WO2009067813A1 - Apurinic/apyrimidinic endonuclease 1 (ape1) for use in the treatment of disorders associated with aberrant rna transcription, aberrant microrna transcription, viral rna transcription, and aberrant c-myc rna transcription - Google Patents

Abstract

A method of treating or preventing a disorder selected from: aberrant RNA transcription; viral RNA transcription; aberrant microRNA transcription; and aberrant c-myc RNA transcription, the method including administering a pharmaceutically effective amount of apurinic/apyrimidic endonuclease (APE1), a fragment of APE1, variants of APE1 or a pharmaceutical composition thereof is provided. In other aspects uses of APE1 peptides or fragments or variants or pharmaceutical compositions thereof are provided for treatment, prevention, or for preparation of medicaments for treatment and prevention of a disorder selected from: aberrant RNA transcription; viral RNA transcription; aberrant microRNA transcription; and aberrant c-myc RNA transcription.

Description

APURINIC/APYRIMIDINIC ENDONUCLEASE 1 (APEl) FOR USE IN THE

TREATMENT OF DISORDERS ASSOCIATED WITH ABERRANT RNA

TRANSCRIPTION, ABERRANT microRNA TRANSCRIPTION, VIRAL RNA

TRANSCRIPTION, AND ABERRANT C-MYC RNA TRANSCRIPTION

FIELD OF THE INVENTION

The invention relates to ribonucleases. More specifically, the present invention is drawn to endoribonucleases and uses thereof.

BACKGROUND

Ribonucleases (RNases) are enzymes that catalyze the hydrolysis of ribonucleic acid (RNA) by cleaving phosphodiester bonds. An endoribonuclease hydrolyzes the interior bonds of RNA molecules, generating oligonucleotides and polynucleotides, whereas an exoribonuclease hydrolyzes the terminal bonds of RNA molecules, producing mononucleotides.

RNases have been implicated as playing an important role in the maturation and maintenance of cellular RNA (e.g., ribosomal RNA, transfer RNA, messenger RNA) in cells. Many ribonucleases have been implicated as having other activities, in addition to their ribonuclease activity. These activities include anti-viral, anti-neoplastic, antibacterial, anti-parasitic, and neurotoxic activities. For example, eosinophil cationic protein (ECP) is a ribonuclease secreted by activated human eosinophils that is reported to have anti-parasitic, antibacterial, and neurotoxic activities (Rosenberg HF, J Biol Chem., 270(14):7876-81, 1995). Similarly, a frog ribonuclease termed "onconase" has been reported to have antiviral and antineoplastic activities (Ardelt et al., J Biol Chem., 5:266(1):245-51, 1991 ; Saxena et al., J Biol Chem., 271(34):20783-8, 1996).

The most well-characterized RNases have been isolated from bacteria, and there are relatively few well-characterized eukaryotic, e.g., mammalian ribonucleases, particularly those that degrade mature mRNAs (Guhaniyogi and Brewer, Gene 265:11-23, 2001). However, human apurinic/apyrimidic (AP) endonuclease (HAPl or APEl) is reported to have AP endonuclease activity and RNase H activity (Barzilay, G et al. Nucleic Acid Research 23(9):1544-1550, 1995).

A specific coding region in c-myc mRNA, termed the coding region determinant (CRD), is implicated in the regulation of c-myc mRNA half-life and abundance. C-myc mRNA decay intermediates corresponding to the CRD have been detected in cells and in cell-free systems, providing further support that c-myc mRNA can be endonucleolytically cleaved. However, the endoribonuclease or endoribonucleases responsible for this cleavage were previously unknown.

MicroRNAs (miRNAs) are implicated in the regulation of numerous cellular pathways and also suspected to act as oncogenes or tumour supressors. Ma, L. et al. Nature 449:682-689, 2007) report micro RNA-IOb as the initiating tumour invasion and metastasis in breast cancer. Numerous other microRNAs have also been implicated in cancer development (Voorhoeve PM. et al. Cell 124(6): 1169-81, 2006; Meng F. et al. Gastroenterology 133(2):647-58, 2007; Zhu S. et al. J Biol Chem. 282(19): 14328-36, 2007; Si ML. et al. Oncogene 26(19):2799-803, 2007; Chan JA. et al. Cancer Res. 65(14):6029-33, 2005; Ie Sage C. et al. EMBO J. 26(15):3699-708, 2007; Galardi S. et al. J Biol Chem. 282(32):23716-24, 2007; Landais S. et al. Cancer Res. 67(12):5699-707, 2007; Lum AM. et al. Retrovirology 4:5, 2007; Costinean S. et al. Proc Natl Acad Sci U S A. 103(18):7024-9, 2006; Lu Y. et al. Dev Biol. 310(2):442-453, 2007; Matsubara H. et al. Oncogene 26(41):6099-105, 2007; Hayashita Y. et al. Cancer Res. 65(21):9628-32, 2005; He L. et al. Nature 435(7043):828-33, 2005; Hammond SM. Curr Opin Genet Dev. 16(l):4-9, 2006; and O'Donnell KA. et al. Nature, 435(7043):839-43, 2005).

SUMMARY

The present application is based in part on the discovery that apurinic/apyrimidic (AP) endonuclease (APEl) has endoribonuclease activity and that it is capable of preferential RNA cleavage at sites 3' of uracil residues or sites 5' of adenine residues and cleaves aberrant c-myc RNA.

In one aspect, the present application provides methods for treating or preventing a disorder associated with aberrant RNA transcription, aberrant microRNA transcription, viral RNA transcription, or aberrant c-myc RNA transcription, by administering an endoribonuclease as described herein. The endoribonuclease may be selected from one or more of the following: apurinic/apyrimidic endonuclease (APEl) polypeptide; a peptide fragment of APEl; a peptide variant of APEl; peptide analogue of APEl ; a fusion thereof; and combinations thereof, as described herein, whereby the endoribonuclease is capable of preferentially cleaving RNA molecules at sites 3' of uracil residues or sites 5' of adenine residues. The endoribonuclease may be selected from one or more of the following: apurinic/apyrimidic endonuclease (APEl); a fragment of APEl; variants of APEl as described herein, whereby the endoribonuclease is capable of preferentially cleaving aberrant c-myc RNA.

The viral RNA may be SARS orf3, SARS spike, or SARS orflb; the aberrant c- myc RNA may be CRD RNA. The micro RNA may be selected from one or more of the microRNAs set out in TABLE 2. The endoribonuclease may also be a fusion polypeptide, which may include a targeting molecule capable of targeting the endoribonuclease to a virus-infected cell or a cancer cell. The endoribonuclease may be provided together with a pharmaceutically acceptable carrier or excipient. The endoribonuclease may include the DNA repair/nuclease domain, but not the other domains of APEl . The endoribonuclease may, for example include AA 68-318 or 68-317 of SEQ ID NOs 1-11 or functional equivalents thereof, and may exclude AA 1-67. Furthermore, the endoribonuclease may, for example include an amino acid sequence corresponding to SEQ ID NO: 23.

In further aspects, there are provided methods of screening a compound for modulating endoribonuclease activity by a) providing the endoribonuclease; b) providing a RNA molecule substrate capable of being cleaved by the endoribonuclease; c) providing a test compound; and d) determining whether the test compound modulates the cleavage of the RNA molecule substrate. The method may be carried out within a cell or carried out using a cell free system. The RNA molecule substrate may be provided in a sample.

In further aspects, there are provided kits or commercial packages including the endoribonuclease described herein (e.g. lyophilized or in a suitable buffer in a container), together with instructions for performing an endonuclease assay or for administering to a subject. The kit may include suitable buffers and other components for performing an endoribonuclease assay. The kit may include a targeting molecule and compounds for linking the targeting molecule to the endoribonuclease.

In accordance with another aspect of the invention, there is provided a method of treating or preventing a disorder selected from: aberrant RNA transcription; viral RNA transcription; aberrant microRNA transcription; and aberrant c-myc RNA transcription, the method including administering a pharmaceutically effective amount of an apurinic/apyrimidic endonuclease (APEl), a fragment of APEl, a variant of APEl or a pharmaceutical composition thereof.

In accordance with another aspect of the invention, there is provided a use of a pharmaceutically effective amount of an APEl, a fragment of APEl, a variant of APEl or a pharmaceutical composition thereof for the curative or prophylactic treatment of a disorder selected from: aberrant RNA transcription; viral RNA transcription; aberrant microRNA transcription; and aberrant c-myc RNA transcription.

In accordance with another aspect of the invention, there is provided a use of a pharmaceutically effective amount of an APEl, a fragment of APEl, a variant of APEl or a pharmaceutical composition thereof in the preparation of a medicament for the curative or prophylactic treatment of a disorder selected from: aberrant RNA transcription; viral RNA transcription; aberrant microRNA transcription; and aberrant c-myc RNA transcription.

In accordance with another aspect of the invention, there is provided an APEl peptide or a fragment or a variant thereof or a pharmaceutical composition thereof for the curative or prophylactic treatment of a disorder selected from: aberrant RNA transcription; viral RNA transcription; aberrant microRNA transcription; and aberrant c-myc RNA transcription.

In accordance with another aspect of the invention, there is provided a pharmaceutical composition for the curative or prophylactic treatment of a disorder selected from: aberrant RNA transcription; viral RNA transcription; aberrant microRNA transcription; and aberrant c-myc RNA transcription, including an APEl peptide or a fragment or a variant thereof, or a pharmaceutically acceptable salt thereof, together with a pharmaceutically acceptable diluent or carrier.

In accordance with another aspect of the invention, there is provided a commercial package containing, as an active pharmaceutical ingredient, an APEl peptide or a fragment or a variant thereof, or a pharmaceutically acceptable salt thereof, together with instructions for its use for the curative or prophylactic treatment of a disorder selected from: aberrant RNA transcription; viral RNA transcription; aberrant microRNA transcription; and aberrant c-myc RNA transcription, in an animal.

In accordance with another aspect of the invention, there is provided a kit containing, as an active pharmaceutical ingredient, an APEl peptide or a fragment or a variant thereof, or a pharmaceutically acceptable salt thereof, together with instructions for its use for the curative or prophylactic treatment of a disorder selected from: aberrant RNA transcription; viral RNA transcription; aberrant microRNA transcription; and aberrant c- myc RNA transcription, in an animal. The APEl, the fragment of APEl , the variant of APEl or the pharmaceutical composition thereof, may include one or more of the following: amino acids corresponding to SEQ ID NO:23 or amino acids 68-318 or 68-317 of SEQ ID NOS: 1 -11. The APEl, the fragment of APEl, the variant of APEl or the pharmaceutical composition thereof may be capable of preferentially cleaving RNA molecules at sites 3' of uracil residues or sites 5' of adenine residues. The APEl, the fragment of APEl, the variant of APEl or the pharmaceutical composition thereof may be capable of preferentially cleaving aberrant c-myc RNA. The APEl, the fragment of APEl, the variant of APEl or the pharmaceutical composition thereof may be capable of preferentially cleaving viral RNA. The APEl, the fragment of APEl, the variant of APEl or the pharmaceutical composition thereof may be capable of preferentially cleaving aberrant microRNA. The aberrant microRNA may be selected from one or more of the RNAs represented by SEQ ID NOS:25-39 or other microRNAs known in the art. The APEl, the fragment of APEl, the variant of APEl or the pharmaceutical composition thereof may be capable of cleaving one or more of a sequence selected from the group including of UA, UC, UU, CA, CU, CG, AC, AU, and UG. The APEl, the fragment of APEl, the variant of APEl or the pharmaceutical composition thereof may further include a fusion polypeptide. The APEl , the fragment of APEl, the variant of APEl or the pharmaceutical composition thereof may further include a targeting moiety. The targeting moiety may be capable of targeting the APEl, the fragment of APEl, the variant of APEl or the pharmaceutical composition thereof to a virus-infected cell or a cancer cell. The endoribonuclease may be capable of cleaving non-base paired RNA or single stranded RNA. The endoribonuclease may be capable of cleaving c-myc mRNA, SARS orf3 RNA, SARS spike RNA, or SARS orflb RNA. The aberrant c-myc RNA may be CRD RNA.

The medicament may be adapted for oral administration. The medicament may be formulated for administration by injection. The pharmaceutical composition may be adapted for oral administration. The pharmaceutical composition may be adapted for administration by injection. The active pharmaceutical ingredient may be adapted for oral administration. The active pharmaceutical ingredient may be adapted for administration by injection.

In accordance with another aspect of the invention, there are provided methods of cleaving a RNA molecule by contacting the RNA molecule with an endoribonuclease as described herein under conditions in which the endoribonuclease is active, where the endoribonuclease cleaves the RNA molecule. The RNA molecule may be non-base paired RNA, single stranded RNA, or double stranded RNA, or may be a aberrant c-myc RNA molecule or a SARS RNA molecule (for example, orf3, spike, or orflb). The RNA molecule may include a UA, CA, or UG sequence or other cleavage sequence described herein. The RNA molecule may also be a microRNA or a microRNA precursor molecule as described herein (for example see TABLE 2). The RNA does not need to be hybridized to a DNA molecule for cleavage.

In accordance with another aspect of the invention, there is provided a kit including the APEl, the fragment of APEl, the variant of APEl or the pharmaceutical composition thereof of described herein, together with instructions for use of the endoribonuclease.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGURE 1. shows that recombinant human APEl exhibits endoribonuclease activity against c-myc CRD RNA. (A) Left panel, Coomasie blue-stained SDS-PAGE gel of recombinant human APEl at 140 μM (lane 2) and 28 μM (lane 3). Right panel, Western blot analysis of recombinant human APEl as detected by specific monoclonal antibody against APEl. (B) 5 '-labeled c-myc CRD RNA were treated with 3 μM of purified recombinant human APEl for 5 min (lane 2), 10 min (lane 3) and 20 min (lane 4), or with 0.1 U of the partially purified 35 kDa native enzyme for 5 min (lane 5), 10 min (lane 6) and 20 min (lane 7). Lane 1 had no protein added. Samples were run on a 8% polyarylamide/7 M urea gel. Numbers on the right indicate cleavage sites generated by the enzymes. (C) Secondary structure of c-myc CRD RNA (nts 1705-1792) and sites cleaved by APEl as shown by arrows.

FIGURE 2. Electromobility shift assay showing binding of recombinant human APEl to c-myc CRD RNA. Purified recombinant mouse CRD-BP (lanes 2 and 3) and human APEl (lanes 4, 8 and 9) (at the concentrations indicated) were incubated with 40 nM [³²P] c-myc CRD RNA (50,000 cpm/lane). As negative controls, 0.5 μM Rpp20 (Iane5), Rpp21 (lane 6), and μM Rpp40 (lane 7) were used. None (lanes 1 and 10) indicates no protein was added. The positions of protein-RNA complexes (bound) and unbound RNA (unbound) are indicated on the left.

FIGURE 3. shows the effect of APEl structural mutants on APEl cleavage of c- myc CRD RNA in vitro, as compared to Recombinant wt APEl . The structural mutants, with the exception of D283N, that are associated with abasic DNA endonuclease activity are also associated with APEl RNA-cleavage activity. (A) 5 '-labeled c-myc CRD RNA were treated with the wild-type APEl (lanes 2 and 9), and H309N (lanes 3-5) or E96A (lanes 6-8) mutant APEl for 5 min at the concentrations indicated. Lane 1 and 10 had no protein added. (B) As in (A), 5'-labeled c-myc CRD RNA were treated with 0.7 μM wild- type APEl (lane 2) and N68A (lane 3), D70A (lane 4), Y171F (lane 5), D210N (lane 6), F266A (lane 7), D308A (lane 8), H309S (lane 9) mutant APEl for 5 min. Samples were run on a 8% polyarylamide/7 M urea gel. Numbers on the right indicate cleavage sites generated by the enzymes.

FIGURE 4. shows a linear schematic diagram of APEl protein, including the nuclear localization signal (NLS) from AA 1-35, Redox domain from 36-80 and the DNA repair/nuclease domain from AA 68-318, with the mutagenesis sites N-68, D-70, E-96, Y- 171, D-210, F-266, D-308, and H-309.

FIGURE 5. shows recombinant wild-type human APEl cleaves miR-10b and miR-21. (A) APEl cleaves miR-10b in between the UA and UG dinucleotides at single- stranded or weak stem regions (lOUA; 26UG; 29UA; 35UA; and 37UA) in vitro. (B) APEl cleaves miR-21 in between the CA, UG, UC, and UU dinucleotides at single- stranded or weak stem regions (26UG; 28UU; 29UG; 33UC; 35UC; and 36CA) in vitro. 1 μM of recombinant human APEl was incubated with 5' P-labeled miR-10b or 5' "P- labeled miR-21 in vitro under the standard endonuclease conditions.

FIGURE 6. shows recombinant wild-type human APEl cleaves RNA components of the SARS-corona virus, orflb, and spike RNAs. (A) APEl cleaves orflb RNA in between the UA, UG, UC, CA, CG, CU, and AC dinucleotides at single-stranded or weak stem regions (14443UG; 14445UA; 14448AC; 14449CU; 14453CA; 14455UA; 14462CG; 14464UC; 14467CA; 14473CA; 14484UA; 14487UG; 14489UA) in vitro. (B) APEl cleaves spike RNA in between the CA, UA, and UG dinucleotides at single- stranded or weak stem regions (21490CA; 21492UG; 21496UA; 21504UA; 21507UA; 21514UA) in vitro. 1 μM of recombinant human APEl was incubated with 5'³²P-labeled orflb, or spike RNA in vitro under the standard endonuclease conditions.

FIGURE 7. shows recombinant wild-type human APEl cleaves RNA components of the SARS-corona virus, orf3 RNAs. APEl cleaves orf3 RNA in between UA, UG, and CA dinucleotides at single-stranded or weak stem regions (25266UA; 25278UA; 25290UA; 25296UA; 25301CA; 25305UA; 25310CA; 25312CA; 25319UA; 25326UG; 25329CA) in vitro. 1 μM of recombinant human APEl was incubated with 5'³²P-labeled orβ RNA in vitro under the standard endonuclease conditions.

FIGURE 8. shows knockdown of APEl in HeLa cells lead to increased expression of c-myc mRNA. HeLa human cervical cancer cells were grown to sub- confluent density in 6- well plates and transfected with either with dsRNAi against APEl or scrambled-negative control for 24 and 48 hours using Lipofectamine 2000 Reagent (Invitrogen™). (A) Cell lysates extracted were subjected to Western analysis to detect APEl and β-actin levels. APEl level was reduced by 50% at 24 hour and reduced by 80% at 48 hour. (B) Total RNA extracted were subjected to first strand cDNA synthesis and the relative levels of APEl mRNA, c-myc mRNA and β-actin mRNA were determined by quantitative real time PCR™. APEl mRNA levels were reduced by 80% at 24 hour and reduced by 84% at 48 hour. At the same time, c-myc mRNA levels were increased by 70% at 24 hour and increased by 450% at 48 hour.

FIGURE 9. shows knockdown of APEl in MCF-7 cells lead to increased expression of c-myc mRNA. MCF-7 human breast cancer cells were grown to sub- confluent density in 6-well plates and transfected with either with dsRNAi against APEl or scrambled-negative control for 24 hours using Lipofectamine 2000 Reagent (Invitrogen™). Total RNA was then extracted, subjected to first strand cDNA synthesis and the relative levels of APEl mRNA, c-myc mRNA and β-actin mRNA were determined by quantitative real time PCR™. Figure 9A shows that APEl mRNA was knocked down about 70%, while Figure 9B shows c-myc mRNA was increased about 470% at the same time.

DETAILED DESCRIPTION

An "endoribonuclease" or "endoribonuclease compound" as used herein, may be an apurinic/apyrimidic endonuclease (APEl) polypeptide (also known as APE-I ; APE; APEX; APEXl; APX; APEN; HAPl ; REFl; or REF-I); a peptide fragment of APEl; a peptide variant of APEl ; a peptide analogues of APEl; a fusions thereof; and combinations thereof, as described herein, that is capable of cleaving the interior bonds of RNA molecules, generating oligonucleotides and polynucleotides. Accordingly, the peptide fragment of APEl; the peptide variant of APEl ; the peptide analogues of APEl; the fusions thereof; and the combinations thereof all retain the ability to cleave the interior bonds of RNA molecules as described herein. The RNA molecules may be single- stranded RNA molecules and may be sense or antisense RNA. Furthermore, the RNA may be folded from a single-stranded RNA molecule into double- stranded "stem" regions. Additionally, cleavage as described herein, may be carried out without hybridization of the RNA to DNA. Accordingly, the endoribonuclease activity may be operable to cleave one or more single stranded RNA targets, in the absence of RNA hybridization to a DNA molecule. APEl is known generally as a multifunctional DNA repair enzyme, but is reported herein as having endoribonuclease activity capable of preferential RNA cleavage at sites 3' of uracil residues or sites 5' of adenine residues and cleaves aberrant c-myc RNA.

By "preferentially cleaves" is meant that the endoribonuclease described herein may cleave a RNA molecule at sites 3' of uracil residues or sites 5' of adenine residues at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, or over 100% more frequently or efficiently under standard conditions relative to any other possible cleavage site. In some embodiments, "preferentially cleaves" means that the endoribonuclease described herein cleaves a single-stranded RNA molecule at sites between 3' of uracil residues and 5' of adenine residues (U-A); sites between 3' of uracil residues and 5' of guanine residues (U-G); and/or sites between 3' of cytosine residues and 5' of adenine residues (C-A) at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, or over 100% more frequently or efficiently under standard conditions relative to any other possible cleavage site. In some embodiments, "preferentially cleaves" means that the endoribonuclease described herein cleaves a single- stranded or double-stranded RNA molecule at U-A, C-A, or U-G sites at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, or over 100% more frequently or efficiently under standard conditions relative to any other possible cleavage site. The exact amount of cleavage is not critical, as long as it is statistically significant, as measured by known statistical methods.

A "targeting moiety" is a compound (for example, a nucleic acid, a polypeptide, a small molecule or a combination thereof) that is capable of specifically binding a target cell or molecule. For example, a target cell or molecule may be, one or more of: a cancer cell or molecule; a viral cell or molecule; or a specific mRNA molecule. In some embodiments, a targeting moiety may include part of a fusion protein that includes an endoribonuclease as described herein.

"Modulating" or "modulates" means changing, by either increase or decrease. The increase or decrease may be a change of any number value between 10% and 90%, or of any number value between 30% and 60%, or may be over 100%, when compared with a control or reference sample or compound.

A "test compound" is any naturally-occurring or artificially-derived chemical compound. Test compounds may include, without limitation, peptides, polypeptides, synthesized organic molecules, naturally occurring organic molecules, nucleic acid molecules and peptide nucleic acid molecules (PNA). A test compound can "compete" with a known compound such as an endoribonuclease by, for example, interfering with an endoribonuclease activity or by interfering with any biological response induced by the known compound.

Generally, a test compound can exhibit any value between 10% and 200%, or over 500%, modulation when compared to an endoribonuclease or other reference compound. For example, a test compound may exhibit at least any positive or negative number from 10% to 200% modulation, or at least any positive or negative number from 30% to 150% modulation, or at least any positive or negative number from 60% to 100% modulation, or any positive or negative number over 100% modulation. A test compound that is a negative modulator will in general decrease modulation relative to another compound, while a test compound that is a positive modulator will in general increase modulation relative to another compound. The exact amount of modulation is not critical, as long as it is statistically significant, as measured by known statistical methods.

A "sample" can be any organ, tissue, cell, or cell extract isolated from a subject, such as a sample isolated from a mammal having a cell proliferative disorder, a viral disorder, or an aberrant RNA expression disorder. For example, a sample can include, without limitation, tissue (e.g., from a biopsy or autopsy), cells, peripheral blood, whole blood, red cell concentrates, platelet concentrates, leukocyte concentrates, blood cell proteins, blood plasma, platelet-rich plasma, a plasma concentrate, a precipitate from any fractionation of the plasma, a supernatant from any fractionation of the plasma, blood plasma protein fractions, purified or partially purified blood proteins or other components, serum, semen, mammalian colostrum, milk, urine, stool, saliva, placental extracts, amniotic fluid, a cryoprecipitate, a cryosupernatant, a cell lysate, mammalian cell culture or culture medium, products of fermentation, ascitic fluid, proteins present in blood cells, solid tumours, for example, isolated from a mammal with a cancer, or any other specimen, or any extract thereof, obtained from a patient (human or animal), test subject, or experimental animal. A sample may also include, without limitation, products produced in cell culture by normal or transformed cells (e.g., via recombinant DNA or monoclonal antibody technology). A "sample" may also be a cell or cell line created under experimental conditions, that are not directly isolated from a subject. A sample can also be cell-free, artificially derived or synthesized.

The present application provides, in part, a novel endoribonuclease activity associated with APEl. The APEl endoribonuclease can be purified and modified as described herein and as known in the art. Furthermore, the APEl endoribonucleases, described herein, may be capable of preferentially cleaving RNA molecules at sites 3' of uracil residues or sites 5' of adenine residues.

Various alternative embodiments and examples are described herein. These embodiments and examples are illustrative and should not be construed as limiting the scope of the invention.

Endoribonuclease Compounds and Fusions

The endoribonuclease compounds described herein may be purified from any sample or tissue, e.g., from human, rat, bovine, etc., may be expressed or may be synthesized as known in the art. For example, representative Human APEl may be selected from the following: X66133; CAA46925; X59764; CAA42437; M92444; AAA58629; M99703; AAA58373; D90373; BAA14381; D1337O; BAA02633; M80261 ; AAA58371 ; M81955; AAA58372; U79268; AAB50212; BT007236; AAP35900; AF488551 ; AAL86909; AAH02338; AAH08145; AAH95428; AAH 19291 ; AAH04979; BC004979; BC008145; BC019291; BC095428; S43127; AAB22977; S23550; P27695; Q969L5; Q99775; NP_542380; NP_542379; NP_001632; 1E9N_B; 2ISI_A; 2ISI_C; and BC002338. Representative mouse APEl may be selected from the following: NM 009687; and AY007717. Examples of mutant APEl are also described herein, for example N68A, D70A, E96A, Y171F, D210N, F266A, D283N, D308A, H309S and H309N.

The endoribonuclease compounds described herein may be provided as fusion proteins by for example, covalently linking two protein segments. The covalent linkage may be reversible, such that the endoribonuclease is released upon delivery to a target cell or molecule. The endoribonuclease may be linked to another polypeptide using any means known in the art, for example, using chemical linkers such as a carbodiimide (e.g., 1-ethyl- 3-(3-dimethylaminopropyl)carbodiimide (EDAC) or l-ethyl-3-[3- dimethylaminopropyljcarboimide hydrochloride (EDC)), or other linker, such as, sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-l -carboxylate (Sulfo-SMCC) or N-hydroxysulfosuccinimide (Sulfo-NHS), etc.

In addition to the endoribonuclease compounds described herein, common proteins which may be used in combination (for example, a "second polypeptide") may be selected from one or more of the following: beta-galactosidase; beta-glucuronidase; green fluorescent protein (GFP); autofluorescent proteins, including blue fluorescent protein (BFP); glutathione-S-transferase (GST); luciferase, horseradish peroxidase (HRP); chloramphenicol acetyltransferase (CAT); maltose binding protein (MBP). Fusion proteins may also include epitope tags alternatively or additionally to the second polypeptide. Common epitope tags include histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags. Fusion proteins can also include Lex A DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and herpes simplex virus (HSV) BP 16 protein fusions. Fusion proteins can also include a targeting moiety, for example, an antibody that directs the fusion protein to specific cells, such as cancer cells, viruses, or cells infected by a virus.

It is well known in the art that some modifications and changes can be made in the structure of a polypeptide without substantially altering the biological function of that peptide, to obtain a biologically equivalent polypeptide. In one aspect of the invention, proteins that differ from the native protein sequences by conservative amino acid substitutions are provided. As used herein, the term "conserved amino acid substitutions" refers to the substitution of one amino acid for another at a given location in the protein, where the substitution can be made without substantial loss of the relevant function. In making such changes, substitutions of like amino acid residues can be made on the basis of relative similarity of side-chain substituents, for example, their size, charge, hydrophobicity, hydrophilicity, and the like, and such substitutions may be assayed for their effect on the function of the protein by routine testing.

In some embodiments, conserved amino acid substitutions may be made where an amino acid residue is substituted for another having a similar hydrophilicity value (e.g., within a value of plus or minus 2.0), where the following may be an amino acid having a hydropathic index of about -1.6 such as Tyr (-1.3) or Pro (-1.6)s are assigned to amino acid residues (as detailed in United States Patent No. 4,554,101, incorporated herein by reference): Arg (+3.0); Lys (+3.0); Asp (+3.0); GIu (+3.0); Ser (+0.3); Asn (+0.2); GIn (+0.2); GIy (0); Pro (-0.5); Thr (-0.4); Ala (-0.5); His (-0.5); Cys (-1.0); Met (-1.3); VaI (- 1.5); Leu (-1.8); He (-1.8); Tyr (-2.3); Phe (-2.5); and Trp (-3.4).

In alternative embodiments, conserved amino acid substitutions may be made where an amino acid residue is substituted for another having a similar hydropathic index (e.g., within a value of plus or minus 2.0). In such embodiments, each amino acid residue may be assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics, as follows: He (+4.5); VaI (+4.2); Leu (+3.8); Phe (+2.8); Cys (+2.5); Met (+1.9); Ala (+1.8); GIy (-0.4); Thr (-0.7); Ser (-0.8); Trp (-0.9); Tyr (-1.3); Pro (-1.6); His (-3.2); GIu (-3.5); GIn (-3.5); Asp (-3.5); Asn (-3.5); Lys (-3.9); and Arg (-4.5).

In alternative embodiments, conserved amino acid substitutions may be made where an amino acid residue is substituted for another in the same class, where the amino acids are divided into non-polar, acidic, basic and neutral classes, as follows: non-polar: Ala, VaI, Leu, He, Phe, Trp, Pro, Met; acidic: Asp, GIu; basic: Lys, Arg, His; neutral: GIy, Ser, Thr, Cys, Asn, GIn, Tyr.

In alternative embodiments, conservative amino acid changes may include for example changes based on one or more of the following considerations: hydrophilicity or hydrophobicity; size; volume; polarity; and charge. Amino acids can be generally characterized as hydrophobic or hydrophilic, depending primarily on the properties of the amino acid side chain. A hydrophobic amino acid exhibits a hydrophobicity of greater than zero, and a hydrophilic amino acid exhibits a hydrophilicity of less than zero, based on the normalized consensus hydrophobicity scale of EISENBERG et al. (J. MoI. Bio. 179:125-142, 184). Genetically encoded hydrophobic amino acids include GIy, Ala, Phe, VaI, Leu, He, Pro, Met and Trp, and genetically encoded hydrophilic amino acids include Thr, His, GIu, GIn, Asp, Arg, Ser, and Lys. Non-genetically encoded hydrophobic amino acids include t-butylalanine, while non-genetically encoded hydrophilic amino acids include citrulline and homocysteine.

Hydrophobic or hydrophilic amino acids can be further subdivided based on the characteristics of their side chains. For example, an aromatic amino acid is a hydrophobic amino acid with a side chain containing at least one aromatic or hetero aromatic ring, which may contain one or more substituents such as -OH, -SH, -CN, -F, -Cl, -Br, -I, - NO2, -NO, -NH2, -NHR, -NRR, -C(O)R, -C(O)OH, -C(O)OR, -C(O)NH2, -C(O)NHR, - C(O)NRR, etc., where R is independently (C1-C6) alkyl, substituted (C1-C6) alkyl, (Cl- C6) alkenyl, substituted (C1-C6) alkenyl, (C1-C6) alkynyl, substituted (C1-C6) alkynyl, (C5-C20) aryl, substituted (C5-C20) aryl, (C6-C26) alkaryl, substituted (C6-C26) alkaryl, 5-20 membered heteroaryl, substituted 5-20 membered heteroaryl, 6-26 membered alkheteroaryl or substituted 6-26 membered alkheteroaryl. Genetically encoded aromatic amino acids include Phe, Tyr, and Trp.

An apolar amino acid (or non-polar)is a hydrophobic amino acid with a side chain that is uncharged at physiological pH and which has bonds in which a pair of electrons shared in common by two atoms is generally held equally by each of the two atoms (i.e., the side chain is not polar). Genetically encoded apolar amino acids include GIy, Leu, VaI, He, Ala, and Met. Apolar amino acids can be further subdivided to include aliphatic amino acids, which is a hydrophobic amino acid having an aliphatic hydrocarbon side chain. Genetically encoded aliphatic amino acids include Ala, Leu, VaI, and He.

A polar amino acid is a hydrophilic amino acid with a side chain that is uncharged at physiological pH, but which has one bond in which the pair of electrons shared in common by two atoms is held more closely by one of the atoms. Genetically encoded polar amino acids include Ser, Thr, Asn, and GIn.

An acidic amino acid is a hydrophilic amino acid with a side chain pKa value of less than 7. Acidic amino acids typically have negatively charged side chains at physiological pH due to loss of a hydrogen ion. Genetically encoded acidic amino acids include Asp and GIu. A basic amino acid is a hydrophilic amino acid with a side chain pKa value of greater than 7. Basic amino acids typically have positively charged side chains at physiological pH due to association with hydronium ion. Genetically encoded basic amino acids include Arg, Lys, and His.

It will be appreciated, by one skilled in the art, that the above classifications are not absolute and that an amino acid may be classified in more than one category. In addition, amino acids can be classified based on known behaviour and or characteristic chemical, physical, or biological properties based on specified assays or as compared with previously identified amino acids. Furthermore, peptides having a conservative amino acid substitution may be tested to confirm activity using one of the methods described herein (for example, see methods associated with Figures 3 and 5) or any methods known to a person of skill in the art. Accordingly, a determination of what constitutes a considered conserved amino acid substitution may be determined by a test of the activity of the peptide. For example, it will be appreciated by a person of skill in the art that N68A, D70A, E96A, Y171F, D210N, F266A, D308A, H309S and H309N would not be considered conserved amino acid substitutions at regions important to the APEl activity described herein and D283N would be considered a conserved amino acid substitution or a substitution in an area that is not important to or of reduced importance to the APEl activity described herein.

In alternative embodiments, the invention provides isolated compounds such as nucleic acids and proteins. By "isolated", it is meant that the isolated substance has been substantially separated or purified away from other components, such as biological components, with which it would otherwise be associated, for example in vivo, so that the isolated substance may be itself be manipulated or processed. The term "isolated" therefore includes substances purified by purification methods known in the art, as well as substances prepared by recombinant expression in a host, as well as chemically synthesized substances. In some embodiments, a compound is "isolated" when it is separated from the components that naturally accompany it so that it is at least 60%, more generally 75% or over 90%, by weight, of the total relevant material in a sample. Thus, for example, a polypeptide that is chemically synthesized or produced by recombinant technology may be generally substantially free from its naturally associated components. A nucleic acid molecule is substantially pure when it is not immediately contiguous with (i.e., covalently linked to) the coding sequences with which it is normally contiguous in the naturally occurring genome of the organism from which the DNA of the invention is derived. An isolated compound can be obtained, for example, by extraction from a natural source; by expression of a recombinant nucleic acid molecule encoding a polypeptide compound; or by chemical synthesis. Purity can be measured using any appropriate method such as column chromatography, gel electrophoresis or HPLC.

The term "recombinant" means that something has been recombined, so that when made in reference to a nucleic acid construct the term refers to a molecule that is comprised of nucleic acid sequences that are joined together or produced by means of molecular biological techniques. The term "recombinant" when made in reference to a protein or a polypeptide refers to a protein or polypeptide molecule, which is expressed using a recombinant nucleic acid construct created by means of molecular biological techniques. The term "recombinant" when made in reference to genetic composition refers to a gamete or progeny with new combinations of alleles that did not occur in the parental genomes. Recombinant nucleic acid constructs may include a nucleotide sequence, which is ligated to, or is manipulated to become ligated to, a nucleic acid sequence to which it is not ligated in nature, or to which it is ligated at a different location in nature. Recombinant nucleic acid constructs, therefore, indicates that the nucleic acid molecule has been manipulated using genetic engineering, i.e. by human intervention. Recombinant nucleic acid constructs may for example be introduced into a host cell by transformation. Such recombinant nucleic acid constructs may include sequences derived from the same host cell species or from different host cell species, which have been isolated and reintroduced into cells of the host species. Recombinant nucleic acid construct sequences may become integrated into a host cell genome, either as a result of transformation of the host cells, or as the result of subsequent recombination events.

Peptides or peptide analogues or peptide fragments or peptide variants or fusions thereof can be synthesized by techniques known in the art, for example, by automated synthesis using solution or solid phase synthesis methodology. Automated peptide synthesizers are commercially available and use techniques well known in the art. Peptides and peptide analogues can also be prepared using recombinant DNA technology using methods such as those described in, for example, SAMBROOK J. AND RUSSELL D. (2000) Molecular Cloning: A Laboratory Manual (Third Edition) Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y.) or AUSUBEL et al. (Current Protocols in Molecular Biology, John Wiley & Sons, 1994). The peptides, peptide analogues, peptide fragments, peptide variants of fusions thereof may include an endoribonuclease selected from one or more of the following: apurinic/apyrimidic endonuclease (APEl) polypeptide; a peptide fragment of APEl ; a peptide variant of APEl; peptide analogue of APEl ; a fusion thereof; and combinations thereof, as described herein. Provided that the endoribonuclease polypeptide, peptide fragment, peptide variant, peptide analogue, or fusion thereof is capable of preferentially cleaving RNA molecules at sites 3' of uracil residues or sites 5' of adenine residues. Accordingly such molecules may be of use in treating or preventing a disorder associated with aberrant RNA transcription, aberrant microRNA transcription, viral RNA transcription, or aberrant c-myc RNA transcription, by administering an endoribonuclease as described herein.

Test Compounds

Test compounds may be identified from large libraries of both natural products or synthetic (or semi-synthetic) extracts or chemical libraries according to methods known in the art. Those skilled in the field of drug discovery and development will understand that the precise source of test extracts or compounds is not critical to the method(s) of the invention. Accordingly, virtually any number of chemical extracts or compounds can be screened using the exemplary methods described herein. Examples of such extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic compounds, as well as modification of existing compounds. Numerous methods are also available for generating random or directed synthesis (e.g., semi-synthesis or total synthesis) of any number of chemical compounds, including, but not limited to, saccharide-, lipid-, peptide-, and nucleic acid-based compounds. Synthetic compound libraries are commercially available. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources, including Biotics (Sussex, UK), Xenova (Slough, UK), Harbor Branch Oceanographic Institute (Ft. Pierce, FL, USA), PharmaMar, MA, USA, and Canadian Chemical Biology Network. In addition, natural and synthetically produced libraries of compounds are produced, if desired, according to methods known in the art, e.g., by standard extraction and fractionation methods. Furthermore, if desired, any library or compound is readily modified using standard chemical, physical, or biochemical methods.

When a crude extract is found to modulate endoribonuclease activity, further fractionation of the positive lead extract is necessary to isolate chemical constituents responsible for the observed effect. Thus, the goal of the extraction, fractionation, and purification process is the careful characterization and identification of a chemical entity within the crude extract having endoribonuclease modulatory activities. The same assays described herein for the detection of activities in mixtures of compounds can be used to purify the active component and to test derivatives thereof. Methods of fractionation and purification of such heterogeneous extracts are known in the art. If desired, compounds shown to be useful agents for treatment are chemically modified according to methods known in the art. Compounds identified as being of therapeutic, prophylactic, diagnostic, or other value may be subsequently analyzed using a suitable animal model for cell proliferation, viral infection, or aberrant RNA expression disorders. Laboratory or Clinical Applications

The endoribonuclease compounds described herein may be used as laboratory or clinical agents in a variety of research or clinical applications or assays as described herein.

In some embodiments the endoribonuclease compounds may be used in a mode similar to DNA restriction enzymes (DNA endonucleases) to cleave RNA at, for example, phosphodi ester bonds 3' of U and 5' of A of non-base paired sites or at other sites as described herein.

In some embodiments, the endoribonuclease compounds may be used to eliminate RNA (e.g., mRNA) present in a cell or sample to, for example, isolate DNA present in the cell or sample, or to disrupt protein expression within a cell. This may be done by for example exposing the cell or sample to the endoribonuclease compounds under conditions suitable for degrading RNA molecules, for example under the endonuclease assay conditions described herein or known in the art.

In some embodiments, the endoribonuclease compounds may be used to study the physical secondary structure of a specific RNA molecule (e.g. a RNA molecule that is in solution) by taking advantage of the ability of the endoribonuclease compounds to preferentially cleave non-base paired RNA.

In some embodiments, any RNA, including mRNA and structural RNAs, can be targeted for degradation using the endoribonuclease compounds of the invention. For example, introduction of a complementary antisense RNA sequence corresponding to a specific site of a target mRNA (e.g., a RNA probe), under conditions that will facilitate hybridization of the RNA molecule with the mRNA of the gene, in combination with introduction of an endoribonuclease compound, results in degradation of the resulting double-stranded RNA. Alternatively, RNA degradation may be achieved without the addition of complementary antisense RNA sequence corresponding to a specific site of a target RNA and addition of just endoribonuclease compound, whereby introduction of the endoribonuclease compound described herein into a target cell results in the degradation of the RNA within the cell. Elimination of the RNA of a specific gene may be useful for example to study the function of the gene.

In some embodiments, the endoribonuclease compounds may be used to assay the presence or absence of specific cleavage sites or to map the location of sequences on a RNA molecule for example by annealing the RNA molecule with a complementary RNA probe and cleaving the resulting double stranded RNA with the compound.

In some embodiments, the endoribonuclease compounds may be used to detect mutations or mismatches by annealing a RNA molecule with a complementary DNA probe, where a fully complementary RNA/DNA duplex would not be sensitive to cleavage by the endoribonuclease compound, while a mutation or mismatch that created single stranded, non-complementary portions would be cleaved by the endoribonuclease compound.

In some embodiments, the endoribonuclease compounds may be used to isolate specific DNA sequences or molecules from a cell or sample by annealing the DNA molecule with a complementary RNA probe, where the RNA/DNA duplex would not be sensitive to cleavage by the endoribonuclease compound, but non-hybridized RNA could be eliminated due to single stranded endoribonuclease activity. If desired, the RNA probe could be degraded by for example RNase H treatment after isolation of the duplex to leave intact the DNA molecule of interest.

In some embodiments, the endoribonuclease compounds described herein may be used to identify endoribonucleases having similar chemical or physical properties, or to identify agents capable of modulating the endoribonuclease activity, by for example comparing the chemical or physical properties of the test molecule with the endoribonuclease compounds of the invention.

The various applications may be carried out under conditions suitable for optimal activity of the compounds of the invention. For example, endoribonuclease reactions may be carried out at a temperature of at least 45⁰C to about 65⁰C for at least 10 minutes. In other embodiments, endoribonuclease reactions may be carried out at a temperature of about 4⁰C. In other embodiments, endoribonuclease reactions may be carried out in the presence of inhibitors known to inactivate other RNases. In other embodiments, endoribonuclease reactions may be carried out in the presence of metal ions such as magnesium and calcium ions. The reactions may be inactivated for example by adding an excess of copper ions. The reactions may be carried out in cell-free conditions, or may be carried out using cells obtained from various sources as described herein or known to those of skill in the art.

In some embodiments, the endoribonuclease compounds described herein may be used to reduce the levels of RNA expression, aberrant RNA expression, aberrant microRNA, viral RNA expression, or aberrant c-myc RNA expression for the treatment or prevention of a disorder associated with aberrant RNA transcription, aberrant microRNA transcription, viral RNA transcription, or aberrant c-myc RNA transcription, by administering such an endoribonuclease. The endoribonuclease may be capable of preferentially cleaving RNA molecules at sites 3' of uracil residues or sites 5' of adenine residues. The endoribonuclease may be capable of preferentially cleaving aberrant c-myc RNA.

TABLE 1. summarizes apurinic/apyrimidic (AP) DNA endonuclease and RNA- cleaving activities of recombinant mutant APEl as compared to the wild-type recombinant APEl .

a en rom guyen et a , o o : - ; rz erger et a ,

(1999) J MoI Biol 290:447-457; Chou KM and Cheng YC, (2003) J Biol Chem

278:18289-18296; Erzberger JP et al, (1998) Nucleic Acids Res 26:2771-2778; Hadi MZ et al, (2000) Nucleic Acids Res 28:3871-3879; Barzilay G et al., (1995) Nat Struct Biol

2:561-568.

Assays

Various assays, as described herein or known to one of ordinary skill in the art, may be performed to determine the modulatory activity of a test compound or to eliminate, target, or protect RNA molecules as described herein or as known by one of ordinary skill in the art. Endoribonuclease compounds may be provided in cells or cell lysates from, for example, animal tissue (e.g., rat liver, bovine liver, etc). Cells and cell lines may be obtained from commercial sources, for example, ATCC, Manassas, VA, USA. Cells and tissues may also be derived from subjects having any of the disorders described herein. For example, cell lines used as models of proliferative diseases may include commercially available cells from, for example, the American Type Culture Collection (ATCC), Manassus, VA, USA. Such cell lines may include LnCaP cells, HeLa cells, Daudi cells, Raji cells, HEK 293 cells, K562, MCF-7, HL-60, etc. Suitable animal models, e.g., of proliferative diseases include, for example, transgenic rodents (e.g. mice, rats) bearing gain of function proto-oncogenes (e.g. Myc, Src) and/or loss of function of tumour suppressor proteins (e.g. p53, Rb) or rodents that have been exposed to radiation or chemical mutagens that induce DNA changes that facilitate neoplastic transformation. Many such animal models are commercially available, for example, from The Jackson Laboratory, ME, USA. These animal models may be used as source cells or tissue for the assays of the invention. Test compounds may also be assayed in these models.

The assays may be conducted using detectably labelled molecules, i.e., any means for marking and identifying the presence of a molecule, e.g., an oligonucleotide probe or primer, a gene or fragment thereof, a peptide, or a cDNA molecule. Methods for detectably-labelling a molecule are well known in the art and include, without limitation, radioactive labelling (e.g., with an isotope such as ³²P or ³⁵S) and nonradioactive labelling such as, enzymatic labelling (for example, using horseradish peroxidase or alkaline phosphatase), chemiluminescent labeling, fluorescent labeling (for example, using fluorescein), bioluminescent labeling, or antibody detection of a ligand attached to the probe. Also included in this definition is a molecule that is detectably labelled by an indirect means, for example, a molecule that is bound with a first moiety (such as biotin) that is, in turn, bound to a second moiety that may be observed or assayed (such as fluorescein-labeled streptavidin). Labels also include digoxigenin, luciferases, and aequorin.

Therapeutics and Prophylactics

Endoribonuclease compounds described herein may be used for treatment or prophylaxis of disorders that would benefit from a reduction in the quantity of RNA e.g., disorders associated with the aberrant expression or overexpression of RNA or by excessive or aberrant cell proliferation that may include RNA overexpression as a component. Such disorders may include prion diseases (e.g., Creuzfeldt- Jakob Disease (CJD) and vCJD in humans, or bovine spongiform encephalopathy (BSE) in cows) or disorders associated with expression of microRNAs or RNAs transcribed from introns or antisense DNA. Cell proliferative diseases and disorders include, for example, neoplasms, such as fibrosarcoma, myosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioandotheliosarcoma, synoviome, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, gastric cancer, esophageal cancer, colon carcinoma, rectal cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, uterine cancer, cancer of the head and neck, skin cancer, brain cancer, squamous cell carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinome, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, testicular cancer, lung carcinoma, small cell lung carcinoma, non-small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astracytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangloblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma, leukemia, lymphoma, mantle cell lymphoma or Kaposi's sarcoma. Disorders of cell proliferation also include haematopoietic diseases, psoriasis, atherosclerosis, dermatological diseases, such as pemphigus vulgaris and pemphigus foleaceus, inflammatory disorders, e.g., Crohn's disease, rheumatoid arthritis, ulcerative colitis, organ transplants.

In some embodiments, endoribonuclease compounds described herein are capable of cleaving and degrading aberrant c-myc RNA. C-myc is a transcription factor that plays a fundamental role in controlling cell growth, differentiation, and death in virtually all mammalian cells, which is consistent with its ability to bind to several thousand coding sequences. Aberrant c-myc activity, e.g., amplification or overexpression, at both polypeptide and nucleic acid levels, has been implicated in the pathogenesis of cell proliferative disorders such as various cancers (Dang CV. MoI. Cell Biol. 19:1-11, 1999), including bladder cancer, breast cancer, colon cancer, gastric cancer, hepatocellular cancer, leukemia, lymphoma, glioblastoma, cervical cancer, melanoma, neuroblastoma, ovarian cancer, prostate cancer, rhabdomyosarcoma, small-cell lung cancer, uveal melanoma, etc. C-myc has also been implicated in the pathogenesis of restenosis (Lee et al. Antisense and Nucleic Acid Dev 9:487-492, 1999).

By a "cancer" or "neoplasm" is meant any unwanted growth of cells serving no physiological function. In general, a cell of a neoplasm has been released from its normal cell division control, i.e., a cell whose growth is not regulated by the ordinary biochemical and physical influences in the cellular environment. In most cases, a neoplastic cell proliferates to form a clone of cells which are either benign or malignant. Examples of cancers or neoplasms include, without limitation, transformed and immortalized cells, tumours, and carcinomas such as breast cell carcinomas and prostate carcinomas. The term cancer includes cell growths that are technically benign but which carry the risk of becoming malignant. By "malignancy" is meant an abnormal growth of any cell type or tissue. The term malignancy includes cell growths that are technically benign but which carry the risk of becoming malignant. This term also includes any cancer, carcinoma, neoplasm, neoplasia, or tumor

Endoribonuclease compounds described herein may be used for treatment or prophylaxis of disorders related to viral infection, for example, by SARS virus, human immunodeficiency virus (HIV), Human T-cell Lymphotrophic virus (HTLV), human papillomavirus (HPV), Hepatitis A, B, or C virus, herpesviruses (e.g., herpes simplex virus, varicella herpes zoster virus, cytomegalovirus, or Epstein Barr virus), paramyxoviruses, polioviruses, rhinoviruses, adenoviruses, coronaviruses, or viruses that cause rubella, measles, mumps, rabies, ebola, or influenza. In some embodiments, endoribonuclease compounds described herein are capable of cleaving and degrading SARS virus RNAs, such as orf3, orflb, or spike RNA. Endoribonuclease compounds described herein may also be used for treatment or prophylaxis of disorders related to infection, for example by a bacterium, yeast, other parasite (for example, a helminth a type of parasitic worm), etc.

Endoribonuclease compounds described herein may be used for treatment or prophylaxis of disorders related to aberrant Micro RNA transcription. For example many cancers have been associated with MicroRNAs. MicroRNAs associated with cancer development may be found, for example, in TABLE 2 below.

Pharmaceutical & Veterinary Compositions, Administration, and Dosages

Endoribonuclease compounds described herein can be provided alone or in combination with other compounds (for example, nucleic acid molecules, small molecules, peptides, or peptide analogues), in the presence of any pharmaceutically acceptable carrier, in a form suitable for administration to animals such as mammals, for example, humans, cattle, sheep, etc. If desired, treatment with an endoribonuclease compound described herein may be combined with more traditional and existing therapies for cell proliferative disorders, viral infections, or aberrant RNA expression disorders.

Conventional pharmaceutical practice may be employed to provide suitable formulations or compositions to administer the endoribonuclease compounds to subjects suffering from or presymptomatic for cell proliferative disorders, viral infection, or RNA expression disorders. Methods well known in the art for making formulations are found in, for example, "Remington's Pharmaceutical Sciences" (19^th edition), ed. A. Gennaro, 1995, Mack Publishing Company, Easton, Pa. Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes. Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene- polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems include ethylene- vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel. For therapeutic or prophylactic compositions, the compounds are administered to an individual in an amount sufficient to stop or slow a cell proliferative disorder, a viral infection, or a RNA expression disorder, depending on the disorder.

The compounds described herein may be administered in combination (e.g, by covalent or non-covalent binding, as a fusion) with a targeting molecule, e.g., an antibody that specifically recognizes a cell, such as a cell that is undergoing inappropriate cell proliferation or RNA expression, or that is infected with for example a virus or other infectious organism, for delivery to that cell. For example, malignant B cells over-express CD22 and an antibody to CD22 would therefore target B cells. Such targeting methods are known in the art, and are described in for example U.S. Patent No. 5,541,297 issued to Hansen et al. July 30, 1996; U.S. Patent No. 4,867,973 issued to Goers et al. September 19, 1989; or U.S. Patent No. 5,776,427 issued to Thorpe et al. July 7, 1998. Targeting molecules may also include polypeptides such as the antennapedia transducing protein (Chikh GG et al. (2001) J. Immunology 167: 6462-6470), that is capable of delivering a fusion polypeptide into a cell.

The endoribonuclease compounds described herein may be administered in combination, in a single formulation or as separate formulations, with for example an antisense RNA molecule that is complementary to a gene of interest such that the compound may specifically degrade the double stranded molecules formed as a result of hybridization between the mRNA of the gene of interest and the complementary RNA molecule.

Any appropriate route of administration may be employed, for example, parenteral, intravenous, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intrathecal, intracisternal, intraperitoneal, intranasal, aerosol, topical, or oral administration. Formulations may be in the form of liquid solutions or suspensions; for oral administration, formulations may be in the form of tablets or capsules; and for intranasal formulations, in the form of powders, nasal drops, or aerosols. For treatment of restenosis, for example, the therapeutic or prophylactic formulations may be coated on a stent. The endoribonuclease compounds may be provided in liposomes.

An "effective amount" of an endoribonuclease compound described herein includes a therapeutically effective amount or a prophylactically effective amount. A "therapeutically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, such as reduction of cell proliferation, viral infection, or aberrant RNA expression, or reduction of diseased cells or tissue. A therapeutically effective amount of an endoribonuclease compound may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the compound to elicit a desired response in the individual. Dosage regimens may be adjusted to provide the optimum therapeutic response. A therapeutically effective amount is also one in which any toxic or detrimental effects of the endoribonuclease compound are outweighed by the therapeutically beneficial effects. A "prophylactically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result, such as reduction of cell proliferation, viral infection, or aberrant RNA expression, or reduction of diseased cells or tissue. Typically, a prophylactic dose is used in subjects prior to or at an earlier stage of disease, so that a prophylactically effective amount may be less than a therapeutically effective amount. An exemplary range for therapeutically or prophylactically effective amounts of an endoribonuclease compound may be any number from 0.1 nM-O.lM, 0.1 nM-0.05M, 0.05 nM-15μM or 0.01 nM-10μM.

It is to be noted that dosage values may vary with the severity of the condition to be alleviated. For any particular subject, specific dosage regimens may be adjusted over time according to the individual need and the professional judgement of the person administering or supervising the administration of the compositions. Dosage ranges set forth herein are exemplary only and do not limit the dosage ranges that may be selected by medical practitioners. The amount of active compound in the composition may vary according to factors such as the disease state, age, sex, and weight of the individual. Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. It may be advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage.

In the case of vaccine formulations, an immunogenically effective amount of an endoribonuclease compound described herein can be provided, alone or in combination with other compounds, with an immunological adjuvant, for example, Freund's incomplete adjuvant, dimethyldioctadecylammonium hydroxide, or aluminum hydroxide. The compound may also be linked with a carrier molecule, such as bovine serum albumin or keyhole limpet hemocyanin to enhance immunogenicity.

In general, endoribonuclease compounds described herein should be used without causing substantial toxicity. Toxicity of these compounds can be determined using standard techniques, for example, by testing in cell cultures or experimental animals and determining the therapeutic index, i.e., the ratio between the LD50 (the dose lethal to 50% of the population) and the LDlOO (the dose lethal to 100% of the population). In some circumstances however, such as in severe disease conditions, it may be necessary to administer substantial excesses of the compositions.

Materials and Methods Purification of the native APEl

Native endonucleases were purified from juvenile frozen rat livers as previously described (Bergstrom K. et al. (2006) J Cell Biochem 98:519-537) except for the following changes: (i) Reactive blue-4 chromatographic step was omitted, (ii) dialysis rather than dilution was performed at each step to remove excess KCl, (iii) Superdex 75 Hi Load 16/60 (GE Healthcare, Quebec) gel filtration was used as the last preparative step, and (iv) RNasin was omitted in the endonuclease assay. One unit (U) of enzyme was defined as the quantity of purified enzyme (up to heparin-sepharose column) required to cleave 25% of the 5'-³²P-labeled c-myc CRD RNA substrate in the endoribonuclease assay described herein. For gel filtration purified enzyme, 1 U of 10-20 kDa enzyme was defined as the volume of the enzyme required to cleave 25% of the 5'-³²P-labeled c-myc CRD RNA substrate in the endoribonuclease assay described herein. 1 U of 30-40 kDa enzyme was defined as the volume of the purified enzyme measured under the endonuclease assay.

Construction of plasmids and DNA templates

The plasmid pGEM4Z-myc 1705-1792 was constructed as previously described (Bergstrom K. et al. (2006) J Cell Biochem 98:519-537; Tafech A. et al. (2007) Biochim Biophys Acta 1769:49-60). Plasmids ρUC19-Spike, pUC19-orf3, and pUC19-orflb were constructed using molecular sub-cloning techniques according to established protocols. cDNA clones of SARS-coronavirus were gifts from Dr. Marco Marra (Genome Science Centre, BC Cancer Agency) and were used as template to amplify segments of cDNA of spike (nts 21482-21499), orf3 (nts 25260-25278), and orflb (nts 14440-14457) (Marra MA et al (2003) Science 300: 1399-1404). The PCR™ primers used were: Spike forward primer, 5'-CTC GGA TCC TAA TAC GAC TCA CTA TAG GCT AAA CGA ACA TGT TTA T-3\ Spike reverse primer, CTC GAA TTC TGC ACC GGT CAA GGT CAC-3'; orf3 forward primer, 5'-CTC GGA TCC TAA TAC GAC TCA CTA TAG GCG AAC TTA TGG ATT TGT T-3\ and orf3 reverse primer, 5'-CTC GAA TTC GAG AAG CAT TGT CAA TTT-3'; orflb forward primer, 5'-CTC GGA TCC TAA TAC GAC TCA CTA TAG GAG GAT GTA AAC TTA CAT A-3', orflb reverse primer, CTC GAA TTC ATA GCT GGA TCA GCA GCA-3'. T7 RNA promoter sequences are underlined and restriction sites for EcoRl and BamRl are italicized. PCR™ products were digested with BamRl and EcoRl and sub-cloned into BamHl and £coRI site of pUC19. pMIF-cGFP- Zeo-hsa-miR-10b was purchased from System Biosciences (Mountain View, CA) and pSIF-Neo-Ires-GFP-has-miR-21 was a gift from Dr. Yong Li (University of Louisville, USA). These were used as templates for PCR™ amplification to generate DNA templates suitable for direct use in in-vitro transcription. The PCR™ primers used were: pre-miR- 10b forward primer, 5'-GGA TCC TAA TAC GAC TCA CTA TAG GTA CCC TGT AGA ACC GAA T-3', pre-miR-lOb reverse primer, 5'-ATT CCC CTA GAA TCG AAT- 3'; pre-miR-21 forward primer, 5'-GGA TCC TAA TAC GAC TCA CTA TAG GTA GCT TAT CAG ACT GAT G-3\ pre-miR-21 reverse primer, 5'-ACA GCC CAT CGA CTG GTG-3'. Preparation of radiolabeled nucleic acids

To synthesize human c-myc CRD RNA corresponding to nucleotides 1705-1792, the plasmid pGEM4Z-myc 1705-1792 was linearized and in-vitro transcribed as previously described (Bergstrom K. et al. (2006) J Cell Biochem 98:519-537; Tafech A. et al. (2007) Biochim Biophys Acta 1769:49-60). To synthesize spike, orO, and orflb RNAs, pUC19-Spike, pUC19-orβ, and pUC19-orflb were each linearized with EcoRl and in-vitro transcribed using T7 RNA polymerase as previously described (Bergstrom K. et al. (2006) J Cell Biochem 98:519-537; Tafech A. et al. (2007) Biochim Biophys Acta 1769:49-60). To synthesize pre-miR-lOb and ρre-miR-21, the PCR™ amplified DNA templates described above were used directly for in-vitro transcription by T7 RNA polymerase. All RNAs were then 5 '-labeled with γ- [³²P] -ATP using T4 polynucleotide kinase (Bergstrom K. et al. (2006) J Cell Biochem 98:519-537; Tafech A. et al. (2007) Biochim Biophys Acta 1769:49-60).

In vitro assay for endonuclease activity

The standard 20-25-μl reaction mixture used for this assay included 2 mM DTT, 1.0 unit of RNasin, 2 mM magnesium acetate, 50 mM potassium acetate, 0.1 mM spermidine, 1 ng of 5 '-end-labeled ³²P-RNA (~ 5 x 10⁴ cpm), and 10 mM Tris-HCl, pH 7.4. The pH of all buffers for experiments described here was determined at room temperature. Reactions were incubated for 5 min at 37⁰C unless otherwise indicated, placed in liquid nitrogen, and then at 80-90⁰C to inactivate enzyme activities. Five μl of loading dye (9 M urea, 0.2% xylene cyanol, 0.2% bromophenol blue) were added to 5 μl of reaction samples, and then subjected to electrophoresis on 8% polyacrylamide, 7 M urea gel. For identification of cleavage sites, partial RNase Tl digestion and alkaline hydrolysis of radiolabeled RNA were done as previously described and samples were ran on 8% or 12% polyacrylamide, 7 M urea gel (Bergstrom K. et al. (2006) J Cell Biochem 98:519-537). Gels were fixed in 10% acetic acid, 10% methanol for 15 min, and then dried before subjecting them to phosphorlmaging using a Cyclone Phosphor Imager™.

Endonuclease Assay and Mapping of RNA Cleavage Sites

To synthesize human c-myc CRD RNA corresponding to nts 1705-1886, the plasmid pGEM4Z-myc 1705-1886 was linearized and in-vitro transcribed as previously described (Bollenbach TJ. et al. (2004) Prog Nucleic Acid Res MoI Biol 78:305-337). The RNA was then 5'-labeled with γ-[³²P]-ATP using T4 polynucleotide kinase, and used in the endonuclease assay described previously (Bergstrom K. et al. (2006) J Cell Biochem 98:519-537; Tafech A. et al. (2007) Biochim Biophys Acta 1769:49-60). Reaction samples were run on 8% polyacrylamide/7M urea gel, dried and exposed to Phosphorlmager screen (Cyclone Phosphorlmager™). To determine if the native enzyme was N-glycosylated, 100 U of N-glycosidase F (Roche Diagnostics™, Germany) was incubated with 3.0 ml of post heparin-sepharose samples overnight at 3O⁰C before subjecting the samples to gel filtration analysis. The collected 0.5 ml fractions were then analyzed for presence of endonuclease activity as described above. To determine if the native enzyme was composed of multi-subunits linked by disulfide bonds, 3.0 ml of post heparin-sepharose samples was incubated with 250 mM DTT for 1 h at 4°C before subjecting the samples to gel filtration analysis followed by endonuclease assay. For mapping RNA cleavage sites, RNase Tl digestion and alkaline hydrolysis of radiolabeled RNA were performed as described previously (Bergstrom K. et al. (2006) J Cell Biochem 98:519-537) and samples were separated on a 12% polyacrylamide/7M urea gel.

Electrophoretic mobility shift assays

Electrophoretic mobility shift assays (EMSA) were performed as described previously (Sparanese D. and Lee CH. (2007) Nucleic Acids Res 35:1209-1221). Briefly, EMSA-binding buffer containing radiolabeled c-myc CRD RNA was incubated with purified recombinant proteins in a 20-μl reaction volume at 30⁰C for 10 min and transferred to ice for 5 min. This was repeated before heparin was added to a final concentration of 5 mg/ml for the final 5 min on ice. After addition of loading dye, reaction samples were run on 8% native polyacrylamide gel, dried and then subjected to autoradiography using the Cyclone Phosphorlmager™.

Western blot analysis

Protein samples were separated in a 12.5% polyacrylamide/SDS Lammeli gel system, transferred to a nitrocellulose membrane, and incubated against APEl monoclonal antibody (Affinity Bioreagents™, Colorado) or β-actin monoclonal antibody (Sigma™). For re-use, some blots were stripped by incubating at 50-55⁰C with gentle shaking in 63 mM Tris. pH 6.7, 2% SDS. 100 mM β-mercaptoethanol. Full range rainbow marker (GE Healthcare™, Quebec) was used to identify size of bands. Sizes of proteins on the marker in kDa are: 250, 160, 105, 75, 50, 35, 30, 25, 15, and 10.

Cell culture and siRNA transfection

HeLa human cervical cancer cell line cells and MCF-7 human breast cancer cell line cells (available from the ATCC™) were cultured in DMEM medium supplemented with 10% fetal bovine serum (Invitrogen™) at 37°C in 5% CO₂. The day before transfection, - 2.5 x 10⁵ cells were plated per well in 6- well plates. Transient transfection of 20 μM siRNAs was carried out using Lipofectamine 2000™ reagent (Invitrogen™) following the manufacturer's instructions. The double-stranded Dicer substrate RNAi directed against APEl mRNA was chemically synthesized (IDT Inc.). The sense and antisense sequences were: r(GUCUGGUACGACUGGAGUACCGG)dCA and r(UGCCGGUACUCCAGUCGU ACCAGACCU). As control, the DS Scrambled Negative (Integrated DNA Technologies Inc.™) was used. Cells from duplicate wells in each experiment were subjected to either total RNA extraction as described below or to cell lysate isolation as previously described (Bassett T et al (2008) Cancer Lett 272: 167- 175).

Total RNA extraction and quantitative reverse transcription-PCR

Total RNA was extracted from cells using TRIzol™ reagent (Invitrogen™) as according to the manufacturer's instructions. APEl, c-myc, and β-actin mRNA levels were examined by quantitative real-time reverse transcription-PCR (qRT-PCR). The first strand cDNA synthesis was performed using QuantiTect RT™ kit (Qiagen™) on 1 μg of total RNA, and the qRT-PCR was performed using iQ SYBR Green Supermix™ (Bio- Rad™) on an iQ5 Multicolor Real-Time PCR Detection System (Bio-Rad™). The PCR primers synthesized by IDT Inc. were: APEl forward primer, 5'-TGG AAT GTG GAT GGG CTT CGA GCC-3', and APEl reverse primer, 5'-AAG GAG CTG ACC AGT ATT GAT GA-3'; c-myc forward primer, 5'-ACG AAA CTT TGC CCA TAG CA-3', and c- myc reverse primer, 5' GCA AGG AGA GCC TTT CAG AG-3'; β-actin forward primer, 5'-TTG CCG ACA GGA TGC AGA AGG A-3', and β-actin reverse primer, 5'-AGG TGG ACA GCG AGG CCA GGA T-3'. The cycling protocol consisted of 95°C for 3 min and 40 cycles of denaturation at 95⁰C for 10 s, annealing at 52°C for 30 s and plate read. To confirm amplification specificity, we performed a melting curve analysis at the end of each cycling. Each sample was run in triplicate. The data were analyzed using iQ5™ optical system software. Serial dilutions were carried out for each total RNA sample and reverse-transcribed under the above-mentioned conditions for each primer set to ensure amplification with efficiencies near 100%. Cj values for target genes (APEl and c-myc) and reference gene (β-actin) were then used in the comparative Cj method or commonly known as the 2^"ΔACT method (30) to determine the expression level of target gene in APEl- knockdown samples relative to the DS Scrambled Negative-treated sample.

Purification of recombinant wild-type and mutants human APEl

The plasmid pET15b-hAPEl, containing human APEl cDNA (Accession no. BC002338) is shown below in Table 3 and was provided by Sankar Mitra from Sealy Center for Molecular Medicine, at the University of Texas, Medical Branch. Furthermore, the recombinant APEl was expressed using the following protocol. Briefly, the plasmid pET15b-hAPEl was transformed into BL21 (DE3) cells and plated onto LB agar ampicillin plate at 30 C and a cell paste containing an area of bacterial growth was taken into 500 ml LB media with 200 μg/ml ampicillin. The cells were allowed to grow at 37°C with shaking until OD600 of 0.3-0.6 was achieved. The temperature was then shifted to either 23⁰C (for another 6 hours) or 16°C (overnight) with additional 200 μg/ml ampicillin and 0.5 mM IPTG.

The recombinant His-tagged APEl was then purified using two-step column chromatography as described (Izumi T. et al (1999) J MoI Biol 287:47-57). Briefly, following the growth of bacteria either at 23°C orl6°C, cells was then pelted and resuspended in ice-cold buffer B (20 mM Tris, pH 8, 0.5 M NaCl). Cells were then sonicated and filtered through 0.45 μm filter unit. The filtrate was then applied onto 3 ml Ni-NTA column and the column was washed with 30 ml buffer B. A further 18 ml buffer B containing 20 mM Imidazole™ was applied to the column. Finally, the His-tagged recombinant APEl was eluted with 6-10 ml buffer B containing 200 mM imidazole. The His-tag was then removed by incubating with 10-15 U thrombin at 4°C overnight. Following removal of the His-tag with thrombin, the recombinant protein was further purified by Superdex HiPrep FPLC™ (GE Healthcare™). Just prior to use for enribonuclease assay, the recombinant protein was dialyzed for 5 h against 10 mM Tris- HCl, pH 7.4, 2 mM DTT, 2 mM magnesium acetate, and 50 mM potassium acetate, with two buffer changes. The plasmids for making E96A and H309N mutants were generated using the standard PCR-based method and the recombinant mutant proteins E96 and H309N were purified in the same manner as described above (Izumi T. et al. (1999) JMo/ Biol 287:47-57). The recombinant mutant proteins N68A, D70A, Yl 71F, D210N, F266A, D3O8A, and H309S were provided by Dr. David M. Wilson III (NIH, Baltimore) and these were purified according to the method described previously (Hadi MZ et al. (2000) Nucleic Acids Res 28:3871-3879; Nguyen LH et al. (2000) J MoI Biol 298:447-459; Erzberger JP and Wilson DM III (1999) JMo/ Biol 290:447-457).

Alternatively, APEl protein can be obtained commercially from New England Biolabs™ (Catalog no. M0282S and M0282L).

Representative human APEl sequences with associated accession numbers may be found in TABLE 4 below.

The above underlined residues in SEQ ID NOs: 12-21 are known to reduce or eliminate APEl RNAse cleavage activity. In particular, the following APEl mutants have been tested (some at vaπous concentrations): N68A; D70A; E96A; Yl 7 IF; D210N; F266A; D308A; H309S; and H309N. All the above mutants showed reduced or no APEl RNAse cleavage activity.

Partial Human APEl sequence and Synthetic APEl sequence are shown in TABLE 5 below.

e aa res ues may represent conservat ve y or non-conservat ve y su st tute am no acids or may be absent.

APEl is also referred to as HAPl and REF-I . Additional representative Human APEl /HAPl /REF-I may be selected from the following:

X66133; CAA46925; X59764; CAA42437; M92444; AAA58629; M99703; AAA58373; D90373; BAA14381; D13370; BAA02633; M80261 ; AAA58371; M81955; AAA58372; U79268; AAB50212; BT007236; AAP35900; AF488551 ; AAL86909; AAH02338; BC004979; BC008145; BC019291 ; BC095428; S43127; AAB22977; S23550; P27695; Q969L5; and Q99775.

Representative mouse APEl may be selected from the following: NM_009687; and AY007717.

EXAMPLES Recombinant Human APEl Exhibited Similar RNA Cleavage Pattern

Recombinant human APEl shows endoribonuclease activity for c-myc CRD RNA. The purified proteins were almost homogenous (more than 95% pure) based on Coomasie blue-staining after SDS-PAGE (Fig. IA, left panel) and identity checked by Western analysis (Fig. IA, right panel). In Figure IA, the left panel shows protein at approximately 32kDa in lanes 2 and 3. Figure IA, right panel, shows a concentration of APEl at approximately 32kDa in lanes 1 and 2. There is also a minor, lower molecular weight band in the immunoblot that is likely to be an N-terminal cleavage product of APEl . This is commonly observed as the protein is quite susceptible to specific hydrolysis upon boiling. This endonuclease analysis shows that recombinant APEl from two separate sources exhibits endonuclease activity against c-myc CRD RNA with a distinct preference for the 175 IUA dinucleotide (data not shown). In Figure IB, 5'- labeled c-myc CRD RNA were treated with 3 μM of purified recombinant human APEl for 5 min (lane 2), 10 min (lane 3) and 20 min (lane 4), or with 0.1 U of the partially purified 35 kDa native enzyme for 5 min (lane 5), 10 min (lane 6) and 20 min (lane 7). Lane 1 had no protein added. Numbers on the right indicate cleavage sites generated by the enzymes. Recombinant APEl was reduced, denatured with guanidine hydrochloride and renatured, the renatured recombinant APEl shows endonuclease activity (see lanes 2- 4), which was similar, if not identical, to that of the native enzyme (lanes 5-7) with 175 IUA still being the dominant cleavage site. However, the 1768CA, 1771 CA, 1773UA and 1775CA cleavages were less apparent in lanes 5-7.

Recombinant Human APEl Binds to Human Aberrant c-myc RNA

Recombinant APEl was tested for binding to c-myc CRD RNA by gel electromobility shift analysis (EMSA). CRD-BP, which is known to bind to c-myc CRD RNA and three recombinant proteins, Rpp20, Rpp21, and Rpp40, which are known to have no binding affinity for c-myc CRD RNA, were used as controls (lanes 2, 3, 5-7 in Figure 2), whereby the majors bands were all within the "unbound" region. Figure 2 also shows recombinant human APEl at 1, 2 and 2.5 μM (lanes 4, 8, 9 respectively) formed a specific complex of distinct mobility with the c-myc CRD RNA (within the "bound" region).

Identification of Active Residues in APEl for Eiidoribonuclease Activity

Specific residues N-68, D-70, E-96, Y-171, D-210, F-266, D-308, and H-309 have been associated with the AP DNA endonuclease (Barzilay G. et al. (1995) Nat Struct Biol 2:561-568 and Izumi T. et al. (1999) J MoI Biol 287:47-57), exonuclease (Chou K-M and Cheng Y-C. (2003) J Biol Chem 278:18289-18296) and RNase H activities of APEl (Barzilay G. et al. (1995) Nucleic Acids Res 23:1544-1550). To examine whether the c- myc CRD RNA-cleaving activity of APEl is dependent on the same amino acids as the above nuclease activities, APEl N68A, D70A, Y171F, D210N, F266A, D308A, H309S mutant polypeptides were purified and tested for RNA endonuclease activity using the endonuclease assay described herein. Figure 3 A shows the lack of RNA cleaving activity of the E96A mutant at up to 22 μM of the protein (lanes 6-8, Figure 3A). H309N mutant also did not exhibit any endoribonuclease activity at 3 and 11 μM (lanes 3 and 5, Figure 3A). Interestingly, at a higher concentration (22 μM), the H309N mutant cleaved CRD RNA at 1727CA, 1768CA, 177 ICA, 1773UA and 1775CA but not at 1757UA, 175 IUA, 1747UA and 1742CA, when compared to lanes 2 and 9, which have wild type recombinant APEl and show cleavage products at 1727CA, 1768CA, 177 I CA, 1773UA and 1775CA, 1757UA, 175 IUA, 1747UA and 1742CA.

Similarly, Figure 3B shows 0.7 μM of APEl mutants, (provided by Dr. David M. Wilson III), incubated with ³²P-labeled c-myc CRD RNA under standard endonuclease conditions. The structural mutants N68A (lane 3), D70A (lane 4), Y171F (lane 5), D210N (lane 6), F266A (lane 7), D283N (lane 8), D308A (lane 9), and H309S (lane 10), are reported to be important for abasic DNA endonuclease activity (Hadi MZ et al. (2000) Nucleic Acids Res 28:3871-3879; Nguyen LH et al. (2000) J MoI Biol 298:447-459; Erzberger JP and Wilson DM III (1999) J MoI Biol 290:447-457; Barzilay G et al. (1995) Nat Struct Biol 2:561-568), and are shown herein, with the exception of D283N (lane 8). to also be important for APEl RNA-cleaving activity (see Figure 3B). Figure 3B shows wild type recombinant APEl (lane 2) and D283N (lane 8) as having cleavage products at 1727CA, 1768CA, 1771CA, 1773UA and 1775CA, 1757UA, 1751UA, 1747UA and 1742CA, while N68A (lane 3), D70A (lane 4), Y171F (lane 5), D210N (lane 6), F266A (lane 7), D308A (lane 9), and H309S (lane 10) show no or very reduced cleavage products. Thereby confirming that the endoribonuclease activity of APEl associated with c-myc CRD RNA shares many of same amino acids (with the exception of D283N) as those involved in its AP DNA endonuclease, RNase H and exonuclease activities. A comparative summary of AP DNA endonuclease activity and RNA-cleaving activity of the recombinant mutant proteins as compared to the wild-type recombinant APEl is shown in Table 1.

Recombinant APEl is shown herein to bind c-myc CRD RNA (Figure 2) and to cleave specific RNA sequences on the transcript, namely in between CA, UA, and UG dinucleotides at single-stranded regions or weak stem regions (Figure IB and 1C). To our knowledge, this is the first demonstration of a sequence specific endoribonuclease activity intrinsic to APEl .

Besides the nucleus, APEl is also found in the cytoplasm and in some cases. APEl has been reported to be exclusively present in the cytoplasm (Damante G. et al. (2005) Antioxid Redox Signal 7:367-384). Furthermore, re-distribution of the protein between the nucleus and cytoplasm in some cancers has been shown (Damante G. et al. (2005) Antioxid Redox Signal 7:367-384; and Evans AR. et al. (2000) Mutat Res 461 :83- 108). Indeed, APEl has been reported to associate with ribosomes in motor neurons and also possibly in highly proliferative cells including hepatocytes (Evans AR. et al. (2000) Mutat Res 461 :83-108). Interestingly, we have purified APEl from rat liver polysomal fraction which supports its role in RNA processing.

A linear schematic diagram of APEl protein with tested mutation positions are shown in Figure 4. A nuclear localization signal (NLS) is shown from AA 1-36, Redox domain from 37-80 and the DNA repair/nuclease domain from AA 81-318. Individual mutagenesis sites N-68, D-70, E-96, Y-171 , D-210, F-266, D-308, and H-309 are represented.

Recombinant Wild-type Human APEl Cleaves pre-miR-lOb and pre-miR-21 in vitro.

Recombinant wild-type human APEl is shown herein to cleave miR-10b in between the UA and UG dinucleotides at single-stranded or weak stem regions (lOUA; 26UG; 29UA; 35UA; and 37UA) in vitro (Figure 5A lane 3) as compared to RNase Tl cleavage products at G39, G34, G28, G27, G25, G23, and Gl 7 (lane 1). 1 μM of recombinant human APEl was incubated with 32P-labeled miRNAlOb in vitro under the standard endonuclease conditions (Tafech A et al. (2007) Biochim Biophys Acta 1769:49- 60). miR-10b has been shown to cause tumor invasion and metastasis in human breast cancer (Ma L et al. (2007) Nature 449:682-689). Similarly, Figure 5B shows that APEl cleaves iniR-21 in between the CA, UG, UC, and UU dinucleotides at single-stranded or weak stem regions (26UG; 28UU; 29UG; 33UC; 35UC; and 36CA) in vitro. 1 μM of recombinant human APEl was incubated with 5'³²P-labeled miR-10b or 5'³²P-labeled miR-21 in vitro under the standard endonuclease conditions.

Accordingly, APEl 's ability to cleave miR-10b in between the UA and UG or APEl ' s ability to cleave miR-21 in between CA, UG, UC, and UU dinucleotides at single- stranded or weak stem regions demonstrates usefulness in treating tumor invasion and metastasis in human breast cancer.

Recombinant Wild-type Human APEl also Cleaves SARS-corona virus, orflb, spike, and orO RNAs.

Recombinant wild-type human APEl is shown herein to cleave components of the SARS-corona virus, orflb, spike, and orf3 RNAs. Figure 6A shows APEl cleavage of segments of orflb RNA in between the UA, UG, UC, CA, CG, CU, and AC dinucleotides at single-stranded or weak stem regions (14443UG; 14445UA; 14448AC; 14449CU; 14453CA; 14455UA; 14462CG; 14464UC; 14467CA; 14473CA; 14484UA; 14487UG; 14489UA) in vitro. Similarly, Figure 6B shows APEl cleavage of segments of spike RNA in between the CA, UA, and UG dinucleotides at single-stranded or weak stem regions (21490CA; 21492UG; 21496UA; 21504UA; 21507UA; 21514UA) in vitro. Figure 7 shows APEl cleavage of segments of orf3 RNA in between UA, UG, and CA dinucleotides at single-stranded or weak stem regions (25266UA; 25278UA; 25290UA; 25296UA; 25301CA; 25305UA; 25310CA; 25312CA; 25319UA; 25326UG; 25329CA) in vitro. The assays shown in Figures 6 A and B and Figure 7 were performed with 1 μM of recombinant human APEl incubated with 5'³²P-labeled orflb, spike, or orf3 RNA in vitro under the standard endonuclease conditions.

Accordingly, APEl 's ability to cleave SARS-corona virus, orflb, spike, and orf3 RNAs dinucleotides at single-stranded or weak stem regions demonstrates usefulness as anti-viral agent for the treatment of viral infections, including severe acute respiratory syndrome (SARS).

Down- regulation of APEl Results in Increased Levels of c-myc mRNA in HeLa Human Cervical Cancer Cell Line.

Figure 8 A shows knockdown of APEl protein levels in HeLa at 24 hour (reduced by 50%) and 48 hour (reduced by 80%) after transfection with dsRNAi against APEl . Figure 8B shows that APEl mRNA was reduced by 80% at 24 hour and 84% at 48 hour. At the same time c-myc mRNA was increased 70% at 24 hour and 450% at 48 hour. Accordingly, APEl can influence c-myc mRNA levels in HeLa cells by c-myc mRNA degradation, further supporting APEl 's usefulness in treating human cancers (for example, cervical cancer). Down-regulation of APEl Results in Increased Levels of c-myc mRNA in MCF-7 Human Breast Cancer Cell Line.

Figure 9A shows that APEl mRNA was knocked down about 70%, while Figure 9B shows c-myc mRNA was increased about 470% at the same time. Accordingly, APEl can influence c-myc mRNA levels in MCF-7 cells by c-myc mRNA degradation, further supporting APEl 's usefulness in treating tumor invasion and metastasis in human breast cancer.

Claims

WHAT IS CLAIMED IS:

1. A method of treating or preventing a disorder selected from: aberrant RNA transcription; viral RNA transcription; aberrant microRNA transcription; and aberrant c- myc RNA transcription, the method comprising administering a pharmaceutically effective amount of an apurinic/apyrimidic endonuclease (APEl), a fragment of APEl, a variant of APEl or a pharmaceutical composition thereof.

2. The method of claim 1 , wherein the APEl, a fragment of APEl, the variant of APEl or the pharmaceutical composition thereof, comprises one or more of the following: amino acids corresponding to SEQ ID NO:23 or amino acids 68-318 or 68-317 of SEQ ID NOS:l-l l .

3. The method of claim 1 or 2, wherein the APEl , the fragment of APEl , the variant of APEl or the pharmaceutical composition thereof is capable of preferentially cleaving RNA molecules at sites 3' of uracil residues or sites 5' of adenine residues.

4. The method of claim 1 or 2, wherein the APEl, the fragment of APEl, the variant of APEl or the pharmaceutical composition thereof is capable of preferentially cleaving aberrant c-myc RNA.

5. The method of claim 1 or 2, wherein the APEl, the fragment of APEl, the variant of APEl or the pharmaceutical composition thereof is capable of preferentially cleaving viral RNA.

6. The method of claim 1 or 2, wherein the APEl, the fragment of APEl, the variant of APEl or the pharmaceutical composition thereof is capable of preferentially cleaving aberrant microRNA.

7. The method of claim 6, wherein the aberrant microRNA is selected from one or more of the RNAs represented by SEQ ID NOS:25-39.

8. The method of claim 1 or 2, wherein the APEl, the fragment of APEl, the variant of APEl or the pharmaceutical composition thereof is capable of cleaving one or more of a sequence selected from the group comprising of UA, UC, UU, CA, CU, CG, AC, AU, and UG.

9. The method of any one of claims 1 -8, wherein the APEl , the fragment of APEl, the variant of APEl or the pharmaceutical composition thereof further comprises a fusion polypeptide.

10. The method of any one of claims 1 -9, wherein the APEl , the fragment of APEl, the variant of APEl or the pharmaceutical composition thereof further comprises a targeting moiety.

1 1. The method of claim 10, wherein the targeting moiety is capable of targeting the APEl, the fragment of APEl, the variant of APEl or the pharmaceutical composition thereof to a virus-infected cell or a cancer cell.

12. The method of any one of claims 1-1 1, wherein the endoribonuclease is capable of cleaving non-base paired RNA or single stranded RNA.

13. The method of any one of claims 1-12, wherein the endoribonuclease is capable of cleaving c-myc mRNA, SARS orβ RNA, SARS spike RNA, or SARS orflb RNA.

14. The method of any one of claims 1-13, wherein the aberrant c-myc RNA is CRD RNA.

15. A method of cleaving a RNA molecule comprising contacting the RNA molecule with the APEl, the fragment of APEl, or the variant of APEl under conditions in which the endoribonuclease is active, wherein the endoribonuclease cleaves the RNA molecule.

16. A kit comprising the APEl, the fragment of APEl, the variant of APEl or the pharmaceutical composition thereof of claim 1 , together with instructions for use of the endoribonuclease.

17. Use of a pharmaceutically effective amount of an APE 1 , a fragment of APEl, a variant of APEl or a pharmaceutical composition thereof for the curative or prophylactic treatment of a disorder selected from: aberrant RNA transcription; viral RNA transcription; aberrant microRNA transcription; and aberrant c-myc RNA transcription.

18. Use of a pharmaceutically effective amount of an APEl , a fragment of APEl, a variant of APEl or a pharmaceutical composition thereof in the preparation of a medicament for the curative or prophylactic treatment of a disorder selected from: aberrant RNA transcription; viral RNA transcription; aberrant microRNA transcription; and aberrant c-myc RNA transcription.

19. An APEl peptide or a fragment or variant thereof or a pharmaceutical composition thereof for the curative or prophylactic treatment of a disorder selected from: aberrant RNA transcription; viral RNA transcription; aberrant microRNA transcription; and aberrant c-myc RNA transcription.

20. A pharmaceutical composition for the curative or prophylactic treatment of a disorder selected from: aberrant RNA transcription; viral RNA transcription; aberrant microRNA transcription; and aberrant c-myc RNA transcription, comprising an APEl peptide or a fragment or a variant thereof, or a pharmaceutically acceptable salt thereof, together with a pharmaceutically acceptable diluent or carrier.

21. A commercial package containing, as an active pharmaceutical ingredient, an APEl peptide or a fragment or a variant thereof, or a pharmaceutically acceptable salt thereof, together with instructions for its use for the curative or prophylactic treatment of a disorder selected from: aberrant RNA transcription; viral RNA transcription; aberrant microRNA transcription; and aberrant c-myc RNA transcription, in an animal.

22. A kit containing, as an active pharmaceutical ingredient, an APEl peptide or a fragment or a variant thereof, or a pharmaceutically acceptable salt thereof, together with instructions for its use for the curative or prophylactic treatment of a disorder selected from: aberrant RNA transcription; viral RNA transcription; aberrant microRNA transcription; and aberrant c-myc RNA transcription, in an animal.

23. The use of claim 18, wherein the medicament is adapted for oral administration.

24. The use of claim 18, wherein the medicament is formulated for administration by injection.

25. The pharmaceutical composition of claim 20, which is adapted for oral administration.

26. The pharmaceutical composition of claim 20, which is adapted for administration by injection.

27. The commercial package according to claim 21 , wherein the active pharmaceutical ingredient is adapted for oral administration.

28. The commercial package according to claim 21, wherein the active pharmaceutical ingredient is adapted for administration by injection.