WO2009049007A2 - Compositions, methods and systems for rapid identification of pathogenic nucleic acids - Google Patents

Abstract

Assays, methods, kits and the like are disclosed to detect the presence and type of pathogen present in a sample. In certain examples, the assays may use a universal probe effective to hybridize to a conserved region of a nucleic acid template in the sample, and a species specific probe effective to hybridize to a non-conserved region of a nucleic acid template in the sample. Methods using the assay and kits using the probes are also described.

Description

COMPOSITIONS, METHODS AND SYSTEMS FOR RAPID IDENTIFICATION OF PATHOGENIC NUCLEIC ACIDS

PRIORITY APPLICATION

[0001] This application claims priority to U.S. Provisional Application No. 60/979,030 filed on October 10, 2007, the entire disclosure of which is hereby incorporated herein by reference.

FIELD OF THE TECHNOLOGY

[0002] Certain examples disclosed herein relate generally to methods and systems for detecting the presence and type of pathogen in a sample.

BACKGROUND

[0003] Detection of the exact species of pathogen in a sample is cumbersome and may take several days using conventional methods due to the slow growth of the pathogens in cell culture. Also, detection of antibiotic resistance bacteria takes several days, thus delaying the time upon which proper treatment may be prescribed.

SUMMARY

[0004] Certain aspects and examples disclosed herein are directed to compositions, methods and systems that may be used to detect the type and species of pathogen in a sample. [0005] In a first aspect, a method comprising exposing a sample comprising a nucleic acid template to a species specific probe and a universal probe, each of the species specific probe and the universal probe comprising a unique electrophoretic tag, amplifying the nucleic acid template to cleave an electrophoretic tag from one or both of the universal probe or the species specific probe that is hybridized to the nucleic acid template, and detecting at least one cleaved electrophoretic tag from the species specific probe or the universal probe to determine the presence and/or type of pathogen in the sample is provided. [0006] In certain examples, the method may further comprise configuring the universal probe with a nucleic acid sequence specific for a type of pathogen. In other examples, the type of pathogen may be a bacterium, virus or fungus. In some examples, the universal probe may comprise a nucleic acid sequence that is effective to hybridize to a 5S, 16S or 23S rRNA gene in the nucleic acid template. In certain examples, the species specific probe may be configured to detect the presence of one or more bacteria selected from the group consisting of Staphylococcus aureus, Ricksettia rickettsii, Klebsiella pneumoniae, Haemophilus influenzae, Legionella pneumophila, Neisseria meningitidis, Escherichia coli, Staphylococcus epidermidis, Enterococcus faecalis, Streptococcus pneumoniae, Staphylococcus hominis, Borrelia burgdorferi, Bacillus anthracis, Yersinia pestis, Proteus mirabilis and Streptococcus pneumoniae. In some examples, the electrophoretic tag of the universal probe and the species specific probe may be selected to have different electrophoretic mobilities. In other examples, the amplifying step may comprise exposing the nucleic acid template to one or more primers and one or more polymerases. In additional examples, the detecting step may comprise separating cleaved electrophoretic tags in the sample. In some examples, the detecting step may further comprise determining a ratio of cleaved electrophoretic tag from the species specific probe to cleaved electrophoretic tag from the universal probe. In some examples, the separating of the cleaved electrophoretic tags may be performed by capillary electrophoresis.

[0007] In another aspect, a method comprising exposing a sample comprising a nucleic acid template to a universal probe and a plurality of species specific probes, each of the universal probe and the plurality of species specific probes comprising a unique electrophoretic tag, amplifying the nucleic acid template to cleave an electrophoretic tag from one or more of the universal probe or the plurality of species specific probes that are hybridized to the nucleic acid template, and detecting at least one cleaved electrophoretic tag from the plurality of species specific probe or the universal probe to determine the presence and/or type of pathogen in the sample is provided.

[0008] In certain examples, the method may further comprise configuring the universal probe with a nucleic acid sequence specific for a type of pathogen. In other examples, the type of pathogen may be a bacterium, virus or fungus. In additional examples, the universal probe may comprise a nucleic acid sequence that is effective to hybridize to a 5S, 16S or 23S rRNA gene in the nucleic acid template. In some examples, the method may further comprise configuring the species specific probes to detect the presence of one or more bacteria selected from the group consisting of Staphylococcus aureus, Ricksettia rickettsii, Klebsiella pneumoniae, Haemophilus influenzae, Legionella pneumophila, Neisseria meningitidis, Escherichia coli, Staphylococcus epidermidis, Enterococcus faecalis, Streptococcus pneumoniae, Staphylococcus hominis, Borrelia burgdorferi, Bacillus anthracis, Yersinia pestis, Proteus mirabilis and Streptococcus pneumoniae, wherein the plurality of species specific probes are each configured to detect different bacterial species. In certain examples, the electrophoretic tag of the universal probe and each of the plurality of species specific probes may be selected to have different electrophoretic mobilities. In some examples, the amplifying step comprising exposing the nucleic acid template to one or more primers and one or more polymerases. In other examples, the detecting step may comprise separating cleaved electrophoretic tags in the sample. In certain examples, the detecting step may further comprise determining a ratio of cleaved electrophoretic tag from at least one of the plurality of species specific probes to cleaved electrophoretic tag from the universal probe. In some examples, the separating of the cleaved electrophoretic tags may be performed by capillary electrophoresis.

[0009] In an additional aspect, a kit comprising a universal probe effective to hybridize to a nucleic acid template from a pathogen to identify the type and/or presence of a pathogen in a sample, the universal probe comprising a nucleic acid sequence coupled to a first electrophoretic tag, a species specific probe effective to hybridize to identify the species of pathogen present in the sample, the species specific probe comprising a nucleic acid sequence coupled to a second electrophoretic tag, and instructions for using the universal probe and the species specific probe is disclosed.

[0010] In certain examples, the universal probe may be effective to bind to a 5S, 16S or 23S rRNA gene in the pathogen. In other examples, the universal probe may be effective to hybridize to a conserved region of a bacterial DNA. In some examples, the species specific probe may be effective to hybridize to a non-conserved region of a bacterial DNA. In other examples, the kit may further comprise at least one primer or at least one DNA polymerase. In certain examples, the kit may be configured with a species specific probe to be effective to hybridize to a nucleic acid template from one or more bacteria selected from the group consisting of Staphylococcus aureus, Ricksettia rickettsii, Klebsiella pneumoniae, Haemophilus influenzae, Legionella pneumophila, Neisseria meningitidis, Escherichia coli, Staphylococcus epidermidis, Enterococcus faecalis, Streptococcus pneumoniae, Staphylococcus hominis, Borrelia burgdorferi, Bacillus anthracis, Yersinia pestis, Proteus mirabilis and Streptococcus pneumoniae. In other examples, the electrophoretic tag of the universal probe and the species specific probe may be selected to have different electrophoretic mobilities. In additional examples, the universal probe and the species specific probe may be effective to identify the type of pathogen and/or the species of pathogen using less than 30 PCR amplification cycles. In some examples, the electrophoretic tag of each of the universal probe and the species specific probe may be effective to be cleaved upon amplification of the nucleic acid template.

[0011] In another aspect, a kit comprising a universal probe effective to hybridize to a nucleic acid template from a pathogen to identify the type and/or presence of pathogen in a sample, the universal probe comprising a nucleic acid sequence coupled to a first electrophoretic tag, a first species specific probe effective to hybridize to identify the species of a first pathogen present in the sample, the first species specific probe comprising a nucleic acid sequence coupled to a second electrophoretic tag, a second species specific probe effective to identify the species of a second pathogen in the sample, the second species specific probe comprising a nucleic acid sequence coupled to a third electrophoretic tag, and instructions for using the universal probe and the first and second species specific probes is provided.

[0012] In certain examples, the universal probe may be effective to bind to a 5S, 16S or 23S rRNA gene in the pathogen. In other examples, the universal probe may be effective to hybridize to a conserved region of a bacterial DNA. In additional examples, each of the species specific probes may be effective to hybridize to a non-conserved region of a bacterial DNA, and the first and second species specific probes may be effective to bind to different non-conserved regions. In some examples, the kit may further comprise at least one primer or at least one DNA polymerase. In certain examples, each of the species specific probes may be effective to hybridize to a nucleic acid template from one or more bacteria selected from the group consisting of Staphylococcus aureus, Ricksettia rickettsii, Klebsiella pneumoniae, Haemophilus influenzae, Legionella pneumophila, Neisseria meningitidis, Escherichia coli, Staphylococcus epidermidis, Enterococcus faecalis, Streptococcus pneumoniae, Staphylococcus hominis, Borrelia burgdorferi, Bacillus anthracis, Yersinia pestis, Proteus mirabilis and Streptococcus pneumoniae, and wherein the first and second species specific probes are selected to hybridize to different bacterial species. In some examples, the electrophoretic tag of the universal probe and each of the species specific probes may be selected to have different electrophoretic mobilities. In additional examples, the universal probe and each of the species specific probes may be effective to identify the type of pathogen and the species of pathogens using less than 30 PCR amplification cycles. In other examples, the electrophoretic tag of each of the universal probe and each of the species specific probes may be effective to be cleaved from the probe upon amplification of the nucleic acid template. [0013] In another aspect, a homogeneous assay for detecting the presence and/or type of pathogen in a sample, the assay comprising exposing a sample comprising a nucleic acid template to a universal probe and a species specific probe, the universal probe comprising a first electrophoretic tag coupled to a nucleic acid sequence effective to hybridize to a conserved region of the nucleic acid template to identify the type of pathogen in the sample, the species specific probe comprising a second electrophoretic tag coupled to a nucleic acid sequence effective to hybridize to a non-conserved region of the nucleic acid template to identify the species of pathogen present in the sample; and detecting cleavage of the first electrophoretic tag, the second electrophoretic tag, or both, to determine the type of pathogen and/or the species of pathogen present in the sample is provided.

[0014] In certain examples, the assay may further comprise amplifying the nucleic acid template to cleave the electrophoretic tag from one or both of the universal probe and the species specific probe. In some examples, the cleavage may be detected by analyzing the sample using capillary electrophoresis. In additional examples, the assay may further comprise at least one additional species specific probe comprising a third electrophoretic tag, the additional species specific probe effective to identify an additional species of pathogen in the sample. In some examples, the assay may further comprise determining a ratio of cleaved electrophoretic tag from the species specific probe to cleaved electrophoretic tag from the universal probe to provide the level of species of pathogen present in the sample. [0015] In another aspect, a kit for detecting the presence of an antibiotic resistant strain of bacteria in a sample is disclosed. In certain examples, the kit comprises a universal probe comprising a first electrophoretic tag, the universal probe comprising a nucleic acid sequence effective to hybridize to a conserved region of a bacterial DNA, and a species specific probe comprising a second electrophoretic tag, the species specific probe effective to hybridize to a non-conserved region of the bacterial DNA encoding for antibiotic resistance to identify the presence of an antibiotic resistant strain of bacteria in the sample. In some examples, the electrophoretic tag of the universal probe and the electrophoretic tag of the species specific probes may be selected to have different electrophoretic mobilities.

[0016] In an additional aspect, an assay comprising exposing a sample comprising a nucleic acid template to a universal probe and a species specific probe, the universal probe comprising a first tag coupled to a nucleic acid sequence effective to hybridize to a conserved region of a pathogen, the universal probe comprising at least a first region and a second region, wherein the first region is complementary to the second region to provide a hairpin structure, and the species specific probe comprising a second tag coupled to a nucleic acid sequence effective to hybridize to non-conserved region of the pathogen to identify the species of pathogen, the species specific probe comprising at least a first region and a second region, wherein the first region is complementary to the second region to provide a hairpin structure, and determining the type and species of pathogen in the sample by detecting cleavage of at least one of the first tag and the second tag after amplification of the nucleic acid template is disclosed. In some examples, the assay may further comprise detecting the cleaved first tag and the cleaved second tag is performed by capillary electrophoresis, fluorescence or using an array.

[0017] In another aspect, a kit comprising a universal probe comprising a first tag coupled to a nucleic acid sequence effective to hybridize to a conserved region of a pathogen, the universal probe comprising at least a first region and a second region, wherein the first region is complementary to the second region to provide a hairpin structure, a species specific probe comprising a second tag coupled to a nucleic acid sequence effective to hybridize to non- conserved region of the pathogen to identify the species of pathogen, the species specific probe comprising at least a first region and a second region, wherein the first region is complementary to the second region to provide a hairpin structure, and instructions for using the universal probe and the species specific probe is provided.

[0018] In an additional aspect, a device for determining the type and/or presence of a pathogen is provided. In certain examples, the device comprises a chamber configured to allow exposure of a sample to a universal probe comprising a first electrophoretic tag and a species specific probe comprising a second electrophoretic tag, a separation device coupled to the chamber and configured to separate the first electrophoretic tag from the second electrophoretic tag, and a detector configured to detect the first electrophoretic tag and the second electrophoretic tag is provided. [0019] These and other aspects, examples and advantages are described in more detail below.

BRIEF DESCRIPTION OF THE FIGURES

[0020] Certain specific examples are described below with reference to the accompanying figures in which:

[0021] FIG. IA is a schematic of a universal probe and a specific probe hybridized to a nucleic acid template, in accordance with certain examples; [0022] FIG. IB is a prophetic chromatogram showing separation of electrophoretic tags of a species specific probe and a universal probe shown in FIG. IA, in accordance with certain examples;

[0023] FIG. 2A is a schematic of a multiplexing scheme that uses a plurality of species specific probes, in accordance with certain examples;

[0024] FIG. 2B is a prophetic chromatogram showing separation of electrophoretic tags of a plurality of species specific probe and a universal probe shown in FIG. 2A, in accordance with certain examples;

[0025] FIG. 3 is a prophetic chromatogram showing the results of probes used to detect common contaminants, in accordance with certain examples;

[0026] FIG. 4 is a schematic of a multiplexed assay using a probe, in accordance with certain examples;

[0027] FIG. 5 is a schematic showing one method of designing probes, in accordance with certain examples;

[0028] FIG. 6 is a schematic of a multiplexing scheme that uses a plurality of species specific probes, in accordance with certain examples;

[0029] FIG. 7 is a schematic showing various regions of a probe, in accordance with certain examples;

[0030] FIG. 8 is a schematic showing one design for an electrophoretic tag, in accordance with certain examples;

[0031] FIGS. 9A and 9B show chemical structures for illustrative electrophoretic tags, in accordance with certain examples;

[0032] FIGS. 10A- 1OC include Tables V-VII, respectively, in accordance with certain examples;

[0033] FIG. 11 includes Table VIII, in accordance with certain examples;

[0034] FIGS. 12A-12D include Tables XI-XIV, respectively, in accordance with certain examples; and

[0035] FIGS. 13A-13E include Tables XV-XIX, respectively, in accordance with certain examples.

[0036] Certain features or elements in the figures are not necessarily to scale or in a particular order in which they may be used in the assay disclosed herein. Certain elements may have been shown in an unconventional manner relative to other features to provide a more user-friendly description of the illustrative features, aspects and examples described herein.

DETAILED DESCRIPTION

[0037] Certain embodiments disclosed herein use nucleic acid target amplification (PCR) to identify the presence of bacteria, the type of bacteria or both. The devices, methods and systems are applicable to a broad range of pathogen detection along with specific pathogen detection including, for example, those with antibiotic resistance genes. False positive and false negatives may be reduced using embodiments of the rapid, accurate and high throughput devices, systems and methods disclosed herein.

[0038] In accordance with certain examples, the assay described herein use a universal probe and a species specific probe to identify the type of pathogen present, e.g., bacteria, fungus, virus, etc. and the particular species of pathogen present. Each of the species specific probe and the universal probe may include a unique tag that may be detected to provide for rapid determination of the type and nature of the pathogen present in a sample. Illustrative tags, probes and other materials for use in the assays disclosed herein are described in more detail below.

[0039] In accordance with certain examples, the probes used in the assays described herein typically comprise a suitable number of nucleic acids to hybridize to a portion of a DNA template present in a sample. Preferably, at least about 80% of the sequences in the probe are capable of hybridizing to a portion of the DNA template. Thus, while there may not be a 1:1 correspondence between the DNA template and the hybridized probe, a suitable amount of the nucleic acids in the template and the probe may base pair to result in hybridization. [0040] In certain examples disclosed herein, the probes may be used to hybridize to a nucleic acid template in a sample. In some examples, the sample may be a clinical sample such as, for example, urine, saliva, sputum, a mouth swab, nasal secretions, aspirate, tears, sweat, cerebrospinal fluid, lymph fluid, serum, plasma or other fluid sample commonly obtained from a mammal infected with a pathogen. The nucleic acid template may be liberated from the sample using conventional methods used to isolate nucleic acids from a cell. In some examples, the nucleic acid template is a template from one or more bacterial species and includes conserved regions and non-conserved regions. The universal probes used herein may be selected to hybridize to the conserved regions, and the species specific probe may be selected to hybridize to the non-conserved regions. In some examples, the non-conserved regions of different bacterial species are sufficiently different such that a probe designed to target a first bacterial species does not substantially hybridize to a second bacterial species. In certain examples, the non-conserved regions differ, for example, by about 5 or more nucleotides, e.g., 10 or more nucleotides.

[0041] In accordance with certain examples, the assays described herein may be used to rapidly detect the presence of bacteria that are resistant to one or more antibiotics. In particular, one or more species specific probes may be used to target one or more regions of the bacterial genome that encodes for antibiotic resistance. Illustrative sequences that encode for antibiotic resistance are described below. In contrast to existing methods used to identify bacteria having antibiotic resistance, e.g., cell plating, which may take several days, embodiments of the assay described herein may provide for the rapid and accurate identification of such bacteria with 1-3 hours.

[0042] In accordance with certain examples, the rapid identification of microorganisms, in particular the frequently occurring bacteria, viruses and fungi, is of great interest. An important area of use is that of clinical diagnosis, particularly in the case of intensive care patients who are suffering from severe bacterial infections and who are at high risk of incurring severe organ damage within the context of a systemic inflammatory reaction and of even dying from it. The mortality rate in connection with severe sepsis, septic shock and multi-organ failure is up to 90%. No early parameters, which can be determined in the chemical laboratory and which indicate the beginning of an infection, even of a severe systemic infection, are currently available. Currently available routine parameters of inflammation, such as increase in leukocyte count or increase in C-reactive protein, only respond to a systemic infection with a chronological delay of from 1 to 3 days, are not specific to this infection and may be increased even in the absence of an infection with microorganisms. However, it would be extremely desirable to be also able to rapidly identify microorganisms in connection with local infections, for example, eye infections, also after eye operations, which can otherwise even lead to the loss of the eye which has been operated on, periodontis and also local fungal infections. Early diagnosis of an infection is essential for providing the possibility of early therapy. In particular, it is important to identify the infecting microorganism at an early stage in order to be able to initiate selective antibiotic therapy.

[0043] Conventional microbiological diagnosis by means of propagation and culture detection is not satisfactory in this context. Standard culture and susceptibility tests are the gold standards for pathogen identification and antimicrobial susceptibility profiling, but have several limitations. For example, this detection frequently takes several days and, this type of detection is generally only possible when live bacteria are present in the sample which is provided. However, since body fluids, in particular blood, possess bactericidal properties, this is frequently not the case even when there is an infection. False positive results due to contamination and false negative results due to, for example, antibiotic treatment at the time of sampling are well known problems. Detection of fastidious and non-culturable organisms is a still a major challenge.

[0044] Rapid diagnosis of an infection, and rapid identification of the infecting microorganism, would therefore mean the possibility of early therapy which was specifically oriented toward the organism which had been found and therefore gave grounds for the hope of being able to exert a favorable influence on the severity of the disease and even on the mortality rate of the disease.

[0045] Specific detection can also be effected using specific probes which only bind to DNA/RNA of particular species; if a microorganism other than the presumed one is present in the sample, it may then be necessary to perform experiments using different specific probes until a suitable probe is identified. Consequently, current methods only provide information, in the first PCR run, that DNA/RNA of bacterial or fungal origin is present; the specification itself is a further, elaborate process of searching which is only defined by empirical values.

[0046] Primers targeted toward consensus regions may be used to amplify the pathogenic DNA. For example, PCT Application WO97/07238 describes the amplification of fungal DNA from clinical material (blood) using consensus primers, which, by means of PCR, amplify a region of the 18S rRNA, and subsequent specific identification of the amplified fungal DNA by means of Southern blotting. The entire disclosure of this PCT application is hereby incorporated herein by reference. Additional methods describing the use of PCR in microbiological analysis may be found in Espy et al., Clin. Microbiol. Rev., 19, pp. 165-256, 2006, the entire disclosure of which is hereby incorporated herein by reference. In brief, PCR generally involves the amplification of nucleic acid by thermally cycling the assay to first denature the nucleic acid and then amplify the nucleic acid by extending/elongating the denatured strands using one or more primers, one or more polymerases, and free nucleoside triphosphates. The thermal cycling is repeated numerous times, e.g., 35 times or more, to amplify the template nucleic acid. [0047] In the case of bacteria, consensus primers which bind to one or more highly conserved regions of bacterial DNA, for example the highly conserved 16S region of the rRNA or else the likewise highly conserved 23S region of the rDNA, are also known. The corresponding templates can be amplified using suitable consensus primers and the bacterial DNA which has been amplified in this way can then be detected by means of various detection methods (Anthony, Brown, French; J. Olin. Microbiol. 2000, pp. 781-788 "Rapid Diagnosis of Bacteremia by universal amplification of 23S Ribosomal DNA followed by Hybridization to an Oligonucleotide Array and WO 00/ '66777 ', the entire disclosure of each of which is hereby incorporated herein by reference for all purposes). WO 00/66777 proposes, as do Woo, Patel et al. in Anal. Biochem. 1998, 259 and in J. Microbiol. Methods 1999, 23-30, using bacteria- specific primers; using such primers, only specific bacteria are amplified. Similar methods may also be used for herpes viruses (HSV)- Espyl, UhI et al. /. Clin. Microbiol. 2000, pp. 795 et al.; this document uses suitable primers for specifically amplifying the thymidine kinase gene of the virus and subsequently uses melting curve analysis to verify the amplified DNA which has been identified using the primers. The specific primers which are used in this publication do not bind exclusively to consensus regions but, rather, to quite specific sequences such that only the latter are amplified.

[0048] Rapid and efficient means of microbial identification are needed. Current methods of identification and differentiation of microorganisms have principally relied on microbial morphology and growth variables. Advances in molecular biology techniques over the last few years have led to the development of novel methods of rapid identification of multiple pathogens in a single assay. Some of these multiplexed methods are described below. In J. Clin. Microbiol. 1999, pp. 464-466 "Gram-Type Specific Broad-Range POR Amplification for Rapid Detection of 62 Pathogenic Bacteria", Klausegger et al. show that the DNA/RNA of Gram-positive bacteria can be amplified in a group specific manner in a PCR reaction using specially designed Gram-positive primers, and that the Gram-negative bacteria are not amplified in this PCR reaction, such that it is at least possible to subdivide the bacteria under investigation into Gram-positive bacteria and Gram-negative bacteria. Klausegger uses conventional microbiological methods for further specifying the Gram-positive bacteria which have been amplified in this way. According to Klausegger, it is at least possible to treat pathogenic bacteria rapidly, with this treatment being directed towards Gram-positive bacteria or Gram-negative bacteria. However, the Klausegger publication does not permit any more precise identification within a short period of time. [0049] Simultaneous detection and/or species identification of microorganisms in a given sample has been reported recently with the multiplexing technique, with multiple sets of species- specific primer pairs and probes corresponding to different amplification targets (Corless, C. E., M. Guiver, R. Borrow, V. Edwards- Jones, A. J. Fox, and E. B. Kaczmarski. 2001. Simultaneous detection of Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumoniae in suspected cases of meningitis and septicemia using real-time PCR. J. Clin. Microbiol. 39:1553-1558.).

[0050] The use of multiplex PCR for detection of antibiotic resistance genes has been described (J. Clin. Microbiol, 2003, 4089-4094; 2005, 5026-5033). The sensitivity of this assay (100 pg corresponds to 10 staphylococcal cells, useful in direct detection from positive cultures) and the specificity, however, needs further improvement. Infections caused by methicillin (oxacillin)-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant Enterococcus spp. (VRE) have worse outcomes and higher associated costs than infections caused by methicillin (oxacillin)-susceptible Staphylococcus aureus or vancomycin- susceptible Enterococcus spp. Unfortunately, the rates of MRSA and VRE continue at an accelerating pace in U.S. hospitals Broad-based surveillance for MRSA or VRE, using culture based methods, may be especially demanding if not impossible for most clinical microbiology laboratories. Moreover, the time required for a final result may take several days. Real-time PCR testing methods for both MRSA and VRE could provide same day results.

[0051] There are several multiplexing methods in existence, but each has several limitations. In multiplexed detection of pathogens using melting curves, two primers per pathogen are used and each pathogen amplicon is differentiated based on size. Thus, melting curves can be used to identify the pathogen. A significant limitation of this assay is that if two are more pathogens are present, or different levels of pathogens are present, the method does not work well. False positives and False Negatives are a problem for this method. [0052] The QIA-Plex (tem-PCR) using Luminex detection is a variation on nested primer that uses intelligent design of primers to multiplex. This method detects about 1,000 copies per assay using Luminex beads. A limitation of this test is that due to the limitation of primer concentration, the sensitivity of the assay is compromised.

[0053] In accordance with certain examples, another embodiment uses universal primers to conserved regions. See U.S. Patent No. 6,699,670, the entire disclosure of which is hereby incorporated herein by reference. A Taqman probe may be used to identify infection. With the probe-based PCR system described here, both steps can be accomplished simultaneously. This assay requires the use of two fluorophores whose emission spectra do not overlap. This assay also requires the discriminatory power of the detection instrument itself, which presently can simultaneously differentiate up to four different fluorophores in a single tube. Thus, the number of species specific probes which may be included in an individual reaction (in addition to the universal probe and positive control) is restricted. Typically this method is good for rapid identification of infection. To identify the organism (as a priori the identity of the organism is not known and a unique species specific probe is needed to identify each organism), other analysis are needed. Thus, the number of species specific probes which may be included in an individual reaction (in addition to the universal probe, positive control) is restricted. This method also suffers from too many false positives and false negatives. [0054] Corless et al. have found that for universal PCR (CE. Corless, J. Clin.Microbiol, 2000, 1747-1752) to give consistent results, it was not possible to eliminate contaminating DNA from the PCR (Taq DNA polymerase has a high affinity for DNA; therefore, a certain amount of contaminating bacterial DNA may always remain protected from physical, chemical, or enzymatic treatment) for detection of eubacterial 16S rRNA without a significant decrease in sensitivity. The loss in sensitivity obviates any advantage gained in amplifying a multicopy target, which, in this study, was the 16S rRNA gene. [0055] In accordance with certain examples, devices, systems and methods disclosed herein may utilize a universal probe and a species- specific probe. The devices, systems and methods may also use one or more primers and universal PCR.

[0056] Universal PCR can be used as a tool for the rapid detection of bacteria in normally sterile clinical samples and, as such, would be useful in differentiating bacterial from viral infections. This would confirm the necessity for antibiotic treatment and would influence patient management. Numerous reports have used the 16S rRNA gene as a target for non- culture detection, and it has been the most widely used target for universal PCR amplification of DNAs from a broad range of organisms. The 16S rRNA gene is present in multiple copies in the genomes of all known human bacterial pathogens that belong to the eubacterial kingdom. Many bacterial species contain up to seven copies of the gene. A gene target that is present in multiple copies increases the possibility of detection of small numbers of pathogens over an assay that detects a single copy gene target.

[0057] A large amount of 16S rRNA sequence data is available, and these data indicate the highly conserved nature of the gene across the eubacterial kingdom. In addition, there is sufficient variation within the 16S rRNA gene to provide species- specific discrimination of some of the major causative agents of meningitis and septicemia, namely, Neisseria meningitidis, Escherichia coil, Haemophilus influenzae, Streptococcus pneumoniae, and Listeria monocytogenes.

[0058] Other universal gene targets are 5S, 23S and 16S-23S inter-genic spacer regions. For example, the amplification of bacterial rRNA is in no way restricted to the 16S region or the 23S region; it is also known that, in bacteria, it is possible to amplify the "spacer region" between the 16S and 23S genes in the prokaryotic rRNA using special primers which are suitable for this purpose (App...and Environmental Microbiology, 1993, pp. 945-952); the "spacer region" lies between two highly conserved regions on each of which a primer then lies.

[0059] "Broad range" PCR primers are designed to recognize the conserved region of 16S rRNA gene. These primers also amplify intervening, variable regions without the need to know any prior sequence information of the unknown bacterial isolate. The method was typically used to rapidly (few hours) confirm the presence of bacterium in a clinical sample. Unfortunately, minor contamination of the PCR mixture with exogenous DNA is a problem. This problem is exaggerated by the use of a highly conserved multiple copy amplification target. The implementation of a universal 16S rRNA PCR can be hindered by problems with contamination of reagents which may be derived from a bacterial source, such as Taq DNA polymerase and uracil-N-glycosylase (UNG). During enzyme production, nucleic acid, including ribosomal DNA sequences, is co-purified. It has been well documented that Taq DNA polymerase enzyme may contain a source of contaminating DNA as a result of its manufacture and incomplete purification. The enzyme is commonly expressed as a recombinant protein in E. coil or is obtained as a native protein from Thermus aquaticus. False positives due to contamination from Taq DNA polymerase, reagents, environment and plastic-ware guaranteed to be free of DNA along with the implementation of a PCR for detection of eubacterial 16S rRNA by sensitive technologies, such as the TaqMan system, will continue to be problematic. For example, Corless (CE. Corless, J. Clin.Microbiol, 2000, 1747-1752) found that to give consistent results, it was not possible to eliminate contaminating DNA from the PCR reaction (Taq DNA polymerase has a high affinity for DNA; therefore, a certain amount of contaminating bacterial DNA may always remain protected from physical, chemical, or enzymatic treatment) for detection of eubacterial 16S rRNA without a significant decrease in sensitivity. The loss in sensitivity obviates any advantage gained in amplifying a multicopy target, which, in this study, was the 16S rRNA gene.

[0060] Reducing the number of PCR cycles would produce the false-negative signal outside the detection limits by use of real time TaqMan chemistry. This approach, however, would not provide the improved non-culture means of detection needed for enhanced disease surveillance. Universal PCR detection followed by species identification requires a second post-PCR processing step, which can be technically cumbersome and slow the time to reporting of results. Current methods of universal detection with species identification include PCR amplification with a universal primer set followed by performance of species identification assays, such as oligonucleotide array, restriction digestion, or sequencing. Another variation has been to universally amplify cultured clinical samples and then subject the amplified product to hybridization using different sets of specific probes. Regardless of the methodology used, virtually all techniques for universal detection and species identification of bacteria have thus far involved at least two sequential steps. [0061] In accordance with certain examples, the devices, systems and methods disclosed herein may include a universal probe and a species specific probe. In the case of bacteria, the universal probe is selected such that it hybridizes to template DNA from any species of bacteria. A species specific probe is selected such that is hybridizes only to template DNA that includes specific sequences found in a particular species. The ratio of the bound specific probe to the bound universal probe determines the amount of the specific bacteria presence in the sample. Primers may be used to amplify the template DNA using PCT. [0062] In one embodiment, the universal probe may include a label at a first end and one member of a binding pair at a second end. Similarly, the species specific probe may include a label at a first end and one member of a binding pair at a second end. For example, each of the probes may include an electrophoretic tag at a 5 '-end of the probe and biotin at a 3 '-end of the probe (or downstream from the electrophoretic tag, e.g., next to the electrophoretic tag). Preferably the electrophoretic tags of the universal and species specific probes have different electrophoretic mobilities such that they may be analyzed simultaneously using, for example, capillary electrophoresis. During the assay, amplification of the template DNA may result in cleavage of the electrophoretic tag from the probe. The other member of the binding pair may then be added to the mixture to remove any uncleaved probe. The resulting free electrophoretic tags may be analyzed using electrophoresis to determine the relative amounts of the electrophoretic tags present in the mixture. The ratio of the amount of electrophoretic tag of the species specific probe to the amount of electrophoretic tag of the universal probe provides the relative amount of the specific bacteria present in the sample. [0063] In accordance with certain examples, a simplified schematic of an assay is shown in FIG. IA. A species specific probe 110 may be added to a mixture including template DNA 120. The species specific probe 110 includes an electrophoretic tag E₁ at a 5'-end and a biotin molecule B at a 3 '-end. The universal probe includes an electrophoretic tag E₂ at a 5'- end and a biotin molecule B at a 3 '-end. The electrophoretic tag of the universal probe is selected to have a different electrophoretic mobility than the electrophoretic tag of the species specific probe. Primers and suitable enzymes may be added such that the template may be elongated during the PCR reaction. For example, primers may be designed to bind to the conserved region of the 16S target DNA. During PCR, if the probes bind to the template, amplification along with 5' nuclease activity results in cleavage of the electrophoretic tag. After amplification, avidin may be added to bind to biotin resulting in removal of any uncleaved probe. The sample may be subjected to electrophoresis, e.g., capillary electrophoresis, to identify which electrophoretic tags have been cleaved in the sample. It is expected that the electrophoretic tag E₂ attached to the universal probe is present as the probe may be selected to bind to substantially any type of pathogen, e.g., any species of eubacteria. If the particular pathogen is present that includes DNA specific for the species specific probe, then the presence of the electrophoretic tag E₁ from the species specific probe should also be present (See FIG. IB). The ratio of E₁ZE₂ provides the relative amount of the specific pathogen present in the sample. One or more control tags may also be present, such as CE control 1 and CE control 2 shown in FIG. IB.

[0064] In accordance with certain examples, the devices, systems and methods disclosed herein may be multiplexed such that a plurality of different, species specific probes may be present simultaneously. Referring to FIG. IA, an assay may be performed using five species specific probes bearing electrophoretic tags E₁, E₃, E₄, E₅ and E₆, and a single universal probe bearing an electrophoretic tag E₂. By using a plurality of species specific probes, the presence and type of many different species of bacteria may be simultaneously identified. In addition, the relative amount of each species of bacteria may be identified. For example, the ratio of a particular species specific electrophoretic tag to the universal probe electrophoretic tag (e.g., E₁ZE₂, E₃ZE₂, E₄ZE₂, EsZE₂ or E₆ZE₂) can provide the amount of each specific pathogen present in a sample. Additional advantages of using a plurality of probes includes, but is not limited to, competition between multiple PCR primer pairs is avoided or reduced, detection of additional DNA templates requires addition of only another electrophoretic tag labeled probe instead of an entire new reaction mixture, and standard curves do not need to be altered as a result of amplification efficiencies for separate reaction mixtures. [0065] In accordance with certain examples, the electrophoretic tags may be analyzed and quantified using suitable electrophoresis methods such as, for example, capillary electrophoresis. The PCR reaction mixture may be introduced into a suitable capillary electrophoresis device, e.g., manually or in an automated fashion, to separate the electrophoretic tags. The electrophoretic tags may be detected using a suitable detector such as, for example, a UV/Vis absorption spectrophotometer, a fluorescence detector or other suitable types of detectors or instruments, e.g., mass spectrometers.

[0066] In certain embodiments, the sensitivity of the assays described herein may be several fold (or more) better than existing assays. For example, the typical sensitivity of real-time PCR is about 10 nM which corresponds to about 10¹¹ molecules in 20 uL. Detection with capillary electrophoresis is more sensitive, e.g., about 1 pM (or 10⁷ molecules in 20 uL; small fluorescent molecules, rapid separation, sharp peak). Thus to detect a single bacterium, a minimum of 35 PCR cycles is required (assuming 100%) to detect the single bacterium using a real-time fluorescence TaqMan based detection method. In embodiments of the technology disclosed herein, only about 20 PCR cycles are needed to detect a single bacterium using an electrophoretic tag.

[0067] In accordance with certain examples, the assays described herein may allow for detection in the exponential phase of the PCR reaction. In a kinetic PCR mode (detecting in exponential phase of PCR), enzyme is used in excess of amplified target with a typical enzyme concentration is 10⁸ to 10¹⁰ molecules per assay. Such detection eliminates or reduces most multiplexed PCR based artifacts. Also, such detection permits detection at two or more PCT cycle numbers for a more specific identification of pathogen. For each clinical sample, the PCR may be stopped after 20 and 30 cycles and the electropherogram analyzed to identify infection and species (e.g., more than 50 species specific probes can be added per tube). The higher detection limit of capillary electrophoresis detection allows one to detect amplification product during the PCR amplification exponential phase, thus obviating common issues or problems associated with multiplexing PCR. The ability to analyze the same clinical sample at two or more different tubes and at two or more different PCR cycles increases the accuracy of the method. This method also allows for the identification of common false positives (which plague culture and qPCR). By using two tubes per clinical sample and performing analysis at two or more different preset PCR cycles, infection may be determined more accurately, and low levels of resistant bacteria may be detected. [0068] In certain examples, the assay disclosed herein may provide fewer false positives than conventional assays. Universal PCR-based bacterial detection systems have been hampered by contamination issues. High sequence conservation of the DNA region chosen for PCR primer annealing coupled with the immense amplification power of PCR results in the amplification of exceedingly minor bacterial contaminants leading to false positives. Residual bacterial DNA from various sources has historically prevented widespread use of universal primer sets in PCR-based assays. Due to the high multiplexing capability of the methods disclosed herein, commonly encountered contaminates may be identified using a specific probe(s) with a unique electrophoretic tag. Thus, control probes to identify common contaminants may be included in the assay. The detection may be performed during the exponential phase of amplification, thus allowing one to not only identify the infectious agent but also contaminate(s) in the same PCR assay. Typical contaminants may be accurately identified, for example, by at least two tags. Thus allowing greater flexibility in tolerating contamination. An illustration of this assay is shown in FIG. 3, which shows the results of a prophetic analysis using various probes with different electrophoretic tags. Tags E₁ and E₁₂ are infecting pathogens, Tag E₂ is a tag from a universal probe, Tag E_1O is a positive control and Tags E₃, E₄, E₉ and E₁₁ are tags from species specific probes directed to detect common contaminants.

[0069] The assays, methods and devices disclosed herein may provide increased accuracy of existing assay by detecting at least two tags and/or the absence of tags from common contaminants. Thus for positive identification of a pathogen both a species-specific tag and a universal tag have to be present. It is quite possible that one typically sees both the contaminant(s) and specific pathogen in the same assay. The method permits the use of multiple sequence specific probes to accurately identify a pathogen with high sensitivity even in the presence of contaminants.

[0070] In certain examples, the assay disclosed herein may also provide fewer false negatives. For example, the ability to detect PCR products in the exponential phase or higher sensitivity along with the increased accuracy of the method eliminates false negatives. Cumbersome methods (restriction enzymes, ultraviolet irradiation, psoralan cross linking) to eliminate false positives are not needed. These methods to remove false positives, which reduce assay sensitivity, are not needed. [0071] In certain embodiments, the assay provided herein provide the ability to detect infections caused by more than one pathogen (e.g., about 1% of all cases of meningitis are due to more than one pathogen). The multiplexed methods described herein are ideally suited to detect infection by more than one pathogen. Traditional laboratory methods may not always identify multiple pathogens in a single clinical sample, as identification from culture is based on the predominating organism and may be influenced by the user of selective culture media. Lots of evidence exists which confirms that on multiple occasions, more than one organism may be present in a clinical sample and these may be under-detected by traditional laboratory methods. The current method is ideally suited to detect multiple pathogens in a single clinical sample.

[0072] In accordance with certain example, another assay that may be used to identify the presence and type of pathogen present utilizing one or more nucleases. This assay is similar to the other assays described herein that use universal PCR amplification. The detection method may be, for example, capillary electrophoresis, Luminex, Blue- shift or arrays. The detection probe design is unique. A region at each end of the probe is designed to be complementary to itself, so at low temperatures, the ends anneal, creating a hairpin (or looped) structure. This integral annealing property allows the use of hundreds of probes in an assay without cross-interaction between probes. At high temperatures (e.g., above about 90 ⁰C), both the PCR amplification product and probe are single stranded. As the temperature of the PCR is lowered, the probe binds to the PCR product and is followed by 5 '-nuclease cleavage. Cleavage results in separation of the two interacting probes. The cleaved probe carrying the fluorophore (or other label or tag) may be detected using either capillary electrophoresis hybridization to an array, Luminex beads, blue-shift beads or other suitable devices and materials selected based on the properties of the tag. If no PCR amplification product is available for binding, the probe reanneals to itself, and is not available for hybridization and can be further removed using, for example, magnetic avidin beads. The assay may be configured to include a series of addition steps with no wash steps (e.g., may be homogeneous). An illustrative schematic of this assay is shown in FIG. 4 with F₁ representing a first fluorescent tag and B representing biotin.

[0073] In designing probes for use in an assay that includes a 5 '-nuclease, a suitable connector may be used to connect the two portions of the probe. For example, a polyethylene glycol chain may be used to connect the two portions of the probe such that 5 '-nuclease activity would provide a first portion with biotin and a second portion comprising the polyethylene glycol and the tag. A schematic of this probe arrangement and cleavage is shown in FIG. 5.

[0074] In certain examples, probes that are configured with hairpin loops may also be used in a multiplexed assay. A schematic of such a multiplexed assay is shown in FIG. 6. In this assay, each species specific probe would have a unique tag, and the universal probe would have a tag different from the tags used in the species specific probes. All of the species specific probes may be added in an assay along with a universal probe to determine that types of pathogens are present in the sample. Depending on the type of tag used, the tag may be detected using electrophoresis, Luminex beads or other suitable detection devices and methods.

[0075] In accordance with certain examples, the probes may be designed such that the linker region and a portion of the probe together have a unique composition. Referring to FIG. 7, the probe includes a tag F₁ on a 5'-end, a biotin molecule on the 3'end, a first portion "a" between the tag F₁ and a linker portion "c," and a second portion "b" between the liner portion "c" and the biotin molecule. Cleavage of the molecule at the 5 '-end of the second portion b provides a portion including F₁, "a" and "c" that is unique, e.g., has a unique electrophoretic mobility, fluorescence signal or the like. In examples where the probe of FIG. 7 is a species specific probe, the "a" portion of the probe may be complementary to an organism specific sequence, the "c" portion of the probe may vary and the "b" portion of the probe may be pathogen specific. The loop structure of the probe prevent interaction of different probes with each other allowing multiplexing at high levels, e.g., 100 probes or more may be used in the same assay.

[0076] The assays described herein may be used to detect several pathogens in a single clinical sample. In addition, several regions of a particular pathogen may be targeted for detection of rapidly mutating organisms. The assays also have the capacity to identify and to measure multiple pathogens in a single sample with high sensitivity in a cost-effective manner. The potential could be realized through the direct integration of PCR with ultra fast CE separation. A specialized instrument that integrates PCR thermocycling, sample dispensing, and capillary-based separation may increase throughout even further. [0077] In accordance with certain examples, the assay disclosed herein may be homogeneous assays that require no wash steps. In particular, the desired materials may all be placed in a single container for the PCR reaction and the detection assay. Such homogeneous assays simplify the assay, reduce the likelihood of contamination, are less costly and provide other advantages.

[0078] In accordance with certain examples, the assays disclosed herein may use an electrophoretic tag coupled to a probe sequence. The electrophoretic tag may be any suitable molecule with a known or determinable electrophoretic mobility that does not substantially interfere with the assay. Illustrative electrophoretic tags are described, for example, in U.S. Patent Nos. 7,037,654, 7,001,725, 6,955,874, 6,949,347, 6,916,612, 6,818,399, 6,770,439, 6,686,152, 6,682,887, 6,673,550, and 6,514,700. During the assay, the electrophoretic tag may be cleaved from the probe. Various electrophoretic tags may be separated using electrophoresis to provide the nature of the pathogen and the specific pathogen type. [0079] In accordance with certain examples, electrophoretic tags may be produced using conventional phosphoramidite coupling chemistry as shown, for example, in FIG. 8. In FIG. 6, the reaction shown includes mobility modifiers M to alter the electrophoretic mobility of the tag. Such modifiers are optional and are desirably used where two tags have a similar electrophoretic mobility. In some examples, one or more linking groups may be placed between the probe sequence and the electrophoretic tag to facilitate linking of the tag to the probe sequence or to reduce any steric issues. Illustrative electrophoretic tags are shown in FIGS. 9A and 9B. In FIG. 9B, C₃, C₆, C₉, and C₁₈ are commercially available phosphoramidite spacers from Glen Research, Sterling Va. The units are derivatives of N₅N- diisopropyl, O-cyanoethyl phosphoramidite, which is indicated by "Q". C₃ is DMT (dimethoxytrityl)oxypropyl Q; C₆ is DMToxyhexyl Q; C₉ is DMToxy(triethyleneoxy) Q; C₁₂ is DMToxydodecyl Q; and C₁₈ is DMToxy(hexaethyleneoxy) Q. The electrophoretic tags shown in FIGS. 8, 9 A and 9B are merely exemplary and other molecules may be used as electrophoretic tags in the assay described herein as long as the electrophoretic mobilities of the tags are sufficiently different to discriminate between the different tags. [0080] In accordance with certain examples, the electrophoretic tags may be coupled to at least one probe sequence. As discussed above, the universal probes used in the assays described herein are designed to bind to a substantial number of pathogens within a kingdom, e.g., a large number of bacteria. Illustrative sequences for the universal probes include, for example, those listed in Table I below, which are designed for use with bacterial 16S and 23S rDNA. SEQ. ID. NOS. 1-18 and 20-27 are from Escherichia coli and SEQ. ID. NO.19 is from Staphylococcus aureus. Each of these probes is designed for use with either all bacteria or most bacteria. See M. Maiwald, MoI. Microbiol.: Diagnostic Principles and Practice. Ed. D.H. Persing. Ch. 30, 2004 ASM Press and Horz et al. J. Clin. Microbiol., 43, pp. 5332-5337, 2005.

Table I

One or more of the probes listed above may be coupled to a tag, as discussed further below, to provide an electrophoretic tag-probe molecule for use as a universal probe. [0081] The assays described herein also use a species specific probe to identify the particular species of bacteria present in a sample. Illustrative species specific probes are listed below in Table II along with the particular organisms to which they correspond, as described, for example in U.S. Patent No. 6,699,670.

Table II

As discussed above, one or more of the specific sequences may be coupled to a unique electrophoretic tag such that the presence of a particular species of bacteria in a sample may be detected.

[0082] In accordance with certain examples, the assay described herein typically use one or more primers during amplification. Illustrative primers suitable for use in the assay described herein include, but are not limited to, those listed in Table III. Unless indicated otherwise, these primers are from Escherichia coli. Other suitable primers are described, for example, in Woo et al. /. Clin. Microbiol, 38, pp. 3515-3517, 2000, and in Horz et al., /. Clin. Microbiol, 43, pp. 5332-5337, 2005, the entire disclosure of each of which is hereby incorporated herein by reference.

Table III

Additional suitable primers for use in the assays described herein will be readily selected by the person of ordinary skill in the art, given the benefit of this disclosure. [0083] In accordance with certain examples, kits including a universal probe and a species specific probe are provided. In some examples, the kit may comprise a universal probe effective to hybridize to a nucleic acid template from a pathogen to identify the type of pathogen presence in a sample, the universal probe comprising a nucleic acid sequence coupled to a first electrophoretic tag. In other examples, the kit may comprise a species specific probe effective to hybridize to identify the species of pathogen present in the sample, the species specific probe comprising a nucleic acid sequence coupled to a second electrophoretic tag. In yet other examples, the kit may comprise a first species specific probe effective to hybridize to identify the species of a first pathogen present in the sample, the first species specific probe comprising a nucleic acid sequence coupled to a second electrophoretic tag, and a second species specific probe effective to identify the species of a second pathogen in the sample, the second species specific probe comprising a nucleic acid sequence coupled to a third electrophoretic tag. In certain examples, the kit may comprise instructions for using the universal probe and the species specific probe(s).

[0084] In accordance with certain examples, a composition comprising at least one of SEQ. ID. NOS.: 1-76 coupled to at least one electrophoretic tag is provided. In some examples, the composition may be used as either a universal probe or a species specific probe, depending on the particular nucleic acid sequence that is selected. In certain examples, the electrophoretic tag may be coupled to the nucleic acid sequence at the 5 '-end of the nucleic acid sequence such that after hybridization of the probe to a nucleic acid template, the electrophoretic tag may be cleaved from the probe during amplification of the template. [0085] In accordance with certain examples, a method of facilitating identification of the type and species of a pathogen in a sample is provided. In certain examples, the method comprises providing a universal probe comprising a first electrophoretic tag coupled to a nucleic acid sequence effective to bind to a conserved region of a type of pathogen, and a providing a species specific probe comprising a second electrophoretic tag coupled to a nucleic acid sequence effective to bind to a non-conserved region present in a particular species of the pathogen. Other materials, such as additional species specific probes, primers, polymerases and the like may also be provided.

[0086] In accordance with certain examples, a device comprising a chamber configured to allow exposure of a sample to a universal probe comprising a first electrophoretic tag and a species specific probe comprising a second electrophoretic tag, a separation device coupled to the chamber and configured to separate the first electrophoretic tag from the second electrophoretic tag, and a detector configured to detect the first electrophoretic tag and the second electrophoretic tag is provided. In some examples, the separation device may a device configured to use capillary electrophoresis to separate the first and second electrophoretic tags. The exact detector selected depends, at least in part, on the physical and chemical properties of the electrophoretic tags and illustrative detectors include, but are not limited to, mass spectrometers, UV/Visible absorption detectors, electrochemical detectors, thermal conductivity detectors, fluorescence detectors, phosphorescence detectors, nuclear magnetic resonance detectors and other types of detectors that can detect the presence of a particular electrophoretic tag.

[0087] Certain specific examples are described below to illustrate further the technology described herein. Certain organisms referred to below may be used in the design of primers or probe sequences. For convenience, certain organisms and their Genbank accession numbers are listed below. The sequences found in the Genbank may be used to design primers and probes to target specific types of organisms. Also see Bernard, P. S., et al., Anal. Biochem., 255 (1998) 101-107, Espy, M. J., et al., /. Clin. Microbiol, 38 (2000) 795-799, Klausegger, A., et al., /. Clin. Microbiol, 37 (1999) 464-466, Matthews, J. A., and Kricka, L. J., Anal. Biochem., 169 (1988) 1-25, and Woo, T. H., et al., /. Microbiol. Methods, 35 (1999) 23-30.

Organism Accession no.

Staphylococcus aureus X68417, AF146368, AF076030, D83353,

D83355, D83357

Staphylococcus capitis AY030321

Staphylococcus epidermidis AY030342, D83363, D83362, X75944

Staphylococcus auricularis D83358

Staphylococcus cohnii AB009936, D83361

Staphylococcus hominis AY030318, X66101, L37601

Staphylococcus simulans D83373

Staphylococcus saprophyticus D83371, Z26902, L37596, L20250

Staphylococcus arlettae AB009933

Staphylococcus condimenti Y15750

Staphylococcus delphini AB 009938

Staphylococcus felis D83364

Staphylococcus gallinarum D83366

Staphylococcus intermedius AFl 93882

Staphylococcus kloosii AB009940

Staphylococcus lentus D83370

Staphylococcus linens AF527483

Streptococcus pneumoniae X58312, AF003930

Streptococcus agalactiae AB023574

Streptococcus sp. group G AB002517

Streptococcus milled U02917

Streptococcus mitis AY005045

Streptococcus mutans AFl 39603

Streptococcus pyogenes AB023575

Streptococcus salivarius U02923

Streptococcus sanguinis AF003928

Bacillus subtilis AB065370

Lactobacillus gasseri AF243165, AF243144

Lactobacillus jensenii AF243176, AF243153, AF243143 Enterococcus faecium AB018210, AF039901, AF070223, AJ276355,

AJ291731, AJ291732, AJ301830, AJ420800, AY057055

Nocardia otitidiscaviarum X80611

Kitasatospora setae AB022868

Pseudomonas aeruginosa AF094720

Stenotrophomonas maltophilia AJ293474, AJ293469

Acinetobacter baumannii X81660

Acinetobacter Iwoffii U10875

Helicobacter pylori AF302106, AF348617, AF363064,

AF512997, AF535196, AF535197, AF535198, AY022898, AY062899, U00679, U01328, U01329, U01330, U01331, U01332

Helicobacter rodentium U96296, U96297

Salmonella enterica serovar Typhi U88545, Z47544

Salmonella enterica serovar Paratyphi X80682

Salmonella enterica serovar Enteritidis U90318

Klebsiella pneumoniae AB004753, AF130981, AF130982, AF130983,

AF228918, AF228919, AJ23342, Y17654, Y17656, Y17657, X87276, X93214,

Klebsiella oxytoca AB004754, AF129440, U78183, U78184,

Y17655, Y17667,

Enterobacter cloacae AJ251469

Enterobacter aerogenes AJ251468

Escherichia coli AB035920

Yersinia pestis Z75317

Yersinia entercolitica AF366378

Yersinia pseudotuberculosis AF366375

Shigella dysenteriae X96966, X80680

Shigella sonnei X96964

Shigella boy dii X94965

Shigella flexneri X96963

Haemophilus influenzae AF224305, AF224306, AF224308, AF224309,

Haemophilus haemolyticus M75045

Haemophilus aegypticus M75044

Example 1

[0088] One or more probes and primers may be used to identify the presence and type of a pathogenic gram positive bacterium. Illustrative pathogenic gram positive bacteria include, but are not limited to, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus agalactine, Streptococcus pyogenes, Enterococcus faecium, Enterococcus faecalis and various Mycobacterium spp. The sequences and e-Tags below refer to specific sequences that may be used to identify a particular species of bacteria. The e-Tag may be any E-tag and preferably each sequence includes its own unique e-Tag. [0089] Staphylococcus epidermidis: eTag2- GA(BIOTIN)ACAAATGTGTAAGTAACTATGCACG (Gram +) (SEQ ID NO. 77); Staphylococcus aureus: eTag5-GA(BIOTIN)ACATATGTGTAAGTAACTGTGCACA (Gram +) (SEQ ID NO. 78); Enterococcus faecium: eTagό- GA(BIOTIN)TGAGAGTAACTGTTCATCCCTTG (Gram +) (SEQ ID NO. 79); Enterococcus faecialis: eTag7-GA(BIOTIN)CGTTAGTAACTGAACGTCCCCT (Gram +) (SEQ ID NO. 80); Streptococcus pyogenes: eTagl5-

GT(BIOTIN)GGGAGTGGAAAATCCACCAAGT (Gram +) (SEQ ID NO. 81); Streptococcus pyogenes: eTagl 5-GT(BIOTIN)GGGAGTGGAAAATCCACCAAGT (Gram +) (SEQ ID NO. 82); (gram+/gram-) probe eTag20-

GAGGC(BIOTIN)AGCAGTGGGGAATATTG ((SEQ ID NO. 83); Gram-positive probe: eTag24-GAGGC(BIOTIN)AGCAGTAGGGAATCTTC (SEQ ID NO. 84); Gram-positive probe: eTag25-CC(BIOTIN)TAACCAGAAAGCCACGGCTAACTACGTG (SEQ ID NO. 85); Gram-positive probe: eTag26-

CC(BIOTIN)TAATCAGAAAGCGACGGCTAACTACGTGC (SEQ ID NO. 86); Gram- positive probe: eTag27-AGAAAGC(BIOTIN)CACGGCTAACTACGTGC (SEQ ID NO. 87); Mycobacterium, pneumoniae,.: eTaglό-

GT(BIOTIN)AATGGCTAGAGTTTGACTGTACCA (SEQ ID NO. 88) Mycobacterium tuberculosis: eTagl 9-CT(BIOTIN)CTCGGATTGACGGTAGGTGGAG (SEQ ID NO. 89); and Corynebacterium jejuni: eTagl7-CAC(BIOTIN)TGTGTGGTGACGGTACCTG (SEQ ID NO. 90). Illustrative forward primers (based on bacterial 16 rRNA) include, but are not limited to, TACGGGAGGCAGCAGT (SEQ ID NO. 91), TCCTACGGGAGGCAGCAGT (SEQ ID NO. 92), CTACGGGAGGCAGCAGT (SEQ ID NO. 93), and GCG GTG AAA TGC GTA GAG AT (SEQ ID NO. 94). Illustrative reverse primers (based on bacterial 16 rRNA) include, but are not limited to, TATTACCGCGGCTGCT (SEQ ID NO. 95), GTATTACCGCGGCTGCTG (SEQ ID NO. 96), TATTACCGCGGCTGCTG (SEQ ID NO. 97) and GTT TACGGCGTGGACTACCA (SEQ ID NO. 98).

Example 2

[0090] Probes and primers may be selected to detect the presence of pathogenic Gram negative bacteria in a sample. Illustrative pathogen Gram negative bacteria include, but are not limited to, Escherichia coli, Klebsiella pneumoniae, Serratia marcescens, Enterobacter cloacae, Enterobacter aerogenes, Proteus mirabilis, Pseudomonas aeruginosa, Acinetobacter baumanii, Stenotrophomonas maltophiliaand various Mycobacterium spp. Illustrative probes and primers to detect selected Gram negative bacteria are listed below. E. colϊ. eTagl-AG(BIOTIN)GGAGTAAAGTTAATACCTTTGCTC (SEQ ID NO. 99); Pseudomonas: eTag3-GG(BIOTIN)AAGGGCAGTAAGTTAATACCTTG (SEQ ID NO. 100); Acinetobacter baumannii: eTag4-

AT(BIOTIN)ACCTAGAGATAGTGGACGTTACTC; (SEQ ID NO. 101); Haemophilus influenzae: eTag8-TG(BIOTIN)ATGTGTTAATAGCACATCAAATTGAC (SEQ ID NO. 102); Enterobacter cloacae: eTag9-GA(BIOTIN)CAGGGTTAATAACCCTGTCGATT (SEQ ID NO. 103); Klebsiella pneumoniae: eTaglO-

CG(BIOTIN)ATGAGGTTAATAACCTCATCGATT (SEQ ID NO. 104); Enterobacter aerogenes: eTagl 8-AC(BIOTIN)CTTGGCGATTGACGTTACTCGC (SEQ ID NO. 105); Serratia: eTagl 1-AA(BIOTIN)TACGCTCATCAATTGACGTTACTC (SEQ ID NO. 106); Legionella pneumoniae.: eTagl 2- GG(B 1OTIN)TTG AT AGGTTA AG AGCTG ATTA AC (SEQ ID NO. 107); Proteus vulgaris: eTagl3-

TG(BIOTIN)ATAAAGTTAATACCTTTGTCAATTGAC (SEQ ID NO. 109); Bacteroides fragiles: eTagl4-TG(BIOTIN)CAGTATGTATACTGTTTTGTATGTATT (SEQ ID NO. 110); (gram+/gram-) probe eTag20-GAGGC(BIOTIN)AGCAGTGGGGAATATTG (SEQ ID NO. Ill); Gram(-) probe: eTag21-

AC(BIOTIN)CGCAGAATAAGCACCGGCTAACTCCGTGC (SEQ ID NO. 112); Gram(-) probe: eTag22-CC(BIOTIN)GCAGAATAAGCACCGGCTAACTCCGT (SEQ ID NO. 113); and Gram(-) probe eTag23-AGAAGC(BIOTIN)ACCGGCTAACTCCGTGC (SEQ ID NO. 114). Illustrative forward primers for use in detecting Gram negative bacteria include, but are not limited to, TACGGGAGGCAGCAGT (SEQ ID NO. 115), TCCTACGGGAGGCAGCAGT (SEQ ID NO. 116), CTACGGGAGGCAGCAGT (SEQ ID NO. 117) and GCGGTGAAATGCGTAGAGAT (SEQ ID NO. 118). Illustrative backward primers include, but are not limited to, TATTACCGCGGCTGCT (SEQ ID NO. 119), GTATTACCGCGGCTGCTG (SEQ ID NO. 120), TATTACCGCGGCTGCTG (SEQ ID NO. 121) and GTTTACGGCGTGGACTACCA.

Example 3

[0091] Primers may be designed or selected to target Gram negative or Gram positive bacteria. Such primers may be used, for example, in pairs to distinguish between Gram positive and Gram negative bacteria. For example, the following primers may be used (from E. colϊ):

Table IV

[0092] These primers have been used in combination to distinguish gram negative and gram positive bacteria. In particular, primers N6R and NF may be used to identify the presence of the following Gram negative bacteria: E. coli, K. pneumoniae, S. marcescens, H. influenzae, P. mirabilis, and P. aeruginosa as demonstrated, for example, in Carroll et al., /. CHn. Microbiol, 38, pp. 1753-1757, 2000. Primers P2F and NR may be used to identify the presence of the following gram positive bacteria: S. aureus, S. epidermidis, S. pyogenes, S. faecilis, S. viridans, S. pneumoniae, P. acnes, and B. cereus.

Example 4

[0093] Primers may be selected such that only Gram positive or Gram negative bacteria are identified in a sample. For example, it may be desirable to only test for the presence of Gram negative or Gram positive. A primer may be selected or designed such that only nucleic acid from a Gram negative or Gram positive organism is amplified. An illustrative Gram negative primer is AYGACGTCAAGTCMTCATGG (SEQ ID NO. 128). An illustrative Gram positive primer is GAYGACGTCAARTCMTCATGC (SEQ. ID NO. 129). See Klausegger et al., /. Clin. Microbiol, 37, pp 464-466, 1999. Illustrative probes for detecting Gram positive organisms are shown below in Table V-VII (FIGS. 10A-10B). Illustrative primers for detecting Gram positive organisms are shown in Table VIII in FIG. 11.

Example 5

[0094] Primers and probes may be selected or designed to detect the presence of fungi. Illustrative fungi include, but are not limited to, Candida albicans, Candida tropicalis, Candida parapsilosis, Candida crusei, Candida glabrata, and Aspergillus fumigatus. Illustrative probes for detecting selected fungi are: Candida albicans: eTag28- TC(BIOTIN)TGGGTAGCCATTTATGGCGAACCAGGAC (SEQ. ID NO. 311); Candida krusei: eTag29-GT(BIOTIN)CTTTCCTTCTGGCTAGCCTCGGGCGAAC (SEQ. ID NO. 312); Candida parapsilosis: eTag30-

TT(BIOTIN)TCCTTCTGGCTAGCCTTTTTGGCGAACC (SEQ. ID NO. 313); Candida tropiealis: eTag31 -GT(BIOTIN)TGGCCGGTCCATCTTTCTGATGCGTACT (SEQ. ID NO. 314); Torulopsis glabrata: eTag32-

TT(BIOTIN)CTGGCTAACCCCAAGTCCTTGTGGCTTG (SEQ. ID NO. 315); Aspergillus: eTag33-CAT(BIOTIN)GGCCTTCACTGGCTGTGGGGGGAACCA (SEQ. ID NO. 316); general fungal probe 1: eTag34-CT(BIOTIN)GAATGATTAATAGGG ACGGTCGG (SEQ. ID NO. 317); and general fungal probe 2: eTag34-

GGT(BIOTIN)ATCAGTATTCAGTTGTCAGAGGTGAAA (SEQ. ID NO. 318). Illustrative primers include, but are not limited to: forward primer- PFUI fungal consensus primer ATTGGAGGGCAAGTCTGGTG (SEQ. ID NO. 319) and backward primer- PFU2 fungal consensus primer CCGATCCCTAGTCGGCATAG (SEQ. ID NO. 320).

Example 6

[0095] Primers and probes may be designed or selected to detect the presence of viruses in a sample. Illustrative viruses include, but are not limited to, parainfluenza virus 1 (PIV)-I, PIV-2, PIV-3, influenza type A virus (FIu-A), FIu-B, respiratory syncytial virus (RSV), human metapneumo virus (hMPV), rhinoviruses (RhVs), entorviruses (EnVs) and severe acute respiratory syndrome (SARS) cornavirus.

[0096] These viruses may be detected in a sample by releasing the RNA using, for example, a viral vaccum kit such as those commercially available from QIAGEN, Inc. (Valencia, CA), and using probes similar to those available in Taqman assays (Applied Biosystems). Instead of labeling the probes with a fluorophore, however, the probes are each labeled with a unique electrophoretic tag. The sample may be contacted with the electrophoretic tags labeled probes to identify the type and amount of virus present in the sample.

Example 7

[0097] Probes and primers may be designed or selected to identify a particular type of enterovirus present in a sample. Entoviruses contribute to many diseases including, but not limited to, aseptic meningitis, encephalitis, paralytic poliomyelitis and myocarditis. Illustrative enteroviruses include, but are not limited to, polio virus, coxsackie A and B viruses, echo viruses and a large number of non-polio enteroviruses. Selected primers may be used to amplify the enteroviral RNA. Two illustrative primers are (5'- CCCTGAATGCGGCTAAT-3' (SEQ ID NO. 321) and 5'-ATTGTCACCATAAGCAGCC- 3' (SEQ ID NO. 322). Selected probes may also be used to identify the presence of ento viral RNA. An illustrative probe that is EV-specific is- 5 '-GCGGAACCGACTACTTTGGGT-S' (SEQ ID. NO. 323). The EV specific probe may be labeled with an electrophoretic tag as described herein.

Example 8

[0098] Probes and primers may be selected or designed to identify a particular type of virus present in a sample. For example, it may be desirable to detect the presence of cytomegalovirus (CMV), enterovirus, hepatitis B virus (HBV), hepatitis C virus (HCV), human acquired immunodeficiency virus (HIV) or other viruses. To do so using the assays disclosed herein, a universal probe and a species specific probe may be selected or designed. Similarly, a suitable primer or set of primers may be used to amplify the viral nucleic acids. Illustrative primers and probes are shown in Table IX below.

Table IX

Example 9

[0099] Probe sequences may be selected or designed to identify the presence of bacteria that are resistant to one or more antibiotics and can identify the particular antibiotic to which they are resistant.

[00100] The primers include a Staph765F primer (5'-

AACTCTGTTATTAGGGAAGAACA-S' (SEQ ID NO. 336)), a Staph750R primer (5'- CCACCTTCCTCCGGTTTGTC ACC-3' (SEQ ID NO. 337)) for Staphylococcus genus- specific 16S rRNA, Nuc 1 (5'GCGATT GATGGTGATACGGTT-3' (SEQ. ID NO. 338)) and Nuc 2 (5'-AGCCAAGCCTTGACG AACTAAAGC-3' (SEQ. ID NO. 339)) for nuc which encodes for a thermonuclease, MupA (5'-TATATTATGCGATGGAAGGTTGG-S' (SEQ ID NO. 340)) and MupB (5'-AATAAAATCAGCTGGAAAGTGTTG-S' (SEQ ID NO. 341)) for mupA, which encodes resistance to mupirocin, and MecAl (5'- GTAGAAATGACTGAACGTCCGATAA-3' (SEQ ID NO. 342)) and MecA2 (5'- CC AATTCC ACATTGTTTCGGTCTAA-3' (SEQ ID NO. 343)) for mecA, which encodes resistance to methicillin. Additional sequences to target a particular antibiotic resistance gene including, but not limited to, rpoB (rifampicin resistance), katG (isoniazid resistance), femA and femB (methicillin resistance), lytA and other antibiotic resistance genes described, for example, in Fluit et al., Clin Microbiol. Rev., 14, pp. 836-871, 2001, will be readily selected by the person of ordinary skill in the art, given the benefit of this disclosure. [00101] A universal probe may be selected to identify the presence of bacteria or a particular genus of bacteria (or both). Specific probes may be selected that bind to specific regions of the nuc, mupA or mecA gene to identify the presence of an antibiotic resistant bacteria. The assay may be multiplexed to simultaneously identify the presence of different types of antibiotic resistant bacteria that may be present in a sample.

Example 10

[00102] Primers and probes may be selected or designed to identify the number and type of antibiotic resistant genes present. For example, probes may be selected or designed to identify the presence of bacteria encoding for resistance to methicillin (mecA gene), aminoglycoside resistance (aacA-aphD), tetracycline resistance (tetK, tetM), macrolide- lincosamide-streptogramin-B resistance (erm(A) and erm(C)), streptogramin A resistance (vat(A), vat(B), and vat(C)). Such identification may be performed incrementally or simultaneously. Illustrative primers and probes include those shown below in Table X, as described in Strommenger et al, /. Clin. Microbiol, 41, pp. 4089-4094, 2003.

Table X

Example 11

[00103] Probes may be designed or selected to target one or more species of Vibrio.

For example, probes may be designed to target V. cholerae, V. parahaemolyticus, V. vulnificus, V. hollisae, V. mimicus, V. fluvialis and other species of Vibrio. Illustrative probe sequences are listed in Tables XI-XIV (FIGS. 12A- 12D) for various species of Vibrio and for other bacteria encoding antibacterial resistance, as described, for example in Vora et al., P roc. Natl. Acad. ScL, 201, pp. 19109-19114, 2005. Illustrative primer sequences for specific types of Vibrio species and bacteria in general are listed in Tables XV-XIX. (FIGS. 13A- 13E).

[00104] A first probe may be designed to identify the presence of Vibrio, e.g., by selecting a nucleic acid probe to target a conserved region in Vibrio species, and a second probe may be designed to identify the particular species of Vibrio present in a sample, e.g., by selecting a probe to target a sequence specific to a particular Vibrio species.

Example 12

[00105] Probes may be designed or selected to target one or more species of

Acinetobacter spp. Suitable primers include, but are not limited to, 5'- IIIGCGCCGICATCAGGC-3' (SEQ. ID. NO. 584), 5'-ACGTCTTATCAGGCCTAC-S' (SEQ ID NO. 585) and 5'-TGGTCGCGG-S' (SEQ. ID. NO. 586). Probe sequences may be selected or designed to target the nucleic acid sequences of Acinetobacter (GenBank Accession Nos. X81660 and U10875 et al.)

[00106] When introducing elements of the examples disclosed herein, the articles "a,"

"an," "the" and "said" are intended to mean that there are one or more of the elements. The terms "comprising," "including" and "having" are intended to be open ended and mean that there may be additional elements other than the listed elements. It will be recognized by the person of ordinary skill in the art, given the benefit of this disclosure, that various components of the examples can be interchanged or substituted with various components in other examples. Should the meaning of the terms of the patents or publications incorporated herein by reference conflict with the meaning of the terms used in this disclosure, the meaning of the terms in this disclosure are intended to be controlling.

[00107] Although certain aspects, examples and embodiments have been described above, it will be recognized by the person of ordinary skill in the art, given the benefit of this disclosure, that additions, substitutions, modifications, and alterations of the disclosed illustrative aspects, examples and embodiments are possible. In addition, certain nucleotides shown in the sequences listed herein may be listed as those other than A, C, T, G or I (inosine). Unless otherwise clear from the context, these nucleotides may be any of A, C, T or G.

Claims

1. A method comprising: exposing a sample comprising a nucleic acid template to a species specific probe and a universal probe, each of the species specific probe and the universal probe comprising a unique electrophoretic tag; amplifying the nucleic acid template to cleave an electrophoretic tag from one or both of the universal probe or the species specific probe that is hybridized to the nucleic acid template; and detecting at least one cleaved electrophoretic tag from the species specific probe or the universal probe to determine the presence and/or type of pathogen in the sample.

2. The method of claim 1, further comprising configuring the universal probe with a nucleic acid sequence specific for a type of pathogen.

3. The method of claim 2, wherein the type of pathogen is a bacterium, virus or fungus.

4. The method of claim 2, wherein the universal probe comprises a nucleic acid sequence that is effective to hybridize to a 5S, 16S or 23S rRNA gene in the nucleic acid template.

5. The method of claim 2, further comprising configuring the species specific probe to detect the presence of one or more bacteria selected from the group consisting of Staphylococcus aureus, Ricksettia rickettsii, Klebsiella pneumoniae, Haemophilus influenzae, Legionella pneumophila, Neisseria meningitidis, Escherichia coli, Staphylococcus epidermidis, Enterococcus faecalis, Streptococcus pneumoniae, Staphylococcus hominis, Borrelia burgdorferi, Bacillus anthracis, Yersinia pestis, Proteus mirabilis and Streptococcus pneumoniae.

6. The method of claim 1, in which the electrophoretic tag of the universal probe and the species specific probe are selected to have different electrophoretic mobilities.

7. The method of claim 1, in which the amplifying step comprising exposing the nucleic acid template to one or more primers and one or more polymerases.

8. The method of claim 1, in which the detecting step comprises separating cleaved electrophoretic tags in the sample.

9. The method of claim 8, in which the detecting step further comprising determining a ratio of cleaved electrophoretic tag from the species specific probe to cleaved electrophoretic tag from the universal probe.

10. The method of claim 8, in which the separating of the cleaved electrophoretic tags is performed by capillary electrophoresis.

11. A method comprising : exposing a sample comprising a nucleic acid template to a universal probe and a plurality of species specific probes, each of the universal probe and the plurality of species specific probes comprising a unique electrophoretic tag; amplifying the nucleic acid template to cleave an electrophoretic tag from one or more of the universal probe or the plurality of species specific probes that are hybridized to the nucleic acid template; and detecting at least one cleaved electrophoretic tag from the plurality of species specific probe or the universal probe to determine the presence and/or type of pathogen in the sample.

12. The method of claim 11, further comprising configuring the universal probe with a nucleic acid sequence specific for a type of pathogen.

13. The method of claim 12, wherein the type of pathogen is a bacterium, virus or fungus.

14. The method of claim 12, wherein the universal probe comprises a nucleic acid sequence that is effective to hybridize to a 5S, 16S or 23S rRNA gene in the nucleic acid template.

15. The method of claim 12, further comprising configuring the plurality of species specific probes to detect the presence of one or more bacteria selected from the group consisting of Staphylococcus aureus, Ricksettia rickettsii, Klebsiella pneumoniae, Haemophilus influenzae, Legionella pneumophila, Neisseria meningitidis, Escherichia coli, Staphylococcus epidermidis, Enterococcus faecalis, Streptococcus pneumoniae, Staphylococcus hominis, Borrelia burgdorferi, Bacillus anthracis, Yersinia pestis, Proteus mirabilis and Streptococcus pneumoniae, wherein the plurality of species specific probes are each configured to detect different bacterial species.

16. The method of claim 11, in which the electrophoretic tag of the universal probe and each of the plurality of species specific probes are selected to have different electrophoretic mobilities.

17. The method of claim 11, in which the amplifying step comprising exposing the nucleic acid template to one or more primers and one or more polymerases.

18. The method of claim 11, in which the detecting step comprises separating cleaved electrophoretic tags in the sample.

19. The method of claim 18, in which the detecting step further comprising determining a ratio of cleaved electrophoretic tag from at least one of the plurality of species specific probes to cleaved electrophoretic tag from the universal probe.

20. The method of claim 18, in which the separating of the cleaved electrophoretic tags is performed by capillary electrophoresis.

21. A kit comprising: a universal probe effective to hybridize to a nucleic acid template from a pathogen to identify the type of pathogen present in a sample, the universal probe comprising a nucleic acid sequence coupled to a first electrophoretic tag; a species specific probe effective to hybridize to identify the species of pathogen present in the sample, the species specific probe comprising a nucleic acid sequence coupled to a second electrophoretic tag ; and instructions for using the universal probe and the species specific probe.

22. The kit of claim 21, in which the universal probe is effective to bind to a 5S, 16S or 23S rRNA gene in the pathogen.

23. The kit of claim 21, in which the universal probe is effective to hybridize to a conserved region of a bacterial DNA.

24. The kit of claim 21, in which the species specific probe is effective to hybridize to a non-conserved region of a bacterial DNA.

25. The kit of claim 21, further comprising at least one primer.

26. The kit of claim 21, further comprising at least one DNA polymerase.

27 The kit of claim 21, further comprising configuring the species specific probe to be effective to hybridize to a nucleic acid template from one or more bacteria selected from the group consisting of Staphylococcus aureus, Ricksettia rickettsii, Klebsiella pneumoniae, Haemophilus influenzae, Legionella pneumophila, Neisseria meningitidis, Escherichia coli, Staphylococcus epidermidis, Enterococcus faecalis, Streptococcus pneumoniae, Staphylococcus hominis, Borrelia burgdorferi, Bacillus anthracis, Yersinia pestis, Proteus mirabilis and Streptococcus pneumoniae.

28. The kit of claim 21, in which the electrophoretic tag of the universal probe and the species specific probe are selected to have different electrophoretic mobilities.

29. The kit of claim 21, in which the universal probe and the species specific probe are effective to identify the type of pathogen and the species of pathogen using less than 30 PCR amplification cycles.

30. The kit of claim 21, in which the electrophoretic tag of each of the universal probe and the species specific probe are effective to be cleaved from the probe upon amplification of the nucleic acid template.

31. A kit comprising: a universal probe effective to hybridize to a nucleic acid template from a pathogen to identify the type of pathogen presence in a sample, the universal probe comprising a nucleic acid sequence coupled to a first electrophoretic tag; a first species specific probe effective to hybridize to identify the species of a first pathogen present in the sample, the first species specific probe comprising a nucleic acid sequence coupled to a second electrophoretic tag; a second species specific probe effective to identify the species of a second pathogen in the sample, the second species specific probe comprising a nucleic acid sequence coupled to a third electrophoretic tag; and instructions for using the universal probe and the first and second species specific probes.

32. The kit of claim 31, in which the universal probe is effective to bind to a 5S, 16S or 23S rRNA gene in the pathogen.

33. The kit of claim 31, in which the universal probe is effective to hybridize to a conserved region of a bacterial DNA.

34. The kit of claim 31, in which each of the species specific probes are effective to hybridize to a non-conserved region of a bacterial DNA, and wherein the first and second species specific probes are effective to bind to different non-conserved regions.

35. The kit of claim 31, further comprising at least one primer.

36. The kit of claim 31, further comprising at least one DNA polymerase.

37. The kit of claim 31, further comprising configuring each of the species specific probes to be effective to hybridize to a nucleic acid template from one or more bacteria selected from the group consisting of Staphylococcus aureus, Ricksettia rickettsii, Klebsiella pneumoniae, Haemophilus influenzae, Legionella pneumophila, Neisseria meningitidis, Escherichia coli, Staphylococcus epidermidis, Enterococcus faecalis, Streptococcus pneumoniae, Staphylococcus hominis, Borrelia burgdorferi, Bacillus anthracis, Yersinia pestis, Proteus mirabilis and Streptococcus pneumoniae, and wherein the first and second species specific probes are selected to hybridize to different bacterial species.

38. The kit of claim 31, in which the electrophoretic tag of the universal probe and each of the species specific probes are selected to have different electrophoretic mobilities.

39. The kit of claim 31, in which the universal probe and each of the species specific probes are effective to identify the type of pathogen and the species of pathogens using less than 30 PCR amplification cycles.

40. The kit of claim 31, in which the electrophoretic tag of each of the universal probe and each of the species specific probes are effective to be cleaved from the probe upon amplification of the nucleic acid template.

41. A homogeneous assay for detecting the presence and/or type of pathogen in a sample, the assay comprising exposing a sample comprising a nucleic acid template to a universal probe and a species specific probe, the universal probe comprising a first electrophoretic tag coupled to a nucleic acid sequence effective to hybridize to a conserved region of the nucleic acid template to identify the type of pathogen in the sample, the species specific probe comprising a second electrophoretic tag coupled to a nucleic acid sequence effective to hybridize to a non-conserved region of the nucleic acid template to identify the species of pathogen present in the sample; and detecting cleavage of the first electrophoretic tag, the second electrophoretic tag, or both, to determine the type of pathogen and/or the species of pathogen present in the sample.

42. The homogeneous assay of claim 41, further comprising amplifying the nucleic acid template to cleave the electrophoretic tag from one or both of the universal probe and the species specific probe.

43. The homogeneous assay of claim 42, in which the cleavage is detected by analyzing the sample using capillary electrophoresis.

44. The homogeneous assay of claim 43, further comprising at least one additional species specific probe comprising a third electrophoretic tag, the additional species specific probe effective to identify an additional species of pathogen in the sample.

45. The homogeneous assay of claim 44, further comprising determining a ratio of cleaved electrophoretic tag from the species specific probe to cleaved electrophoretic tag from the universal probe to provide the level of species of pathogen present in the sample.

46. A kit for detecting the presence of an antibiotic resistant strain of bacteria in a sample, the kit comprising: a universal probe comprising a first electrophoretic tag, the universal probe comprising a nucleic acid sequence effective to hybridize to a conserved region of a bacterial DNA; and a species specific probe comprising a second electrophoretic tag, the species specific probe effective to hybridize to a non-conserved region of the bacterial DNA encoding for antibiotic resistance to identify the presence of an antibiotic resistant strain of bacteria in the sample.

47. The kit of claim 46, in which the electrophoretic tag of the universal probe and the electrophoretic tag of the species specific probes are selected to have different electrophoretic mobilities.

48. An assay comprising: exposing a sample comprising a nucleic acid template to a universal probe and a species specific probe, the universal probe comprising a first tag coupled to a nucleic acid sequence effective to hybridize to a conserved region of a pathogen, the universal probe comprising at least a first region and a second region, wherein the first region is complementary to the second region to provide a hairpin structure, and the species specific probe comprising a second tag coupled to a nucleic acid sequence effective to hybridize to non-conserved region of the pathogen to identify the species of pathogen, the species specific probe comprising at least a first region and a second region, wherein the first region is complementary to the second region to provide a hairpin structure; and determining the type and/or species of pathogen in the sample by detecting cleavage of at least one of the first tag and the second tag after amplification of the nucleic acid template.

49. The assay of claim 48, further comprising detecting the cleaved first tag and the cleaved second tag by capillary electrophoresis, fluorescence or using an array.

50. A kit comprising: a universal probe comprising a first tag coupled to a nucleic acid sequence effective to hybridize to a conserved region of a pathogen, the universal probe comprising at least a first region and a second region, wherein the first region is complementary to the second region to provide a hairpin structure; a species specific probe comprising a second tag coupled to a nucleic acid sequence effective to hybridize to non-conserved region of the pathogen to identify the species of pathogen, the species specific probe comprising at least a first region and a second region, wherein the first region is complementary to the second region to provide a hairpin structure; and instructions for using the universal probe and the species specific probe.

51. A device comprising : a chamber configured to allow exposure of a sample to a universal probe comprising a first electrophoretic tag and a species specific probe comprising a second electrophoretic tag; a separation device coupled to the chamber and configured to separate the first electrophoretic tag from the second electrophoretic tag; and a detector configured to detect the first electrophoretic tag and the second electrophoretic tag.