WO2009087967A1 - Method for detecting a protein-protein interaction - Google Patents
Method for detecting a protein-protein interaction Download PDFInfo
- Publication number
- WO2009087967A1 WO2009087967A1 PCT/JP2009/000033 JP2009000033W WO2009087967A1 WO 2009087967 A1 WO2009087967 A1 WO 2009087967A1 JP 2009000033 W JP2009000033 W JP 2009000033W WO 2009087967 A1 WO2009087967 A1 WO 2009087967A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- domain
- tlucc
- mut
- amino acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6845—Methods of identifying protein-protein interactions in protein mixtures
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1055—Protein x Protein interaction, e.g. two hybrid selection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/536—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase
- G01N33/542—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase with steric inhibition or signal modification, e.g. fluorescent quenching
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/61—Fusion polypeptide containing an enzyme fusion for detection (lacZ, luciferase)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/902—Oxidoreductases (1.)
- G01N2333/90241—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
Definitions
- the present invention relates to methods for detecting a protein-protein interaction.
- This complementation strategy has been used with a variety of reporter proteins, including dihydrofolate reductase, b-Lactamase, and green fluorescent protein.
- luciferases have been also used including Renilla luciferase, firefly luciferase, red click beetle luciferase, and green click beetle luciferase.
- the split fragments of these luciferases have their own specificity and a fragment can recover its luminescent ability only when it is placed close to another fragment derived from the same species of luciferase.
- the inventors have developed a mutant C-terminus fragment of the click beetle luciferase (TlucC(mut); SEQ ID NO: 1) which has the ability to complement the N-terminus fragment derived from other species of luciferase such as wild type firefly luciferase (FlucN; SEQ ID NO: 3) and green click beetle luciferase (GlucN; SEQ ID NO: 2), as well as that of the red click beetle luciferase (TlucN; SEQ ID NO: 4), using the same luciferin substrate.
- TlucC(mut) wild type firefly luciferase
- FlucN wild type firefly luciferase
- GlucN green click beetle luciferase
- TlucN red click beetle luciferase
- One embodiment of the present invention is a protein comprising a TlucC(mut) domain.
- the TlucC(mut) domain has amino acid SEQ ID NO: 1.
- Another embodiment is a method for detecting a protein comprising either a GlucN domain, a FlucN domain, or a TlucN domain.
- This method comprises allowing the protein to interact with the protein comprising a TlucC(mut) domain to form a complex. These domains in the complex complement to each other and become able to emit specific light. By detecting the emitted light, the protein comprising either a GlucN domain, a FlucN domain, or a TlucN domain can be detected.
- Another embodiment is a method for detecting a protein comprising a TlucC(mut) domain.
- This method comprises allowing the protein to interact with a protein comprising either a GlucN domain, a FlucN domain, or a TlucN domain to form a complex. These domains in the complex complement to each other and become able to emit specific light. By detecting the emitted light, the protein comprising a TlucC(mut) domain can be detected.
- Another embodiment is a method for detecting a complex comprising a first protein comprising a TlucC(mut) domain and a second protein comprising either a GlucN domain having amino acid SEQ ID NO: 2, a FlucN domain having amino acid SEQ ID NO: 3, or a TlucN domain having amino acid SEQ ID NO: 4.
- This method comprises detecting the light emitted from the complex.
- Another embodiment is a method for detecting binding of a first protein comprising a TlucC(mut) domain and a second protein comprising either a GlucN domain, a FlucN domain, or a TlucN.
- This method comprises allowing the proteins to interact with each other to form a complex, and detecting the light emitted from the complex of the proteins.
- Another embodiment is a method for detecting binding of a first protein and a second protein, the proteins being capable of binding to each other.
- the method comprises fusing a TlucC(mut) domain to the first protein, fusing either a GlucN domain, a FlucN domain, or a TlucN domain to the second protein, allowing the fused first protein and the fused second protein to interact with each other to form a complex, and detecting the light emitted from the complex.
- Another embodiment is a method for selecting a binding protein of a first protein between a second protein and a third protein, the first protein being fused to a TlucC(mut) domain, each of the second protein and the third protein being fused to a different domain selected from a group consisting of a GlucN domain, a FlucN domain, and a TlucN domain, comprising allowing the first protein to interact with the second protein and the third protein, detecting the emitted light, and determining which complex of the proteins emits the light.
- Another embodiment is a method for selecting a binding protein of a first protein between a second protein and a third protein.
- This method comprises fusing a TlucC(mut) domain to the first protein, fusing each of two domains selected from a group consisting of a GlucN domain, a FlucN domain, a TlucN domain to the second protein and the third protein, allowing the first protein to interact with the second protein and the third protein, detecting the emitted light, and determining which complex of the proteins emits the light.
- the protein containing a TlucC(mut) domain may have amino acid SEQ ID NO: 1 which contains one or a few of either substitution, deletion, or addition of an amino acid, as long as the protein is capable of binding to either a GlucN domain having amino acid SEQ ID NO: 2, a FlucN domain having amino acid SEQ ID NO: 3, or a TlucN domain having amino acid SEQ ID NO: 4, to form a complex.
- Figure 1 shows a schematic of the principle of the bioluminescent probes based on the protein complementation.
- Figure 2 shows the complementation of (a) FlucN and TlucC(mut), (b) GlucN and TlucC(mut), and (c) TlucC and TlucC(mut) in an example.
- Figure 3 shows the constructs of luminescent probes used in an example.
- Figure 4 shows expressions from the constructs of pBAD(wt)-TlucC(mut), pBAD(S112A)-TlucC(mut), pBAD(S136A)-TlucC(mut), pBAD(S155A)-TlucC(mut), pBAD(StrippleA)-TlucC(mut), pGlucN-14-3-3, and pGlucN-BCL-X L in the COS-7 cells in an example.
- Figure 5 show the interactions between BAD or BAD variants and 14-3-3 in an example.
- Figure 6 shows that there was no phosphorylation of the 112nd, 136th, and 155th amino acids in BAD(S112A), BAD(S136A), BAD(S155A), respectively, and that there were phosphorylation of all of three amino acids in BAD(wt), in an example.
- Figure 7 shows effects of various phosphorylation stimulators and inhibitors on BAD/14-3-3 interaction in an example.
- Figure 8 shows the interactions between BAD and BCL-XL, and effects of BCL-XL inhibitors on the BAD/BCL-XL interaction in an example.
- FIG. 9 shows the spectrum shift of lights emitted by the combinations of GlucN and Tluc(mut), FlucN and TlucC(mut), and TlucN and TlucC(mut) in an example.
- Fig. 10 shows detection of luminescence in subcutaneous cells of nude mice in an example. "Em530nm” and “Em600nm” indicate wavelengths of detected lights. "OPEN” indicates the result obtained without narrowing wavelength for detection of light.
- the present invention provides a modified complementation strategy for detecting protein-protein interactions, using a mutant C-terminus fragment of the red click beetle luciferase (TlucC(mut); SEQ ID NO: 1).
- the wild type C-terminus fragment of the red click beetle luciferase (wtTluc; SEQ ID NO: 1) can complement only the N-terminus fragment derived from the red click beetle luciferase (TlucN) but not those derived from other species of luciferase.
- the TlucC(mut) has the ability to complement the N-terminus fragment derived from other species of luciferase such as wild type firefly luciferase (FlucN) and green click beetle luciferase (GlucN), as well as that of the red click beetle luciferase (TlucN), using the same luciferin substrate.
- FlucN wild type firefly luciferase
- GlucN green click beetle luciferase
- TlucN red click beetle luciferase
- the complex of proteins having each of the domains emits light with a specific wavelength i.e., the emitted light has peak near 600 nm in the case of a combination with TlucN, near 530 nm in the case of a combination with GlucN, and near 560 nm in the case of a combination with FlucN, respectively. Therefore, it can be determined which complex of the proteins emits the light, depending on the wavelength of the emitted light.
- the complex can be identified as having a combination with TlucN, GlucN and FlucN, by detecting light with a wavelength of 600 nm, 530 nm and 560 nm, respectively.
- TlucN TlucN
- GlucN GlucN
- FlucN FlucN
- Emitted light from the complex can be detected as luminescence in cell lysates, cell extracts, and cultured cells, as well as luminescence in a living body as shown in Example 5. It is easier to detect luminescence in cells located near a body surface such as endodermic and subcutaneous cells.
- the following applications can be made as examples: (1) detection of a protein having an anti-TlucC(mut) domain, using a protein having a TlucC(mut) domain, the proteins being capable of binding to each other; (2) detection of a protein having a TlucC(mut) domain, using a protein having an anti-TlucC(mut) domain, the proteins being capable of binding to each other; (3) detection of a complex of a protein having a TlucC(mut) domain and a protein having an anti-TlucC(mut) domain, the proteins being capable of binding to each other; (4) detection of binding of a protein having a TlucC(mut) domain to a protein having an anti-TlucC(mut) domain; and (5) selection of a binding protein of a protein having a TlucC(mut) domain between a second protein and a third protein, each of which has a different anti-TlucC(mut) domain.
- existence of a protein having an anti-TlucC(mut) domain can be examined by allowing the protein to interact with a protein, which has a TlucC(mut) domain and is capable of binding with a protein having an anti-TlucC(mut) domain, and detecting the light emitted when the proteins are bound and the domains are placed in such a close position as to interact with each other.
- existence of a protein having a TlucC(mut) domain can be examined by allowing the protein to interact with a protein, which has an anti-TlucC(mut) domain and is capable of binding with a protein having a TlucC(mut) domain, and detecting the light emitted when the proteins are bound and the domains are placed in such a close position as to interact with each other.
- a gene encoding a protein of interest fused by an anti-TlucC(mut) domain is expressed in some cells, the expression can be detected by expressing another gene encoding a protein fused by a TlucC(mut) domain, which can bind to the protein of interest, in the cells together.
- the domains complement to each other and light specific to the combination of the domains are emitted. By detecting the emitted light, the existence of the protein of interest can be detected.
- Such a system can be used for examining expression of a protein, the specificity of a promoter, etc. as applications.
- a binding protein of a protein having a TlucC(mut) domain can be selected between two or three proteins, each of which has a different anti-TlucC(mut) domain.
- the light with a different wavelength is emitted. Therefore, by detecting the emitted light and its wavelength, it will be known which complex is formed and a binding protein to the protein having a TlucC(mut) domain can be identified and selected.
- This embodiment has its wide-range of applications. For example, if the property of the protein having a TlucC(mut) domain is changed depending on the situation in a cell and the binding partner of the protein is changed depending on its property, then the situation in the cell can be detected by putting the protein having a TlucC(mut) domain and the other proteins having a anti-TlucC(mut) domain in the cell and examining the binding partner of the protein having a TlucC(mut) domain. If the complex is detected in real-time by fluorescence etc., the change of the property of the protein can be also detected in real-time.
- the methods for producing the fusion protein are not limited but production by a chemical synthesis or a molecular biological synthesis is preferred and a molecular biological synthesis is most preferred.
- a gene coding the fusion protein is inserted into an expression vector, the expression vector is introduced in a cell, and the fusion protein can be thus expressed in the cell.
- the methods for detecting light emitted from the complex of the fusion proteins are not particularly limited and the most suitable method to the substrate and the emitted light can be used.
- TlucN, GlucN or FlucN can complement to TlucC(mut)
- the interacting proteins, FKBP and FRB which can be bound in the presence of rapamycin, were utilized.
- pTlucN-FKBP pGlucN-FKBP, pFlucN-FKBP and pFRB-TlucC(mut)
- the cDNA of TlucN, GlucN, FlucN, FKBP, FRB, and TlucC(mut) were generated by standard polymerase chain reaction to add the Kozak sequence and restriction sites.
- sequences of the primers used for generating these cDNAs are the followings: (TlucN-1) 5'AAGCTTGCCATGGTAAAGCGTGAGAAAAATGTC3'(SEQ ID NO: 5) (TlucN-2) 5'GGATCCTCCGCCTCCTCCGCCGTCGTCGATGGCCTC3' (SEQ ID NO: 6) (GlucN-1) 5'AAGCTTGCCATGGAGAGAGAGAAGAAC3'(SEQ ID NO: 7) (GlucN-2) 5'GGATCCTCCGCCTCCTCCTACCATAGGTCCCCAGAT3' (SEQ ID NO: 8) (FlucN-1) 5'AAGCTTGCCATGGAAGACGCCAAAAACATAAAGAAAGGC3' (SEQ ID NO: 9) (FlucN-2) 5'GGATCCTCCGCCTCCTCCATCCTTGTCAATCAAGGCGTTGGT3' (SEQ ID NO: 10) (FKBP-1) 5'GGATCCATGGGCGTGCAGGTGGAG3
- TlucN, GlucN and FlucN cDNA each was digested with HindIII and BamH1, and ligated with the pcDNA4/V5-His vector digested with the same enzymes to construct pTlucN, pGlucN, and pFlucN vector, respectively.
- FKBP cDNA was digested with BamH1 and Xho1, and ligated with the pTlucN, pGlucN or pFlucN vector digested with the same enzymes to complete the construct of pTlucN-FKBP, pGlucN-FKBP and pFlucN-FKBP, respectively.
- TlucC and TlucC(mut) cDNA was digested with Xho1 and Apa1, and ligated with the pcDNA4/V5-His vector digested with the same enzymes to construct pTlucC and pTlucC(mut) vectors, respectively.
- FRB cDNA was digested with BamH1 and Xho1 and ligated with the pTlucC and pTlucC(mut) vector digested with the same enzymes to complete the construct of pFRB-TlucC and pFRB-TlucC(mut), respectively.
- pTK-Rluc which expresses Renilla luciferase (Rluc) was used as internal control to normalize the transfection efficiency.
- the COS-7 cells were plated on the 12-well plates and transiently transfected with pTlucN-FKBP, pFRB–TlucC(mut)and pTK-Rluc; pGlucN-FKBP, pFRB–TlucC(mut) and pTK-Rluc; and pFlucN-FKBP, pFRB–TlucC(mut)and pTK-Rluc, respectively using LipofectAMINE 2000 (GibcoBRL).
- pFRB–TlucC was used instead of pFRB–TlucC(mut).
- the cells were stimulated by rapamycin (final conc. 100nM) for 30 min and then washed once with PBS.
- the cells as a negative control experiment were not stimulated by rapamycin but were subject to all other experimental procedures.
- TlucC(wt) scarcely binds to either GlucN or FlucN but TlucN
- TlucC(mut) can serve as an excellent complementation partner of TlucN, GlucN or FlucN to evaluate protein-protein interactions.
- BAD cDNA was digested with BamH1 and EcoR1, and ligated with the pTlucC(mut) vector digested with the same enzymes to complete the BAD-TlucC(mut) construct.
- 14-3-3 cDNA was digested with BamH1 and EcoR1, and ligated with the pGlucN digested with the same enzymes to complete the pGlucN–14-3-3 construct.
- COS-7 cells were plated on the 12-well plates and transiently transfected with p14-3-3–GlucN, pBAD–TlucC(mut), or pBCL-X L –GlucN as described in Example 1.
- the cells were lysed with the sample buffer (125 mM Tris pH6.8, 10% glycerol, 4% SDS, 0.006% Bromophenol blue, 1.8% beta-mercaptoethanol) and portions of the lysates were subject to Western blotting using anti-V5 antibody [1 : 5000 in 1% skimmed milk in TBST (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 0.05% Tween 20)] and alkaline phosphatase-labeled anti-mouse antibody (1 : 4000 in 1% skimmed milk in TBST).
- the protein expression was analyzed by an image analyzer (LAS-1000 plus, Fujifilm Co., Tokyo, Japan) using an ECL TM kit (Amersham Biosciences, UK) ( Figure 4). The result confirmed expression from these constructs.
- BAD(S112A), BAD(S136A), BAD(S155A), and BAD(StrippleA) were generated by standard polymerase chain reaction to add the Kozak sequence and restriction sites. After confirming the sequence of these cDNAs, BAD(S112A), BAD(S136A), BAD(S155A) and BAD(StrippleA) were digested with BamH1 and EcoR1, and ligated with the pTlucC(mut) vector digested with the same enzymes to complete the pBAD(S112A)-TlucC(mut), pBAD(S136A)-TlucC(mut), pBAD(S155A)-TlucC(mut), and pBAD(StrippleA)-TlucC(mut) constructs, respectively.
- sequences of the oligonucleotide pairs used in PCR for generating BAD(S112A), BAD(S136A), and BAD(S155A) are the followings: (BAD(S112A)-1) 5'GAGACT CGGAGTCGCCACAGTGCGTACCCAGCGGGGACCGAG3' (SEQ ID NO: 23) (BAD(S112A)-2) 5'CTCGGTCCCCGCTGGGTACGCACTGTGGCGACTCCGAGTCTC3' (SEQ ID NO: 24) (BAD(S136A)-1) 5'CGAGGACGCTCGCGTGCGGCTCCCCCCAATCTCTGGGCAGCG3' (SEQ ID NO: 25) (BAD(S136A)-2) 5'CGCTGCCCAGAGATTGGGGGGAGCCGCACGCGAGCGTCCTCG3' (SEQ ID NO: 26) (BAD(S155A)-1) 5'GAGCTCCGAAGGATGGCCGATGAGTTTGAGGGTTCCTTC
- the expression vectors, p14-3-3–GlucN and either one of pBAD–TlucC(mut), pBAD(S112A)–TlucC(mut), pBAD(S136A)–TlucC(mut), pBAD(S155A)-TlucC(mut) or pBAD(StrippleA)-TlucC(mut) were cotransfected in COS-7 cells as described above. At 12-16 hours after transfection, cells were lysed and luminescence was monitored by luminometer. The result is shown in Fig. 5.
- BAD and BCL-X L were used as the interacting proteins.
- BCL-X L To construct the pGlucN–BCL-X L , the cDNAs of BCL-X L were generated by standard polymerase chain reaction to add the Kozak sequence and restriction sites. After confirming the sequence of the cDNA, BCL-X L cDNA was digested with EcoR1 and Xho1, and ligated with the pGlucN vector to complete pGlucN-BCL-X L construct.
- the cultured COS-7 cells were transfected with the pGlucN-FKBP and pFRB-TlucC(mut) and incubated at 37 O C for 24 hours. Cells were stimulated with rapamycin (1.0 mM) and again incubated for another 10-12 hours at 37 O C. The cultured medium was then removed and luciferin substrate solution was added. After 3-5 minutes, cells were lysed and the spectrum was obtained using fluorescence spectrophotometer. As shown in Fig. 9, the spectrum had a peak (lmax) near 530 nm.
- the spectrum of the detected light by the combination of pFlucN-FKBP and pFRB-TlucC(mut) had a peak (lmax) near 560 nm
- the spectrum of the detected light by the combination of pTlucN-FKBP and pFRB-TlucC(mut) had a peak (lmax) near 600 nm.
- mice The expression vectors, p14-3-3–GlucN and either one of pBAD–TlucC(mut) or pBAD(StrippleA)–TlucC(mut) were introduced into mice as follows.
- pGluc(wt) was constructed as follows.
- the cDNA of Gluc(wt) was generated by standard polymerase chain reaction to add restriction sites. After confirming the sequence of the cDNA, Gluc(wt) was digested with HindIII and Xho1 and inserted in the vector digested with the same enzymes to construct pGluc(wt).
- the sequences of the oligonucleotide pairs used in PCR for generating Gluc(wt) are the followings: (Gluc(wt)-1) 5'AAGCTTATGGAGAGAGAGAAGAACGTGTACGGC 3' (SEQ ID NO: 29) (Gluc(wt)-2) 5'CTCGAGCGCAGCTTAGAAGCCTTCTCCATCAG 3' (SEQ ID NO: 30)
- COS-7 cells were cultured in four 10 cm dishes. Each dish was: (1) transfected with Gluc(wt)alone; (2) cotransfected with pBAD-TlucC(mut) and pGlucN-14-3-3-TlucN; (3) cotransfected with pBAD-TlucC(mut), pGlucN-14-3-3-TlucN and Gluc(wt); and (4) cotransfected with pBAD(StrippleA)-TlucC(mut), pGlucN-14-3-3-TlucN and Gluc(wt). The cells were harvested after incubated at 37 O C for 18-24 hours.
- mice The cells were suspended in phosphate buffer saline, and an aliquot of 1x10 6 cells was implanted in anesthetized BALB/c nude mice (female, 4 weeks old, ⁇ 15g body weight) at positions indicated in Fig.1. Fifteen minutes after cells implantation, luciferin, 3mg dissolved in 100 mL of PBS, was injected i.p. Ten minutes after the injection, mice were imaged by using a CCD camera (Versarray: 1300B, Prinston Instruments).
- the present invention provides a modified complementation strategy for detecting protein-protein interactions.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Urology & Nephrology (AREA)
- Physics & Mathematics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Hematology (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Cell Biology (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
- Enzymes And Modification Thereof (AREA)
- Peptides Or Proteins (AREA)
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2008000789A JP5258084B2 (ja) | 2008-01-07 | 2008-01-07 | タンパク質間相互作用の検出方法 |
| JP2008-000789 | 2008-01-07 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2009087967A1 true WO2009087967A1 (en) | 2009-07-16 |
Family
ID=40853081
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/JP2009/000033 Ceased WO2009087967A1 (en) | 2008-01-07 | 2009-01-07 | Method for detecting a protein-protein interaction |
Country Status (2)
| Country | Link |
|---|---|
| JP (1) | JP5258084B2 (https=) |
| WO (1) | WO2009087967A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2436764A4 (en) * | 2009-05-29 | 2012-11-28 | Univ Tokyo | METHOD OF ULTRASENSIBLE DETECTION OF PROTEIN-PROTEIN INTERACTION |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| MX2022013030A (es) | 2020-04-17 | 2023-03-09 | Regeneron Pharma | Ensayos de deteccion para anticuerpos neutralizantes de coronavirus. |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002016944A2 (en) * | 2000-08-24 | 2002-02-28 | Promega Corporation | Synthetic nucleic acid molecule compositions and methods of preparation |
| WO2007027919A2 (en) * | 2005-09-01 | 2007-03-08 | Washington University In St. Louis | Complementation assays utilizing complexes of heteroproteins |
-
2008
- 2008-01-07 JP JP2008000789A patent/JP5258084B2/ja not_active Expired - Fee Related
-
2009
- 2009-01-07 WO PCT/JP2009/000033 patent/WO2009087967A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002016944A2 (en) * | 2000-08-24 | 2002-02-28 | Promega Corporation | Synthetic nucleic acid molecule compositions and methods of preparation |
| WO2007027919A2 (en) * | 2005-09-01 | 2007-03-08 | Washington University In St. Louis | Complementation assays utilizing complexes of heteroproteins |
Non-Patent Citations (1)
| Title |
|---|
| OZAWA,T.: "Hikari probe no atarashii design to seitaikinou no kashika.", KAGAKU KOGYO, vol. 58, no. 11, November 2007 (2007-11-01), pages 860 - 864 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2436764A4 (en) * | 2009-05-29 | 2012-11-28 | Univ Tokyo | METHOD OF ULTRASENSIBLE DETECTION OF PROTEIN-PROTEIN INTERACTION |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2009159889A (ja) | 2009-07-23 |
| JP5258084B2 (ja) | 2013-08-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7843318B2 (ja) | 構造的相補性による生物発光の活性化 | |
| Azad et al. | Split-luciferase complementary assay: applications, recent developments, and future perspectives | |
| US7060506B2 (en) | Compositions and methods for monitoring the modification of modification dependent binding partner polypeptides | |
| Molinari et al. | Functional complementation of high-efficiency resonance energy transfer: a new tool for the study of protein binding interactions in living cells | |
| US8669074B2 (en) | Chimeric phosphorylation indicator | |
| US20200363424A1 (en) | Complex bret technique for measuring biological interactions | |
| JP2005501525A (ja) | リン酸化の蛍光比測定インディケーター | |
| US9970930B2 (en) | Drug discovery and protein-protein interaction assay using fluorescent protein exchange | |
| US11053300B2 (en) | Membrane span-kinase fusion protein and the uses thereof | |
| JP4849698B2 (ja) | タンパク質間相互作用の高感度検出方法 | |
| Wade et al. | Inhibition of protein-protein interactions: cell-based assays | |
| Dimri et al. | Dynamic monitoring of STAT3 activation in live cells using a novel STAT3 Phospho-BRET sensor | |
| WO2009087967A1 (en) | Method for detecting a protein-protein interaction | |
| De et al. | Engineering aspects of bioluminescence resonance energy transfer systems | |
| JP6785008B2 (ja) | 新規人工生物発光酵素群 | |
| US9017962B2 (en) | Intracellular reporters | |
| EP1171627A2 (en) | Assay for measuring different enzyme activities simultaneously | |
| CN119032275A (zh) | 基于与门蛋白的开关 | |
| US20080233589A1 (en) | Complementation Systems Utilizing Complexes of Heteroproteins | |
| WO2001075142A2 (en) | Protein kinase assay | |
| Maslar | Development of Endoplasmic Reticulum Targeted Probes and Red Fluorescent Probes for Detecting Zinc | |
| Ding | Design and applications of fluorescent protein-based biosensors for live cell imaging | |
| WO2013087922A1 (en) | Methods for producing engineered fluorescent proteins for enhanced fret, products and uses thereof | |
| Kostyuk et al. | imaging, Free Radical Biology and Medicine | |
| Belal | Development of new fluorescent protein biosensors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09701333 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 32PN | Ep: public notification in the ep bulletin as address of the adressee cannot be established |
Free format text: COMMUNICATION PURSUANT TO RULE 112(1) EPC |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 09701333 Country of ref document: EP Kind code of ref document: A1 |