WO2009080779A1 - Ceacam1 servant de biomarqueur du psoriasis - Google Patents

Ceacam1 servant de biomarqueur du psoriasis Download PDF

Info

Publication number
WO2009080779A1
WO2009080779A1 PCT/EP2008/068082 EP2008068082W WO2009080779A1 WO 2009080779 A1 WO2009080779 A1 WO 2009080779A1 EP 2008068082 W EP2008068082 W EP 2008068082W WO 2009080779 A1 WO2009080779 A1 WO 2009080779A1
Authority
WO
WIPO (PCT)
Prior art keywords
ceacam1
psoriasis
skin
cells
antibody
Prior art date
Application number
PCT/EP2008/068082
Other languages
English (en)
Inventor
Hans Yssel
Jean-Pierre Moles
Jérôme PENE
Original Assignee
Inserm (Institut National De La Sante Et De La Recherche Medicale)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Inserm (Institut National De La Sante Et De La Recherche Medicale) filed Critical Inserm (Institut National De La Sante Et De La Recherche Medicale)
Publication of WO2009080779A1 publication Critical patent/WO2009080779A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/20—Dermatological disorders
    • G01N2800/205—Scaling palpular diseases, e.g. psoriasis, pytiriasis

Definitions

  • CEACAM1 AS A BIOMARKER OF PSORIASIS
  • the present invention relates to the use of carcinoembryonic antigen-related cellular adhesion molecule 1 (CEACAM1 ) as a biomarker of psoriasis. More particularly, the present invention relates to a method for diagnosing psoriasis in a patient comprising detecting the expression of CEACAM1 gene in a biological obtained from said patient.
  • CEACAM1 carcinoembryonic antigen-related cellular adhesion molecule 1
  • the epidermis a living interface between our body and the environment, is mainly constituted of multiple layers of specialized epithelial cells named keratinocytes.
  • Epidermis can be injured by many different causes, including microorganisms, chemicals, behaviours, physical injury, ageing, U.V. irradiation, cancer, autoimmune or inflammatory diseases.
  • Epidermis homeostasis is the result of a fine balance between the differentiation and proliferation of keratinocytes, differentiating from the basal to the cornified layers of the skin. Keratinocytes become able to differentially respond to soluble mediators such as Epidermal Growth Factor (EGF) family members. These modulators are produced by keratinocytes themselves, skin fibroblasts, Langerhans cells or by other immune competent infiltrating cells such as T lymphocytes. In response, keratinocytes release additional signalling molecules that modulate the expression level of cell surface receptors, modify the cytoskeleton morphology of immunocompetent cells, and modulate their migration, differentiation and proliferation capacities. In response to epidermal stress or in some skin diseases during an inflammatory response, wound healing or in a chronic disease, this crosstalk is activated.
  • EGF Epidermal Growth Factor
  • diseases which are characterized by hyperproliferation of keratinocytes are psoriasis, in particular psoriasis vulgaris, psoriasis capitis, psoriasis guttata, psoriasis inversa, but also in atopic dermatitis, nummular dermatitis, actinic keratosis, hyperkeratosis with epidermolytic hyperkeratosis and hyperkeratosis lenticularis perstans as well as keratosis pilaris, acne, abnormal scarring, keloids and ichthyoses.
  • psoriasis in particular psoriasis vulgaris, psoriasis capitis, psoriasis guttata, psoriasis inversa, but also in atopic dermatitis, nummular dermatitis, actinic keratosis, hyperkeratosis with epider
  • Psoriasis is the most common auto-immune disease of the skin, affecting about 2 % of the Caucasian population.
  • the pathology of this cutaneous disorder is thought to result from a self-perpetuating activation of skin-infiltrating T lymphocytes that are resident in the psoriatic lesions and that, through the secretion of various soluble factors and cytokines, contribute to the epidermal hyperproliferation and abnormal differentiation which are characteristic for this disease (Lew W. et al. 2004).
  • Atopic dermatitis (or eczema) is another chronic, inflammatory skin disease that may occur at any age and is very common in children. Atopic dermatitis has been reported to affect more than 10% of children and 1 -3 % of adults.
  • dermatitis is a form of eczema. It is characterized by round-to-oval erythematous plaques most commonly found on the arms and legs. Psoriasis is clinically and histologically well-characterized in its common presentation. However, a differential diagnosis can be difficult to differentiate from other types of dermatitis.
  • psoriasis and nummular dermatitis share several common histopathologic features, such as parakeratosis that is often accompanied by psoriasiform acanthosis, spongiosis, edema of the papillary dermis, and a lymphocyte infiltrate around dilated venules of the superficial plexus.
  • no reliable laboratory test is available to distinguish psoriasis from other inflammatory skin diseases, such as atopic dermatitis or nummular dermatitis.
  • the present invention relates to a method for diagnosing psoriasis in a patient comprising detecting the expression of the CEACAM1 gene in a biological sample obtained from said patient.
  • psoriasis refers to all variations of psoriasis including but not limited to psoriasis vulgaris, psoriasis capitis, psoriasis guttata, and psoriasis inverse. More particularly, the term “psoriasis” denotes an inflammatory skin disease which is marked by T cell-mediated inflammation leading to keratinocyte hyperproliferation and neo-angiogenesis with marked ectasia of blood vessels, i.e., erupting cutaneous lesions.
  • CEACAM1 refers to the carcinoembryonic antigen-related cellular adhesion molecule 1 (Beauchemin N. et al. 1999; Gray-Owen S. et al. 2006) formerly know as biliary glycoprotein, C-CAM or CD66.
  • the term may include any naturally occurring CEACAM1 and variants and modified forms thereof.
  • CEACAM1 can be from any source, but typically is a mammalian (e.g., human and non-human primate)
  • CEACAM1 particularly a human CEACAM1.
  • An exemplary human native CEACAM1 amino acid sequence is provided in GenPept database under accession number
  • NP_001703 An exemplary human native CEACAM1 nucleotide sequence is provided in GenBank database under accession number NM_001712.
  • a patient denotes a mammal such as a rodent, a feline, a canine and a primate.
  • a patient according to the invention is a human.
  • biomarker refers generally to a molecule, i.e., a gene (or nucleic acid encoding said gene), protein, the expression of which in a biological sample from a patient can be detected by standard methods in the art (as well as those disclosed herein), and is predictive or denotes a condition of the subject from which it was obtained.
  • detection includes qualitative and/or quantitative detection (measuring levels) with or without reference to a control. Detecting the expression of the CEACAM1 gene can be performed either at the level of the mRNA or at the level of the protein.
  • the present invention relates to the use of CEACAM 1 as a biomarker of psoriasis.
  • the present invention also relates to a method for diagnosing psoriasis in a patient comprising detecting the expression level of CEACAM1 gene in a biological sample obtained from said patient.
  • the method of the invention is particularly suitable for diagnosing psoriasis vulgaris.
  • the method of the invention is particularly suitable for the differential diagnosis psoriasis in a patient suffering from an inflammatory skin disease selected from psoriasis, atopic dermatitis and nummular dermatitis, wherein the presence of CEACAM1 is indicative of psoriasis.
  • CEACAM1 is not expressed in biological samples from patients suffering from other inflammatory skin diseases such as atopic dermatitis and nummular dermatitis.
  • the biological sample is a cutaneous biopsy obtained from psoriatic lesions of the patient's skin.
  • the biological sample is skin exudates or skin scales.
  • the biological sample may be whole blood, serum, or plasma.
  • the biological sample is a cell sample obtained from the skin of said patient, more preferably a keratinocyte sample.
  • Total nucleic acids or proteins can be easily extracted from cell or tissue samples.
  • the biological sample may be treated prior to its use, e.g. in order to render nucleic acids or proteins available.
  • Techniques of cell or protein lysis, concentration or dilution of nucleic acids, are known by the skilled person.
  • the invention relates to a method for diagnosing psoriasis in a patient comprising determining the quantity of mRNA of the gene encoding
  • CEACAM1 in a biological sample obtained from said patient is a sample obtained from the skin of said patient (such as a skin biopsy), more preferably a keratinocyte sample.
  • Determination of the expression level of a gene can be performed by a variety of techniques. Generally, the expression level as determined is a relative expression level.
  • the determination comprises contacting the sample with selective reagents such as probes, primers or ligands, and thereby detecting the presence, or measuring the amount of nucleic acids of interest originally in the sample.
  • selective reagents such as probes, primers or ligands
  • the expression level may be determined by determining the quantity of mRNA.
  • Methods for determining the quantity of mRNA are well known in the art.
  • the nucleic acid contained in the samples e.g., cell or tissue prepared from the patient
  • the extracted mRNA is then detected by hybridization (e. g., Northern blot analysis) and/or amplification (e.g., RT-PCR).
  • the expression level of the CEACAM1 gene is determined by RT-PCR, preferably quantitative or semi-quantitative RT-PCR, even more preferably semi-quantitative RT-PCR or real-time quantitative.
  • Primers useful for quantifying the level of mRNA of the gene encoding CEACAM1 can be easily designed by the skilled person. Those can include, but are not limited to the following pairs sense: AAACC AG AGTCTCCC GTCCT (SEQ ID NO:2) / anti-sense: AAAACATGCCAGGGCTACTG (SEQ ID NO:3); sense: GCAACAGGACCACAGTCAAGACGA (SEQ ID NO:4) / anti-sense: TTTTTGAAGAACCAACGGATGG (SEQ ID NO:5); sense: SEQ ID NO:4 / anti-sense: TTGTGCTCTGTGAGATCACGC (SEQ ID NO:6); sense: SEQ ID NO:4 / anti-sense: GTGGTTGGAGACTGAGGGTTTG (SEQ ID NO:7); sense: SEQ ID NO:4 / anti-sense: TGGAGTGGTCCTGAGCTGCCG (SEQ ID NO:2) / anti-sense: AAAACATGCCAGGGCTACTG (SEQ
  • nucleic acids having at least 10 nucleotides and exhibiting sequence complementarity or homology to the mRNA of interest herein find utility as hybridization probes or amplification primers. It is understood that such nucleic acids need not be identical, but are typically at least about 80% identical to the homologous region of comparable size, more preferably 85% identical and even more preferably 90-95% identical. In certain embodiments, it will be advantageous to use nucleic acids in combination with appropriate means, such as a detectable label, for detecting hybridization.
  • Probes typically comprise single-stranded nucleic acids of between 10 to 1000 nucleotides in length, for instance of between 10 and 800, more preferably of between 15 and 700, typically of between 20 and 500.
  • Primers typically are shorter single-stranded nucleic acids, of between 10 to 25 nucleotides in length, designed to perfectly or almost perfectly match a nucleic acid of interest, to be amplified.
  • the probes and primers are "specific" to the nucleic acids they hybridize to, i.e. they preferably hybridize under high stringency hybridization conditions (corresponding to the highest melting temperature Tm, e.g., 50 % formamide, 5x or 6x SCC.
  • SCC is a 0.15 M NaCI, 0.015 M Na-citrate).
  • the nucleic acid primers or probes used in the above amplification and detection method may be assembled as a kit.
  • a kit includes consensus primers and molecular probes.
  • a preferred kit also includes the components necessary to determine if amplification has occurred.
  • the kit may also include, for example, PCR buffers and enzymes; positive control sequences, reaction control primers; and instructions for amplifying and detecting the specific sequences.
  • the invention in another embodiment, relates to a method for diagnosing psoriasis in a patient comprising measuring the CEACAM1 protein in a biological sample obtained from said patient.
  • Determination of the expression level of a protein can be performed by a variety of techniques.
  • the methods of the invention comprise contacting the biological sample with a binding partner capable of selectively interacting with CEACAM1 present in the biological sample.
  • the binding partner may be an antibody that may be polyclonal or monoclonal, preferably monoclonal. In another embodiment, the binding partner may be an aptamer.
  • Polyclonal antibodies of the invention or a fragment thereof can be raised according to known methods by administering the appropriate antigen or epitope to a host animal selected, e.g., from pigs, cows, horses, rabbits, goats, sheep, and mice, among others.
  • a host animal selected, e.g., from pigs, cows, horses, rabbits, goats, sheep, and mice, among others.
  • Various adjuvants known in the art can be used to enhance antibody production.
  • antibodies useful in practicing the invention can be polyclonal, monoclonal antibodies are preferred.
  • Monoclonal antibodies of the invention or a fragment thereof can be prepared and isolated using any technique that provides for the production of antibody molecules by continuous cell lines in culture.
  • Techniques for production and isolation include but are not limited to the hybhdoma technique originally described by Kohler and Milstein (1975); the human B-cell hybridoma technique (Cote et al., 1983); and the EBV-hybhdoma technique (Cole et al. 1985).
  • Antibodies useful in practicing the present invention also include anti-CEACAM1 fragments including but not limited to F(ab')2 fragments, which can be generated by pepsin digestion of an intact antibody molecule, and Fab fragments, which can be generated by reducing the disulfide bridges of the F(ab')2 fragments.
  • Fab and/or scFv expression libraries can be constructed to allow rapid identification of fragments having the desired specificity to CEACAM1. For example, phage display of antibodies may be used.
  • single-chain Fv (scFv) or Fab fragments are expressed on the surface of a suitable bacteriophage, e. g., M13.
  • a suitable host e. g., mouse
  • the coding regions of the VL and VH chains are obtained from those cells that are producing the desired antibody against the protein. These coding regions are then fused to a terminus of a phage sequence.
  • a suitable carrier e. g., bacteria
  • the phage displays the antibody fragment.
  • Phage display of antibodies may also be provided by combinatorial methods known to those skilled in the art. Antibody fragments displayed by a phage may then be used as part of an immunoassay.
  • Monoclonal antibodies specific for CEACAM1 are described, for example, in Donda et al 2000, and Singer et al 2002.
  • Examples of commercially available monoclonal antibodies for CEACAM1 include those obtained from the R&D Systems (Mineapolis, USA), such as mAb282334 or mAb2244.
  • Other examples of commercially available monoclonal antibodies include those obtained from Abnova (Tapei, Taiwan), such as H00000634-M01 and obtained from Abeam under the reference GM8G5.
  • Another example of antibody is the one described in the EXAMPLE and named 19.6 mAb.
  • the binding partner may be an aptamer.
  • Aptamers are a class of molecule that represents an alternative to antibodies in term of molecular recognition. Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity.
  • ligands may be isolated through Systematic Evolution of Ligands by Exponential enrichment (SELEX) of a random sequence library, as described in Tuerk C. 1997.
  • the random sequence library is obtainable by combinatorial chemical synthesis of DNA. In this library, each member is a linear oligomer, eventually chemically modified, of a unique sequence. Possible modifications, uses and advantages of this class of molecules have been reviewed in Jayasena S.
  • Peptide aptamers consist of conformationally constrained antibody variable regions displayed by a platform protein, such as E. coli Thioredoxin A, that are selected from combinatorial libraries by two hybrid methods (Colas et al., 1996).
  • binding partners of the invention such as antibodies or aptamers, may be labelled with a detectable molecule or substance, such as a fluorescent molecule, a radioactive molecule or any others labels known in the art.
  • a detectable molecule or substance such as a fluorescent molecule, a radioactive molecule or any others labels known in the art.
  • Labels are known in the art that generally provide (either directly or indirectly) a signal.
  • the term "labelled", with regard to the antibody or aptamer, is intended to encompass direct labelling of the antibody or aptamer by coupling (i.e., physically linking) a detectable substance, such as a radioactive agent or a fluorophore (e.g. fluorescein isothiocyanate (FITC) or phycoerythrin (PE) or lndocyanine (Cy5)) to the antibody or aptamer, as well as indirect labelling of the probe or antibody by reactivity with a detectable substance.
  • a detectable substance such as a radioactive agent or a fluorophore (e.g. fluorescein isothiocyanate (FITC) or phycoerythrin (PE) or lndocyanine (Cy5)
  • FITC fluorescein isothiocyanate
  • PE phycoerythrin
  • Cy5 lndocyanine
  • An antibody or aptamer of the invention may be labelled with a
  • the aforementioned assays generally involve the bounding of the binding partner (ie. Antibody or aptamer) in a solid support.
  • Solid supports which can be used in the practice of the invention include substrates such as nitrocellulose (e. g., in membrane or microtiter well form); polyvinylchloride (e. g., sheets or microtiter wells); polystyrene latex (e.g., beads or microtiter plates); polyvinylidine fluoride; diazotized paper; nylon membranes; activated beads, magnetically responsive beads, and the like.
  • CEACAM 1 may be performed by using standard immunodiagnostic techniques, including immunoassays such as competition, direct reaction, or sandwich type assays.
  • immunoassays such as competition, direct reaction, or sandwich type assays.
  • assays include, but are not limited to, agglutination tests; enzyme-labelled and mediated immunoassays, such as ELISAs; biotin/avidin type assays; radioimmunoassays; Immunoelectrophoresis; immunoprecipitation.
  • an ELISA method can be used, wherein the wells of a microtiter plate are coated with a set of anti-CEACAM1 antibodies. A biological sample containing or suspected of containing CEACAM1 is then added to the coated wells. After a period of incubation sufficient to allow the formation of antibody-antigen complexes, the plate(s) can be washed to remove unbound moieties and a detectably labelled secondary binding molecule added. The secondary binding molecule is allowed to react with any captured sample marker protein, the plate washed and the presence of the secondary binding molecule detected using methods well known in the art.
  • IHC immunohistochemistry
  • IHC specifically provides a method of detecting targets in a sample or tissue specimen in situ. The overall cellular integrity of the sample is maintained in IHC, thus allowing detection of both the presence and location of the targets of interest.
  • a sample is fixed with formalin, embedded in paraffin and cut into sections for staining and subsequent inspection by light microscopy.
  • Current methods of IHC use either direct labeling or secondary antibody-based or hapten-based labeling.
  • IHC systems include, for example, EnVision(TM) (DakoCytomation), Powervision(R) (Immunovision, Springdale, AZ), the NBA(TM) kit (Zymed Laboratories Inc., South San Francisco, CA), HistoFine(R) (Nichirei Corp, Tokyo, Japan).
  • a tissue section ie a skin biopsy
  • the NBA(TM) kit Zymed Laboratories Inc., South San Francisco, CA
  • HistoFine(R) Neichirei Corp, Tokyo, Japan
  • a tissue section ie a skin biopsy
  • microscopic inspections in the sample mounted on a suitable solid support may be performed.
  • sections comprising samples may be mounted on a glass slide or other planar support, to highlight by selective staining the presence of CEACAM1 protein.
  • IHC samples may include, for instance: (a) preparations comprising fresh tissues or cells isolated form said tissues (b) fixed and embedded said tissue or cells samples and (c) detecting CEACAM1 protein in said tissues or cells samples.
  • an IHC staining procedure may comprise steps such as: cutting and trimming tissue, fixation, dehydration, paraffin infiltration, cutting in thin sections, mounting onto glass slides, baking, deparaffination, rehydration, antigen retrieval, blocking steps, applying primary anti-CEACAM1 antibody, washing, applying secondary antibody (optionally coupled to a suitable detectable label), washing, counter staining, and microscopic examination.
  • Detection of CEACAM1 may also include separation of the compounds: centrifugation based on the compound's molecular weight; electrophoresis based on mass and charge; HPLC based on hydrophobicity; size exclusion chromatography based on size; and solid-phase affinity based on the compound's affinity for the particular solid-phase that is used.
  • CEACAM 1 may be identified based on the known "separation profile" e. g., retention time, for that compound and measured using standard techniques.
  • the separated compounds may be detected and measured by, for example, a mass spectrometer.
  • the detection of CEACAM1 is performed in a skin biopsy through an immunohistochemical protocol as described in the EXAMPLE. More specifically, the method of the invention comprises the steps of (a) reacting a tissue sample with an antibody or an aptamer that binds to CEACAM1 , (b) forming an immunocomplex between CEACAM1 in the tissue sample and the antibody, and (c) detecting the immunocomplex formed by staining.
  • tissue sample refers to a skin tissue sample obtained from a patient, such as a cutaneous biopsy (or skin biopsy), skin exudates or skin scales.
  • the method of the invention further may comprise a step of comparing the concentration of the CEACAM1 protein with a predetermined threshold value. Said comparison is indicative of the presence of psoriasis patient.
  • the methods of the invention may be thus useful for classifying patients as affected by psoriasis.
  • the biomarker of the invention is particularly suitable to a make a differential diagnosis between psoriasis and other forms of dermatitis such as nummular dermatitis.
  • the methods of the invention may be thus used to choose the accurate treatment for said patient.
  • patients classified as affected by psoriasis may thus receive an appropriate treatment selected in the group consisting of topical corticosteroids, topical vitamin D derivatives, topical retinoids but also systemic treatment including methotrexate or ciclospohn and the recently anti-TNF biologies.
  • Such a method may thus help the physician to make a choice on a therapeutic treatment. Costs of the treatments may therefore be adapted to risk of the patients.
  • kits for diagnosing psoriasis in a patient comprising means for measuring the expression of CEACAM1 in a biological sample obtained from the sample.
  • the kit may include probes and primers as above described.
  • the kit may include an antibody, or a set of antibodies as above described. In a particular embodiment, the antibody or set of antibodies are labelled as above described.
  • the kit may also contain other suitably packaged reagents and materials needed for the particular detection protocol, including solid-phase matrices, if applicable, and standards.
  • FIGURES Figure 1. Keratinocytes in the outer epidermal layer of psoriatic lesions specifically express CEACAM1.
  • FIG. 1 Culture supernatants of activated skin-infiltrating T cells induce expression of CEACAM1 transcripts and protein by NHEK in an IFN- ⁇ - dependent manner
  • NHEK were cultured with different dilutions of supernatants of in vitro activated skin-infiltrating T cells, depleted or not for the presence of IFN- ⁇ , and the expression of CEACAM 1 transcripts was analyzed by real-time RT-PCR following 24h of incubation
  • FIG. 1 IFN- ⁇ induces cell surface expression of CEACAM1 by NHEK:
  • NHEK were cultured for 48h in the (a) absence or (b) presence of IFN- ⁇ .
  • Cell surface expression of CEACAM1 was determined by immunohistochemistry. Negative control is inserted in Figure 3b.
  • OSM induces cell surface expression of CEACAM1 on human reconstituted epidermis: Human reconstituted epidermis was cultured for 48h in (a) the absence or (b) the presence of 30% T cell-derived culture supernatant, with (c) OSM or (d) IL-17, both at a concentration of 10 ng/ml. The expression of CEACAM1 was determined by immunohistochemistry analysis.
  • IL-17 does not induce CEACAM1 expression on NHEK: NHEK were cultured in medium only (Cont) or in the presence of either a culture supernatant (30%, T cell SN) of in vitro activated psoriatic skin-infiltrating T cells, IFN- ⁇ (10 ng/ml) or IL-17 and the expression of CEACAM1 was analyzed by immunohistochemistry after 48h of incubation. Negative controls for the two conditions that induce CEACAM1 expression are inserted in the figures.
  • Cytokines produced by activated skin-infiltrating T cells induce the expression of transcripts for the short and long CEACAM1 isoforms on primary keratinocytes: (a) NHEK were cultured with a culture supernatant (30%) of in vitro activated psoriatic skin-infiltrating T cells or (b) were also cultured with OSM (10 ng/ml). The expression of transcripts for the short (3S and 4S) and long (3L and 4L) isoforms of CEACAM1 was analyzed by RT-PCR (a) or by real-time RT-PCR (b), following 24h of incubation.
  • FIG. 7 IFN- ⁇ -induced expression of CEACAM1 on keratinocytes protects neutrophils from spontaneous apoptosis: (a) One million of freshly isolated peripheral blood neutrophils were cultured for 24h in medium alone or (b) 200 ng/ml GM-CSF or were co-cultured with either NHEK that had been preincubated for 48h (c) in medium, (d) with 10 ng/ml IFN- ⁇ , or with (e) wild type CHO cells or with CHO cells expressing (f) the long or (g) the short isoform of CEACAM1.
  • CEACAM1 engagement delays neutrophil apoptosis One million of freshly isolated peripheral blood neutrophils were either cultured (a) in medium only, (b) with 200 ng/ml GM-CSF, (c) with 30 ⁇ g/ml of the anti-CEACAM1 mAb 19.6 or (d) with 30 ⁇ g/ml of an isotype control mAb for various periods of time. Frequencies of viable and early or late apoptotic cells were determined by measuring annexin-V binding and Pl incorporation using flow cytometry Representative results from 4 independent experiments with neutrophils from different donors. Percentages of cells in the quadrants are indicated, (e) Kinetics of viable cell frequencies are expressed as the mean ⁇ SD of the values obtained in the 4 experiments.
  • Anti-CEACAM1 mAbs The 19.6 mAb (IgGI ) was generated following the immunization of 12 weeks old female BALB/c mice with the skin-derived T cell clone BOY-JF.161 (Lecart et al., 2001 ) and fusion of mouse spleen cells with the myeloma line X-63 Ag-8. Culture supernatants of growing hybridomas were tested by immunofluorescence and flow cytometry and the corresponding mAb was selected for reactivity with a panel of skin-derived T cell clones, absence of reactivity with CD4+ peripheral blood T cells and for suitability in Western blotting and immunoprecipitation procedures.
  • the molecule recognized by the 19.6 mAb was identified by mass spectrometry and sequencing of tryptic peptides. A Mascot search of seven out of the ten peptides generated in this way permitted to identify with a probability score of p ⁇ 0.001 a peptide with the amino acid sequence QIVGYAIGTQQATPGPANSGR (SEQ ID NO:1 ) that is characteristic of human CEACAM1 (P13688). Moreover, the 19.6 mAb recognizes the expected 115 kDa glycoprotein on a 64 kDa protein backbone on activated T cells, as shown by Western blotting analysis.
  • T cell lines were generated from cutaneous punch biopsies of lesional skin of patients with Psoriasis vulgaris that had been cultured in the presence of the anti-CD3- and anti-CD28 mAb-coated T cell Expander beads® (Invitrogen Life Technologies, Cergy-Pontoise, France), according to the manufacturers recommendations, and expanded for 10-14 days in Yssel's medium (Yssel et al., 1984), supplemented with 1 % human serum (Etableau Frangais du Sang, Lyon, France) and 20 ng/ml rlL-2 (Diaclone Research, Besangon, France) prior to use in experiments.
  • NHEK normal human epidermal keratinocytes
  • K-SFM Invitrogen Life Technologies
  • epidermal growth factor 5 ng/ml
  • bovine pituitary extract 50 ⁇ g/mL, Invitrogen Life Technologies
  • Peripheral blood neutrophils were isolated from venous blood of healthy volunteers by percoll gradient centhfugation, resuspended in Hank's Balanced Salt Solution and immediately used in experiments.
  • CHO cells transfected with cDNA encoding the long (NCBI data base, NM 001712) or short (NM 001024912) isoforms of CEACAM1 were cultured in IMDM, supplemented with 10% FCS (Biowest, Nuaille, France) and 300 ⁇ g/mL of G418 (Invitrogen Life Technologies).
  • Reconstituted human skin was generated as described previously (Moles et al., 1994). Briefly, keratinocyte suspensions (2 x 105 cells in 15 ⁇ l) were seeded on the center of a dead, de-epidermised dermis and grown at the air-liquid interface on a metallic support for 2 weeks at 37°C, 5% CO2 in a humidified incubator.
  • Culture medium consisted of Ham's F12/DMEM (1/3; v/v), supplemented with 10% fetal calf serum, 1 % penicillin/streptomycin, 1 % fungizone (Invitrogen Life Technologies), 0.4 ⁇ g/ml hydrocortisone, 5 ⁇ g/ml insulin, 10-10 M cholera toxin, and 10 ng/ml EGF (Sigma Aldrich, Saint-Quentin-Fallavier, france). The culture medium was supplemented with the various cytokines during the 2 weeks of reconstruction.
  • T cell culture supernatants Primary T cell lines were washed extensively in SFM without any supplements and were cultured at a concentration of 2.106 cells/ml in the same culture medium in the presence of plate-bound anti-CD3 (SPV-T3b, Beckman-Coulter, Roissy, France; coated for 4h at 37°C at a concentration of 10 ⁇ g/ml in PBS) and anti-CD28 (L293, BD Biosciences, Le Pont de Claix, France: 1 ⁇ g/ml) mAbs. Controls consisted of culture medium incubated only with the latter mAbs and were used to evaluate possible non-specific activation of the keratinocytes.
  • Culture supernatants were collected after 24h of culture and following removal of remaining cells by centhfugation, aliquoted and stored at -80 0 C prior to use. Depletion of IFN- ⁇ from the culture supernatants was carried out as follows: 250 ⁇ l of goat-anti-mouse IgG Ab-coated magnetic beads (Dynal, Compiegne, france) were incubated with 100 ⁇ l of the neutralizing anti-human IFN- ⁇ mAb BB-1 (1 mg/ml: Diaclone Research) for 30 min at 4°C under orbital shaking.
  • the mAb-coated beads were incubated with 1 ml of T cell- derived culture supernatant for 30 min at 4°C under orbital shaking. After removal of the beads by a magnetic device (Invitrogen Life Technologies), the culture supernatant was used directly in experiments. This procedure allows the complete and specific removal of a IFN- ⁇ from the culture supernatant, as determined by cytokine-specific ELISA following depletion.
  • Immunofluorescence and flow cytometry analysis All immunofluorescence and flow cytometry procedures were carried out as described (Scheffold et al., 2002).
  • the following (m)Abs and control IgG were used : non-conjugated anti-CD3 mAb SPV-T3b, non-conjugated anti-CD25 mAb and non-conjugated mouse IgGI as isotype-specific negative control (BD Biosciences); PE-conjugated anti-CD4 and a FITC-conjugated goat anti-mouse IgG Ab (Caltag, Le Perray-en-Yvelines, France). Cells were analyzed on a FACSCalibur® flow cytometer equipped with Cellquest software (BD Biosciences).
  • RNA isolation and quantitative RT-PCR analysis Total cellular RNA from keratinocytes was extracted using Tri-Reagent (Sigma Aldrich T9424) following the manufacturer's protocol. Total RNA was reverse-transcribed using the primer oligo(dT) and Superscript Il enzyme (Invitrogen Life Technologies). cDNAs, were subsequently analyzed by quantitative real-time PCR using the LightCycler system (Roche Diagnostics, Meylan, France), as described originally by Wittwer et al. (Wittwer et al., 1997).
  • CEACAM1 (NM001712) sense: AAACCAGAGTCTCCCGTCCT (SEQ ID NO:2) / anti-sense: AAAACATGCCAGGGCTACTG (SEQ ID NO:3); CEACAM1 -3L, sense: GCAACAGGACCACAGTCAAGACGA (SEQ ID NO:4) / anti-sense: TTTTTGAAGAACCAACGGATGG (SEQ ID NO:5); CEACAM1 -3S sense: idem / anti- sense: TTGTGCTCTGTGAGATCACGC (SEQ ID NO:6); CEACAM1 -4L sense: idem / anti-sense: GTG GTTG GAGACTGAG G GTTTG (SEQ ID NO:7); CEACAM1 -4S sense: idem / anti-sense: TGGAGTGGTCCTGAGCTGCCG (SEQ ID NO:8).
  • the calculated amount was normalized to the housekeeping gene glyceraldehyde-3-
  • Soluble CEACAM1 measurements were carried out according to a similar procedure, using the anti-CEACAM1 mAb 19.6 as the capture antibody (2 ⁇ g/ml) and a biotinylated goat anti-recombinant CEACAM1 Ab (R&D Systems: BAF2244) as the detection antibody (0.1 ⁇ g/ml). Streptavidin-AP (BD PharMingen, dilution 1/10,000) and the substrate 4-nitro-phenyl phosphate (Sigma- Aldrich) was used as the read-out. Recombinant CEACAM 1 (R&D Systems) was used to establish a standard curve. The sensitivity of the assay was 300 pg/ml.
  • Neutrophil apoptosis was measured by a procedure based on double-staining with FITC-Annexin V (early apoptosis) and Pl (late apoptosis), thus identifying early apoptotic cells as Annexin V+, Pl-, late apoptotic cells as Annexin V+, Pl+ and viable cells as Annexin V-, Pl- using the Bender Medsystems apoptosis kit (Tebu, Le Perray-en-Yvelines, France) on a FACSCalibur® flow cytometer equipped with Cellquest software.
  • Keratinocytes in the outer epidermal layer of psoriatic lesions specifically express CEACAM1 :
  • the in situ expression of CEACAM1 in human skin biopsies was determined by immunohistochemistry, using a mAb suitable for in situ staining of CEACAM1 , as validated by its reactivity with primary melanoma cells that strongly express this molecule ( Figure 1 a).
  • CEACAM1 is expressed in biological samples from patients suffering from psoriasis but is not expressed in biological samples from patients suffering from other inflammatory skin diseases such as atopic dermatitis and nummular dermatitis.
  • Cytokines produced by T cells that infiltrate psoriatic lesions induce
  • CEACAM1 expression on normal primary keratinocytes and on reconstituted human skin in vitro The absence of expression of CEACAM 1 by keratinocytes in healthy skin, in contrast to its specific expression in the context of psoriatic inflammation, suggests that its expression might be subject to regulation by T cells that infiltrate this particular inflammatory environment.
  • T helper (Th) type 1 IFN- ⁇ - secreting T lymphocytes
  • primary skin-infiltrating T cell lines generated from psoriatic lesions were analyzed for their capacity to induce the expression of CEACAM 1 on NHEK.
  • oncostatin M has potent modulatory effects on keratinocyte function (Boniface et al., 2007). We therefore determined the capacity of this cytokine to induce the expression of CEACAM1 on either NHEK or on reconstituted human epidermis. Similar to the effects of IFN- ⁇ , OSM induced transcripts for CEACAM1 in NHEK and reconstituted epidermis. In contrast, the addition of IL-17, a cytokine produced by a recently identified subpopulation of CD4+ T cells called Th17 cells that are reportedly involved in the pathogenesis of several autoimmune and inflammatory disorders, did not result in the induction of CEACAM1 transcripts.
  • OSM oncostatin M
  • Cytokine-activated keratinocytes express the CEACAM1-S and -L isoforms, but do not produce soluble CEACAM1 :
  • Various splicing events of CEACAM1 mRNA can give rise to the generation of 3 and 4 extracellular domains, in combination with long and short cytoplasmic tails, as well as soluble, isoforms.
  • the ratio of CEACAM1 long and short isoform expression differs according to cell type and activation state. Because the heavy glycosylation of CEACAM 1 makes distinguishing between isoforms difficult, we carried out real-time RT-PCR analysis in order to determine which CEACAM1 isoforms are induced on keratinocytes. Cytokine-activated NHEK were found to express transcripts for the four major isoforms of CEACAM 1 ( Figure 6).
  • CEACAM1 secreted CEACAM1 levels were analyzed in the culture supernatants of cytokine-activated NHEK using CEACAM 1 -specific ELISA.
  • soluble CEACAM1 was detectable in culture supernatants of NHEK, stimulated for 48h with either IFN- ⁇ or with OSM, under the same experimental conditions that induced the expression of CEACAM1 at the surface of these cells.
  • N- formyl-Met-Leu-Phe (fMLP)- or GM-CSF-activated neutrophils used as a positive control, produced soluble CEACAM1.
  • Activated keratinocytes delay neutrophil apoptosis via homotypic CEACAM1 interactions: Active Psoriasis vulgaris skin lesions are characterized by the presence of neutrophils in the typical Munro-Saboureau microabscess in the outer layer of the epidermis. As neutrophils rapidly undergo apoptosis after having left the circulation, we investigated whether CEACAM 1 -mediated homotypic interactions between keratinocytes and neutrophils might contribute to the persistence of the latter cells in this particular skin disease. Early and late apoptotic stages of neutrophils, cultured in the presence or absence of CEACAM 1 -expressing NHEK, were analyzed by measuring annexin-V binding and Pl incorporation, respectively, using flow cytometry.
  • CEACAM1 engagement by means of the addition of the 19.6 mAb also delayed spontaneous neutrophil apoptosis at least until 4Oh after the initiation of the cultures ( Figure 8c) and even after 66 h of culture, 4% of neutrophils were still viable ( Figure 8e), whereas the addition of an isotype control IgG was ineffective ( Figure 8d,e).
  • CEACAM1 expression (whether at the protein or the mRNA level) in a biological sample obtained from a patient is useful for the diagnosis of psoriasis in said patient.
  • Carcinoembryonic antigen-related cell adhesion molecule 1 expression and signaling in human, mouse, and rat leukocytes evidence for replacement of the short cytoplasmic domain isoform by glycosylphosphatidylinositol-linked proteins in human leukocytes. J Immunol. 2002 168:5139-1546.
  • Tuerk C Using the SELEX combinatorial chemistry process to find high affinity nucleic acid ligands to target molecules. Methods MoI Biol. 1997; 67: 219-30.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne l'utilisation de la molécule 1 d'adhésion cellulaire liée à l'antigène carcinoembryonique (CEACAM1) en tant que biomarqueur du psoriasis. En particulier, la présente invention concerne un procédé de diagnostic du psoriasis chez un patient, le procédé consistant à détecter l'expression du gène CEACAM1 dans un échantillon biologique prélevé sur ledit patient.
PCT/EP2008/068082 2007-12-20 2008-12-19 Ceacam1 servant de biomarqueur du psoriasis WO2009080779A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP07301723.8 2007-12-20
EP07301723 2007-12-20

Publications (1)

Publication Number Publication Date
WO2009080779A1 true WO2009080779A1 (fr) 2009-07-02

Family

ID=39209938

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2008/068082 WO2009080779A1 (fr) 2007-12-20 2008-12-19 Ceacam1 servant de biomarqueur du psoriasis

Country Status (1)

Country Link
WO (1) WO2009080779A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020068709A1 (en) * 1999-12-23 2002-06-06 Henrik Orum Therapeutic uses of LNA-modified oligonucleotides
US20040047858A1 (en) * 2002-09-11 2004-03-11 Blumberg Richard S. Therapeutic anti-BGP(C-CAM1) antibodies and uses thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020068709A1 (en) * 1999-12-23 2002-06-06 Henrik Orum Therapeutic uses of LNA-modified oligonucleotides
US20040047858A1 (en) * 2002-09-11 2004-03-11 Blumberg Richard S. Therapeutic anti-BGP(C-CAM1) antibodies and uses thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MOLÈS J-P ET AL: "Reverse transcriptase activity in human normal and psoriatic skin samples.", THE BRITISH JOURNAL OF DERMATOLOGY SEP 2007, vol. 157, no. 3, September 2007 (2007-09-01), pages 482 - 486, XP002474653, ISSN: 0007-0963 *

Similar Documents

Publication Publication Date Title
US7449303B2 (en) Use of JAG2 expression in diagnosis of plasma cell disorders
US20060088532A1 (en) Lymphatic and blood endothelial cell genes
Berrih‐Aknin et al. CCL21 overexpressed on lymphatic vessels drives thymic hyperplasia in myasthenia
US20150044695A1 (en) Method and a Kit To Detect Malignant Tumors and Provide a Prognosis
EP1913387A1 (fr) Procédé destiné à identifier des lymphocytes t régulateurs
US9453070B2 (en) Methods for detecting Th1 cells
WO2011145725A1 (fr) Procédé et kit pour diagnostiquer une maladie associée à l'aim
JP2012021943A (ja) 子宮体がんの検査方法、子宮体がんの検査薬、並びに子宮体がん抗原に対する抗体
Huilaja et al. Pemphigoid gestationis autoantigen, transmembrane collagen XVII, promotes the migration of cytotrophoblastic cells of placenta and is a structural component of fetal membranes
US10000809B2 (en) Methods for determining risk of chronic lung allograft dysfunction (CLAD) and subtypes thereof
US20100196935A1 (en) Treating pre-eclempsia and cardiovascular diseases
WO2009080779A1 (fr) Ceacam1 servant de biomarqueur du psoriasis
US8206897B2 (en) Assay for soluble CD200
KR101628035B1 (ko) Ｖｓｉｇ４를 이용한 난소암 치료제 스크리닝 방법
US20140113288A1 (en) Methods of identifying risk of preeclampsia and pregnancy-related disorders
US20100298418A1 (en) Assay for measuring plasma FGL-2 and methods and uses thereof
EP4375375A1 (fr) Biomarqueur pour prédire le pronostic d'un patient cancéreux, procédé pour prédire le pronostic d'un patient cancéreux, procédé pour prédire l'effet d'un médicament thérapeutique contre le cancer sur un patient cancéreux, et kit pour prédire le pronostic d'un patient cancéreux
JP6721571B2 (ja) １５種類の男性生殖関連タンパク質またはその組み合わせの使用
WO2023144303A1 (fr) Cd38 en tant que biomarqueur et biocible dans des lymphomes t
JPH11504318A (ja) 低酸素栄養膜におけるタンパク質発現の変化
WO2010099568A1 (fr) Biomarqueurs du syndrome de fatigue chronique

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08865417

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08865417

Country of ref document: EP

Kind code of ref document: A1