WO2009063466A1 - Compositions and methods for inhibiting hiv-1 replication and integrase activity - Google Patents

Abstract

The present invention provides compositions comprising and methods for obtaining peptides identified by their ability to shift the oligomerization equilibrium of HIV-1 integrase protein towards formation of an inactive tetramer, and use of same for treating HIV-1 infection, inhibiting HIV-1 replication and inhibiting activity of HIV-1 integrase protein. The invention is exemplified by an isolated peptide which inhibits HIV-1 integrase protein (IN) but which does not have any significant sequence homology to any HIV-1 protein, as well as additional peptides derived therefrom, including fragments, derivatives, mutations and modifications thereof.

Description

COMPOSITIONS AND METHODS FOR INHIBITING HIV-I REPLICATION AND INTEGRASE ACTIVITY

FIELD OF THE INVENTION The present invention provides isolated peptides for treating HIV-I infection, inhibiting HIV-I replication and inhibiting DNA binding and 3 '-end processing activity of HIV-I integrase protein, and methods of identifying these peptides.

BACKGROUND OF THE INVENTION

Human Immunodeficiency Virus 1 (HIV-I) Rev and Integrase (IN) proteins are required within the nuclei of infected cells in the late and early phases of the viral replication cycle, respectively. HIV-I Rev is a karyophilic protein, which is required at the late phase of the viral life cycle for promoting nuclear export of partially-spliced or un-spliced viral RNA.

Following penetration of HIV-I into the host cell, reverse transcription of the viral RNA produces cDNA, which is then integrated into the host chromosome. The integration of the viral cDNA is an essential early step in the HIV-I life cycle. This reaction is catalyzed by the viral integrase (IN), a 32-kDa protein that is an integral part of the viral pre-integration complex (PIC). The IN protein is encoded by the viral pol gene and is translated as part of a large Gag-Pol polyprotein, which is processed by the viral protease (PR).

For integration to occur, the viral IN must recognize specific sequences in the viral cDNA, at the termini of the long terminal repeat (LTR) elements. Retroviral integration proceeds in two steps: in the first, 3 '-end processing, a dinucleotide is removed from the 3' end. This reaction occurs in the cytoplasm, within the PIC. In the next step, after entering the nucleus, the processed viral double-stranded DNA is joined to the host target DNA by an IN-mediated strand-transfer reaction.

Due to its central role in HIV replication, the IN protein is an attractive target for antiviral therapy. Moreover, probably no cellular counterpart of IN exists in human cells and therefore, IN inhibitors will not interfere with normal cellular processes. However, only a few IN inhibitors have been identified to date.

1 1496

Specific domains within viral proteins are responsible for their interaction with host-cell receptors and with other viral and cellular proteins enabling the completion of the viral propagation cycle within the host cell (41, 42). Peptides derived from these binding domains may interfere with virus-host and virus-virus protein interactions and as such are excellent candidates as therapeutic agents. Using this approach, short peptides that inhibit IN enzymatic activity were obtained following analysis of the interaction between two of the HIV-I proteins, RT and IN. Screening a complete library of RT-derived peptides demonstrated that two domains of about 20 amino acids mediate this interaction. Peptides bearing these amino acid sequences blocked IN enzymatic activities in vitro (19).

A limited number of IN inhibitory peptides have already been described. Using a combinatorial peptide library, a hexapeptide was selected bearing the sequence HCKFWW (SEQ ID NO: 16) that inhibited the 3 '-processing and integration activity of IN (43). Based on the observation that this peptide also inhibited the IN from HIV- 2, FIV, and MLV, it was suggested that a conserved region around the catalytic domain of IN is being targeted. An IN inhibitory peptide was also selected using a phage-display library (44). IN-derived peptides that interfered with its oligomerization also blocked its enzymatic activity (29). Several other inhibitory peptides have been described in the last few years. Other studies described IN inhibitory peptides with anti-HIV-1 activity in some cell types (17, 45). WO 2008/053478 (PCT/IL2007/001321) describes IN inhibitory peptides derived from LEDGF/p75 protein. International PCT Patent Application WO 2008/068765 (PCT/IL2007/001516) by the present inventors, which is hereby incorporated by reference as if fully set forth herein, describes Rev protein derived IN inhibitory peptides.

The inclusion or description of literary references in this section or any other part of this application does not constitute an admission that the references are regarded as prior art to this invention.

The background art teaches a number of different potentially inhibitory peptides for inhibiting HIV-I functions, for example HIV-I replication. However, there is still an unmet need for efficient and safe solutions to the problem of such inhibition and treatment of HIV-I₅ either in conjunction with known therapies or as an alternative to known therapies. 1496

SUMMARY OF THE INVENTION

The present invention overcomes the drawbacks of the background art by providing an isolated peptide which inhibits HIV-I integrase protein (IN) but which does not have any significant sequence homology to any HIV-I protein, as well as additional peptides derived therefrom, and use of same for treating HIV-I infection, inhibiting HIV-I replication and inhibiting DNA binding and 3 '-end processing activity of HIV-I integrase protein. As described in greater detail below, the initial peptide, designated herein as "IN-I" (SEQ ID NO:1), was determined on the basis of functionality only, through a complex screening process. Two other peptides, designated herein as "IN-I 1-10" (SEQ ID NO:6) and "IN-I 11-20" (SEQ ID NO.7) were then further designed by the present inventors on the basis of the sequence of IN- 1 (SEQ ID NO:1) itself in order to obtain shorter peptides which still preserve the functionality of IN-I (SEQ ID NO:1), and which are provided as non-limiting examples of fragments of IN-I.

According to some embodiments of the present invention, peptides according to the present invention include modifications, fragments and mutations of any of SEQ ID NOs: 1, 6 and 7. For example and without wishing to be limited in any way, SEQ ID NOs 6 and 7 (IN-I 1-10 and IN-I 11-20, respectively) are each a fragment of, or derived from a fragment of, IN-I (SEQ ID NO.l). As a further example and without wishing to be limited in any way, IN-I 11-20 (SEQ ID NO:7) features an additional tryptophan that was added to residues 11-20 of IN-I (SEQ ID NO:1). IN-I 11-20* represents these residues alone without the added tryptophan (SEQ ID NO: 8). Thus, any type of suitable modification or alteration of such peptides may optionally be performed and is encompassed by the present invention.

Further surprisingly, but without wishing to be limited by a single hypothesis, at least certain of the peptides of the present invention (including SEQ ID NO. 1), have been shown to act as "shiftides", which inhibit the activity of IN by shifting its oligomerization equilibrium from the active dimer to the inactive tetramer. Such an inhibition mechanism is highly complex and could not have been predicted from the sequences of the peptides alone, further strengthening the important inventive advance of the peptides according to the present invention. 008/001496

In another embodiment, the present invention provides a peptide having a sequence selected from IN-I (SEQ ID NO:1), IN-I 1-10 (SEQ ID NO:6), IN-I 11-20 (SEQ ID NO:7) and IN-I 11-2O* (SEQ ID NO:8), and one of the following derivatives thereof, wherein the derivative exhibits integrase inhibiting properties:

(1) a sequence of any of the above peptides, wherein at least one amino acid has been replaced by a naturally or non-naturally occurring amino acid, or by an organic peptidomemetic moiety;

(2) a sequence of any of the above peptides, wherein at least one side chain of the amino acid has been chemically modified;

(3) a sequence of any of the above peptides, wherein at least one terminal or non terminal amino acid has been deleted;

(4) a sequence of any of the above peptides, wherein at least one peptidic bond has been replaced by a non- naturally occurring peptidic bond;

(5) a sequence of any of the above peptides, wherein at least one of the amino acids is replaced by the corresponding D- amino acid;

(6) a sequence being the sequence of any of the above peptides, in reverse order, preferably having all D-amino acids (retro inverso); and

(7) a derivative having a combination of two or more of the derivations described in (l)-(6);

(8) a fragment of any one of (1-7) above, having at least 5 amino acids

The present invention further concerns pharmaceutical compositions comprising a pharmaceutically acceptable carrier and as an active ingredient at least one of the peptides, or the compounds as defined above.

Preferably the pharmaceutical compositions are for the inhibition of the replication of or treatment of HTV, or for prevention of infection thereof in a subject.

According to other embodiments of the present invention, there is hereby provided a method for identifying such IN inhibitory peptides, which optionally and preferably do 6

not exhibit substantially or any homology to an HIV-I protein, as well as peptides thereby identified and compositions and uses thereof. According to an optional embodiment of the present invention, such a method for identifying an HIV-I integrase inhibitory peptide comprises (a) providing a peptide library; (b) isolating HIV-I integrase-binding peptides from said peptide library; (c) selecting HIV-I integrase binding peptides of (b) capable of shifting the oligomerization equilibrium of HIV-I integrase towards formation of a tetramer, thereby identifying a peptide inhibitor of HIV-I integrase.

The term "peptide," as used herein, refers to either a peptide or a peptidomimetic. "Peptidomimetic" refers to a moiety derived from a peptide and having any of the modifications described herein, either singly or in combination. Each possibility represents a separate embodiment of the present invention.

Other objects, features and advantages of the present invention will become clear from the following description and drawings.

BRIEF DESCRIPTION OF THE DRAWINGS

The invention is herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the preferred embodiments of the present invention only, and are presented in order to provide what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the invention. In this regard, no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention, the description taken with the drawings making apparent to those skilled in the art how the several forms of the invention may be embodied in practice. In the drawings:

Figure 1: Binding of Y2H peptides to IN: (a) ELISA results: The five selected peptides (IN-l-IN-5; SEQ ID NOs 1-5) were covalently attached to biotinylated BSA

(Bb) molecules as described before ⁴⁰. ELISA plates were coated with IN as described ⁴⁰ and then incubated with 0.2 μg of each of the BSA-peptide conjugates. The degree of binding was estimated as described ⁴⁰ and the data shown are after subtracting the values obtained following binding of Bb only (equivalent to an O. D of 0.140 units at 490 nm). (b) Fluorescence anisotropy binding studies. IN was titrated into the fluorescein-labeled peptides (100 nM): IN-I (A), IN-2 (■), IN-3 (♦), IN-4 (+) and IN- 5 (•). Data were fit to the Hill equation (See Table 2 for binding affinities). Figure 2: Inhibition of IN activity in vitro by IN-I. The IN protein (187.5 nM) was incubated with peptides IN-I and IN-2 and its 3 '-end processing (a) or strand- transfer activities (b) were analyzed by the qualitative assay as described in Materials and Methods (c) The degree of IN activity in the presence of increasing concentrations of IN-I peptide was calculated using the densitometric software TINA (version 2.07d; Raytest Isotope-nmessagerate, GmbH). The IC₅₀ values derived from the attached inhibition curves are 12 μM and 38 μM for the strand transfer and the 3 '-end processing reactions respectively.

Figure 3: The effect of IN-I to IN-5 peptides on IN activity in vitro: Quantitative Analysis. IN protein (390 nM) was incubated in the presence IN-I to IN- 5 peptides at the indicated peptide/IN ratios. The overall integration process was monitored using the quantitative assay system as described in Materials and Methods.

Figure 4: Effect of the IN-binding peptides on the oligomeric state of IN. (a) IN (14 μM) alone (pink), or in the presence of 14 μM IN-I (black), or IN-5 (blue) was analyzed by analytical gel filtration as described in Materials and Methods. Only IN-I, but not the other peptides, shifted the oligomerization equilibrium of IN towards tetramer. (b) The effect of IN-interacting peptides on the DNA binding of IN - fluorescence anisotropy studies. IN protein was titrated into fluorescein-labeled HIV-I LTR DNA (10 nM) alone (♦) and in the presence of 1 μM of: IN-I (•), IN-4 (■) as described in Materials and Methods. Figure 5: Cell penetration and toxicity of IN peptides, (a) Fluorescently labeled peptides (10 μM) were incubated for 1 h in 37⁰C with HeLa cells as described ²² and in Materials and Methods. The cells were then washed with PBS and visualized by a fluorescent microscope. No intracellular fluorescence was seen following incubation with the IN-3 peptide. In order to demonstrate that the lack of fluorescence is not due to the absence of cells in the microscopic field, IN-3 and IN-3* are pictures taken from the same field following observation by phase contract and fluorescence microscopy respectively, (b) Cell toxicity was determined by the MTT assay as described before ²² and in Materials and Methods. 2008/001496

Figure 6: Inhibition of HIV-I replication by IN-I. (a) TZM-bl cells were incubated with the indicated peptides at the indicated concentration and following HIV-I infection were tested for β-galactosidase activity ^{22> 23}. (b) T-lymphoid H9 cells were incubated with the indicated peptides and after infection with HIV-I p24 content was estimated, (c) SupTl T-lymphoid cells were incubated with the indicated peptides at the indicated concentrations and following HIV-I infection the percentage of integrated viral DNA was assessed, (d) Effect of IN-binding peptides on total viral DNA in HIV-I infected cells was tested in SupTl cells, which were incubated with 12.5 μM of the indicated peptides, or with 2 μM of AZT for 2 h, following HIV-I infection and 6 h incubation, the viral Gag (I) or Nef (II) DNA sequences were amplified using specific primers. All other experimental details as described in Materials and Methods.

Figure 7: Inhibition of HIV-I replication By IN-I is dependent on its time of addition. SupTl cells were infected with HIV-I at a multiplicity of infection of 2, and the test compounds were added at different time points after infection (0, 2, 4...12 and 24 h). Viral p24 Ag production was determined at 48 h post infection. Control (Δ); dextran sulfate 20 μM (x); AZT 2 μM (A); IN-I 12.5 μM (•); IN-4 12.5 μM (a). Figure 8: IN-I peptides (SEQ ID NOs 1, 6 and 7) bind to IN and inhibit DNA binding. The IN-I peptides bind IN: (a) the IN protein was titrated into the fluorescein-labeled peptide. Binding affinities and Hill coefficients are shown in Table 3a. The IN-I 1-10 (SEQ ID NO. 6) (orange) and IN-I 11-20 (SEQ ID NO. 7) (purple) peptides bind IN. The short IN-I peptides inhibit the DNA binding of IN: IN (lOμM) was titrated into fluorescein-labeled viral LTR DNA (1OnM) (b) alone (blue), and (c) after a 20 min incubation on ice with 50OnM of the IN-I 1-10 (SEQ ID NO. 6) (orange) and the IN-I 11 -20 (SEQ ID NO. 7) (purple) peptides. Binding affinities and Hill coefficients are shown in Table 3b.

Figure 9; The IN integration activity is inhibited in vitro by the peptides. IN (390 nM) was incubated with each peptides at ratios (IN:peptide) 1:200 (IN-I (SEQ ID NO. 1), IN-I 1-10 (SEQ ID NO. 6)) or 1:50 (IN-I 11-20 (SEQ ID NO. 7)) before performing the IN activity assay. Percentage of inhibition is shown in table 4a.

Figure 10: The peptides penetrate HeLa cells. Fluorescein-labeled IN-I peptides were incubated with HeLa cells. The cells were visualized by fluorescent microscopy using a confocal microscope. The fluorescein-labeled peptides are localized both in the cytoplasm and the nucleus: (a) IN-I 1-10 (SEQ ID NO. 6) field of 8 001496

cells; (b) IN-I 1-10 (SEQ ID NO. 6) + fluorescein; (c) IN-I 11-20 (SEQ ID NO. 7) field of the cells and (d) IN-I 11-20 (SEQ ID NO. 7) + fluorescein.

Figure 11; The peptides inhibit infectivity in cultured cells. HeLa MAGI TZM-bl cells were incubated for 2 hours pre-infection with different concentrations of the peptides. Blue cells were counted as a measure of the viral early stage of infection. IN-I (SEQ ID NO. 1) and IN-I 1-10 (SEQ ID NO. 6) (red and blue respectively) show up to 70% inhibition of infectivity, while IN-I 11-20 (SEQ ID NO. 7) (green) shows only 30% inhibition.

Figure 12; Binding Regions of the Peptides, (a) Schematic presentation of binding regions in function of IN's structural domains Three of the peptide binding sites are situated in the catalytic core domain of IN, while a fourth binding region is in its DNA binding region, (b) Presentation of the peptide binding regions on the catalytic core domain. The two dimers are colored in two shades of blue, IN 70-84 in green, IN 94-108 in red and IN 118-132 in purple on the solved structure of the CCD (PDB#: 2b4j).

Figure 13; Proposed model of inhibition by the peptides. Each of the short IN-I peptides bind only two sites on the protein: (a) IN-I 1-10 (SEQ ID NO. 6) binds two sites in the catalytic core domain (CCD); (b) IN-I 11-20 (SEQ ID NO. 7) binds one of these sites in the CCD, and an additional site in the DNA binding domain; (c) The whole IN-I peptide (SEQ ID NO. 1) acts as a bridge between two dimers, making a dimer of dimers.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides an isolated peptide which inhibits HIV-I integrase protein (IN) but which does not have any significant sequence homology to any HIV-I protein, as well as additional peptides derived therefrom, including fragments, derivatives, mutations and modifications thereof, and use of same for treating HIV-I infection, inhibiting HIV-I replication and inhibiting DNA binding and

3 '-end processing activity of HIV-I integrase protein. The following abbreviations are used herein: Y2H, yeast two-hybrid; IN, integrase; HIV-I, human immunodeficiency virus type 1; LTR, long terminal repeat;

PIC, pre-integration complex; LEDGF, lens epithelium-derived growth factor; IBD, integrase binding domain, CCD catalytic core domain. 2008/001496

For the purposes of description only and without any intention of being limiting, the below Table lists all of the sequences for which SEQ ID NOs are assigned herein. It should be noted that the present invention is not limited to the peptides which are listed in the below Table 1, but further encompasses, in at least some embodiments, modifications, derivatives, mutations and fragments thereof.

Table 1 - SEQ ID NO and Sequences

Preferably in at least some embodiments, the isolated peptide or fragment of methods and compositions of the present invention binds, in a physiological solution, a tetramer of an HIV-I integrase protein with a greater affinity than the isolated peptide 008/001496

or fragment binds a dimer of the HIV-I integrase protein, thereby increasing the ratio of the tetramer to the dimer in the physiological solution. In another embodiment, the isolated peptide or fragment binds a tetramer of an HIV-I integrase protein under physiological conditions with a greater affinity than the isolated peptide or fragment binds a dimer of the HIV-I integrase protein under the same conditions. Each possibility represents a separate embodiment of the present invention.

Methods for measuring the oligomeric state of HIV-I IN are well known in the art, and include the methods disclosed herein, such as for example fluorescence anisotropy and analytic gel filtration.

More preferably, the isolated peptide of methods and compositions of the present invention is capable of inhibiting binding of an HIV-I integrase protein to an HIV-I long terminal repeat (LTR) DNA terminus. In another embodiment, the inhibition is measured in a physiological solution. Each possibility represents a separate embodiment of the present invention.

Methods for measuring binding of an HIV-I integrase protein to an HIV-I LTR

DNA terminus are well known in the art, and include the methods disclosed herein (see, inter alia, the section entitled "fluorescence anisotropy" hereinbelow). Each method represents a separate embodiment of the present invention .

"Inhibiting binding" refers, preferably, to ability to inhibit IN binding to LTR DNA with an IC50 of 1 nM (nanomolar)-5 mcM (micromolar). In another embodiment, the term refers to ability to inhibit binding with an IC50 of 1 nM-4 mcM. In another embodiment, the term refers to an IC50 range of 1 nM-10 mcM. In another embodiment, the term refers to an IC50 range of 1 nM-8 mcM. In another embodiment, the term refers to an IC50 range of 1 nM-3 mcM. In another embodiment, the term refers to an IC50 range of 1 nM-2.5 mcM. In another embodiment, the term refers to an IC50 range of 1 nM-2 mcM. In another embodiment, the term refers to an IC50 range of 1 nM-1.5 mcM. In another embodiment, the term refers to an IC50 range of 1 nM-1 mcM. In another embodiment, the term refers to an IC50 range of 1-700 nM. In another embodiment, the term refers to an IC50 range of 1 -500 nM. In another embodiment, the term refers to an IC50 range of 1-300 nM. In another embodiment, the term refers to an IC50 1496

range of 1-200 nM. In another embodiment, the term refers to an IC50 range of 1-100 nM. In another embodiment, the term refers to an IC50 range of 1-70 nM. In another embodiment, the term refers to an IC50 range of 1-50 nM. In another embodiment, the term refers to an IC50 range of 1 nM-30 nM. In another embodiment, the term refers to an IC50 range of 2 nM-10 mcM. In another embodiment, the term refers to an IC50 range of 2 nM-7 mcM. In another embodiment, the term refers to an IC50 range of 2 nM-5 mcM. In another embodiment, the term refers to an IC50 range of 2 nM-3 mcM. In another embodiment, the term refers to an IC50 range of 2 nM-2.5 mcM. In another embodiment, the term refers to an IC50 range of 2 nM-2 mcM. In another embodiment, the term refers to an IC50 range of 2 nM-1.5 mcM. In another embodiment, the term refers to an IC50 range of 2 nM-1 mcM. In another embodiment, the term refers to an IC50 range of 2-700 nM. In another embodiment, the term refers to an IC50 range of 2-500 nM. In another embodiment, the term refers to an IC50 range of 2-300 nM. In another embodiment, the term refers to an IC50 range of 2-200 nM. In another embodiment, the term refers to an IC50 range of 2- 100 nM. In another embodiment, the term refers to an IC50 range of 2-70 nM. In another embodiment, the term refers to an IC50 range of 2-50 nM. In another embodiment, the term refers to an IC50 range of 2-30 nM. In another embodiment, the term refers to an IC50 range of 3nM-10mcM. In another embodiment, the term refers to an IC50 range of 3nM-7mcM. In another embodiment, the term refers to an IC50 range of 3nM- 5mcM. In another embodiment, the term refers to an IC50 range of 3nM-3mcM. In another embodiment, the term refers to an IC50 range of 3nM-2.5mcM. In another embodiment, the term refers to an IC50 range of 3nM-2mcM. In another embodiment, the term refers to an IC50 range of 3nM-lmcM. In another embodiment, the term refers to an IC50 range of 3-700 nM. In another embodiment, the term refers to an IC50 range of 3-500 nM. In another embodiment, the term refers to an IC50 range of 3-300 nM. In another embodiment, the term refers to an IC50 range of 3-200 nM. In another embodiment, the term refers to an IC50 range of 3-100 nM. In another embodiment, the term refers to an IC50 range of 3-70 nM. In another embodiment, the term refers to an IC50 range of 3-50 nM. In another embodiment, the term refers to an IC50 range of 5nM-10mcM. In another embodiment, the term refers to an IC50 range of 5nM-7mcM. In another embodiment, the term refers to an IC50 range of 5nM- 5mcM. In another embodiment, the term refers to an IC50 range of 5nM-3mcM. In another embodiment, the term refers to an IC50 range of 5nM-2mcM. In another IL2008/001496

embodiment, the term refers to an IC50 range of 5nM-lmcM. In another embodiment, the term refers to an IC50 range of 5-700 nM. In another embodiment, the term refers to an IC50 range of 5-500 nM. In another embodiment, the term refers to an IC50 range of 5-300 nM. In another embodiment, the term refers to an IC50 range of 5-200 nM. In another embodiment, the term refers to an IC50 range of 5-100 nM. In another embodiment, the term refers to an IC50 range of 5-50 nM. In another embodiment, the term refers to an IC50 range of 5-30 nM. In another embodiment, the term refers to an IC50 range of IOnM-lOmcM. In another embodiment, the term refers to an IC50 range of 10nM-7mcM. In another embodiment, the term refers to an IC50 range of 1OnM- 5mcM. In another embodiment, the term refers to an IC50 range of 10nM-3mcM. In another embodiment, the term refers to an IC50 range of 10nM-2mcM. In another embodiment, the term refers to an IC50 range of IOnM-lmcM. In another embodiment, the term refers to an IC50 range of 10-700 nM. In another embodiment, the term refers to an IC50 range of 10-500 nM. In another embodiment, the term refers to an IC50 range of 10-300 nM. In another embodiment, the term refers to an IC50 range of 10-200 nM. In another embodiment, the term refers to an IC50 range of 10- 100 nM. In another embodiment, the term refers to an IC50 range of 10-70 nM. In another embodiment, the term refers to an IC50 range of 10-50 nM. In another embodiment, the term refers to an IC50 range of 10-30 nM. In another embodiment, the term refers to an IC50 range of 2OnM-I OmcM. In another embodiment, the term refers to an IC50 range of 20nM-7mcM. In another embodiment, the term refers to an IC50 range of 20nM-5mcM. In another embodiment, the term refers to an IC50 range of 20nM-3mcM. In another embodiment, the term refers to an IC50 range of 2OnM- 2mcM. In another embodiment, the term refers to an IC50 range of 20nM-lmcM. In another embodiment, the term refers to an IC50 range of 20-700 nM. In another embodiment, the term refers to an IC50 range of 20-500 nM. In another embodiment, the term refers to an IC50 range of 20-300 nM. In another embodiment, the term refers to an IC50 range of 20-200 nM. In another embodiment, the term refers to an IC50 range of 20-100 nM. In another embodiment, the term refers to an IC50 range of 20-70 nM. In another embodiment, the term refers to an IC50 range of 20-50 nM. In another embodiment, the term refers to an IC50 range of 30nM-10mcM. In another embodiment, the term refers to an IC50 range of 30nM-7mcM. In another embodiment, the term refers to an IC50 range of 30nM-5mcM. In another embodiment, the term refers to an IC50 range of 30nM-3mcM. In another 1496

embodiment, the term refers to an IC50 range of 30nM-2mcM. In another embodiment, the term refers to an IC50 range of 30nM-lmcM. In another embodiment, the term refers to an IC50 range of 30-700 nM. In another embodiment, the term refers to an IC50 range of 30-500 nM. In another embodiment, the term refers to an IC50 range of 30-300 nM. In another embodiment, the term refers to an IC50 range of 30-200 nM. In another embodiment, the term refers to an IC50 range of 30- 100 nM. In another embodiment, the term refers to an IC50 range of 30-70 nM. In another embodiment, the term refers to an IC50 range of 30-50 nM. In another embodiment, the term refers to an IC50 range of 50nM-10mcM. In another embodiment, the term refers to an IC50 range of 50nM-7mcM. In another embodiment, the term refers to an IC50 range of 50nM-5mcM. In another embodiment, the term refers to an IC50 range of 50nM-3mcM. In another embodiment, the term refers to an IC50 range of 50nM-2mcM. In another embodiment, the term refers to an IC50 range of 50nM-lmcM. In another embodiment, the term refers to an IC50 range of 50-700 nM. In another embodiment, the term refers to an IC50 range of 50-500 nM. In another embodiment, the term refers to an IC50 range of 50-300 nM. In another embodiment, the term refers to an IC50 range of 50-200 nM. In another embodiment, the term refers to an IC50 range of 50- 100 nM. In another embodiment, the term refers to an IC50 range of 50-70 nM. In another embodiment, the term refers to an IC50 range of 70nM-10mcM. In another embodiment, the term refers to an IC50 range of 70nM-7mcM. In another embodiment, the term refers to an IC50 range of 70nM-5mcM. In another embodiment, the term refers to an IC50 range of 70nM-3mcM. In another embodiment, the term refers to an IC50 range of 70nM-2mcM. In another embodiment, the term refers to an IC50 range of 70nM-lmcM. In another embodiment, the term refers to an IC50 range of 70-700 nM. In another embodiment, the term refers to an IC50 range of 70-500 nM. In another embodiment, the term refers to an IC50 range of 70-300 nM. In another embodiment, the term refers to an IC50 range of 70-200 nM. In another embodiment, the term refers to an IC50 range of 70- 100 nM. In another embodiment, the term refers to an IC50 range of lOOnM-lOmcM. In another embodiment, the term refers to an IC50 range of 100nM-7mcM. In another embodiment, the term refers to an IC50 range of 100nM-5mcM. In another embodiment, the term refers to an IC50 range of 100nM-3mcM. In another embodiment, the term refers to an IC50 range of 100nM-2mcM. In another embodiment, the term refers to an IC50 range of lOOnM-lmcM. In another embodiment, the term refers to an IC50 range of 100-700 nM. In another embodiment, the term refers to an IC50 range of 100-500 nM. In another embodiment, the term refers to an IC50 range of 100-300 nM. In another embodiment, the term refers to an IC50 range of 100-200 nM. In another embodiment, the term refers to an IC50 range of 100-150 nM. In another embodiment, the term refers to an IC50 range of 15OnM- lOmcM. In another embodiment, the term refers to an IC50 range of 150nM-7mcM. In another embodiment, the term refers to an IC50 range of 150nM-5mcM. In another embodiment, the term refers to an IC50 range of 150nM-3mcM. In another embodiment, the term refers to an IC50 range of 150nM-2mcM. In another embodiment, the term refers to an IC50 range of 150nM-lmcM. In another embodiment, the term refers to an IC50 range of 150-700 nM. In another embodiment, the term refers to an IC50 range of 150-500 nM. In another embodiment, the term refers to an IC50 range of 150-300 nM. In another embodiment, the term refers to an IC50 range of 150-200 nM. In another embodiment, the term refers to an IC50 range of 20OnM-I OmcM. In another embodiment, the term refers to an IC50 range of 200nM-7mcM. In another embodiment, the term refers to an IC50 range of 20OnM- 5mcM. In another embodiment, the term refers to an IC50 range of 200nM-3mcM. In another embodiment, the term refers to an IC50 range of 200nM-2mcM. In another embodiment, the term refers to an IC50 range of 200nM-lmcM. In another embodiment, the term refers to an IC50 range of 200-700 nM. In another embodiment, the term refers to an IC50 range of 200-500 nM. In another embodiment, the term refers to an IC50 range of 200-300 nM. In another embodiment, the term refers to an IC50 range of 30OnM-I OmcM. In another embodiment, the term refers to an IC50 range of 300nM-7mcM. In another embodiment, the term refers to an IC50 range of 3OOnM-5mcM. In another embodiment, the term refers to an IC50 range of 30OnM- 3mcM. In another embodiment, the term refers to an IC50 range of 300nM-2mcM. In another embodiment, the term refers to an IC50 range of 300nM-lmcM. In another embodiment, the term refers to an IC50 range of 300-700 nM. In another embodiment, the term refers to an IC50 range of 300-500 nM. In another embodiment, the term refers to an IC50 range of 50OnM-I OmcM. In another embodiment, the term refers to an IC50 range of 500nM-7mcM. In another embodiment, the term refers to an IC50 range of 500nM-5mcM. In another embodiment, the term refers to an IC50 range of 500nM-3mcM. In another embodiment, the term refers to an IC50 range of 50OnM-

14 2mcM. In another embodiment, the term refers to an IC50 range of 500nM-lmcM. In another embodiment, the term refers to an IC50 range of 500-700 nM. In another embodiment, the term refers to an IC50 range of 70OnM-I OmcM. In another embodiment, the term refers to an IC50 range of 700nM-7mcM. In another embodiment, the term refers to an IC50 range of 700nM-5mcM. In another embodiment, the term refers to an IC50 range of 700nM-3mcM. In another embodiment, the term refers to an IC50 range of 700nM-2mcM. In another embodiment, the term refers to an IC50 range of 70OnM-I mcM. In another embodiment, the term refers to an IC50 range of 1-1 OmcM. In another embodiment, the term refers to an IC50 range of l-7mcM. In another embodiment, the term refers to an IC50 range of l-5mcM. In another embodiment, the term refers to an IC50 range of l-3mcM. In another embodiment, the term refers to an IC50 range of l-2mcM. In another embodiment, the term refers to an IC50 range of 1.5-lOmcM. In another embodiment, the term refers to an IC50 range of 1.5-7mcM. In another embodiment, the term refers to an IC50 range of 1.5-5mcM. In another embodiment, the term refers to an IC50 range of 1.5-3mcM. In another embodiment, the term refers to an IC50 range of 2-1 OmcM. In another embodiment, the term refers to an IC50 range of 2- 7mcM. In another embodiment, the term refers to an IC50 range of 2-5mcM. In another embodiment, the term refers to an IC50 range of 2-3mcM. In another embodiment, the term refers to an IC50 range of 3-lOmcM. In another embodiment, the term refers to an IC50 range of 3-7mcM. In another embodiment, the term refers to an IC50 range of 3-5mcM. In another embodiment, the term refers to an IC50 range of 5-1 OmcM. In another embodiment, the term refers to an IC50 range of 5-7mcM. Each possibility represents a separate embodiment of the present invention.

In another embodiment, the term refers to ability to inhibit DNA binding by at least 3-fold, when pre-incubated with IN at a concentration of 500 nM peptide under physiological conditions (e.g. with IN at a concentration of 4 μM) and DNA at a concentration of 1OnM. In another embodiment, the term refers to ability to inhibit DNA binding by at least 6-fold under the above conditions. In another embodiment, the term refers to ability to inhibit DNA binding by at least 2-fold under the above conditions. Each possibility represents a separate embodiment of the present invention . 008/001496

"Physiological conditions" are well known to those skilled in the art, and include, for example, 0.2 M Tris, pH 7.4, with 0.15 M NaCl. Those skilled in the art will be readily able to discern physiological conditions appropriate for DNA binding assays, 3 '-end processing activity, etc. Each possibility represents a separate embodiment of the present invention.

Most preferably, the isolated peptide of methods and compositions of the present invention is capable of inhibiting HIV-I replication in a target cell. "Target cell," as used herein, may refer to any cell wherein HIV-I is capable of replicating. Preferably, the target cell is a human cell or an immortalized cell line derived from a human cell. Each possibility represents a separate embodiment of the present invention.

Methods for measuring HIV-I replication in a target cell are well known in the art, and include the use of HeLa MAGI cells (as described in greater detail below). Each method represents a separate embodiment of the present invention.

In another embodiment, a composition of the present invention further comprises a non-naturally occurring amino acid, in addition to the isolated peptide of the present invention. In another embodiment, a composition of the present invention further comprises an organic peptidomimetic moiety, in addition to the isolated peptide of the present invention. In another embodiment, a side chain of an amino acid of the isolated peptide of the present invention has been chemically modified. In another embodiment, a peptidic bond has been replaced by a non-naturally occurring bond. In another embodiment, one of the amino acids is replaced by the corresponding D- amino acid. In another embodiment, the present invention encompasses an N-methyl variant of the sequence. In another embodiment, the present invention provides a sequence disclosed herein in reverse order, preferably having all D-amino acids (retro inverso). In another embodiment, a derivative of the present invention possesses one of the above modifications at a plurality of locations (e.g. a plurality of residues). In another embodiment, a derivative of the present invention possesses two of the above modifications. In another embodiment, a derivative of the present invention possesses more than 2 of the above modifications. Each possibility represents a separate embodiment of the present invention. "Treatment of HIV infection" refers to improvement in at least one clinical parameter associated with the HIV infection as compared to non-treated control and notably to improve in the viral load count and increase in CD4+ bearing cells. The improvement may be actual reduction in the viral load, but may also be slowing down in the rate of increase of the viral load, or inhibition of complications of the disease.

In another embodiment, a peptide of the present invention is capable of entering a mammalian cell under physiological conditions. In another embodiment, the peptide penetrates the cell membrane of the mammalian cell. In another embodiment, the peptide is actively transported through the cell membrane. In another embodiment, the peptide diffuses through the cell membrane. Each possibility represents a separate embodiment of the present invention.

In another embodiment, a peptide of the present invention further comprises an additional peptide sequence, attached to an end of the isolated peptide of the present invention, hi another embodiment, the additional peptide sequence is attached to the N- terminal end of the isolated peptide, hi another embodiment, the additional peptide sequence is attached to the C-terminal end of the isolated peptide, hi another embodiment, the additional peptide sequences are attached to the N-terminal and C- terminal ends of the isolated peptide. Each possibility represents a separate embodiment of the present invention.

In another embodiment, a peptide of the present invention further comprises an organic, non-peptidic moiety. In another embodiment, the peptide of the present invention comprises a hydrophobic moiety attached to the end of the isolated peptide. In another embodiment, the hydrophobic moiety is a linear hydrocarbon. In another embodiment, the hydrophobic moiety is a branched hydrocarbon, hi another embodiment, the hydrophobic moiety is a linear hydrocarbon, hi another embodiment, the hydrophobic moiety is a cyclic hydrocarbon, hi another embodiment, the hydrophobic moiety is a polycyclic hydrocarbon, hi another embodiment, the hydrophobic moiety is a heterocyclic hydrocarbon, hi another embodiment, the hydrophobic moiety is a hydrocarbon derivative. In another embodiment, the hydrophobic moiety is a protecting group, hi another embodiment, the protecting group serves to decrease degradation (e.g. of a linear compound). In another embodiment, the non-peptidic moiety is attached to the N-terminal end of the isolated peptide of the present invention. In another embodiment, the non-peptidic moiety is attached to the C-terminal end of the isolated peptide. In another embodiment, the non-peptidic moieties are attached to the N-terminal and C-terminal ends of the isolated peptide. Each possibility represents a separate embodiment of the present invention.

In another embodiment, an additional peptide sequence is attached to the N- terminal end of the isolated peptide of the present invention and a non-peptidic moiety is attached to the C-terminal end. In another embodiment, an additional peptide sequence is attached to the C-terminal end of the isolated peptide and a non-peptidic moiety is attached to the N-terminal end. Each possibility represents a separate embodiment of the present invention.

In another embodiment, the additional sequence(s) or moiety(ies) improve(s) a pharmacological property of the peptide. In another embodiment, the additional sequence(s) or moiety(ies) improve(s) a physiological property of the peptide. In another embodiment, the property is penetration into cells (e.g. moieties which enhance penetration through membranes or barriers, generally termed "leader sequences"). In another embodiment, the modified peptides exhibit slower degradation in vivo. In another embodiment, the modified peptides exhibit slower clearance in vivo, hi another embodiment, the modified peptides exhibit decreased repulsion by various cellular pumps. In another embodiment, the modified peptides exhibit decreased immunogenicity. In another embodiment, the modified peptides exhibit improved administration to a subject in need, hi another embodiment, the modified peptides exhibit improved penetration through an in vivo barrier (e.g. the gut). In another embodiment, the modified peptides exhibit increased specificity for HIV-I integrase. hi another embodiment, the modified peptides exhibit increased affinity for HIV-I integrase. hi another embodiment, the modified peptides exhibit decreased toxicity. In another embodiment, the modified peptides exhibit improvement in another pharmacological or physiological property, hi another embodiment, the modified peptides exhibit improvement in ability to be imaged using an existing technology. Each possibility represents a separate embodiment of the present invention. IL2008/001496

The association between the amino acid sequence component of the compound and other components of the compound may be by covalent linking, by non-covalent complexion, for example, by complexion to a hydrophobic polymer, which can be degraded or cleaved producing a compound capable of sustained release; by entrapping the amino acid part of the compound in liposomes or micelles to produce the final compound of the invention. The association may be by the entrapment of the amino acid sequence within the other component (liposome, micelle) or the impregnation of the amino acid sequence within a polymer to produce the final compound of the invention.

Preferably, the isolated amino acid sequence is in association with (in the meaning described above) a moiety for transport across cellular membranes.

The term "moiety for transport across cellular membranes" refers to a chemical entity, or a composition of matter (comprising several entities) that causes the transport of members associated (e.g. an isolated amino acid sequence) with it through phospholipidic membranes. Examples of such moieties are hydrophobic moieties such as linear, branched, cyclic, polycyclic or heterocyclic substituted or non-substituted hydrocarbons. Another example of such moieties is short peptides that cause transport of molecules attached to them into the cell by, gradient derived, active, or facilitated transport. Other examples of other non-peptidic moieties known to be transported through membranes are glycosylated steroid derivatives, which are well known in the art.

The moiety of the compound may be a polymer, liposome or micelle containing, entrapping or incorporating the amino acid sequence therein, hi the above examples, the compound of the invention is the polymer, liposome micelle etc. impregnated with the amino acid sequence.

Suitable functional groups for increasing transport across cellular membranes are described in Green and Wuts, "Greene 's Protective Groups in Organic Synthesis " John Wiley and Sons, 2007, the teachings of which are incorporated herein by reference. Preferred protecting groups are those that facilitate transport of the compound attached thereto into a cell, for example, by reducing the hydrophilicity and increasing the lipophilicity of the compounds.

These moieties can be cleaved in vivo, either by hydrolysis or enzymatically, inside the cell. (Ditter et al, J. Pharm. ScL 57:783 (1968); Ditter et al., J. Pharm. Sci. 57:828 008/001496

(1968); Ditter et al, J. Pharm. Sci. 58:557 (1969); King et al., Biochemistry 26:2294 (1987); Lindberg et al, Drug Metabolism and Disposition 17:311 (1989); and Tunek et al, Biochem. Pharm. 37:3867 (1988), Anderson et al , Arch. Biochem. Biophys. 239:538 (1985) and Singhal et al, FASEB J. 1:220 (1987)). Hydroxyl protecting groups include esters, carbonates and carbamate protecting groups. Amine protecting groups include alkoxy and aryloxy carbonyl groups, as described above for N-terminal protecting groups. Carboxylic acid protecting groups include aliphatic, benzylic and aryl esters, as described above for C-terminal protecting groups. In one embodiment, the carboxylic acid group in the side chain of one or more glutamic acid or aspartic acid residue in a compound of the present invention is protected, preferably with a methyl, ethyl, benzyl or substituted benzyl ester, more preferably as a benzyl ester.

Examples of N-terminal protecting groups include acyl groups (-CO-R1) and alkoxy carbonyl or aryloxy carbonyl groups (-CO-O-R1), wherein Rl is an aliphatic, substituted aliphatic, benzyl, substituted benzyl, aromatic or a substituted aromatic group. Specific examples of acyl groups include acetyl, (ethyl)-CO-, n-propyl-CO-, iso-propyl-CO-, n-butyl-CO-, sec-butyl-CO-, t-butyl-CO-, hexyl, lauroyl, palmitoyl, myristoyl, stearyl, oleoyl phenyl-CO-, substituted phenyl-CO-, benzyl-CO- and (substituted benzyl)-CO-. Examples of alkoxy carbonyl and aryloxy carbonyl groups include CH3-O-CO-, (ethyl)-O-CO-, n-propyl-O-CO-, iso-propyl-O-CO-, n-butyl-0-CO-, sec-butyl-0-CO-, t-butyl-0-CO-, phenyl-O- CO-, substituted phenyl-O-CO- and benzyl-O-CO-, (substituted benzyl)- O-CO-, Adamantan, naphtalen, myristoleyl, toluen, biphenyl, cinnamoyl, nitrobenzoxy, toluoyl, furoyl, benzoyl, cyclohexane, norbornane, Z-caproic. In order to facilitate the N-acylation, one to four glycine residues can be present at the N-terminus of the molecule.

The carboxyl group at the C-terminus of the compound can be protected, for example, by an amide (i.e., the hydroxyl group at the C-terminus is replaced with -NH 2, -NHR2 and -NR2R3) or ester (i.e. the hydroxyl group at the C-terminus is replaced with -OR2). R2 and R3 are independently an aliphatic, substituted aliphatic, benzyl, substituted benzyl, aryl or a substituted aryl group. In addition, taken together with the nitrogen atom, R2 and R3 can form a C4 to C8 heterocyclic ring with from about 0-2 additional heteroatoms such as nitrogen, oxygen or sulfur. Examples of suitable heterocyclic rings include piperidinyl, pyrrolidinyl, morpholino, thiomorpholino or IL2008/001496

piperazinyl. Examples of C-terminal protecting groups include -NH2, -NHCH3, -N(CH3 )₂, -NH(ethyl), -N(ethyl)₂, -N(methyl) (ethyl), -NH(benzyl), -N(C₁-C₄ alkyl)(benzyl), -NH(phenyl), -N(C₁-C₄ alkyl) (phenyl), -OCH3, -O-(ethyl), -O-(n-propyl), -O-(n-butyl), -O-(iso-propyl), -O-(sec- butyl), -O-(t-butyl), -O-benzyl and -O-phenyl.

Derivatives

There are several types of derivation that can be applied to isolated peptide amino acid sequences of the present invention. The derivative may include several types of derivation (replacements and deletions, chemical modification, change in peptidic backbone etc.)

Replacements

Typically no more than 40% of the amino acids are replaced by a naturally or non- naturally occurring amino acid or with a peptidomimetic organic moiety. Preferably no more than 35%, 30%, 25%, 20%, 15%, 10%, or 5%. The replacement may be by naturally occurring amino acids (both conservative and non-conservative substitutions), by non-naturally occurring amino acids (both conservative and non-conservative substitutions), or with organic moieties which serve either as true peptidomimetics (i.e. having the same steric and electrochemical properties as the replaced amino acid), or merely serve as spacers in lieu of an amino acid, so as to keep the spatial relations between the amino acid spanning this replaced amino acid. Guidelines for the determination of the replacements and substitutions are provided below. Preferably no more than, 35%, 30%, 25%, 20%, 15%, 10%, or 5% of the amino acids are replaced.

The term "naturally occurring amino acid" refers to a moiety found within a peptide and is represented by -NH-CHR-CO-, wherein R is the side chain of a naturally occurring amino acid.

The term "non-naturally occurring amino acid" (amino acid analog) is either a peptidomimetic, or is a D or L residue having the following formula: -NH-CHR-CO-, wherein R is an aliphatic group, a substituted aliphatic group, a benzyl group, a substituted benzyl group, an aromatic group or a substituted aromatic group and wherein 6

R does not correspond to the side chain of a naturally-occurring amino acid. This term also refers to the D-amino acid counterpart of naturally occurring amino acids. Amino acid analogs are well-known in the art; a large number of these analogs are commercially available. Many times the use of non-naturally occurring amino acids in the peptide has the advantage that the peptide is more resistant to degradation by enzymes which fail to recognize them.

The term "conservative substitution" in the context of the present invention refers to the replacement of an amino acid present in the native sequence in the specific peptide with a naturally or non-naturally occurring amino or a peptidomimetic having similar steric properties. Where the side-chain of the native amino acid to be replaced is either polar or hydrophobic, the conservative substitution should be with a naturally occurring amino acid, a non-naturally occurring amino acid or with a peptidomimetic moiety which is also polar or hydrophobic (in addition to having the same steric properties as the side- chain of the replaced amino acid).

As the naturally occurring amino acids are grouped according to their properties, conservative substitutions by naturally occurring amino acids can be easily determined, bearing in mind the fact that, in accordance with the invention, replacement of charged amino acids by sterically similar non-charged amino acids are considered as conservative substitutions.

For producing conservative substitutions by non-naturally occurring amino acids, it is also possible to use amino acid analogs (synthetic amino acids) that are known in the art.

When affecting conservative substitutions, the substituting amino acid should have the same or a similar functional group in the side chain as the original amino acid.

The following are some non-limiting examples of groups of naturally occurring amino acids or of amino acid analogs are listed below. Replacement of one member in the group by another member of the group will be considered herein as conservative substitutions:

Group I includes leucine, isoleucine, valine, methionine, phenylalanine, cysteine, and modified amino acids having the following side chains: ethyl, n-butyl, -CH₂CH₂OH, -CH₂CH₂CH₂OH, -CH₂CHOHCH₃ and -CH₂SCH₃. Preferably Group I includes leucine, isoleucine, valine and methionine.

Group π includes glycine, alanine, valine, cysteine, and a modified amino acid having an ethyl side chain. Preferably Group II includes glycine and alanine.

Group III includes phenylalanine, phenylglycine, tyrosine, tryptophan, cyclohexylmethyl, and modified amino residues having substituted benzyl or phenyl side chains. Preferred substituents include one or more of the following: halogen, methyl, ethyl, nitro, methoxy, ethoxy and -CN. Preferably, Group III includes phenylalanine, tyrosine and tryptophan.

Group IV includes glutamic acid, aspartic acid, a substituted or unsubstituted aliphatic, aromatic or benzylic ester of glutamic or aspartic acid (e.g., methyl, ethyl, n-propyl iso-propyl, cyclohexyl, benzyl or substituted benzyl), glutamine, asparagine, CO-NH-alkylated glutamine or asparagine (e.g., methyl, ethyl, n-propyl and iso-propyl) and modified amino acids having the side chain -(CH^.COOH, an ester thereof (substituted or unsubstituted aliphatic, aromatic or benzylic ester), an amide thereof and a substituted or unsubstituted N-alkylated amide thereof. Preferably, Group IV includes glutamic acid, aspartic acid, glutamine, asparagine, methyl aspartate, ethyl aspartate, benzyl aspartate and methyl glutamate, ethyl glutamate and benzyl glutamate.

Group V includes histidine, lysine, arginine, N-nitroarginine, β-cycloarginine, μ-hydroxyarginine, N-amidinocitrulline and 2-amino-4- guanidinobutanoic acid, homologs of lysine, homologs of arginine and ornithine. Preferably, Group V includes histidine, lysine, arginine, and ornithine. A homolog of an amino acid includes from 1 to about 3 additional methylene units in the side chain.

Group VI includes serine, threonine, cysteine and modified amino acids having C1-C5 straight or branched alkyl side chains substituted with -OH or -SH. Preferably, Group VI includes serine, cysteine, and threonine.

The term "non-conservative substitutions" concerns replacement of the amino acid as present in the native peptide by another naturally or non-naturally occurring amino acid, having different electrochemical and/or steric properties, for example as determined by the fact the replacing amino acid is not in the same group as the replaced amino acid 001496

of the native peptide sequence. Those non-conservative substitutions which fall under the scope of the present invention are those which still constitute a compound having integrase inhibiting activities.

In another embodiment, a "non-conservative substitution" is a substitution in which the substituting amino acid (naturally occurring or modified) has significantly different size, configuration and/or electronic properties compared with the amino acid being substituted. Thus, the side chain of the substituting amino acid can be significantly larger

(or smaller) than the side chain of the native amino acid being substituted and/or can have functional groups with significantly different electronic properties than the amino acid being substituted. Examples of non-conservative substitutions of this type include the substitution of phenylalanine or cycohexylmethyl glycine for alanine, isoleucine for glycine, or -NH-CH[(-CH2)5_COOH]-CO- for aspartic acid.

In another embodiment, a functional group may be added to the side chain, deleted from the side chain or exchanged with another functional group. Examples of non- conservative substitutions of this type include adding an amine or hydroxyl, carboxylic acid to the aliphatic side chain of valine, leucine or isoleucine, exchanging the carboxylic acid in the side chain of aspartic acid or glutamic acid with an amine or deleting the amine group in the side chain of lysine or ornithine. In yet another alternative, the side chain of the substituting amino acid can have significantly different steric and electronic properties from the functional group of the amino acid being substituted. Examples of such modifications include tryptophan for glycine, lysine for aspartic acid and -(CH2)4

COOH for the side chain of serine. These examples are not meant to be limiting.

A "peptidomimetic organic moiety" can be substituted for amino acid residues in the compounds of this invention both as conservative and as non-conservative substitutions. These peptidomimetic organic moieties either replace amino acid residues of essential and non-essential amino acids or act as spacer groups within the peptides in lieu of deleted amino acids (of non-essential amino acids). The peptidomimetic organic moieties often have steric, electronic or configurational properties similar to the replaced amino acid and such peptidomimetics are used to replace amino acids in the essential positions, and are considered conservative substitutions. However, such similarities are not necessarily required. The only restriction on the use of peptidomimetics is that the 001496

peptides retain their integrase inhibiting properties or HTV-replication inhibiting properties/ or equilibrium shifting properties as defined above.

Peptidomimetics are often used to inhibit degradation of the peptides by enzymatic or other degradative processes. The peptidomimetics can be produced by organic synthetic techniques. Examples of suitable peptidomimetics include D amino acids of the corresponding L amino acids, tetrazole (Zabrocki et al, J. Am. Chem. Soc. 110:5875-5880 (1988)); isosteres of amide bonds (Jones et al, Tetrahedron Lett. 29: 3853-3856 (1988));

LL-3-amino-2-propenidone-6-carboxylic acid (LL- Acp) {Kemp et al, J. Org. Chem. 50:5834-5838 (1985)). Similar analogs are shown in Kemp et al, Tetrahedron Lett. 29:5081-5082 (1988) as well as Kemp et al, Tetrahedron Lett. 29:5057-5060 (1988), Kemp et al, Tetrahedron Lett. 29:4935-4938 (1988) and Kemp et al, J. Org. Chem. 54:109-115 (1987). Other suitable peptidomimetics are shown inNagai and Sato, Tetrahedron Lett. 26:647-650 (1985); Di Maio et al, J. Chem. Soc. Perkin Trans., 1687 (1985); Kahn et al, Tetrahedron Lett. 30:2317 (1989); Olson et al, J. Am. Chem. Soc. 112:323-333 (1990); Garvey et al, J. Org. Chem. 56:436 (1990). Further suitable peptidomimetics include hydroxy- 1,2,3,4-tetrahydroisoquinoline- 3-carboxylate (Miyake et al, J. Takeda Res. Labs 43:53-76 (1989)); 1,2,3,4-tetrahydro- isoquinoline-3-carboxylate (Kazmierski et al, J. Am. Chem. Soc. 133:2275-2283 (1991)); histidine isoquinolone carboxylic acid (HIC) (Zechel et al, Int. J. Pep. Protein Res. 43 (1991)); (2S, 3S)-methyl-phenylalanine, (2S, 3R)-methyl-ρhenylalanine, (2R, 3S)-methyl- phenylalanine and (2R, 3R)-methyl-phenylalanine (Kazmierski and Hruby, Tetrahedron Lett. (1991)).

Chemical modifications:

Typically no more than 40%, preferably 35%, 30%, 25%, 15%, 10%, or 5% of the amino acids have their side chains modified. The modification means the same type of amino acid residue, but to its side chain a functional group has been added. For example, the side chain may be phosphorylated, glycosylated, fatty acylated, acylated, iodinated or carboxyacylated. Deletions:

The deletion may be of terminal or non-terminal amino acids to result either in deletion of non terminal amino acid or in a fragment having at least 3,4,5,6,7,8,9.10,11,12 amino acids.

Combination of modifications:

Generally at least 50%, at least 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10, or 5% of the amino acids in the parent sequence of (a)-(b) are maintained so that the combination of the deletions, chemical modifications, and replacements are no more than 50% of the total peptides as long as they retain the property of equilibrium shifting, integrase inhibition or HIV-I replication inhibition.

It should be appreciated that some of the derivatives are not active. Those derivatives that fall under the scope of the invention are those that can inhibit the HTV-I replication, preferably those that inhibit the viral integrase activity, most preferably those that can cause a shift in the oligomerization equilibrium shift in a similar manner to the parent protein of (a)-(b)).

Typically "essential amino acids" (as will be detailed below) are maintained or replaced by conservative substitutions while non-essential amino acids may be maintained, deleted or replaced by conservative or non-conservative replacements. Generally, essential amino acids are determined by various Structure-Activity- Relationship (SAR) techniques (for example amino acids when replaced by Ala cause loss of activity) are replaced by conservative substitution while non-essential amino acids can be deleted or replaced by any type of substitution. Guidelines for the determination of the deletions, replacements and substitutions are given

Other types of derivatives: D-amino acids The term "corresponding D-amino acid" refers to the replacement of the naturally occurring L-configuration of the natural amino acid residue by the D-confϊguration of the same residue. 6

Peptidic backbone modifications (peptidomimetics)

The term "at least one peptidic backbone has been altered to a non-naturally occurring peptidic backbone" means that the bond between the N- of one amino acid residue to the C- of the next has been altered to non-naturally occurring bonds by reduction (to -CH₂-NH-), alkylation (methylation) on the nitrogen atom, or the bonds have been replaced by, urea bonds, or sulfonamide bond, etheric bond (-CH₂-O-), thioetheric bond (-CH₂-S-), or to -CS-NH-. The side chain of the residue may be shifted to the backbone nitrogen to obtain N-alkylated-Gly (a peptoid) as well as aza peptides

Reverse order:

The term "in reverse order" refers to the fact that the sequence of (a) to (c) may have the order of the amino acids as it appears in the native protein, or may have the reversed order (as read in the C-to N-direction). It has been found that many times sequences having such a reverse order can have the same properties, in small peptides, as the "correct" order, probably due to the fact that the side chains, and not the peptidic backbones are those responsible for interaction with other cellular components. Particularly preferred are "retro inverso" peptides - i.e. peptides that have both a reverse order as explained above, and in addition each and every single one of the amino acids, has been replaced by the non-naturally occurring D- amino acid counterpart, so that the net end result, as regards the positioning of the side chains, (the combination of reverse order and the change from L to D) is zero change. Such retro-inverso peptides, while having similar binding properties to the native peptide, were found to be resistant to degradation

Preparation of peptides of the present invention

Peptide sequences for producing any of the sequence of the compounds of the invention can be synthesized by solid phase peptide synthesis (e.g., t-BOC or F-MOC) method, by solution phase synthesis, or by other suitable techniques including combinations of the foregoing methods. The t-BOC and F-MOC methods, which are established and widely used, are described in Merrifield, J Am. Chem. Soc, 88:2149 (1963); Meienhofer, Hormonal Proteins and Peptides, CH. Li, Ed., Academic Press, 1983, pp. 48-267; and Barany and Aarifield, in The Peptides, E. Gross and J. Meienhofer, Eds., Academic Press, New York, 1980, pp. 3-285. Methods of solid phase peptide 2008/001496

synthesis are described in Aarifield, R.B., Science, 232:341 (1986); Carpino, L.A. and Han, G. Y., J Org. Chem., 37:3404 (1972); and Gauspohl, H. et al, Synthesis, 5:315 (1992)). The teachings of these references are incorporated herein by reference.

As demonstrated herein, peptides of the present invention inhibit HIV-I IN activity. Furthermore, the present invention demonstrates that peptides of the present invention inhibit HIV-I replication in cultured cells at low micromolar concentrations, as shown by three different, unrelated assay systems. Without wishing to be limited by theory, is believed that these peptides inhibit viral IN in vivo, as indicated by the correlation between their inhibition of IN enzymatic activity in vitro and their ability to reduce HIV-I replication.

Without wishing to be limited by theory, it is believed that the shift in IN oligomerization equilibrium, caused by the isolated peptides of the present invention, affects the DNA binding of IN. When the peptide is added to free IN₅ it shifts its oligomerization equilibrium towards a tetramer with significantly reduced affinity for DNA. When DNA was added before the peptides, most IN is DNA-bound when the peptide is added. The peptide can then shift the equilibrium only of the free IN fraction.

The following examples are presented in order to more fully illustrate some embodiments of the invention. They should, in no way be construed, however, as limiting the broad scope of the invention.

EXPERIMENTAL DETAILS SECTION

Example 1 - Peptides IN-I - IN-5 (SEO ID NQs. 1-5)

Correlation between shiftide activity and HIV-I integrase inhibition by a peptide selected from a combinatorial library

This Example used the yeast two hybrid system with the HIV-I IN as a bait and a combinatorial peptide aptamer library as a prey to select peptides of twenty amino acids that specifically bind IN. The selection of protein-interacting peptides under intracellular conditions was made possible by employing the yeast two hybrid system (Y2H) combined with the screening of expression vectors coding for random peptide and peptide aptamer libraries ¹⁴. The peptide aptamers are displayed on the surface of an inert scaffold protein and the subsequent screening of combinatorial peptide 6

aptamer libraries may result in a peptide that can specifically interact with a given target protein under intracellular conditions ^{15; 16}. Such peptides may have the potential to selectively block the function of their target protein both in vitro and in vivo; however, as described in greater detail herein, the mere selection of a peptide through such a screening process does not provide any predictive indication of the actual function of the peptide as an inhibitor of any type.

Five different non-homologous peptides, designated IN-I to IN-5 (SEQ ID NOs. 1-5), were selected on the basis of the screening process. ELISA studies confirmed that IN binds the free peptides. All the five peptides interact with IN with comparable affinity, K_& around 10 μM, as was revealed by fluorescence anisotropy studies. Only one peptide, IN-I (SEQ ID NO. 1), inhibited the enzymatic activity of IN in vitro and the HIV-I replication in cultured cells. (In correlation, fluorescence anisotropy binding experiments revealed that out of the five peptides, only the inhibitory IN-I (SEQ ID NO. 1) inhibited the DNA binding of IN. Analytical gel filtration experiments revealed that only the IN-I (SEQ ID NO. 1), but not the four other peptides, shifted the oligomerization equilibrium of IN towards the tetramer. Thus, the results show a distinct correlation between the ability of the selected peptides to inhibit IN activity and to shift its oligomerization equilibrium.

MATERIALS AND EXPERIMENTAL METHODS

Cells Yeast cells

Yeast strain KFl (AMTa trpl-901,leu2-3,112 his3~200 gal4 AgalδO LYS2::GAL1-HIS3 GAL2-ADE2 met2\:GAL7-lacZ SPALl 0-URA3) ^w was used for the peptide screening, were grown in YPD medium (1% (w/v) yeast extract, 1% (w/v) tryptone and 2% (w/v) glucose). Selective medium (SD) (0.67% (w/v) yeast nitrogen base without amino acids and 2% glucose) was used as a selective medium, where tryptophan (200 mg/1), leucine (1 g/1), adenine (1 mg/1) histidine (200 mg/1) and uracil (200 mg/1) were added as required. Mammalian cultured cells

Monolayer adherent HeLa cells, HEK293T cells and HeLa MAGI cells (TZM- bl) ³², expressing the β-galactosidase gene under regulation of the trans-activation response (TAR) element ²³ were grown in Dulbecco's Modified Eagle's Medium 001496

(DMEM). The T-lymphocyte cell lines Sup Tl and H9 were grown in RPMI 1640 Medium, all cells were provided by the NIH Reagent Program, Division of AIDS, NIAID, NIH₃ USA. Cells were incubated at 37⁰C in 5% CO₂ atmosphere. All media were supplemented with 10% (v/v) fetal calf serum (FCS), 0.3 g/1 L-glutamine, 100 U/ml penicillin and 100 U/ml streptomycin (Biological Industries, Beit Haemek, Israel).

Peptide aptamer screening by the yeast two-hybrid system Peptide aptamer screening was performed essentially as previously described ¹⁴. The HIV-I full-length IN hybrid expression plasmid pPC97-IN (bait plasmid) was constructed by fusing HIV-I IN to the GAL4 DNA binding domain (BD). This was performed by cleaving a DNA fragment encoding the IN sequence from the pYES2yEGFP-IN ³³ with Sail and BamHI and inserted into Sail and BgIII (compatible cohesive ends with the BamHI) digested pPC97 vector. The yeast prey vector pADTRX encodes the Escherichia coli thioredoxin A (trxA) gene fused to the Gal4 activation domain (AD). A 20 amino acid randomized peptide library was inserted in the RsrII site of trxA which corresponds to a constrained loop and this library contains 2 x 10⁸ different peptide aptamer ¹⁴. The yeast strain ICFl was transformed by bait (bearing the HIV-I integrase) and then by prey plasmids (bearing the peptide aptamer library) using the lithium acetate (LiAC) method ³⁴. BUF 1 transformants expressing pPC97-IN and the peptide aptamer expression library were selected initially for growth in the absence of adenine on agar plates containing SD lacking tryptophan, leucine and adenine. Subsequently, positive clones were transferred into replicas plated on histidine and uracil deficient media to analyze their ability to induce the GAL1-HIS3 and SPO13-URA3 markers of KF-I. Growth under screening conditions occurs only if a peptide binds to the IN, bringing the AD in the vicinity of the BD, thereby creating a transcription factor which activates the expression of a selectable marker. The plasmids, encoding the IN-interacting peptide aptamers, were recovered using the lyticase protocol and isolated from the yeast strain colonies. Recovered plasmids were transferred into E. coli DH5α for isolation and the DNA sequence of the insert determined. Finally, the recovered plasmids retransformed into the yeast baits strains to confirm specific interaction.

Peptide synthesis, labeling and purification

Peptides were synthesized on an Applied Biosystems (ABI) 433 A peptide synthesizer. For the fluorescence anisotropy and cellular uptake studies, the peptides were labeled fluorescein at their N-terminus. The peptides were also labeled with Trp at their N-terminus for UV spectroscopy. The peptides were labeled using 5' and 6' carboxyfluorescein succinimidyl ester (Molecular Probes) at the N-terminus ⁷. The peptides were purified on a Gilson HPLC using a reverse-phase C 8 semi-preparative column (ACE) with a gradient from 5% to 60% acetonitrile in water (both containing 0.001% (v/v) trifluoroacetic acid). Peptide concentrations were determined using a UV spectrophotometer (Shimadzu) as described ³⁵.

Viruses

Wild-type HIV-I was generated by transfection of HEK293T cells with pSVC21 plasmid containing the full-length HIV-1_HXB₂ viral DNA ³⁶. Wild-type and the Δenv/VSV~G viruses were harvested from HEK293T cells 48 and 72 h post- transfection with pSVC21 Δenv. The viruses were stored at -75⁰C.

Infection of cultured cells with HIV-I

Cultured lymphocytes (1 x 10⁵) were centrifuged for 5 min at 2000 rpm and after removal of the supernatant the cells were resuspended in 0.2 to 0.5 ml of RPMI (1640) medium containing virus at a multiplicity of infection (m.o.i.) of 0.1 and 2. Following absorption for 1 h at 37⁰C, the cells were washed to remove unbound virus and then incubated at the same temperature for an additional 1 to 10 days ²².

HIV-I titration by using multinuclear activation of a galactosidase indicator (MAGI) assay

Quantitative titration of HIV-I was carried out by the MAGI assay, as described by Kimpton and Emerman ²³. Briefly, TZM-bl were grown in 96-well plates at 10 x 10³ cells per well and following 12 h incubation at 37⁰C₃ peptides were added and after additional 2 h of incubation, the cells were infected with 50 μl of serially diluted HIV- 1 Δenv /V SV-G virus as described ²³. Two days post-infection, cultured cells were fixed and beta-GAL was estimated exactly as described before ²³. Blue cells were counted under a light microscope at 200 X magnification.

Quantitative estimation of HIV-I infection by determination of p24 H9 lymphoid cells were incubated with the indicated peptides (see Figure 6(b)) for 2 h and following infection with wild-type HIV-I at a m.o.i of 0.1 (as described above) the cells were incubated for 10 days. The amount of p24 was estimated exactly as described before ²².

ELISA-based binding assays 6

Protein-peptide binding was estimated using an ELISA-based binding assay exactly as described previously ³¹.

Cell-penetration experiments

Fluorescein-labeled peptides at a final concentration of 10 μM in PBS were incubated with HeLa cells for 1 h at 37⁰C. After three washes in PBS, non-fixed cells were visualized by a fluorescent microscope as described ²².

Determination of integrase activity

Two IN assay systems were employed. In the first the 3 '-end processing and the strand-transfer activities of the IN, as well as preparation of the recombinant HIV-I IN and the gel-purified oligonucleotides used for these enzymatic assays, were performed exactly as previously described ^{19> 37}.

Determination of the IN enzymatic activity by the second assay was performed using a previously described assay system ²⁰' ²¹, Briefly a oligonucleotide substrate of which one oligo (5'-ACTGCTAGAGATTTTCCACACTGACTAAAAGGGTC; SEQ ID NO. 9) was labeled with biotin on the 3' end and the other oligo (5'-

GACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGT; SEQ ID NO. 10) was labeled with digoxigenin at the 5' end. When peptide inhibition was studied, the IN was pre-incubated with the peptide for 10 min prior to addition of the DNA substrate.

Over-all integrase reaction was followed by an immunosorbent assay on avidin-coated plates as described ^22;21.

Fluorescence anisotropy

Measurements were performed at 1O⁰C using a PerkinElmer LS-55 luminescence spectrofluorimeter equipped with a Hamilton microlab 500 dispenser essentially as described ⁷. The fluorescein-labeled peptide or DNA (1 ml, 0.05-0.1 μM in 20 niM Tris buffer pH 7.4, 185 mM NaCl) was placed in a cuvette, and the non-labeled IN protein (200 μl, -100 μM) was added in 20 aliquots of 10 μl at 1-min intervals. The total fluorescence and anisotropy were measured after each addition using an excitation wavelength of 480 nm and an emission wavelength of 530 nm. Data were fit to the Hill equation

AR*(K_a ⁿ *[IN]ⁿ)

R = R₀+- l + K_a ⁿ *[IN]ⁿ (R = measured anisotropy, ΔR = the amplitude of the anisotropy change from RO (free peptide) to peptide in complex, [IN] = the added concentration of IN and Ka = the association constant).

Quantitation of integrated HIV-I DNA in the cellular genome The integration reaction was estimated essentially as described before ²². Briefly, following incubation of the indicated peptides with SupTl cells for 2 h, the cells were infected with a HIV-I Δenv/VSV-G virus at m.o.i of 2 (as described above) for 24 h. Integrated HIV-I sequences were amplified by two PCR replication steps using the HIV-I LTR-specific primer (LTR-TAG-F 5'- ATGCCACGTAAGCGAAACTCTGGCTAACTAGGGAACCCACTG-S'; SEQ ID NO. 11) and Alu-targeting primers (first- AIu-F 5'-AGCCTCCCGAGTAGCTGGGA- 3' (SEQ ID NO. 12) and first-Alu-R 5'-TTACAGGCATGAGCCACCG-S' (SEQ ID NO. 13)) ³⁹.

During the second-round PCR, the first-round PCR product could be specifically amplified by using the tag-specific primer (tag-F 5'- ATGCCACGTAAGCGAAACTC-3' (SEQ ID NO. 14)) and the LTR primer (LTR-R 5'-AGGCAAGCTTTATTGAGGCTTAAG-S' (SEQ ID NO.15)) designed by PrimerExpress (Applied Biosystems) using default settings. For generating a linear curve the SVC21 plasmid containing the full-length HIV-1H_XB2 viral DNA was used as a template. In the first round PCR the LTR-TAG-F and LTR-R primers were used and the second-round PCR was performed using the tag-F and LTR-R primers. The standard linear curve was in the range of 5 ng to 0.25 fg (R = 0.99). DNA samples were assayed with quadruplets of each sample. Further experimental details as described ²². PCR analysis of early viral genes

SupTl cells were incubated with 12.5 μM of either peptides or with 2 μM of AZT for 2 h, cells following infection with a HIV-I Δenv/VSV-G virus at a m.o.i of 2 and incubation for 6 h. The viral Gag or Nef DNA sequences were amplified using specific primers as described before ²². Effect of peptides on cell viability using the MTT (3-(4,5-dimethylthiazol-2- yl)-2,5-diphenyltetrazolium bromide) assay

Following incubation with the indicated peptides, the medium was removed and the cells were incubated in Earl's solution containing 0.3 mg/ml MTT for 1 h. Subsequently, the solution was removed and the cells were dissolved in 100 μl DMSO 01496

for 10 min at room temperature. The DMSO-solubilized cells were transferred to 96- well ELISA plate and OD values were monitored at a wavelength of 570 run.

Time of addition assay SupTl cells were infected with wild-type HIV-I at a multiplicity of infection of

I₃ and the test compounds were added at different time points after infection (0, 2, 4...12, 16, and 24 h). Viral p24 Ag production was determined at 48 h post infection, dextran sulfate was tested at 20 μM, AZT at 2 μM, IN-I and 4 at 12.5 μM ²⁵.

Analytical gel filtration Analytical gel filtration of IN (lOμM) was performed on an AKTA Explorer using a Superose 12 analytical column 30x1 cm (GE Healthcare - Pharmacia Corp.) equilibrated with buffer, 20 niM Tris pH 7.4, 1 M NaCL and 10% glycerol exactly as described before ^{7; 22}.

Selection of IN-interacting peptides by Y2H system

A Y2H system was used to select peptide aptamers that specifically bind IN in vivo ¹⁷. The complete HIV-I IN protein fused to the Gal4-binding domain was used as bait. As prey, a randomized peptide aptamer expression library was employed. The Escherichia coli (E. coli) thioredoxin A protein (TrxA), fused to the Gal4 transcriptional activation domain, served as a scaffold to present a random library of constrained peptides. From about 10⁶ different transformants, we have isolated 5 clones that activated all the markers (growth in the absence of adenine, histidine and uracil). The vectors, encoding the interacting peptide aptamers were isolated from the yeast strain. As negative controls, these plasmids were transformed with a plasmid expressing Gal4-binding domain alone, or with plasmids expressing various other unrelated proteins (LEDGF, importin α and histone H2A). No interactions with HIV-I IN were detected with these control proteins (not shown).

After determination the DNA sequence of the positive plasmids, the corresponding IN-interacting peptides, designated as IN-I to IN-5, were synthesized (for sequences see Table 1 above) and their ability to interact with a recombinant full- length IN was estimated in vitro (Figure l(a) and (b)). Furthermore, gel filtration experiments have also shown that all these peptides indeed interacted with the IN protein, as could be inferred from the fact that the fluorescently labeled peptides were eluted together with the IN protein, as opposed to free peptides which were eluted in a 6

different fraction (not shown). The selected peptides interacted, almost to the same extent with the IN protein, as can be inferred from the apparent K_d calculated based on results of the fluorescence anisotropy experiments (Figure l(b) and Table 2).

Table 2: Binding affinity of the selected IN-binding peptides to IN* Peptide Kg (uM) Hill coefficeint

IN-I 8.7 ± 0.2 4.5

IN-2 5.3 ± 0.1 4.1

IN-3 4.5 ± 0.4 3.1 IN-4 12.5 ± 0.7 3.6

IN-5 12.0 ± 0.4 5.0

*IN was titrated into the fluorescently labeled IN binding peptides and binding was estimated by monitoring fluorescence anisotropy (Figure l(b)) and fitting the results to the Hill equation as described in Materials and Methods.

Only one of the selected peptides inhibits of HIV-I IN enzymatic activity in vitro

To study the effect of the five IN-interacting peptides on the IN activities, two in vitro enzymatic assay systems were employed. The qualitative assay shows that IN-I, but not IN-2, inhibited both the 3 '-end processing and the strand transfer activities of

IN (Figure 2(a) and (b)). A densitometer analysis reveals that IN inhibition by IN-I was concentration dependent blocking both activities almost completely at 60 μM

(Figure 2(c)). The apparent concentrations leading to an inhibition of 50% of the initial IN activities (IC₅₀ values) were calculated to be about 12 μM and 40 μM for the strand transfer and 3 '-end processing activities, respectively. This difference in the sensitivities to IN-inhibitory peptide is not surprising since the strand transfer is inhibited more readily than the 3'-end processing as previously described ^{18; 19}. No significant IN inhibition was observed with IN-2, IN-3, IN-4 and IN-5 (data not shown). To confirm these results we have also assessed the IN inhibitory capacity of 1496

the five peptides using another IN enzymatic activity assay ' ' . Again, only IN-I and none of the other four IN-interacting peptides inhibited IN (Figure 3 (a), (b) and not shown).

The oligomerization equilibrium of the IN is shifted only by the inhibitory IN-I

The selection of five IN interacting peptides, out of which only one (IN-I) was inhibitory, enable the potential correlation between the ability of a given peptide to inhibit IN and to shift its oligomerization equilibrium to be studied. Similar to the

LEDGF/p75 derived peptides ⁷, also the inhibitory IN-I promotes the formation of IN tetramers (Figure 4(a)). No detectable tetramer formation was observed after incubation of IN with the non-inhibitory peptide IN-4 (Figure 4(a)). Similarly IN-2,

IN-3 and IN-5 failed to promote the formation of IN tetramers (not shown). In line with these results, fluorescence anisotropy experiments revealed that only IN-I, but not IN-2 to IN-5, inhibited the interaction between the IN and its substrate DNA (Figure 4(b) and not shown).

Cell permeability and Toxicity of the IN-interacting peptides Incubation of fluorescently labeled IN-I, IN-2, IN-4 and IN-5 peptides with cultured HeLa cells resulted in the appearance of intracellular fluorescence indicating their ability to translocate through the cells' plasma membrane (Figure 5(a)). On the other hand, IN-3 was cell impermeable (Figure 5 (a)), as no intracellular fluorescence could be detected (Figure 5 (a)). None of the IN-interacting peptides were toxic to the HeLa cultured cells at the concentrations employed (up to about 62.5 μM) as reflected by the MTT assay (Figure 5(b)).

Only IN-I and none of the other selected peptides inhibit HIV-I infectivity in cultured cells

The ability of the IN-interacting peptides to inhibit HIV-I replication was studied using virus infected TZM-bl (MAGI) cells, whose percentage of blue cells indicates the titer of the infectious virus ²³. The results in Figure 6(a) show that out of the four penetratable peptides, only IN-I inhibited virus infection in a dose response manner reaching a maximum inhibition of about 75% in the presence of 62.5 μM peptide. Inhibition of HIV-I infectivity was also observed with IN-I when HIV-I infection was monitored by the appearance of the p24 HIV-I protein (Figure 6(b)), as well as from the level of viral DNA integrated into the cellular genome (Figure 6(c)). Neither IN-I nor the other IN-interacting peptides inhibited the synthesis of viral cDNA, as was estimated after the first cycle of infection, 6 h post-infection (Figure 6(d) and not shown). This strongly suggests that the inhibition of viral infectivity by peptide IN-I results from the intracellular inhibition of the integration process, since no other steps prior to integration seem to be affected. As expected, inhibition of viral DNA synthesis was observed only after incubation of the virus infected cells with the potent reverse transcriptase inhibitor, AZT ²⁴ (Figure 6(d)). These results further indicate that IN-I inhibited the integration step of the virus infection cycle in cells.

Inhibition of the integration step can also be inferred from Figure 7, summarizing the results obtained following the addition of various HIV-I inhibitory compounds to virus infected cells at different times ²⁵. As expected, no effect on virus infectivity, as estimated by the appearance of p24 level, was observed following the addition of IN-4 at different intervals after infection. Dextran sulfate, a polyanion which interfere with virus-cell interaction ^{26; 27; 28}, blocked virus infection, only when added at time zero; and was completely inactive when added 4 h after virus addition. On the other hand, as expected, the RT inhibitor AZT ²⁴, gradually lost its inhibitory effect when added between 4 and 1O h post infection and finally became completely inactive, as expected, after 12 h. The kinetics shown in this figure clearly suggest that the peptide IN-I inhibits a retroviral step that follows the reverse transcription step, thus confirming the results shown in Figure 6(d), that the intracellular integration step is inhibited. IN-I was still inhibitory even when administrated 12 h post infection, at time point at which AZT was completely inactive (Figure 7). Nevertheless the results in Figure 7 confirm those shown in Figure 6(b), demonstrating that AZT was a stronger inhibitor than IN- 1.

Example 2 - Peptides IN-I, IN-1 1-10 and IN-1 11-20 (SEO ID NQs. 1, 6 and 7)

In order to understand the mechanism of action of IN-I (SEQ ID NO. 1), both halves of the peptide were synthesized as separate peptides, forming IN-I 1-10 (SEQ ID NO. 6) and IN-I 11-20 (SEQ ID. NO. 7); the latter peptide includes an additional tryptophan moiety not present in the original IN-I sequence. The binding and inhibitory properties of these different peptides were compared. The short peptides, IN-I 1-10 (SEQ ID NO. 6) and IN-I 11-20 (SEQ ID. NO. 7), were found to bind IN at least as well as the original IN-I (SEQ ID NO. 1), but whereas for IN-I the Hill coefficient was 4, indicating the peptide binds a tetrameric from of the protein, both short peptides bound IN dimers as described in greater detail below. The fact that the shorter peptides bound the dimeric form of the protein did not affect their inhibitory properties. Both in the in vitro assay and in cultured cells, the peptide IN-I 1-10 showed similar inhibition as the original IN-I, whereas IN-I 11-20 showed a twofold less inhibition in both assays. As described in greater detail below, three regions on the IN protein bound one or more of the peptides; residues 94-112 and 118-132 in the catalytic core domain of IN, and residues 242-256 in the DNA binding domain. In addition, residues 70-84 were found to bind one or more of the peptides; however, upon being mapped on the solved structure of the catalytic core domain, it was determined that residues 70-84 are in fact buried inside the protein, and so this result was discarded.

One of the above described regions (residues 118-132) binds also the two halves of IN- 1 , while each of IN- 1 1-10 and IN-I 11-20 binds an additional different region as well (residues 94-112 and residues 242-256 respectively). IN 118-132, which bound the three peptides, is known to be sticky. This region is part of the interface between IN and one of its cellular cofactors LEDGF/p75. From the solved structure it can be seen that these residues are located on the surface of the protein. From other research by the present inventors e.g., as disclosed in 2008/068765 (see also ref. 7) it was found that this region also bound Rev and LEDGF-derived peptides.

Without wishing to be limited by a single hypothesis, the whole IN-I peptide (SEQ ID NO. 1) is proposed to act as a bridge between two dimers, making a dimer of dimers. Both halves of the peptide each bind IN at two sites; IN-I 1-10 (SEQ ID NO. 6) binds two sites in the catalytic core domain (CCD), and IN-I 11-20 (SEQ ID NO. 7) binds one of these sites in the CCD, and an additional site in the DNA binding domain. The fact that IN-I (SEQ ID NO. 1) and its fragment IN-I 1-10 (SEQ ID NO.6) bind more strongly in the CCD correlates with their stronger inhibition in vitro and in cultured cells.

MATERIALS AND EXPERIMENTAL METHODS

The materials and experimental methods used in this Example are described with regard to Example 1 above. RESULTS

The IN-1-derived peptides bindINdimer

As described above, IN-I (SEQ ID NO. 1) was found to bind IN as a tetranier with a K_d of 8.7 μM. In order to try to understand the mechanism of IN inhibition by this peptide, two shorter peptides were prepared, IN-I 1-10 (SEQ ID NO. 6) and IN-I 11-20 (SEQ ID NO. 7), corresponding to its N- and C-terminal halves (table 1 above). Using fluorescence anisotropy it was found that both short peptides bound dimeric IN, as indicated by a Hill coefficient of 2. Binding affinity of the peptides to IN was around one micromolar, approximately one order of magnitude tighter that the affinity of the parent IN-I (SEQ ID NO. 1) peptide (figure 8a + table 3a). Table 3: (a) Binding of the peptides to IN

Peptide KH fμM) Hill coefficient

IN-I (SEQ ID NO. 1) 8.7 4.5

IN-I 1-10 (SEQ ID NO. 6) 1.7 ± 0.1 1.5 ± 0.1

IN-I 11-20 (SEQ ID NO. 7) 1.8 ± 0.1 2.1 ± 0.1

(b) Effect of the peptides on binding of IN to DNA

Peptide Kn CnM) Hill coefficient

No peptide 59 ± 2 1.7 ± 0.1

IN-I (SEQ ID NO. 1) 300

IN-I 1-10 (SEQ ID NO. 6) 590 ± 20 2.0 ± 0.1

IN-I 11-20 (SEQ ID NO. 7) 870 ± 90 2.1 ± 0.3

The IN-I (SEQ ID NO. l)-derived peptides inhibit the DNA binding and catalytic activity of IN in vitro Fluorescence anisotropy was used to test the effect of the short IN-I (SEQ ID

NO. 1) - derived peptides on the DNA binding of IN. In agreement with our previous results, a dimer of IN bound fluorescein labeled LTR DNA with affinity of 59 nM (figure 8b + table 3b). In presence of the peptides, the binding between IN and DNA was inhibited by an order of magnitude at least. Both short peptides inhibited the DNA 96

binding of IN around two-fold better than the parent IN-I (SEQ ID NO. 1). In presence of the peptides, IN still bound the LTR DNA as a dimer, as reflected from the Hill coefficient (figure 8c + table 3b).

To test the ability of the peptides to inhibit the enzymatic activity of IN, an in vitro IN integration activity assay was performed, which provided a quantitative estimation of the inhibition. At a IN:pep ratio of 1:200, IN-I (SEQ ID NO. 1) inhibited the integration reaction by 64%. IN-I 1-10 (SEQ ID NO. 6) inhibited the enzymatic activity of IN to a similar extent, while inhibition by IN-I 11-20 (SEQ ID NO. 7) was around two fold weaker (figure 9 + table 4).

Table 4:

(a) Inhibition of IN activity (in vitro)

Peptide Percentage of inhibition

IN-I (SEQ ID NO. 1) 64% IN-I 1-10 (SEQ ID NO. 6) 58%

IN-I 11-20 (SEQ ID NO. 7) 36%

(b) Inhibition of HIV-I infectivity (in cultured cells)

Peptide Percentage of inhibition IN-I (SEQ ID NO. 1) 69%

IN-I 1-10 (SEQ ID NO. 6) 64%

IN-I 11 -20 (SEQ ID NO. 7) 30%

IN-I 1-10 (SEQ ID NO. 6) C3S 61%

The IN-I (SEQ ID NO. l)-derived peptides penetrate HeLa cells and inhibit

HIV-I replication in cultured cells

To determine the effect of the peptides in HIV-I infected cells, it was tested whether they are able to penetrate cells. Fluorescein-labeled IN-I 1-10 (SEQ ID NO. 6) and IN 1 11-20 peptides were incubated with cultured HeLa cells. Using confocal microscopy, intracellular fluorescence was observed with both peptides both in the cytoplasm and the nuclei, indicating that both peptides do penetrate the cells (figure 10).

The MAGI system in TZM-bl cells was used to study the ability of the peptides to inhibit HIV-I replication in cultured cells. Both the original IN-I (SEQ ID NO. 1) and IN-I 1-10 (SEQ ID NO. 6) showed similar inhibition of about 65%. Inhibition by IN-I 11-20 (SEQ ID NO. 7) was slightly less pronounced, reaching a value of 30% (figure 11 + table 4).

The IN-I (SEQ ID NO. l)-derived peptides have different binding sites on IN

To gain insight into the mechanism of inhibition by the peptides, the location of their binding sites on IN was determined. Elucidation of the binding sites for the different peptides could potentially explain how the different peptides bind the different oligomeric states of IN. To address this question, ELISA binding studies between the inhibitory peptides and a peptide library covering the full length of the IN protein obtained through the AIDS Research and Reference Reagent Program of the Division of AIDS, National Institute of Allergy and Infectious Diseases, NIH. The results are described in figure 12 and table 5. The parent 20-mer IN-I (SEQ ID NO. 1) peptide bound five peptides from the IN library, corresponding to four regions in the IN protein: residues 70-84, 94-112 and 118-132 in the catalytic core domain of IN, and IN 242-256 is situated in the DNA binding domain (figure 12a). The IN 70-84 region is buried inside the protein (figure 12b), and thus it may be a false positive result, obtained due to the use of peptides. Both short peptides, IN-I 1-10 (SEQ ID NO. 6) and IN-I 11-20 (SEQ ID NO. 7), each bound only two out of the four INl -binding regions. While both short peptides bound the IN 118-132 region, IN-I 1-10 (SEQ ID NO. 6) bound exclusively to residues 94-112 in the CCD of IN. On the contrary, IN-I 11-20 (SEQ ID NO. 7) bound exclusively to residues 242-260 in the DNA-binding region of IN.

Table 5:

Binding regions of the peptides

Binding region Interacts with IN-I with IN-I 1-10 with IN-I 11-20

IN 70-84 V - -

IN 94-108 V V -

IN 98-112 V V -

IN 118-132 V V V

IN 242-256 V - -

IN 246-260 V EXAMPLE 3: Identifying essential and non-essential amino acids in the subsequence chosen

Deletion and replacement by non-conservative amino acids generally is performed in "non-essential" amino acids, while essential amino acids should be maintained or replaced by conservative substitutions. To identify essential vs. non-essential amino acids, the following techniques are utilized:

(1) Shortening of sequence:

To determine the minimum sequence of the lead peptide required for IN binding; integrase inhibition and/or HIV-I replication inhibition, a series of truncated partly overlapping peptides derived from the isolated peptides of the present invention as described herein is prepared. Peptides are shortened by one residue at a time from the N terminus and from the C terminus. The short peptides are labeled with fluorescein for the fluorescence anisotropy and cellular uptake studies.

(2) Systematic Amino Acid Replacement: To improve the binding affinity of the lead peptides to IN, a new series of peptides are prepared wherein the residues that do not contribute to IN binding are replaced by other natural and non-natural amino acids. Design of the mutations is based on a bioinformatics search. Viral homologous sequences are identified, and amino acids in the lead peptide are mutated according to naturally occurring residues in these positions. In parallel, a combinatorial approach is used to discover which type of amino acid will best fit the mutation positions. Fluorescein- labeled peptides are synthesized, wherein amino acids not important for IN binding are replaced by mixtures of 4-5 natural and non-natural amino acids that have the same character (e.g. polar, hydrophobic etc.). Non-natural amino acids will be primarily utilized, since their incorporation increases peptide stability. Binding of the peptides to IN is tested using fluorescent anisotropy, mixtures that bind IN are separated by HPLC, and binding of individual peptides to IN is tested. To identify synergy between the different mutations, peptides are synthesized with multiple amino acid replacements, wherein mutations resulting in tightest IN binding are combined.

(3) Increasing peptide stability: To stabilize the lead peptides against proteolysis, non- natural amino acids such as N-methyl amino acids and D-amino acids are introduced into the peptide sequence. A D-amino acid scan of the lead peptides is performed, and a series of peptides is synthesized wherein each amino acid is systematically replaced by its D enantiomer. In other experiments, an N-methyl amino acids scan of the lead peptides is performed (similarly to the D-amino acid scan). N-methylation is known to stabilize peptide to enzymatic degradation and increase their oral bioavailability due to the lack of the amide protons, which reduces their polarity.

(4) Conversion into peptidomimetics and Aza-scan: The lead peptides at this stage bear an optimized side chain composition with only the required pharmacophores present, have a shorter sequence and are stable against proteolysis. Next, backbone modifications are introduced. The lead peptides are subject to AZA scan, to improve the peptide stability and its binding affinity and specificity. Aza peptides are peptide analogs in which the α-carbon of one or more of the amino acid residues is replaced with a nitrogen atom. This reduces the flexibility of the parent linear peptide due to replacement of the rotatable Cα-CO bond by a more rigid urea N-CO structure, and leads to improved pharmacological properties such as increased duration of action, potency, and/or selectivity, as was shown for aza-analogues of angiotensin II and somatostatin and of serine and cysteine protease inhibitors. Each amino acid in the lead peptides is systematically replaced by the corresponding Aza amino acid, followed by assays for binding IN and inhibiting IN activity and HTV-I replication as described above, hi other experiments, the backbone amide bonds are each systematically converted into a peptoid bond, wherein the side chain of the peptide is moved from the α-carbon to the α-nitrogen.

(6) Conversion into small molecules: Next, further modifications are introduced into the most potent peptidomimetic and in its backbone and side chains to further convert it into a small molecule. The modifications are in further modification of the peptide bonds (e.g. reduction of the carbonyl to methylene), and replacement of the side chains by organic groups with similar properties, to fine-tune the interaction with IN.

Omission scan

In other experiments, identification of essential vs. non-essential amino acids in the peptide is achieved by preparing several peptides in which each amino acid is sequentially omitted ("omission-scan"). Amino acids whose loss results in reduction in physiological activity can be defined as "essential," while those whose loss does not cause significant change of activity can be defined as "non-essential" (Morrison et ah, Chemical Biology 5:302-307, 2001).

All the results described in the present work are an average of at least triplicate determinations, where the standard deviation never exceeded +/- 20%.

The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without undue experimentation and without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. The means, materials, and steps for carrying out various disclosed functions may take a variety of alternative forms without departing from the invention.

References:

1. Sherman, M. P. & Greene, W. C. (2002). Slipping through the door: HIV entry into the nucleus. Microbes Infect. 4, 67-73.

2. Pommier, Y., Johnson, A. A. & Marchand, C. (2005). Integrase inhibitors to treat HIV/ AIDS. Nat. Rev. Drug. Discov. 4, 236-248.

3. Hazuda, D. J., Young, S. D., Guare, J. P., Anthony, Ν. J., Gomez, R. P., Wai, J. S., et al. (2004). Integrase inhibitors and cellular immunity suppress retroviral replication in rhesus macaques. Science 305, 528-532.

4. Lataillade, M. & Kozal, M. J. (2006). The hunt for HIV-I integrase inhibitors. AIDS Patient Care STDS 20, 489-501.

5. Markowitz, M., Morales-Ramirez, J. O., Nguyen, B. Y., Kovacs, C. M., Steigbigel, R. T., Cooper, D. A., et al. (2006). Antiretroviral activity, pharmacokinetics, and tolerability of MK-0518, a novel inhibitor of HIV-I integrase, dosed as monotherapy for 10 days in treatment-naive HIV-I- infected individuals. J. Acquir Immune Defic. Syndr. 43, 509-515.

6. Cherepanov, P., Ambrosio, A. L., Rahman, S., Ellenberger, T. & Engelman, A. (2005). Structural basis for the recognition between HIV-I integrase and transcriptional coactivator p75. Proc. Natl. Acad. Sci. USA 102, 17308-17313.

7. Hayouka, Z., Rosenbluh, J., Levin, A., Loya, S., Lebendiker, M., Veprintsev, D., et al (2007). Inhibiting HIV-I integrase by shifting its oligomerization equilibrium. Proc. Natl Acad. Sci. USA 104, 8316-8321.

8. Chen, A., Weber, I. T., Harrison, R. W. & Leis, J. (2006). Identification of amino acids in HIV-I and avian sarcoma virus integrase subsites required for specific recognition of the long terminal repeat Ends. J. Biol. Chem. 281, 4173-4182. 008/001496

9. Deprez, E., Tauc, P., Leh, H., Mouscadet, J. F., Auclair, C. & Brochon, J. C. (2000). Oligomeric states of the HIV-I integrase as measured by time-resolved fluorescence anisotropy. Biochemistry 39, 9275-9284.

10. Deprez, E., Tauc, P., Leh, H., Mouscadet, J. F., Auclair, C, Hawkins, M. E., et al. (2001). DNA binding induces dissociation of the multimeric form of HIV-I integrase: a time-resolved fluorescence anisotropy study. Proc. Natl. Acad. ScI USA 98, 10090-10095.

11. Faure, A., Calmels, C, Desjobert, C, Castroviejo, M., Caumont-Sarcos, A., Tarrago-Litvak, L., et al. (2005). HIV-I integrase crosslmked oligomers are active in vitro. Nucleic Acids Res. 33, 977-986.

12. Guiot, E., Carayon, K., Delelis, O., Simon, F., Tauc, P., Zubin, E., et al. (2006). Relationship between the oligomeric status of HIV-I integrase on DNA and enzymatic activity. J. Biol. Chem. 281, 22707-22719.

13. Zhao, L., O'Reilly, M. K., Shultz, M. D. & Chmielewski, J. (2003). Interfacial peptide inhibitors of HIV-I integrase activity and dimerization. Bioorg. Med. Chem. Lett. 13, 1175-1177.

14. Butz, K., Denk, C, Ullmann, A., Scheffner, M. & Hoppe- Seyler, F. (2000). Induction of apoptosis in human papilloma virus positive cancer cells by peptide aptamers targeting the viral E6 oncoprotein. Proc. Natl. Acad. ScI USA 97, 6693-6697.

15. Hoppe-Seyler, F., Crnkovic-Mertens, L, Tomai, E. & Butz, K. (2004). Peptide aptamers: specific inhibitors of protein function. Curr. MoI. Med. 4, 529-538.

16. Tomai, E., Butz, K., Lohrey, C₅ von Weizsacker, F., Zentgraf, H. & Hoppe-Seyler, F. (2006). Peptide aptamer-mediated inhibition of target proteins by sequestration into aggresomes. J. Biol. Chem. 281, 21345-21352.

17. de Soultrait, V. R., Caumont, A., Parissi, V., Morellet, N., Ventura, M., Lenoir, C, et al. (2002). A novel short peptide is a specific 6

inhibitor of the human immunodeficiency virus type 1 integrase. J. MoI. Biol. 318, 45-58.

18. Gleenberg, I. O., Herschhorn, A. & Hizi, A. (2007). Inhibition of the activities of reverse transcriptase and integrase of human immunodeficiency virus type-1 by peptides derived from the homologous viral protein R (vpr). J. MoI. Biol. 369, 1230-1243.

19. Oz Gleenberg, I., Avidan, O., Goldgur, Y., Herschhorn, A. & Hizi, A. (2005). Peptides derived from the reverse transcriptase of human immunodeficiency virus type 1 as novel inhibitors of the viral integrase. J. Biol. Chem. 280, 21987-21996.

20. Craigie, R., Mizuuchi, K., Bushman, F. D. & Engelman, A. (1991). A rapid in vitro assay for HIV DNA integration. Nucleic Acids Res. 19, 2729-2734.

21. Hwang, Y., Rhodes, D. & Bushman, F. (2000). Rapid microtiter assays for poxvirus topoisomerase, mammalian type IB topoisomerase and HIV-I integrase: application to inhibitor isolation. Nucleic Acids Res. 28, 4884-4892.

22. Rosenbluh, J., Hayouka, Z., Loya, S., Levin, A., Armon-Omer, A., Britan, E., et al. (2007). Interaction between HIV-I Rev and Integrase Proteins: A basis for the development of anti-HIV peptides. J. Biol. Chem. 282, 15743-15753.

23. Kimpton, J. & Emerman, M. (1992). Detection of replication- competent and pseudotyped human immunodeficiency virus with a sensitive cell line on the basis of activation of an integrated beta-galactosidase gene. J. Virol 66, 2232-2239.

24. Rigourd, M., Lanchy, J. M., Le Grice, S. F., Ehresmann, B., Ehresmann, C. & Marquet, R. (2000). Inhibition of the initiation of HIV-I reverse transcription by 3'-azido-3'-deoxythymidine. Comparison with elongation. J. Biol. Chem. 275, 26944-26951. 1496

25. Pannecouque, C, Pluymers, W., Van Maele, B., Tetz, V., Cherepanov, P., De Clercq, E., et al. (2002). New class of HIV integrase inhibitors that block viral replication in cell culture. Curr. Biol. 12, 1169-1177.

26. Baba, M., Pauwels, R., Balzarini, J., Arnout, J., Desmyter, J. & De Clercq, E. (1988). Mechanism of inhibitory effect of dextran sulfate and heparin on replication of human immunodeficiency virus in vitro. Proc. Natl. Acad. Sci. USA 85, 6132-6136.

27. Mitsuya, H., Looney, D. J., Kuno, S., Ueno, R., Wong-Staal, F. & Broder, S. (1988). Dextran sulfate suppression of viruses in the HIV family: inhibition of virion binding to CD4+ cells. Science 240, 646-649.

28. Nakashima, H., Yoshida, O., Baba, M., De Clercq, E. & Yamamoto, N. (1989). Anti-HIV activity of dextran sulphate as determined under different experimental conditions. Antiviral Res. 11, 233-246.

29. Maroun, R. G., Gayet, S., Benleulmi, M. S., Porumb, H., Zargarian, L., Merad, H., et al. (2001). Peptide inhibitors of HIV-I integrase dissociate the enzyme oligomers. Biochemistry 40, 13840-13848.

30. Li, H. Y., Zawahir, Z., Song, L. D., Long, Y. Q. & Neamati, N. (2006). Sequence-based design and discovery of peptide inhibitors of HIV-I integrase: insight into the binding mode of the enzyme. J. Med. Chem. 49, 4477-4486.

31. Rosenbluh, J., Kapelnikov, A., Shalev, D. E., Rusnati, M., Bugatti, A. & Loyter, A. (2006). Positively charged peptides can interact with each other, as revealed by solid phase binding assays. Anal. Biochem. 352, 157-168.

32. Derdeyn, C. A., Decker, J. M., Sfakianos, J. N., Wu, X., O'Brien, W. A., Ratner, L., et al. (2000). Sensitivity of human immunodeficiency virus type 1 to the fusion inhibitor T-20 is modulated by coreceptor specificity defined by the V3 loop of gpl20. J. Virol 74, 8358- 8367. 33. Armon-Omer, A., Rosenbluh, J., Melamed-Book, N., Graessmann, A. & Loyter, A. (2007). Nuclear import of HIV integrase in yeast is mediated by a specific NLS and via importin alpha. J. Biol. Chem., Submitted.

34. Gietz, D., St Jean, A., Woods, R. A. & Schiestl, R. H. (1992). Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res. 20, 1425.

35. Kohler, F., Cardon, G., Pohlman, M., Gill, R. & Schider, O. (1989). Enhancement of transformation rates in higher plants by low-does irradiation: are DNA repair systems involved in incorporation of exogenous DNA into the plant genome? Plant MoI. Biol. 12, 189-199.

36. Heinzinger, N. K., Bukinsky, M. L, Haggerty, S. A., Ragland, A. M., Kewalramani, V., Lee, M. A., et al. (1994). The Vpr protein of human immunodeficiency virus type 1 influences nuclear localization of viral nucleic acids in nondividing host cells. Proc. Natl. Acad. Sci. U SA 91, 7311-7315.

37. Marchand, C, Neamati, N. & Pommier, Y. (2001). In vitro human immunodeficiency virus type 1 integrase assays. Methods Enzymol. 340, 624-633.

38. Friedler, A., Hansson, L. O., Veprintsev, D. B., Freund, S. M., Rippin, T. M., Nikolova, P. V., et al. (2002). A peptide that binds and stabilizes p53 core domain: chaperone strategy for rescue of oncogenic mutants. Proc. Natl. Acad. Sci. USA 99, 937-942.

39. Yamamoto, N., Tanaka, C, Wu, Y., Chang, M. O., Inagaki, Y., Saito, Y., et al. (2006). Analysis of human immunodeficiency virus type 1 integration by using a specific, sensitive and quantitative assay based on realtime polymerase chain reaction. Virus Genes 32, 105-113.

40. Armon-Omer, A., Graessmann, A. & Loyter, A. (2004). A synthetic peptide bearing the HIV-I integrase 161-173 amino acid residues

49 mediates active nuclear import and binding to importin alpha: characterization of a functional nuclear localization signal. J MoI. Biol. 336, 1117-1128.

41. Greene, W. C, and Peterlin, B. M. (2002) Nat Med 8, 673-680.

42. Van Maele, B., and Debyser, Z. (2005) AIDS Rev 7, 26-43.

43. Puras Lutzke, R. A., Eppens, N. A., Weber, P. A., Houghten, R. A., and Plasterk, R. H. (1995) Proc Natl Acad Sci U S A 92, 11456-11460.

44. Desjobert, C, de Soultrait, V. R., Faure, A., Parissi, V., Litvak, S., Tarrago-Litvak, L., and Fournier, M. (2004) Biochemistry 43, 13097-13105.

45. de Soultrait, V. R., Desjobert, C, and Tarrago-Litvak, L. (2003) Curr Med Chem 10, 1765-1778.

Claims

1. An isolated peptide of SEQ ID NO: 1 and mutants, derivatives or fragments thereof, or a combination thereof.

2. The peptide of claim 1 , comprising an isolated peptide of any of SEQ ID NOs. 6-8 or a combination thereof.

3. A pharmaceutical composition, comprising the isolated peptide of any one of claims 1 and 2 and a pharmaceutically acceptable carrier, diluent, or additive.

4. A method of inhibiting replication of HIV-I in a target cell, comprising administering to said target cell the isolated peptide of any one of claim 1 and claim 2, thereby inhibiting replication of HIV-I in a target cell.

5. A method for treating HIV-I infection in a subject in need thereof, comprising administering to said subject the isolated peptide of any one of claim 1 and claim 2, thereby treating HIV-I infection in a subject in need thereof.

6. A method for inhibiting an HIV-I integrase protein, comprising contacting said HIV-I integrase protein with the isolated peptide of any one of claim 1 and claim 2, thereby shifting the equilibrium of HIV-I integrase towards tetramer formation.

7. A method for inhibiting binding or processing of an HIV-I integrase protein, comprising contacting said HIV-I integrase protein with the isolated peptide of any one of claim 1 and claim 2, thereby inhibiting binding or processing of an HIV-I integrase protein.

8. The pharmaceutical composition of claim 3 for inhibiting replication of an HIV-I in a target cell.

9. The pharmaceutical composition of claim 3 for treating HIV-I infection in a subject in need thereof.

10. The pharmaceutical composition of claim 3 for inhibiting 3 ' -end processing of an HIV-I integrase protein.

11. The pharmaceutical composition of claim 3 for inhibiting binding of an HIV-I integrase protein to an HIV-I long terminal repeat DNA terminus.

12. Use of the isolated peptide of any one of claims 1 or 2 in the preparation in a pharmaceutical composition for inhibiting an HIV-I integrase protein, inhibiting replication of an HIV-I in a target cell, treating HIV-I infection in a subject in need thereof, or inhibiting binding or processing of an HIV-I integrase protein.

13. A method for identifying an HIV- 1 integrase inhibitory peptide comprising:

(a) providing a peptide library;

(b) isolating HIV-I integrase-binding peptides from said peptide library;

(c) selecting HIV-I integrase binding peptides of (b) capable of shifting the oligomerization equilibrium of HIV-I integrase towards formation of a tetramer, thereby identifying a peptide inhibitor of HIV-I integrase.

14. The method of claim 13, wherein the peptide library is a randomized peptide library.

15. An isolated peptide identified by the method of claim 13.

16. A pharmaceutical composition, comprising the isolated peptide of claim 15 and a pharmaceutically acceptable carrier, diluent, or additive.

17. A method of inhibiting replication of HIV-I in a target cell, comprising administering to said target cell the isolated peptide of claim 15, thereby inhibiting replication of HIV-I in a target cell.

18. A method for treating HIV-I infection in a subject in need thereof, comprising administering to said subject the isolated peptide of claim 15, thereby treating HIV-I infection in a subject in need thereof.

19. A method for inhibiting binding or processing of an HIV-I integrase protein, comprising contacting said HIV-I integrase protein with the isolated peptide of claim 15, thereby inhibiting binding or processing of an HIV-I integrase protein.

20. A method for inhibiting an HIV-I integrase protein, comprising contacting said HIV-I integrase protein with the isolated peptide of claim 15, thereby shifting the equilibrium of HIV-I integrase towards tetramer formation.

21. The pharmaceutical composition of claim 16 for inhibiting replication of an HIV-I in a target cell.

22. The pharmaceutical composition of claim 16 for treating HIV-I infection in a subject in need thereof.

23. The pharmaceutical composition of claim 16 for inhibiting 3 '-end processing of an HIV-I integrase protein. 6

24. The pharmaceutical composition of claim 16 for inhibiting binding of an HIV-I integrase protein to an HIV-I long terminal repeat DNA terminus.

25. Use of an isolated peptide of claim 15 in the preparation of a pharmaceutical composition for inhibiting an HIV-I integrase protein, inhibiting replication of an HIV-I in a target cell, treating HIV-I infection in a subject in need thereof, or inhibiting binding or processing by an HIV-I integrase protein.