WO2009062149A1

WO2009062149A1 - Methods for maintaining inner ear neurons

Info

Publication number: WO2009062149A1
Application number: PCT/US2008/082978
Authority: WO
Inventors: Bernd Fritzsch; Kirk Beisel
Original assignee: Creighton University
Priority date: 2007-11-08
Filing date: 2008-11-10
Publication date: 2009-05-14

Abstract

The invention generally relates to a composition of at least one first vector and at least one second vector, wherein the first vector comprises a nucleic acid sequence of a neurotrophic factor and the second vector comprises a recombinase. The invention further provides methods of maintaining inner ear neurons.

Description

METHODS FOR MAINTAINING INNER EAR NEURONS

GOVERNMENTAL RIGHTS

[0001] The present invention was made, at least in part, with support by the National Institute on Deafness and Other Communication Disorders grant number DC005590. Accordingly, the United States Government may have certain rights in the invention.

FIELD OF THE INVENTION

[0002] The invention generally relates to a composition of vectors and methods of maintaining inner ear neurons.

BACKGROUND OF THE INVENTION

[0003] The peripheral auditory system consists of auditory receptors, hair cells in the organ of Corti, and primary auditory neurons. Spiral ganglion neurons ("SGN") are primary afferent auditory neurons that deliver signals from the peripheral auditory receptors, the hair cells in the organ of Corti, to the brain through the cochlear nerve. The eighth nerve connects the primary auditory neurons in the spiral ganglia to the brain stem.

[0004] Hearing loss afflicts over ten percent of the population of the

United States. Damage to the peripheral auditory system is responsible for a majority of such hearing deficits. In particular, destruction of hair cells and of the primary afferent neurons in the spiral ganglia, which transduce auditory signals from the hair cells to the brain, have been implicated as major causes of hearing impairments. Such damage may be due to the inheritance of a gene that impairs the function of a critical biomolecule, age, noise-induced hearing loss, chemically induced hearing loss, or illness/infection.

[0005] Treatments for hearing loss have focused, in part, on repairing or regenerating hair cells, or utilizing cochlear implants. A cochlear implant is an electronic device that is implanted into the inner ear to restore auditory perception, at least partially. Cochlear implants create auditory sensation by generating electric field gradients in the area of the peripheral nerve fibers of the auditory nerve bundle.

[0006] Each of the above treatments, however, depends on the presence of functioning neurons. Loss of hair cells, however, and subsequent degeneration of the organ of Corti is followed by loss of nerve fibers. Consequently, there is a need in the art for a method for retaining nerve fibers to support cochlear implants or for re-connecting to regenerated hair cells after hair cell loss.

SUMMARY OF THE INVENTION

[0007] One aspect of the invention encompasses a composition comprising two vectors. The first vector comprises a nucleic acid sequence of a neurotrophic factor operably linked to a promoter. The second vector comprises a nucleic acid sequence of a recombinase.

[0008] Another aspect of the invention encompasses a method for maintaining inner ear neurons in a subject. The method comprises administering a composition comprising at least one first vector and at least one second vector to the subject. The first vector comprises a nucleic acid sequence of a neurotrophic factor operably linked to a promoter. The second vector comprises a nucleic acid sequence of a recombinase.

[0009] Yet another aspect of the invention encompasses a method for expressing a neurotrophic factor in a cell. The method comprises contacting a cell with a composition comprising at least one first vector and at least one second vector. The first vector comprises a nucleic acid sequence of a neurotrophic factor operably linked to a promoter. The second vector comprises a nucleic acid sequence of a recombinase.

[0010] Still another aspect of the invention encompasses a method for decreasing hearing loss in a subject. The method comprises administering a composition comprising at least one first vector and at least one second vector to the subject. The first vector comprises a nucleic acid sequence of a neurotrophic factor operably linked to a promoter. The second vector comprises a nucleic acid sequence of a recombinase.

[0011 ] Other aspects and iterations of the invention are described more thoroughly below.

REFERENCE TO COLOR FIGURES

[0012] The application file contains at least one photograph executed in color. Copies of this patent application publication with color photographs will be provided by the Office upon request and payment of the necessary fee.

BRIEF DESCRIPTION OF THE FIGURES

[0013] Figure 1 depicts a schematic representation of the two plasmids, pCMV-lnt and pCAG-panNTF. The plasmid backbone is depicted by the black circle. The two promoters are indicted in green and represents the cytomegalovirus immediate early promoter/ enhancer (pCMV) and the combined CMV enhancer/chicken β-actin promoter (CMVenh pCAG). The phage C31 integrase and panNFT are indicated by respectively by the blue and purple lines. The SV40 polyadenylation signal (SV40 PAS) is shown by the red line and the attB sequence by the gray line.

DETAILED DESCRIPTION OF THE INVENTION

[0014] The present invention provides vectors comprising a nucleic acid sequence of a neurotrophic factor and vectors comprising a serine recombinase. The invention further provides methods for maintaining neurons, the method comprising administering the vectors of the invention to a subject. Advantageously, the vectors and methods provided herein may be used to maintain the neuronal pathway necessary for hearing, even after hair cell loss. In some embodiments, the vectors and methods provided herein may be used to maintain the neuronal pathway necessary for hearing for an extended period of time. For instance, in some embodiments the neuronal pathway may be maintained for at least a week, at least a month, at least a year, or greater than a year.

I. Composition comprising at least one first vector and at least one second vector

[0015] The present invention provides a composition comprising at least one first vector and at least one second vector. The first vector comprises, in part, the nucleic acid sequence of a neurotrophic factor. The second vector comprises, in part, the nucleic acid sequence of a recombinase. The vectors are designed so that, generally speaking, when a cell is contacted with both vectors, the nucleic acid sequence of the neurotrophic factor will be integrated into the DNA of the cell, and the cell will subsequently express the neurotrophic factor. Advantageously, the cell will indefinitely (as opposed to transiently) express the neurotrophic factor.

[0016] The methods and techniques for preparing vectors are well known in the art. For instance, see Molecular Cloning: A Laboratory Manual, 3^rd edition, David W. Russell and Joe Sambrook (2001 ), Cold Spring Harbor Press. Each vector is described in more detail herein.

(a) First vector

[0017] The first vector, as detailed above, comprises in part the nucleic acid sequence of a neurotrophic factor. Generally speaking, the nucleic acid sequence of the neurotrophic factor is operably linked to a promoter. Additionally, the first vector may comprise a recombinase site. Typically, but not necessarily, the first vector will also comprise a polyadenylation signal. Suitable polyadenylation signals include the SV40 polyadenylation sequence. Usually, the polyadenylation signal is located 3' to the neurotrophic factor. /. neurotrophic factor

[0018] Generally speaking, neurotrophic factors are biomolecules that regulate the survival and differentiation of neurons during embryonic and postnatal development, and are also important for maintenance of synaptic connectivity and plasticity in the adult nervous system. Non-limiting examples of neurotrophic factors may include neurotrophins, glial cell-line derived neurotrophic factor family ligands (GFLs), and neuropoietic cytokines. In one embodiment, the neurotrophic factor may be a neurotrophin. Non-limiting examples of neurotrophins may include nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin-1 (NT-1 ), neurotrophin-3 (NT-3; NTF3), and neurotrophin-4 (NT-4). In one embodiment, the neurotrophin may be BDNF. In another embodiment, the neurotrophin may be NTF3. In yet another embodiment, the neurotrophin may be a pan-neurotrophin. As used herein, a pan-neurotrophin is a neurotrophin that binds to more than one neurotrophic factor receptor. For instance, a pan-neurotrophin may bind to both the Ntrk2 and Ntrk3 receptor. (See Urfer et al., (1994) Embo J. 13:5896.)

[0019] In some embodiments, the neurotrophic factor may be a

GFL. Non-limiting examples of GFLs may include glial cell line-derived neurotrophic factor (GDNF), neurturin (NRTN), artemin (ARTN) and persephin (PSPN). In other embodiments, the neurotrophic factor may be a neuropoietic cytokine. Non-limiting examples of neuropoietic cytokines may include ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), oncostatin M, cardiotrophin-1 , IL-6, and IL-11.

[0020] The nucleic acid sequences of the neurotrophic factors detailed above are well known in the art.

ii. first vector promoter

[0021 ] Generally speaking, the nucleic acid sequence of the neurotrophic factor is operably linked to a promoter. The term operably linked, as used herein, may mean that expression of a gene is under the control of a promoter with which it is spatially connected. A promoter may be positioned 5' (upstream) or 3' (downstream) of a gene under its control. The distance between the promoter and a gene may be approximately the same as the distance between that promoter and the gene it controls in the gene from which the promoter is derived. As is known in the art, variation in this distance may be accommodated without loss of promoter function.

[0022] The term promoter, as used herein, may mean a synthetic or naturally derived molecule that is capable of conferring, activating or enhancing expression of a nucleic acid in a cell. A promoter may comprise one or more specific transcriptional regulatory sequences to further enhance expression and/or to alter the spatial expression and/or temporal expression of the nucleic acid. A promoter may also comprise distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription. A promoter may be derived from several sources including viral, bacterial, fungal, plants, insects, and animals. A promoter may regulate the expression of a gene component constitutively, or differentially with respect to cell, the tissue or organ in which expression occurs or, with respect to the developmental stage at which expression occurs, or in response to external stimuli such as physiological stresses, pathogens, metal ions, or inducing agents (i.e. an inducible promoter). Non-limiting representative examples of promoters may include the bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac operator-promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, CMV IE promoter, SV40 early promoter or SV40 late promoter and the CMV IE promoter. Additionally, the promoter may be a CMV immediate early promoter/enhancer (pCMV) or the CMV enhancer/chicken β-actin promoter (pCAG).

[0023] Generally speaking, the promoter should be selected based on the strength of the promoter, the temporal control of the promoter, and the spatial control of the promoter. In some embodiments, the promoter is organ specific. In other embodiments, the promoter is tissue specific. In some embodiments, the promoter is cell specific. For instance, the promoter may be specific for supporting cells in the inner ear. Non-limiting examples of a supporting cell specific promoter are the PLP promoter and the Gfap promoter.

Hi. recombinase site

[0024] The vector may further comprise a recombinase site.

Generally speaking, a recombinase site is a nucleic acid sequence recognized by a recombinase, such as an integrase. One skilled in the art is aware that the selection of a recombinase site depends on the recombinase being used. Typically, a recombinase site may be recognized by a tyrosine recombinase (i.e. a recombinase that uses a tyrosine-mediated mechanism of recombination) or a serine recombinase (i.e. a recombinase that uses a sehne-mediated mechanism). Tyrosine recombinases are well known in the art, and include Cre and FLP. Serine recombinases are also well known in the art, and include phage integrases, such as the φC31 integrase. In one embodiment, the serine recombinase site is a site recognized by a φC31 integrase. For instance, the site may be an attB, attP, attL, or attR site. The nucleic acid sequence of an attB, attP, attL or attR site is known in the art.

(b) second vector

[0025] The second vector, as detailed above, comprises in part a nucleic acid sequence of a recombinase. The recombinase may be operably linked to a promoter. Typically, but not necessarily, the first vector will also comprise a polyadenylation signal. Suitable polyadenylation signals include the SV40 polyadenylation sequence. Usually, the polyadenylation signal is located 3' to the recombinase.

/. recombinase

[0026] Generally speaking, a recombinase may be a tyrosine recombinase (i.e. a recombinase that uses a tyrosine-mediated mechanism of recombination) or a serine recombinase (i.e. a recombinase that uses a serine- mediated mechanism). Tyrosine recombinases are well known in the art, and include Cre and FLP. Serine recombinases are also well known in the art, and include phage integrases, such as the φC31 integrase. In one embodiment, the recombinase is a φC31 integrase. For instance, the site may be an attB site. Nucleic acid sequences encoding a φC31 integrase are known in the art.

ii. second vector promoter

[0027] Generally speaking, the nucleic acid of the recombinase is operably linked to a promoter. The terms promoter and operably linked are defined above. Non-limiting representative examples of promoters may include the bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac operator-promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, CMV IE promoter, SV40 early promoter or SV40 late promoter and the CMV IE promoter. Additionally, the promoter may be a CMV immediate early promoter/enhancer (pCMV) or the CMV enhancer/chicken β- actin promoter (pCAG).

[0028] Generally speaking, the promoter should be selected based on the strength of the promoter, the temporal control of the promoter, and the spatial control of the promoter. In some embodiments, the promoter is organ specific. In other embodiments, the promoter is tissue specific. In some embodiments, the promoter is cell specific. For instance, the promoter may be specific for supporting cells in the inner ear. Non-limiting examples of a supporting cell specific promoter are the PLP promoter and the Gfap promoter.

(c) composition

[0029] The composition of the invention comprises at least one first vector and at least one second vector. The ratio of first vector to second vector may be determined by the use of the composition, for instance, the cell type contacted with the composition, the recombinase used, and the neurotrophic factor used. In some embodiments, the ratio of first vector to second vector maybe 1 :1 , 1 :2, 1 :3, 1 :4, 1 :5, 5:1 , 4:1 , 3:1 , or 2:1.

II. Cell comprising a first vector and a second vector

[0030] Another aspect of the invention encompasses a cell comprising at least one first vector and at least one second vector. Usually, within such a cell, the recombinase of the second vector is expressed. The recombinase recognizes the recombinase site of the first vector and a recombinase site within the DNA of the cell, and consequently integrates the neurotrophic factor into the DNA of the cell. In some embodiments, the integration event alters the recombination sites such that the integration event is non-reversible.

[0031 ] The recombinase site within the DNA of the cell will typically correlate to the recombinase site of the first vector. Stated another way, the same recombinase will generally recognize the recombinase site of the first vector and the recombinase site within the DNA of the cell. For instance, if the recombinase site of the first vector is a LoxP site, then the recombinase site within the DNA of the cell will be a LoxP site. Similarly, if the recombinase site of the first vector is an attB site, the recombinase site within the DNA of the cell will be an attP or a pseudo-attP site. In some embodiments, the cell is engineered to comprise a recombination site within the DNA of the cell. Methods of engineering a cell to comprise a recombination site are well known in the art. In other embodiments, the cell naturally comprises recombination sites (i.e. no engineering is required for the cell to comprise the recombination site within the DNA of the cell).

[0032] Suitable cells include cells from an organism that expresses neurotrophic factors. Non-limiting examples include cells from laboratory animals and experimental models, non-human primates, and humans. For instance, non- limiting examples of laboratory animals and/or experimental models include rodents, such as mice, rats, and guinea pigs, dogs, Drosophila, and Caenorhabditis elegans.

[0033] Methods to make a cell comprising at least one first vector and at least one second vector are well known in the art. Such methods may include transfection or transformation techniques such as electroporation, heat shock, calcium phosphate, magnetofection, dendrimers, lipofection, lipid-cation based transfection, transfection via gene gun, and transfection using viral-based vectors. Additionally, commercially available transfection reagents may be used, such as Lipofectamine, Fugene, jetPEI, or DreamFect. Suitable viral vectors may include retroviruses, adenovirus based vectors, herpesvirus based vectors, adeno-asssociated viruses, vaccinia virus, foamyvirus, lentivirus, and poxvirus vectors. Such methods may be applied to cells in vitro, ex vivo, in vivo, or in situ.

[0034] In one embodiment, the cell is contacted with the composition using lipofection. In another embodiment, the cell is contacted with the composition using liposomes. In yet another embodiment, the cell is contacted with a composition comprising at least one first vector, at least one second vector, N-[1 -(2,3-Dioleoloxy)propyl]N,N,N-trimethylammonium methylsulfate (DOTAP), and cholesterol.

III. Methods of expressing a neurotrophic factor

[0035] Yet another aspect of the invention is a method for expressing a neurotrophic factor. In some embodiments, the neurotrophic factor is expressed in vitro, ex vivo, in vivo, or in situ. In other embodiments, the neurotrophic factor is expressed in vivo or in situ in a cell of the inner ear. For instance, the neurotrophic factor may be expressed in supporting or non-sensory cells of the inner ear. Alternatively, the neurotrophic factor may be expressed in hair cells of the inner ear. In other embodiments, the neurotrophic factor may be expressed in cells lining the scala.

[0036] The method for expressing a neurotrophic factor typically comprises contacting a cell with a composition comprising at least one first vector and at least one second vector of the invention described above. Generally speaking, after contacting the cell with the composition, the cell comprises at least one first vector and at least one second vector. Usually, within such a cell, the recombinase of the second vector is expressed. The recombinase recognizes the recombinase site of the first vector and a recombinase site within the DNA of the cell, and consequently integrates the neurotrophic factor into the DNA of the cell. In some embodiments, the integration event alters the recombination sites such that the integration event is non-reversible. Generally, the integrated nucleic acid sequence of the neurotrophic factor is transcribed and translated such that the neurotrophic factor is expressed as a protein by the cell.

[0037] Methods of contacting the cell with the composition are known in the art. Such methods may include transfection or transformation techniques such as electroporation, heat shock, calcium phosphate, magnetofection, dendrimers, lipofection, lipid-cation based transfection, transfection via gene gun, and transfection using viral-based vectors. Additionally, commercially available transfection reagents may be used, such as Lipofectamine, Fugene, jetPEI, or DreamFect. Suitable viral vectors may include retroviruses, adenovirus based vectors, herpesvirus based vectors, adeno- asssociated viruses, vaccinia virus, foamyvirus, lentivirus, and poxvirus vectors. In one embodiment, the cell is contacted with the composition using lipofection. In another embodiment, the cell is contacted with the composition using liposomes. In yet another embodiment, the cell is contacted with a composition comprising at least one first vector, at least one second vector, N-[1 -(2,3- Dioleoloxy)propyl]N,N,N-trimethylammonium methylsulfate (DOTAP), and cholesterol.

[0038] In one embodiment, the neurotrophic factor expressed by the cell is a neurotrophin. Non-limiting examples of neurotrophins include BDNF, a modified BDNF, NTF3 and a modified NTF3. In another embodiment, the neurotrophin is a pan-neurotrophin. In an exemplary embodiment, the cell is contacted with the composition comprising the first vector and the second vector and the first vector comprises a pan-neurotrophin.

[0039] In an exemplary embodiment, the cell is contacted using lipofection with a composition comprising at least one first vector comprising a nucleic acid sequence of a pan-neurotrophin and at least one second vector.

IV. Methods of maintaining inner ear neurons

[0040] Still another aspect of the invention is a method for maintaining inner ear neurons in a subject. The method comprises administering a composition comprising at least one first vector and at least one second vector to the subject. Generally, the administered composition will contact at least one cell of the subject. Usually, within such a cell, the recombinase of the second vector is expressed. The recombinase recognizes the recombinase site of the first vector and a recombinase site within the DNA of the cell, and consequently integrates the neurotrophic factor into the DNA of the cell. In some embodiments, the integration event alters the recombination sites such that the integration event is non-reversible. Generally, the integrated nucleic acid sequence of the neurotrophic factor is transcribed and translated such that the neurotrophic factor is expressed as a protein by the cell. The expressed neurotrophic factor may then bind to a neurotrophic receptor of an inner ear neuron, thereby maintaining the neuron. In this context, maintaining refers to the neuron not dying, and the neuron retaining its processes.

[0041 ] In one embodiment, the first vector of the composition comprises a neurotrophin. Non-limiting examples of neurotrophins include BDNF, a modified BDNF, NTF3 and a modified NTF3. In another embodiment, the neurotrophin is a pan-neurotrophin.

[0042] Methods of administering the composition to a subject are known in the art. Injectable preparations of the composition, for example, sterile injectable aqueous or oleaginous suspensions, may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a nontoxic parenterally or intrathecal^ acceptable diluent or solvent. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed, including synthetic mono- or diglycehdes. In addition, fatty acids such as oleic acid are useful in the preparation of injectables. Dimethyl acetamide, surfactants including ionic and non-ionic detergents, and polyethylene glycols can be used. Mixtures of solvents and wetting agents such as those discussed above are also useful.

[0043] For therapeutic purposes, formulations for administration of the composition may be in the form of aqueous or non-aqueous isotonic sterile injection solutions or suspensions. The composition may be comprise water, polyethylene glycol, propylene glycol, ethanol, corn oil, cottonseed oil, peanut oil, sesame oil, benzyl alcohol, sodium chloride, and/or various buffers. Other adjuvants and modes of administration are well and widely known in the pharmaceutical art.

[0044] Methods of administration may also include infusion with an osmotic minipump, direct microinjection into the cochlea, and application of the composition to the round window membrane. In an exemplary embodiment, the composition is applied to the round window membrane. In some embodiments, the composition may be applied to the round window membrane using vector soaked Gelfoam. In other embodiments, the composition maybe applied using liposomes. In one embodiment, the composition is applied to the round window membrane using liposomes according to the technique described in Maeda et al. (2007) 58(3):250. In some embodiments, the composition applied to the round window membrane comprises at least one first vector, at least one second vector, N-[1 -(2,3-Dioleoloxy)propyl]N,N,N-trimethylammonium methylsulfate (DOTAP), and cholesterol. [0045] The amount of the composition that may be combined with the carrier materials to produce a single dosage of the composition can and will vary depending upon the subject and the particular mode of administration. For instance, the total volume, when administered via the round window membrane, depends in part on the size of the round window in the subject. The size of the round window of a subject may be determined using techniques known in the art. For mice, the diameter of the round window is approximately 250 μm. In humans, the diameter of the round window is approximately 1 mm. Therefore, the volume administered to a human may be between about 4 and about 5 times the volume administered to a mouse. Generally speaking, the dosage may be between about 0.1 μg/mm to about 4 μg/mm. In some embodiments, the dosage may be about 0.1 μg/mm, 0.5 μg/mm, 1.0 μg/mm, 1.5 μg/mm, 2.0 μg/mm, 2.5 μg/mm, 3.0 μg/mm, 3.5 μg/mm, or 4.0 μg/mm.

[0046] In some embodiments, the ratio of liposome and recombinant plasmid in liposome-DNA complex may have the ratio of about 1 :1 , about 1 :2, about 1 :3, about 1 :4, about 1 :5, about 1 :6, about 1 :7, about 1 :8 or greater than about 1 :8.

[0047] In some embodiments of the method, the composition is administered before substantial hair cell loss or destruction in at least one organ of Corti in a subject. In this context, substantial means at least 60%, at least 70%, at least 80% or at least 90% loss of or destruction of hair cells in at least one organ of Corti. In other embodiments, the composition is administered during hair cell loss. In still other embodiments, the composition is administered after substantial hair cell loss. In further embodiments, the composition may be administered before, during, or after a cochlear implant is inserted. Methods of inserting a cochlear implant are known in the art.

[0048] Suitable subjects include subjects that comprise an organ of

Corti. For instance, non-limiting examples include laboratory animals, non-human primates, and humans. Non-limiting examples of laboratory animals and/or experimental models include rodents, such as mice, rats, and guinea pigs, dogs. V. Methods of decreasing hearing loss

[0049] A further aspect of the invention encompasses a method for decreasing hearing loss. The method typically comprises administering a composition comprising at least one first vector and at least one second vector to a subject. Methods of administering the composition are described above. Generally, the administered composition will contact at least one cell of the subject. Usually, within such a cell, the recombinase of the second vector is expressed. The recombinase recognizes the recombinase site of the first vector and a recombinase site within the DNA of the cell, and consequently integrates the neurotrophic factor into the DNA of the cell. In some embodiments, the integration event alters the recombination sites such that the integration event is non-reversible. Generally, the integrated nucleic acid sequence of the neurotrophic factor is transcribed and translated such that the neurotrophic factor is expressed as a protein by the cell. The expressed neurotrophic factor may then bind to a neurotrophic receptor of an inner ear neuron, thereby maintaining the neuron. In this context, maintaining refers to the neuron not dying and retaining its processes. Typically, maintaining inner ear neurons, in turn, decreases the hearing loss associated with inner ear neuron death. For instance, maintaining inner ear neurons may improve the hearing performance of a subject using a cochlear implant.

[0050] The decreased hearing loss may be congenital, or it may be acquired. The hearing loss may have been caused by loud noise, aging, infections, and ototoxic chemicals, among which are aminoglycoside antibiotics and platinum-containing antineoplastic agents such as cisplatin.

[0051] In some embodiments, the composition is administered before substantial hair cell loss or destruction in at least one organ of Corti in a subject. In this context, substantial means at least 60%, at least 70%, at least 80% or at least 90% loss of or destruction of hair cells in at least one organ of Corti. In other embodiments, the composition is administered during hair cell loss. In still other embodiments, the composition is administered after substantial hair cell loss. In further embodiments, the composition may be administered before, during, or after a cochlear implant is inserted. Methods of inserting a cochlear implant are known in the art.

[0052] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the practice of the invention. Those of skill in the art should, however, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention, therefore all matter set forth or shown in the accompanying drawings is to be interpreted as illustrative and not in a limiting sense.

EXAMPLES

[0053] The following examples illustrate various iterations of the invention.

Example 1 : Characterization of integration capacity of modified integrases.

[0054] Earlier work has demonstrated that random integration of a transgene into the mammalian genome will lead to tumohgenesis. The use of the site-specific recombinases (SSRs) is proposed to circumvent disruption of tumor- suppressor genes or other functional genes (Groth et al., 2000; Chalberg et al., 2006). The Streptomyces phage ΦC31 integrase (Int) mediates DNA recombination at binding sequences of an established attB and pseudo-attP sites within mammalian genomic DNA to permit permanent integration of a transgene (Groth and Calos, 2004; Calos, 2006). Two constructs have been produced (Figure 2). The integrase gene was amplified from DNA of the Streptomyces bacteriophage ΦC31 , obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany), using the 5' forward (5'GTGGACACGTACGCGGGTGCT 3')(SEQ ID NO:1 ) primer and the 3' reverse (5'GGCTTCCGGGTGTCTCGCTAC 3') (SEQ ID NO:2) ΦC31 lnt primer set. The amplified products were cloned into the pCRII-TOPO vector (Invitrogen, Carlsbad, CA). These clones were sequenced to verify that no Taq polymerase errors had altered the sequence. The lnt gene was subcloned into the pCMV- Script mammalian expression vector (Agilent Technologies Co. La JoIIa, CA) using a BamHI and EcoRV fragment (see Figure 2A). For the second plasmid (Figure 2B), we have use a single neurotrophin, panNTF, genetically altered to interact with both NTRK2 and NTRK3 receptors (Urfer et al., 1994).

Example 2: Construction of expression vectors

[0055] The efficiency of ΦC31 integrase in mammalian cells was found to be enhanced with the addition of a mammalian Kozak site [(A/G)N(C/G)ATG(A/G)] for protein initiation in mammals, incorporation of an N- or C-termini Nuclear Localization Signal (NLS) (Andreas et al., 2002), codon- optimized SSR (Int-o) (Raymond and Soriano, 2007) or mutated high-efficiency Int-G81 R integrase (HoIMs et al., 2003). The modified pCMV-lnt clones (Kozak, C-termini NLS, Int-o and Int-G81 R), as well as the attB target clones, have already been constructed.

[0056] Production of the attB-containing mini-circles: The genetically altered Ntf3-mut26 plasmid (pRcCMV-Ntf3-mut26) has a unique Xho\ site that will be blunted and an EcoR\ linker inserted. A blunt-end-EcoRI panNTF fragment will be obtained by digesting with Sma\ and EcoR\. We have found that using a "blunt-sticky" fragment facilitates the ligation, ensures correct 5'-3' orientation, and essentially eliminates non-recombinant clones. This fragment will be inserted into the pDRIVE-CAG vector (InvivoGen, San Diego, CA), which was prepared by blunt-ending the Λ/col site using T4 polymerase and followed by EcoR\ digestion. This pDRIVE-CAG-panNTF vector will then be modified by the addition of the attR sequence

(AGTAGTGCCCCAACTGGGGTAACCTTTGGGCTCCCCGGGCGCGTACTCC)( SEQ ID NO:3) in the unique Sbf\ site just 5' to the composite CMV enhancer/chicken b-actin promoter (pCAG) and the addition of the attL sequence (CCGCGGTGCCAGGGCGTGCCCTTGAGTTCTCTCAGTTGGGGGCGCGTA) (SEQ ID NO:4) in the unique Swa\ site 3' to the SV40 PAS. In order to eliminate any effects of the plasmid bacterial DNA backbone, a minicircle DNA approach will be used (Chen et al., 2005). A minicircle will be prepared (Chen et al., 2005) by combining the modified pDRIVE-CAG-panNTF plasmid with an arbabinose- inducible pBAD-18Kan plasmid system. This system has an excisionase- integrase that causes an unidirectional recombination of the attL and attR to create the pCAG-panNTF attB and plasmid backbone attP mini-circles. An alterative approach would be to use the bi-directional form of lnt containing the E449K mutation (Rowley et al., 2008). The pCAG-panNTF minicircle vector will be purified from the /Asel linearized pDRIVE using ATP-dependent exonuclease digestion (Qiagen, Valencia, CA). The resulting pCAG-panNTF vector will have an attB site (CCGCGGTGCGGGTGCCAGGGC

GTGCCCTTGGGCTCCCCGGGCGCGTACTCC) (SEQ ID NO:5) required for integration into the mammalian genome by the ΦC31 integrase (Calos, 2006). Both systems have been constructed. If any problems occur, as an alternative, the attB site from Streptomyces lividans genomic DNA (DSMZ, Braunschweig, Germany, obtained by PCR amplification using (5'GTCGACGATGTAGGTCACGGTC 3') (SEQ ID NO:6) forward and (5'GTCGACATGCCCGCCGTGACCG 3') (SEQ ID NO:7) reverse primers may be directly ligated into the Swa\ and SbΑ sites.

Example 3: Measure the efficiency of modified ΦC31 lnt in site-specific integration

[0057] We will examine the rate of transgene integration by measuring the copy number of transgene per mg genomic DNA and also determine the relative usage of known pseudo-attP sites. Our mammalian intergration PCR assay will be examined in HEK293 cells transfected using MegaFectin™ (Obiogene, Inc., Irvine, CA). Cell cultures that have reached 70- 80% confluence in a 60-mnn diameter dish will be transfected with a mixture of 100 ng of minicircle containing the attB and 5 mg of the plasmid pCMV-lnt containing wild type or modified lnt clones. The pDRIVE-CAG will be used to determine the efficiency of transfection based on molar concentrations of plasmid used. We will follow the protocol of Sclimenti et al., (2001 ) to determine the efficiency of site-specific integration per ug of genomic DNA. QPCR analysis of the rate of integration bases on the amount of attL and attR sites will be determined. We have selected a number of pseudo-attP sites identified in the human genome (Chalberg et al., 2006) and these represent intergenic (3q26.31 ; 10q21.2; 17q25.1 -2, Xq22.1 ), intronic (1 p32.3; 2q11.2; 8p22), and the GLI3 exonic (7p14.1 ) chromosomal sites. A QPCR assay will determine the relative integration frequency of each site compared with the total site-specific integration. These analyses will establish if a site-specific integration is occurring for each of the designed lnt and whether or not hot spots of integration are preferentially utilized. Our selected panel of pseudo-attP sites does not include those sites associated with repetitive DNA elements, such as ERVL (Endogenous Retrovirus Line), LINE1 -A and LINE1 -B elements. These experiments will identify the appropriate ΦC31 lnt to use in a gene therapeutic approach that produces a consistent site-specific integration into genomic DNA.

Example 4: Integration of pDRIVE-attB in FVB mice

[0058] The plasmid vectors pCMV-lnt or a modified form and pDRIVE-attB minicircle in lipocomplex solution will be complexed with "in vivo MegaFectin™" [4 mM N-[1 -(2,3-Dioleoloxy)propyl]N,N,N-trimethylammonium methylsulfate (DOTAP): cholesterol cationic liposome] (Obiogene, Inc., Irvine, CA ) (Templeton et al., 1997). Different ratios of pCMV-lnt (selected based on results from experiments above) and pDRIVE-attB minicircle will be used in a concentration of 0.25-0.50 μg/ml of total plasmid DNA and tested to determine the efficiency and extent of integration of the lacZ reporter within the pDRIVE- attB minicircle DNA. Three different DOTAP-based liposome formulations will be used for transfection using FluoroFectin™ (Qbiogene, Inc., Irvine, CA). Fluorescence intensity will be used to quantify the incorporation of liposomes. QPCR of genomic DNA will be used to evaluate the number of copies of pDRIVE-attB integrated into the genome. Finally the levels of integrase and LacZ transcripts will be assessed using QPCR and in situ hybridization.

[0059] We will follow the procedure of Maeda et al., (2007) for the surgical approach to the round window membrane (RWM). In our initial set of experiments, we will determine the best formulation of DOTAP:cholesterol for liposome transfer into the scala tympani and transfection of the cells lining the scala. The extent and quantity of transfection along the longitudinal axis of the cochlea will be determined. These experiments will use normal FVB adult mice at -5-6 weeks of age. We will examine the cochleae of 3-5 animals with pCMV- Int/pDRIVE-attB at 1 , 2, 4 and 8 weeks post liposome administration for integrase and LacZ expression. This should permit us to determine the extent and quality of the site-specific integration and duration of LacZ expression.

Example 5: Integration of pCAG-panNTF in FVB mice

[0060] Using the optimal experimental design defined by the above example, the efficiency and extent of integration will be examined, as well as the production of panNTF in vivo. These experiments will use normal FVB adult mice at -5-6 weeks of age. The cochleae of 3-5 animals with pCMV-lnt/pCAG- panNTF minicircle at 1 , 2, 4 and 8 weeks post liposome administration will be examined for panNTF and integrase expression using QPCR, in situ hybridization and immunohistochemistry for panNTF expression.

Example 6: Effects of panNTF on neurite retention in Pou4f3ddl/ddl mice

[0061 ] Six week old Pou4f3ddl/ddl and Pou4f3ddl/+ will be treated with the liposomes containing pCMV-lnt/pCAG-panNTF minicircle to determine the extent and quantity of transfection along the longitudinal axis of the cochlea in the presence or absence of HCs. The cochleae of at least 3 animals will be examined at 1 , 2, 4 and 8 weeks post liposome administration for innervation. Both qualitative and quantitative assessment of panNTF, endogenous Ntf2 and Ntf3, integrase, LacZ and organ of Corti innervation will be done. Comparisons will be done to evaluate innervation of cells surrounding the scala tympani.

Example 7: Models of Hearing Loss

[0062] The above vector system will also be tested in environtmental and age-related hearing models. For instance, aminoglycoside-, cisplatin-, and noise-induced hearing loss will also be examined to determine the extent of applicability to environmental based hearing loss. In addition, models of age-related hearing loss will be studied.

Materials and methods for examples 1-7

[0063] Expression analyses: HEK293 cells and mouse cochleae will be examined for changes in the panNTF transcripts in cochlear apical, mid and basal tissue. RT-PCR will be used to qualitatively determine the absence or presence of panNTF, Ntf2 and Ntf3 transcripts and quantitative RT-PCR (QPCR) will be done to determine the levels of transcripts, in particular human panNTF. ImHChem and protein analyses will be implemented to confirm the ISH data and provide semi-quantitative data on the levels of protein expression (Judice et al., 2002; Beisel et al., 2005). Qualitative and quantative assessment of the neurotrophins will be done by RT-PCR and QPCR (Beisel et al., 2005).

[0064] Fixation and treatment of tissue will be similar to wmlSH with some modification. LacZ and NTF positive cells will be counted at approximately 4Ox primary magnification (NA 1.3) and the total number of cells and areas of the sensory epithelia will be measured using ImagePro software in FVB and mutant mice in whole mounted sensory epithelia. Counting of selected areas will be done by importing pre-selected images according to the specifications of existing unbiased counting software (Microbrightfield). Total numbers will be estimated using the area measurements and unbiased counting procedures. At least 6 ears will be quantified and the mean of various mutant, wildtype and heterozygous mice will be compared using statistical software. All data generated will be morphomethcally analyzed using the available ImagPro (Media Cybernetics) software (see below). Captured images of the fluorescent labeled structures will be stored on a 1 Terabyte hard drive and subsequently written on DVDs (4 GB each) using the four available DVD burners.

[0065] Histological and morphometry analyses: Mice will be examined for morphological changes in the cochleae (Spicer et al., 2003; Ohlemiller and Gagnon, 2004). In order to document the qualitative and quantitative changes in the cochlea, morphomethcal analyses will be done. Supporting cells, inner ear afferent neurons and innervating nerve fibers will be quantified. 200 μm stretches of the apical, middle and basal turns and basal hook regions will be compared for both mutants and normal heterozygous littermates. The images will be captured using confocal microscopy (Zeiss LSM 510 META NLO system). The statistical significance of these quantitative histological and morphological alterations in SGN number and density of OC innervation in each mouse will be done using ANOVA. The optical dissector technique will be used on the 200 μm stretches of the cochlea supporting cells and SGNs (Fritzsch et al., 1997). The mean and standard errors will be calculated for the quantitative data out of at least 6 ears and student's t-tests will be used to test for significance among the various genotypes and age groups. A power analysis will be done to calculate if 6 ears can provide sufficient significance. If indicated, we will increase sample size accordingly.

[0066] Nerve fiber counts will be made in the osseous spiral lamina near the habenula perforata in tangential sections through the basal tip, middle and apical tip (Postigo et al., 2002). In each selected section, several fascicles of the peripheral axons of auditory nerve fibers will be cut in cross section. An observer (blind to the genotype of the animals) will count all neuronal profiles in all fascicles in each section. The number of nerve fibers will then be divided by the spiral extent (in millimeters) of osseous spiral lamina included in that section to arrive at an estimate of the number of myelinated nerve fibers per mm of OC. For the final plots, all nerve fiber densities will be normalized by place-matched data from control ears and expressed as a fractional loss.

[0067] Statistical evaluation: Tests for normal distribution will be conducted and the total numbers will be compared with FVB, wildtype and mutant littermate ears using parametric tests (T-test for two way comparison, ANOVA for three way comparison; in case normal distribution cannot be established, a less powerful non-parametric ranking test will be used).

Claims

CLAIMSWhat is claimed is:

1. A composition comprising two vectors, wherein the first vector comprises a nucleic acid sequence of a neurotrophic factor operably linked to promoter; and the second vector comprises a nucleic acid sequence of a recombinase.

2. The composition of claim 1 , wherein the promoter of the first vector is an inner ear specific promoter.

3. The composition of claim 2, wherein the inner ear specific promoter is specific for supporting cells.

4. The composition of claim 2, wherein the inner ear specific promoter is specific for non-sensory cells.

5. The composition of claim 1 , wherein the neurotrophic factor is a neurotrophin.

6. The composition of claim 5, wherein the neurotrophin is selected from the group comprising BDNF, a modified BDNF, NTF3, and a modified NTF3.

7. The composition of claim 5, wherein the neurotrophin is a pan- neurotrophin.

8. The composition of claim 1 , wherein the recombinase in a serine recombinase.

9. The composition of claim 8, wherein the serine recombinase is a phage integrase.

10. The composition of claim 9, wherein the phage integrase is a φC31 integrase.

11. A method for maintaining inner ear neurons in a subject, the method comprising administering the composition of claim 1 to the subject.

12. The method of claim 11 , wherein the composition is administered before substantial hair cell loss in the subject.

13. The method of claim 11 , wherein the composition is administered during hair cell loss in the subject.

14. The method of claim 11 , wherein the composition is administered after substantial hair cell loss in the subject.

15. The method of claim 11 , further comprising inserting a cochlear implant in the subject.

16. The method of claim 11 , wherein the composition is administered by application to the round window membrane.

17. A method for expressing a neurotrophic factor in a cell, the method comprising contacting a cell with the composition of claim 1.

18. The method of claim 17, wherein the neurotrophic factor is a neurotrophin.

19. The method of claim 18, wherein the neurotrophin is selected from the group comprising BDNF, a modified BDNF, NTF3, and a modified NTF3.

20. The method of claim 18, wherein the neurotrophin is a pan- neurotrophin.

21. A method for decreasing hearing loss in a subject, the method comprising administering a composition of claim 1 to the subject.

22. The method of claim 21 , wherein the hearing loss is congenital.

23. The method of claim 21 , wherein the hearing loss is acquired.

24. The method of claim 21 , wherein the composition is administered before substantial hair cell loss in the subject.

25. The method of claim 21 , wherein the composition is administered during hair cell loss in the subject.

26. The method of claim 21 , wherein the composition is administered after substantial hair cell loss in the subject.

27. The method of claim 21 , further comprising inserting a cochlear implant in the subject.

28. The method of claim 21 , wherein the composition is administered by application to the round window membrane.