleviating, or preventing said dry eye condition in a subject.

50. The method of claim 49, further comprising adding a medicament selected from the group consisting of anti-allergic medicaments, immunosuppressants, cyclooxygenase-2 inhibitors, NSAIDs, DMARDS, antibiotics, 5 -lipoxygenase inhibitors, LTB₄ antagonists, LTC₄ antagonists, LTD₄ antagonists, LTE₄ antagonists, LTA₄ hydrolase inhibitors, anti-cell adhesion molecules, and combinations thereof to the composition.