WO2009086353A1 - Séquençage à deux amorces amélioré pour analyse d'expression de haute capacité - Google Patents
Séquençage à deux amorces amélioré pour analyse d'expression de haute capacité Download PDFInfo
- Publication number
- WO2009086353A1 WO2009086353A1 PCT/US2008/088125 US2008088125W WO2009086353A1 WO 2009086353 A1 WO2009086353 A1 WO 2009086353A1 US 2008088125 W US2008088125 W US 2008088125W WO 2009086353 A1 WO2009086353 A1 WO 2009086353A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- primer
- sequencing
- sequence
- nucleic acid
- universal
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Definitions
- the invention is in the field of molecular biology and relates to methods for nucleic acid analysis. In some aspects, the invention relates to methods of high- throughput gene expression analysis, particularly, in the context of sequencing by synthesis.
- Gene expression signatures comprised of tens of genes have been found to be predictive of disease type and patient response to therapy, and have been informative in countless experiments exploring biological mechanisms.
- High- density DNA microarrays are currently the method of choice for transcriptome analysis and represent a semi-quantitative route to signature discovery.
- gene expression signatures with diagnostic potential must be validated in large cohorts of patients, in whom measuring the entire transcriptome is neither necessary nor desirable.
- the ability to describe cellular states in terms of a gene expression signature raises the possibility of performing high- throughput, small-molecule screens using a signature of interest as a read-out. For this to be practical, one would need to be able to screen thousands of compounds per day at a cost dramatically below that of conventional microarrays.
- High-throughput genomic signature screening has been hampered by the lack of ability to quantitatively measure cellular changes in a reproducible, high- throughput manner. Since the sequencing of the human genome, new sequencing technologies have emerged that are capable of directly reading the individual sequences of single molecules of DNA or RNA, thus allowing the researchers to directly quantify the copy number for any individual gene or RNA of interest. With the advent of these high-throughput sequencing technologies, the researchers may now use quantitative RNA measurements from cell-based assays, across very large numbers of compounds, while monitoring changes in tens of thousands of genes. [0005] Nevertheless, multiplexed high-throughput sequencing still remains constrained in complexity (number of samples sequenced in parallel) and in capacity (number of sequences obtained per sample). Physical space segregation of the sequencing platform into a fixed number of channels allows only limited multiplexing. Furthermore, all currently available high-throughput sequencing platforms show a trade-off between the average sequence read length and the number of nucleic acid molecules being sequenced.
- 'barcoding in which each sample is associated with two or more uniquely designed nucleotide barcodes (unique sequence identifiers).
- the barcodes allow for independent samples to be pooled together for sequencing, with subsequent bioinformatic segregation of the sequencer output.
- 'Barcodes' have been used in several experimental contexts, for example, in sequence-tagged mutagenesis (STM) screens, where a sequence barcode acts as an identifier or type specifier in a heterogeneous cell-pool or organism-pool.
- STM barcodes are usually 20-60 nucleotides long, are selected or follow ambiguity codes, and are present as one unit or split into groups.
- nucleic acids to be sequenced are hybridized to primers that are covalently attached to a derivatized glass surface so that the resulting primer/target duplexes are individually optically resolvable (i.e., they can detected as individual molecules).
- primers that are covalently attached to a derivatized glass surface so that the resulting primer/target duplexes are individually optically resolvable (i.e., they can detected as individual molecules).
- a wash step one or more optically labeled nucleotides is/are added along with a polymerase in order to allow template-dependent sequencing-by-synthesis to occur. The process is repeated until a sufficient number of target nucleotides is determined.
- Sequencing may be conducted such that a single labeled species of nucleotides is added sequentially, or multiple species with different labels, are added at the same time.
- tSMSTM systems currently provide read lengths on the order of 25 bases, which should be enough to sequence at least two barcodes of optimal length (10-15 nt).
- properly pasting two barcodes together e.g., a well barcode and a gene barcode
- requires an intervening hybridization site which further adds 15-25 nucleotides between the barcodes, readily exceeding the available read length.
- An alternative approach that eliminates the intervening hybridization site requires a dramatically larger number of unique primers (e.g., 384 vs. 384,000), and therefore, is not practical.
- the current solution for reading two or more barcodes on tSMSTM systems is to use a "melt-and-resequence" procedure (e.g., as described in U.S. Patent No. 7,283,337).
- Melt-and-resequence requires template copying, strand melting and re-hybridization with a second primer, and the efficiencies of each step may be lower than desirable while variability, higher.
- the present invention provides a method of sequencing a nucleic acid molecule that contains two or more target regions to be sequenced (such as, for example, barcodes).
- the invention is advantageous for sequencing by synthesis two or more target regions whose combined lengths plus the length of any intermediate sequence exceeds the available read length on a given sequencing platform. This approach is suitable, for example, for reading nucleic acid barcodes. However, it may also be used for any other sequencing-by-synthesis application that requires sequencing any two or more non-contiguous regions (referred to herein as "target regions” or "target sequences”) within the same nucleic acid template.
- nucleic acid constructs By designing nucleic acid constructs in such a way as to have a different universal primer site for each target region, the need for the "melt-and-resequence" procedure is obviated, resulting in increased efficiency, accuracy, and/or speed of nucleic acid identification.
- GSSTM genomic signature sequencing
- This invention provides a process to drive the yield of multiple reads much higher.
- the present invention utilizes an unblocked first primer in conjunction with one or more reversibly blocked primers. All of such primers can be efficiently hybridized to template nucleic acids before conducting sequencing by synthesis. The primers can then be individually deblocked to allow for the subsequent rounds of sequencing, without the need of the post-sequencing primer addition.
- the invention utilizes nucleic acid constructs containing at least the following elements i) through v), arranged in the recited order in the 3'-to-5' direction: i) a complement of a first universal primer, ii) a first target sequence, iii) a polynucleotide spacer (optional), iv) a complement of a second universal primer, and v) a second target sequence.
- the first target sequence includes a sample-specific barcode sequence which identifies the source of the sample (e.g., position of sample on the plate, plate number, different treatment conditions, disease, tissue, etc.); and the second target sequence includes a gene-specific barcode identifying the gene of interest.
- the methods of the invention include at least the following steps. First, a plurality (e.g., 96, 384, 1536 or more) of biological samples is obtained, for example, for high throughput screening gene expression (GE-HTS) analysis. Each of the samples contains a plurality (e.g., 10, 100, 1000 or more) of nucleic acid constructs ("templates" or "template nucleic acids”) as described above. The samples are prepared for nucleic acid sequencing by synthesis. The first and second universal primers are hybridized to template nucleic acids, wherein one of said universal primers is reversibly blocked at the 3' end.
- GE-HTS high throughput screening gene expression
- a first round of sequencing by synthesis is performed by extension of the unblocked primer to obtain the corresponding target sequence (i.e., the first target sequence if extending the first primer and the second target sequence if extending the second primer, depending on which primer is unblocked).
- the first round of sequencing is terminated. The termination may be accomplished by an addition of a chain-terminating nucleotide to the reaction.
- the reversibly blocked primer is then deblocked.
- a second round of sequencing by synthesis is initiated—this time, by elongating the remaining universal primer, thereby sequencing a second target region.
- the initially blocked primer is the second primer. In other embodiments, the initially blocked primer is the first primer.
- template nucleic acid molecules are single-stranded and all primers are hybridized to the same strand of a template nucleic acid.
- template nucleic acids may be immobilized on a solid support, for example, with the 3'-end being tethered to the support and the 5'-end being free.
- real-time sequencing by synthesis involves the detection of fluorescently labeled nucleotides as they are incorporated into a nascent strand of DNA that is complementary to the template being sequenced.
- only one species of the labeled nucleotide is added at a time, and its location in the growing chain is detected.
- the sequential addition of all four species of labeled nucleotides is referred to as "quad.” Due to a less-than-100% incorporation efficiency, some nucleotide chains may grow slower than others.
- the first target sequence and the second universal primer sites may be separated by a "stalling" nucleotide spacer, i.e., a short nucleotide sequence having a significantly lower incorporation rate per "quad” as compared to the target sequences.
- stalling nucleotide spacer examples include homopolymeric nucleotide spacers that are 4-20 nt long.
- the invention provides a method of sequencing a nucleic acid molecule that includes the steps of: a) obtaining the plurality of template nucleic acid molecules, wherein each of the nucleic acids comprises i) through v) below arranged in the 3'-to-5' direction: i) the complement of the first universal primer, ii) a sample-specific barcode sequence (e.g., a well barcode), iii) a homopolymeric nucleotide spacer, iv) the complement of the second universal primer, and v) a gene-specific barcode sequence (e.g., a gene barcode); b) hybridizing the first and the second universal primers to the plurality of nucleic acid molecules, said second universal primer being reversibly blocked at the 3' end; c) performing sequencing by synthesis off the first universal primer thereby identifying the first barcode sequence; d) incorporating a chain-terminating nucleotide; e) de
- Figure 1 depicts one illustrative embodiment of the invention.
- Barcoded nucleic acids are converted into a single-stranded template.
- a 3'-end reversibly blocked primer for the gene barcode (GBC) is hybridized to the template at molar excess.
- the template/primer duplexes are then captured onto a solid support at their 3' ends by hybridization to a capture sequence/well barcode (WBC) primer.
- WBC capture sequence/well barcode
- the short spacer sequence after the first barcode buffers the second sequencing primer site from base additions during first round sequencing thereby enabling slow barcodes to catch up to all others without inhibiting second round sequencing.
- FIG. 2 provides an overview of a barcoding method for GE-HTS.
- Two oligonucleotide probes are designed against each transcript of interest.
- the first probe contains a first universal primer site and a target gene-specific sequence (-10-50 nt).
- the second probe contains the second target gene-specific sequence (-10-50 nt), a gene-specific barcode (GBC), and a GBC universal primer site, distinct from the site on the first probe.
- GBC gene-specific barcode
- mRNAs are captured on immobilized poly-dT.
- the pre-designed probes are then annealed to captured mRNA (or cDNA) and ligated to create a barcoded strand.
- the barcoded strand can then be amplified.
- a second set of two oligonucleotide probes one of which contains the first universal primer, while the other contains a second barcode (sample/well- specific barcode (WBC), a WBC universal primer sequence and a sequence complementary to the GBC universal primer in the GBC barcoded strand.
- WBC sample/well- specific barcode
- the mixture of the second set of oligos and annealed probe from step one is subjected to an amplification process (e.g., PCR) to create a contiguous strand containing the two barcodes.
- an amplification process e.g., PCR
- the product of this process is then subjected to methods of sequencing by synthesis to analyze the combinations of both barcodes (GBC/WBC) formed.
- Figure 3 illustrates GBC- and WBC-containing oligonucleotides that were used in the procedures described in the Example.
- the invention relates to methods of sequencing nucleic acid molecules, such as DNA and RNA, and especially, to methods of sequencing by synthesis on systems with a limited read length (e.g., less than 60-70 nts).
- the methods of the invention can be used for sequencing two or more target regions whose combined lengths plus the length of any intermediate sequence exceeds the available read length on a given sequencing platform.
- the present invention provides a method of sequencing a nucleic acid molecule that includes two or more target regions, such as, for example, barcodes that provides a rapid and cost effective way to conduct high-throughput gene expression analysis, for example, in screening a large number of compounds and/or genes with the goal of identifying a therapeutically effective compound or to provide insight into the treatment of disease.
- target regions such as, for example, barcodes that provides a rapid and cost effective way to conduct high-throughput gene expression analysis, for example, in screening a large number of compounds and/or genes with the goal of identifying a therapeutically effective compound or to provide insight into the treatment of disease.
- the invention utilizes nucleic acid constructs containing at least the following elements i) through v), arranged in the recited order in the 3'-to-5' direction: i) a complement of a first universal primer, ii) a first target sequence, iii) a polynucleotide spacer (optional), iv) a complement of a second universal primer, and v) a second target sequence.
- the invention also provides complements of the recited constructs, and reagent kits, comprising such constructs/complements and primers and other oligonucleotides for performing the method of invention.
- Figure 1 depicts one illustrative embodiment of the invention.
- Barcoded nucleic acids are converted into a single-stranded template.
- a 3'-end reversibly blocked primer for the gene barcode (GBC) is hybridized to the template at molar excess.
- the template/primer duplexes are then captured onto a solid support at their 3' ends by hybridization to a capture sequence/well barcode (WBC) primer.
- WBC capture sequence/well barcode
- the WBC is sequenced by synthesis.
- the short spacer sequence after the first barcode buffers the second sequencing primer site from base additions during first round sequencing thereby enabling slow barcodes to catch up to all others without inhibiting second round sequencing.
- terminating nucleotides ddNTPs
- the reversibly blocked primer is then deblocked, thereupon sequencing recommences from the deblocked primer into the GBC region.
- the invention provides a method of sequencing a nucleic acid molecule that comprises: a) obtaining a plurality of biological samples, each sample containing a plurality of template nucleic acid molecules, each of the template nucleic acids comprising i) through v) arranged in the recited order in the 3'-to-5' direction: i) a complement of a first universal primer, ii) a first target sequence, iii) optionally, a polynucleotide spacer, iv) a complement of a second universal primer, and v) a second target sequence; b) hybridizing the first and the second universal primers to the plurality of nucleic acid molecules, one of said universal primers being reversibly blocked at the 3' end; c) performing sequencing by synthesis by elongating the unblocked universal primer thereby identifying a corresponding target sequence; d) terminating the sequencing; e) deblocking the blocked universal primer; and f) performing sequencing by
- the reversibly blocked primer is the second primer, while in other embodiments, the reversibly blocked primer is the first primer.
- the first and the second universal primers are hybridized sequentially to the plurality of template nucleic acids.
- the first universal primer is initially hybridized to the first priming sites in the plurality of nucleic acids. Then, before the growing chain would otherwise extend into the second priming site, the first round of sequencing is terminated, e.g., by addition of a chain-terminating nucleotide (ddNTP, e.g., ddATP, ddTTP, ddCTP, ddUTP, ddGTP, or combination thereof).
- ddNTP chain-terminating nucleotide
- dNTP non-chain-terminating nucleotide
- Any nucleotide triphosphate or analog which lacks a 3'-OH and is a substrate for a polymerase may be used for this process.
- the second universal primer is then hybridized to the second priming sites in the plurality template nucleic acids.
- the first universal primer and its extension are removed before the hybridization of the second primer.
- the "second" primer can be hybridized and sequenced first while the "first" primer is blocked by a reversible blocker on the 3'end.
- the first target sequence comprises a sample- specific barcode sequence which identifies the source of the sample.
- the barcode may identify the sample, e.g., by its serial number, source, and/or location during processing (e.g., a plate-specific barcode, a batch-specific barcode, etc.). These barcodes may be indicative of the origin of the sample, different treatment conditions, disease, tissue, etc.
- the barcode may identify a compound tested in a given sample from a library of compounds.
- the barcode may correspond to the source of tissue or cells from a tissue/cell bank.
- the second target sequence comprises a gene-specific barcode sequence which identifies a gene which the nucleic acid is encoded by or from which it is obtained.
- a third, fourth, fifth, etc., target sequence can be present in the template nucleic acid being analyzed.
- Each of such target sequences may be separated in manner similar to the first and second target sequences, i.e., with an individual universal priming site, each optionally preceded by a polynucleotide spacer.
- the third and subsequent barcodes if any, may identify any of the above parameters, similarly to the first and second barcode.
- Use of multiple barcodes to encode the identity of a sample may be advantageous as it allows one to reduce the number of starting oligonucleotides.
- the first barcode may identify the sample position on a plate, while the second barcode may identify the plate number. The exact order of such barcodes relative to each other is not essential.
- barcode refers to known nucleic acid sequences that are specifically added to naturally occurring sequences to serve as unique identifiers of the sequence identity, origin, or source. Examples of barcodes are described, for example, in Shoemaker et al. (1996) Nature Genetics, 14:450; Parameswaran et al. (2007) Nucleic Acids Res., 35:e130; and in the Example. Barcodes are typically less than 20-nucleotides long and are designed to be maximally different yet still retain similar hybridization properties to facilitate simultaneous analysis on high-density oligonucleotide arrays.
- a barcode used in the methods of the invention may be, for example, 4-25, 6-18, 8-14, or 10-12 nts long. Desirable barcode sequences have no homopolymers (2 or more of the same base in a row), have sequence edit distances greater than 2 or more bases apart in the encoded barcode (so that the barcodes are error tolerant, i.e., sequencing-by-synthesis process reading errors do not convert a barcode from one to another), and have sequences which are normalized for growth rate in the sequencing-by-synthesis process (ideally, between 1.2-1.6 bases decoded per quad).
- Figure 2 provides an overview of barcoding for GSS.
- two oligonucleotides are designed against each transcript/gene of interest.
- the first oligonucleotide contains a "Universal Primer site” and a gene-specific half (-20 nt).
- the second contains another gene-specific half (-20 nt), a gene-specific barcode (GBC), and a "GBC primer” site, distinct from the priming site on the first probe.
- mRNAs (or cDNAs) are captured on immobilized poly-dT ("RNA Catcher Plate”).
- the pre-designed primers are then annealed to captured mRNA (or cDNA) and ligated to create a barcoded strand.
- the barcoded strand can be amplified by PCR or another amplification method.
- a second set of two oligonucleotides one of which is "Universal Primer"
- the other contains a second barcode (sample/well-specific barcode (WBC)) and a Universal Well Barcode Primer.
- WBC sample/well-specific barcode
- the second set of probes is then annealed to the barcoded strand and amplified by PCR or another amplification method to create a final strand with the two barcodes.
- WBC sample/well-specific barcode
- a primer is a short, synthetic, single-stranded DNA molecule of known sequence, typically 18-40 bases long, which anneals to its complementary sequence ("priming site") on the template nucleic acid and allows a polymerase to initiate replication.
- the term "universal primer,” as used herein, refers to a primer common to a plurality of nucleic acids being analyzed. For example, all or a subset (e.g., 10%, 20%, 30%, 40% 50%, 60%, 70%, 80%, 90%, or more) of all nucleic acids in the sample may share the identical universal priming site, allowing for the simultaneous synthesis of the different nucleic acids in the sample using a single universal primer.
- the primers consist of at least 16, 17, 18, 19, 20, 21 , 22, 23, 24, 26, 28, 30 or more nucleotides.
- Nonlimiting examples of commonly used universal primers can be found in, for example, Messing (2001 ) Methods MoI. Biol. 167:13-31 ; and in Alphey, DNA Sequencing (Introduction to BioTechniques), p. 28, Garland Science; 1st edition (1997); see also Table 1 below (note that the exact sequences of the exemplified primers may vary slightly from those shown in the table.).
- the primers are selected from the primers listed in Table 1 and their complementary sequences.
- the primers comprise at least, for example, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 26, 28, or 30 nucleotides of any one of the primers listed in Table 1 and their complementary sequences.
- the primers are selected from T3 and RG2 (including their complements).
- the first and the second primer are less than 70%, 60%, 50%, 40%, 30%, identical to each other.
- the primer may contain a detectable label, e.g., florescent labels such as Cy5 (red) or Cy3 (green), or other labels as described in the General Considerations section.
- a detectable label e.g., florescent labels such as Cy5 (red) or Cy3 (green), or other labels as described in the General Considerations section.
- the primer presence of labels aids in determining location of a primer as well as efficiency of primer hybridization.
- the hybridization efficiency for the second primer might be monitored using either a noncleavable green dye on platforms with multicolor capabilities or by a red cleavable dye on the primer for a one-color system.
- sets of barcodes and the corresponding primers are developed to minimize self-hybridization into hairpin structures and cross- hybridization with both each other and other components of the reaction mixtures, including the target sequences and sequences on the larger nucleic acid sequences outside of the target sequences (e.g., to sequences within genomic DNA).
- the primers designed may be compared to the known sequences in the template nucleic acid, to avoid hybridization of the priming sites and barcodes to gene-derived portions of the nucleic acids.
- primers and barcodes for use in detecting nucleotides in human genomic DNA can be "BLASTed" against human GenBank sequences, e.g., at www.ncbi.nlm.nih.gov.
- GenBank sequences e.g., at www.ncbi.nlm.nih.gov.
- one of the primers can be used as a universal capture sequence.
- the primer may be covalently bound to a solid support, on which the template nucleic acid is immobilized by hybridization to the primer.
- Table 1 Examples of Universal Primers
- the reversibly blocked primers can be blocked with different chemical groups. By choosing the appropriate method of deblocking, one primer may be deblocked without affecting the blocking groups of the other primers.
- the blocking group is -PO 4 .
- the second primer is blocked by PO 4 and deblocking is accomplished by polynucleotide kinase (e.g., T4 PNK, by utilizing its 3'-phosphatase activity) or calf-intestinal alkaline phosphatase (CIAP) or any suitable phosphatase.
- the blocking group is a thio group or a phosphorothiol group.
- the primer may blocked by a sequence of 5'- NUX-3' wherein N represents an oligonucleotide sequence of any length, U is uracil, and X is a dideoxy-nucleotide.
- the reversibly blocked primer may be deblocked by Uracil DNA glycosylase and AP endonuclease to generate an deblocked primer with an extendable 3' end.
- At least one reversibly blocked primer may comprise a sequence of 5'-NYZ-3' wherein N represents an oligonucleotide sequence of any length, Y is a modified nucleotide, and Z represents a single nucleotide base; and wherein the modified nucleotide can be deblocked by formamidopyhmidine (fapy)-DNA glycosylase.
- This modified base can be, e.g., 8- oxoguanine, 8-oxoadenine, fapy-guanine, methyl-fapy-guanine, fapy-adenine, aflatoxin Brfapy-guanine, 5-hydroxy cytosine and 5-hydroxy-uracil.
- the second primer may have multiple (1 -3 or more) mismatched bases on the 3'-end, and the primer is deblocked by incubation with an editing enabled polymerase, exo+, which removes the mismatched bases.
- an editing enabled polymerase exo+
- One may use a flap endonuclease and a short oligo probe which cleaves off the overhanging base to produce a polymerase-competent primer.
- real-time sequencing is used.
- only one species of the optically labeled nucleotide is added at a time, and its location in the growing chain is detected.
- various chains may grow at different rates, it might be necessary to allow slow-growing chains to "catch-up" before the first sequencing round is terminated.
- the first target sequence and the second universal primer sites can be separated by a "stalling" nucleotide spacer, which is a short nucleotide sequence that has a significantly lower incorporation rate per "quad” as compared to the target sequences.
- spacers examples include homopolymeric nucleotide spacers that are, for example, 4-20, 4-16, 4-12, 4-10, 4-8, or 4-6 nts long. However, spacers containing multiple nucleotide species can also be used so long as their "per quad" incorporation rate is lower than that of the first target sequence.
- the spacer is selected from polyA, polyC, polyT, polyG, or polyU. In certain embodiments, the spacer is AAAAA. Other mechanisms, such as non-sequencable abasic polynucleotide spacers, can also be also used.
- Methods of the invention are particularly suitable for gene expression analysis in high-throughput screens (GE-HTS) that involve assaying multiple samples and multiple gene transcripts.
- GE-HTS high-throughput screens
- the samples may represent different treatment conditions (e.g., test compounds from a chemical library), tissue or cell types, or source (e.g., blood, urine, cerebrospinal fluid, seminal fluid, saliva, sputum, stool), etc.
- Each of the samples may contain a plurality (e.g., 10, 50, 100, 500, 1000, or more) of nucleic acid constructs in accordance with the present invention.
- each construct may represent a gene transcript whose expression level is being measured.
- Nucleic acids to be analyzed may come from a variety of sources.
- nucleic acids can be naturally occurring DNA or RNA (e.g., mRNA or non- coding RNA) isolated from any source, recombinant molecules, cDNA, or synthetic analogs.
- nucleic acids may include whole genes, gene fragments, exons, introns, regulatory elements (such as promoters, enhancers, initiation and termination regions, expression regulatory factors, expression controls, and other control regions), DNA comprising one or more single-nucleotide polymorphisms (SNPs), allelic variants, other mutations.
- SNPs single-nucleotide polymorphisms
- Nucleic acids may also include tRNA, rRNA, ribozymes, splice variants, antisense RNA, or siRNA.
- Nucleic acids may be obtained from whole organisms, organs, tissues, or cells from different stages of development, differentiation, or disease state, and from different species (human and non-human, including bacteria, fungus, and viral proteins).
- Various methods for extraction of nucleic acids from biological samples are known (see, e.g., Nucleic Acids Isolation Methods, Bowein (ed.), American Scientific Publishers (2002)).
- genomic DNA is obtained from nuclear extracts that are subjected to mechanical shearing to generate random long fragments.
- genomic DNA may be extracted from tissue or cells using a Qiagen DNeasy Blood & Tissue kit following the manufacturer's protocol.
- nucleic acid can be extracted from a biological sample by a variety of techniques such as those described by Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY, pp. 280-281 (1982). Nucleic acid obtained from biological samples typically is fragmented to produce suitable fragments for analysis. In one embodiment, nucleic acid from a biological sample is fragmented by sonication. Nucleic acid template molecules can be obtained as described in U.S. Patent Application Publication 2002/0190663.
- Methods of the inventions can be used in the context of sequencing by synthesis.
- the invention is advantageous for high throughput sequencing platforms, particularly, sequencing by synthesis, where two or more target regions within the same template need to be sequenced. However, their combined lengths plus the length of any intermediate sequence exceeds the available read length on a given sequencing platform.
- the sequencing platforms used in the methods of the present invention have one or more of the following features:
- the average available read length is 50, 40, 30, 25, or 20 or fewer nucleotides
- sequencing-by-ligation is utilized (e.g., SOLiD);
- pyrophosphate detection is utilized (e.g., Roche/454);
- the invention provides a method of determining a nucleic acid copy number, comprising capturing an unamplified target nucleic acid onto a solid surface using methods of the invention and determining the number of the captured target nucleic acids, for example, by reference to a known control.
- Heliscope is the only one of the four systems that provides true single-molecule sequencing (tSMSTM), thus eliminating amplification artifacts such as errors or bias.
- the methods of the invention are practiced on tSMSTM system.
- a plurality of nucleic acid molecules being sequenced is bound to a solid support.
- a "capture sequence" can be added, for example, at the 3' end of the template.
- the nucleic acids are bound to the solid support by hybridizing the capture sequence to a complementary sequence covalently attached to the solid support.
- the capture sequence also referred to as a universal capture sequence, is a nucleic acid sequence complimentary to a sequence attached to a solid support that may also serve as a universal primer.
- the capture sequence is poly/Vn, wherein N is U, A, T, G, or C, n>5, e.g., 20-70, 40-60, e.g., about 50.
- the capture sequence could be polyT 40- 5o or its complement.
- a member of a coupling pair (such as, e.g., antibody/antigen, receptor/I igand, or the avidin-biotin pair as described in, e.g., U.S. Patent Application No. 2006/0252077) may be linked to each fragment to be captured on a surface coated with a respective second member of that coupling pair.
- a coupling pair such as, e.g., antibody/antigen, receptor/I igand, or the avidin-biotin pair as described in, e.g., U.S. Patent Application No. 2006/0252077
- the solid support may be, for example, a glass surface such as described in, e.g., U.S. Patent App. Pub. No. 2007/0070349.
- the surface may be coated with an epoxide, polyelectrolyte multilayer, or other coating suitable to bind nucleic acids.
- the surface is coated with epoxide and a complement of the capture sequence is attached via an amine linkage.
- the surface may be dehvatized with avidin or streptavidin, which can be used to attach to a biotin-bearing target nucleic acid.
- other coupling pairs such as antigen/antibody or receptor/I igand pairs, may be used.
- the surface may be passivated in order to reduce background. Passivation of the epoxide surface can be accomplished by exposing the surface to a molecule that attaches to the open epoxide ring, e.g., amines, phosphates, and detergents.
- a molecule that attaches to the open epoxide ring e.g., amines, phosphates, and detergents.
- the sequence may be analyzed, for example, by single molecule detection/sequencing, e.g., as described in the Example and in U.S. Patent No. 7,283,337, including template-dependent sequencing-by-synthesis.
- sequencing-by-synthesis the surface-bound molecule is exposed to a plurality of labeled nucleotide triphosphates in the presence of polymerase.
- the sequence of the template is determined by the order of labeled nucleotides incorporated into the 3' end of the growing chain. This can be done in real time or can be done in a step-and-repeat mode. For real-time analysis, different optical labels to each nucleotide may be incorporated and multiple lasers may be utilized for stimulation of incorporated nucleotides.
- Nucleotides useful in the invention include any nucleotide or nucleotide analog, whether naturally occurring or synthetic.
- preferred nucleotides include phosphate esters of deoxyadenosine, deoxycytidine, deoxyguanosine, deoxythymidine, adenosine, cytidine, guanosine, and uridine.
- nucleotides useful in the invention comprise an adenine, cytosine, guanine, thymine base, a xanthine or hypoxanthine; 5-bromouracil, 2-aminopurine, deoxyinosine, or methylated cytosine, such as 5-methyl cytosine, and N4-methoxydeoxycytosine.
- bases of polynucleotide mimetics such as methylated nucleic acids, e.g., 2'-O-methRNA, peptide nucleic acids, modified peptide nucleic acids, locked nucleic acids and any other structural moiety that can act substantially like a nucleotide or base, for example, by exhibiting base-complementarity with one or more bases that occur in DNA or RNA and/or being capable of base-complementary incorporation, and includes chain-terminating analogs.
- a nucleotide corresponds to a specific nucleotide species if they share base-complementarity with respect to at least one base.
- Nucleotides for nucleic acid sequencing according to the invention preferably comprise a detectable label that is directly or indirectly detectable.
- Preferred labels include optically-detectable labels, such as fluorescent labels.
- fluorescent labels include, but are not limited to, 4-acetamido-4'- isothiocyanatostilbene-2,2'disulfonic acid; acridine and derivatives: acridine, achdine isothiocyanate; 5-(2'-aminoethyl)aminonaphthalene-1 -sulfonic acid (EDANS); 4- amino-N-[3-vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate; N-(4-anilino-1 - naphthyl)maleimide; anthranilamide; BODIPY; Brilliant Yellow; coumahn and derivatives; coumahn, 7-amino-4-methylcoumarin (AMC, Coumarin 120
- Nucleic acid polymerases generally useful in the invention include DNA polymerases, RNA polymerases, reverse transcriptases, and mutant or altered forms of any of the foregoing. DNA polymerases and their properties are described in detail in, among other places, DNA Replication 2nd edition, Komberg and Baker, W. H. Freeman, New York, N.Y. (1991 ).
- Known conventional DNA polymerases useful in the invention include, but are not limited to, Pyrococcus furiosus (Pfu) DNA polymerase (Lundberg et al.
- Thermophilic DNA polymerases include, but are not limited to, ThermoSequenase®, 9°N®, Therminator®, Taq, Tne, Tma, Pfu, TfI, Tth, TIi, Stoffel fragment, Vent® and Deep Vent® DNA polymerase, KOD DNA polymerase, Tgo, JDF-3, and mutants, variants and derivatives thereof.
- Reverse transcriptases useful in the invention include, but are not limited to, reverse transcriptases from HIV, HTLV-1 , HTLV-II, FeLV, FIV, SIV, AMV, MMTV, MoMuLV and other retroviruses (see Levin (1997) Cell, 88:5-8; Verma (1977) Biochim. Biophys. Acta, 473:1 -38; Wu et al. (1975) CRC Crit. Rev. Biochem., 3:289-347).
- nucleic acid template molecules are attached to a solid support ("substrate").
- substrate e.g., a glass slide
- Substrates for use in the invention can be two-or three-dimensional and can comprise a planar surface (e.g., a glass slide) or can be shaped.
- a substrate can include glass (e.g., controlled pore glass (CPG)), quartz, plastic (such as polystyrene (low cross-linked and high cross-linked polystyrene), polycarbonate, polypropylene and poly(methymethacrylate)), acrylic copolymer, polyamide, silicon, metal (e.g., alkanethiolate-derivatized gold), cellulose, nylon, latex, dextran, gel matrix (e.g., silica gel), polyacrolein, or composites.
- CPG controlled pore glass
- plastic such as polystyrene (low cross-linked and high cross-linked polystyrene), polycarbonate, polypropylene and poly(methymethacrylate)
- acrylic copolymer polyamide
- silicon e.g., metal (e.g., alkanethiolate-derivatized gold)
- cellulose e.g., nylon, latex, dextran, gel matrix (e.g.
- Suitable three-dimensional substrates include, for example, spheres, microparticles, beads, membranes, slides, plates, micromachined chips, tubes (e.g., capillary tubes), microwells, microfluidic devices, channels, filters, or any other structure suitable for anchoring a nucleic acid.
- Substrates can include planar arrays or matrices capable of having regions that include populations of template nucleic acids or primers. Examples include nucleoside-derivatized CPG and polystyrene slides; derivatized magnetic slides; polystyrene grafted with polyethylene glycol, and the like.
- a substrate is coated to allow optimum optical processing and nucleic acid attachment.
- Substrates for use in the invention can also be treated to reduce background.
- Exemplary coatings include epoxides, and derivatized epoxides (e.g., with a binding molecule, such as streptavidin).
- the surface can also be treated to improve the positioning of attached nucleic acids (e.g., nucleic acid template molecules, primers, or template molecule/primer duplexes) for analysis.
- a surface according to the invention can be treated with one or more charge layers (e.g., a negative charge) to repel a charged molecule (e.g., a negatively charged labeled nucleotide).
- a substrate according to the invention can be treated with polyallylamine followed by polyacrylic acid to form a polyelectrolyte multilayer.
- the carboxyl groups of the polyacrylic acid layer are negatively charged and thus repel negatively charged labeled nucleotides, improving the positioning of the label for detection.
- Coatings or films applied to the substrate should be able to withstand subsequent treatment steps (e.g., photoexposure, boiling, baking, soaking in warm detergent-containing liquids, and the like) without substantial degradation or disassociation from the substrate.
- substrate coatings include, vapor phase coatings of 3- aminopropyltrimethoxysilane, as applied to glass slide products, for example, from Erie Glass (Portsmouth, NH).
- hydrophobic substrate coatings and films aid in the uniform distribution of hydrophilic molecules on the substrate surfaces.
- the coatings or films that are substantially non-interfering with primer extension and detection steps are preferred.
- it is preferable that any coatings or films applied to the substrates either increase template molecule binding to the substrate or, at least, do not substantially impair template binding.
- Various methods can be used to anchor or immobilize the primer to the surface of the substrate.
- the immobilization can be achieved through direct or indirect bonding to the surface.
- the bonding can be by covalent linkage. See, Joos et al. (1997) Analytical Biochemistry, 247:96-101 ; Oroskar et al. (1996) Clin. Chem., 42:1547-1555; and Khandjian (1986) MoI. Bio. Rep., 11 :107-11.
- a preferred attachment is direct amine bonding of a terminal nucleotide of the template or the primer to an epoxide integrated on the surface.
- the bonding also can be through non-covalent linkage. For example, biotin-streptavidin (Taylor et al. (1991 ) J. Phys. D: Appl.
- any detection method may be used that is suitable for the type of label employed.
- exemplary detection methods include radioactive detection, optical absorbance detection, e.g., UV-visible absorbance detection, optical emission detection, e.g., fluorescence or chemiluminescence.
- extended primers can be detected on a substrate by scanning all or portions of each substrate simultaneously or serially, depending on the scanning method used.
- fluorescence labeling selected regions on a substrate may be serially scanned one- by-one or row-by-row using a fluorescence microscope apparatus, such as described in Fodor (U.S. Pat. No. 5,445,934) and Mathies et al. (U.S. Pat. No. 5,091 ,652).
- Hybridization patterns may also be scanned using a CCD camera (e.g., Model TE/CCD512SF, Princeton Instruments, Trenton, NJ) with suitable optics (Ploem, in Fluorescent and Luminescent Probes for Biological Activity, Mason (ed.), Academic Press, Landon, pp. 1-11 (1993), such as described in Yershov et al. (1996) Proc. Natl. Acad. Sci., 93:4913, or may be imaged by TV monitoring.
- a PhosphorlmagerTM device can be used (Johnston et al.
- Electrophoresis 13:566; Drmanac et al. (1992) Electrophoresis, 13:566).
- Other commercial suppliers of imaging instruments include General Scanning Inc., (Watertown, MA; genscan.com), Genix Technologies (Waterloo, Ontario, Canada; confocal.com), and Applied Precision Inc. Such detection methods are particularly useful to achieve simultaneous scanning of multiple attached template nucleic acids.
- Optical setups include near-field scanning microscopy, far-field confocal microscopy, wide-field epi- illumination, light scattering, dark field microscopy, photoconversion, single and/or multiphoton excitation, spectral wavelength discrimination, fluorophore identification, evanescent wave illumination, and total internal reflection fluorescence (TIRF) microscopy.
- TIRF total internal reflection fluorescence
- certain methods involve detection of laser-activated fluorescence using a microscope equipped with a camera.
- Suitable photon detection systems include, but are not limited to, photodiodes and intensified CCD cameras.
- an intensified charge couple device (ICCD) camera can be used.
- ICCD intensified charge couple device
- the use of an ICCD camera to image individual fluorescent dye molecules in a fluid near a surface provides numerous advantages. For example, with an ICCD optical setup, it is possible to acquire a sequence of images (movies) of fluorophores.
- TIRF microscopy uses totally internally reflected excitation light and is well known in the art. See, e.g., nikon- instruments.jp/eng/page/products/tirf.aspx.
- detection is carried out using evanescent wave illumination and total internal reflection fluorescence microscopy.
- An evanescent light field can be set up at the surface, for example, to image fluorescently-labeled nucleic acid molecules.
- the optical field does not end abruptly at the reflective interface, but its intensity falls off exponentially with distance.
- This surface electromagnetic field called the "evanescent wave”
- the evanescent wave can selectively excite fluorescent molecules in the liquid near the interface.
- the thin evanescent optical field at the interface provides low background and facilitates the detection of single molecules with high signal-to-noise ratio at visible wavelengths.
- the evanescent field also can image fluorescently-labeled nucleotides upon their incorporation into the attached template/primer complex in the presence of a polymerase. Total internal reflectance fluorescence microscopy is then used to visualize the attached template/primer duplex and/or the incorporated nucleotides with single molecule resolution.
- Epoxide-coated glass slides are prepared for oligo attachment.
- Epoxide-functionalized 40 mm diameter #1.5 glass cover slips (slides) are obtained from Erie Scientific (Salem, NH).
- the slides are preconditioned by soaking in 3x SSC for 15 minutes at 37°C.
- a 500-pM aliquot of 5' aminated oligonucleotide (TCCACTTATCCTTGCATCCATCCTCTGCCCTG (SEQ ID NO:32)) is incubated with each slide for 30 minutes at room temperature in a volume of 80 ml.
- the slides are then treated with phosphate (1 M) for 4 hours at room temperature in order to passivate the surface.
- Slides are then stored in 20 mM Tris, 100 mM NaCI, 0.001 % Triton X-100, pH 8.0 at 4°C until they are used for sequencing.
- the slide is placed in a modified FCS2 flow cell (Bioptechs, Butler, PA) using a 50- ⁇ m thick gasket.
- the flow cell is placed on a movable stage that is part of a high-efficiency fluorescence imaging system built based on a Nikon TE-2000 inverted microscope equipped with a total internal reflection (TIR) objective.
- TIR total internal reflection
- An aliquot of the synthetic oligonucleotides (examples of sequences are provided as SEQ ID NOs:33-42 and in Figure 3) designed to mimic the PCR product of the Genome Signature Sequencing (GSSTM) process is diluted in 3x SSC to a final concentration of 200 pM (each). A 100- ⁇ l aliquot is placed in the flow cell and incubated on the slide for 15 minutes. After incubation, the flow cell is rinsed with 1x SSC/HEPES/0.1 % SDS followed by HEPES/NaCI. A passive vacuum apparatus is used to pull fluid across the flow cell.
- the resulting slide contains tends of thousands of GSSTM oligonucleotides/phmer template duplexes randomly bound to the glass surface.
- the temperature of the flow cell is then reduced to 37°C for sequencing and the objective is brought into contact with the flow cell.
- cytosine triphosphate, guanidine triphosphate, adenine triphosphate, and uracil triphosphate are stored separately in buffer containing 20 mM Tris-HCI, pH 8.8, 50 ⁇ M MnSO 4 , 10 mM (NH4) 2 SO 4 , 10 mM HCI, and 0.1 % Triton X-100, and 50 U Klenow exo " polymerase (NEB). Sequencing proceeds as follows.
- initial imaging is used to determine the positions of DNA duplexes on the epoxide surface.
- the Cy3 label attached to the synthetic oligo fragments is imaged by excitation using a laser tuned to 532 nm radiation (Verdi V-2 Laser, Coherent, Santa Clara, CA) in order to establish duplex position. For each slide only single fluorescent molecules that are imaged in this step are counted. Imaging of incorporated nucleotides as described below is accomplished by excitation of a cyanine-5 dye using a 635-nm radiation laser (Coherent). 100 nM Cy5-CTP is placed into the flow cell and exposed to the slide for 2 minutes.
- SSC/HEPES/SDS 1x SSC/15 mM HEPES/0.1 % SDS/pH 7.0
- HEPES/NaCI 150 mM HEPES/150 mM NaCI/pH 7.0
- An oxygen scavenger containing 30% acetonithle and scavenger buffer (134 ⁇ l 150 mM HEPES/100 mMNaCI, 24 ⁇ l 100 mM Trolox in 150 mM MES, pH 6.1 , 10 ⁇ l 100 mM DABCO in 150 mM MES, pH 6.1 , 8 ⁇ l 2M glucose, 20 ⁇ l 50 mM NaI, and 4 ⁇ l glucose oxidase (USB) is next added.
- the slide is then imaged (100 frames) for 250 milliseconds using an Inova 301 K laser (Coherent) at 647 nm, followed by green imaging with a Verdi V-2 laser (Coherent) at 532 nm for 2 seconds to confirm duplex position. The positions having detectable fluorescence are recorded. After imaging, the flow cell is rinsed 5 times each with SSC/HEPES/SDS (60 ⁇ l) and HEPES/NaCI (60 ⁇ l).
- the cyanine-5 label is cleaved off incorporated CTP by introduction into the flow cell of 50 mM TCEP/250 mM Tris, pH 7.6/100 mM NaCI for 5 minutes, after which the flow cell is rinsed 5 times each with SSC/HEPES/SDS (60 ⁇ l) and HEPES/NaCI (60 ⁇ l).
- the remaining nucleotide is capped with 50 mM iodoacetamide/I OOmM Tris, pH 9.0/100 mM NaCI for 5 minutes followed by rinsing 5 times each with SSC/HEPES/SDS (60 ⁇ l) and HEPES/NaCI (60 ⁇ l).
- the scavenger is applied again in the manner described above, and the slide is again imaged to determine the effectiveness of the cleave/cap steps and to identify non-incorporated fluorescent objects.
- the image stack data i.e., the single-molecule sequences obtained from the various surface-bound duplex
- the individual single molecule sequence read lengths obtained range from 2 to 16 consecutive nucleotides with about 12.6 consecutive nucleotides being the average length and only those greater than 9 bases in length with less than 2 errors where used in the final analysis.
- the sequencing products of the first barcode are terminated using 10 ⁇ M ddNTPs and TherminatorTM (NEB) for 15 min at 45° using TherminatorTM buffer provided by the manufacturer.
- the flow cell is rinsed using HEPES/0.5 M NaCI to remove the polymerase and ddNTPs from the system. Additional rinses are performed with standard HEPES/NaCI.
- the second primer (CGACATCGCACGAATAGACGGCACTCAGAC (SEQ ID NO:43) which has a 5'-cleavable Cy5 is diluted in 3x SSC to a final concentration of 1 nM.
- a 100- ⁇ l aliquot is placed in the flow cell and incubated on the slide for 15 minutes at 37°C. After incubation, the flow cell is rinsed with 1x SSC/HEPES/0.1 % SDS followed by HEPES/NaCI.
- a passive vacuum apparatus is used to pull fluid across the flow cell.
- the sequencing process is repeated as previously described except the first picture taken was a red image since the second primer is labeled with a cleavable Cy5 dye. Following imaging, the cleavable red dye is removed and capped using TCEP and iodoacetamide solutions and cycles of C, U, A , and G are performed as previous (40 total cycles). [0076] Once the desired number of cycles is completed, the image stack data (i.e., the single-molecule sequences obtained from the various surface-bound duplex) are aligned to the reference sequence. The individual single molecule sequence read lengths obtained range from 2 to 16 consecutive nucleotides with about 12.6 consecutive nucleotides being the average length and only those greater than 9 bases in length with less than 2 errors are used in the final analysis.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
L'invention concerne un procédé de séquençage d'une molécule d'acide nucléique qui contient deux régions cibles ou plus à séquencer (telles que, par exemple, des code-barres). L'invention est avantageuse pour séquencer par synthèse deux régions cibles ou plus dont les longueurs combinées plus la longueur de toute séquence intermédiaire dépasse la longueur de lecture disponible sur une plate-forme de séquençage donnée. Les procédés de l'invention utilisent des constructions d'acides nucléiques contenant au moins l'un des éléments suivants : un complément d'une première amorce universelle, une première séquence cible, un espaceur de polynucléotide facultatif, un complément d'une seconde amorce universelle, et une seconde séquence cible. Les deux amorces universelles sont hybridées sur les acides nucléiques de matrice, toutefois, l'une des amorces universelles est bloquée de manière réversible. Une première campagne de séquençage par synthèse est effectuée pour séquencer par allongement l'amorce universelle non bloquée. Une fois la séquence d'une région cible obtenue, la première campagne de séquençage est terminée. Ensuite, l'amorce restante est débloquée, et une seconde campagne de séquençage par synthèse est conduite pour séquencer une seconde région cible.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US96406307A | 2007-12-26 | 2007-12-26 | |
US11/964,063 | 2007-12-26 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2009086353A1 true WO2009086353A1 (fr) | 2009-07-09 |
Family
ID=40824713
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2008/088125 WO2009086353A1 (fr) | 2007-12-26 | 2008-12-23 | Séquençage à deux amorces amélioré pour analyse d'expression de haute capacité |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2009086353A1 (fr) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20180014054A (ko) * | 2015-07-30 | 2018-02-07 | 일루미나, 인코포레이티드 | 뉴클레오타이드의 직교 비블록화 |
US20190119742A1 (en) * | 2016-04-07 | 2019-04-25 | Omniome, Inc. | Methods of quantifying target nucleic acids and identifying sequence variants |
Citations (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5552278A (en) * | 1994-04-04 | 1996-09-03 | Spectragen, Inc. | DNA sequencing by stepwise ligation and cleavage |
US5807669A (en) * | 1992-05-11 | 1998-09-15 | Schuepbach; Joerg | Process for the detection of reverse transcriptase |
US6613513B1 (en) * | 1999-02-23 | 2003-09-02 | Caliper Technologies Corp. | Sequencing by incorporation |
US20040132050A1 (en) * | 2002-07-19 | 2004-07-08 | Althea Technologies, Inc. | Strategies for gene expression analysis |
US6838243B2 (en) * | 2000-04-28 | 2005-01-04 | Quantum Dot Corporation | Methods and compositions for polynucleotide analysis using generic capture sequences |
US20050170373A1 (en) * | 2003-09-10 | 2005-08-04 | Althea Technologies, Inc. | Expression profiling using microarrays |
US20060024711A1 (en) * | 2004-07-02 | 2006-02-02 | Helicos Biosciences Corporation | Methods for nucleic acid amplification and sequence determination |
US20060252060A1 (en) * | 2000-10-24 | 2006-11-09 | Willis Thomas D | Direct multiplex characterization of genomic DNA |
-
2008
- 2008-12-23 WO PCT/US2008/088125 patent/WO2009086353A1/fr active Application Filing
Patent Citations (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5807669A (en) * | 1992-05-11 | 1998-09-15 | Schuepbach; Joerg | Process for the detection of reverse transcriptase |
US5552278A (en) * | 1994-04-04 | 1996-09-03 | Spectragen, Inc. | DNA sequencing by stepwise ligation and cleavage |
US6613513B1 (en) * | 1999-02-23 | 2003-09-02 | Caliper Technologies Corp. | Sequencing by incorporation |
US6838243B2 (en) * | 2000-04-28 | 2005-01-04 | Quantum Dot Corporation | Methods and compositions for polynucleotide analysis using generic capture sequences |
US20060252060A1 (en) * | 2000-10-24 | 2006-11-09 | Willis Thomas D | Direct multiplex characterization of genomic DNA |
US20040132050A1 (en) * | 2002-07-19 | 2004-07-08 | Althea Technologies, Inc. | Strategies for gene expression analysis |
US20050170373A1 (en) * | 2003-09-10 | 2005-08-04 | Althea Technologies, Inc. | Expression profiling using microarrays |
US20060024711A1 (en) * | 2004-07-02 | 2006-02-02 | Helicos Biosciences Corporation | Methods for nucleic acid amplification and sequence determination |
Cited By (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20180014054A (ko) * | 2015-07-30 | 2018-02-07 | 일루미나, 인코포레이티드 | 뉴클레오타이드의 직교 비블록화 |
CN107771223A (zh) * | 2015-07-30 | 2018-03-06 | 亿明达股份有限公司 | 核苷酸的正交去封闭 |
JP2018518947A (ja) * | 2015-07-30 | 2018-07-19 | イラミーナ インコーポレーテッド | ヌクレオチドのオルトゴナルな脱ブロッキング |
KR102189965B1 (ko) * | 2015-07-30 | 2020-12-11 | 일루미나, 인코포레이티드 | 뉴클레오타이드의 직교 디블로킹 |
RU2742955C2 (ru) * | 2015-07-30 | 2021-02-12 | Иллюмина, Инк. | Ортогональное деблокирование нуклеотидов |
EP3329007B1 (fr) * | 2015-07-30 | 2021-02-24 | Illumina, Inc. | Déblocage orthogonal de nucléotides |
US11155864B2 (en) | 2015-07-30 | 2021-10-26 | Illumina, Inc. | Orthogonal deblocking of nucleotides |
CN107771223B (zh) * | 2015-07-30 | 2022-03-22 | 亿明达股份有限公司 | 核苷酸的正交去封闭 |
CN114634976A (zh) * | 2015-07-30 | 2022-06-17 | 亿明达股份有限公司 | 核苷酸的正交去封闭 |
US20190119742A1 (en) * | 2016-04-07 | 2019-04-25 | Omniome, Inc. | Methods of quantifying target nucleic acids and identifying sequence variants |
US11326206B2 (en) * | 2016-04-07 | 2022-05-10 | Pacific Biosciences Of California, Inc. | Methods of quantifying target nucleic acids and identifying sequence variants |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20090163366A1 (en) | Two-primer sequencing for high-throughput expression analysis | |
US7767400B2 (en) | Paired-end reads in sequencing by synthesis | |
EP3615671B1 (fr) | Compositions et procédés permettant d'améliorer l'identification d'échantillons dans des bibliothèques d'acides nucléiques indexés | |
EP2007908B1 (fr) | Procede pour augmenter la precision du sequencage d'acide nucleique | |
US20150159210A1 (en) | Methods for Increasing Accuracy of Nucleic Acid Sequencing | |
WO2007014397A2 (fr) | Sequençage monomoleculaire de bases consecutives | |
EP2247741A2 (fr) | Eléments de lecture à extrémités appariées dans le séquençage par synthèse | |
WO2010056728A1 (fr) | Analyse multiplexée d’acides nucléiques codants | |
US20090305248A1 (en) | Methods for increasing accuracy of nucleic acid sequencing | |
US20130344540A1 (en) | Methods for minimizing sequence specific bias | |
WO2011034690A2 (fr) | Marqueurs de centroïde pour une analyse d'image de clusters haute densité dans un séquençage de polynucléotide complexe | |
US20080138804A1 (en) | Buffer composition | |
US20090226906A1 (en) | Methods and compositions for reducing nucleotide impurities | |
WO2009086353A1 (fr) | Séquençage à deux amorces amélioré pour analyse d'expression de haute capacité | |
US20090226900A1 (en) | Methods for Reducing Contaminants in Nucleic Acid Sequencing by Synthesis | |
US20060263790A1 (en) | Methods for improving fidelity in a nucleic acid synthesis reaction | |
WO2009085328A1 (fr) | Molécules et procédés pour le séquençage d'un acide nucléique | |
WO2010096532A1 (fr) | Séquençage de petites quantités d'acides nucléiques |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08866833 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 08866833 Country of ref document: EP Kind code of ref document: A1 |