WO2009076539A2 - Modulation of protein degradation and uses thereof - Google Patents

Abstract

A novel chemical mutagenesis strategy identifies multiple regions of protein proteolytic sites. This provides a new tool in identifying compounds or therapeutic agents, which modulate protein or peptide proteolysis. Identification of such compounds would be essential to treat a battery of diseases.

Description

MODULATION OF PROTEIN DEGRADATION AND USES THEREOF

CROSS-REFERENCE TO RELATED APPLICATIONS

The present application claims the priority of U.S. provisional patent application No. 61/012,798 filed December 11, 2007, which is incorporated herein by reference in its entirety.

STATEMENT AS TO FEDERALLY FUNDED RESEARCH

This invention was made with United States government support under grant number 1 R21 NS056991-01 awarded by the National Institutes of Health. The United States government has certain rights in the invention.

FIELD OF THE INVENTION

Embodiments of the invention relates to modulation of protein degradation, use in treatment of diseases and drug discovery.

BACKGROUND

One of the most important substrates degraded in a phosphorylation dependent manner is Weel, an inhibitor of mitotic entry. Weel is a highly conserved kinase that inactivates the mitosis-specific kinase cdkl/cyclin B complex during the S and G2 phases of the cell cycle by phosphorylating cdkl at tyrosine. However, Weel activity is opposed by the phosphatase Cdc25, which removes phosphorylation of tyrosine 15 on cdkl and thereby activates cdkl/cyclin B at the G2-M transition. Therefore, there is a 'tug-of-war' between Weel and Cdc25 in controlling activity of the cdkl/cyclin B complex. A major mechanism that tips the balance toward Cdc25 and mitotic entry is Weel degradation during the G2 phase of the cell cycle, and once this occurs active Cdc25 and cdkl/cyclin B form a positive feedback loop, which ensures that mitotic entry is unidirectional. Thus, Weel degradation is essential during mitotic entry since it is part of the cdkl activation circuit.

Weel degradation has been observed in S. cerevisiae, Xenopus egg extracts, and human somatic cells. In Xenopus, nuclei are required for proper Weel degradation, and subsequent studies revealed that completion of DNA replication is required to achieve the maximal rate of Weel degradation. Hence, Weel degradation is part of a sensing mechanism that signals that DNA replication is complete and that mitotic entry can proceed. When cells sense that DNA replication has stalled, this fail-safe mechanism allows defects to be corrected before entering mitosis. Indeed, current theories suggest that many cancer cells have ineffective checkpoint pathways that cause them to divide with incompletely replicated DNA, and that this leads to genomic instability. SUMMARY

Identification of protein or peptide proteolytic sites allows for modulation of the rate of protein degradation. Methods of identifying such sites in any desired protein or peptide comprise a mutagenesis strategy, allowing for the identification of peptide docking sites which can be utilized in identification of compounds that modulate protein degradation. Compositions include molecules associated with modulation of protein degradation.

Accordingly, the invention provides compounds or identification of compounds which regulate for example, cell proliferation, cell differentiation, and cell survival. Embodiments of the invention also provide methods for modulating protein degradation, cell proliferation, cell differentiation and/or cell survival by modulating protein degradation; assays for identifying compounds which modulate protein degradation, cell proliferation, differentiation and/or cell survival; methods for treating disorders associated with aberrant protein degradation, cell proliferation, cell differentiation, and/or cell survival; and diagnostic and prognostic assays for determining whether a subject is at risk of developing a disorder associated with an aberrant protein degradation, cell proliferation, cell differentiation, and/or survival.

In a preferred embodiment, a vector comprises a Weel nucleic acid molecule operably linked to a detectable marker. Examples of detectable markers include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include ¹²⁵I, ¹³¹1, ³⁵S or ³H. In one aspect the detectable marker is luciferase. In another preferred embodiment, a composition comprises a Weel molecule fused to a therapeutic agent, kinase inhibitor, enzyme and the like. Examples of protein kinase inhibitors include, for example, dasatinib which is often used in the treatment of cancer and inflammation. Some of the kinase inhibitors used in treating cancer are inhibitors of tyrosine kinases. Treatment of a patient comprises administration of one or more Weel molecules or other modulators of protein degradation in combination with conventional treatments. For example, radiotherapy, surgery, chemotherapy, antibiotics, anti-inflammatory agents, and the like, depending on the disease being treated. Treatment with the modulators of protein degradation can be administered prior to, concurrently or after treatment with other therapies. In another preferred embodiment, the Weel nucleic acid comprises a mutant Weel nucleic acid expressing a Weel protein or peptide comprise at least one mutated amino acid.

In another preferred embodiment, the mutated amino acids comprise amino acids at positions 53, 123, 425,468, 469, 471, 472, 473, 475, 477, 480, 483, and 487 of the Weel protein, peptides or fragments thereof. Preferably, the mutated amino acids comprise amino acids at positions 425,468, 469, 471, 472, 473, 475, 477, 480, 483, and 487 or at any Weel protein phosphorylation sites.

In another preferred embodiment, a mutated Weel protein, peptide or fragment thereof, comprises at least one mutated amino acid at position 425,468, 469, 471, 472, 473, 475, 477, 480, 483, and 487 or at any Weel protein phosphorylation sites. In another preferred embodiment a polynucleotide expresses a Weel protein or peptide comprising mutated amino at positions 53, 123, 425,468, 469, 471, 472, 473, 475, 477, 480, 483, and 487 of the Weel protein, peptides or fragments thereof. Preferably, the polynucleotide encodes mutated amino acids at positions 425,468, 469, 471, 472, 473, 475, 477, 480, 483, and 487 or at any Weel protein phosphorylation sites. In another preferred embodiment, a polynucleotide expresses a Weel protein or peptide comprising at least one mutated amino at positions 53, 123, 425,468, 469, 471, 472, 473, 475, 477, 480, 483, and 487 of the Weel protein, peptides or fragments thereof. Preferably, the polynucleotide encodes a protein or peptide comprising at least one mutated amino acid at position 425, 468, 469, 471, 472, 473, 475, 477, 480, 483, or 487 or at any Weel protein phosphorylation sites.

In another preferred embodiment, a vector expresses a Weel protein or peptide fused to a molecule comprising a detectable marker, protein, peptide, or radioligand. In another preferred embodiment, a peptide docking site comprises a Weel protein wherein the Weel protein, peptide or fragments thereof comprise mutations at one or more positions comprising amino acids at positions 53, 123, 425, 468, 469, 471, 472, 473, 475, 477, 480, 483, and 487 or at any Weel protein phosphorylation sites and kinase activation domain (residues 461-488).

In another preferred embodiment, a peptide docking site comprises mutations at one or more amino acid positions comprising positions 425, 468, 469, 471, 472, 473, 475, 477, 480, 483, and 487 or at any Weel protein phosphorylation sites.

In another preferred embodiment, a composition comprises Weel mutants: R167Q, E273K-Weel, R253H-Weel, G106S and L483F.

In another preferred embodiment, a composition comprises Weel mutants:R167Q, E273K-Weel, R253H-Weel, G106S, L483F, R167Q/E273K-Weel, or G106S/L483F-Weel.

In another preferred embodiment, a cell comprises a Weel nucleic acid molecule operably linked to a detectable marker; a Weel protein or peptide fused to a molecule comprising a detectable marker, protein, peptide, or radioligand; a Weel protein, peptide or fragments thereof comprising mutations at one or more positions comprising amino acids at positions 53, 123, 425, 468, 469, 471, 472, 473, 475, 477, 480, 483, and 487; and Weel mutants comprising R167Q, E273K-Weel, R253H-Weel, G106S, L483F, R167Q/E273K- Weel, or G106S/L483F-Weel. In another preferred embodiment, a method of identifying Weel proteolysis sites comprise fusing a nucleic acid encoding Weel to a lucif erase nucleic acid and creating a construct comprising Weel-luciferase; treating the construct with a mutating agent and transforming cells with the construct; identifying mutated Weel and fusing Weel mutants to a protein or peptide; and, measuring steady state levels of the Weel mutant fusion proteins, peptides or fragments thereof as compared to wild -type Weel controls; and, identifying Weel proteolysis sites.

In another preferred embodiment, the mutating agent comprises hydroxylamine, site- directed mutagenesis, PCR, PCR using one or more primers having the sequence set forth as SEQ ID NOS: 1-13. In another preferred embodiment, a method of identifying candidate therapeutic agents comprise incubating cells comprising a Weel-luciferase construct, a construct expressing a Weel mutant fusion protein, peptide or fragments thereof with a candidate therapeutic agent; and, measuring phosphorylation and/or degradation of Weel constructs; and, identifying candidate therapeutic agents.

In another preferred embodiment, the candidate therapeutic agent modulates cell proliferation, modulates protein degradation. In another preferred embodiment, a method of diagnosing or identifying patients at risk of developing abnormal cell growth or changes in levels of proteins as compared to normal patients comprises identifying mutations in Weel which alter phosphorylation of Weel and degradation as compared to steady state levels in normal individuals. Examples include, neurological disorders, cancer, autoimmune disorders, infection of cells by pathogens etc.

In another preferred embodiment, a method of identifying protein or peptide proteolysis sites comprises fusing a nucleic acid encoding a desired protein or peptide to a luciferase nucleic acid and creating a construct comprising protein- or peptide-lucif erase; treating the construct with a mutating agent and transforming cells with the construct; identifying mutated proteins or peptides fused to luciferase measuring steady state levels of the mutant fusion proteins, peptides or fragments thereof as compared to wild -type protein controls; and, identifying proteolysis sites of a protein or peptide.

Other aspects of the invention are described infra.

BRIEF DESCRIPTION OF THE DRAWINGS The invention is pointed out with particularity in the appended claims. The above and further advantages of this invention may be better understood by referring to the following description taken in conjunction with the accompanying drawings, in which:

Figure IA is a schematic illustration showing the mutagenesis strategy. Weel- luciferase was treated with hydroxylamine for 90 min to introduce mutations. Mutagenized DNA was transformed into E. coli. Individual clones were picked into nucleospin blocks. DNA was then isolated and prepared from the individual blocks and normalized. 40 ng of DNA encoding the various Weel -luciferase constructs was spotted on 384 well plates. The DNA was then transfected into HeLa cells using Mirus reagent. 24 hours after transfection, Brite-lite reagent was added to each well of the 384 well plate and luciferase units were quantified. Figure IB is a schematic representation of a screening assay to identify protein degradation modulators.

Figures 2A, 2B show steady-state levels of wee 1 -mutants. Weel-lucif erase was treated with hydroxylamine for 90 min to introduce mutations. Mutagenized DNA was transformed into E. coll. Individual clones were picked into nucleospin blocks. DNA was then isolated and prepared from the individual blocks and normalized. 40 ng of DNA encoding the various weel-luciferase constructs was spotted on 384 well plates. The DNA was then transfected into HeLa cells using Mirus reagent. 24 hours after transfection, Brite-lite reagent was added to each well of the 384 well plate and luciferase units were quantified. Figure 2A is a graph showing wild-type weel or the various mutant weel constructs were transfected into HeLa cells using a 'reverse-transfection' procedure. 24 hours after transfection, cells were lysed using 'Brite-lite' reagent. The relative luciferase units (RLU) are indicated. Experiments were performed in quadruplicate. Average and standard deviation are shown for representative experiment. Figure 2B are photographs of blots showing equivalent amounts of myc-tagged wild type weel (WT) or weel mutants transfected into HeLa cells and processed for anti-myc Western analysis after isolating asynchronous, mitotic, or 8/G2 cells (mitotic cells were isolated after nocodazole treatment; 8/G2 cells after double thymidine synchronization) .

Figure 3 shows graphs of in vitro degradation assays of 3 Weel mutants relative to wild-type Weel. ³⁵S-labeled wild-type Weel or the indicated mutants were incubated in somatic cell extracts and the amount of Weel remaining determined after 80S -PAGE and autoradiography. Average and standard deviation of 3 independent experiments shown.

Figures 4A to 4C show mutation of serine residues near the L483 site increases the steady state levels of Weel . Figure 4A shows the sequence of the region of human Weel identified as required for Weel turnover. Leucine 483 and serine 472 are underlined. Figure 4B is a plot showing that human Weel is phosphorylated at serine 472. Flag-tagged Weel was immuno-isolated from transfected 293T cells and the resulting immunoprecipitate resolved by SDS-PAGE. Bands were excised and LC-MS/MS performed on Weel band after trypsin digest. Scan indicated +80 AMU on serine 472, evidencing that it was phosphorylated (see Materials and Methods for further details). Figure 4C is a photograph of a blot showing that mutation of activation domain residues 471,472, or 483 stabilizes Weel. HeLa cells were transfected with either wild- type Wee 1 or the indicated mutants. The known sites required for Weel destruction are serine-53 and serine-123. Figures 5A-5C show that S472A-Weel or L483F-Weel mutation does not affect weel structure or kinase activity. Figure 5 A is a schematic illustration showing X-ray crystal structure of the kinase domain of human Weel kinase highlighting the ATP binding site and activation segment. The small molecule inhibitor PD407824 is drawn in the active site as a CPK model. Insets show overlays of phenylalanine for leucine at position 483 and alanine for serine at position 472. Figure 5B is a photograph of a blot showing: HeLa cells were synchronized in S phase using thymidine, released for 4 hours, and transfected with either Myc-WT-Weel, Myc- S472A-Weel, or Myc-L483F-Weel, or vector alone. Thymidine was then added for another 18 hours at which time cells were released and isolated at 0, 2, 4, 6, 8, and 10 hours and processed for myc, anti-phospho-histone and Skp-1 immunoreactivity. Figure 5C: Left Panel: is a graph showing results from Wee 1 kinase assay for Wild-type- Weel, S472A-Weel, or L483F-Weel. Right Panel is a photograph of a blot showing corresponding inputs for Weel kinase assay in left panel processed for anti-Weel or phospho-serine 53-Weel immunoreactivity. Figures 6 A and 6B show Weel activation domain may provide a second docking site for β-trcp or Tome-1. Figure 6A is a photograph of a blot showing Myc -Wild- type K329M- Weel or the various mutants were transfected into HeLa cells with vector, Flag-Tome- 1 or Flag-β-trcp and the steady-state levels determined by Anti- Myc Western analysis. Figure 6B shows the PEST-FiND analysis of human Weel. + indicates region that contains strong PEST prediction while - is a region with a PEST prediction. N- terminal serines and activation domain sites we identified as required for Weel turn-over are shaded.

Figure 7 shows that Weel-Luciferase is an accurate surrogate of Weel turnover. Top Panel: is a graph showing Weel-Luciferase is degraded faster than luciferase alone. Weel- luciferase or Luciferase construct was transfected into HeLa cells and the amount of remaining protein detected after various lengths of cycloheximide addition. Cycloheximide was added at a concentration of 100 μg/ml. Bottom Panel: is a photograph of a blot showing cells synchronized in S/G2 with double thymidine block were transfected with either Myc- Weel or Weel-Luciferase and incubated with cycloheximide for varying lengths of time. Myc or Luciferase. Western analysis was performed to indicate the amount of myc -Weel or Weel-Luciferase remaining.

Figure 8 is a photograph of blots showing steady- state level of wild-type Weel or indicated mutants. HeLa cells were synchronized at S phase and transfected with wild- type weel or the indicated mutants isolated from the weel -luciferase screen. Thymidine was added 4 hours after transfection. Cells were released from thymidine block 24 hours later. Anti-myc Western Blot analysis was then performed. Skp-1 served as a loading control.

Figure 9 is a photograph of a blot showing that the steady-state level of G106S/L483F mutant is higher than that of wild- type Weel or other mutants. HeLa cells were synchronized at S phase and transfected with wild- type Weel or the indicated mutants isolated from the Weel-luciferase screen. Thymidine was added 4 hours after transfection. Cells were released from thymidine block 24 hours later. Anti-myc Western Blot analysis was then performed. Skp-1 served as a loading control.

Figure 10 shows the sequence alignment of Weel activation domain from indicated species. Regions of similarity are boxed while identical regions are boxed and shaded. Activation domain residues include residues 461 to 488 of human sequence.

DETAILED DESCRIPTION

Compositions comprising Weel constructs mutated Weel nucleic acids, proteins and peptides. The identification of mutant Weel allows for modulating protein degradation, phosphorylation and cellular replication.

Traditional methods for identifying amino acids targeting proteins for destruction involve mass spectrometric analysis of proteins of interest in order to identify amino acids, mutants or modifications associated with protein turnover. However, since these proteins are targeted for destruction, it is difficult to isolate sufficient amounts to perform mass spectrometric analysis. Furthermore, due to the inherent limitations of mass spectrometry, it is difficult to identify all modifications present in the peptides analyzed. There is thus a need in the art to identify amino acids that are involved in protein turnover and therapeutic agents which allow for modulating a cell's processes such as protein turnover, especially in abnormal cells, such as a variety of cancers, neurodegenerative diseases and the like. Several aspects of the invention are described below with reference to example applications for illustration. It should be understood that numerous specific details, relationships, and methods are set forth to provide a full understanding of the invention. One having ordinary skill in the relevant art, however, will readily recognize that the invention can be practiced without one or more of the specific details or with other methods. In other instances, well-known structures or operations are not shown in detail to avoid obscuring the invention. The present invention is not limited by the illustrated ordering of acts or events, as some acts may occur in different orders and/or concurrently with other acts or events. Furthermore, not all illustrated acts or events are required to implement a methodology in accordance with the present invention.

Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

Definitions

The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms "including", "includes", "having", "has", "with", or variants thereof are used in either the detailed description and/or the claims, such terms are intended to be inclusive in a manner similar to the term "comprising."

As used herein, the term "test substance" or "candidate therapeutic agent" are used interchangeably herein, and the terms are meant to encompass any molecule, chemical entity, composition, drug, therapeutic agent, chemotherapeutic agent, or biological agent capable of preventing, ameliorating, or treating a disease or other medical condition. The term includes small molecule compounds, antisense reagents, siRNA reagents, antibodies, and the like. A test substance can be assayed in accordance with the methods of the invention at any stage during clinical trials, during pre-trial testing, or following FDA-approval. As used herein, the term "gene" or "polynucleotide" means the gene and all currently known variants thereof and any further variants which may be elucidated, including different species. For example, Weel gene or polynucleotide includes all species variants.

"Variant" polynucleotides and polypeptides include molecules containing one or more deletions, insertions and/or substitutions compared to the nucleic acids. Variant polynucleotides can encode the same or a functionally-equivalent polypeptide. The term "variant" when used in context of polypeptides refers to an amino acid sequence that is altered by one or more amino acid residues. The variant may have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties (e.g., replacement of leucine with isoleucine). More rarely, a variant may have "nonconservative" changes (e.g., replacement of glycine with tryptophan). Analogous minor variations may also include amino acid deletions or insertions, or both. Guidance in determining which amino acid residues may be substituted, inserted, or deleted without abolishing biological activity may be found using computer programs well known in the art, for example, LASERGENE software (DNASTAR).

The term "variant," when used in the context of a polynucleotide sequence, may encompass a polynucleotide sequence related to a wild type gene. This definition may also include, for example, "allelic," "splice," "species," or "polymorphic" variants. A splice variant may have significant identity to a reference molecule, but will generally have a greater or lesser number of polynucleotides due to alternate splicing of exons during mRNA processing. The corresponding polypeptide may possess additional functional domains or an absence of domains. Species variants are polynucleotide sequences that vary from one species to another. Of particular utility in the invention are variants of wild type gene products. Variants may result from at least one mutation in the nucleic acid sequence and may result in altered mRNAs or in polypeptides whose structure or function may or may not be altered. Any given natural or recombinant gene may have none, one, or many allelic forms. Common mutational changes that give rise to variants are generally ascribed to natural deletions, additions, or substitutions of nucleotides. Each of these types of changes may occur alone, or in combination with the others, one or more times in a given sequence. The resulting polypeptides generally will have significant amino acid identity relative to each other. A polymorphic variant is a variation in the polynucleotide sequence of a particular gene between individuals of a given species. Polymorphic variants also may encompass "single nucleotide polymorphisms" (SNPs,) or single base mutations in which the polynucleotide sequence varies by one base. The presence of SNPs may be indicative of, for example, a certain population with a propensity for a disease state, that is susceptibility versus resistance.

"Derivative" polynucleotides include nucleic acids subjected to chemical modification, for example, replacement of hydrogen by an alkyl, acyl, or amino group. Derivatives, e.g., derivative oligonucleotides, may comprise non-naturally-occurring portions, such as altered sugar moieties or inter- sugar linkages. Exemplary among these are phosphorothioate and other sulfur containing species which are known in the art. Derivative nucleic acids may also contain labels, including radionucleotides, enzymes, fluorescent agents, chemiluminescent agents, chromogenic agents, substrates, cofactors, inhibitors, magnetic particles, and the like. A "derivative" polypeptide or peptide is one that is modified, for example, by glycosylation, pegylation, phosphorylation, sulfation, reduction/alkylation, acylation, chemical coupling, or mild formalin treatment. A derivative may also be modified to contain a detectable label, either directly or indirectly, including, but not limited to, a radioisotope, fluorescent, and enzyme label.

"Oligonucleotides" or "oligomers" refer to a nucleic acids, preferably comprising contiguous nucleotides, of at least about 6 nucleotides to about 60 nucleotides, preferably at least about 8 to 10 nucleotides in length, more preferably at least about 12 nucleotides in length e.g., about 15 to 35 nucleotides, or about 15 to 25 nucleotides, 18 to 20 nucleotides, or about 20 to 35 nucleotides, which can be typically used in PCR amplification assays, hybridization assays, or in microarrays. It will be understood that the term "oligonucleotide" is substantially equivalent to the terms primer, probe, or amplimer, as commonly defined in the art. It will also be appreciated by those skilled in the pertinent art that a longer oligonucleotide probe, or mixtures of probes, e.g., degenerate probes, can be used to detect longer, or more complex, nucleic acid sequences, for example, genomic DNA. In such cases, the probe may comprise at least 20-200 nucleotides, preferably, at least 30-100 nucleotides, more preferably, 50-100 nucleotides.

As used herein, the term "level" refers to expression levels of RNA and/or protein or to DNA copy number of a molecule, e.g. Weel of the present invention. Typically the level of the molecule in a biological sample obtained from the subject is different (i.e., increased or decreased) from the level of the same variant in a similar sample obtained from a healthy individual (examples of biological samples are described herein). Determining the level of the same variant in normal tissues of the same origin is preferably effected along-side to detect an elevated expression and/or amplification and/or a decreased expression, of the variant as opposed to the normal tissues.

"Detect" refers to identifying the presence, absence or amount of the object to be detected.

As used herein the phrase "diagnostic" means identifying the presence or nature of a pathologic condition. Diagnostic methods differ in their sensitivity and specificity. The "sensitivity" of a diagnostic assay is the percentage of diseased individuals who test positive (percent of "true positives"). Diseased individuals not detected by the assay are "false negatives." Subjects who are not diseased and who test negative in the assay are termed "true negatives." The "specificity" of a diagnostic assay is 1 minus the false positive rate, where the "false positive" rate is defined as the proportion of those without the disease who test positive. While a particular diagnostic method may not provide a definitive diagnosis of a condition, it suffices if the method provides a positive indication that aids in diagnosis.

As used herein the phrase "diagnosing" refers to classifying a disease or a symptom, determining a severity of the disease, monitoring disease progression, forecasting an outcome of a disease and/or prospects of recovery. The term "detecting" may also optionally encompass any of the above. Diagnosis of a disease according to the present invention can be effected by determining a level of a polynucleotide or a polypeptide of the present invention in a biological sample obtained from the subject, wherein the level determined can be correlated with predisposition to, or presence or absence of the disease. It should be noted that a "biological sample obtained from the subject" may also optionally comprise a sample that has not been physically removed from the subject, as described in greater detail below.

The term "sample" is meant to be interpreted in its broadest sense. A "sample" refers to a biological sample, such as, for example; one or more cells, tissues, or fluids (including, without limitation, plasma, serum, whole blood, cerebrospinal fluid, lymph, tears, urine, saliva, milk, pus, and tissue exudates and secretions) isolated from an individual or from cell culture constituents, as well as samples obtained from, for example, a laboratory procedure. A biological sample may comprise chromosomes isolated from cells (e.g., a spread of metaphase chromosomes), organelles or membranes isolated from cells, whole cells or tissues, nucleic acid such as genomic DNA in solution or bound to a solid support such as for Southern analysis, RNA in solution or bound to a solid support such as for Northern analysis, cDNA in solution or bound to a solid support, oligonucleotides in solution or bound to a solid support, polypeptides or peptides in solution or bound to a solid support, a tissue, a tissue print and the like.

Numerous well known tissue or fluid collection methods can be utilized to collect the biological sample from the subject in order to determine the level of DNA, RNA and/or polypeptide of the variant of interest in the subject. Examples include, but are not limited to, fine needle biopsy, needle biopsy, core needle biopsy and surgical biopsy (e.g., brain biopsy), and lavage. Regardless of the procedure employed, once a biopsy/sample is obtained the level of the variant can be determined and a diagnosis can thus be made. "Microarray" is an array of distinct polynucleotides, oligonucleotides, polypeptides, peptides, or antibodies affixed to a substrate, such as paper, nylon, or other type of membrane; filter; chip; glass slide; or any other type of suitable support.

As used herein, the term "linker" means a chemical moiety which covalently joins the reactive groups already on the substrate and the molecule (e.g., DNA, antibody, or polypeptide) to be eventually immobilized, having a backbone of chemical bonds forming a continuous connection between the reactive groups on the substrate and the binding elements, and having a plurality of freely rotating bonds along that backbone.

Identification of Molecules Involved in Protein Degradation

The role oiXenopus Weel in the DNA replication checkpoint pathway indicated that Weel phosphorylation is required for its degradation and is regulated by the DNA replication checkpoint. Quantitative mass spectrometry was utilized to determine the stoichiometry of Weel phosphorylation in the presence and absence of the checkpoint. In the presence of the DNA replication checkpoint, Weel phosphorylation was negligible. By contrast, when DNA replication proceeded normally, Weel phosphorylation, Weel degradation, and mitotic entry were normal. Without wishing to be bound by theory, it appears that Weel phosphorylation functionally controlled mitotic entry, and that this mechanism controlled the DNA replication checkpoint. One aspect of Weel degradation conserved between embryonic and somatic cell cycles is the requirement for an SCF ubiquitin ligase that targets Weel for proteolysis. A novel Weel interacting protein, Tome-1, associates with the SCF components Skp-1 and CuI- 1 in both Xenopus egg extracts and somatic cells (Ayad, N. G. et al. Tome-1, a trigger of mitotic entry, is degraded during Gl via the APC. Cell 113, 101-13 (2003)). Tome-1 is important for Weel degradation during G2 and binds to Weel in a phosphorylation dependent manner as is the well-characterized F-box protein β-trcp-1. Redundant mechanisms regulate Weel degradation, since either β-trcp or Tome-1 depletion stabilizes Weel during the S and G2 phases of the cell cycle. What is still unclear is which sequence elements target Weel for destruction via SCF^13"^ or SCF^{Tome l}. Other studies attempting to identify these sequences have relied on mass spectrometry-based identification of phosphorylation sites required for interactions with either Tome-1 or β-trcp. Since phosphorylated SCF substrates are efficiently targeted for degradation, it is often difficult to isolate them for analysis by mass spectrometry.

The compositions can be used to treat diseases associated with abnormal cell proliferation, abnormal protein turn over, abnormal protein degradation or proteins that have not been degraded. For example, Weel levels are low in non-small cell lung cancer; Weel is a mitosis inhibitor- thus by modulating the degradation or rate of degradation, the levels of Weel can be in a cell can be modulated; Weel blocks cell proliferation; Prostate epithelium has low levels of weel, thus methods of treatment would include increasing weel levels in prostate cancer cells; Weel reduces cell proliferation, thus, abnormal cell proliferation can be modulated; Weel activity is lower in Alzheimer's patients, thus treatment would comprise one or more Weel molecules; Weel Ubiquitin ligases Tome-1 and β-trcp are overexpressed in cancer.

In a preferred embodiment, a method of identifying sites required for substrate turnover, comprises a cell-based means of identifying the most stable proteins after chemical mutagenesis. Using this method, the activation domain of Weel was identified as required for timely degradation during G2 and mitosis. The methods described in various embodiments, complements mass spectrometry based identification of phosphorylation sites on substrates.

In a preferred embodiment, a method of identifying amino acids involved in the destruction of rapidly turned over proteins comprises performing random mutagenesis cell- based screens with tumor suppressor proteins fused to a detectable marker, such as for example, firefly luciferase. Details of the methods are found in the Examples section which follows. Briefly, once mutations were generated in vitro, mutagenized plasmids were transfected into cells and the most stable mutations were isolated after luciferase reading of cells. Figures IA and IB are schematic illustrations showing some of the steps employed in the identification of residues (amino acid, nucleic acids or other molecules) involved in the degradation of a protein. The use of Weel to describe embodiments of the invention is merely as an illustrative molecule for illustrative purposes and is not to be construed as limiting. Embodiments of the invention therefore cover any desired protein or polynucleotide that a user may desire to modify or mutate.

The uses of the invention are many. Examples include, identification of important and critical amino acids involved in protein turnover. Once such sites are identified in a protein or peptide of interest, databases can be queried to identify, for example, whether genes encoding the identified amino acids are mutated preferentially in tumors. In a preferred embodiment, any protein or peptide is utilized in the mutagenesis strategy. As such, novel proteolytic sites are identified, new therapeutic agents or compounds can be screened based on the ability to modulate protein degradation. For example, in one preferred embodiment, an inhibitor of Wee 1 degradation comprises paclitaxel (PTX) or PTXlOl.

In another preferred embodiment, mutants which are identified based on the methods described herein, the protein or peptides or each of the mutants can be modified by substituting one or more amino acid positions with other amino acids. For example, the Weel protein, peptide or fragments thereof comprise mutations at one or more positions comprising amino acids at positions 53, 123, 425, 468, 469, 471, 472, 473, 475, 477, 480, 483, and 487 or at any Weel protein phosphorylation sites. Each of these sites can be substituted with another amino acid or the polynucleotide sequence encoding each of the amino acids at these positions can be altered to encode a desired amino acid, examples include: Weel mutants: R167Q, E273K-Weel, R253H-Weel, G106S, L483F, R167Q/E273K-Weel, or G106S/L483F-Weel.

In another preferred embodiment, the Weel molecule is fused with a detectable marker comprises a radiolabel, for example, ¹²⁵1, ³⁵S, ¹⁴C, or ³H, either directly or indirectly, and the radioisotope detected by direct counting of radioemmission or by scintillation counting. Alternatively, compounds can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product. The Weel can be linked via a linker, be encoded from a nucleic acid molecule encoding the Weel molecule and a second molecule. The second molecule can be a therapeutic agent, enzyme, kinase, kinase inhibitor, fluorescent molecule, e.g. GFP, luminescent molecule, phosphorescent molecule, and the like.

Amino acid changes can be made by substituting one amino acid within one group with another amino acid in the same group or can be substituted with an amino acid from another group. Amino acid changes can also be made by substituting one or more nucleic acid codons with one or more different codons that produce a desired amino acid substitution. In this manner, changes are made at the nucleotide level so that the same amino acid is coded for by a different nucleotide sequence. Biologically functional equivalents of the enzymes or fragments thereof of the present invention can have ten or fewer amino acid changes. The encoding nucleotide sequence will thus have corresponding base substitutions, permitting the nucleotide sequence to encode biologically functional equivalent forms of the enzymes or fragments thereof of the present invention. It is understood that certain amino acids may be substituted for other amino acids in a polypeptide to modulate the activity or degradation of a protein or peptide, e.g. Weel. Certain amino acid sequence substitutions can be made in a polypeptide sequence and its underlying DNA coding sequence and, a polypeptide with like or altered properties can be obtained. It is understood that codons capable of coding for such amino acid changes are known in the art. Such modified polypeptides can be produced, for instance, by amino acid substitution, deletion, or addition. For instance, it is reasonable to expect, for example, that an isolated replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar replacement of an amino acid with a structurally related amino acid (i.e. conservative mutations) will not have a major effect on the biological activity of the resulting molecule. Conservative replacements are those that take place within a family of amino acids that are related in their side chains. Genetically encoded amino acids are can be divided into four families: (1) acidic=aspartate, glutamate; (2) basic=lysine, arginine, histidine; (3) nonpolar=alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar=glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids. In similar fashion, the amino acid repertoire can be grouped as (1) acidic=aspartate, glutamate; (2) basic=lysine, arginine histidine, (3) aliphatic=glycine, alanine, valine, leucine, isoleucine, serine, threonine, with serine and threonine optionally be grouped separately as aliphatic -hydroxyl; (4) aromatic=phenylalanine, tyrosine, tryptophan; (5) amide=asparagine, glutamine; and (6) sulfur-containing=cysteine and methionine, (see, for example, Biochemistry, 2nd ed., Ed. by L. Stryer, W. H. Freeman and Co., 1981). Whether a change in the amino acid sequence of a polypeptide results in a functional homolog can be readily determined by assessing the ability of the variant polypeptide to produce a response in cells in a fashion similar to the wild-type protein. For instance, such variant forms of a Weel polypeptide can be assessed, e.g., for their ability to bind to another polypeptide. Polypeptides in which more than one replacement has taken place can readily be tested in the same manner.

In making changes to polypeptides of the present invention, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte and Doolittle, /. MoL Biol. 157, 105-132 (1982)). It is accepted that the relative hydropathic character of amino acids contributes to secondary structure of polypeptides, which in turn defines interaction with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like.

Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics (Kyte and Doolittle, /. MoL Biol. 157, 105-132 (1982)); these are isoleucine (+4.5), valine (+4.2), leucine (+3.8), phenylalanine (+2.8), cysteine/cystine (+2.5), methionine (+1.9), alanine (+1.8), glycine (-0.4), threonine (-0.7), serine (-0.8), tryptophan (-0.9), tyrosine (-1.3), proline (-1.6), histidine (-3.2), glutamate (- 3.5), glutamine (-3.5), aspartate (-3.5), asparagine (-3.5), lysine (-3.9), and arginine (-4.5).

It is also understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. As detailed in U.S. Pat. No. 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0), lysine (+3.0), aspartate (+3.0.+/-0.1), glutamate (+3.0.+/-0.1), serine (+0.3), asparagine (+0.2), glutamine (+0.2), glycine (0), threonine (-0.4), proline (-0.5.+/-0.1), alanine (-0.5), histidine (-0.5), cysteine (-1.0), methionine (-1.3), valine (-1.5), leucine (-1.8), isoleucine (- 1.8), tyrosine (-2.3), phenylalanine (-2.5), and tryptophan (-3.4).

This invention further contemplates a method of generating sets of combinatorial mutants of different proteins, e.g. Weel proteins, as well as truncation mutants, and fusion proteins thereof, and is especially useful for identifying potential variant sequences (e.g. homologs). Such proteins, when expressed from recombinant DNA constructs, can be used in gene therapy protocols. Likewise, mutagenesis can give rise to homologs which have intracellular half-lives dramatically different than the corresponding wild-type protein.

The mutants can include fusions of Weel molecules, Weel molecules linked to another molecule, or polynucleotides encoding peptides comprising Weel molecules and another molecule. For example, an enzyme or kinases. Examples include, but not limited to: galactokinase, homoserine kinase, mevalonate kinase, phosphomevalonate kinase, CDP-ME kinase, N-acetylgalactosamine kinase, mevalonate 5-diphosphate decarboxylase, and arabinose kinase. Other superfamilies and kinases that are comprised within these superfamilies are within the scope of the invention. Examples of superfamilies and other kinases include, but not limited to: nucleoside monophosphate (NMP) kinase; WNK kinases; MAPK (mitogen- activated protein kinase) super-family which is composed of three major sets of kinases: the extracellular-receptor kinases (ERK) include ERKl; ERK2; ERK3/ERK4, ERK5, and two types of MAPK-related kinases that respond to cellular stress and inflammatory signal: the c-Jun N-terminal kinases/stress-activated protein kinases (JNK/SAPK) which include JNKl, JNK2 and JNK3 and the p38 MAPKinases: p38alpha, p38beta2, p38gamma and p38delta.

In another preferred embodiment, Weel can be fused to one or more other molecules or the other molecules can be fused to a detectable marker. Examples of other molecules include, Cell cycle G2/M control: Cdc2, CDC28p, CDKl, Cyclin B-dependent kinases; Cdc25, CDC25p, CDC25C, Tyrosine phosphatases; PP2A, Protein phosphatase 2A. Examples of molecules involved in DNA damage and replication checkpoints: Radl, RAD17p, Hradl, Nucleases; Rad3, ESRl (MEC1/SAD3), ATR Caffeine-sensitive, DNA- activated protein kinases; Rad9, Hrad9, 3'-5' Exonucleases; Radl7, RAD24p, Hradl7, p53 and activators; Rad24/25 BMHlp/2p 14-3-3 Nuclear export (Binds to phosphorylated Cdc25); Husl, Hhusl, PCNA-related protein; Chkl, CHKl, CHKl, Kinases; Cdsl, RAD53p, CHK2 Kinase. Examples of nuclear transporters: SpSrpl /Cutl5, Srplp, HSrpl/Qipl/Rchl, importin α. Examples of Vpr-binding proteins: Rhp23, Rad23, HHR23A/B, Excision DNA repair enzymes; Spungl, UNGl, UDG, Uracil-N-glycosylases.

In another preferred embodiment, a cell comprises a vector comprising a promoter operably linked to a polynucleotide expressing at least one of: Weel protein, peptide or fragments thereof . The polynucleotide expressing the Weel molecules can be expressed with a second molecule such as for example, luciferase. In another preferred embodiment, the Weel molecules comprise mutations at one or more amino acids at positions 53, 123, 425, 468, 469, 471, 472, 473, 475, 477, 480, 483, and 487 or at any Weel protein phosphorylation sites and kinase activation domain (residues 461- 488).

In another preferred embodiment, a polynucleotide encodes for at least one Weel mutant comprising: R167Q, E273K-Weel, R253H-Weel, G106S, L483F, R167Q/E273K- Weel, or G106S/L483F-Weel.

In a preferred embodiment, the promoter can be an inducible or tissue specific promoter.

As used herein, "expression" includes the process by which polynucleotides are transcribed into mRNA and translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA, if an appropriate eukaryotic host is selected. Regulatory elements required for expression include promoter sequences to bind RNA polymerase and transcription initiation sequences for ribosome binding. For example, a bacterial expression vector includes a promoter such as the lac promoter and for transcription initiation the Shine-Dalgarno sequence and the start codon AUG (Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989). Similarly, a eukaryotic expression vector includes a heterologous or homologous promoter for RNA polymerase II, a downstream polyadenylation signal, the start codon AUG, and a termination codon for detachment of the ribosome. Such vectors can be obtained commercially or assembled by the sequences described in methods well known in the art, for example, the methods described below for constructing vectors in general.

The terms "vector", "cloning vector" and "expression vector" mean the vehicle by which a DNA or RNA sequence (e.g. a foreign gene) can be introduced into a host cell, so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence. Vectors include plasmids, phages, viruses, etc.

Retroviral vectors typically comprise the RNA of a transmissible agent, into which a heterologous sequence encoding a protein of interest is inserted. Typically, the retroviral RNA genome is expressed from a DNA constrict. A common way to insert one segment of DNA into another segment of DNA involves the use of enzymes called restriction enzymes that cleave DNA at specific sites (specific groups of nucleotides) called restriction sites. A "cassette" refers to a DNA segment that can be inserted into a vector or into another piece of DNA at a defined restriction site. Preferably, a cassette is an "expression cassette" in which the DNA is a coding sequence or segment of DNA that codes for an expression product that can be inserted into a vector at defined restriction sites. The cassette restriction sites generally are designed to ensure insertion of the cassette in the proper reading frame. Generally, foreign DNA is inserted at one or more restriction sites of the vector DNA, and then is carried by the vector into a host cell along with the transmissible vector DNA. A segment or sequence of DNA having inserted or added DNA, such as an expression vector, can also be called a "DNA construct." A common type of DNA construct is a "plasmid" that generally is a self-contained molecule of double-stranded DNA, usually of bacterial origin, that can readily accept additional (foreign) DNA and which can be readily introduced into a suitable producer cell. A plasmid vector often contains coding DNA and promoter DNA and has one or more restriction sites suitable for inserting foreign DNA. A large number of vectors, including plasmid and fungal vectors, have been described for replication and/or expression in a variety of eukaryotic and prokaryotic hosts. Non-limiting examples include pKK plasmids (Amersham Pharmacia Biotech), pUC plasmids, pET plasmids (Novagen, Inc., Madison, Wis.), pRSET or pREP plasmids (Invitrogen, San Diego, Calif.), or pMAL plasmids (New England Biolabs, Beverly, Mass.), and many appropriate host cells, using methods disclosed or cited herein or otherwise known to those skilled in the relevant art. Recombinant cloning vectors will often include one or more replication systems for cloning or expression, one or more markers for selection in the host, e.g. antibiotic resistance, and one or more expression cassettes. A "retroviral plasmid vector" means a plasmid which includes all or part of a retroviral genome including 5' and 3' retroviral long-term repeat (LTR) sequences, a packaging signal (ψ), and may include one or more polynucleotides encoding a protein(s) or polypeptide(s) of interest, such as a therapeutic agent or a selectable marker. Such retroviral plasmid vectors are described, e.g., in U.S. Pat. No. 5,952,225 which is specifically incorporated herein by reference.

Expression of a peptide, e.g. Weel, fragments thereof, conservative variant thereof, or analog or derivative thereof of the invention may be controlled by promoter/enhancer elements disclosed herein, but these regulatory elements must be functional in the host selected for expression. Promoters which may be used to control gene expression include but are not limited to, the SV40 early promoter region (Benoist and Chambon, 1981, Nature 290:304-310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto, et al., 1980, Cell 22:787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al., 1982, Nature 296:39-42); prokaryotic expression vectors such as the β-lactamase promoter (Villa-Kamaroff, et al., 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731), or the tac promoter (DeBoer, et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:21-25); promoter elements from yeast or other fungi such as the Gal 4 promoter, the ADC (alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter, alkaline phosphatase promoter; and the animal transcriptional control regions, which exhibit tissue specificity.

Mammalian expression vectors contemplated for use in the invention include vectors with inducible promoters, such as the dihydrofolate reductase (DHFR) promoter, e.g., any expression vector with a DHFR expression vector, or a DHFR/methotrexate co-amplification vector, such as pED (Pstl, Sail, Sbal, Smal, and EcoRl cloning site, with the vector expressing both the cloned gene and DHFR, see Kaufman, Current Protocols in Molecular Biology, 16.12 (1991). Alternatively, a glutamine synthetase/methionine sulfoximine co- amplification vector, such as pEE14 (Hindlll, Xbal, Smal, Sbal, EcoRl, and Bell cloning site, in which the vector expresses grutamine synthase and the cloned gene; Celltech). In another embodiment, a vector that directs episomal expression under control of Epstein Barr Virus (EBV) can be used, such as pREP4 (BamHl, Sfil, Xhol, Noil, Nhel, Hindlll, Nhel, Pvull, and Kpnl cloning site, constitutive RSV-LTR promoter, hygromycin selectable marker;

Invitrogen), pCEP4 (BamHl, Sfil, Xhol, Noil, Nhel, Hindlll, Nhel, Pvull, and Kpnl cloning site, constitutive hCMV immediate early gene, hygromycin selectable marker; Invitrogen), pMEP4 (Kpnl, Pvul, Nhel, Hindlll, Notl, Xhol, Sfil, BamHll cloning site, inducible metallothionein Ha gene promoter, hygromycin selectable marker; Invitrogen), pREP8 (BamHl, Xhol, Notl, Hindlll, Nhel, and Kpnl cloning site, RSV-LTR promoter, histidinol selectable marker; Invitrogen), pREP9 (Kpnl, Nhel, Hindlll, Notl, Xhol, Sfil, and BamHl cloning site, RSV-LTR promoter, G418 selectable marker; Invitrogen), and pEBVHis (RSV- LTR promoter, hygromycin selectable marker, N-terminal peptide purifiable via ProBond resin and cleaved by enterokinase; Invitrogen). Selectable mammalian expression vectors for use in the invention include pRc/CMV (Hindlll, BstXl, Notl, Sbal, and Apal cloning site, G418 selection; Invitrogen), pRc/RSV (Hindlll, Spel, BstXl, Notl, Xbal cloning site, G418 selection; Invitrogen), and others. Vaccinia virus mammalian expression vectors (see, Kaufman, 1991, supra) for use according to the invention include but are not limited to pSCII (Smal cloning site, TK- and β-gal selection), pMJ601 (Sail, Smal, Afll, Narl, BspMll, BamHl, Apal, Nhel, Sacll, Kpnl, and Hindlll cloning site; TK- and β-gal selection), and pTKgptFIS (EcoRl, Psil, Sail, Accl, Hindlll, Sbal, BamHl, and Hpa cloning site, TK or XPRT selection).

The molecules of interest are operably linked to the promoter. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter or enhancer is operably linked to a coding sequence if it increases the transcription of the coding sequence. Operably linked means that the DNA sequences being linked are typically contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame. However, since enhancers generally function when separated from the promoter by several kilobases and intronic sequences may be of variable lengths, some polynucleotide elements may be operably linked but not contiguous.

Vectors are introduced into desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosome fusion), use of a gene gun, or a DNA vector transporter.

In a preferred embodiment, the nucleotides, e.g. Weel polynucleotides comprise at least one nucleotide polymorphism encoding a mutant Weel molecule. As will be appreciated by the skilled practitioner in the art, the degeneracy of the genetic code results in the production of a multitude of nucleotide sequences encoding a Weel polypeptide. Some of the degenerate sequences may bear minimal homology to the nucleotide sequences of the Weel. Accordingly, the present invention contemplates each and every possible variation of nucleotide sequence that could be made by selecting combinations based on possible codon choices. These combinations are made in accordance with the standard triplet genetic code as applied to the nucleotide sequence of the originally identified Weel polypeptides, and all such variations are to be considered as being specifically disclosed.

For some purposes, it may be advantageous to produce polynucleotides encoding a Weel polypeptide, or its fragments, variants, or derivatives, which possess a substantially different codon usage. Codons may be selected to increase the rate at which expression of the peptide/polypeptide occurs in a particular prokaryotic or eukaryotic host in accordance with the frequency with which particular codons are utilized by the host. Alterations in codon usage can also be used to produce RNA transcripts having more desirable properties, such as a greater half-life, than transcripts produced from the naturally occurring sequence. In particular, RNA molecules may be modified to increase intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends of the molecule, or the use of phosphorothioate or 2' O-methyl, rather than phosphodiesterase linkages within the backbone of the molecule. This concept is inherent in the production of PNAs and can be extended in all of these molecules by the inclusion of nontraditional bases such as inosine, queosine, and wybutosine, as well as acetyl- , methyl-, thio-, and similarly modified forms of adenine, cytosine, guanine, thymine, and uridine which are not as easily recognized by endogenous endonucleases.

The Weel polynucleotides, and complementary sequences, and fragments thereof, can be engineered using methods generally known in the art in order to alter the sequences for a variety of reasons, including, but not limited to, alterations which modify the cloning, processing, and/or expression of the gene product. For example, DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides may be used to engineer the nucleotide sequences. In addition, site-directed mutagenesis may be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, or introduce mutations, and the like.

Also encompassed by the invention derivatives of the Weel polynucleotides, and complementary sequences, and fragments thereof, which comprise one or more chemical modification, for example, replacement of hydrogen by an alkyl, acyl, or amino group. Alternatively, derivative polynucleotides may comprise non-naturally-occurring portions, such as altered sugar moieties or inter-sugar linkages. Exemplary among these are phosphorothioate and other sulfur containing species which are known in the art. Derivative polynucleotides may also contain detection labels, including radionucleotides (e.g., ³²P, ³H, and ³⁵S), enzymes, fluorescent (e.g., rhodamine, fluorescein, and Cy3, Cy5), chemiluminescent, or chromogenic, and other labels (e.g., DNP, digoxigenin, and biotin) such as substrates, cofactors, inhibitors, magnetic particles, and the like.

A wide variety of labels and conjugation techniques are known and employed by those skilled in the art. Nucleic acid labeling can be achieved by oligo-labeling, nick translation, end-labeling, or PCR amplification using a labeled primer. Alternatively, polynucleotides, or any portions or fragments thereof, may be cloned into a vector for the production of labeled mRNA sequences. Such vectors are known in the art, are commercially available, and may be used to synthesize labeled RNA in vitro by addition of an appropriate RNA polymerase, such as T7, T3, or SP(6) and labeled nucleotides. These procedures may be conducted using a variety of commercially available kits (e.g., from Amersham- Pharmacia; Promega Corp.; and U.S. Biochemical Corp., Cleveland, Ohio).

The present invention also encompasses the production of polynucleotides, or portions thereof, which encode a Weel polypeptide, see, for example, Table 1, and its fragments, and derivatives, by any means. For example, synthetic chemistry (see, for example, M. H. Caruthers et al., 1980, Nucl. Acids Res. Symp. Ser., 215-223 and T. Horn et al., 1980, Nucl. Acids Res. Symp. Ser., 225-232). After production, the synthetic sequence may be inserted into any of the many available expression vectors and cell systems using reagents that are well known to those in the art. Moreover, synthetic chemistry may be used to introduce mutations into a sequence encoding a Weel polypeptide, or any fragment, variant, or derivative thereof. Alternatively, the polynucleotides of the invention can be produced by PCR amplification of the cloned sequences. In addition, the polynucleotides may be produced by recombinant systems, including cell-based and cell-free systems.

Polynucleotides that encode a Weel polypeptide, or fragments, variants, or derivatives thereof, may be used in recombinant DNA molecules to direct the expression of a Weel, or fragments or functional equivalents thereof, in appropriate host cells. Because of the inherent degeneracy of the genetic code, other DNA sequences, which encode substantially the same or a functionally equivalent amino acid sequence, may be produced and these sequences may be used to clone and express a Weel polypeptide. For expression in recombinant systems, a start and stop codons may be added to the nucleic acid sequence of a Weel polypeptide. In addition, nucleotide sequences encoding epitopes or protein tags can be added to the nucleic acid sequence of the Weel polypeptide, as described in detail herein. Methods of cloning and expression are well known to those skilled in the art and are described in numerous publication's, for example, Sambrook, Fritsch, and Maniatis, Molecular Cloning: a Laboratory Manual, 2^nd Edition, Cold Spring Harbor Laboratory Press, USA, (1989).

In another preferred embodiment, Weel molecules, e.g. polynucleotides comprise one or more substitutions or modifications. The polymorphisms may be consecutive or dispersed along the molecule. Any polynucleotide that encodes an amino acid sequence of a Weel polypeptide or peptide, or complementary sequences, or related fragments or variants, is included in the invention. Polynucleotide variants of the present invention include, but are not limited to, variants that share at least 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% nucleotide sequence identity with Weel.

In another preferred embodiment, SEQ ID NOS: 1-13 comprise one or more modifications.

In one embodiment, the nucleobases are substituted with locked nucleic acids (LNA). Certain preferred oligonucleotides of this invention are chimeric oligonucleotides. "Chimeric oligonucleotides" or "chimeras," in the context of this invention, are oligonucleotides which contain two or more chemically distinct regions, each made up of at least one nucleotide. These oligonucleotides typically contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells). In another preferred embodiment, the region of the oligonucleotide which is modified comprises at least one nucleotide modified at the 2' position of the sugar, most preferably a 2'-O-alkyl, 2'-O-alkyl-O-alkyl or 2'-fluoro-modified nucleotide. In other preferred embodiments, RNA modifications include 2'-fluoro, 2'-amino and 2' O-methyl modifications on the ribose of pyrymidines, abasic residues or an inverted base at the 3' end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these oligonucleotides have been shown to have a higher T_m (i.e., higher target binding affinity) than; 2'-deoxyoligonucleotides against a given target. The effect of such increased affinity is to greatly enhance RNAi oligonucleotide inhibition of gene expression. RNAse H is a cellular endonuclease that cleaves the RNA strand of RNA:DNA duplexes; activation of this enzyme therefore results in cleavage of the RNA target, and thus can greatly enhance the efficiency of RNAi inhibition. Cleavage of the RNA target can be routinely demonstrated by gel electrophoresis. In another preferred embodiment, the chimeric oligonucleotide is also modified to enhance nuclease resistance. Cells contain a variety of exo- and endo-nucleases which can degrade nucleic acids. A number of nucleotide and nucleoside modifications have been shown to make the oligonucleotide into which they are incorporated more resistant to nuclease digestion than the native oligodeoxynucleotide. Nuclease resistance is routinely measured by incubating oligonucleotides with cellular extracts or isolated nuclease solutions and measuring the extent of intact oligonucleotide remaining over time, usually by gel electrophoresis. Oligonucleotides which have been modified to enhance their nuclease resistance survive intact for a longer time than unmodified oligonucleotides. A variety of oligonucleotide modifications have been demonstrated to enhance or confer nuclease resistance. Oligonucleotides which contain at least one phosphorothioate modification are presently more preferred. In some cases, oligonucleotide modifications which enhance target binding affinity are also, independently, able to enhance nuclease resistance. Some desirable modifications can be found in De Mesmaeker et al. Ace. Chem. Res. 1995, 28:366-374.

Specific examples of some preferred oligonucleotides envisioned for this invention include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Most preferred are oligonucleotides with phosphorothioate backbones and those with heteroatom backbones, particularly CH₂ --NH-O-CH₂, CH,-N(CH₃)-O-CH₂ [known as a methylene(methylimino) or MMI backbone], CH₂ --O--N (CH₃)-CH₂, CH₂ -N (CH₃)-N (CH₃)- CH₂ and O— N (CH₃)- CH₂ -CH₂ backbones, wherein the native phosphodiester backbone is represented as O— P-- O— CH,). The amide backbones disclosed by De

Mesmaeker et al. Ace. Chem. Res. 1995, 28:366-374) are also preferred. Also preferred are oligonucleotides having morpholino backbone structures (Summerton and Weller, U.S. Pat. No. 5,034,506). In other preferred embodiments, such as the peptide nucleic acid (PNA) backbone, the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleobases being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone (Nielsen et al. Science 1991, 254, 1497). Oligonucleotides may also comprise one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 2' position: OH, SH, SCH₃, F, OCN, OCH₃ OCH₃, OCH₃ 0(CH₂)_n CH₃, 0(CH₂)_n NH₂ or 0(CH₂)_n CH₃ where n is from 1 to about 10; C₁ to C₁₀ lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF₃ ; OCF₃; O-, S--, or N-alkyl; O-, S-, or N-alkenyl; SOCH₃; SO₂ CH₃; ONO₂; NO₂; N₃; NH₂; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or a group for improving the pharmacodynamic properties of an oligonucleotide and other substituents having similar properties. A preferred modification includes 2'-methoxyethoxy [2'-0-CH₂ CH₂ OCH₃, also known as 2'-O-(2-methoxyethyl)] (Martin et al., HeIv. Chim. Acta, 1995, 78, 486). Other preferred modifications include T- methoxy (2'-0-CH₃), 2'-propoxy (2'-OCH₂ CH₂CH₃) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group.

Oligonucleotides may also include, additionally or alternatively, nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5- Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2' deoxycytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2- (methylamino)adenine, 2-(imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other hetero substituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5- hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N₆ (6-aminohexyl)adenine and 2,6- diaminopurine. Kornberg, A., DNA Replication, W. H. Freeman & Co., San Francisco, 1980, pp75-77; Gebeyehu, G., et al. Nucl. Acids Res. 1987, 15:4513). A "universal" base known in the art, e.g., inosine, may be included. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2⁰C. (Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions.

Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety, a cholesteryl moiety (Letsinger et al., P roc. Natl. Acad. ScL USA 1989, 86, 6553), cholic acid (Manoharan et al. Bioorg. Med. Chem. Let. 1994, 4, 1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al. Ann. NY. Acad. Sci. 1992, 660, 306; Manoharan et al. Bioorg. Med. Chem. Let. 1993, 3, 2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res. 1992, 20, 533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al. EMBO J. 1991, 10, 111; Kabanov et al. FEBS Lett. 1990, 259, 327; Svinarchuk et al. Biochimie 1993, 75, 49), a phospholipid, e.g., di-hexadecyl-rac- glycerol or triethylammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al. Tetrahedron Lett. 1995, 36, 3651; Shea et al. Nucl. Acids Res. 1990, 18, 3777), a polyamine or a polyethylene glycol chain (Manoharan et al. Nucleosides & Nucleotides 1995, 14, 969), or adamantane acetic acid (Manoharan et al. Tetrahedron Lett. 1995, 36, 3651). Oligonucleotides comprising lipophilic moieties, and methods for preparing such oligonucleotides are known in the art, for example, U.S. Pat. Nos. 5,138,045, 5,218,105 and 5,459,255. It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single oligonucleotide or even at within a single nucleoside within an oligonucleotide. The present invention also includes oligonucleotides which are chimeric oligonucleotides as hereinbefore defined. In another embodiment, the nucleic acid molecule of the present invention is conjugated with another moiety including but not limited to abasic nucleotides, polyether, polyamine, polyamides, peptides, carbohydrates, lipid, or polyhydrocarbon compounds. Those skilled in the art will recognize that these molecules can be linked to one or more of any nucleotides comprising the nucleic acid molecule at several positions on the sugar, base or phosphate group.

The oligonucleotides used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the talents of one of ordinary skill in the art. It is also well known to use similar techniques to prepare other oligonucleotides such as the phosphorothioates and alkylated derivatives. It is also well known to use similar techniques and commercially available modified amidites and controlled-pore glass (CPG) products such as biotin, fluorescein, acridine or psoralen-modified amidites and/or CPG (available from Glen Research, Sterling VA) to synthesize fluorescently labeled, biotinylated or other modified oligonucleotides such as cholesterol-modified oligonucleotides.

Polypeptides: The Weel polypeptides, peptides, or fragments or variants thereof, may be linked to short tags, e.g., epitope tags such as HA and the like, or to other proteins, such as GST, GFP (e.g., GFP Y66F, GFP Y66H, GFP Y66W, wild type GFP, GFP S65A, GFP S65L, GFP S65T, ECFP, EYFP, DsRed; BD Biosciences CLONTECH, Palo Alto, Calif.), thioredoxin, maltose binding protein, etc. Also provided by the invention are chemically modified derivatives of the peptides and polypeptides of the invention that may provide additional advantages such as increased solubility, stability, and circulating time of the polypeptide. The chemical moieties for derivitization may be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like. The polypeptides may be modified at random positions within the molecule, or at predetermined positions within the molecule and may include one, two, three or more attached chemical moieties. In addition, amino acid sequence variants of the present invention include, but are not limited to, variants that share at least 40%, 50%, 60%, 61%, 67%, 70%, 74%, 76%, 80%, 81%, 84%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% nucleotide sequence identity with Weel or any other protein or polypeptide that a user may select. Polypeptide and peptide variants include variants differing by the addition, deletion, or substitution of one or more amino acid residues. For example, to isolate Weel polypeptides or peptides, it may be useful to encode a tagged Weel peptide or polypeptide that can be recognized by a commercially available antibody. In particular, a peptide or polypeptide can be fused or linked to epitope tags (e.g., FLAG, HA, GST, thioredoxin, maltose binding protein, etc.), or affinity tags such as biotin and/or streptavidin. As one example, a system for the ready purification of non-denatured fusion proteins expressed in human cell lines has been described by Janknecht et al., (1991, Proc. Natl. Acad. Sci. USA, 88:8972-8976). In this system, the gene of interest is subcloned into a vaccinia recombination plasmid such that the open reading frame of the gene is translationally fused to an amino-terminal tag having six histidine residues. The tag serves as a matrix -binding domain for the fusion protein. Extracts from cells infected with the recombinant vaccinia virus are loaded onto an Ni²⁺ nitriloacetic acid-agarose column and histidine-tagged proteins are selectively eluted with imidazole-containing buffers. A peptide or polypeptide tagged with an epitope or protein may also be engineered to contain a cleavage site located between the binder coding sequence and the tag coding sequence. This can be used to remove the tag, and isolate the Weel peptide or polypeptide. The Weel peptides or polypeptides of the invention can be covalently attached to chemical moieties via the amino acid backbone. For these purposes, the peptides or polypeptides may be modified by N- or C-terminal processing of the sequences (e.g., proteolytic processing), deletion of the N-terminal methionine residue, etc. The polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein, as described in detail herein.

Also included are modified polypeptides and peptides in which one or more residues are modified, and mutants comprising one or more modified residues. Amino acid variants of the invention can be generated by employing the techniques of gene- shuffling, motif- shuffling, exon- shuffling, and/or codon- shuffling (collectively referred to as "DNA shuffling"). DNA shuffling can be employed to generate peptides or polypeptides with altered activity. See, generally, U.S. Pat. Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and 5,837,458, and Patten et al, 1997, Curr. Opinion Biotechnol., 8:724-33; Harayama,

1998, Trends Biotechnol., 16(2):76-82; Hansson, et al., 1999, /. MoI. Biol., 287:265-76; and Lorenzo and Blasco, 1998, Biotechniques, 24(2):308-313, the contents of each of which are hereby incorporated by reference in its entirety.

In one embodiment of the invention, alteration of one or more of the Weel polypeptide sequences can be achieved by DNA shuffling. DNA shuffling involves the assembly of two or more DNA segments by homologous or site-specific recombination to generate variation in the protein-coding sequence. In another embodiment, the encoded peptides or polypeptides, may be altered by subjecting the coding sequences error-prone PCR, random nucleotide insertion, or other methods, prior to recombination. In another embodiment, one or more components, motifs, sections, parts, domains, fragments, etc., of a polynucleotide encoding a peptide or polypeptide of this invention may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules. The peptides and polypeptides may be differentially modified during or after translation, e.g., by derivatization with known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Useful modifications may include glycosylation, amidation, phosphorylation, sulfation, reduction/alkylation (Tarr, 1986, Methods of Protein Microcharacterization, J. E. Silver, Ed., Humana Press, Clifton, NJ. , pp. 155-194); acylation (Tarr, supra); chemical coupling (Mishell and Shiigi (Eds), 1980, Selected Methods in Cellular Immunology, W H Freeman, San Francisco, Calif.; U.S. Pat. No. 4,939,239); and mild formalin treatment (Marsh, 1971, Int. Arch, of Allergy and Appl. Immunol. 41:199-215). Any of numerous chemical modifications may be carried out by known techniques, including but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH4; acetylation, formylation, oxidation, reduction; metabolic synthesis in the presence of tunicamycin; etc. Additional post-translational modifications encompassed by the invention include, for example, e.g., attachment of N-linked or O-linked carbohydrate chains, processing of N-terminal or C- terminal ends, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of prokaryotic host cell expression.

Additionally, D-amino acids, non-natural amino acids, or non-amino acid analogs can be substituted or added to produce a modified polypeptide. Furthermore, the polypeptides disclosed herein can be modified using polyethylene glycol (PEG) according to known methods (S. I. Wie et ah, 1981, Int. Arch. Allergy Appl. Immunol. 64(l):84-99) to produce a protein conjugated with PEG. In addition, PEG can be added during chemical synthesis of the protein. Modifications or sequence variations may occur at the amino- or carboxy- terminal positions of the reference polypeptide sequence or anywhere between those terminal positions, interspersed either individually among the amino acids in the reference sequence or in one or more contiguous groups within the reference sequence. The polypeptides and peptides of this invention can be isolated, synthetic, or recombinant. The amino acid sequences may be obtained as individual polypeptides or peptides, or part of a complex. Polypeptides or peptides may also be modified with a label capable of providing a detectable signal, either directly or indirectly, including, but not limited to, radioisotope, fluorescent, and enzyme labels. Fluorescent labels include, for example, Coumarin (e.g., Hydroxycoumarin, Aminocoumarin, Methoxycoumarin), R-Phycoerythrin (PE), Fluorescein, FITC, Fluor X, DTAF, Auramine, Alexa (e.g., ALEXA FLUOR™ 350, -430, -488, -532, - 546, -555, -568, -594, -633, -647, -660, -680, -700, -750), BODIPY-FL, Sulforhodamine (e.g., Texas Red™), Carbocyanine (e.g., Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7), Rhodamine, XRITC, TRITC, Lissamine Rhodamine B, Peridinin Chlorphyll Protein (PerCP), Allophycocyanin (APC), PE-Cy5 conjugates (e.g., Cychrome, TRI-COLOR™, QUANTUM RED™), PE-Cy5.5 conjugates, PE-Cy7 conjugates, PE- Texas Red conjugates (e.g., Red613), PC5-PE-Cy5 conjugates, PerCP-Cy5.5 conjugates (e.g., TruRed), APC-Cy5.5 conjugates, APC-Cy7 conjugates, ECD-PE-Texas Red conjugates, Sulfonated Pyrene (e.g., Cascade Blue), AMCA Blue, Lucifer Yellow.

Preferred isotope labels include ³H, ¹⁴C, ³²P, ³⁵S, ³⁶Cl, ⁵¹Cr, ⁵⁷Co, ⁵⁸Co, ⁵⁹Fe, ⁹⁰Y, ¹²⁵I, ¹³¹I, and ¹⁸⁶Re. Preferred enzyme labels include peroxidase, β-glucuronidase, β-D- glucosidase, β-D-galactosidase, urease, glucose oxidase plus peroxidase, and alkaline phosphatase (see, e.g., U.S. Pat. Nos. 3,654,090; 3,850,752 and 4,016,043). Enzymes can be conjugated by reaction with bridging molecules such as carbodiimides, diisocyanates, glutaraldehyde, and the like. Enzyme labels can be detected visually, or measured by calorimetric, spectrophotometric, fluorospectrophotometric, amperometric, or gasometric techniques. Other labeling systems, such as avidin/biotin, colloidal gold (e.g.,

NANOGOLD™), Tyramide Signal Amplification (TSA™), are known in the art, and are commercially available (see, e.g., ABC kit, Vector Laboratories, Inc., Burlingame, Calif.; NEN™ Life Science Products, Inc., Boston, Mass.; Nanoprobes, Inc., 95 Horse Block Road, Yaphank, N.Y.). Polypeptides may be produced by direct peptide synthesis using solid-phase techniques (J. Merrifield, 1963, /. Am. Chem. Soc, 85:2149-2154; J. Y. Roberge et al, 1995, Science, 269:202-204). Protein or peptide synthesis may be performed using manual techniques or by automation. Automated synthesis may be achieved, for example, using ABI 431A Peptide Synthesizer (PE Biosystems). Various fragments of a biomarker polypeptide or peptide can be chemically synthesized separately and then combined using chemical methods to produce the full-length molecule. The newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e.g., T. Creighton, 1983, Proteins, Structures and Molecular Principles, W. H. Freeman and Co., New York, N. Y.), by reversed-phase high performance liquid chromatography, or other purification methods as are known in the art. The composition of the synthetic peptides may be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; Creighton, supra). In addition, the amino acid sequence of peptide or polypeptide or any portion thereof, may be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins, or any part thereof, to produce a variant peptide or polypeptide.

Diagnostics: In a preferred embodiment, a patient can be diagnosed with diseases associated with abnormal cell proliferation, protein degradation etc, by identifying at least one or more Weel molecules, Weel mutants, variants, at least one of SEQ ID NOS: 1-13 and the like.

Identification of Candidate Therapeutic Agents

In a preferred embodiment, the high-throughput screening assay (HTS) screening assay is used to screen a diverse library of member compounds. The "compounds" or

"candidate therapeutic agents" or "candidate agents" can be any organic, inorganic, small molecule, protein, antibody, aptamer, nucleic acid molecule, or synthetic compound.

In another preferred embodiment, methods (also referred to herein as "screening assays") are provided for identifying modulators, i.e., candidate or test compounds or agents (e.g., proteins, peptides, peptidomimetics, peptoids, small molecules or other drugs) which modulate the degradation of proteins, e.g. Weel and also identify protein or peptide docking sites, phosphorylation sites etc. Compounds thus identified can be used to modulate the activity of target gene products, prolong the half-life of a protein or peptide, regulate cell division, etc, in a therapeutic protocol, to elaborate the biological function of the target gene product, or to identify compounds that disrupt normal target gene interactions.

In another preferred embodiment, the candidate agents modulate enzymes. These enzymes can be involved in various biochemical pathways such as synthetic pathways, breakdown pathways, e.g. ubiquitin, enzymatic pathways, protein trafficking pathways, metabolic pathways, signal transduction pathways, and the like. These pathways include prokaryotic and eukaryotic pathways.

In another preferred embodiment, the high throughput assays identifies candidate agents that target and modulate bacterial pathways. The candidate agents would be useful in developing and identifying novel antibiotic or other antimicrobial agents.

In one embodiment, the invention provides assays for screening candidate or test compounds which modulate the phosphorylation of Weel protein or polypeptide or a biologically active portion thereof, mutants or fragments thereof. In other embodiments, proteins other than Weel are used, for example, ubiquitin, molecules required in cell proliferation, receptors, ligands and the like.

In another embodiment, the invention provides assays for screening candidate or test compounds that bind to or modulate an activity of Weel protein or polypeptide or a biologically active portion thereof, mutants or fragments, or fusion proteins thereof.

Candidate agents include numerous chemical classes, though typically they are organic compounds including small organic compounds, nucleic acids including oligonucleotides, and peptides. Small organic compounds suitably may have e.g. a molecular weight of more than about 40 or 50 yet less than about 2,500. Candidate agents may comprise functional chemical groups that interact with proteins and/or DNA.

The test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; peptoid libraries (libraries of molecules having the functionalities of peptides, but with a novel, non-peptide backbone which are resistant to enzymatic degradation but which nevertheless remain bioactive; see, e.g., Zuckermann, R. N. et al. (1994) /. Med. Chem. 37:2678-85); spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the one-bead one- compound library method; and synthetic library methods using affinity chromatography selection. The biological library and peptoid library approaches are limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam (1997) Anticancer Drug Des. 12:145).

Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc. Natl. Acad. Sci. U.S.A. 90:6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91:11422; Zuckermann et al. (1994). /. Med. Chem. 37:2678; Cho et al. (1993) Science 261:1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl.

33:2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061; and Gallop et al. (1994) J. Med. Chem. 37:1233.

Libraries of compounds may be presented in solution (e.g., Houghten (1992) Biotechniques 13:412-421), or on beads (Lam (1991) Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556), bacteria (Ladner, U.S. Pat. No. 5,223,409), spores (Ladner U.S. Pat. No. 5,223,409), plasmids (Cull et al. (1992) Proc Nat'lAcad Sci USA 89:1865-1869) or on phage (Scott and Smith (1990) Science 249:386-390; Devlin (1990) Science 249:404-406; Cwirla et al. (1990) Proc. Natl. Acad. Sci. 87:6378-6382; Felici (1991) /. MoI. Biol. 222:301- 310; Ladner supra.).

In another preferred embodiment, the candidate therapeutic agent comprises, proteins, peptides, organic molecules, inorganic molecules, nucleic acid molecules, and the like. These molecules can be natural, e.g. from plants, fungus, bacteria etc., or can be synthesized or synthetic.

A prototype compound may be believed to have therapeutic activity on the basis of any information available to the artisan. For example, a prototype compound may be believed to have therapeutic activity on the basis of information contained in the Physician's Desk Reference. In addition, by way of non-limiting example, a compound may be believed to have therapeutic activity on the basis of experience of a clinician, structure of the compound, structural activity relationship data, EC₅₀, assay data, IC₅₀ assay data, animal or clinical studies, or any other basis, or combination of such bases.

A therapeutic ally- active compound is a compound that has therapeutic activity, including for example, the ability of a compound to induce a specified response when administered to a subject or tested in vitro. Therapeutic activity includes treatment of a disease or condition, including both prophylactic and ameliorative treatment. Treatment of a disease or condition can include improvement of a disease or condition by any amount, including prevention, amelioration, and elimination of the disease or condition. Therapeutic activity may be conducted against any disease or condition, including in a preferred embodiment against human immunodeficiency virus, cancer, arthritis or any combination thereof. In order to determine therapeutic activity any method by which therapeutic activity of a compound may be evaluated can be used. For example, both in vivo and in vitro methods can be used, including for example, clinical evaluation, EC₅₀, and IC₅₀ assays, and dose response curves.

Candidate compounds for use with an assay of the present invention or identified by assays of the present invention as useful pharmacological agents can be pharmacological agents already known in the art or variations thereof or can be compounds previously unknown to have any pharmacological activity. The candidate compounds can be naturally occurring or designed in the laboratory. Candidate compounds can comprise a single diastereomer, more than one diastereomer, or a single enantiomer, or more than one enantiomer. Candidate compounds can be isolated, from microorganisms, animals or plants, for example, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, candidate compounds of the present invention can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one -bead one-compound" library method, and synthetic library methods using affinity chromatography selection. The biological library approach is limited to polypeptide libraries. The other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds and are preferred approaches in the present invention. See Lam, Anticancer Drug Des. 12: 145-167 (1997).

In an embodiment, the present invention provides a method of identifying a candidate compound as a suitable prodrug. A suitable prodrug includes any prodrug that may be identified by the methods of the present invention. Any method apparent to the artisan may be used to identify a candidate compound as a suitable prodrug.

In another aspect, the present invention provides methods of screening candidate compounds for suitability as therapeutic agents. Screening for suitability of therapeutic agents may include assessment of one, some or many criteria relating to the compound that may affect the ability of the compound as a therapeutic agent. Factors such as, for example, efficacy, safety, efficiency, retention, localization, tissue selectivity, degradation, or intracellular persistence may be considered. In an embodiment, a method of screening candidate compounds for suitability as therapeutic agents is provided, where the method comprises providing a candidate compound identified as a suitable prodrug, determining the therapeutic activity of the candidate compound, and determining the intracellular persistence of the candidate compound. Intracellular persistence can be measured by any technique apparent to the skilled artisan, such as for example by radioactive tracer, heavy isotope labeling, or LCMS.

In screening compounds for suitability as therapeutic agents, intracellular persistence of the candidate compound is evaluated. In a preferred embodiment, the agents are evaluated for their ability to modulate the protein or peptide intracellular persistence may comprise, for example, evaluation of intracellular residence time or half- life in response to a candidate therapeutic agent. In a preferred embodiment, the half-life of a protein or peptide in the presence or absence of the candidate therapeutic compound in human tissue is determined. Half-life may be determined in any tissue. Any technique known to the art worker for determining intracellular persistence may be used in the present invention. By way of non- limiting example, persistence of a compound may be measured by retention of a radiolabeled or dye labeled substance. A further aspect of the present invention relates to methods of inhibiting the activity of a condition or disease comprising the step of treating a sample or subject believed to have a disease or condition with a prodrug identified by a compound of the invention. Compositions of the invention act as identifiers for prodrugs that have therapeutic activity against a disease or condition. In a preferred aspect, compositions of the invention act as identifiers for drugs that show therapeutic activity against conditions including for example cancer, inflammation, rheumatoid arthritis, autoimmune diseases, neurological diseases, immunosuppression and the like, or any combination thereof. For example, Alzheimer's disease has been shown to be due to the accumulation of certain proteins resulting in amyloid plaques and neurofibrillary tangles composed of misplaced proteins. Modulation in the half- life of these proteins so that they degrade as in normal individuals would be of great therapeutic value, not to mention the economic value and benefit to society as a whole. Compositions of the invention may also act as identifiers for drugs that have therapeutic activity against infectious agents. Infectious agents against which the therapeutic agents may be effective include, without limitation, bacteria, viruses, and yeast. For example, modulation of the turn over or half-life of certain proteins or peptides could target the replication machinery of a cell, increase degradation of enzymes etc, and would prevent a virus from performing essential steps in the viral cycle, thus preventing spread of the virus, e.g. HIV.

If desired, after application of an identified prodrug, the amount of an infectious organism or the level or any material indicative of the infection or condition may be observed by any method including direct and indirect methods of detecting such level. Quantitative, semi-quantitative, and qualitative methods of determining such a level are all contemplated. Any method, including but not limited to, observation of the physiological properties of a living organism, are also applicable. In one embodiment, a screening assay is a cell-based assay in which a cell expresses a protein- or peptide-detectable marker construct or fusion protein construct, for example, Weel-luciferase, or mutants thereof, which is contacted with a test compound, and the ability of the test compound to modulate the protein- or peptide or fusion protein half- life or turnover is determined. Determining the ability of the test compound to modulate the protein- or peptide-detectable marker half- life or fusion protein or turnover can be accomplished by monitoring, for example, using the degradation assays described in detail in the Examples section which follows. The cell, for example, can be of mammalian origin, e.g., human. Any one or more of the above constructs can be used.

In another preferred embodiment, the screening assay is a high-throughput screening assay. The ability of a compound to interact with the docking site or for the identification of the docking site on a protein or peptide can be evaluated as described in detail in the Examples which follow. In another preferred embodiment, soluble and/or membrane-bound forms of isolated proteins, mutants or biologically active portions thereof, can be used in the assays if desired. When membrane-bound forms of the protein are used, it may be desirable to utilize a solubilizing agent. Examples of such solubilizing agents include non-ionic detergents such as n-octylglucoside, n-dodecylglucoside, n-dodecylmaltoside, octanoyl-N-methylglucamide, decanoyl-N-methylglucamide, TRITON™ X-100, TRITON™ X-114, THESIT™,

Isotridecypoly(ethylene glycol ether)_n, 3-[(3-cholamidopropyl)dimethylamminio]-l-propane sulfonate (CHAPS), 3- [(3-cholamidopropyl)dimethylamminio] -2-hydroxy- 1 -propane sulfonate (CHAPSO), or N-dodecyl=N,N-dimethyl-3-ammonio-l -propane sulfonate.

Cell-free assays can also be used and involve preparing a reaction mixture of the target gene protein and the test compound under conditions and for a time sufficient to allow the two components to interact and bind, thus forming a complex that can be removed and/or detected.

The interaction between two molecules can also be detected, e.g., using fluorescence energy transfer (FET) (see, for example, Lakowicz et al., U.S. Pat. No. 5,631,169; Stavrianopoulos, et al, U.S. Pat. No. 4,868,103). A fluorophore label on the first, 'donor' molecule is selected such that its emitted fluorescent energy will be absorbed by a fluorescent label on a second, 'acceptor' molecule, which in turn is able to fluoresce due to the absorbed energy. Alternately, the 'donor' protein molecule may simply utilize the natural fluorescent energy of tryptophan residues. Labels are chosen that emit different wavelengths of light, such that the 'acceptor' molecule label may be differentiated from that of the 'donor'. Since the efficiency of energy transfer between the labels is related to the distance separating the molecules, the spatial relationship between the molecules can be assessed. In a situation in which binding occurs between the molecules, the fluorescent emission of the 'acceptor' molecule label in the assay should be maximal. A FET binding event can be conveniently measured through standard fluorometric detection means well known in the art (e.g., using a fluorimeter). In another embodiment, determining the ability of a protein to bind or "dock" to a target molecule or docking site on a target molecule can be accomplished using real-time Biomolecular Interaction Analysis (BIA) (see, e.g., Sjolander, S. and Urbaniczky, C. (1991) Anal. Chem. 63:2338-2345 and Szabo et al. (1995) Curr. Opin. Struct. Biol. 5:699-705). "Surface plasmon resonance" or "BIA" detects biospecific interactions in real time, without labeling any of the interactants (e.g., BLAcore). Changes in the mass at the binding surface (indicative of a binding event) result in alterations of the refractive index of light near the surface (the optical phenomenon of surface plasmon resonance (SPR)), resulting in a detectable signal which can be used as an indication of real-time reactions between biological molecules. In one embodiment, the target product or the test substance is anchored onto a solid phase. The target product/test compound complexes anchored on the solid phase can be detected at the end of the reaction. Preferably, the target product can be anchored onto a solid surface, and the test compound, (which is not anchored), can be labeled, either directly or indirectly, with detectable labels discussed herein. Candidate agents may be obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides. Alternatively, libraries of natural compounds in the form of e.g. bacterial, fungal and animal extracts are available or readily produced. Chemical Libraries: Developments in combinatorial chemistry allow the rapid and economical synthesis of hundreds to thousands of discrete compounds. These compounds are typically arrayed in moderate-sized libraries of small molecules designed for efficient screening. Combinatorial methods can be used to generate unbiased libraries suitable for the identification of novel compounds. In addition, smaller, less diverse libraries can be generated that are descended from a single parent compound with a previously determined biological activity. In either case, the lack of efficient screening systems to specifically target therapeutically relevant biological molecules produced by combinational chemistry such as inhibitors of important enzymes hampers the optimal use of these resources. A combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis, by combining a number of chemical "building blocks," such as reagents. For example, a linear combinatorial chemical library, such as a polypeptide library, is formed by combining a set of chemical building blocks (amino acids) in a large number of combinations, and potentially in every possible way, for a given compound length (i.e., the number of amino acids in a polypeptide compound). Millions of chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks.

A "library" may comprise from 2 to 50,000,000 diverse member compounds. Preferably, a library comprises at least 48 diverse compounds, preferably 96 or more diverse compounds, more preferably 384 or more diverse compounds, more preferably, 10,000 or more diverse compounds, preferably more than 100,000 diverse members and most preferably more than 1,000,000 diverse member compounds. By "diverse" it is meant that greater than 50% of the compounds in a library have chemical structures that are not identical to any other member of the library. Preferably, greater than 75% of the compounds in a library have chemical structures that are not identical to any other member of the collection, more preferably greater than 90% and most preferably greater than about 99%.

The preparation of combinatorial chemical libraries is well known to those of skill in the art. For reviews, see Thompson et al, Synthesis and application of small molecule libraries, Chem Rev 96:555-600, 1996; Kenan et al, Exploring molecular diversity with combinatorial shape libraries, Trends Biochem Sci 19:57-64, 1994; Janda, Tagged versus untagged libraries: methods for the generation and screening of combinatorial chemical libraries, Proc Natl Acad Sci USA. 91:10779-85, 1994; Lebl et al, One-bead-one-structure combinatorial libraries, Biopolymers 37:177-98, 1995; Eichler et al, Peptide, peptidomimetic, and organic synthetic combinatorial libraries, Med Res Rev. 15:481-96, 1995; Chabala, Solid-phase combinatorial chemistry and novel tagging methods for identifying leads, Curr Opin Biotechnol. 6:632-9, 1995; Dolle, Discovery of enzyme inhibitors through combinatorial chemistry, MoI Divers. 2:223-36, 1997; Fauchere et al, Peptide and nonpeptide lead discovery using robotically synthesized soluble libraries, Can J. Physiol Pharmacol. 75:683-9, 1997; Eichler et al, Generation and utilization of synthetic combinatorial libraries, MoI Med Today 1: 174-80, 1995; and Kay et al, Identification of enzyme inhibitors from phage-displayed combinatorial peptide libraries, Comb Chem High Throughput Screen 4:535-43, 2001. Other chemistries for generating chemical diversity libraries can also be used. Such chemistries include, but are not limited to, peptoids (PCT Publication No. WO 91/19735); encoded peptides (PCT Publication WO 93/20242); random bio-oligomers (PCT Publication No. WO 92/00091); benzodiazepines (U.S. Pat. No. 5,288,514); diversomers, such as hydantoins, benzodiazepines and dipeptides (Hobbs, et al, Proc. Nat. Acad. Sci. USA, 90:6909-6913 (1993)); vinylogous polypeptides (Hagihara, et al., J. Amer. Chem. Soc 114:6568 (1992)); nonpeptidal peptidomimetics with β-D-glucose scaffolding (Hirschmann, et al., J. Amer. Chem. Soc, 114:9217-9218 (1992)); analogous organic syntheses of small compound libraries (Chen, et al., J. Amer. Chem. Soc, 116:2661 (1994)); oligocarbamates (Cho, et al, Science, 261 : 1303 (1993)); and/or peptidyl phosphonates (Campbell, et al, J. Org. Chem. 59:658 (1994)); nucleic acid libraries (see, Ausubel, Berger and Sambrook, all supra); peptide nucleic acid libraries (see, e.g., U.S. Pat. No. 5,539,083); antibody libraries (see, e.g., Vaughn, et al, Nature Biotechnology, 14(3):309-314 (1996) and PCT/US96/10287); carbohydrate libraries (see, e.g., Liang, et al, Science, 274:1520-1522 (1996) and U.S. Pat. No. 5,593,853); small organic molecule libraries (see, e.g., benzodiazepines, Baum C&E News, January 18, page 33 (1993); isoprenoids (U.S. Pat. No. 5,569,588); thiazolidinones and metathiazanones (U.S. Pat. No. 5,549,974); pyrrolidines (U.S. Pat. Nos. 5,525,735 and 5,519,134); morpholino compounds (U.S. Pat. No. 5,506,337); benzodiazepines (U.S. Pat. No. 5,288,514); and the like. Devices for the preparation of combinatorial libraries are commercially available (see, e.g., 357 MPS, 390 MPS, Advanced Chem. Tech, Louisville Ky., Symphony, Rainin, Woburn, Mass., 433A Applied Biosystems, Foster City, Calif., 9050 Plus, Millipore, Bedford, Mass.). In addition, numerous combinatorial libraries are themselves commercially available (see, e.g., ComGenex, Princeton, NJ. , Asinex, Moscow, Ru, Tripos, Inc., St. Louis, Mo., ChemStar, Ltd., Moscow, RU, 3D Pharmaceuticals, Exton, Pa., Martek Bio sciences, Columbia, Md., etc.).

Small Molecules: Small molecule test compounds can initially be members of an organic or inorganic chemical library. As used herein, "small molecules" refers to small organic or inorganic molecules of molecular weight below about 3,000 Daltons. The small molecules can be natural products or members of a combinatorial chemistry library. A set of diverse molecules should be used to cover a variety of functions such as charge, aromaticity, hydrogen bonding, flexibility, size, length of side chain, hydrophobicity, and rigidity. Combinatorial techniques suitable for synthesizing small molecules are known in the art, e.g., as exemplified by Obrecht and Villalgordo, Solid-Supported Combinatorial and Parallel Synthesis of Small-Molecular- Weight Compound Libraries, Pergamon-Elsevier Science Limited (1998), and include those such as the "split and pool" or "parallel" synthesis techniques, solid-phase and solution-phase techniques, and encoding techniques (see, for example, Czarnik, Curr. Opin. Chem. Bio., 1:60 (1997). In addition, a number of small molecule libraries are commercially available.

The whole procedure can be fully automated. For example, sampling of sample materials may be accomplished with a plurality of steps, which include withdrawing a sample from a sample container and delivering at least a portion of the withdrawn sample to test platform. Sampling may also include additional steps, particularly and preferably, sample preparation steps. In one approach, only one sample is withdrawn into the auto-sampler probe at a time and only one sample resides in the probe at one time. In other embodiments, multiple samples may be drawn into the auto-sampler probe separated by solvents. In still other embodiments, multiple probes may be used in parallel for auto sampling.

In the general case, sampling can be effected manually, in a semi-automatic manner or in an automatic manner. A sample can be withdrawn from a sample container manually, for example, with a pipette or with a syringe-type manual probe, and then manually delivered to a loading port or an injection port of a characterization system. In a semi-automatic protocol, some aspect of the protocol is effected automatically (e.g., delivery), but some other aspect requires manual intervention (e.g., withdrawal of samples from a process control line). Preferably, however, the sample(s) are withdrawn from a sample container and delivered to the characterization system, in a fully automated manner — for example, with an auto- sampler.

In one embodiment, auto-sampling may be done using a microprocessor controlling an automated system (e.g., a robot arm). Preferably, the microprocessor is user- programmable to accommodate libraries of samples having varying arrangements of samples (e.g., square arrays with "n-rows" by "n-columns," rectangular arrays with "n-rows" by "m- columns," round arrays, triangular arrays with "r-" by "r-" by "r-" equilateral sides, triangular arrays with "r-base" by "s-" by "s-" isosceles sides, etc., where n, m, r, and s are integers). Automated sampling of sample materials optionally may be effected with an auto- sampler having a heated injection probe (tip). An example of one such auto sampler is disclosed in U.S. Pat. No. 6,175,409 Bl (incorporated by reference).

According to the present invention, one or more systems, methods or both are used to identify a plurality of sample materials. Though manual or semi-automated systems and methods are possible, preferably an automated system or method is employed. A variety of robotic or automatic systems are available for automatically or programmably providing predetermined motions for handling, contacting, dispensing, or otherwise manipulating materials in solid, fluid liquid or gas form according to a predetermined protocol. Such systems may be adapted or augmented to include a variety of hardware, software or both to assist the systems in determining mechanical properties of materials. Hardware and software for augmenting the robotic systems may include, but are not limited to, sensors, transducers, data acquisition and manipulation hardware, data acquisition and manipulation software and the like. Exemplary robotic systems are commercially available from CAVRO Scientific Instruments (e.g., Model NO. RSP9652) or BioDot (Microdrop Model 3000). Generally, the automated system includes a suitable protocol design and execution software that can be programmed with information such as synthesis, composition, location information or other information related to a library of materials positioned with respect to a substrate. The protocol design and execution software is typically in communication with robot control software for controlling a robot or other automated apparatus or system. The protocol design and execution software is also in communication with data acquisition hardware/software for collecting data from response measuring hardware. Once the data is collected in the database, analytical software may be used to analyze the data, and more specifically, to determine properties of the candidate drugs, or the data may be analyzed manually. Data and Analysis: The practice of the present invention may also employ conventional biology methods, software and systems. Computer software products of the invention typically include computer readable medium having computer-executable instructions for performing the logic steps of the method of the invention. Suitable computer readable medium include floppy disk, CD-ROM/DVD/DVD-ROM, hard-disk drive, flash memory, ROM/RAM, magnetic tapes and etc. The computer executable instructions may be written in a suitable computer language or combination of several languages. Basic computational biology methods are described in, for example Setubal and Meidanis et al., Introduction to Computational Biology Methods (PWS Publishing Company, Boston, 1997); Salzberg, Searles, Kasif, (Ed.), Computational Methods in Molecular Biology, (Elsevier, Amsterdam, 1998); Rashidi and Buehler, Bioinformatics Basics: Application in Biological Science and Medicine (CRC Press, London, 2000) and Ouelette and Bzevanis Bioinformatics: A Practical Guide for Analysis of Gene and Proteins (Wiley & Sons, Inc., 2^nd ed., 2001). See U.S. Pat. No. 6,420,108. The present invention may also make use of various computer program products and software for a variety of purposes, such as probe design, management of data, analysis, and instrument operation. See, U.S. Pat. Nos. 5,593,839, 5,795,716, 5,733,729, 5,974,164, 6,066,454, 6,090,555, 6,185,561, 6,188,783, 6,223,127, 6,229,911 and 6,308,170. Additionally, the present invention relates to embodiments that include methods for providing genetic information over networks such as the Internet.

Administration of Compositions to Patients

The compositions or agents identified by the methods described herein may be administered to animals including human beings in any suitable formulation. For example, the compositions for modulating protein degradation may be formulated in pharmaceutically acceptable carriers or diluents such as physiological saline or a buffered salt solution. Suitable carriers and diluents can be selected on the basis of mode and route of administration and standard pharmaceutical practice. A description of exemplary pharmaceutically acceptable carriers and diluents, as well as pharmaceutical formulations, can be found in Remington's Pharmaceutical Sciences, a standard text in this field, and in USP/NF. Other substances may be added to the compositions to stabilize and/or preserve the compositions.

The compositions of the invention may be administered to animals by any conventional technique. The compositions may be administered directly to a target site by, for example, surgical delivery to an internal or external target site, or by catheter to a site accessible by a blood vessel. Other methods of delivery, e.g., liposomal delivery or diffusion from a device impregnated with the composition, are known in the art. The compositions may be administered in a single bolus, multiple injections, or by continuous infusion (e.g., intravenously). For parenteral administration, the compositions are preferably formulated in a sterilized pyrogen-free form.

The compounds can be administered with one or more therapies. For example, chemotherapy, chemokines, radionuclides, cytokines, anti-angio genie agents or radiotherapy. The compositions provided herein may be used alone or in combination with conventional therapeutic regimens such as surgery, irradiation, chemotherapy and/or bone marrow transplantation (autologous, syngeneic, allogeneic or unrelated). The chemotherapeutic agents may be administered under a metronomic regimen. As used herein, "metronomic" therapy refers to the administration of continuous low-doses of a therapeutic agent. Therapeutic agents can include, for example, chemotherapeutic agents such as, cyclophosphamide (CTX, 25 mg/kg/day,/λø.), taxanes (paclitaxel or docetaxel), busulfan, cisplatin, cyclophosphamide, methotrexate, daunorubicin, doxorubicin, melphalan, cladribine, vincristine, vinblastine, and chlorambucil.

In another preferred embodiment, one or more Weel molecules can be linked or fused with one or more agents such as growth factors, protein inhibitors, cytokines and the like. Dosage, toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD₅₀ (the dose lethal to 50% of the population) and the ED₅₀ (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD₅₀/ED₅₀. Compounds that exhibit high therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED₅₀ with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC₅₀ (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography. As defined herein, a therapeutically effective amount of a compound (i.e., an effective dosage) means an amount sufficient to produce a therapeutically (e.g., clinically) desirable result. The compositions can be administered one from one or more times per day to one or more times per week; including once every other day. The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the compounds of the invention can include a single treatment or a series of treatments. Formulations

While it is possible for a composition to be administered alone, it is preferable to present it as a pharmaceutical formulation. The active ingredient may comprise, for topical administration, from 0.001% to 10% w/w, e.g., from 1% to 2% by weight of the formulation, although it may comprise as much as 10% w/w but preferably not in excess of 5% w/w and more preferably from 0.1% to 1% w/w of the formulation. The topical formulations of the present invention, comprise an active ingredient together with one or more acceptable carrier(s) therefor and optionally any other therapeutic ingredients(s). The carrier(s) must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.

Formulations suitable for topical administration include liquid or semi-liquid preparations suitable for penetration through the skin to the site of where treatment is required, such as liniments, lotions, creams, ointments or pastes, and drops suitable for administration to the eye, ear, or nose. Drops according to the present invention may comprise sterile aqueous or oily solutions or suspensions and may be prepared by dissolving the active ingredient in a suitable aqueous solution of a bactericidal and/or fungicidal agent and/or any other suitable preservative, and preferably including a surface active agent. The resulting solution may then be clarified and sterilized by filtration and transferred to the container by an aseptic technique. Examples of bactericidal and fungicidal agents suitable for inclusion in the drops are phenylmercuric nitrate or acetate (0.002%), benzalkonium chloride (0.01%) and chlorhexidine acetate (0.01%). Suitable solvents for the preparation of an oily solution include glycerol, diluted alcohol and propylene glycol.

Lotions according to the present invention include those suitable for application to the skin or eye. An eye lotion may comprise a sterile aqueous solution optionally containing a bactericide and may be prepared by methods similar to those for the preparation of drops. Lotions or liniments for application to the skin may also include an agent to hasten drying and to cool the skin, such as an alcohol or acetone, and/or a moisturizer such as glycerol or an oil such as castor oil or arachis oil.

Creams, ointments or pastes according to the present invention are semi-solid formulations of the active ingredient for external application. They may be made by mixing the active ingredient in finely-divided or powdered form, alone or in solution or suspension in an aqueous or non-aqueous fluid, with the aid of suitable machinery, with a greasy or non- greasy basis. The basis may comprise hydrocarbons such as hard, soft or liquid paraffin, glycerol, beeswax, a metallic soap; a mucilage; an oil of natural origin such as almond, corn, arachis, castor or olive oil; wool fat or its derivatives, or a fatty acid such as stearic or oleic acid together with an alcohol such as propylene glycol or macrogels. The formulation may incorporate any suitable surface active agent such as an anionic, cationic or non-ionic surface active such as sorbitan esters or polyoxyethylene derivatives thereof. Suspending agents such as natural gums, cellulose derivatives or inorganic materials such as silicaceous silicas, and other ingredients such as lanolin, may also be included.

Kits

In another preferred embodiment, a kit comprises at least one Weel molecule fused or linked to a second molecule. Preferably the second molecule is luciferase.

In another preferred embodiment, a kit comprises a molecule such as Weel, at least one primer set forth as SEQ ID NOS: 1 to 13 and a detectable marker. The kits may also include buffer and/or excipient solutions (in liquid or frozen form)— or buffer and/or excipient powder preparations to be reconstituted with water. Thus, preferably the kits containing the components, are frozen, lyophilized, pre-diluted, or pre-mixed at such a concentration that the addition of a predetermined amount of heat, of water, or of a solution provided in the kit will result in a formulation of sufficient concentration and pH as to be effective assaying any compound for therapeutic value in the treatment of disease. Preferably, such a kit will also comprise instructions for reconstituting and using the components of the assay. The kit may also comprise two or more component parts for the reconstituted active composition. The above-noted buffers, excipients, and other component parts can be sold separately or together with the kit.

The following examples are offered by way of illustration, not by way of limitation. While specific examples have been provided, the above description is illustrative and not restrictive. Any one or more of the features of the previously described embodiments can be combined in any manner with one or more features of any other embodiments in the present invention. Furthermore, many variations of the invention will become apparent to those skilled in the art upon review of the specification.

All publications and patent documents cited in this application are incorporated by reference in pertinent part for all purposes to the same extent as if each individual publication or patent document were so individually denoted. By their citation of various references in this document, Applicants do not admit any particular reference is "prior art" to their invention. EXAMPLES

The following examples serve to illustrate the invention without limiting it thereby. It will be understood that variations and modifications can be made without departing from the spirit and scope of the invention.

Embodiments of the invention may be practiced without the theoretical aspects presented. Moreover, the theoretical aspects are presented with the understanding that Applicants do not seek to be bound by the theory presented.

While various embodiments of the present invention have been described above, it should be understood that they have been presented by way of example only, and not limitation. Numerous changes to the disclosed embodiments can be made in accordance with the disclosure herein without departing from the spirit or scope of the invention. Thus, the breadth and scope of the present invention should not be limited by any of the above described embodiments. Materials and Methods

Weel Mutagenesis Screen: Mutagenesis of the Wee 1-lucif erase PGL3 vector was performed by treating lμg aliquots of plasmid DNA with IM Hydroxylamine (Hydroxylamine hydrochloride, Sigma), pH 6.7 for 70 minutes at 7O⁰C. The DNA was washed with the Qiagen Miniprep kit PB buffer with three extra washes to remove hydroxylamine. The washed Wee 1-lucif erase plasmids were transformed into MACHl competent cells and plated as previously described for site directed mutagenesis (Sato et al. Nat Genet. 38:312-9, 2006). Approximately 1100 colonies were picked from these plates. 96 deep-well plates filled with TB and carbenecillin (Sigma) from the NucleoSpin Robot-96 Plasmid Purification Kit (Macherey-Nagel) were inoculated with one colony for each well, and grown overnight at 37⁰C in a shaker at 5% CO₂ and 230rpm along with transformed colonies with control constructs of unaltered pGL3Weel -luciferase, pGL3 luciferase, and pGL3 vector only. The resulting bacterial cultures were pelleted and then purified using the NucleoSpin Robot-96 Plasmid Purification Kit (Macherey-Nagel) as directed by manufacturer, using the Microlab Star Robot (Hamilton). The resulting purified DNA clones were loaded into 96-well UV spectrometry plates and the DNA concentrations were determined. The DNA was normalized using the Microlab Star (Hamilton) via dilution and spotted in quadruplicate onto 384- well plates (Corning) with the Minitrak from Perkin Elmer resulting in 40ng of DNA per well. Asynchronous HeLa cells were harvested with trypsin, resuspended in DMEM with 20% FBS (Gibco) and 2% Penicillin-Streptomycin (Gibco) at a concentration of 5xlO⁵ cells/ml. TransIT LT-I (Mirus) transfection reagent was diluted in OptiMEM media along with vector only DNA such that 125ng of plasmid DNA and 375μg of Mirus reagent was present per 20 μl of final mixture. The Mirus transfection reagent mixture was spotted with the Multidrop 384 (Titan) onto each 384 well plate in aliquots of 20 μl per well, and incubated for 30 minutes. The HeLa cell/media mixture was spotted with the Multidrop 384 (Titan) onto each plate after transfection reagent DNA complexing, in aliquots of 50μl per well. The plates were covered with sterile metal lids with aerating holes and incubated at 37⁰C in 10% CO₂ for 20 hours. Britelite Luminescence Reporter Gene Assay System (Perkin-Elmer) was spotted with the Multidrop 384 (Titan) onto the HeLa cell transfected 384 well plates in aliquots of 40 μl per well, and each plate was incubated for one minute at room temperature. Each plate was read using the Analyst GT from Molecular Devices and Relative Luminescence Values (RLU) were taken for each well. RLU values were loaded and analyzed in Microsoft Excel.

Weel Constructs: The Weel gene purchased from Invitrogen is the same as that on NCBI (Weel tyrosine kinase (Homo sapiens, NP 003381), with the exception of base pair 256, which is an A, not a C. DNA purifications were performed using Qiagen's Mini or Maxi prep kits according to the manufacturer's protocols. PCR purification and Agarose Gel Extractions were performed using the Qiagen QIAquick Kit. Weel was cloned using BamHl and EcoRl restriction enzyme sites using standard cloning protocols into the myc-tagged pCS2 mammalian expression vector. The Wee 1-lucif erase construct was made through standard cloning of Weel from the pCS2 plasmid into the pGL3 lucif erase expression vector (Promega) using Ncol and Hindlll. Wild type and mutant Weel constructs were cloned into a modified pCS2-flag-expression plasmid using EcoRl and Notl. The GC codon optimized opti-Weel construct was made by GenScript and was cloned into the cs2 myc-tagged mammalian expression vector. PCR-based site-directed mutagenesis of Weel was performed using the following primers: S53A: 5' CACTCTACTGGCGAAGACGCAGCTTTCCAGGAGCCTGAC 3' (SEQ ID NO:

1)

S123A: GGGCTTCGGCTCTAGCGCTCCTGTGAAATCTCCTG (SEQ ID NO: 2) (ZV 'xϊuaoqj 'saxSojouqoax OJOXUIAJOJ Εoxπs pssnj -p-x uiui OOI ^χ "P'° ^mm 09£) suuxnjooaxd Q£ ojuo papuoj 'ppt? oμaoB PMFO ^UT pajnjμsuooai ax3M sajnjxxux uoμsaSxQ "ssauAjp oj ua^tη put? paptujxa 3J3M sapμdad aqj uoμsaSxp SUXMOJJOJ -uoμsaSxp uxsdAjj oj joμd pajtqA^jB put? paonpaj 3J3M spu q paspxa 'Axjaμg ^•Ajjaiuojpads SSBIU AqdBjSojBiuojqo pxnbxj Suxsn pazA^BUB puv 'pajsaSxp 'paspxa 3J3M pa^ JO spu q upjojj -}X5[ Ajpiuojpads ssBjy\[ oj urejg dVNS ^J3Λ1TS S ^

DJSXJ Suxsn paurejs JSΛJXS 3J3M uaqj puB (U3§OJJXΛUI) sjpo g^ £6Z pspsjsuBJj IUOJJ apBiu 3J3M suoμBjxdpajdouniuiui :sisι(jvuy LiidiuoiiJddζ ssvjη

^•jqSxujaΛo 3_o/,£ }B pajBqnoux puB '(BIUSXS) uxπi^DT^U3Cl^JBD q/§riooi Suxurejuoo sajBjd gq ojuo pajBjd 3J3M suoμBiujojsuBjχ

^OD %ζ qjxM iπnxpaiu 3OS J° l^OOZ ^UT D_oΔ£ ϊ^B Sux5[Bqs uoμBqnoux ajnuxiu ς\ puv aox uo uoμBqnoux ajnuxiu i v ^₀ L£ T^ uoμBqnoux ajnuxiu \ 'aox uo uoμBqnoux ajnuxxu Q\ v qjxM s\\oo juapduxoo Qi

IHDVIAI ^OΪ^UT psuuojsuBJ} QIQIA suoμB§x{ 3qχ '^_oζ\ ye SSBSXJ j/X qjxM jqSxxxjaΛo pa}B§x{

3J3M sjsaSxp auxAzua uoμoμjsaj 3qχ -uoμBΛμDBux jBaq oj papafqns OJO/A sajnjxxxu axuAzua uoμoμjsaj uaqj puB 'sjnoq g JOJ jooojojd s_tJ3jnpBjnuBux oj SuxpjoooB (BSSUJOJJ) \ud(j qjxM pajsaSxp 3J3M spnpojd ^j^ 3qχ -3^9 }B sajnuxiu 9 puu '3₀gg }B ajnuxiu \ '-J_oςβ W spuooas

0£ jo sapAo g\ Aq paMojjoj '^₀ gg JB ajnuxxu i μxux auo jo uiBjSojd SuxpAo aqj qjxM 'poojojd ς\ s_tJ3jnpBjnuBui oj SuxpjoooB (saouapsoxg αiAig) asBjaxuApd VNO ϊ^JBϊ^sϊ°H 003 Suxsn Su OS ye I⁹⁹M pd° P^UB '§^u ζZX J° uoμBJjuaouoo B JB pasn QIQIA sjauxμd ^{^}SDd sxsauaSBjnux papajxp-ajxg -3}B{duj3} v SB pnijsuoo [dd^-μdo aqj Suxsn paujjojjad SBM ^Dd

(£1 ON αi OHS) OVDVXXXXOVVOXVVVDODXXXXXXODXOVXVODOOOVO -d£2Vl

(Zl ON αi OHS) OOVOVVOXXOVVDVDDXDODDXDXVOOVVDVVXOXVD -YZLVS Ol

(II ON αi OHS) OVOVVOXXOVVDVDDXOVVDODXVOOVVDVVXOXVDOO =VUtS

(OI ON αi OHS) OXVVVDOXXDXXXXODXDOXVODOOOVOVVOXXOVVD :V08^S

(6 ON αi OHS) DVXXXXOVVOXVVVDOXVDXXXXODXOVXVODOOO -HiSVl

(8 ON αi OHS) OVVDVVVOXVOVVOXXDDVDXVXXVOXOVDDOVVOO -ϋiLZΗ.

(L ON αi OHS) DDXXVOXVVOOXXVXODOVOVOVVVOVXODXODXO :VΔ£Z1 S

(9 ON αi OHS) OXXVXODVVOVOVVVOVDVDXODXOXOVDVOOVDXD ΗεSZΗ

(S ON αi OHS) DVOVVDVDXDDXDDVDOOOOXDDDVDXVOVDD :V£ΔIX

(V ON αi OHS) OOXDDDVDXVOVDDXDOVDDDOVVOVVOVD =VΔ9IΗ

(£ ON αi OHS) DVOOOXDDDVDXVOVDDVVDVDDDOVVOVVOVDOOVVO :OΔ9IΗ

Z.i7i7980/800ZSIl/X3d 6CS9/.0/600Z OΛV packed with 3 cm irregular C18 (5-15 μm non- spherical, YMC, Inc., Wilmington, NC) and washed with 0.1 M acetic acid for 5 min before switching in-line with the resolving column (7 cm spherical C18, 360 mm o.d. x 100 mm i.d. fused silica). Once the columns were inline, the peptides were eluted along a gradient from 2% to 80% acetonitrile in 0.1 M acetic acid at an approximate flow rate of 350 nL/min. All samples were analyzed using a Thermo Electron LTQ (San Jose, CA).

Electrospray was accomplished using a pulled fused silica emitter tip of approximately 5 μm with a voltage of 1.7kV. The mass spectrometer was operated in data dependent mode with the top five most abundant ions in each spectrum selected for sequential MS/MS experiments. The exclusion list was used (1 repeat, 180 sec return time) to increase dynamic range. All MS/MS spectra were searched with Sequest (version 2.7) using sample dependent databases. Searches were performed with a fixed carbamidomethylation of cysteine (C) and variable oxidation of methionine (M) and phosphorylation of serine (S) and threonine (T). Database search results were tabulated and visually inspected for correct assignment using Scaffold version 1.7 (Proteome Software, Portland, OR).

In vitro Degradation Assays: In vitro degradation assays were performed as previously described by Ayad et al. {Methods Enzymol 399, 404-14 (2005)). HeLa cells were grown and synchronized as previously described. At five hours after final thymidine release, HeLa cells were harvested, washed and resuspended in swelling buffer (2OmM Hepes, pH7.7, 1OmM MgCl₂, 5mM KCL, ImM DTT, 3mM creatine phosphate, 0.4mM ATP, pH7.4, 0.04mM EGTA, pH7.7, and Protease Inhibitor Cocktail (P8340 Sigma)) in a ratio of 1:0.75 of pellet volume to buffer volume, and allowed to incubate on ice for 20 minutes. A small volume of unlysed cells were added to -2O⁰C 70% ethanol for FACS analysis. Cell lysis was performed by dounce homogenization, and complete cell lysis was monitored by trypan blue exclusion. The resulting cell lysates were passed through a 26.5 gauge needle, and spun at top speed in a 4⁰C table-top centrifuge (approximately 21000xg) for 20 minutes. The resulting pellet was discarded, and the cells extract supernatant was saved for in vitro degradation assays. Radiolabeled in vitro translated proteins of Weel mutants were made using Promega's TnT SP6 Coupled Reticulate Lysate System according to manufacturer's directions for in vitro translation with lμg of myc tagged cs2 plasmid constructs. Degradation assays were assembled on ice with 20 μl of cell extracts, lμl of radiolabeled protein and lμl of reaction mixture energy mix (15OmM creatine phosphate, 2OmM ATP, pH7.4, 2mM EGTA, pH7.7), cycloheximide (Sigma 0.1mg/ml), and 0.1mg/ml ubiquitin (Boston BioChem) in a 1:1:1 ratio). The reactions were moved from ice to room temperature and time points were taken by adding 4μl of reaction mixture to 20μl of Laemmli Sample Buffer (Bio-Rad) supplemented with 2mM DTT. Mitotic Entry assay of transfected HeLa cells: HeLa cells were plated at 40% confluency in 10cm dishes with lOmls of IX HeLa Media (DMEM containing 10% FBS and Pen/Strep) containing 2mM Thymidine and grown in a humidified 37⁰C incubator with 10% CO₂ for 18-20 hours. Cells were released from the Thymidine block by washing 2X in PBS and adding 9ml of Optimem to the plate for transfection. Lipofectamine 2000 (Invitrogen, CA) transfection was done according to manufacturers instructions with 7μg of pCS2+MT- HsOptiWeel, S472A mutant of Weel, L483F mutant of Weel, or vector alone, lμg of pCS2+eGFP was added to determine transfection efficiency. Cells were transfected shortly after release from the thymidine block and complexes were allowed to incubate with cells for 4-6hrs. Each 10 cm transfected plate was then split into a 6-well dish and plated in IX HeLa media containing 2mM thymidine and allowed to incubate for 18-20 hrs. The cells were released from the thymidine block and time points were collected every 2 hrs for 10 hrs by scraping cells in growth media, washing IX in lOmls PBS and snap freezing pellets in liquid nitrogen until all time points were collected. Pellets were resuspended in IX SDS-containing sample buffer and processed for phospho-histone, myc, or Skp-1 immunoreactivity. Weel kinase assay: Determination of Weel kinase activity was performed according to the manufacturer's directions (Cyclex). Flag-wild-type Weel or the S472A or L483F Weel mutants were produced in 293T cells, immuno-isolated using anti-Flag beads (Sigma), and eluted from the beads using 500ng/μl of Flag peptide. The amount of Weel used in assays were then normalized by both Coomassie blue staining and Western blot of analysis of eluted Weel. Assay measures extent of Y15 phosphorylation of Cdkl, which is pre-adsorbed to assay plate. Incubation of control or experimentally produced Weel is incubated with Cdkl for 1 hour at RT, followed by successive washes and incubations with anti-phospho- tyrosine antibody and anti- secondary antibody conjugated to HRP. After washing away unbound secondary Ab-HRP, the HRP chromogenic substrate TMB is added and read at Absorbance 450. Negative Control (buffer control) for the kinase assay routinely gave a value of 0.050 at A450.

Co-expression of wild-type Weel, S472A-Weel, or L483F-Weel with Tomel or β- trcpl: HeLa cells were plated at 40% confluency in 10cm dishes with lOmls of IX HeLa Media (DMEM containing 10% FBS and Pen/Strep) containing 2mM Thymidine and grown in a humidified 37⁰C incubator with 10% CO₂ for 18-20 hours. Cells were released from the Thymidine block by washing 2X in PBS and adding 9ml of Optimem to the plate for transfection. Lipofectamine 2000 (Invitrogen, CA) transfection was performed according to manufacturer' s instructions with 4μg of pCS2+MT-HsOptiWeel K328M, S472A K328M Weel, L483F K328M Weel, or vector alone and 4μg of Flag-β-trcp-1, Flag-Tome-1, or vector only. Cells were transfected shortly after release from the thymidine block and complexes were allowed to incubate with cells for 4-6hrs. The media was changed to IX HeLa media containing 2mM thymidine and cultured for an additional 18-20 hrs. The cells were released into fresh IX HeLa media and incubated for 3 hrs. The cells were collected by scraping in media and spinning at 500xg for 10 min, then washed once in lOmls PBS.

Immunoblotting: Anti-myc (A- 14, Santa Cruz), anti-Wee l(H-300 Santa Cruz), anti- skpl(H-163, Santa Cruz), anti-p-histone (H3) (Ser 10-R, Santa Cruz), anti-phospho serine 53- Weel (AP3285a, Abgent) and anti-GFP (FL, Santa Cruz) rabbit polyclonal IgG were used as primary antibodies. Anti rabbit IgG donkey IgG (GE Healthcare ECL) was used as secondary antibody. Imaging of Western blots was performed using the GE Healthcare Amersham ECL Plus Western Blotting Detection system.

Example 1: Activation Domain Dependent Degradation of Somatic Weel Kinase A novel chemical mutagenesis strategy identifies essential Weel proteolysis sites: A novel cell based screening method was established to identify sites initiating Weel degradation. The coding region of human Weel was fused to luciferase. Weel is a very unstable protein relative to luciferase; therefore measuring Weel -luciferase degradation is an accurate surrogate of determining Weel turnover as turnover of Weel -Luc was very similar to Weel (Figure 7). After creating the Weel -luciferase construct, the construct was treated with hydroxylamine and transformed E. coli to isolate individual mutated plasmids, whose concentration was normalized and spotted robotically on 384 well plates. Each clone (1,300 total) was then individually transfected into HeLa cells that were cultured for 24 hr before adding 'Brite-lite' reagent, which simultaneously lyses cells and allows one to determine luminescence. Any clone that gave a signal 1.5 times greater than that generated by wild- type Weel -Luc was re-tested. Once the most stable Weel-luciferase constructs (those having the highest signal relative to wild type Weel luciferase, shown in Figures 2A, 2B) were identified, the Weel coding region was sequenced to identify mutated sites. These mutations were then shuttled into Myc-epitope tagged Weel and assessed for their steady-state levels relative to wild-type, Myc-tagged Weel following transfection in HeLa cells. In asynchronous, S phase/G2 cells, or mitotic cells, three Weel mutants were more highly expressed than wild-type-Weel, R253H, R167Q/E273K, and the G106S/L483F, and here increased levels of protein directly correlated with increased luciferase activity as Weel-Luc fusions, confirming that Weel-Luc was an accurate surrogate of Weel. Identified Weel mutations inhibit Weel turn-over in vitro: To demonstrate that Weel degradation was indeed inhibited after mutating these residues, in vitro degradation assays were performed utilizing somatic cell extracts. Extracts from S phase/G2-arrested HeLa cells were incubated with either in vitro translated ³⁵S-labeled wild-type Weel, R253H-Weel, R167Q/E273K-Weel, or the G106S/L483F-Weel. At specific intervals, reactions were terminated and their in vitro degradation rates were determined following SDS-PAGE and phosphor imager analyses. Indeed all three of these mutants had reduced rates of turnover compared to wild-type Weel (Figures 2A, 2B), and their relative rates of degradation were inversely proportional to their steady-state levels, with the G106S/L483F-Weel mutant having the slowest degradation rate. Serines in the kinase activation domain direct Weel turnover. Since the

G106S/L483F Weel mutant was the most stable (Figures 2A, 2B, Figures 8, 9 and Table 1), the contribution of glycine 106 or leucine 483 to Weel turnover was evaluated. Mutating glycine-106 to serine did not affect the steady state levels of Weel, suggesting that changes in turnover were due to changing leucine-483. Indeed, mutation of leucine-483 to alanine, phenylalanine, or even histidine was sufficient to stabilize Weel (Figures 4A-4C, Figure 8).

Phosphorylation of the N-terminal Weel residues serine-53 and serine-123 are important for its turnover. Given the locale of leucine-483 within the Weel kinase activation domain (residues 461-488) it was postulated that this domain was necessary for Weel destruction and that degradation might be mediated by phosphorylation of serines-471, -472, and/or -480 that reside within this domain. To test this notion, LCMS/MS analysis of immunopurified Flag-tagged Weel expressed in 293 cells was initially performed, which demonstrated that serine-472 was indeed phosphorylated (Figure 4B). Moreover, mutation of serine-472 to alanine led to marked increases in steady state levels of the protein, and the same effects were also observed in S471A and S480A Weel mutants (Figure 4C, Figure 8). When directly compared with the known S53A and S123A stabilizing mutations, the kinase activation domain mutants S471A, L483A (F, H), S472A, or S480A had much more profound effects on the steady state levels of Weel (Figure 4C and Figure 8; for comparison residue T257 to was mutated to alanine, which was predicted to be phosphorylated by

Prosite). Therefore, serines within the kinase activation domain of Weel, along with leucine 483, were required for proper Weel degradation in somatic cells.

Activation domain mutations do not affect Weel structure or activity: Possible explanations for the increased stability of the kinase activation domain mutants were that these disturbed Weel structure or kinase activity. To assess the structural consequences of these mutations, modeling and energy minimization of the Weel structure was performed and compared to that of wild type Weel. Notably, the L483F or S472A Weel mutant structures were very similar to wild- type Weel (Figure 5A). Since the Weel N-terminus is lacking in the Weel crystal structure, effects of these mutations on structure and folding of the Weel N- terminus could not be assessed. However, the S472A and L483F mutants did not affect the phosphorylation of the N-terminal serine residue, serine 53, which is also required for Weel turnover in somatic cells (Figure 5C).

To test whether the S472 and L483 played critical roles in mitotic entry, HeLa cells expressing wild-type, S472A, or L483F Weel were synchronized at the Gl/S transition by a double-thymidine block and were then released. Serine-10 phosphorylation of histone H3 was then monitored to measure mitotic entry. Control HeLa cells transfected with empty vector entered mitosis 6 hours after thymidine release and this was blocked in cells expressing wild-type Weel (Figure 5B). Further, cells expressing the S472A or L483 Weel also failed to enter mitosis, and indeed here the block was slightly more complete than wild type Weel (Figure 5B). Therefore, the mutations in the kinase activation domain that stabilize Weel did not affect its overall structure or function.

To test the effects of these activation domain mutations on Weel kinase activity, FLAG-tagged wild-type, S472A, or L483F Weel were immunopurified from 293T cells, the proteins eluted using FLAG peptide, and then tested for their relative ability to phosphorylate Cdkl using a commercially available Weel kinase assay (CycLex; see Materials and

Methods). The S472A and L483F Weel mutants had activity similar to that of wild-type Weel (Figure 5C). Therefore, the effects of activation domain mutations on Weel turnover were independent of effects on kinase activity. Activation domain serines are required for Weel degradation: These mass spectrometry analyses not only established the ratio of wild type Weel to G106S, L483F mutant, but have also identified potentially important phosphorylation sites. Specifically, in addition to the known Weel phosphorylation sites at serine 53 and serine 123, Weel phosphorylation at serine 472 were identified. This site was mutated to alanine and found that this amino acid and neighboring residues 471 and 480 were also required for Weel destruction. These studies also demonstrated that mutation of the glycine 106 did not significantly affect Weel stability. Furthermore, the relative effect of mutating residues in the activation domain relative to changing residues in other parts of Weel was determined, and found that activation domain mutants were among the most stable .

Activation domain mutants are resistant to ubiquitin ligase dependent degradation: Turnover of Weel is be directed by both the SCFβ-trcp and SCFTome-1 ubiquitin ligases. Whether Weel activation domain mutants were resistant to degradation by SCFβ-trcp and/or SCFTome-1 was tested by transfecting synchronized HeLa cells with Flag-Tome-1 or Flag-β- trcp-1 expression vectors and assessed effects on the steady state levels of kinase inactive versions of wild-type (WT-K328M), S472A (S472A/K328M), or L483F (L483F/K328M) Weel. Here it was necessary to utilize kinase inactive versions of Weel since overexpression of Wild-type Weel with Tome-1 rapidly triggered cell death. As expected, co-expression of either Tome-1 or β-trcp reduced the steady-state level of wild-type Weel relative to vector control transfected cells (Figures 6A, 6B). By contrast, degradation of S472A or L483F Weel by Tome-1 or β-trcp was significantly impaired (Figures 6A, 6B).

Table 1: Subset of Mutations Map to Weel Sequence

Base Pair Location Original Codon Mutant Codon Resulting Amino Acid

Mutation

500 CGG CAG R 167N

817 GAG AAG E273K

75H CGT CAT R253H

788 TGT TAT C263Y

907 GAG AAG E306K

1270 CAC TAC H424Y

1275 ATG ATA M425I

1289 ACTT^' AAT S430N

316 GGC AGC GΪ06S

1447 CTT ITT L483F

190 CCC TCC P64S

1478 ACA ATA T4931

1487 CCA CAA P496Q

1832 AGA AAA R611K Table 1 shows representative mutations isolated from Weel mutagenesis screen. G106S/1483F mutations were on the same plasmid; the R167N/E273K and the C263Y/E306K mutations were also a double mutation. All other mutations were single mutations in the Weel coding region. Discussion: These findings indicate that a novel hydroxylamine induced mutagenesis strategy identified uncharacterized regulatory regions of Weel. Specifically, whereas other studies have concentrated on N-terminal serine residues (S53A and S 123A), it was established here that multiple domains of Weel are important for Weel destruction. This is highly significant since other studies indicated that Weel degradation was largely dependent on N-terminal residues. This work indicates that multiple signaling pathways and ubiquitin ligases interface with Weel by utilizing different parts of the molecule as docking sites and thus may give clues as to how Weel can function in controlling mitotic entry, apoptosis, and development.

Prior studies have suggested key roles for N-terminal serine residues of Weel (serine - 53 and serine-123) in directing Weel destruction, yet the unbiased screen reported herein has established that the evolutionarily conserved kinase activation domain also contributes to Weel turnover (Supplemental Figure S5). Thus, other domains of Weel contribute to modulating its levels, and this evidences that multiple signaling pathways and ubiquitin ligases may control Weel turnover, which may explain how Weel is regulated during mitotic entry, apoptosis, and development. Consistent with this notion, we found that the ability of β-trcp or Tome-1 to induce Weel degradation was abrogated if Weel was mutated on either serine-472 or leucine- 483. Thus, the activation domain, like the Weel N-terminus, is a major site of Weel proteolytic regulation.

The precise mechanisms that control Weel remain unresolved. Both the N-terminus and the activation domain of Weel contain or are proximal to putative PEST regions involved in degradation, which is consistent with the observation that two or more substrate degrons could be important to promote efficient binding of ubiquitin ligases (Figure 5). Thus one could predict that the binding of β-trcp and/or Tome-1 to Weel would be compromised by stabilizing mutations in the activation domain. However, defects in binding of β-trcp and/or Tome-1 to S472A or L483F Weel were not detected, at least in vitro. This is perhaps due to the presence of N-terminal residues that provide an alternate docking site for these ubiquitin ligases or, alternatively, might indicate a requirement for other Weel binding proteins such as hsl7 for the efficient destruction of Weel. Regardless, the activation domain is needed for efficient turnover of Weel and is linked to phosphorylation of at least one serine residue, serine-472, and it will be important to determine whether such requirements are important in Weel-directed control of embryonic cell mitotic entry and gastrulation.

The unbiased hydroxylamine-directed mutagenesis and cell-based screens described herein to assess Weel turnover can easily be applied to resolve the control of other cell cycle regulators. For instance, though phosphorylation of p27^Kipl on Tl 87 was thought to direct recognition by an E3 ligase containing the ubiquitin ligase Skp-2, subsequent studies using a mouse knock-in model demonstrated that phosphorylation of this site was dispensable for control of p27^&pl turnover. While this may indicate that ubiquitin ligases other than Skp-2 such as KPC regulate p27^&pl destruction in vivo, Skp-2 mediated destruction of p27^Kipl may also require sites that have not been identified. The cell-based means described herein, of identifying sites required for protein destruction can be easily implemented to identify these sites as well as those of virtually every unstable protein. Although hydroxylamine mediated mutagenesis is ideally suited for cDNAs such as Weel that are GC rich since it specifically targets GC pairs, error-prone PCR was also utilized, which is more efficient than hydroxylamine at introducing random mutations and have identified putative new degrons for p21^Cipl and p27^Kipl.

Further refinements that we are now examining include maximizing the number of mutations introduced per plasmid utilized. The coding sequences of proteins of interest are being utilized as a source of mutagenesis. We are also developing bioinformatic tools to match sites identified through the methods discussed herein to those mutated in different cancers.

Other Embodiments

It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention. Other aspects, advantages, and modifications are within the scope of the following claims.

All references cited herein, are incorporated herein by reference. Although the invention has been illustrated and described with respect to one or more implementations, equivalent alterations and modifications will occur to others skilled in the art upon the reading and understanding of this specification and the annexed drawings. In addition, while a particular feature of the invention may have been disclosed with respect to only one of several implementations, such feature may be combined with one or more other features of the other implementations as may be desired and advantageous for any given or particular application.

The Abstract will allow the reader to quickly ascertain the nature of the technical disclosure. It is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the following claims.

Claims

What is claimed is:

1. A vector comprising a Weel nucleic acid molecule operably linked to a detectable marker.

2. The vector of claim 1, wherein the Weel nucleic acid comprises, Weel mutants, fragments, alleles, homologs, variants, analogs and derivatives thereof.

3. The vector of claim 1, wherein the Weel nucleic acid comprises a mutant Weel nucleic acid expressing a Weel protein or peptide comprise at least one mutated amino acid in kinase activation domains as compared to wild type Weel.

4. The vector of claim 1, wherein the mutated amino acids comprise mutations at positions 53, 123, 425,468, 469, 471, 472, 473, 475, 477, 480, 483, and 487 of the Weel protein, peptides or fragments thereof as compared to wild type Weel.

5. The vector of claim 1, wherein the mutated amino acids comprise amino acids at positions 425,468, 469, 471, 472, 473, 475, 477, 480, 483, and 487 or at any Weel protein phosphorylation sites as compared to wild type Weel.

6. The vector of claim 1, wherein at least one serine in a kinase activation domain of the Weel protein or polypeptide is mutated as compared to wild type Weel.

7. The vector of claim 1, wherein at least one leucine in a kinase activation domain of the Weel protein or polypeptide is mutated as compared to wild type Weel.

8. The vector of claim 1, wherein at least one serine and/or one leucine in a kinase activation domain of Weel protein or polypeptide is/are mutated as compared to wild type Weel.

9. The vector of claim 2, wherein the Weel protein or peptide are fused to a molecule comprising a detectable marker, protein, peptide, or radioligand.

10. The vector of claim 9, wherein the detectable marker is luciferase.

11. A peptide docking site comprising a Weel protein wherein the Weel protein, peptide or fragments thereof comprise mutations at one or more positions comprising amino acids at positions 53, 123, 425,468, 469, 471, 472, 473, 475, 477, 480, 483, and 487 or at any Weel protein phosphorylation sites as compared to wild type Weel protein or peptides thereof.

12. The peptide docking site of claim 11, wherein the Weel proteins, peptides or fragments thereof, comprise Weel alleles, homologs, variants, analogs and derivatives thereof.

13. The peptide docking site of claim 11, wherein the mutations at one or more amino acid positions comprise amino acids at positions 425,468, 469, 471, 472, 473, 475, 477, 480, 483, and 487 or at any Weel protein phosphorylation sites.

14. The peptide docking site of claim 11, wherein the Weel mutants comprise R167Q, E273K-Weel, R253H-Weel, G106S, L483F, R167Q/E273K-Weel, or G106S/L483F-Weel, alleles, homologs, variants, analogs, and derivatives thereof.

15. A composition comprising Weel mutants: R167Q, E273K-Weel, R253H-Weel, G106S, L483F, R167Q/E273K-Weel, G106S/L483F-Weel, or at least one mutated amino acid in Weel kinase activation domains, as compared to wild type Weel.

16. The composition of claim 15, wherein the Weel mutants comprise a polynucleotide encoding at least one Weel mutant identified as R167Q, E273K-Weel, R253H-Weel, G106S, L483F, R167Q/E273K-Weel, G106S/L483F-Weel, alleles, homologs, variants, fragments analogs, and derivatives thereof.

17. The composition of claim 15, wherein the Weel mutants comprise a polynucleotide encoding at least one Weel mutant molecule comprising mutations at one or more amino acids at positions 53, 123, 425,468, 469, 471, 472, 473, 475, 477, 480, 483, and 487 or at any Weel protein phosphorylation sites as compared to wild type Weel protein or peptides thereof.

18. The composition of claim 15, wherein the Weel mutants comprise a polypeptide encoding at least one Weel mutant identified as R167Q, E273K-Weel, R253H-Weel, G106S, L483F, R167Q/E273K-Weel, or G106S/L483F-Weel, homologs, analogs, variants, fragments, and derivatives thereof.

19. The composition of claim 15, comprising a polynucleotide encoding a Weel molecule comprises at least one mutation in a Weel kinase activation site.

20. A cell comprising a Weel nucleic acid molecule operably linked to a detectable marker; or, a Weel protein or peptide fused to a molecule comprising a detectable marker, protein, peptide, or radioligand; a Weel protein, peptide or fragments thereof; comprising mutations at one or more positions comprising amino acids at positions 53, 123, 425,468, 469, 471, 472, 473, 475, 477, 480, 483, and 487; and Weel mutants comprising R167Q, E273K-Weel, R253H-Weel, G106S, L483F, R167Q/E273K-Weel, or G106S/L483F-Weel.

21. The cell of claim 18, wherein the Weel comprises alleles, homologs, variants, fragments analogs, and derivatives thereof or at least one mutated nucleobase .

22. A method of identifying Weel proteolysis sites comprising: fusing a nucleic acid encoding Weel to a lucif erase nucleic acid and creating a construct comprising Weel-luciferase; treating the construct with a mutating agent and transforming cells with the construct; identifying mutated Weel and fusing Weel mutants to a protein or peptide; and, measuring steady state levels of the Weel mutant fusion proteins, peptides or fragments thereof as compared to wild -type Weel controls; and, identifying Weel proteolysis sites.

23. The method of claim 22, wherein the mutating agent comprises hydroxylamine, site- directed mutagenesis, PCR, PCR with primers having any one or more primers set forth as SEQ ID NOS: 1-13.

24. The method of claim 22, wherein the method is formatted for high-throughput assays.

25. A method of identifying candidate therapeutic agents comprising: incubating cells comprising a Wee 1-lucif erase construct, a construct expressing a Weel mutant fusion protein, peptide or fragments thereof with a candidate therapeutic agent; and, measuring phosphorylation and/or degradation of Weel constructs; and, identifying candidate therapeutic agents.

26. The method of claim 25, wherein the candidate therapeutic agent modulates cell proliferation or modulates protein degradation as compared to a control.

27. The method of claim 25, wherein a candidate therapeutic agent comprises paclitaxel (PTX) or PTXlOl.

28. A method of diagnosing or identifying patients at risk of developing abnormal cell growth or changes in levels of proteins as compared to normal patients comprising identifying mutations in Weel which alter phosphorylation of Weel and degradation as compared to steady state levels in normal individuals.

29. A method of identifying protein or peptide proteolysis sites comprising: fusing a nucleic acid encoding a desired protein or peptide to a luciferase nucleic acid or other marker and creating a construct comprising protein- or peptide-luciferase or other marker; treating the construct with a mutating agent and transforming cells with the construct; identifying mutated proteins or peptides fused to luciferase or other markers; measuring steady state levels of the mutant fusion proteins, peptides or fragments thereof as compared to wild -type protein controls; and, identifying proteolysis sites of a protein or peptide.

30. A fusion peptide comprising at least one of Weel, Weel mutants and at least one molecule comprising a therapeutic molecule, marker, isotope, kinase or kinase inhibitor.

31. The fusion peptide of claim 30, wherein the Weel molecule comprises at least one mutation at one or more amino acids at positions 53, 123, 425,468, 469, 471, 472, 473, 475, 477, 480, 483, 487 or at any Weel protein phosphorylation sites or kinase activation domains as compared to wild type Weel; and/or the Wee molecule comprises R167Q, E273K-Weel, R253H-Weel, G106S, L483F, R167Q/E273K-Weel, or G106S/L483F-Weel.

32. The fusion peptide of claim 30, wherein the marker comprises luciferase.

33. A method of treating a patient with abnormal cell proliferation or abnormal protein degradation as compared to a healthy individual, comprising administering in a therapeutically effective dose a Weel molecule comprising at least one mutation at one or more amino acids at positions 53, 123, 425,468, 469, 471, 472, 473, 475, 477, 480, 483, 487 or at any Weel protein phosphorylation sites or kinase activation domains as compared to wild type Weel; and/or the Wee molecule comprises R167Q, E273K-Weel, R253H-Weel, G106S, L483F, R167Q/E273K-Weel, or G106S/L483F-Weel.