WO2009047360A9 - Il-21 antibodies - Google Patents

Il-21 antibodies Download PDF

Info

Publication number
WO2009047360A9
WO2009047360A9 PCT/EP2008/063723 EP2008063723W WO2009047360A9 WO 2009047360 A9 WO2009047360 A9 WO 2009047360A9 EP 2008063723 W EP2008063723 W EP 2008063723W WO 2009047360 A9 WO2009047360 A9 WO 2009047360A9
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
seq
sequence
antibodies
amino acid
Prior art date
Application number
PCT/EP2008/063723
Other languages
French (fr)
Other versions
WO2009047360A1 (en
Inventor
Stefan Zahn
Anne Worsaae KLÜVER
Dorthe Lundsgaard
Jesper Pass
Birgitte Friedrichsen
Original Assignee
Novo Nordisk A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novo Nordisk A/S filed Critical Novo Nordisk A/S
Publication of WO2009047360A1 publication Critical patent/WO2009047360A1/en
Publication of WO2009047360A9 publication Critical patent/WO2009047360A9/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/244—Interleukins [IL]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Definitions

  • the field of the invention is generation of anti-IL-21 antibodies for use in treatment of inflammatory diseases, such as human autoimmune diseases, such as rheumatoid arthritis, systemic sclerosis and inflammatory bowel disease, and other immunologically related diseases, such as graft transplant rejection.
  • inflammatory diseases such as human autoimmune diseases, such as rheumatoid arthritis, systemic sclerosis and inflammatory bowel disease
  • other immunologically related diseases such as graft transplant rejection.
  • IL-21 is a 4-helical bundle cytokine produced by activated T cells and belonging to the family of cytokines signalling through the common ⁇ -chain receptor in a complex with a private IL-21 R chain (Parrish-Novak et al., Nature 408, 57-63 (2000)).
  • IL-21 and/or IL-21 R has been shown to be upregulated in several human autoimmune diseases, for instance rheumatoid arthritis, systemic sclerosis and inflammatory bowel disease.
  • IL-21 -antagonism has been shown to be beneficial in animal models for rheumatoid arthritis, systemic lupus erythematosus and inflammatory bowel disease (see for instance Young et al., Arthritis & Rheumatism 56, 1152-1163 (2007), Herber et al., J. Immunol. 178, 3822-3830 (2007), and Fina et al., Gastroenterology 134, 1038-1048 (2008)).
  • T H 17-cells This subset of T cells is also potent producers of IL-21 suggesting an autocrine loop of enhancing auto-aggression in inflammatory diseases (Korn T., Nature 448, 484-487 (2007), Nurieva R., Nature 448, 480-483 (2007) and Zhou L., Nat. Immunol. 8(9), 967-974 (2007)). It is suggested that antibodies specific for IL-21 can be used for treatment of such conditions. IL21 antagonism has also been implicated in graft rejection (Baan CC, Transplantation 83(11 ), 1485-1492 (2007).
  • WO2006057027 concerns antigenic epitopes of IL-21 and antibodies binding thereto.
  • WO20071 11714 concerns anti-IL21 antibodies directed against specific epitopes
  • this invention provides antibodies specific for IL-21 having an amino acid sequence comprising one or more of the CDR regions of an anti-IL-21 antibody having an amino acid sequence for V L as presented in SEQ ID No. 1 and an amino acid sequence for V H as presented in SEQ ID No. 2 or of an anti-IL-21 antibody having an amino acid sequence for V L as presented in SEQ ID No. 9 and an amino acid sequence for V H as presented in SEQ ID No. 10 as well as anti-IL-21 antibodies and other IL-21 binding proteins competing with such antibodies for binding to IL-21.
  • this invention provides nucleic acids encoding such peptides, expression vectors comprising such nucleic acid as well as host cells expressing them.
  • this invention provides methods of treating diseases and disorders, wherein said disease or disorder may be treatable by use of an IL-21 antagonist, such as autoimmune and/or inflammatory disease, such as systemic lupus erythematosus, rheumatoid arthritis or inflammatory bowel disease, using, either alone or in combination with other agents, the IL-21 binding peptides of the invention.
  • an IL-21 antagonist such as autoimmune and/or inflammatory disease, such as systemic lupus erythematosus, rheumatoid arthritis or inflammatory bowel disease
  • FIG. 2 BAF-3(hlL21 R) cells were stimulated with serial dilutions of two different preparations of hlL-21. As controls, BAF-3(hlL-21 R) cells were left unstimulated or stimulated with an irrelevant cytokine. From the generated curves the IC 50 and maximal induced proliferative response was calculated (by GraphPad Prism software). Further information in Example 3.
  • FIG. 3 BAF-3(hlL21 R) cells were initially stimulated with 10 "9 M hlL-21 and added serial dilutions of two different rabbit anti hlL-21 polyclonal antibodies. As negative control is shown cells with no stimulation by hlL-21. Further information in Example 3.
  • SEQ ID No. 1 is the amino acid sequence of V L of the antibody 1 F1.
  • SEQ ID No. 2 is the amino acid sequence of V H of the antibody 1 F1.
  • SEQ ID No. 3 is the amino acid sequence of V L -CDR1 of the antibody 1 F1.
  • SEQ ID No. 4 is the amino acid sequence of V L -CDR2 of the antibody 1 F1.
  • SEQ ID No. 5 is the amino acid sequence of V L -CDR3 of the antibody 1 F1.
  • SEQ ID No. 6 is the amino acid sequence of V H -CDR1 of the antibody 1 F1.
  • SEQ ID No. 7 is the amino acid sequence of V H -CDR2 of the antibody 1 F1.
  • SEQ ID No. 8 is the amino acid sequence of V H -CDR3 of the antibody 1 F1.
  • SEQ ID No. 9 is the amino acid sequence of V L of the antibody 1 F22.
  • SEQ ID No. 10 is the amino acid sequence of V H of the antibody 1 F22.
  • SEQ ID No. 11 is the amino acid sequence of V L -CDR1 of the antibody 1 F22.
  • SEQ ID No. 12 is the amino acid sequence of V L -CDR2 of the antibody 1 F22.
  • SEQ ID No. 13 is the amino acid sequence of V L -CDR3 of the antibody 1 F22.
  • SEQ ID No. 14 is the amino acid sequence of V H -CDR1 of the antibody 1 F22.
  • SEQ ID No. 15 is the amino acid sequence of V H -CDR2 of the antibody 1 F22.
  • SEQ ID No. 16 is the amino acid sequence of V H -CDR3 of the antibody 1 F22.
  • SEQ ID No. 17 is the nucleic acid sequence encoding the V L of the antibody 1 F1.
  • SEQ ID No. 18 is the nucleic acid sequence encoding the V H of the antibody 1 F1.
  • SEQ ID No. 19 is the nucleic acid sequence encoding the V L of the antibody 1 F22.
  • SEQ ID No. 20 is the nucleic acid sequence encoding the V H of the antibody 1 F22.
  • SEQ ID No. 21 is the amino acid sequence of human IL-21.
  • SEQ ID No. 22 is the amino acid sequence of C H for murine lgG2a.
  • SEQ ID No. 23 is the amino acid sequence of C H for murine IgGL
  • SEQ ID No. 24 is the amino acid sequence of C L for the murine IgGI and lgG2a.
  • the present invention provides IL-21 binding peptides ("IL-21 BPs”), which may be useful in the treatment, diagnosis and prevention of a variety of disorders, in which IL-21 antagonism is considered a potentially viable treatment.
  • IL-21 BPs IL-21 binding peptides
  • IL-21 antigen or “antigen IL-21” are used interchangeably herein, and is intended to describe an IL-21 polypeptide having an amino acid sequence as shown in SEQ ID No. 21.
  • the present invention provides an IL-21 binding peptide, which is capable of antagonizing the action of IL-21 on the human IL-21 receptor.
  • IL-21 binding peptide is capable of decreasing the activity of IL-21 on the human IL-21 receptor by at least 25%, such as at least 50%, for instance at least 75%, such as at least 90%
  • the antagonism of said IL-21 binding peptide is determined by use of an assay as described in Example 3.
  • the IL-21 BPs according to the present invention competes with an anti-IL21 antibody having a) a V L domain having the amino acid sequence of SEQ ID No. 1 and a V H domain having the amino acid sequence of SEQ ID No. 2 and/or b) an anti-IL21 antibody having a V L domain having the amino acid sequence of SEQ ID No. 9 and a V H domain having the amino acid sequence of SEQ ID No. 10 for binding to IL-21.
  • the anti-IL21 antibody 1 F1 is a murine lgG2a antibody having a V L domain having the amino acid sequence of SEQ ID No. 1 and a V H domain having the amino acid sequence of SEQ ID No. 2.
  • the C H region of murine lgG2a is presented in SEQ ID No. 22.
  • the anti-IL21 antibody 1 F22 is a murine IgGI antibody having a V L domain having the amino acid sequence of SEQ ID No. 9 and a V H domain having the amino acid sequence of SEQ ID No. 10.
  • the C H region of murine IgGI is presented in SEQ ID No. 23.
  • the CL region of the two antibodies are identical and shown as SEQ ID No. 24.
  • the generation of the anti-IL21 antibodies 1 F1 and 1 F22 are described in the examples.
  • Antibodies interact with target antigens primarily through amino acid residues that are located in the six heavy and light chain complementarity determining regions (CDRs). For this reason, the amino acid sequences within CDRs are more diverse between individual antibodies than sequences outside of CDRs. Because CDR sequences are responsible for most antibody-antigen interactions, it is possible to express recombinant antibodies that mimic the properties of specific naturally occurring antibodies by constructing expression vectors that include CDR sequences from the specific naturally occurring antibody grafted onto framework sequences from a different antibody with different properties (see for instance Riechmann, L. et al., Nature 332, 323-327 (1998), Jones, P. et al., Nature 321, 522-525 (1986) and Queen, C. et al., PNAS USA 86, 10029-10033 (1989)).
  • the recombinant antibodies of the present invention prepared as set forth above may comprise the heavy and light chain CDR3s of 1 F1 and 1 F22.
  • Antibodies of the present invention may further comprise the CDR2s of 1 F1 and 1 F22, and the antibodies of the present invention may further comprise the CDR1 s of 1 F1 and 1 F22.
  • peptide with respect to both I L-21 -binding peptides and non-IL-21 peptides described herein includes any suitable peptide and may be used synonymously with the terms polypeptide and protein, unless otherwise stated or contradicted by context; provided that the reader recognize that each type of respective amino acid polymer- containing molecules may be associated with significant differences and thereby form individual embodiments of the present invention (for example, a peptide such as an antibody, which is composed of multiple polypeptide chains, is significantly different from, for example, a single chain antibody, a peptide immunoadhesin, or single chain immunogenic peptide).
  • peptide herein should generally be understood as referring to any suitable peptide of any suitable size and composition (with respect to the number of amino acids and number of associated chains in a protein molecule). Moreover, peptides in the context of the inventive methods and compositions described herein may comprise non- naturally occurring and/or non-L amino acid residues, unless otherwise stated or contradicted by context.
  • peptide and if discussed as individual embodiments of the term(s) polypeptide and/or protein also encompasses derivatized peptide molecules.
  • a derivative is a peptide in which one or more of the amino acid residues of the peptide have been chemically modified (for instance by alkylation, acylation, ester formation, or amide formation) and/or associated with one or more non- amino acid organic and/or inorganic atomic or molecular substituents (for instance a polyethylene glycol (PEG) group, a lipophilic substituent (which optionally may be linked to the amino acid sequence of the peptide by a spacer residue or group such as ⁇ -alanine, ⁇ -aminobutyric acid (GABA), L/D-glutamic acid, succinic acid, and the like), a fluorophore, biotin, a radionu
  • Non-limiting examples of unusual amino acid residues that can be incorporated into a peptide include, for instance, 2-aminoadipic acid, 3-aminoadipic acid, ⁇ -alanine, ⁇ -aminopropionic acid, 2-aminobutyric acid, 4-aminobutyric acid, 6-aminocaproic acid, 2-aminoheptanoic acid, 2-aminoisobutyric acid, 3-aminoisobutyric acid, 2-aminopimelic acid, 2,4-diaminobutyric acid, desmosine, 2,2'-diaminopimelic acid, 2,3-diaminopropionic acid, N-ethylglycine, N-ethylasparagine, hydroxylysine, allohydroxylysine, 3-hydroxyproline, 4-hydroxyproline, isodesmosine, alloisoleucine, N-methylglycine, N-methylisoleucine, 6-N-methyllysine, N-methylva
  • Antigen binding peptides refers to any peptide that specifically binds to a portion of a given antigen under cellular and/or physiological conditions for an amount of time sufficient to induce, promote, enhance, and/or otherwise modulate a physiological effect associated with the antigen; to allow detection by ELISA, Western blot, or other similarly suitable protein binding technique described herein and/or known in the art; and/or to otherwise be detectably bound thereto after a relevant period of time (for instance at least about 15 minutes, at least about 30 minutes, at least about 45 minutes, at least about 1 hour, at least about 2 hours, at least about 4 hours, at least about 6 hours, at least about 12 hours, about 1-24 hours, about 1 -36 hours, about 1 -48 hours, about 1-72 hours, about one week, or longer).
  • a relevant period of time for instance at least about 15 minutes, at least about 30 minutes, at least about 45 minutes, at least about 1 hour, at least about 2 hours, at least about 4 hours, at least about 6 hours, at least about 12 hours
  • IL-21 binding peptide is an antigen binding peptide that specifically binds to the antigen IL-21.
  • immunoglobulin refers to a molecule belonging to a class of structurally related glycoproteins consisting of two pairs of polypeptide chains, one pair of light (L) low molecular weight chains and one pair of heavy (H) chains, all four inter-connected by disulfide bonds.
  • L light
  • H heavy
  • each heavy chain typically is comprised of a heavy chain variable region (abbreviated herein as V H ) and a heavy chain constant region.
  • V H heavy chain variable region
  • the heavy chain constant region typically is comprised of three domains, C H 1 , C H 2, and C H 3.
  • Each light chain typically is comprised of a light chain variable region (abbreviated herein as V L ) and a light chain constant region.
  • the light chain constant region typically is comprised of one domain, C L .
  • the V H and V L regions may be further subdivided into regions of hypervariability (or hypervariable regions which may be hypervariable in sequence and/or form of structurally defined loops), also termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs).
  • CDRs complementarity determining regions
  • Each V H and V L is typically composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1 , CDR1 , FR2, CDR2, FR3, CDR3, FR4 (see also Chothia and Lesk J. MoI. Biol. 196, 901-917 (1987)).
  • FR1 , CDR1 , FR2, CDR2, FR3, CDR3, FR4 see also Chothia and Lesk J. MoI. Biol. 196, 901-917 (1987)
  • the numbering of amino acid residues in this region is performed by the method described in Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD.
  • variable domain residue numbering as in Kabat or “according to Kabat” herein refer to this numbering system for heavy chain variable domains or light chain variable domains.
  • the actual linear amino acid sequence of a peptide may contain fewer or additional amino acids corresponding to a shortening of, or insertion into, a FR or CDR of the variable domain.
  • a heavy chain variable domain may include a single amino acid insert (residue 52a according to Kabat) after residue 52 of V H CDR2 and inserted residues (for instance residues 82a, 82b, and 82c, etc. according to Kabat) after heavy chain FR residue 82.
  • the Kabat numbering of residues may be determined for a given antibody by alignment at regions of homology of the sequence of the antibody with a "standard" Kabat numbered sequence.
  • antibody in the context of the present invention refers to an immunoglobulin molecule, a fragment of an immunoglobulin molecule, or a derivative of either thereof, which has the ability to specifically bind to an antigen under typical physiological conditions for significant periods of time such as at least about 30 minutes, at least about 45 minutes, at least about one hour, at least about two hours, at least about four hours, at least about 8 hours, at least about 12 hours, about 24 hours or more, about 48 hours or more, about 3, 4, 5, 6, 7 or more days, etc., or any other relevant functionally- defined period (such as a time sufficient to induce, promote, enhance, and/or modulate a physiological response associated with antibody binding to the antigen).
  • periods of time such as at least about 30 minutes, at least about 45 minutes, at least about one hour, at least about two hours, at least about four hours, at least about 8 hours, at least about 12 hours, about 24 hours or more, about 48 hours or more, about 3, 4, 5, 6, 7 or more days, etc., or any other relevant functionally- defined period (
  • variable regions of the heavy and light chains of the immunoglobulin molecule contain a binding domain that interacts with an antigen.
  • the constant regions of the antibodies (Abs) may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (such as effector cells) and the first component (CIq) of the classical complement system.
  • An anti-IL-21 antibody may be a bispecific antibody, diabody, or similar molecule
  • bispecific antibodies, diabodies, and the like, provided by the present invention may bind any suitable target in addition to a portion of IL-21.
  • antibody herein, unless otherwise stated or clearly contradicted by context, includes fragments of any suitable full lenght antibody, which fragment retains the ability to specifically bind to an antigen. It has been shown that the antigen-binding function of an antibody may be performed by fragments of a full-length antibody.
  • binding fragments encompassed within the term "antibody” include (i) a Fab fragment, a monovalent fragment consisting of the V L , V H , C L and C H 1 domains; (ii) F(ab) 2 and F(ab') 2 fragments, bivalent fragments comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting or consisting essentially of the V H and C H 1 domains; (iv) a Fv fragment consisting or consisting essentially of the V L and V H domains of a single arm of an antibody, (v) a dAb fragment (Ward et al., Nature 341 , 544-546 (1989)), which consists or consists essentially of a V H domain; and (vi) an isolated complementarity determining region (CDR).
  • a Fab fragment a monovalent fragment consisting of the V L , V H , C L and C H 1 domains
  • the two domains of the Fv fragment, V L and V H are coded for by separate genes, they may be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the V L and V H regions pair to form monovalent molecules (known as single chain antibodies or single chain Fv (scFv), see for instance Bird et al., Science 242, 423-426 (1988) and Huston et al., PNAS USA 85, 5879-5883 (1988)).
  • single chain antibodies are also encompassed within the term antibody unless otherwise noted or clearly indicated by context.
  • other forms of single chain antibodies, such as diabodies are included within the term antibody.
  • fragments are generally included within the meaning of antibody, they collectively and each independently are unique features of the present invention, exhibiting different biological properties and utility. These and other useful antibody fragments in the context of the present invention are discussed further herein.
  • antibody also generally includes antibodies that can be classified by various other structural properties, such as polyclonal antibodies, monoclonal antibodies (mAbs), antibody-like polypeptides, such as chimeric antibodies and humanized antibodies, anti-idiotypic (anti-Id) antibodies to antibodies, and antibody fragments retaining the ability to specifically bind to the antigen (antigen-binding fragments) provided by any known technique, such as enzymatic cleavage, peptide synthesis, and recombinant techniques.
  • an antibody in the context of the invention can possess any isotype.
  • An "anti-IL-21 antibody” is an antibody as described above, which binds specifically to the antigen IL-21.
  • epitope means a protein determinant capable of specific binding to an antibody.
  • Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics. Conformational and nonconformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents.
  • the epitope may comprise amino acid residues directly involved in the binding (also called immunodominant component of the epitope) and other amino acid residues, which are not directly involved in the binding, such as amino acid residues which are effectively blocked by the specifically antigen binding peptide (in other words, the amino acid residue is within the footprint of the specifically antigen binding peptide).
  • bispecific molecule is intended to include any agent, such as a protein, peptide, or protein or peptide complex, which has two different binding specificities.
  • the molecule may bind to, or interact with, (a) a cell surface antigen and (b) an Fc receptor on the surface of an effector cell.
  • multispecific molecule is intended to include any agent, for instance a protein, peptide, or protein or peptide complex, which has more than two different binding specificities.
  • the molecule may bind to, or interact with, (a) a cell surface antigen, (b) an Fc receptor on the surface of an effector cell, and (c) at least one other component.
  • the present invention includes, but is not limited to, bispecific, trispecific, tetraspecific, and other multispecific molecules which are directed to IL-21 , and to other cell surface antigens or targets, such as Fc receptors on effector cells.
  • bispecific antibodies is intended to include any anti-IL-21 antibody, which is a bispecific molecule.
  • the term “bispecific antibodies” also includes diabodies. Diabodies are bivalent, bispecific antibodies in which the V H and V L domains are expressed on a single polypeptide chain, but using a linker that is too short to allow for pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain and creating two antigen binding sites (see for instance Holliger, P. et al., PNAS USA 90, 6444-6448 (1993), Poljak, R.J. et al., Structure 2, 1121-1123 (1994)).
  • effector cell refers to an immune cell which is involved in the effector phase of an immune response, as opposed to the cognitive and activation phases of an immune response.
  • exemplary immune cells include cells of a myeloid or lymphoid origin, for instance lymphocytes (such as B cells and T cells including cytolytic T cells (CTLs)), killer cells, natural killer cells, macrophages, monocytes, eosinophils, neutronphils, polymorphonuclear cells, granulocytes, mast cells, and basophils.
  • lymphocytes such as B cells and T cells including cytolytic T cells (CTLs)
  • killer cells such as B cells and T cells including cytolytic T cells (CTLs)
  • killer cells such as B cells and T cells including cytolytic T cells (CTLs)
  • killer cells such as B cells and T cells including cytolytic T cells (CTLs)
  • killer cells such as B cells and T cells including cytolytic T cells (CTLs)
  • killer cells such as B cells and T
  • an effector cell is capable of inducing antibody-dependent cellular cytotoxicity (ADCC), such as a neutrophil capable of inducing ADCC.
  • ADCC antibody-dependent cellular cytotoxicity
  • monocytes, macrophages, which express FcR are involved in specific killing of target cells and presenting antigens to other components of the immune system, or binding to cells that present antigens.
  • an effector cell may phagocytose a target antigen, target cell, or microorganism.
  • the expression of a particular FcR on an effector cell may be regulated by humoral factors such as cytokines.
  • Fc ⁇ RI has been found to be up-regulated by interferon Y (IFN- ⁇ ) and/or G-CSF. This enhanced expression increases the cytotoxic activity of Fc ⁇ RI-bearing cells against targets.
  • An effector cell can phagocytose or lyse a target antigen or a target cell.
  • human antibody is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences.
  • the human antibodies of the present invention may include amino acid residues not encoded by human germline immunoglobulin sequences (for instance mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo).
  • human antibody is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences.
  • a human antibody is "derived from" a particular germline sequence if the antibody is obtained from a system using human immunoglobulin sequences, for instance by immunizing a transgenic mouse carrying human immunoglobulin genes or by screening a human immunoglobulin gene library, and wherein the selected human antibody is at least 90%, such as at least 95%, for instance at least 96%, such as at least 97%, for instance at least 98%, or such as at least 99% identical in amino acid sequence to the amino acid sequence encoded by the germline immunoglobulin gene.
  • a human antibody derived from a particular human germline sequence will display no more than 10 amino acid differences, such as no more than 5, for instance no more than 4, 3, 2, or 1 amino acid difference from the amino acid sequence encoded by the germline immunoglobulin gene.
  • chimeric antibody refers to an antibody that contains one or more regions from one antibody and one or more regions from one or more other antibodies.
  • the term “chimeric antibody” includes monovalent, divalent, or polyvalent antibodies.
  • a monovalent chimeric antibody is a dimer (HL)) formed by a chimeric H chain associated through disulfide bridges with a chimeric L chain.
  • a divalent chimeric antibody is tetramer (H 2 L 2 ) formed by two HL dimers associated through at least one disulfide bridge.
  • a polyvalent chimeric antibody may also be produced, for example, by employing a CH region that aggregates (for instance from an IgM H chain, or ⁇ chain).
  • a chimeric antibody refers to an antibody in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (see for instance US 4,816,567 and Morrison et al., PNAS USA 81., 6851-6855 (1984)).
  • Chimeric antibodies are produced by recombinant processes well known in the art (see for instance Cabilly et al., PNAS USA 8_1, 3273-3277 (1984), Morrison et al., PNAS USA 8J., 6851-6855 (1984), Boulianne et al., Nature 312, 643-646 (1984), EP125023, Neuberger et al., Nature 314, 268-270 (1985), EP171496, EP173494, WO86/01533, EP184187, Sahagan et al., J. Immunol. 137, 1066-1074 (1986), WO87/02671 , Liu et al., PNAS USA 84.
  • a “humanized antibody” is an antibody that is derived from a non-human species, in which certain amino acids in the framework and constant domains of the heavy and light chains have been mutated so as to avoid or abrogate an immune response in humans.
  • Humanized forms of non-human (for instance murine) antibodies are chimeric antibodies which contain minimal sequence derived from non-human immunoglobulin.
  • humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and capacity.
  • Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • humanized antibodies may comprise residues which are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance.
  • a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin sequence.
  • a humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
  • monoclonal antibody or “monoclonal antibody composition” as used herein refer to a preparation of antibody molecules of single molecular composition.
  • a monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
  • human monoclonal antibody refers to antibodies displaying a single binding specificity which have variable and constant regions derived from human germline immunoglobulin sequences.
  • the human monoclonal antibodies may be generated by a hybridoma which includes a B cell obtained from a transgenic or transchromosomal nonhuman animal, such as a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene, fused to an immortalized cell.
  • recombinant human antibody includes all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as (a) antibodies isolated from an animal (such as a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom (described further elsewhere herein), (b) antibodies isolated from a host cell transformed to express the antibody, such as from a transfectoma, (c) antibodies isolated from a recombinant, combinatorial human antibody library, and (d) antibodies prepared, expressed, created or isolated by any other means that involve splicing of human immunoglobulin gene sequences to other DNA sequences.
  • Such recombinant human antibodies have variable and constant regions derived from human germline immunoglobulin sequences.
  • such recombinant human antibodies may be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the V H and V L regions of the recombinant antibodies are sequences that, while derived from and related to human germline V H and V L sequences, may not naturally exist within the human antibody germline repertoire in vivo.
  • a "heterologous antibody” is defined in relation to the transgenic non-human organism producing such an antibody.
  • This term refers to an antibody having an amino acid sequence corresponding to that found in an organism not consisting of the non- human animal, and generally from a species other than that of the transgenic non-human animal.
  • An "isolated antibody,” as used herein, is intended to refer to an antibody which is substantially free of other antibodies having different antigenic specificities (for instance an isolated antibody that specifically binds to IL-21 is substantially free of antibodies that specifically bind antigens other than IL-21).
  • An isolated antibody that specifically binds to an epitope, isoform or variant of human IL-21 may, however, have cross-reactivity to other related antigens, for instance from other species (such as IL-21 species homologs).
  • an isolated antibody may be substantially free of other cellular material and/or chemicals.
  • a combination of "isolated" monoclonal antibodies having different specificities are combined in a well defined composition.
  • specific binding refers to the binding of an antigen binding peptide, such as an antibody, to a predetermined antigen.
  • the antigen binding peptide such as an antibody, binds with an affinity corresponding to a K D of about 10 '7 M or less, such as about 10 '8 M or less, such as about 10 '9 M or less, about 10 '10 M or less, or about 10 '11 M or even less when determined by for instance surface plasmon resonance (SPR) technology in a BIAcore 3000 instrument using the antigen as the ligand and the antibody as the analyte, and binds to the predetermined antigen with an affinity corresponding to a K D that is at least ten-fold lower, such as at least 100 fold lower, for instance at least 1000 fold lower, such as at least 10,000 fold lower, for instance at least 100,000 fold lower than its affinity for binding to a non-specific antigen (e.g., BSA, casein) other than the predetermined antigen or a closely-related antigen.
  • a non-specific antigen e.g., BSA, casein
  • the amount with which the affinity is lower is dependent on the K D of the antigen binding peptide, so that when the K 0 of the antigen binding peptide is very low (that is, the antigen binding peptide is highly specific), then the amount with which the affinity for the antigen is lower than the affinity for a non-specific antigen may be at least 10,000 fold.
  • the phrases "an antigen binding peptide recognizing an antigen” and “an antigen binding peptide specific for an antigen” are used interchangeably herein with the term “an antigen binding peptide which binds specifically to an antigen”.
  • the phrases “an antibody recognizing an antigen” and “an antibody specific for an antigen” are used interchangeably herein with the term “an antibody which binds specifically to an antigen”
  • k d (sec 1 ), as used herein, refers to the dissociation equilibrium rate constant of a particular antibody-antigen interaction. Said value is also referred to as the k off value.
  • k a (M '1 x sec '1 ), as used herein, refers to the association equilibrium rate constant of a particular antibody-antigen interaction.
  • K 0 (M), as used herein, refers to the dissociation equilibrium constant of a particular antibody-antigen interaction.
  • K A (M '1 ), as used herein, refers to the association equilibrium constant of a particular antibody-antigen interaction and is obtained by dividing the k a by the k d .
  • isotype refers to the immunoglobulin class (for instance IgGI , lgG2, lgG3, lgG4, IgD, IgA, IgE, or IgM) that is encoded by heavy chain constant region genes.
  • isotype switching refers to the phenomenon by which the class, or isotype, of an antibody changes from one immunoglobulin class to one of the other immunoglobulin classes.
  • nonswitched isotype refers to the isotypic class of heavy chain that is produced when no isotype switching has taken place; the CH gene encoding the nonswitched isotype is typically the first CH gene immediately downstream from the functionally rearranged VDJ gene. Isotype switching has been classified as classical or non- classical isotype switching.
  • Classical isotype switching occurs by recombination events which involve at least one switch sequence region in the transgene.
  • Non-classical isotype switching may occur by, for example, homologous recombination between human ⁇ and human ⁇ ( ⁇ -associated deletion).
  • Alternative non-classical switching mechanisms such as intertransgene and/or interchromosomal recombination, among others, may occur and effectuate isotype switching.
  • switch sequence refers to those DNA sequences responsible for switch recombination.
  • a "switch donor” sequence typically a ⁇ switch region, will be 5' (i.e., upstream) of the construct region to be deleted during the switch recombination.
  • the "switch acceptor” region will be between the construct region to be deleted and the replacement constant region (for instance Y, ⁇ , etc.). As there is no specific site where recombination always occurs, the final gene sequence will typically not be predictable from the construct.
  • glycosylation pattern is defined as the pattern of carbohydrate units that are covalently attached to a protein, more specifically to an immunoglobulin (antibody) protein.
  • a glycosylation pattern of a heterologous antibody may be characterized as being substantially similar to glycosylation patterns which occur naturally on antibodies produced by the species of the non-human transgenic animal, when one of ordinary skill in the art would recognize the glycosylation pattern of the heterologous antibody as being more similar to said pattern of glycosylation in the species of the non-human transgenic animal than to the species from which the CH genes of the transgene were derived.
  • naturally-occurring refers to the fact that an object may be found in nature.
  • a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that may be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally-occurring.
  • rearranged refers to a configuration of a heavy chain or light chain immunoglobulin locus wherein a V segment is positioned immediately adjacent to a D-J or J segment in a conformation encoding essentially a complete V H or V L domain, respectively.
  • a rearranged immunoglobulin (antibody) gene locus may be identified by comparison to germline DNA; a rearranged locus will have at least one recombined heptamer/nonamer homology element.
  • V segment refers to the configuration wherein the V segment is not recombined so as to be immediately adjacent to a D or J segment.
  • nucleic acid molecule is intended to include DNA molecules and RNA molecules.
  • a nucleic acid molecule may be single-stranded or double- stranded, but is preferably double-stranded DNA.
  • the nucleic acids may be present in whole cells, in a cell lysate, or in a partially purified or substantially pure form.
  • a nucleic acid is "isolated” or “rendered substantially pure” when purified away from other cellular components or other contaminants, such as other cellular nucleic acids or proteins, by standard techniques, including alkaline/SDS treatment, CsCI banding, column chromatography, agarose gel electrophoresis and others well known in the art. See, F. Ausubel et al., ed.
  • a nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence.
  • a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence.
  • operably linked means that the DNA sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame.
  • operably linked indicates that the sequences are capable of effecting switch recombination.
  • the term "inhibits growth" is intended to include any measurable decrease in the cell growth when contacted with an IL-21 BP, such as an anti-IL-21 antibody, as compared to the growth of the same cells not in contact with an IL-21 BP, such as an anti-IL-21 antibody, for instance an inhibition of growth of a cell culture by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99%, or 100%.
  • the terms “inhibits binding” and “blocks binding” are used interchangeably and encompass both partial and complete inhibition/blocking.
  • the inhibition/blocking of binding of an IL-21 binding partner to IL-21 may reduce or alter the normal level or type of cell signaling that occurs when an IL-21 binding partner binds to IL-21 without inhibition or blocking.
  • Inhibition and blocking are also intended to include any measurable decrease in the binding affinity of an IL-21 binding partner to IL-21 when in contact with an IL-21 BP, such as an anti-IL-21 antibody, as compared to the ligand not in contact with an IL-21 BP, such as an anti-IL-21 antibody, for instance a blocking of binding of an IL-21 binding partner to IL-21 by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99%, or 100%.
  • vector is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • plasmid refers to a circular double stranded DNA loop into which additional DNA segments may be ligated.
  • viral vector Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome.
  • Certain vectors are capable of autonomous replication in a host cell into which they are introduced (for instance bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (such as non-episomal mammalian vectors) may be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
  • vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as “recombinant expression vectors” (or simply, “expression vectors”).
  • expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
  • plasmid and vector may be used interchangeably as the plasmid is the most commonly used form of vector.
  • the present invention is intended to include such other forms of expression vectors, such as viral vectors (such as replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.
  • recombinant host cell (or simply “host cell”), as used herein, is intended to refer to a cell into which a recombinant expression vector has been introduced. It should be understood that such terms are intended to refer not only to the particular subject cell but to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term “host cell” as used herein.
  • Recombinant host cells include, for example, transfectomas, such as CHO cells, NS/0 cells, and lymphocytic cells.
  • regulatory sequence is intended to include promoters, enhancers and other expression control elements (for instance polyadenylation signals) that control the transcription or translation of the antibody chain genes.
  • promoters for instance promoters, enhancers and other expression control elements (for instance polyadenylation signals) that control the transcription or translation of the antibody chain genes.
  • Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology. Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). It will be appreciated by those skilled in the art that the design of the expression vector, including the selection of regulatory sequences may depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc.
  • regulatory sequences for mammalian host cell expression include viral elements that direct high levels of protein expression in mammalian cells, such as promoters and/or enhancers derived from cytomegalovirus (CMV), Simian Virus 40 (SV40), adenovirus, (e.g., the adenovirus major late promoter (AdMLP)) and polyoma.
  • CMV cytomegalovirus
  • SV40 Simian Virus 40
  • AdMLP adenovirus major late promoter
  • nonviral regulatory sequences may be used, such as the ubiquitin promoter or ⁇ -globin promoter.
  • the term "subject” includes any human or non-human animal.
  • non-human animal includes all vertebrates, for instance mammals and non-mammals, such as non-human primates, sheep, dog, cow, chickens, amphibians, reptiles, etc.
  • transfection are intended to encompass a wide variety of techniques commonly used for the introduction of exogenous DNA into a prokaryotic or eukaryotic host cell, e.g., electroporation, calcium-phosphate precipitation, DEAE-dextran transfection, lipofectin transfection and the like.
  • transfectoma includes recombinant eukaryotic host cells expressing the antibody, such as CHO cells, NS/0 cells, HEK293 cells, plant cells, or fungi, including yeast cells.
  • transgenic, non-human animal refers to a non-human animal having a genome comprising one or more human heavy and/or light chain transgenes or transchromosomes (either integrated or non-integrated into the animal's natural genomic DNA) and which is capable of expressing fully human antibodies.
  • a transgenic mouse can have a human light chain transgene and either a human heavy chain transgene or human heavy chain transchromosome, such that the mouse produces human anti-IL-21 antibodies when immunized with IL-21 antigen.
  • the human heavy chain transgene may be integrated into the chromosomal DNA of the mouse, as is the case for transgenic mice, for instance HuMAb mice, such as HCo7 or HCo12 mice, or the human heavy chain transgene may be maintained extrachromosomally, as is the case for transchromosomal KM mice as described in WO02/43478.
  • transgenic and transchromosomal mice are capable of producing multiple isotypes of human monoclonal antibodies to a given antigen (such as IgG, IgA, IgM, IgD and/or IgE) by undergoing V-D-J recombination and isotype switching.
  • Transgenic, nonhuman animal can also be used for production of antibodies against a specific antigen by introducing genes encoding such specific antibody, for example by operatively linking the genes to a gene which is expressed in the milk of the animal.
  • the term "specificity" herein refers to the ability of an IL-21 binding peptide, such as an anti-IL-21 antibody, to recognize an epitope within IL-21 , while only having little or no detectable reactivity with other portions of IL-21 (including other epitopes that are bound by other IL-21 BPs, such as anti-IL-21 antibodies). Specificity may be relatively determined by competition assays as described herein. Specificity can more particularly be determined by any of the epitope identification/characterization techniques described herein or their equivalents known in the art. An antibody with specificity for a particular antigenic determinant may nonetheless cross-react with other biomolecules that may be present in some biological context with IL-21.
  • an IL-21 BP such as an anti-IL-21 antibody
  • an anti-IL-21 antibody may cross-react with IL-21 homologues from other species.
  • typically such cross-reactive antibodies are selective for human IL-21 with respect to relevant structure and/or environmental factors.
  • an IL-21 BP such as an anti-IL-21 antibody
  • an IL-21 BP such as an anti-IL-21 antibody
  • an IL-21 BP, such as an anti-IL-21 antibody, of the present invention is selective for a portion of IL-21 in the context of colon cancer cells (i.e., the anti-IL-21 antibody will selectively bind to the portion of IL-21 over other components of a colon cancer cell).
  • the IL-21 BPs of the present invention are typically used in and provided in an at least "substantially isolated form”.
  • a “substantially isolated” molecule is a molecule that is the predominant species in the composition wherein it is found with respect to the class of molecules to which it belongs (i.e., it makes up at least about 50% of the type of molecule in the composition and typically will make up at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more of the species of molecule, e.g., peptide, in the composition (e.g., the composition will exhibit at least about 98%, 98%, or 99% homogeneity for the IL-21 BP in the context of all present peptide species)).
  • An isolated molecule refers to a molecule that is not associated with significant levels (such as more than about 1%, more than about 2%, more than about 3%, or more than about 5%) of any extraneous and undesirable physiological factors, such as non-IL-21 binding biomolecules (or IL-21 binding molecules that may interfere with the binding and/or activity of an IL-21 BP of the present invention) contained within a cell or animal in which the IL-21 BP is produced.
  • An isolated molecule also refers to any molecule that has passed through such a stage of purity due to human intervention (whether automatic, manual, or both).
  • an IL-21 BP may be present in relatively small amounts in terms of numbers of total molecular species in the composition (for instance in the case of a composition comprising a large amount of a pharmaceutically acceptable carrier, stabilizer, and/or preservative).
  • additional peptides such as BSA, may be included in such a composition with a previously purified IL-21 BP.
  • BSA additional peptides, such as BSA, may be included in such a composition with a previously purified IL-21 BP.
  • additional constituents of the composition are acceptable for the intended application of the IL-21 BP, such a composition can still be described as comprising an isolated IL-21 BP.
  • the IL-21 BPs of the present invention are typically "substantially free” of other IL-21 BPs, such as IL-21 BPs having different antigenic specificities.
  • the present invention does also provide a composition comprising a number of IL-21 BPs with different specificities and characteristics (for instance the present invention provides a "cocktail" of IL-21 BPs having different specificity and/or selectivity characteristics).
  • Treatment means the administration of an effective amount of a therapeutically active compound of the present invention with the purpose of easing, ameliorating, or eradicating (curing) symptoms or disease states.
  • the present invention provides an IL-21 BP comprising a V L region consisting essentially of the sequence of SEQ ID No. 1.
  • the present invention provides an IL-21 BP comprising a V H region consisting essentially of the sequence of SEQ ID No. 2. In one embodiment, the present invention provides an IL-21 BP comprising a V L region consisting essentially of the sequence of 1 and aV H region consisting essentially of the sequence of SEQ ID No. 2.
  • the present invention provides an IL-21 BP comprising a V L CDR1 consisting essentially of the sequence of SEQ ID No. 3. In one embodiment, the present invention provides an IL-21 BP comprising a V L
  • CDR2 consisting essentially of the sequence of SEQ ID No. 4.
  • the present invention provides an IL-21 BP comprising a V L CDR3 consisting essentially of the sequence of SEQ ID No. 5.
  • the present invention provides an IL-21 BP comprising a V H CDR1 consisting essentially of the sequence of SEQ ID No. 6.
  • the present invention provides an IL-21 BP comprising a V H CDR2 consisting essentially of the sequence of SEQ ID No. 7.
  • the present invention provides an IL-21 BP comprising a V H CDR3 consisting essentially of the sequence of SEQ ID No. 8. In one embodiment, the present invention provides an IL-21 BP comprising V L CDRs
  • V L CDR1 , CDR2, and CDR3 consisting essentially of SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No. 5, respectively.
  • the present invention provides an IL-21 BP that comprises V H CDRs (V H CDR1 , CDR2, and CDR3) consisting essentially of SEQ ID No. 6, SEQ ID No. 7 and SEQ ID No. 8, respectively. In one embodiment, the present invention provides an IL-21 BP that comprises
  • SEQ ID No. 7 and SEQ ID No. 8 in close proximity to one another (e.g., near the spacing of
  • V H CDRS in a wild-type anti-IL-21 antibody in the IL-21 BP.
  • the present invention provides an IL-21 BP that comprises a flexible linker positioned between the V L region and V H region of the IL-21 BP.
  • the present invention provides an IL-21 BP, wherein the V L and V H regions are presented on separate chains in the context of an immunoglobulin fold protein and oriented such that the V L CDR1 , CDR2, CDR3 and V H CDR1 , CDR2, and CDR3 cooperatively associate to contribute in selectively and/or specifically bind an antigenic determinant on IL-21.
  • the present invention provides an IL-21 BP that comprises two sets of variable domains (sets of associated V L and V H domains on associated separate chains), such that the IL-21 BP comprises two identical antigenic determinant binding sites.
  • any of such IL-21 BPs are expected to, at least in part, have similar epitope specificity, selectivity, and other characteristics as an antibody having a V L region comprising the sequence of SEQ ID No. 1 and a V H region comprising the sequence of SEQ ID No. 2, and, accordingly, may be useful in the treatment of multiple myeloma.
  • the present invention provides an IL-21 BP comprising a V L region consisting essentially of the sequence of SEQ ID No. 9.
  • the present invention provides an IL-21 BP comprising a V H region consisting essentially of the sequence of SEQ ID No. 10.
  • the present invention provides an IL-21 BP comprising a V L region consisting essentially of the sequence of SEQ ID No. 9 and aV H region consisting essentially of the sequence of SEQ ID No. 10.
  • the present invention provides an IL-21 BP comprising a V L CDR1 consisting essentially of the sequence of SEQ ID No. 1 1.
  • the present invention provides an IL-21 BP comprising a V L CDR2 consisting essentially of the sequence of SEQ ID No. 12.
  • the present invention provides an IL-21 BP comprising a V L CDR3 consisting essentially of the sequence of SEQ ID No. 13. In one embodiment, the present invention provides an IL-21 BP comprising a V H CDR1 consisting essentially of the sequence of SEQ ID No. 14.
  • the present invention provides an IL-21 BP comprising a V H CDR2 consisting essentially of the sequence of SEQ ID No. 15. In one embodiment, the present invention provides an IL-21 BP comprising a V H
  • CDR3 consisting essentially of the sequence of SEQ ID No. 16.
  • the present invention provides an IL-21 BP comprising V L CDRs (V L CDR1 , CDR2, and CDR3) consisting essentially of SEQ ID No. 11 , SEQ ID No. 12 and SEQ ID No. 13, respectively.
  • the present invention provides an IL-21 BP that comprises V H
  • V H CDR1 , CDR2, and CDR3 consisting essentially of SEQ ID No. 14, SEQ ID No. 15 and SEQ ID No. 16, respectively.
  • the present invention provides an IL-21 BP that comprises
  • V L CDRs which independently consist essentially of SEQ ID No. 1 1 , SEQ ID No. 12 and SEQ ID No. 13 in close proximity to one another (e.g., near the spacing of V L CDRs in a wild-type anti-IL-21 antibody) in the IL-21 BP and
  • the present invention provides an IL-21 BP that comprises a flexible linker positioned between the V L region and V H region of the IL-21 BP.
  • the present invention provides an IL-21 BP, wherein the V L and V H regions are presented on separate chains in the context of an immunoglobulin fold protein and oriented such that the V L CDR1 , CDR2, CDR3 and V H CDR1 , CDR2, and CDR3 cooperatively associate to contribute in selectively and/or specifically bind an antigenic determinant on IL-21.
  • the present invention provides an IL-21 BP that comprises two sets of variable domains (sets of associated V L and V H domains on associated separate chains), such that the IL-21 BP comprises two identical antigenic determinant binding sites.
  • any of such IL-21 BPs are expected to, at least in part, have similar epitope specificity, selectivity, and other characteristics as an antibody having a V L region comprising the sequence of SEQ ID No. 9 and a V H region comprising the sequence of SEQ ID No. 10 and, accordingly, may be useful in the treatment of multiple myeloma.
  • the present invention provides an IL-21 BP comprising a V L CDR1 consisting essentially of a sequence according to any one of SEQ ID No. 3 and SEQ ID No. 11 , wherein the N-terminal residue and/or one, two, or three of the C-terminal amino acid residues are missing.
  • the present invention provides an IL-21 BP comprising a V L CDR2 consisting essentially of a sequence according to any one of SEQ ID No. 4 and SEQ ID No. 12, wherein one or two of the N-terminal residues and/or one, two, or three of the C-terminal residues are missing.
  • the present invention provides an IL-21 BP comprising a V L CDR3 consisting essentially of a sequence according to any one of SEQ ID No. 5 and SEQ ID No. 13, wherein the N-terminal residue and/or one, two, three, or four of the C-terminal residues are missing.
  • the present invention provides an IL-21 BP comprising a V H CDR1 consisting essentially of a sequence according to any one of SEQ ID No. 6 and SEQ ID No. 14, wherein one, two, three, or four of the N-terminal residues and/or one, two, three, or four C-terminal residues are missing.
  • the present invention provides an IL-21 BP comprising a V H
  • CDR2 consisting essentially of a sequence according to any one of SEQ ID No. 7 and SEQ ID No. 15, wherein one, two, three, four, or five of the N-terminal amino acids thereof and/or one, two, three, four, five, or six of the C-terminal amino acids thereof are missing.
  • the present invention provides an IL-21 BP comprising a V H CDR3 consisting essentially of a sequence according to any one of SEQ ID No. 8 and SEQ ID No. 16, wherein the N-terminal one, two, or three amino acid residues and/or the C-terminal one, two, three, or four amino acid residues are missing.
  • the present invention also provides IL-21 BPs wherein these "truncated" CDR sequences are combined with each other and/or other CDR sequences described herein.
  • the present invention provides an IL-21 BP that comprises
  • V L CDRs which independently consist essentially of SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No. 5 in close proximity to one another in the IL-21 BP (e.g., near the spacing of V L CDRs in a wild-type anti-IL-21 antibody) and
  • V H CDRs which independently consist essentially of SEQ ID No. 6, SEQ ID No. 7 and SEQ ID No. 8 in close proximity to one another (e.g., near the spacing of
  • V H CDRS in a wild-type anti-IL-21 antibody in the IL-21 BP.
  • the present invention provides an IL-21 BP that comprises a flexible linker positioned between the V L region and V H region of the IL-21 BP.
  • the present invention provides an IL-21 BP wherein the V L and V H regions are presented on separate chains in the context of an immunoglobulin fold protein and oriented such that the V L CDR1 , CDR2, CDR3 and V H CDR1 , CDR2, and CDR3 cooperatively associate to contribute in selectively and/or specifically bind an antigenic determinant on IL-21.
  • the present invention provides an IL-21 BP that comprises two sets of variable domains (sets of associated V L and V H domains on associated separate chains), such that the IL-21 BP comprises two identical antigenic determinant binding sites.
  • any of such IL-21 BPs described in this paragraph are expected to, at least in part, have similar epitope specificity, selectivity, and other characteristics with an antibody having a V L sequence of SEQ ID No. 1 and a V H sequence of SEQ ID No. 2.
  • the present invention provides an IL-21 BP that comprises a flexible linker positioned between the V L region and V H region of the IL-21 BP.
  • the present invention provides an IL-21 BP wherein the V L and V H regions are presented on separate chains in the context of an immunoglobulin fold protein and oriented such that the V L CDR1 , CDR2, CDR3 and V H CDR1 , CDR2, and CDR3 cooperatively associate to contribute in selectively and/or specifically bind an antigenic determinant on IL-21.
  • the present invention provides an IL-21 BP that comprises two sets of variable domains (sets of associated V L and V H domains on associated separate chains), such that the IL-21 BP comprises two identical antigenic determinant binding sites.
  • any of such IL-21 BPs described in this paragraph are expected to, at least in part, have similar epitope specificity, selectivity, and other characteristics with an antibody having a V L sequence of SEQ ID No. 9 and a V H sequence of SEQ ID No. 10.
  • CDR's are determined as described by Kabat (ibid).
  • the present invention also provides IL-21 BPs comprising functional variants of the
  • V L region, V H region, or one or more CDRs of the antibodies of the examples A functional variant of a V L , V H , or CDR used in the context of an IL-21 BP still allows the IL-21 BP to retain at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the affinity/avidity and/or specificity/selectivity of the parent antibody and in some cases such an IL-21 BP may be associated with greater affinity, selectivity, and/or specificity than the parent antibody.
  • the present invention provides an IL-21 BP comprising a variant V L consisting essentially of a sequence having at least about 50%, such as at least 60%, for instance at least about 70%, such as at least about 75%, for instance at least about 80%, such as at least about 85%, for instance at least about 90%, such as at least about 95% amino acid sequence identity to a sequence according to any one of SEQ ID No. 1 and SEQ ID No. 9, wherein the IL-21 BP has at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the epitope binding characteristics of an antibody having a V L sequence of SEQ ID No. 1 or SEQ ID No.
  • the present invention provides an IL-21 BP comprising a variant V L CDR1 consisting essentially of a sequence having at least about 50%, such as at least 60%, for instance at least about 70%, such as at least about 75%, for instance at least about 80%, such as at least about 85%, for instance at least about 90%, such as at least about 95% amino acid sequence identity to a sequence according to any one of SEQ ID No. 3 or SEQ ID No. 11 , wherein the IL-21 BP has at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the epitope binding characteristics of an antibody having a V L CDR1 sequence of SEQ ID No. 3 or SEQ ID No.
  • the present invention provides an IL-21 BP comprising a variant
  • V L CDR2 consisting essentially of a sequence having at least about 50%, such as at least 60%, for instance at least about 70%, such as at least about 75%, for instance at least about 80%, such as at least about 85%, for instance at least about 90%, such as at least about 95% amino acid sequence identity to a sequence according to any one of SEQ ID No. 4 or SEQ ID No. 12, wherein the IL-21 BP has at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the epitope binding characteristics of an antibody having a V L CDR2 sequence of SEQ ID No. 4 or SEQ ID No. 12, respectively, such as an antibody having a V L sequence of SEQ ID No. 1 or SEQ ID No.
  • the present invention provides an IL-21 BP comprising a variant V L CDR3 consisting essentially of a sequence having at least about 50%, such as at least 60%, for instance at least about 70%, such as at least about 75%, for instance at least about 80%, such as at least about 85%, for instance at least about 90%, such as at least about 95% amino acid sequence identity to a sequence according to any one of SEQ ID No. 5 or SEQ ID No. 13, wherein the IL-21 BP has at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the epitope binding characteristics of an antibody having a V L CDR3 sequence of SEQ ID No. 5 or SEQ ID No.
  • the present invention provides an IL-21 BP comprising a variant
  • V H consisting essentially of a sequence having at least about 50%, such as at least 60%, for instance at least about 70%, such as at least about 75%, for instance at least about 80%, such as at least about 85%, for instance at least about 90%, such as at least about 95% amino acid sequence identity to a sequence according to any one of SEQ ID No. 2 or SEQ ID No. 10, wherein the IL-21 BP has at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the epitope binding characteristics of an antibody having a V H sequence of SEQ ID No. 2 or SEQ ID No. 10, respectively, such as an antibody having a V H sequence of SEQ ID No. 2 and a V L sequence of SEQ ID No. 1 , or an antibody having a V H sequence of SEQ ID No. 10 and a V L sequence of SEQ ID No. 9, respectively.
  • the present invention provides an IL-21 BP comprising a variant
  • V H CDR1 consisting essentially of a sequence having at least about 50%, such as at least 60%, for instance at least about 70%, such as at least about 75%, for instance at least about 80%, such as at least about 85%, for instance at least about 90%, such as at least about 95% amino acid sequence identity to a sequence according to any one of SEQ ID No. 6 or SEQ ID No. 14, wherein the IL-21 BP has at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the epitope binding characteristics of an antibody having a V H CDR1 sequence of SEQ ID No. 6 or SEQ ID No. 14, respectively, such as an antibody having a V H sequence of SEQ ID No. 2 or SEQ ID No.
  • the present invention provides an IL-21 BP comprising a variant V H CDR2 consisting essentially of a sequence having at least about 50%, such as at least 60%, for instance at least about 70%, such as at least about 75%, for instance at least about 80%, such as at least about 85%, for instance at least about 90%, such as at least about 95% amino acid sequence identity to a sequence according to any one of SEQ ID No. 7 or SEQ ID No. 15, wherein the IL-21 BP has at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the epitope binding characteristics of an antibody having a V H CDR2 sequence of SEQ ID No. 7 or SEQ ID No.
  • the present invention provides an IL-21 BP comprising a variant
  • V H CDR3 consisting essentially of a sequence having at least about 50%, such as at least 60%, for instance at least about 70%, such as at least about 75%, for instance at least about 80%, such as at least about 85%, for instance at least about 90%, such as at least about 95% amino acid sequence identity to a sequence according to any one of SEQ ID No. 8 or SEQ ID No. 16, wherein the IL-21 BP has at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the epitope binding characteristics of an antibody having a V H CDR3 sequence of SEQ ID No. 8 or SEQ ID No. 16, respectively, such as an antibody having a V H sequence of SEQ ID No. 2 or SEQ ID No.
  • the comparison of sequences and determination of percent identity between two sequences may be accomplished using a mathematical algorithm, as described in the non-limiting examples below.
  • the percent identity between two nucleotide sequences may be determined using the GAP program in the GCG software package (available at http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1 , 2, 3, 4, 5, or 6.
  • the percent identity between two nucleotide or amino acid sequences may also be determined using the algorithm of E. Meyers and W. Miller, Comput. Appl. Biosci 4, 11 -17 (1988)) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • percent identity between two amino acid sequences may be determined using the Needleman and Wunsch, J. MoI. Biol. 48, 444-453 (1970)) algorithm which has been incorporated into the GAP program in the GCG software package (available at http://www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1 , 2, 3, 4, 5, or 6.
  • the nucleic acid and protein sequences of the present invention may further be used as a "query sequence" to perform a search against public databases to, for example, identify related sequences.
  • Such searches may be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al., J. MoI. Biol. 215, 403-10 (1990).
  • Gapped BLAST may be utilized as described in Altschul et al., Nucleic Acids Res. 25(17), 3389-3402 (1997).
  • the default parameters of the respective programs e.g., XBLAST and NBLAST
  • XBLAST and NBLAST may be used. See http://www.ncbi.nlm.nih.gov.
  • the sequence of CDR variants may differ from the sequence of the CDR of the parent antibody sequences through mostly conservative substitutions; for instance at least about 35%, about 50% or more, about 60% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more (e.g., about 65-99%) of the substitutions in the variant are conservative amino acid residue replacements.
  • conservative substitutions may be defined by substitutions within the classes of amino acids reflected in one or more of the following three tables: Amino acid residue classes for conservative substitutions
  • More conservative substitutions groupings include: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Additional groups of amino acids may also be formulated using the principles described in, e.g., Creighton (1984) Proteins: Structure and Molecular Properties (2d Ed. 1993), W.H. Freeman and Company.
  • conservation in terms of hydropathic/hydrophilic properties and residue weight/size also is substantially retained in a variant CDR as compared to a CDR of an antibody of the examples (e.g., the weight class, hydropathic score, or both of the sequences are at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more (e.g., about 65-99%) retained).
  • conservative residue substitutions may also or alternatively be based on the replacement of strong or weak based weight based conservation groups, which are known in the art.
  • the retention of similar residues may also or alternatively be measured by a similarity score, as determined by use of a BLAST program (e.g., BLAST 2.2.8 available through the NCBI).
  • Suitable variants typically exhibit at least about 45%, such as at least about 55%, at least about 65%, at least about 75%, at least about 85%, at least about 90%, at least about 95%, or more (e.g., about 70-99%) similarity to the parent peptide.
  • Substantial changes in function may be made by selecting substitutions that are less conservative than those shown in the defined groups, above.
  • non-conservative substitutions may be made which more significantly affect the structure of the peptide in the area of the alteration, for example, the alpha-helical, or beta-sheet structure; the charge or hydrophobicity of the molecule at the target site; or the bulk of the side chain.
  • substitutions which generally are expected to produce the greatest changes in the peptide's properties are those where 1) a hydrophilic residue, e.g., seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl, or alanyl; 2) a cysteine or proline is substituted for (or by) any other residue; 3) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histidyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or 4) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) a residue that does not have a side chain, e.g., glycine. Accordingly, these and other nonconservative substitution
  • a convenient way for generating substitution variants is affinity maturation using phage using methods known in the art.
  • alanine scanning mutagenesis may also be performed to identify hypervariable region residues contributing significantly to antigen binding.
  • hypervariable region insertions are made to generate a variant antibody, the typical range of lengths of the hypervariable region in question in known antibodies should be taken into consideration.
  • V L CDR1 sequence of a parent antibody typically has an overall of about 9-20 (e.g., about 10-17) residues.
  • V L CDR2 typically has an overall length from about 5-10 residues;
  • V L CDR3 typically has a length of about 7-20 residues;
  • V H CDR1 typically has a length of about 10-15 residues;
  • V H CDR2 typically has a length of about 15-20 residues; and
  • V H CDR3 typically has a length of about 6-30 residues (e.g., 3-25 residues).
  • Insertions in the V H region typically are made in V H CDR3 and typically near the C-terminal of the domain, such as about residues 97-102 of the parent V H CDR3 (for instance adjacent to, or C-terminal in sequence to, residue number 100 of the parent V H CDR3 sequence) using the alignment and numbering as described in Kabat.
  • Antibody variants with inserted amino acid residue(s) in a hypervariable region thereof may be prepared randomly, especially where the starting binding affinity of the parent antibody for the target antigen is such that randomly produced antibody variants may be readily screened. For example, phage display provides a convenient method of screening such random variants.
  • CDR regions may be altered to enable a better binding to the epitope.
  • Antibody CDRs typically operate by building a "pocket,” or other paratope structure, into which the epitope fits. If the epitope is not fitting tightly, the antibody may not offer the best affinity. However, as with epitopes, there often are a few key residues in a paratope structure that account for most of this binding. Thus, CDR sequences may vary in length and composition significantly between antibodies for the same peptide. The skilled artisan will recognize that certain residues, such as tyrosine residues (e.g., in the context of V H CDR3 sequences), that are often significant contributors to such epitope binding, are typically retained in a CDR variant.
  • Variants of the CDR region may also increase the amino acid contacts between the antigen and an antibody variant, as compared to the amino acid contacts between the antigen and the parent antibody, by introducing one or more amino acid residues (either by substitution or insertions) which increase the contacts or energetically favorable interactions between one or more amino acid residues present in an antigen and one or more amino acid residues present in the antibody.
  • the amino acid interactions of interest may be selected from hydrogen bonding interactions, van der Waals interactions, and ionic interactions.
  • CDR variants which are variants of the CDRs of the antibodies of the examples, particularly in the context of variant CDR in anti-IL-21 antibodies or fragments thereof
  • residues required to support and/or orientate the CDR structural loop structure(s) may typically be retained; residues which fall within about 10 angstroms of a CDR structural loop (but optionally only residues in this area that also possess a water solvent accessible surface of about 5 angstroms 2 or greater) may typically be unmodified or modified only by conservative amino acid residue substitutions; and/or the amino acid sequence may typically be subject to only a limited number of insertions and/or deletions (if any), such that CDR structural loop-like structures are retained in the variant (a description of related techniques and relevant principles is provided in for instance Schiweck et al., J MoI Biol.
  • this includes for instance an IL-21 BP that comprises a V L CDR1 that is a fusion of V L CDR1 sequences from an antibody having a V L sequence of SEQ ID No. 1 and V L CDR1 sequences from an antibody having a V L sequence of SEQ ID No. 9.
  • this includes for instance an IL-21 BP that comprises a V L CDR2 that is a fusion of V L CDR2 sequences from an antibody having a V L sequence of SEQ ID No. 1 and V L CDR2 sequences from an antibody having a V L sequence of SEQ ID No. 9.
  • this includes for instance an IL-21 BP that comprises a V L CDR3 that is a fusion of V L CDR3 sequences from an antibody having a V L sequence of SEQ ID No. 1 and V L CDR3 sequences from an antibody having a V L sequence of SEQ ID No. 9
  • this includes for instance an IL-21 BP that comprises a V H CDR1 that is a fusion of V H CDR1 sequences from an antibody having a V H sequence of SEQ ID No. 2 and V H CDR1 sequences from an antibody having a V H sequence of SEQ ID No. 10.
  • this includes for instance an IL-21 BP that comprises a V H CDR2 that is a fusion of V H CDR2 sequences from an antibody having a V H sequence of SEQ ID No. 2 and V H CDR2 sequences from an antibody having a V H sequence of SEQ ID No. 10.
  • this includes for instance an IL-21 BP that comprises a V H CDR3 that is a fusion of V H CDR3 sequences from an antibody having a V H sequence of SEQ ID No. 2 and V H CDR3 sequences from an antibody having a V H sequence of SEQ ID No. 10.
  • the present invention provides antibody and antibody like molecules derived from one of 1 F1 and 1 F22, wherein the V L CDR1 sequence of the derived antibody or antibody-like molecule is replaced with the V L CDR1 sequence of the other of 1 F1 and 1 F22.
  • the present invention provides antibody and antibody like molecules derived from one of 1 F1 and 1 F22, wherein the V L CDR2 sequence of the derived antibody or antibody-like molecule is replaced with the V L CDR2 sequence of the other of 1 F1 and 1 F22.
  • the present invention provides antibody and antibody like molecules derived from one of 1 F1 and 1 F22, wherein the V L CDR3 sequence of the derived antibody or antibody-like molecule is replaced with the V L CDR3 sequence of the other of 1 F1 and 1 F22.
  • the present invention provides antibody and antibody like molecules derived from one of 1 F1 and 1 F22, wherein the V H CDR1 sequence of the derived antibody or antibody-like molecule is replaced with the V H CDR1 sequence of the other of 1 F1 and 1 F22.
  • the present invention provides antibody and antibody like molecules derived from one of 1 F1 and 1 F22, wherein the V H CDR2 sequence of the derived antibody or antibody-like molecule is replaced with the V H CDR2 sequence of the other of 1 F1 and 1 F22
  • the present invention provides antibody and antibody like molecules derived from one of 1 F1 and 1 F22, wherein the V H CDR3 sequence of the derived antibody or antibody-like molecule is replaced with the V H CDR3 sequence of the other of 1 F1 and 1 F22. In one embodiment, the present invention provides a variant antibody derived from
  • the light chain of the antibody comprises one or more substitutions, insertions, or deletions that correspond to the sequence of the other antibody (e.g., the present invention provides a variant of 1 F1 wherein one or more residue changes are introduced into the light chain of the derivative based upon the residues found at corresponding positions in the light chain of 1 F22).
  • the present invention provides a variant antibody derived from 1 F1 and 1 F22, wherein the heavy chain of the antibody comprises one or more substitutions, insertions, or deletions that correspond to the sequence of the other antibody (e.g., the present invention provides a variant of 1 F1 , wherein one or more residue changes are introduced into the heavy chain of the derivative based upon the residues found at corresponding positions in the heavy chain of 1 F22).
  • Additional techniques that may be used to generate variant antibodies include the directed evolution and other variant generation techniques described in for instance US 20040009498, Marks et al., Methods MoI Biol. 248, 327-43 (2004), Azriel-Rosenfeld et al., J MoI Biol. 335(1), 177-92 (2004), Park et al., Biochem Biophys Res Commun. 275(2), 553-7 (2000), Kang et al., Proc Natl Acad Sci U S A. 88(24), 11 120-3 (1991), Zahnd et al., J Biol Chem. 279(18), 18870-7 (2004), Xu et al., Chem Biol.
  • Generated antibody variants may be subjected to any suitable screening technique and antibodies with suitable and desirably superior properties in one or more relevant assays may be selected for further development.
  • IL-21 BPs comprising CDR sequences as described above may comprise any suitable number and combination of such V L and V H CDRs while retaining at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the affinity/avidity and/or specificity/selectivity of an antibody having a V L sequence of SEQ ID No. 1 and a V H sequence of SEQ ID No. 2 or an antibody having a V L sequence of SEQ ID No. 9 and a V H sequence of SEQ ID No. 10, but optionally differing in other characteristics, such as immunogenicity in a human patient, affinity for the epitope, increased half-life, etc.
  • an IL-21 BP may be associated with greater affinity, selectivity, and/or specificity than the parent antibody.
  • less than a full set of V L CDRs and/or V H CDRS is present in an IL-21 BP of the present invention.
  • all of the V L CDRS and V H CDRs are present. Examples of other functional properties of antibodies, which may be altered or retained in variant IL-21 BPs of the present invention as compared to the antibodies of the examples, are:
  • the present invention also provides IL-21 BPs which are characterized with respect to their ability to compete (competitively inhibit) or cross-compete (i.e., relatively partially inhibit epitope binding) with an antibody having a V L sequence of SEQ ID No. 1 and a V H sequence of SEQ ID No. 2 and/or an antibody having a V L sequence of SEQ ID No. 9 and a V H sequence of SEQ ID No. 10 for binding to IL-21.
  • Such an IL-21 BP may be, for instance, a Fab fragment, derived from an antibody that binds to an epitope identical to or overlapping with an epitope bound by an antibody having a V L sequence of SEQ ID No. 1 and a V H sequence of SEQ ID No. 2 or an antibody having a V L sequence of SEQ ID No. 9 and a V H sequence of SEQ ID No. 10.
  • a Fab fragment due to its relatively small size compared to the mAb molecules, may not significantly compete with said antibodies for binding to IL-21 although the antibody from which it derived does.
  • IL-21 BP may be useful in similarly targeting nearby regions of IL-21 (e.g., in the context of targeting a cytotoxin, radionuclide, or the like in the context of an immunoconjugate IL-21 BP). Therefore, such IL-21 BPs may be useful in the context of the methods of the present invention and, accordingly, are also provided by the present invention.
  • Competition for binding to IL-21 or a portion of IL-21 by two or more IL-21 binding peptides may be determined by any suitable technique. In one embodiment, competition is determined by an ELISA assay as described, for example, in Example 2.
  • Competition in the context of the present invention refers to any detectably significant reduction in the propensity for a particular molecule to bind a particular binding partner in the presence of another molecule that binds the binding partner.
  • competition means an at least about 10% reduction, such as an at least about 15%, or an at least about 20% reduction in binding between an IL-21 BP and (a) a form of IL-21 (e.g.
  • IL-21 "unprocessed”, “not processed” or “immature” IL-21 ); (b) a form of free IL-21 (e.g., an IL-21 promigratory fragment and/or IL-21 fragment produced by in vivo processing); (c) a portion of IL-21 ; or (d) a portion of IL-21 , caused by the presence of another IL-21 BP as determined by, e.g., ELISA analysis using sufficient amounts of the two or more competing IL-21 BPs and IL-21. It may also be the case that competition may exist between IL-21 BPs with respect to more than one of IL-21 , and/or a portion of IL-21 , e.g.
  • IL-21 in a context where the binding properties of a particular region of IL-21 are retained in fragments thereof, such as in the case of a well-presented linear epitope located in various tested fragments or a conformational epitope that is presented in sufficiently large IL-21 fragments as well as in IL-21.
  • Assessing competition typically involves an evaluation of relative inhibitory binding using a first amount of a first molecule; a second amount of a second molecule; and a third amount of a third molecule (or a standard determined by binding studies that may be reasonably compared to new binding data with respect to the first and second molecules as a surrogate for actual contemporaneous data), wherein the first, second, and third amounts all are sufficient (in quantity and properties) to make a comparison that imparts information about the selectivity and/or specificity of the molecules at issue with respect to the other present molecules.
  • the first, second, and third amounts may vary with the nature of the IL-21 BP and potential targets therefore at issue.
  • IL-21 BP and/or IL-21 targets are required to assess whether competition exists.
  • Conditions also should be suitable for binding.
  • physiological or near-physiological conditions e.g., temperatures of about 20-40 0 C, pH of about 7-8, etc.
  • competition is marked by a significantly greater relative inhibition than about
  • a higher threshold of relative inhibition as a criteria/determinant of what is a suitable level of competition in a particular context (e.g., where the competition analysis is used to select or screen for new antibodies designed with the intended function of blocking the binding of another peptide or molecule binding to IL-21 or naturally occurring anti-IL-21 antibody)).
  • a criteria for competitiveness wherein at least about 10% relative inhibition is detected; at least about 15% relative inhibition is detected; or at least about 20% relative inhibition is detected before an antibody is considered sufficiently competitive.
  • competition may be marked by greater than about 40% relative inhibition of IL-21 binding (e.g., at least about 45% inhibition, such as at least about 50% inhibition, for instance at least about 55% inhibition, such as at least about 60% inhibition, for instance at least about 65% inhibition, such as at least about 70% inhibition, for instance at least about 75% inhibition, such as at least about 80% inhibition, for instance at least about 85% inhibition, such as at least about 90% inhibition, for instance at least about 95% inhibition, or higher level of relative inhibition).
  • at least about 45% inhibition such as at least about 50% inhibition, for instance at least about 55% inhibition, such as at least about 60% inhibition, for instance at least about 65% inhibition, such as at least about 70% inhibition, for instance at least about 75% inhibition, such as at least about 80% inhibition, for instance at least about 85% inhibition, such as at least about 90% inhibition, for instance at least about 95% inhibition, or higher level of relative inhibition.
  • an IL-21 BP of the present invention specifically binds to one or more residues or regions in IL-21 but also does not cross-react with other peptides, peptide regions, or molecules, e.g., the present invention provides an anti-IL-21 antibody that does not cross-react with for instance IL-2, IL-4, IL, IL-9, or IL-15, which all binds to a receptor comprising the common Y chain (but otherwise have low homology to IL-21).
  • a lack of cross-reactivity means less than about 5% relative competitive inhibition between the molecules when assessed by ELISA using sufficient amounts of the molecules under suitable assay conditions.
  • the present invention provides an IL-21 BP that competes with an antibody having a V L sequence of SEQ ID No. 1 and a V H sequence of SEQ ID No. 2 for binding to IL-21 or a portion thereof.
  • the present invention provides an IL-21 BP that cross-competes with 1 F1 and/or 1 F22 for binding to IL-21 or a portion thereof.
  • references to binding of an IL-21 BP to IL-21 are intended to refer to binding in any suitable context, such as in a conformational context where the structure of IL-21 is present; or in a linear epitope context (or a combination thereof).
  • binding in a limited subset of such context(s) may be an important characteristic with respect to any IL-21 BP provided by the present invention.
  • Cross-competition may be determined by any suitable method and criteria, but typically means the detection of competition among three molecules in an ELISA or other suitable assay (at similar or different levels).
  • Human IL-21 comprises a number of different epitopes, which may include (1 ) peptide antigenic determinants that are comprised within single peptide chains within human IL-21 ; (2) conformational antigenic determinants which consist one or more noncontiguous amino acids on a particular chain and/or amino acids present on spatially contiguous but separate peptide chains (typically where the respective amino acid sequences of the chains are located disjointedly along the human IL-21 polypeptide sequence); (3) post-translational antigenic determinants which consist, either in whole or part, of molecular structures covalently attached to human IL-21 , such as carbohydrate groups; or (4) combinations of (1)-(3).
  • An epitope in the context of the present invention includes any peptide or peptide- derivative determinant capable of specific binding to an immunoglobulin.
  • An epitope may comprise any suitable number of amino acids, in any suitable position (with respect to the linear sequence of IL-21) orientation (with respect to folded IL-21 , or a fragment thereof), amino acid composition (and consequently, at least in part, charge).
  • an epitope may be composed of about 3-10 amino acids, typically 3-8 amino acids, in one or more contiguous or noncontiguous locations with respect to the primary sequence of IL-21 (for instance an epitope may consist essentially of 2, 3, 4, 5, 6, 7, or 8 amino acid residues distributed in 1 , 2, 3, 4, or 5 noncontiguous locations in IL-21 ).
  • an epitope may be considered to be defined by a region of about 5-40 contiguous amino acid residues (e.g., about 7-30 amino acid residues, about 5-20 amino acid residues, or about 3-15 amino acid residues) in IL-21 (solely or in combination with a portion of an adjacent IL-21 domain).
  • an epitope may be characterized on the basis of one or more of such critical residues, with the recognition that other residues may also make some lesser contribution to the epitope.
  • an epitope defined by a region of amino acids it may be that one or more amino acids in the region make only a minor contribution or even negligible contribution to antibody binding, such that the residue may be subject to substitution with an appropriate different residue without resulting in "a loss" of the epitope to at least some IL-21 BPs specific for it.
  • the present invention provides an IL-21 BP, such as an anti- IL-21 antibody, that specifically binds to an IL-21 epitope that also is specifically bound by an antibody having a V L sequence of SEQ ID No. 1 and a V H sequence of SEQ ID No. 2 and/or an antibody having a V L sequence of SEQ ID No. 9 and a V H sequence of SEQ ID No. 10. It is possible that IL-21 BPs having one or more CDRs that differ from the CDRs of an antibody having a V L sequence of SEQ ID No. 1 and a V H sequence of SEQ ID No. 2, or the CDRs of an antibody having a V L sequence of SEQ ID No. 9 and a V H sequence of SEQ ID No.
  • the IL-21 BP in question may recognize or be more specific/selective for particular structures or regions of the epitope than the antibody having a V L sequence of SEQ ID No. 1 and a V H sequence of SEQ ID No. 2 and the antibody having a V L sequence of SEQ ID No. 9 and a V H sequence of SEQ ID No. 10, respectively.
  • a IL-21 epitope bound by an antibody having a V L sequence of SEQ ID No. 1 and a V H sequence of SEQ ID No. 2 or an antibody having a V L sequence of SEQ ID No. 9 and a V H sequence of SEQ ID No. 10, may be identified via standard mapping and characterization techniques, further refinement of which may be identified by any suitable technique, numerous examples of which are available to the skilled artisan. These techniques may also be used to identify and/or characterize epitopes for IL-21 BPs generally. As one example of such mapping/characterization methods, an epitope for an anti-IL-21 antibody may be determined by epitope "foot-printing" using chemical modification of the exposed amines/carboxyls in the IL-21 protein.
  • HXMS hydrogen-deuterium exchange detected by mass spectrometry
  • a hydrogen/deuterium exchange of receptor and ligand protein amide protons, binding, and back exchange occurs, wherein the backbone amide groups participating in protein binding are protected from back exchange and therefore will remain deuterated.
  • Relevant regions may be identified at this point by peptic proteolysis, fast microbore high-performance liquid chromatography separation, and/or electrospray ionization mass spectrometry. See, e.g., Ehring H, Analytical Biochemistry, Vol. 267 (2) 252-259 (1999) and/or Engen, J. R. and Smith, D. L. (2001 ) Anal. Chem.
  • NMR nuclear magnetic resonance epitope mapping
  • the antigen typically is selectively isotopically labeled with 15 N so that only signals corresponding to the antigen and no signals from the antigen binding peptide are seen in the NMR-spectrum.
  • Antigen signals originating from amino acids involved in the interaction with the antigen binding peptide typically will shift position in the spectres of the complex compared to the spectres of the free antigen, and the amino acids involved in the binding may be identified that way.
  • Epitope mapping/characterization may also be performed using mass spectrometry methods. See for instance Downward, J Mass Spectrom. 35(4), 493-503 (2000) and Kiselar and Downard, Anal Chem. 71.(9), 1792-801 (1999).
  • Protease digestion techniques may also be useful in the context of epitope mapping and identification.
  • Antigenic determinant-relevant regions/sequences may be determined by protease digestion, e.g. by using trypsin in a ratio of about 1 :50 to IL-21 o/n digestion at 37°C and pH 7-8, followed by mass spectrometry (MS) analysis for peptide identification.
  • MS mass spectrometry
  • the peptides protected from trypsin cleavage by the IL-21 BP may subsequently be identified by comparison of samples subjected to trypsin digestion and samples incubated with IL-21 BP and then subjected to digestion by e.g. trypsin (thereby revealing a foot print for the binder).
  • a IL-21 BP which gives the significantly same result as an antibody having a V L sequence of SEQ ID No. 1 and a V H sequence of SEQ ID No. 2 or an antibody having a V L sequence of SEQ ID No. 9 and a V H sequence of SEQ ID No. 10 in these measurements are deemed to be an antibody that bind the same epitope as an antibody having a V L sequence of SEQ ID No. 1 and a V H sequence of SEQ ID No. 2 or an antibody having a V L sequence of SEQ ID No. 9 and a V H sequence of SEQ ID No. 10, respectively.
  • the invention provides a method for identifying new antibodies, sequences, and proteins that act as IL-21 BPs.
  • Epitope mapping by competitive binding to IL-21 with two antibodies where one is biotinylated is another method for identifying relevant antigenic determinant regions.
  • phage display techniques may also be used to identify epitopes. See for instance Wang and Yu, Curr Drug Targets. 5(1), 1-15 (2004), Burton, Immunotechnology. 1(2), 87-94 (1995 Aug), Cortese et al., Immunotechnology. 1(2), 87-94 (1995) and Irving et al., Curr Opin Chem Biol. 5(3), 314-24 (2001). Consensus epitopes may also be identified through modified phage display-related techniques (see, http://www.cs.montana.edu/ ⁇ mumey/papers/jcb03.pdf) for discussion.
  • mapping epitopes include crystallography techniques, X-ray diffraction techniques (such as the X-ray diffraction/sequence study techniques developed by Poljak and others in the 1970s-1980s), and the application of Multipin Peptide Synthesis Technology.
  • Computer-based methods such as sequence analysis and three dimensional structure analysis and docking may also be used to identify antigenic determinants.
  • an epitope may also be determined by molecular modeling using a structure of IL-21 with docking of the structure of the Fab fragment of the individual monoclonal antibody.
  • the present invention provides an IL-21 BP having substantially the same specific IL-21 -binding characteristics of one or more mAbs selected from an antibody having a V L sequence of SEQ ID No. 1 and a V H sequence of SEQ ID No. 2 and an antibody having a V L sequence of SEQ ID No. 9 and a V H sequence of SEQ ID No. 10.
  • various predictive analytical methods may be applied.
  • IL-21 may be analyzed for (1) highly hydropathic regions (using the Kyte-Doolittle method); (2) antigenicity as measured by the Protrusion Index method; (3) antigenicity as determined by the Parker method; (4) antigenicity as determined by the Hopp/Woods method; and (5) hydrophilicity as measured by the methods of Goldman, Engleman, and Steitz. Sequences ranging from 10-40 amino acids in length may be selected based on exhibiting one or more of these properties. The rationale for this approach is the general consensus that many ideal B cell epitopes are hydrophilic, surface-oriented, and flexible sequences of about 8-10 amino acids in length.
  • the present invention provides IL-21 BPs specific for IL-21-regions of IL-21 identified in such a manner. Moreover, the termini of these sequences may be compared to predicted antigenic determinant regions located through the other analyses described herein to provide additional specific likely antigenic-determinant containing regions. Other similar comparisons may readily be made to provide additional likely antigenic determinant regions, where IL-21 BPs binding to these antigenic determinant regions may be considered another feature of the present invention.
  • the IL-21 BP of the present invention is an antibody.
  • IL-21 binding antibodies provided by the present invention include (a) a complete functional, immunoglobulin molecule comprising: (i) two identical chimeric heavy chains comprising a variable region with a human B cell surface antigen specificity and human constant region and (ii) two identical all (i.e. non-chimeric) human light chains; (b) a complete, functional, immunoglobulin molecule comprising: (i) two identical chimeric heavy chains comprising a variable region as indicated, and a human constant region, and (ii) two identical all (i.e.
  • non-chimeric non-human light chains (c) a monovalent antibody, i.e., a complete, functional immunoglobulin molecule comprising: (i) two identical chimeric heavy chains comprising a variable region as indicated, and a human constant region, and (ii) two different light chains, only one of which has the same specificity as the variable region of the heavy chains.
  • the resulting antibody molecule binds only to one end thereof and is therefore incapable of divalent binding.
  • antibody/immunoglobulin-related peptides may be said to include the following: (a) a whole immunoglobulin molecule; (b) an scFv; (c) a monoclonal antibody; (d) a human antibody; (e) a chimeric antibody; (f) a humanized antibody; (g) a Fab fragment; (h) an Fab' fragment; (i) an F(ab') 2 fragment; (j) an Fv molecule; and (k) a disulfide-linked Fv molecule.
  • the IL-21 BP of the present invention is a polyclonal antibody. In one embodiment, the IL-21 BP of the present invention is an monoclonal antibody. In a further embodiment, the IL-21 BP of the present invention is a human monoclonal antibody. In another further embodiment, the IL-21 BP of the present invention is a humanized antibody. In another further embodiment, the IL-21 BP of the present invention is a chimeric antibody. In another further embodiment, the IL-21 BP of the present invention is a monoclonal antibody originating entirely from a mammalian species different from humans. In a further embodiment, the IL-21 BP of the present invention is a fully murine monoclonal antibody.
  • a monoclonal antibody refers to a composition comprising a homogeneous antibody population having a uniform structure and specificity.
  • a monoclonal antibody is an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts.
  • Monoclonal antibodies are highly specific and each monoclonal antibody is typically directed against a single epitope, which is in contrast to polyclonal antibody preparations which typically include different antibodies directed against different epitopes. That an antibody is monoclonal is not to be construed as requiring production of the antibody by any particular method.
  • the monoclonal antibodies of the present invention may be produced by the hybridoma method first described by Kohler et al., Nature 256, 495 (1975), or may be produced by recombinant DNA methods.
  • Monoclonal antibodies may also be isolated from phage antibody libraries using the techniques described in, for example, Clackson et al., Nature 352, 624-628 (1991) and Marks et al., J. MoI. Biol. 222, 581-597 (1991).
  • Monoclonal antibodies may be obtained from any suitable source.
  • monoclonal antibodies may be obtained from hybridomas prepared from murine splenic B cells obtained from mice immunized with an antigen of interest or a nucleic acid encoding an antigen of interest.
  • Monoclonal antibodies may also be obtained from hybridomas derived from antibody-expressing cells of immunized humans or non-human mammals such as rats, dogs, primates, etc.
  • human monoclonal antibodies directed against IL-21 may be generated using transgenic or transchromosomal mice carrying parts of the human immune system rather than the mouse system.
  • transgenic and transchromosomic mice include mice referred to herein as HuMAb mice and KM mice, respectively, and are collectively referred to herein as "transgenic mice”.
  • the HuMAb mouse contains a human immunoglobulin gene miniloci that encodes unrearranged human heavy ( ⁇ and Y) and K light chain immunoglobulin sequences, together with targeted mutations that inactivate the endogenous ⁇ and K chain loci (Lonberg, N. et al., Nature 368, 856-859 (1994)). Accordingly, the mice exhibit reduced expression of mouse IgM or K and in response to immunization, the introduced human heavy and light chain transgenes, undergo class switching and somatic mutation to generate high affinity human IgG 1 K monoclonal antibodies (Lonberg, N. et al. (1994), supra; reviewed in Lonberg, N.
  • HuMAb mice The preparation of HuMAb mice is described in detail in Taylor, L. et al., Nucleic Acids Research 20, 6287-6295 (1992), Chen, J. et al., International Immunology 5, 647-656 (1993), Tuaillon et al., J. Immunol. 152, 2912-2920 (1994), Taylor, L.
  • the HCo7 mice have a JKD disruption in their endogenous light chain (kappa) genes (as described in Chen et al., EMBO J. 12, 821 -830 (1993)), a CMD disruption in their endogenous heavy chain genes (as described in Example 1 of WO 01/14424), a KCo5 human kappa light chain transgene (as described in Fishwild et al., Nature Biotechnology 14, 845-851 (1996)), and a HCo7 human heavy chain transgene (as described in US 5,770,429).
  • the HCo12 mice have a JKD disruption in their endogenous light chain (kappa) genes (as described in Chen et al., EMBO J. 12, 821 -830 (1993)), a CMD disruption in their endogenous heavy chain genes (as described in Example 1 of WO 01/14424), a KCo5 human kappa light chain transgene (as described in Fishwild et al., Nature Biotechnology 14, 845-851 (1996)), and a HCo12 human heavy chain transgene (as described in Example 2 of WO 01/14424).
  • the endogenous mouse kappa light chain gene has been homozygously disrupted as described in Chen et al., EMBO J.
  • Vl, 811 -820 (1993) and the endogenous mouse heavy chain gene has been homozygously disrupted as described in Example 1 of WO 01/09187.
  • This mouse strain carries a human kappa light chain transgene, KCo5, as described in Fishwild et al., Nature Biotechnology 14, 845-851 (1996).
  • This mouse strain also carries a human heavy chain transchromosome composed of chromosome 14 fragment hCF (SC20) as described in WO 02/43478.
  • the KM mouse contains a human heavy chain transchromosome and a human kappa light chain transgene.
  • the endogenous mouse heavy and light chain genes also have been disrupted in the KM mice such that immunization of the mice leads to production of human immunoglobulins rather than mouse immunoglobulins. Construction of KM mice and their use to raise human immunoglobulins is described in detail in WO 02/43478.
  • Splenocytes from these transgenic mice may be used to generate hybridomas that secrete human monoclonal antibodies according to well known techniques.
  • Such transgenic mammals mammals comprising an operable nucleic acid sequence coding for expression of an IL-21 BP, mammals stably transfected with one or more I L-21 -encoding nucleic acid sequences, and the like, are additional features of the present invention.
  • Human monoclonal or polyclonal antibodies of the present invention, or antibodies of the present invention originating from other species may also be generated transgenically through the generation of another non-human mammal or plant that is transgenic for the immunoglobulin heavy and light chain sequences of interest and production of the antibody in a recoverable form therefrom.
  • antibodies may be produced in, and recovered from, the milk of goats, cows, or other mammals. See for instance US 5,827,690, US 5,756,687, US 5,750,172 and US 5,741 ,957.
  • human antibodies of the present invention or antibodies of the present invention from other species may be generated through display-type technologies, including, without limitation, phage display, retroviral display, ribosomal display, and other techniques, using techniques well known in the art and the resulting molecules may be subjected to additional maturation, such as affinity maturation, as such techniques are well known in the art (see for instance Hoogenboom et al., J. MoI. Biol. 227, 381 (1991 ) (phage display),
  • Humanized monoclonal antibodies of the present invention may be generated by fusing the constant domains from a human antibody to the variable domains of a non-human species. Examples of how to make humanized antibodies may be found in for instance US 6,054,297, US 5,886,152 and US 5,877,293.
  • a humanized antibody is designed to have greater homology to a human immunoglobulin than animal-derived monoclonal antibodies. Non-human amino acid residues from an "import" (animal) variable domain typically are transfected into a human "backbone".
  • Humanization may essentially be performed following the method of Winter and co-workers (Jones et al., Nature 321, 522-525 (1986), Riechmann et al., Nature 332, 323-327 (1988), Verhoeyen et al., Science 239, 1534-1536 (1988)), by substituting rodent complementarity determining regions ("CDRs") or CDR sequences for the corresponding sequences of a human antibody. Accordingly, in such "humanized” antibodies, the CDR portions of the human variable domain have been substituted by the corresponding sequence from a non-human species.
  • humanized antibodies are typically human antibodies in which some CDR residues and possibly some framework residues are substituted by residues from analogous sites in rodent antibodies.
  • variable domains both light and heavy
  • sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable-domain sequences.
  • the human sequence which is closest to that of the rodent is then accepted as the human framework (FR) for the humanized antibody (Sims et al., J. Immunol. 151, 2296 (1993), Chothia et al., J. MoI. Biol. 196, 901 (1987)).
  • Another method uses a particular framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework may be used for several different humanized antibodies (Carter et al., PNAS USA 89, 4285 (1992), Presta et al., J. Immunol. 151, 2623 (1993)).
  • humanized antibodies may be prepared by a process of analysis of the parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences. Three-dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays permits analysis of the likely role of certain residues in the functioning of the candidate immunoglobulin sequence, i.e., the analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen. In this way, FR residues may be selected and combined from the recipient and import sequences so that the desired antibody characteristic, such as increased affinity for the target antigen(s), is maximized, although it is the CDR residues that directly and most substantially influence antigen binding.
  • Murine antibodies or antibodies from other species may be humanized or primatized using any suitable techniques, a number of suitable techniques being already well known in the art (see for instance Winter and Harris Immunol Today 14, 43-46 (1993) and Wright et al., Crit. Reviews in Immunol. 125-168 (1992)).
  • the antibody of interest may be engineered by recombinant DNA techniques to substitute the C H 1 , C H 2, C H 3, hinge domains, and/or the framework domain with the corresponding human sequence (see WO 92/02190 and US
  • Humanization of antibodies may also be performed following the method of Winter and co-workers (Jones et al., Nature 321, 522-525 (1986), Riechmann et al., Nature 332, 323-327 (1988), Verhoeyen et al., Science 239, 1534-1536 (1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody.
  • rodent CDRs or CDR sequences for the corresponding sequences of a human antibody.
  • such "humanized” antibodies are, in a sense, chimeric antibodies (US 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
  • humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
  • Ig cDNA for construction of chimeric immunoglobulin genes is known in the art (see for instance Liu et al., PNAS USA 84, 3439 (1987) and J.Immunol. 139, 3521 (1987)).
  • mRNA is isolated from a hybridoma or other cell producing the antibody and used to produce cDNA:
  • the cDNA of interest may be amplified by the polymerase chain reaction using specific primers (US 4,683,195 and US 4,683,202).
  • a library is made and screened to isolate the sequence of interest.
  • the DNA sequence encoding the variable region of the antibody is then fused to human constant region sequences.
  • IL-21 BPs of the present invention may be in any suitable form with respect to multimerization.
  • Anti-IL-21 antibodies and antibody fragments may be at least in heterotrimeric form if not in higher multimeric forms such as those associated with IgM antibodies.
  • an IL-21 BP may be presented as a dimer or monomer.
  • Monomeric IL-21 BPs of the present invention may be, for example, modified by any suitable technique so as to form multimeric peptide compositions.
  • the class of a anti-IL-21 antibody of the present invention may be switched by known methods. For example, an antibody of the present invention that was originally IgM may be class switched to an IgG antibody of the present invention.
  • class switching techniques may be used to convert one IgG subclass to another, for instance from IgGI to lgG2.
  • the effector function of the antibodies of the present invention may be changed by isotype switching to, e.g., an IgGI , lgG2, lgG3, lgG4, IgD, IgA, IgE, or IgM antibody for various therapeutic uses.
  • an antibody of the present invention is an IgGI antibody, for instance an IgGI , ⁇ or IgGI , ⁇ isotype.
  • an antibody of the present invention is an lgG3 antibody, for instance an lgG3, ⁇ or lgG3, ⁇ isotype.
  • an antibody of the present invention is an lgG4 antibody, for instance an lgG4, ⁇ or lgG4, ⁇ isotype.
  • an antibody of the present invention is an IgAI or lgA2 antibody.
  • an antibody of the present invention is an IgM antibody.
  • Anti-IL-21 antibodies may be recovered from recombinant combinatorial antibody libraries, such as a scFv phage display library, which may be made with human V L and V H cDNAs prepared from mRNA derived from human lymphocytes. Methods for preparing and screening such libraries are known in the art. There are a number of commercially available kits for generating phage display libraries. There are also other methods and reagents that may be used in generating and screening antibody display libraries (see for instance US
  • V L and V H nucleic acid sequences may be selected using any appropriate method.
  • V L and V H nucleic acids may be selected by employing the epitope imprinting methods described in WO 93/06213.
  • Antibody libraries such as scFv libraries may be prepared and screened using known and suitable methods (with human IL-21-containing peptides as antigen(s)), such as those described in for instance WO92/01047, McCafferty et al., Nature 348, 552-554 (1990) and Griffiths et al., EMBO J 12, 725-734 (1993).
  • Such antibody libraries and other combinations of IL-21 BPs are features of the present invention that may be used therapeutically to provide a more comprehensive immune response; as tools in screening methods for immunogenic peptides, small molecules, other anti-IL-21 antibodies (e.g., by way of competition assays), and the like; and/or in diagnostic methods and compositions (e.g., an immunoassay chip comprising a panel of such antibodies optionally in association with other antibodies may be prepared by standard techniques).
  • "mix and match" experiments in which different pairs of the initially selected V L and V H segments are screened for I L-21 -containing peptide binding, may be performed to select desirable V L /V H pair combinations.
  • reactivity of the peptides may be determined by ELISA or other suitable epitope analysis methods (see for instance Scott, J. K. and Smith, G. P. Science 249, 386-390 (1990), Cwirla et al., PNAS USA 87,
  • Antibodies may be selected by their affinity for antigen and/or by their kinetics of dissociation (off-rate) from antigen (see for instance Hawkins et al., J. MoI. Biol. 226, 889-896 (1992)).
  • V L and V H segments of V L /V H pair(s) may be randomly mutated, for instance within the CDR3 region of V H and/or V L , in a process analogous to the in vivo somatic mutation process responsible for affinity maturation of antibodies during a natural immune response.
  • This in vitro affinity maturation may be accomplished by amplifying V H and V L regions using PCR primers complimentary to the V H CDR3 or V L CDR3, respectively, which primers typically are “spiked” with a random mixture of the four nucleotide bases at certain positions, such that the resultant PCR products encode V H and V L segments into which random mutations have been introduced into the V H and/or V L CDR3 regions.
  • These randomly mutated V H and V L segments may be re-screened for binding to I L-21 -containing peptides.
  • nucleic acid encoding a selected antibody may be recovered from the display package (e.g., from the phage genome) and subcloned into an appropriate vector by standard recombinant DNA techniques.
  • an antibody-encoding nucleic acid may be further manipulated to create other antibody forms or IL-21 BPs.
  • a nucleic acid comprising a sequence encoding the antibody is cloned into a recombinant expression vector and introduced into appropriate host cells (mammalian cells, yeast cells, etc.) under conditions suitable for expression of the nucleic acid and production of the antibody.
  • High-affinity antibody peptides such as human single-chain Fv (scFv) and Fab antibody fragments
  • scFv single-chain Fv
  • Fab antibody fragments may also be isolated from such libraries using a panning technique in which the antigen of interest is immobilized on a solid surface, such as microtiter plates or beads (see for instance Barbas and Burton, Trends. Biotechnol. 14, 230-234 (1996) and Aujame et al., Hum. Antibodies 8, 155-68 (1997).
  • Phage display of large na ⁇ ve libraries also makes it possible to isolate human antibodies directly without immunization (see for instance de Haard et al., J. Biol. Chem. 274(26), 18218-18230 (1999)).
  • the invention provides a method for producing anti-IL21 antibodies with increased affinity.
  • the present invention provides variant anti-IL-21 antibodies.
  • a "variant" anti-IL-21 antibody is an antibody that differs from a parent antibody (typically generated by immunization) by one or more suitable amino acid residue alterations, that is substitutions, deletions, insertions, or terminal sequence additions, in the CDRs or other V H and/or V L sequences (provided that at least a substantial amount of the epitope binding characteristics of the parent antibody are retained, if not improved upon, by such changes). Variations in an antibody variant may be made in each of the framework regions, the constant domain, and/or the variable regions (or any one or more CDRs thereof) in a single variant antibody.
  • variations may be made in only one of the framework regions, the variable regions (or single CDR thereof), or the constant domain in an antibody.
  • Alanine scanning mutagenesis techniques such as described by Cunningham and Wells, Science 244, 1081-1085 (1989), may be used to identify suitable residues for substitution or deletion in generating IL-21 BPs comprising variant V L , V H , or particular CDR sequences, although other suitable mutagenesis techniques also may be applied.
  • Multiple amino acid substitutions may also be made and tested using known methods of mutagenesis and screening, such as those disclosed by Reidhaar-Olson and Sauer, Science 241 , 53-57 (1988) or Bowie and Sauer, PNAS USA 86, 2152-2156 (1989).
  • an antibody variant one or more amino acid residues may be introduced or inserted in or adjacent to one or more of the hypervariable regions of a parent antibody, such as in one or more CDRs.
  • An anti-IL-21 antibody variant may comprise any number of inserted amino acid residues, provided again that at least a substantial amount of the epitope binding characteristics of the parent antibody are retained.
  • An anti-IL-21 antibody variant of the present invention may for example comprise from about 1 -30 inserted amino acid residues, for instance from about 1 -10, such as for instance from about 2-10, for instance from 2-5 or such as from about 1-5 inserted amino acid residues.
  • an anti- IL-21 antibody variant of the present invention may for example comprise from about 1-30 deleted amino acid residues, for instance from about 1-10, such as for instance from about 2-10, for instance from 2-5 or such as from about 1 -5 deleted amino acid residues.
  • an anti-IL-21 antibody variant of the present invention may for example comprise from about 1-30 substituted amino acid residues, for instance from about 1-10, such as for instance from about 2-10, for instance from 2-5 or such as from about 1-5 substituted amino acid residues.
  • an anti-IL-21 antibody variant of the present invention may for example comprise from about 1-30 terminal sequence amino acid residue additions , for instance from about 1-10, such as for instance from about 2-10, for instance from 2-5 or such as from about 1 -5 terminal sequence amino acid residue additions.
  • a antibody variant of the present invention may also comprise a combination of two or more of such insertions, deletings, substitutions and terminal sequence amino acid residue additions, provided that the variant possesses at least a substantial proportion of the parent antibodies affinity, specificity, and/or selectivity with respect to one or more IL-21 epitopes.
  • amino acid sequence alterations such as conservative substitution variations, desirably do not substantially change the structural characteristics of the parent sequence (e.g., a replacement amino acid should not tend to disrupt secondary structure that characterizes the function of the parent sequence).
  • Examples of art-recognized polypeptide secondary and tertiary structures are described in, e.g., Proteins, Structures and Molecular Principles (Creighton, Ed., W. H. Freeman and Company, New York (1984)), Introduction to Protein Structure (C.
  • Amino acid sequence variants of an antibody may be obtained by introducing appropriate nucleotide changes into the antibody-encoding nucleic acid (e.g., by site directed mutagenesis) or by chemical peptide synthesis.
  • Such variants include, for example, deletions from, and/or insertions into and/or substitutions of and/or terminal sequence additions of residues within the amino acid sequences of the antibodies of the examples herein. Any combination of deletions, insertions, and substitutions may be made to arrive at a desired variant, provided that the variant possesses at least a substantial proportion of epitope binding characteristics of the parent antibody.
  • Amino acid sequence changes, with respect to a parent antibody also may alter post-translational processes of the variant antibody with respect to a parent antibody, such as by changing the number or position of glycosylation sites.
  • Variant antibodies of the present invention may comprise alterations in the hypervariable region, such as in the CDRs.
  • IL-21 BPs comprising such CDR variants are described elsewhere herein, and, as described above, such IL-21 BPs may be antibodies.
  • Variant antibodies of the present invention may comprise framework (FR) alterations, that is outside the hypervariable region, for instance in the Fc region, which alterations may be associated with advantageous properties, such as changing the functional or pharmacokinetic properties of the antibodies.
  • a substitution or other modification (insertion, deletion, terminal sequence additions or combination of any thereof) in a framework region or constant domain may be associated with an increase in the half-life of the variant antibody with respect to the parent antibody, or may be made to alter the immunogenicity of the variant antibody with respect to the parent antibody, to provide a site for covalent or non-covalent binding to another molecule, or to alter such properties as complement fixation, for instance resulting in a decrease or increase of C1q binding and CDC or of FcyR binding and antibody-dependent cellular cytotoxicity (ADCC).
  • ADCC antibody-dependent cellular cytotoxicity
  • Substitutions may for example be made in one or more of the amino acid residues 234, 235, 236, 237, 297, 318, 320, and 322 of the heavy chain constant region, thereby causing an alteration in an effector function while retaining binding to antigen as compared with the unmodified antibody, cf. US 5,624,821 and US 5,648,260.
  • the in vivo half-life of the antibodies may also be improved by modifying the salvage receptor epitope of the Ig constant domain or an Ig-like constant domain such that the molecule does not comprise an intact C H 2 domain or an intact Ig Fc region, cf. US 6,121 ,022 and US 6,194,551.
  • the in vivo half-life may furthermore be increased by making mutations in the Fc region, e.g. by substituting threonine for leucine at position 252, threonine for serine at position 254, or threonine for phenylalanine at position 256, cf. US 6,277,375.
  • the present invention provides variant anti-IL-21 antibodies wherein potential T cell epitopes in the antibody have been reduced or eliminated through rationale design.
  • the present invention provides a "deimmunized" anti-IL-21 antibody in which the potential T cell epitopes have been eliminated.
  • the design and construction of deimmunized anti-IL-21 antibodies may be accomplished by any suitable known technique (see for instance WO9852976 with respect to methods for preparing deimmunized antibodies). Immunogenicity in humans is expected to be eliminated or substantially reduced when such IL-21 BPs (e.g., anti-IL-21 variant antibodies) are administered according to the present invention.
  • framework mutations may include sequence changes which may reduce susceptibility to proteolysis, reduce susceptibility to oxidation, and/or confer or modify other physicochemical or functional properties on the associated variant antibody.
  • Amino acid sequence variations in the framework may also result in an altered glycosylation pattern in the variant antibody with respect to a parent antibody.
  • altering is meant deleting one or more carbohydrate moieties found in the parent antibody, and/or adding one or more glycosylation sites that are not present in the parent antibody.
  • Glycosylation of antibodies is typically either N-linked or O-linked.
  • N-linked refers to the attachment of the carbohydrate moiety to the side chain of an asparagine residue.
  • the tripeptide sequences asparagine-X-serine and asparagine-X-threonine, where X is any amino acid except proline, are common recognition sequences for enzymatic attachment of the carbohydrate moiety to the asparagine side chain.
  • O-linked glycosylation refers to the attachment of sugars such as N-aceylgalactosamine, galactose, or xylose to a hydroxyamino acid, most commonly serine or threonine, although 5-hydroxy- proline or 5-hydroxylysine may also be used.
  • Addition of glycosylation sites to the antibody may be conveniently accomplished by altering the amino acid sequence such that it contains one or more of the above-described tripeptide sequences (for N-linked glycosylation sites). The alteration may also be made by the addition of, or substitution by, one or more serine or threonine residues to the sequence of the original antibody (for O-linked glycosylation sites).
  • the antibodies may also be expressed in a transfectoma which does not add the fucose unit normally attached to the carbohydrate attched to Asn at position 297 of Fc in order to enhance the affinity of Fc for Fc ⁇ RIII which in turn will result in an increased ADCC of the antibodies in the presence of NK cells, cf. Shield et al., J. Biol. Chem. 277, 26733 (2002).
  • modification of galactosylation may be made in order to modify CDC. Further reference may be had to WO 99/54342 and Umana et al., Nat. Biotechnol. X7_, 176 (1999) disclosing a CHO cell line engineered to express Gntlll resulting in the expression of monoclonal antibodies with altered glycoforms and improved ADCC activity.
  • CDR shuffling techniques wherein typically CDRs are amplified from a diverse set of gene templates optionally comprising synthetic oligonucleotides, the constant regions of the V L , V H , and/or CDRs are amplified, and the various fragments mixed (in single-stranded or double- stranded format) and assembled by polymerase chain reaction (PCR) to produce a set of antibody-fragment encoding gene products carrying shuffled CDR introduced into the master framework, which is amplified using external primers annealing to sites beyond inserted restriction sites to ensure production of full-length products, which
  • Appropriate structure may be determined by superimposition of the variant/mimetic structures and those of the parent sequences, e.g., by comparison of NMR solution structures. Useful methods for rational design of CDR sequence variants are described in for instance WO 91/09967 and WO 93/16184. Additional examples of such methods are provided elsewhere herein.
  • the present invention also provides "fragments" of antibodies (including variant antibodies) of the present invention, which fragments has the ability to bind to IL-21 (IL-21 binding fragments).
  • IL-21 BPs thus include antibody-like molecules that comprise less than the full tetrameric structure associated with naturally-occurring antibodies.
  • an antibody “fragment” may be any peptide that comprises a portion of a full length antibody, generally the antigen binding or variable region thereof (this includes, for example, fragments of humanized antibodies comprising CDRs from an antibody of the present invention, variants thereof, or other CDRs that allow the antigen fragment to compete with an antibody of the present invention for IL-21 binding).
  • an antibody fragment refers to a peptide that consists essentially or consists only of a portion of an antibody molecule.
  • the present invention provides an antibody fragment comprising at least a portion of a heavy chain variable domain containing one or more V H CDRs of an antibody of the present invention and optionally also a light chain-variable domain comprising one or more V L CDRs of an antibody of the present invention, wherein the heavy chain variable domain, and optionally the light chain variable domain, optionally is (are) fused to an additional moiety, such as an immunoglobulin constant domain.
  • Constant domain sequences may be added to the heavy chain and/or light chain sequence(s) to form species with partial length heavy and/or light chain(s).
  • Constant regions, or portions thereof, of any antibody isotype may be used for this purpose, including IgG, IgM, IgA, IgD, and IgE constant regions.
  • IL-21-binding antibody fragments include Fab, Fab', F(ab') 2 , and Fv fragments.
  • An antibody fragment in the context of the present invention may also include a a peptide comprising a CDR, and the like.
  • the present invention provides an antibody fragment comprising a first polypeptide chain that comprises any of the heavy chain CDRs described herein and a second polypeptide chain that comprises any of the light chain CDRs described herein, wherein the two polypeptide chains are covalently linked by one or more interchain disulfide bonds.
  • the present invention provides a two-chain antibody fragment having such features wherein the antibody fragment is selected from Fab, Fab', Fab'-SH, Fv, and/or F(ab') 2 fragments.
  • Antibodies may be fragmented using conventional techniques, and the fragments screened for utility in the same manner as described above for whole antibodies.
  • F(ab') 2 fragments may be generated by treating antibody with pepsin.
  • the resulting F(ab') 2 fragment may be treated to reduce disulfide bridges to produce Fab' fragments.
  • Fab fragments may be obtained by treating an IgG antibody with papain;
  • F(ab') fragments may be obtained with pepsin digestion of IgG antibody.
  • a F(ab') fragment may also be produced by binding Fab' described below via a thioether bond or a disulfide bond.
  • a Fab' fragment is an antibody fragment obtained by cutting a disulfide bond of the hinge region of the F(ab') 2 .
  • a Fab' fragment may be obtained by treating a F(ab') 2 fragment with a reducing agent, such as dithiothreitol.
  • Antibody fragment peptides may also be generated by expression of nucleic acids encoding such peptides in recombinant cells (see for instance Evans et al., J. Immunol. Meth. 184, 123-38 (1995)).
  • a chimeric gene encoding a portion of a F(ab') 2 fragment could include DNA sequences encoding the C H 1 domain and hinge region of the H chain, followed by a translational stop codon to yield such a truncated antibody fragment molecule.
  • fragment does not imply any method of production (e.g., a "fragment” need not be made by “fragmentation”).
  • IL-21 BPs also include univalent antibodies and single chain antibodies.
  • Single chain antibodies are peptides in which the heavy and light chain Fv regions are connected.
  • the present invention provides a single-chain Fv (scFv) wherein the heavy and light chains in the Fv of an anti-IL-21 antibody of the present invention are joined with a flexible peptide linker (typically of about 10, 12, 15 or more amino acid residues) in a single peptide chain.
  • scFv single-chain Fv
  • Methods of producing such antibodies are described in for instance US 4,946,778, Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds. Springer-Verlag, New York, pp.
  • the single chain antibody may be monovalent, if only a single V H and V L are used, bivalent, if two V H and V L are used, or polyvalent, if more than two V H and V L are used.
  • an IL-21 BP may be derivatized or linked to another functional molecule, for instance another peptide or protein (such as a Fab' fragment) to generate a bispecific or multispecific molecule which binds to multiple binding sites or target epitopes (examples of bispecific and multispecific antibodies are discussed elsewhere herein).
  • another functional molecule for instance another peptide or protein (such as a Fab' fragment) to generate a bispecific or multispecific molecule which binds to multiple binding sites or target epitopes (examples of bispecific and multispecific antibodies are discussed elsewhere herein).
  • an antibody of the present invention may be functionally linked (for instance by chemical coupling, genetic fusion, noncovalent association or otherwise) to one or more other binding molecules, such as another antibody, peptide or binding mimetic.
  • the IL-21 BP is an antibody of the present invention.
  • Bispecific and multispecific molecules of the present invention may further include a third binding specificity, in addition to the anti-IL-21 binding specificity.
  • Such molecules may for instance be prepared as described in WO2006/072620.
  • the bispecific and multispecific molecules of the present invention comprise as a binding specificity at least one further antibody, including, e.g., an Fab, Fab', F(ab')2, Fv, or a scFv.
  • the further antibody may also be a light chain or heavy chain dimer, or any minimal fragment thereof such as a Fv or a single chain construct as described in Ladner et al., in US 4,946,778.
  • the antibody may also be a binding-domain immunoglobulin fusion protein as disclosed in US 2003/0118592 and US 2003/0133939.
  • an IL-21 BP of the present invention is a multispecific anti-IL-21 antibody or antibody-like molecule, a particular example of which is a bispecific antibody comprising at least one pair of V H sequence and V L sequence chains specific for an epitope comprised at least in part in IL-21 and a second at least one pair of V H and V L sequence chains specific for a second epitope.
  • the V H and V L sequences in a bispecific antibody may comprise complete V H and V L sequences corresponding to anti-IL-21 V H and V L regions, variant V H and/or V L sequences, or suitable portions of V H and/or V L regions, such as a suitable combination of CDR sequences and other sequences sufficient to provide binding to the epitopes of interest.
  • a bispecific antibody of the present invention is a diabody.
  • Bispecific antibodies also include cross-linked or "heteroconjugate" antibodies.
  • one of the antibodies in a heteroconjugate may be coupled to avidin and the other to biotin.
  • Such antibodies have, for example, been proposed to target immune system cells to unwanted cells (see for instance US 4,676,980).
  • Heteroconjugate antibodies may be made using any convenient cross-linking methods. Suitable peptide cross-linking agents and techniques are well known in the art, and examples of such agents and techniques are disclosed in for instance US 4,676,980.
  • antibody fragments such as Fab fragments, Fab' fragments, and scFv peptides, antibody- like peptides (peptides comprising a CDR), bi- and multi-specific antibodies and other IL-21 BPs, as appropriate, provided that the IL-21 BP of the present invention retains at least a substantial proportion of the antigen-binding properties of the corresponding complete antibody.
  • antibody fragments may be associated with lower antigen- binding affinity, but may offer other advantageous features that may offset for any such loss in affinity.
  • IL-21 BPs of the present invention and particularly anti-IL-21 antibodies may be selected based on their ability to provide the ability of complement fixation, or not.
  • isotypes of antibodies that are capable of complement fixation and CDC including, without limitation, the following: murine IgM, murine lgG2a, murine lgG2b, murine lgG3, human IgM, human IgGI , and human lgG3.
  • Those isotypes that do not include, without limitation, human lgG2 and human lgG4. lsotype determination and other methods for modifying the complement fixation and CDC functional characteristics of antibodies are known in the art.
  • IL-21 BPs of the present invention also include immunoadhesins, which are molecules wherein one or more CDRs of an anti-IL-21 antibody are covalently or noncovalently associated with the molecule.
  • An immunoadhesin may incorporate the CDR(s) as part of a larger polypeptide chain, may covalently link the CDR(s) to another polypeptide chain, or may incorporate the CDR(s) noncovalently.
  • the CDRs permit the immunoadhesin to specifically bind to an IL-21.
  • IL-21 BP fusion proteins may comprise any suitable amino acid sequence or combination of sequences that are specific and/or selective for at least one domain that is at least partially comprised within IL-21 (e.g., an anti-IL-21 antibody V H domain, V L domain, or particular CDRs thereof) and at least one nonhomologous and typically substantially nonsimilar amino acid sequence (e.g., less than about 40%, less than about 35%, less than about 30%, less than about 25%, or less than about 20% amino acid sequence identity to the IL-21 -specific/selective sequence) that imparts a detectable biological function and/or characteristic to the fusion protein that cannot solely be attributed to the I L-21 -specific/selective sequence (e.g., increased in vivo half-life, fluorescence, increased targeting to a particular type of cell, etc.).
  • IL-21 BP fusion proteins may comprise any suitable amino acid sequence or combination of sequences that are specific and/or selective for at least one domain that is at least partially comprised within IL-21
  • Secondary sequence(s) may also be derived from cytotoxic or apoptotic peptides. Secondary sequences may also confer diagnostic properties. Examples of such sequences include those derived from easily visualized enzymes such as horseradish peroxidase.
  • IL-21 BP fusion proteins may also be characterized by comprising an epitope tag.
  • An epitope tag sequence is an amino acid sequence having enough residues to provide an epitope against which an antibody may be made, in the context of the IL-21 BP, yet is short enough such that it does not substantially interfere with the activity (selectivity, specificity, affinity, and/or biological activity) of the IL-21 BP (as compared to a parent IL-21 BP lacking the epitope tag).
  • An epitope tag desirably is sufficiently unique so that the anti-epitope tag antibody does not substantially cross-react with other epitopes.
  • Suitable tag polypeptides generally have at least about 6 amino acid residues and usually between about 8-50 amino acid residues (e.g., about 9-30 residues).
  • epitope tags include the flu HA tag polypeptide and its antibody 12CA5 (Field et al., MoI. Cell. Biol. 8, 2159-2165 (1988)); the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto (Evan et al., MoI. Cell. Biol. 5(12), 3610-3616 (1985)) and the Herpes Simplex virus glycoprotein D (gD) tag and its antibody (Paborsky et al., Protein Engineering 3(6), 547-553 (1990)).
  • the epitope tag is a "salvage receptor binding epitope".
  • salvage receptor binding epitope refers to an epitope of the Fc region of an IgG molecule (for instance IgGI , lgG2, lgG3, or lgG4) that is responsible for increasing the in vivo serum half-life of the IgG molecule.
  • IL-21 BPs of the present invention also include IL-21 BP derivatives.
  • IL-21 BP derivatives may be produced by chemically conjugating a radioisotope, protein, or other agent/moiety/compound to the N-terminal side or C-terminal side of the I L-21 BP or subunit thereof (e.g., an anti-IL-21 antibody H chain, L chain, or anti-IL-21 specific/selective fragment thereof), an appropriate substituent group or side chain or to a sugar chain in the IL-21 BP (see, e.g., Antibody Engineering Handbook, edited by Osamu Kanemitsu, published by Chijin Shokan (1994)). Derivatives may also be generated by conjugation at internal residues or sugars, where appropriate.
  • a derivative may for instance be a peptide in which one or more of the amino acid residues of the peptide have been chemically modified (e.g. by alkylation, acylation, ester formation, or amide formation) or covalently associated with one or more heterologous substituents (e.g., a lipophilic substituent, a PEG moiety, a peptide side chain linked by a suitable organic moiety linker, etc.).
  • the peptide may also be conjugated to a therapeutic moiety, such as a cytotoxin, a chemotherapeutic drug, an immunosuppressant, or a radioisotope (a socalled immunoconjugate).
  • IL-21 BPs described herein may be modified by inclusion of any suitable number of such modified amino acids and/or associations with such conjugated substituents. Suitability in this context is generally determined by the ability to at least substantially retain IL-21 selectivity and/or specificity associated with the non-derivatized parent IL-21 BP.
  • the inclusion of one or more modified amino acids may be advantageous in, for example, increasing polypeptide serum half-life, reducing polypeptide antigenicity, or increasing polypeptide storage stability.
  • Amino acid(s) are modified, for example, co-translationally or post-translationally during recombinant production (e.
  • Non-limiting examples of a modified amino acid include a glycosylated amino acid, a sulfated amino acid, a prenlyated (e. g., farnesylated, geranylgeranylated) amino acid, an acetylated amino acid, an acylated amino acid, a PEGylated amino acid, a biotinylated amino acid, a carboxylated amino acid, a phosphorylated amino acid, and the like.
  • a glycosylated amino acid e. g., farnesylated, geranylgeranylated
  • a prenlyated amino acid e. g., farnesylated, geranylgeranylated
  • the modified amino acid may for instance be selected from a glycosylated amino acid, a PEGylated amino acid, a farnesylated amino acid, an acetylated amino acid, a biotinylated amino acid, an amino acid conjugated to a lipid moiety, or an amino acid conjugated to an organic derivatizing agent.
  • antibodies may be chemically modified by covalent conjugation to a polymer to for instance increase their circulating half-life.
  • Exemplary polymers, and methods to attach them to peptides are illustrated in for instance US 4,766,106, US 4,179,337, US 4,495,285 and US 4,609,546.
  • Additional illustrative polymers include polyoxyethylated polyols and polyethylene glycol (PEG) (e.g., a PEG with a molecular weight of between about 1 ,000 and about 40,000, such as between about 2000 and about 20,000, e.g., about 3,000-12,000).
  • PEG polyethylene glycol
  • the present invention provides an IL-21 BP that is conjugated to a second molecule that is selected from a radionuclide, an enzyme, an enzyme substrate, a cofactor, a fluorescent marker, a chemiluminescent marker, a peptide tag, or a magnetic particle.
  • an IL-21 BP may be conjugated to one or more antibody fragments, nucleic acids (oligonucleotides), nucleases, hormones, immunomodulators, chelators, boron compounds, photoactive agents, dyes, and the like. These and other suitable agents may be coupled either directly or indirectly to IL-21 BPs of the present invention.
  • One example of indirect coupling of a second agent is coupling by a spacer moiety.
  • spacers may be either insoluble or soluble (see for instance Diener et al., Science 231 , 148 (1986)) and may be selected to enable drug release from the IL-21 BP at a target site and/or under particular conditions.
  • Additional examples of therapeutic agents that may be coupled to IL-21 BPs include lectins and fluorescent peptides.
  • IL-21 BP derivatives comprising one or more radiolabeled amino acids are provided.
  • a radiolabeled IL-21 BP may be used for both diagnostic and therapeutic purposes (conjugation to radiolabeled molecules is another possible feature).
  • Nonlimiting examples of labels for polypeptides include, but are not limited to 3H, 14C, 15N, 35S, 9OY, 99Tc, and 1251, 1311, and 186Re.
  • radiolabeled amino acids and related peptide derivatives are known in the art (see for instance Junghans et al., in Cancer Chemotherapy and Biotherapy 655-686 (2d edition, Chafner and Longo, eds., Lippincott Raven (1996)) and US 4,681 ,581 , US 4,735,210, US 5,101 ,827, US 5,102,990 (US RE35,500), US 5,648,471 and US 5,697,902.
  • a radioisotope may be conjugated by a chloramine T method.
  • Radionuclides in diagnostic contexts are indium isotopes and in the context of therapeutic applications yttrium isotopes, which are cytotoxic.
  • Photon-emitting radioisotopes in general, are advantageous in diagnostic (radioimmunoscintigraphy (RIS)) methods. Auger electrons have a very short path length (5-10 nm) and need to be internalized to be cytotoxic (see for instance Adelstein et al., Nucl. Med. Biol. 14, 165-169 (1987)).
  • peptides conjugated to such isotopes may be useful in diagnostic methods, but only peptides that are internalized should be considered for radioisotopes that emit Auger electrons in therapeutic contexts.
  • Alpha particles need to be close to a cell (within 3-4 cell diameters) to be effective as therapeutic agents (Vriesendorp et al.,
  • Radioimmunoglobulin therapy in High Dose Cancer Therapy Armitage et al., (eds). (Williams & Wilkins, Baltimore, Md. 1992)). Both Auger electrons and alpha emitters may be considered to have high selectivity because their short-range emission typically will not irradiate neighboring normal cells.
  • the radiometals 111 In and 90 Y are, respectively, a pure ⁇ -emitter and a pure ⁇ -emitter. lodine-125, the most commonly used emitter of Auger electrons, has a half-life of about 60 days and frequently is released by immunoconjugates in vivo (due to dehalogenation).
  • the most commonly considered alpha emitters for clinical use have relatively short half-lives (7.2 h and 1.0 h, respectively) and decay into radioactive isotopes that may not be retained by the immunoconjugate after the first alpha emission (Wilbur, Antibiot. Immunoconjug. Radiopharm. 4, 5-97 (1991)).
  • IL-21 BPs labeled with indium-11 1 or technetium-99m may be used. Both of these isotopes emit gamma rays within the appropriate energy range for imaging, (100-250 keV). Energys below this range typically are not penetrating enough to reach an external imaging device. Higher energy levels are difficult to collimate and provide diagnostic images with poor resolution.
  • the short-half life of 99 Tc typically restricts its use to immunoconjugates with rapid tumor uptake.
  • first and second IL-21 BPs conjugated with first and second radioisotopes are provided.
  • a single IL-21 BP conjugated with two radioisotopes is provided.
  • the radioisotopes 125 I, 131 I, 99 Tc, 186 Re, and 188 Re may be, for example, covalently bound to proteins (including antibodies) through amino acid functional groups.
  • radioactive iodine it is usually through the phenolic group found on tyrosine. There are numerous methods to accomplish this: chloramine-T (see for instance Greenwood et al., Biochem J. 89, 114-123 (1963) and lodogen (Salacinski et al., Anal. Biochem. V ⁇ l_, 136-146 (1981)).
  • Tc and Re isotopes may be covalently bound through the sulfhydryl group of cysteine (see for instance Griffiths et al., Cancer Res.
  • a IL-21 BP may also be labeled with enzymes that are useful for detection, such as horseradish peroxidase, ⁇ -galactosidase, luciferase, alkaline phosphatase, glucose oxidase, and the like.
  • a IL-21 BP may also be labeled with biotin, and accordingly detected through indirect measurement of avidin or streptavidin binding.
  • a IL-21 BP may also be labeled with a predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags, etc.).
  • a secondary reporter e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags, etc.
  • enzyme conjugate candidates include malate dehydrogenase, staphylococcal nuclease, delta-V-steroid isomerase, yeast alcohol dehydrogenase, ⁇ -glycerophosphate dehydrogenase, triose phosphate isomerase, asparaginase, glucose oxidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase, and acetylcholinesterase.
  • Additional exemplary labeling moieties generally include, but are not limited to spin- label
  • the present invention provides crosslinked IL-21 BP derivatives.
  • such an IL-21 BP derivative may be produced by crosslinking two or more antibodies, at least one of which is specific/selective for IL-21 (of the same type or of different types, e.g., to create bispecific antibodies).
  • Suitable crosslinkers include those that are heterobifunctional, having two distinctly reactive groups separated by an appropriate spacer (e.g., m-maleimidobenzoyl-N-hydroxysuccinimide ester) or homobifunctional (e.g., disuccinimidyl suberate).
  • Such linkers are available from Pierce Chemical Company, Rockford, III.
  • IL-21 BPs may also be derivatized with a detection agents, for instance fluorescent compounds, including fluorescein, fluorescein isothiocyanate, rhodamine, 5-dimethylamine- 1-napthalenesulfonyl chloride, lanthanide phosphors, and the like.
  • fluorescent compounds including fluorescein, fluorescein isothiocyanate, rhodamine, 5-dimethylamine- 1-napthalenesulfonyl chloride, lanthanide phosphors, and the like.
  • suitable fluorescent labels include a 125 Eu label, an isothiocyanate label, a phycoerythrin label, a phycocyanin label, an allophycocyanin label, an o-phthaldehyde label, a fluorescamine label, etc.
  • chemiluminescent labels include luminal labels, isoluminal labels, aromatic acridinium ester labels, imidazole labels, acridinium salt labels, oxalate ester labels, a luciferin labels, luciferase labels, aequorin labels, etc.
  • an IL-21 BP derivative comprises a conjugated nucleic acid or nucleic acid-associated molecule.
  • the conjugated nucleic acid is a cytotoxic ribonuclease.
  • the conjugated nucleic acid is an antisense nucleic acid (for instance a S100A10 targeted antisense molecule, which may also be an independent component in a combination composition or combination administration method of the present invention - see for instance Zhang et al., J Biol Chem. 279(3), 2053-62 (2004)).
  • the conjugated nucleic acid is an inhibitory RNA molecule (e.g., a siRNA molecule).
  • the conjugated nucleic acid is an immunostimulatory nucleic acid (e.g., an immunostimulatory CpG motif-containing DNA molecule).
  • the conjugated nucleic acid is an expression cassette coding for expression of a tumor suppressor gene, anti-cancer vaccine, anti-cancer cytokine, or apoptotic agent.
  • Such derivatives also may comprise conjugation of a nucleic acid coding for expression of one or more cytotoxic proteins, such as plant and bacterial toxins.
  • an IL-21 BP is conjugated to a functional nucleic acid molecule.
  • Functional nucleic acids include antisense molecules, interfering nucleic acid molecules (e.g., siRNA molecules), aptamers, ribozymes, triplex forming molecules, and external guide sequences.
  • the functional nucleic acid molecules may act as affectors, inhibitors, modulators, and stimulators of a specific activity possessed by a target molecule, or the functional nucleic acid molecules may possess a de novo activity independent of any other molecules.
  • an IL-21 BP is conjugated to an aptamer.
  • Aptamers are molecules that interact with a target molecule, for instance in a specific way.
  • aptamers are small nucleic acids ranging from 15-50 bases in length that fold into defined secondary and tertiary structures, such as stem-loops or G-quartets.
  • Aptamers can bind small molecules, such as ATP (US 5,631 ,146) and theophiline (US 5,580,737), as well as large molecules, such as reverse transcriptase (US 5,786,462) and thrombin (US 5,543,293).
  • the present invention provides an IL-21 BP which is conjugated to a ribozyme.
  • Ribozymes are nucleic acid molecules that are capable of catalyzing a chemical reaction, either intramolecularly or intermolecularly. Ribozymes are thus catalytic nucleic acids.
  • ribozymes that catalyze nuclease or nucleic acid polymerase type reactions which are based on ribozymes found in natural systems, such as (a) hammerhead ribozymes, (described in for example US 5,334,711 , US 5,436,330, US 5,616,466, US 5,633,133, US 5,646,020, US 5,652,094, US 5,712,384, US 5,770,715, US 5,856,463, US 5,861 ,288, US 5,891 ,683, US 5,891 ,684, US 5,985,621 , US 5,989,908, US 5,998,193, US 5,998,203, WO 9858058, WO 9858057 and WO 9718312), (b) hairpin ribozymes (described in for instance US 5,631 , 115, US 5,646,031 , US 5,683,902, US 5,712,384, US 5,856,188, US 5,866,70
  • Ribozymes typically cleave RNA or DNA substrates, and more commonly cleave RNA substrates. Ribozymes typically cleave nucleic acid substrates through recognition and binding of the target substrate with subsequent cleavage. This recognition is often based mostly on canonical or non-canonical base pair interactions.
  • the present invention provides an IL-21 BP that is conjugated to a triplex forming function nucleic acid.
  • nucleic acid molecules can interact with either double-stranded or single-stranded nucleic acid.
  • triplex molecules interact with a target region, a structure called a triplex is formed, in which three strands of DNA form a complex dependant on both Watson-Crick and Hoogsteen base-pairing.
  • Triplex molecules can bind target regions with high affinity and specificity.
  • an IL-21 BP is conjugated to an external guide sequence.
  • External guide sequences are molecules that bind a target nucleic acid molecule forming a complex that is recognized by RNase P, which cleaves the target molecule. EGSs may be designed to specifically target a RNA molecule of choice. RNAse P aids in processing transfer RNA (tRNA) within a cell. Bacterial RNAse P may be recruited to cleave virtually any RNA sequence by using an EGS that causes the target RNA:EGS complex to mimic the natural tRNA substrate, (see for instance WO 92/03566 and Forster and Altman, Science 238, 407-409 (1990) for discussion).
  • an IL-21 BP is conjugated to an interfering nucleic acid molecule, such as a siRNA or other RNAi molecule (e.g., an inhibitory double stranded (ds) RNA molecule of about 20-25 nucleotides), which is targeted to interfere with the action of a target gene expression product, such as a gene expression product involved in an IL-21 mediated disease or condition.
  • interfering nucleic acid molecules such as a siRNA or other RNAi molecule (e.g., an inhibitory double stranded (ds) RNA molecule of about 20-25 nucleotides)
  • an IL-21 BP is conjugated to a tumor targeting domain peptide or molecule. In one embodiment, an IL-21 BP is conjugated to a tumor targeting factor VII sequence.
  • any method known in the art for conjugating the IL-21 BP to the conjugated molecule(s), such as those described above, may be employed, including those methods described by Hunter et al., Nature 144, 945 (1962), David et al., Biochemistry 13, 1014 (1974), Pain et al., J. Immunol. Meth. 40, 219 (1981 ) and Nygren, J. Histochem. and Cytochem. 30, 407 (1982). Linkage/conjugation may be accomplished in any suitable way.
  • a covalent linkage may take the form of a disulfide bond (if necessary and suitable, an IL-21 BP could be engineered to contain an extra cysteine codon, which desirably does not interfere with the IL-21 binding activity of the molecule.
  • a toxin molecule, derivatized with a sulfhydryl group reactive with the cysteine of the modified IL-21 BP, may form an immunoconjugate with the IL-21 BP peptide.
  • a sulfhydryl group may be introduced directly to an IL-21 BP using solid phase polypeptide techniques. For example, the introduction of sulfhydryl groups into peptides is described by Hiskey, Peptides 3, 137 (1981).
  • sulfhydryl groups into proteins are described in Maasen et al., Eur. J. Biochem. 134, 32 (1983).
  • the cytotoxin and IL-21 BP may be purified, both sulfur groups reduced; cytotoxin and ligand mixed (for instance in a ratio of about 1 :5 to 1 :20); and disulfide bond formation allowed to proceed to completion (generally about 20 to 30 minutes) at room temperature.
  • the mixture may then be dialyzed against phosphate buffered saline or chromatographed in a resin such as Sephadex to remove unreacted ligand and toxin molecules.
  • cytotoxic compounds may be joined to proteins through the use of a reactive group on the cytotoxic compound or through the use of a cross-linking agent.
  • a common reactive group that will form a stable covalent bond in vivo with an amine is isothiocyanate (Means et al., Chemical modifications of proteins (Holden-Day, San Francisco 1971 ) pp. 105-1 10). This group preferentially reacts with the ⁇ -amine group of lysine.
  • Maleimide is a commonly used reactive group to form a stable in vivo covalent bond with the sulfhydryl group on cysteine (Ji., Methods Enzymol 91., 580-609 (1983)).
  • Monoclonal antibodies typically are incapable of forming covalent bonds with radiometal ions, but they may be attached to the antibody indirectly through the use of chelating agents that are covalently linked to the antibodies. Chelating agents may be attached through amines
  • Crosslinking agents that have two reactive functional groups are classified as being homo or heterobifunctional.
  • homobifunctional crosslinking agents include bismaleimidohexane (BMH) which is reactive with sulfhydryl groups (Chen et al., J Biol Chem 266, 18237-18243 (1991)) and ethylene glycolbis[succinimidylsucciate] (EGS) which is reactive with amino groups (Browning et al., J. Immunol. 143, 1859-1867 (1989)).
  • BMH bismaleimidohexane
  • EVS ethylene glycolbis[succinimidylsucciate]
  • An example of a heterobifunctional crosslinker is m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS) (Myers et al., J.
  • a therapeutic or diagnostic agent may also or alternatively be attached at the hinge region of a reduced antibody component via disulfide bond formation.
  • such peptides may be attached to the antibody component using a heterobifunctional cross-linker, such as N-succinyl 3-(2-pyridyldithio)proprionate (SPDP). Yu et al., Int. J. Cancer 56, 244 (1994). General techniques for such conjugation are well known in the art.
  • labels or other conjugated substituents are attached to the IL-21 BP amino acid sequence by spacer arms of various lengths to reduce potential steric hindrance.
  • Unlabeled IL-21 BP(s) may be used in combination with other labeled antibodies (second antibodies) that are reactive with the IL-21 BP(s), such as antibodies specific for human immunoglobulin constant regions that bind to anti-IL-21 mAbs.
  • second antibodies that are reactive with the IL-21 BP(s)
  • an IL-21 BP may be directly labeled.
  • labels may be employed for direct or indirect labeling of IL-21 BPs, such as labeling with radionuclides, fluors, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, ligands (particularly haptens), etc.
  • Amino acid sequence insertions include amino- and/or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues.
  • terminal insertions include an antibody with an N-terminal methionyl residue or the antibody fused to an epitope tag.
  • Other insertion variants of the antibody molecule include the fusion to the N- or C-terminus of the antibody of an enzyme or a polypeptide or PEG which increases the serum half-life of the antibody.
  • anti-IL-21 antibody fusion proteins and similar fusion proteins comprising IL-21 BP sequences are another feature of the present invention.
  • a cytotoxin or cytotoxic agent includes any agent that is detrimental to (e.g., kills) cells.
  • kills any agent that is detrimental to (e.g., kills) cells.
  • these classes of drugs which are well known in the art, and their mechanisms of action, see Goodman et al., Goodman and Gilman's The Pharmacological Basis Of Therapeutics, 8th Ed., Macmillan Publishing Co., 1990. Additional techniques relevant to the preparation of antibody immunotoxins are provided in for instance Vitetta, Immunol. Today 14, 252 (1993) and US 5,194,594.
  • Suitable therapeutic agents for forming immunoconjugates of the present invention include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydro- testosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin, antimetabolites (such as methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, fludarabin, 5-fluorouracil, decarbazine, hydroxyurea, asparaginase, gemcitabine, cladribine), alkylating agents (such as mechlorethamine, thioepa
  • the drug moiety need not be construed as limited to classical chemical therapeutic agents.
  • the drug moiety may be a protein or polypeptide possessing a desired biological activity.
  • proteins may include, for example, an agent active at the cell surface, such as phospholipase enzymes, e.g. phospholipase C.
  • the lysing portion of a toxin typically may be readily joined to the Fab fragment of an antibody or antibody fragment of the present invention.
  • suitable conjugated molecules include ribonuclease (RNase), DNase I, Staphylococcal enterotoxin-A, pokeweed antiviral protein, diphtherin toxin, and Pseudomonas endotoxin. See, for example, Pastan et al., Cell 47, 641 (1986) and Goldenberg, Calif. A Cancer Journal for Clinicians 44, 43 (1994). Additional toxins suitable for use in the present invention are known to those of skill in the art (seefor instance US 6,077,499).
  • Conjugates of IL-21 BPs such as antibodies, and such cytotoxic moieties may be made using a variety of bifunctional protein coupling agents.
  • reagents include SPDP, IT, bifunctional derivatives of imidoesters such a dimethyl adipimidate HCI, active esters such as disuccinimidyl suberate, aldehydes such as glutaraldehyde, bis-azido compounds such as bis (p-azidobenzoyl) hexanediamine, bis-diazonium derivatives such as bis-(p-diazoniumbenzoyl)-ethylenediamine, diisocyanates such as tolylene 2,6-diisocyanate, and bis-active fluorine compounds such as 1 ,5-difluoro-2,4-dinitrobenzene and anti-mitotic agents (e.g., vincristine, vinblastine, docetaxel, paclitaxel and vinorelbin).
  • the present invention provides an IL-21 BP that is conjugated to a mixed toxin.
  • a mixed toxin molecule is a molecule derived from two different (typically polypeptide) toxins.
  • peptide toxins comprise one or more domains responsible for generalized eukaryotic cell binding, at least one enzymatically active domain, and at least one translocation domain. The binding and translocation domains are required for cell recognition and toxin entry respectively.
  • Naturally-occurring proteins which are known to have a translocation domain include diphtheria toxin, Pseudomonas exotoxin A, and possibly other peptide toxins.
  • translocation domains of diphtheria toxin and Pseudomonas exotoxin A are well characterized (see for instance Hoch et al., PNAS USA 82, 1692 (1985), Colombatti et al., J. Biol. Chem. 26J., 3030 (1986) and Deleers et al., FEBS Lett. 160, 82 (1983)), and the existence and location of such a domain in other molecules may be determined by methods such as those employed by Hwang et al., Cell 48, 129 (1987) and Gray et al., PNAS USA 8J. 2645 (1984).
  • a useful mixed toxin hybrid molecule may be formed, for example, by fusing the enzymatically active A subunit of E. coli Shiga-like toxin (Calderwood et al., PNAS USA 84, 4364 (1987)) to the translocation domain (amino acid residues 202 through 460) of diphtheria toxin, and to a molecule targeting a particular cell type, as described in US 5,906,820.
  • the targeting portion of the three-part hybrid can cause the molecule to attach specifically to the targeted cells, and the diphtheria toxin translocation portion can act to insert the enzymatically active A subunit of the Shiga-like toxin into a targeted cell.
  • the enzymatically active portion of Shiga-like toxin like diphtheria toxin, acts on the protein synthesis machinery of the cell to prevent protein synthesis, thus killing the targeted cell.
  • Immunoconjugates according to the present invention may also comprise a radioisotope, e.g., iodine-131 , yttrium-90 or indium-1 11 , to generate cytotoxic radiopharmaceuticals for treating an I L-21 -related disorder.
  • a radioisotope e.g., iodine-131 , yttrium-90 or indium-1 11
  • the IL-21 BPs such as the human antibodies of the present invention are attached to a linker-chelator, e.g., tiuxetan, which allows for the antibody to be conjugated to a radioisotope.
  • conjugate substituents include anti-cancer retinoids.
  • Taxane conjugates see for instance Jaime et al., Anticancer Res. 21.(2A), 1 119-28 (2001), cisplatin conjugates, thapsigargin conjugates, linoleic acid conjugates, calicheamicin conjugates (see for instance Damle et al., Curr Opin Pharmacol. 3(4), 386-90 (2003), doxorubicin conjugates, geldanamycin conjugates, and the like, also may be useful in promoting the treatment of cancer (see, generally, Trail et al., Cancer Immunol Immunother. 52(5), 328-37 (2003)).
  • the present invention provides secondary and anti-idiotypic antibodies raised against anti-IL-21 antibodies of the present invention.
  • a secondary antibody refers to an antibody specific for, and typically raised against, an anti-IL-21 antibody.
  • An anti-idiotypic (Id) antibody is an antibody which recognizes unique determinants generally associated with the antigen-binding site of an antibody.
  • An Id antibody may be prepared by immunizing an animal of the same species and genetic type as the source of an anti-IL-21 mAb with the mAb to which an anti-Id is being prepared. The immunized animal typically can recognize and respond to the idiotypic determinants of the immunizing antibody by producing an antibody to these idiotypic determinants (the anti-Id antibody).
  • Such antibodies are described in for instance US 4,699,880. Such antibodies are further features of the present invention.
  • An anti-Id antibody may also be used as an "immunogen" to induce an immune response in yet another animal, producing a so-called anti-anti-ld antibody.
  • An anti-anti-ld may be epitopically identical to the original mAb, which induced the anti-Id.
  • Anti-Id antibodies may be varied (thereby producing anti-Id antibody variants) and/or derivatized by any suitable technique, such as those described elsewhere herein with respect to anti-IL-21 antibodies and other IL-21 BPs of the present invention.
  • anti-Id mAbs may be coupled to a carrier such as keyhole limpet hemocyanin (KLH) and used to immunize BALB/c mice. Sera from these mice typically will contain anti-anti-ld antibodies that have the binding properties similar if not identical to an original/parent IL-21 antibody.
  • KLH keyhole limpet hemocyanin
  • the present invention provides a nucleic acid encoding an IL-21 BP.
  • a IL-21 BP-encoding nucleic acid may have any suitable characteristics and comprise any suitable features or combination thereof.
  • an IL-21 BP-encoding nucleic acid may be in the form of DNA, RNA, or a hybrid thereof, and may include nonnaturally-occurring bases, a modified backbone (e.g., a phosphothioate backbone that promotes stability of the nucleic acid), or both.
  • the nucleic acid advantageously comprises features that promote desired expression in target host cell(s), replication, and/or selection. Examples of such features include an origin of replication component, a selection gene component, a promoter component, an enhancer element component, a polyadenylation sequence component, a termination component, and the like.
  • the present invention provides a vector comprising an IL-21 BP- encoding nucleic acid.
  • a vector refers to a delivery vehicle that promotes the expression of an IL-21 BP-encoding nucleic acid, the production of an IL-21 BP peptide, the transfection/transformation of target cells, the replication of the IL-21 BP-encoding nucleic acid, promotes stability of the nucleic acid, promotes detection of the nucleic acid and/or transformed/transfected cells, or otherwise imparts advantageous biological function to the IL-21 BP-encoiding nucleic acid.
  • a vector in the context of the present invention may be any suitable vector, including chromosomal, non-chromosomal, and synthetic nucleic acid vectors (a nucleic acid sequence comprising a suitable set of expression control elements).
  • suitable vectors include derivatives of SV40, bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, and viral nucleic acid (RNA or DNA) vectors.
  • an IL-21 BP-encoding nucleic acid is comprised in a naked DNA or RNA vector, including, for example, a linear expression element (as described in for instance Sykes and Johnston, Nat Biotech X7_,
  • a compacted nucleic acid vector as described in for instance US 6,077, 835 and/or WO 00/70087
  • a plasmid vector such as pBR322, pUC 19/18, or pUC 118/119
  • a "midge" minimally-sized nucleic acid vector as described in for instance Schakowski et al., MoI Ther 3, 793-800 (2001)
  • a precipitated nucleic acid vector construct such as a CaP04-precipitated construct (as described in for instance WO 00/46147, Benvenisty and Reshef, PNAS USA 83, 9551-55 (1986), Wigler et al., Cell 14, 725 (1978), and Coraro and Pearson, Somatic Cell Genetics 7, 603 (1981)).
  • the vector is suitable for expression of the IL-21 BP in a bacterial cell.
  • vectors which direct high level expression of fusion proteins that are readily purified (for instance multifunctional E. coli cloning and expression vectors such as BlueScript (Stratagene), pi N vectors (Van Heeke & Schuster, J Biol Chem 264, 5503-5509 (1989), pET vectors (Novagen, Madison Wl) and the like).
  • An expression vector may also or alternatively be a vector suitable for expression in a yeast system.
  • Suitable vectors for use in for instance Saccharomyces cerevisiae include, for example, vectors comprising constitutive or inducible promoters such as alpha factor, alcohol oxidase and PGH (reviewed in: F. Ausubel et al., ed. Current Protocols in Molecular Biology, Greene Publishing and Wiley InterScience New York (1987), and Grant et al., Methods in Enzymol 153. 516-544 (1987)).
  • a nucleic acid and/or vector may also comprises a nucleic acid sequence encoding a secretion/ localization sequence, which can target a polypeptide, such as a nascent polypeptide chain, to a desired cellular compartment, membrane, or organelle, or which directs polypeptide secretion to periplasmic space or into cell culture media.
  • a secretion/ localization sequence which can target a polypeptide, such as a nascent polypeptide chain, to a desired cellular compartment, membrane, or organelle, or which directs polypeptide secretion to periplasmic space or into cell culture media.
  • Such sequences are known in the art, and include secretion leader or signal peptides, organelle targeting sequences (e. g., nuclear localization sequences, ER retention signals, mitochondrial transit sequences, chloroplast transit sequences), membrane localization/anchor sequences (e. g., stop transfer sequences, GPI anchor sequences), and the like.
  • IL-21 BP-encoding nucleic acids may comprise or be associated with any suitable promoter, enhancer, and other expression-facilitating elements.
  • suitable promoter, enhancer, and other expression-facilitating elements include strong expression promoters (e. g., human CMV IE promoter/enhancer as well as RSV, SV40, SL3-3, MMTV, and HIV LTR promoters), effective poly (A) termination sequences, an origin of replication for plasmid product in E. coli, an antibiotic resistance gene as selectable marker, and/or a convenient cloning site (e.g., a polylinker).
  • Nucleic acids may also comprise an inducible promoter as opposed to a constitutive promoter such as CMV IE (the skilled artisan will recognize that such terms are actually descriptors of a degree of gene expression under certain conditions).
  • the nucleic acid may be positioned in and/or delivered to the host cell or host animal via a viral vector. Any suitable viral vector may be used in this respect, and several are known in the art.
  • a viral vector may comprise any number of viral polynucleotides, alone or in combination with one or more viral proteins, which facilitate delivery, replication, and/or expression of the nucleic acid of the present invention in a desired host cell.
  • the viral vector may be a polynucleotide comprising all or part of a viral genome, a viral protein/nucleic acid conjugate, a virus-like particle (VLP), a vector similar to those described in US 5,849, 586 and WO 97/04748, or an intact virus particle comprising viral nucleic acids and the nucleic acid of the present invention.
  • a viral particle viral vector may comprise a wild-type viral particle or a modified viral particle.
  • the viral vector may be a vector which requires the presence of another vector or wild-type virus for replication and/or expression (i.e., it may be a helper-dependent virus), such as an adenoviral vector amplicon.
  • such viral vectors consist essentially of a wild-type viral particle, or a viral particle modified in its protein and/or nucleic acid content to increase transgene capacity or aid in transfection and/or expression of the nucleic acid (examples of such vectors include the herpes virus/AAV amplicons).
  • a viral vector is similar to and/or derived from a virus that normally infects humans.
  • Suitable viral vector particles include, for example, adenoviral vector particles (including any virus of or derived from a virus of the adenoviridae), adeno-associated viral vector particles (AAV vector particles) or other parvoviruses and parvoviral vector particles, papillomaviral vector particles, flaviviral vectors, alphaviral vectors, herpes viral vectors, pox virus vectors, retroviral vectors, including lentiviral vectors. Examples of such viruses and viral vectors are in ofr instance Fields et al., eds., Virology Raven Press, Ltd., New York (3rd ed., 1996 and 4th ed., 2001), Encyclopedia of Virology, R. G.
  • Viral vectors that may be employed with polynucleotides of the present invention and the methods described herein include adenovirus and adeno-associated vectors, as in for instance Carter, Curr Opinion Biotech 3, 533-539 (1992) and Muzcyzka, Curr Top Microbiol Immunol 158, 97-129 (1992). Additional types and aspects of AAV vectors are described in for instance Carter, Contrib. Microbiol. 4, 85-86 (2000), Smith-Arica, Curr. Cardiol. Rep. 3(1), 41-49 (2001), Taj, J. Biomed. Sci. 7(4), 279- 91 (2000), Vigna et al., J. Gene Med.
  • Adeno-associated viral vectors may be constructed and/or purified using the methods set forth, for example, in US 4,797,368 and Laughlin et al., Gene 23, 65-73 (1983).
  • a papillomaviral vector Another type of viral vector that may be employed with polynucleotides and methods of the present invention is a papillomaviral vector.
  • Suitable papillomaviral vectors are known in the art and described in, e. g., Hewson, MoI Med Today 5(1), 8 (1999), Stephens, Biochem J. 248(1), 1-11 (1987) and US 5,719, 054. Examples of papillomaviral vectors are provided in for instance WO 99/21979.
  • Alphavirus vectors may be gene delivery vectors in other contexts. Alphavirus vectors are known in the art and described in for instance Carter, Curr Opinion Biotech 3, 533-539 (1992), Muzcyzka, Curr Top Microbiol Immunol.
  • herpes viral vectors Another group of viral vectors are herpes viral vectors. Examples of herpes viral vectors are described in for instance Lachmann et al., Curr Opin MoI Ther 1(5), 622-32 (1999), Fraefel et al., Adv Virus Res. 55, 425-51 (2000), Huard et al., Neuromuscul 7(5), 299-313 (1997), Glorioso et al., Annu Rev Microbiol. 49, 675-710 (1995), Latchman, MoI
  • Retroviral vectors including lentiviral vectors, also may be advantageous gene delivery vehicles in particular contexts.
  • retroviral vectors There are numerous retroviral vectors known in the art. Examples of retroviral vectors are described in for instance Miller, Curr Top Microbiol Immunol 158, 1-24 (1992), Salmons and Gunzburg, Human Gene Therapy 4, 129-141 (1993), Miller et al., Methods in Enzvmolosv 2T7, 581-599 (1994), Weber et al., Curr Opin MoI Ther. 3(5), 439-53 (2001 ), Hu et al., Pharmacol Rev. 52(4), 493-511 (2000), Kim et al., Adv Virus Res.
  • Adenoviral vectors may also be suitable viral vectors for gene transfer.
  • Adenoviral vectors are well known in the art and described in for instance Graham et al, MoI Biotechnol 33(3), 207-220 (1995), Stephenson, Clin Diagn Virol 10(2-3), 187-94 (1998), Jacobs, Clin Sci (Lond). 85(2), 117-22 (1993), US 5,922, 576, US 5,965,358 and US 6,168, 941 and
  • WO98/22588 WO98/56937, WO99/15686, WO99/54441 , and WO00/32754.
  • Adenoviral vectors, herpes viral vectors and Sindbis viral vectors, useful in the practice of the present invention, are described in for instance Jolly Cancer Gene Therapy 1, 51-64 (1994), Latchman Molec Biotechnol 2, 179-195 (1994) and Johanning et al., Nucl Acids Res 23, 1495-1501 (1995).
  • Suitable viral vectors include pox viral vectors. Examples of such vectors are discussed in for instance Berencsi et al., J Infect Dis 183(8), 1171-9 (2001), Rosenwirth et al., Vaccine 19(13-14), 1661 -70 (2001), Kittlesen et al., J Immunol 164(8), 4204-11 (2000), Brown et al., Gene Ther 7(19), 1680-9 (2000), Kanesa-thasan et al., Vaccine 19(4- 5), 483-91 (2000), Sten, Drua 60(2), 249-71 (2000).
  • Vaccinia virus vectors may be pox virus vectors.
  • the present invention provides a cell comprising a nucleic acid stably integrated into the cellular genome that comprises a sequence coding for expression of an IL-21 BP of the present invention.
  • the present invention provides a cell comprising a non-integrated nucleic acid, such as a plasmid, cosmid, phagemid, or linear expression element, which comprises a sequence coding for expression of an IL-21 BP.
  • the present invention also provides immunogenic peptides comprising any of the above-described antigenic determinant portions of IL-21 specific for the IL-21 BPs of the present invention, such as the antigenic determinant portions of IL-21 specific for 1 F1 and 1 F22.
  • immunogens may be used to elicit a direct immune response in a method comprising an active immunotherapy regimen.
  • the present invention further provides a fusion protein comprising such an IL-21 immunogen and a fusion partner sequence that improves the half-life of the fusion protein (e.g., by inclusion of an immunoglobulin domain sequence); facilitates detection and/or purification of the fusion protein (by comprising, e.g., a fluorescent peptide sequence, a reporter enzyme sequence, an epitope tag, a hexa-histidine sequence, or the like); promotes the targeting of the fusion protein (e.g., by comprising a ligand or portion of a ligand specific for a receptor on a target cell); promotes induction of a distinct immune response (e.g., corresponds to a cancer antigen or an immunogenic fragment thereof); is a cytotoxic agent; or achieves any combination thereof (e.g., a heat shock fusion protein partner can increase an immune response generated against a non- similar, heterologous antigen portion of a fusion protein, while also increasing the in vivo half- life of
  • variants of such peptides, and derivatives of such immunogenic peptides or immunogenic peptide variants are additional features of the present invention (e.g., such IL-21 immunogenic peptide derivatives may be modified by chemical coupling, genetic fusion, non-covalent association, and the like, to other molecular entities such as antibodies, toxins, radioisotope, cytotoxic agents, or cytostatic agents).
  • Peptide mimitopes, comprising IL-21 epitope sequences may also, for example, be useful as vaccine candidates.
  • Such peptides may also be useful in the purification of anti-IL-21 antibodies.
  • such peptides may be engineered or selected to also or alternatively comprise one or more anti-IL-21 T cell epitopes.
  • Such epitopes may be identified by any suitable technique known in the art (e.g., by T cell epitope prediction software applications).
  • the present invention provides a nucleic acid encoding such an immunogenic peptide.
  • a nucleic acid may be delivered to a host in a suitable vector, such as a replication-deficient targeted vector (e.g., a targeted nucleic acid vector or a replication-deficient, targeted adenovirus vector).
  • a suitable vector such as a replication-deficient targeted vector (e.g., a targeted nucleic acid vector or a replication-deficient, targeted adenovirus vector).
  • the present invention also provides compositions of one or more of such immunogenic peptides and/or immunogenic peptide- encoding nucleic acids.
  • IL-21 BPs of the present invention include “neutralizing” IL-21 BPs, such as neutralizing antibodies.
  • neutralizing IL-21 BP
  • neutralizing antibody refer to an IL-21 BP or an antibody that is capable of substantially inhibiting or eliminating a biological activity of an IL-21 -associated peptide.
  • a neutralizing IL-21 BP such as a neutralizing anti-IL-21 antibody will inhibit IL-21 binding to the IL-21 receptor in a degree that is about equal or greater than the inhibition of such cells due to administration of an approximately equal amount of the antibodies of the examples.
  • a IL-21 BP of the present invention may have any suitable affinity and/or avidity for one or more epitopes contained at least partially in IL-21.
  • Affinity refers to the strength of binding of the IL-21 BP to such an epitope.
  • affinity is measured by dissociation constant K d , defined as [Ab] x [Ag] / [Ab-Ag] where [Ab-Ag] is the molar concentration of the antibody-antigen complex (or the IL-21 BP-antigen complex), [Ab] is the molar concentration of the unbound antibody (or IL-21 BP) and [Ag] is the molar concentration of the unbound antigen.
  • K a is defined by 1/K d .
  • Suitable methods for determining specificity and affinity by competitive inhibition may be found in for instance Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1988), Colligan et al., eds., Current Protocols in Immunology, Greene Publishing Assoc, and Wiley InterScience N. Y., (1992, 1993) and Muller, Meth. Enzymol. 92, 589-601 (1983).
  • a IL-21 BP, and particularly anti-IL-21 antibodies of the present invention may have an affinity for at least one epitope at least partially comprised in IL-21 in the range of about 10 4 to about 10 10 M "1 .
  • the term immunoreact herein typically refers to binding of an IL-21 BP to an IL-21 epitope with a dissociation constant K d lower than about 10 '4 M.
  • a IL-21 BP may have an affinity that is at least as great for IL-21 as 1 F1 and 1 F22, and in some embodiments have an affinity that is at least about as great as 1 F1 and 1 F22.
  • Affinity may be determined by any of the methods described elsewhere herein or their known equivalents in the art. An example of one method that may be used to determine affinity is provided in Scatchard analysis of Munson & Pollard, Anal. Biochem. 107, 220 (1980).
  • Binding affinity also may be determined by equilibrium methods (for instance enzyme-linked immunoabsorbent assay (ELISA) or radioimmunoassay (RIA)) or kinetics analysis (for instance BIACORETM analysis).
  • equilibrium methods for instance enzyme-linked immunoabsorbent assay (ELISA) or radioimmunoassay (RIA)
  • kinetics analysis for instance BIACORETM analysis.
  • the disassociation constant for IL-21 BPs, such as anti-IL-21 antibodies, of the present invention is less than about 100 nM, less than about 50 nM, less than about 10 nM, about 5 nM or less, about 1 nM or less, about 0.5 nM or less, about 0.1 nM or less, about 0.01 nM or less, or even about 0.001 nM or less.
  • Anti-IL-21 antibodies of the present invention may be prepared by recombinant expression in any suitable type of cells or animals.
  • Recombinant IL-21 BPs such as recombinant antibodies, such as recombinant human antibodies
  • IL-21 BPs such as antibodies, such as human antibodies that are prepared, expressed, created or isolated by recombinant means, such as IL-21 BPs, such as antibodies, such as human antibodies expressed using a recombinant expression vector transfected into a host cell.
  • Recombinant antibodies such as recombinant human antibodies also include antibodies isolated from a recombinant, combinatorial human antibody library, antibodies isolated from an animal, such as a transgenic animal, or antibodies prepared, expressed, created or isolated by any other means that involves splicing of human immunoglobulin- encoding nucleic acid sequences to other nucleic acid sequences exogenous to the human immunoglobulin-encoding nucleic acids and human immunoglobulin-encoding genes.
  • Recombinant human antibodies typically have variable and constant regions derived from human germline immunoglobulin sequences.
  • such recombinant human antibodies are subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and, thus, the amino acid sequences of the V H and V L regions of the recombinant antibodies may be sequences that, while derived from and related to human germline V H and V L sequences, may not naturally exist within the human antibody germline repertoire in vivo. Both types of human antibodies are provided by the present invention. Suitable methods for recombinant protein production are known in the art, see for instance (Sambrook and Russell (eds.), Molecular cloning, third edition, 2001 , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA.
  • suitable methods for antibody production are known in the art and include those described in for instance Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., (1988), Harlow and Lane: Using Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press (1999)), US 4,376,110 and Ausubel et al., eds., Current Protocols In Molecular Biology, Greene Publishing Assoc, and Wiley InterScience N. Y., (1987, 1992).
  • Monoclonal antibodies may be made using the hybridoma method first described by Kohler et al., Nature 256, 495 (1975), or by other well-known, subsequently-developed methods (see, e.g., Goding, Monoclonal Antibodies: Principles and Practice, pp.59-103 (Academic Press, 1986)).
  • Hybridomas useful in the production of anti-IL-21 antibodies of the present invention are also provided by the present invention.
  • Such hybridomas may be formed by chemical fusion, electrical fusion, or any other suitable technique, with any suitable type of myeloma, heteromyeloma, phoblastoid cell, plasmacytoma or other equivalent thereof and any suitable type of antibody-expressing cell.
  • Transformed immortalized B cells may also be used to efficiently produce antibodies of the present invention and are also provided by the present invention.
  • Such cells may be produced by standard techniques, such as transformation with an Epstein Barr Virus, or a transforming gene.
  • transformation with an Epstein Barr Virus or a transforming gene.
  • a transforming gene See, e.g., "Continuously Proliferating Human Cell Lines Synthesizing Antibody of Predetermined Specificity," Zurawaki, V. R. et al., in Monoclonal Antibodies, ed. by Kennett R. H. et al., Plenum Press, N. Y. 1980, pp 19-33.).
  • stable and continuous and/or immortalized anti-IL-21 antibody expressing cells and cell lines are a feature of the present invention.
  • Eukaryotic and prokaryotic cells e.g., yeast cells, continuous and/or immortalized mammalian cell lines (e.g., lymphoid antibody-producing cell derived cell lines), plant cells, insect cells, and bacterial cells such as E. coli cells, etc.
  • yeast cells continuous and/or immortalized mammalian cell lines (e.g., lymphoid antibody-producing cell derived cell lines), plant cells, insect cells, and bacterial cells such as E. coli cells, etc.
  • IL-21 BP- encoding or IL-21 BP-fragment-encoding nucleic acids are provided by the present invention.
  • Transgenic animals such as non-human primates, rodents (e.g., hamsters, guinea pigs, and rats - including modified strains thereof such as severe combined immunodeficient (SCID) mice and other immunocompromised animal strains), dogs, etc., expressing human anti- IL-21 antibodies of the present invention also are provided by the present invention.
  • rodents e.g., hamsters, guinea pigs, and rats - including modified strains thereof such as severe combined immunodeficient (SCID) mice and other immunocompromised animal strains
  • SCID severe combined immunodeficient mice and other immunocompromised animal strains
  • Recombinant cells comprising exogenous nucleic acids encoding IL-21 BPs may be prepared by any suitable technique (e.g., transfection/transformation with a naked DNA plasmid vector, viral vector, invasive bacterial cell vector or other whole cell vector, etc., comprising an IL-21 BP-encoding sequence (or sequences) delivered into the cell by calcium phosphate-precipitation facilitated transfection, receptor-mediated targeting and transfection, biolistic delivery, electroporation, dextran-mediated transfection, liposome-mediated transformation, protoplast fusion, direct microinjection, etc.).
  • any suitable technique e.g., transfection/transformation with a naked DNA plasmid vector, viral vector, invasive bacterial cell vector or other whole cell vector, etc., comprising an IL-21 BP-encoding sequence (or sequences) delivered into the cell by calcium phosphate-precipitation facilitated transfection, receptor-mediated targeting and transfection, biolistic delivery, electroporation, dextran
  • Cell lines available as hosts for recombinant protein expression are well known in the art and include many immortalized cell lines available from the American Type Culture Collection (ATCC). These include, inter alia, Chinese hamster ovary (CHO) cells, NSO, SP2 cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), A549 cells, and a number of other cell lines. Other cell lines that may be used are insect cell lines, such as Sf9 cells.
  • proteins such as IL-21 BPs (including anti-IL-21 antibodies)
  • proteins may be produced by culturing the host cells for a period of time sufficient to allow for expression of the protein, such as an IL-21 BP, in the host cells or by secretion of the protein, such as an IL-21 BP, into the culture medium in which the host cells are grown.
  • IL-21 BPs may be recovered from the culture medium using standard protein purification methods.
  • IL-21 BPs may also be recovered from host cell lysates when directly expressed without a secretory signal.
  • IL-21 BPs such as anti-IL-21 antibodies
  • Bacterial cell produced IL-21 BPs, such as anti-IL-21 antibodies typically lack normal glycosylation and bacterial cell produced anti- IL-21 antibodies may thus be more or less deficient in terms of ADCC functions and other aspects of the immune response associated with anti-IL-21 antibodies produced in mammalian cells and/or animals (e.g., the recruitment of NK cells).
  • Yeast cell produced IL-21 BPs, such as anti-IL-21 antibodies normally exhibit different types of glycosylation patterns than antibodies produced in mammalian cells.
  • the IL-21 BPs are produced by culturing the host cells for a period of time sufficient to allow for expression of the IL-21 BP in the host cells or for secretion of the antibody into the culture medium in which the host cells are grown.
  • the purification of antibodies and other IL-21 BPs from cell cultures, cell lysates, and animals may be achieved by application of any number of suitable techniques known in the art including, e.g., immunoaffinity column purification; sulfate precipitation; chromatofocusing; preparative SDS-PAGE, and the like.
  • Human monoclonal antibodies of the present invention may also be produced by a variety of other techniques, including conventional monoclonal antibody methodology, e.g., the standard somatic cell hybridization technique of Kohler and Milstein, Nature 256, 495 (1975). Other techniques for producing monoclonal antibody may also be employed, e.g. phage display techniques using libraries of human antibody genes.
  • anti- IL-21 antibodies of the present invention produced by use of hybridomas generated in a murine system. Hybridoma production in the mouse is a very well established procedure. Immunization protocols and techniques for isolation of immunized splenocytes for fusion are known in the art. Fusion partners (e.g., murine myeloma cells) and fusion procedures are also known.
  • transgenic or transchromosomal mice containing human immunoglobulin genes may be immunized with an enriched preparation of IL-21 antigen, as described, for example, by Lonberg et al., (1994), supra, Fishwild et al., (1996), supra, and WO 98/24884.
  • mice may be immunized with DNA encoding human IL-21. The mice may be 6-16 weeks of age upon the first infusion.
  • an enriched preparation (5-50 ⁇ g) of the IL-21 antigen may be used to immunize the HuMAb mice intraperitoneal ⁇ .
  • HuMAb transgenic mice respond best when initially immunized intraperitoneal ⁇ (i.p.) or subcutaneously (s.c.) with IL-21 expressing cells in complete Freund's adjuvant, followed by every other week i.p. immunizations (up to a total of 10) with IL-21 expressing cells in PBS.
  • the immune response may be monitored over the course of the immunization protocol with plasma samples being obtained by retroorbital bleeds.
  • the plasma may be screened by FACS analysis, and mice with sufficient titers of anti-IL-21 human immunoglobulin may be used for fusions.
  • Mice may be boosted intravenously with IL-21 expressing cells, for example 4 and 3 days before sacrifice and removal of the spleen..
  • splenocytes and lymph node cells from immunized mice may be isolated and fused to an appropriate immortalized cell line, such as a mouse myeloma cell line.
  • an appropriate immortalized cell line such as a mouse myeloma cell line.
  • the resulting hybridomas may then be screened for the production of antigen-specific antibodies.
  • single cell suspensions of splenic lymphocytes from immunized mice may be fused to SP2/0 nonsecreting mouse myeloma cells (ATCC, CRL 1581) with 50% PEG (w/v).
  • Cells may be plated at approximately 1 x 105 per well in flat bottom microtiter plate, followed by a two week incubation in selective medium containing besides usual reagents 10% fetal Clone Serum, 5-10% origen hybridoma cloning factor (IGEN) and 1X HAT (Sigma). After approximately two weeks, cells may be cultured in medium in which the HAT is replaced with HT. Individual wells may then be screened by ELISA for human kappa-light chain containing antibodies and by FACS analysis using IL-21 expressing cells for IL-21 specificity. Once extensive hybridoma growth occurs, medium may be observed usually after 10-14 days.
  • the antibody secreting hybridomas may be replated, screened again, and if still positive for human IgG, anti-IL-21 monoclonal antibodies may be subcloned at least twice by limiting dilution.
  • the stable subclones may then be cultured in vitro to generate antibody in tissue culture medium for characterization.
  • Human antibodies of the present invention may also be produced in a host cell transfectoma using, for example, a combination of recombinant DNA techniques and gene transfection methods as is well known in the art, see for instance Morrison, S., Science 229, 1202 (1985).
  • DNAs encoding partial or full-length light and heavy chains may be obtained by standard molecular biology techniques (for instance PCR amplification, site directed mutagenesis) and may be inserted into expression vectors such that the genes are operatively linked to transcriptional and translational control sequences.
  • the term "operatively linked" is intended to mean that an antibody gene is ligated into a vector such that transcriptional and translational control sequences within the vector serve their intended function of regulating the transcription and translation of the antibody gene.
  • the expression vector and expression control sequences are chosen to be compatible with the expression host cell used.
  • the antibody light chain gene and the antibody heavy chain gene may be inserted into separate vectors or, more typically, both genes are inserted into the same expression vector.
  • the antibody genes may be inserted into the expression vector by standard methods (e.g., ligation of complementary restriction sites on the antibody gene fragment and vector, or blunt end ligation if no restriction sites are present).
  • the light and heavy chain variable regions of the antibodies described herein may be used to create full-length antibody genes of any antibody isotype by inserting them into expression vectors already encoding heavy chain constant and light chain constant regions of the desired isotype such that the V H segment is operatively linked to the CH segment(s) within the vector and the V L segment is operatively linked to the CL segment within the vector.
  • the recombinant expression vector may encode a signal peptide that facilitates secretion of the antibody chain from a host cell.
  • the antibody chain gene may be cloned into the vector such that the signal peptide is linked in-frame to the amino terminus of the antibody chain gene.
  • the signal peptide may be an immunoglobulin signal peptide or a heterologous signal peptide (i.e., a signal peptide from a non-immunoglobulin protein).
  • the recombinant expression vectors of the present invention carry regulatory sequences that allows and control the expression of the antibody chain genes in a host cell.
  • the recombinant expression vectors of the present invention may carry additional sequences, such as sequences that regulate replication of the vector in host cells (e.g., origins of replication) and selectable marker genes.
  • the selectable marker gene facilitates selection of host cells into which the vector has been introduced (see for instance US 4,399,216, US 4,634,665 and US 5,179,017).
  • the selectable marker gene confers resistance to drugs, such as G418, hygromycin or methotrexate, on a host cell into which the vector has been introduced.
  • selectable marker genes include the dihydrofolate reductase (DHFR) gene (for use in dhfr-host cells with methotrexate selection/amplification) and the neo gene (for G418 selection).
  • DHFR dihydrofolate reductase
  • the expression vector(s) encoding the heavy and light chains is transfected into a host cell by standard techniques.
  • the host cells may be prokaryotic or eukaryotic, such as mammalian, host cells.
  • antigen binding fragments may be expressed in prokaryotic host cells and full-length antibodies may be expressed in eukaryotic host cells.
  • the antibodies are expressed in eukaryotic cells, such as mammalian host cells.
  • mammalian host cells for expressing the recombinant antibodies of the present invention include CHO cells (including dhfr-CHO cells, described in Urlaub and Chasin, PNAS USA 77, 4216-4220 (1980), used with a DHFR selectable marker, for instance as described in R. J. Kaufman and P. A. Sharp, MoI. Biol. 159, 601-621 (1982)), NS/0 myeloma cells, COS cells, HEK293 cells and SP2.0 cells.
  • CHO cells including dhfr-CHO cells, described in Urlaub and Chasin, PNAS USA 77, 4216-4220 (1980), used with a DHFR selectable marker, for instance as described in R. J. Kaufman and P. A. Sharp, MoI. Biol. 159, 601-621 (1982)
  • NS/0 myeloma cells for instance as described in R. J
  • a expression system for use with NS/0 myeloma cells, another example of a expression system is the GS (glutamine synthetase) gene expression system disclosed in WO87/04462, WO89/01036 and EP338841.
  • the IL-21 BP genes may be expressed in other expression systems, including prokaryotic cells, such as microorganisms, e.g. E. coli for the production of scFv antibodies, algi, as well as insect cells.
  • the IL-21 BPs may be produced in transgenic non- human animals, such as in milk from sheep and rabbits or eggs from hens, or in transgenic plants. See for instance Verma, R. et al., J. Immunol. Meth. 2J6, 165-181 (1998), Pollock et al., J. Immunol. Meth. 231, 147-157 (1999) and Fischer, R. et al., Biol.Chem. 380, 825-839 (19
  • Bispecific and multispecific IL-21 BPs of the present invention may be made using chemical techniques (see for instance D. M. Kranz et al., PNAS USA 78, 5807 (1981)), "polydoma” techniques (See US 4,474,893) or recombinant DNA techniques.
  • Bispecific antibodies of the present invention may be produced by a variety of known methods including fusion of hybridomas or linking of Fab' fragments (see for instance Songsivilai & Lachmann, Clin. Exp. Immunol. 79, 315-321 (1990) and Kostelny et al., J. Immunol. 148, 1547-1553 (1992)).
  • the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain-light chain pairs, where the two heavy chains have different specificities (see for instance Milstein and Cuello, Nature 305, 537 (1983)).
  • variable domains with the desired binding specificities are fused to immunoglobulin constant domain sequences by recombinant or synthetic methods.
  • the variable domain sequence is typically fused to an immunoglobulin heavy chain constant domain, comprising at least part of the hinge, C H 2, and C H 3 regions.
  • a first heavy-chain constant region (C H 1) containing the site necessary for light chain binding, also is present in at least one of the fusion peptides.
  • a bispecific antibody is produced comprising a hybrid immunoglobulin heavy chain with a first binding specificity in one arm, and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm.
  • a hybrid immunoglobulin heavy chain-light chain pair providing a second binding specificity
  • Such an asymmetric structure can facilitate the separation of the desired bispecific compound from unwanted immunoglobulin chain combinations (such an approach is described in WO 94/04690).
  • For further details of generating bispecific antibodies see, for example, Suresh et al., Methods in Enzymology 121 , 210 (1986).
  • the interface between a pair of antibody molecules may be engineered to maximize the percentage of heterodimers that are recovered from recombinant cell culture so as to form a population of bispecific antibody molecules.
  • such an interface comprises at least a part of the C H 3 domain of an antibody constant region.
  • one or more amino acid residues with smaller side chains from the interface of the first antibody molecule are replaced with amino acid residues with larger side chains (such as tyrosine or tryptophan).
  • Compensatory "cavities" of identical or similar size to the large side chain amino acid residue(s) are created on the interface of the second antibody molecule by replacing large amino acid side chain residues with smaller ones (such as alanine or threonine). This provides a mechanism for increasing the yield of the heterodimer over other unwanted end-products such as homodimers.
  • Bispecific and multispecific molecules of the present invention may be prepared by conjugating the constituent binding specificities, e.g., the anti-FcR and anti-IL-21 binding specificities, using methods known in the art. For example, each binding specificity of the bispecific and multispecific molecule may be generated separately and then conjugated to one another. When the binding specificities are proteins or peptides, a variety of coupling or cross-linking agents may be used for covalent conjugation.
  • cross-linking agents examples include protein A, carbodiimide, N-succinimidyl-S-acetyl-thioacetate (SATA), 5,5'-dithiobis(2- nitrobenzoic acid) (DTNB), o-phenylenedimaleimide (oPDM), N-succinimidyl-3-(2-pyridyldi- thio)propionate (SPDP) and sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1 -carboxy- late (sulfo-SMCC), see for instance Karpovsky et al., J. Exp. Med. 160, 1686 (1984), Liu, M. A.
  • One of the Fab'-TNB derivatives may then be reconverted to the Fab'-thiol by reduction with mercaptoethylamine and mixed with an equimolar amount of the other Fab'- TNB derivative to form a bispecific antibody.
  • Shalaby et al., J. Exp. Med. 175, 217-225 (1992) describes the production of a fully humanized bispecific antibody F(ab') 2 molecule, according to a related technique.
  • Other methods include those described by Paulus (Behring Ins. Mitt. No. 78, 1 18-132 (1985)) and Glennie et al., J. Immunol. 139, 2367-2375 (1987).
  • conjugating agents are SATA and sulfo-SMCC, both available from Pierce Chemical Co. (Rockford, IL).
  • binding specificities are antibodies, they may be conjugated via sulfhydryl bonding of the C-terminus hinge regions of the two heavy chains.
  • the hinge region is modified to contain an odd number of sulfhydryl residues, for instance one, prior to conjugation.
  • both binding specificities may be encoded in the same vector and expressed and assembled in the same host cell. This method is particularly useful where the bispecific and multispecific molecule is a mAb x mAb, mAb x Fab, Fab x F(ab') 2 or ligand x Fab fusion protein.
  • a bispecific and multispecific molecule of the present invention e.g., a bispecific molecule may be a single chain molecule, such as a single chain bispecific antibody, a single chain bispecific molecule comprising one single chain antibody and a binding determinant, or a single chain bispecific molecule comprising two binding determinants.
  • Bispecific and multispecific molecules may also be single chain molecules or may comprise at least two single chain molecules. Methods for preparing bi- and multispecific molecules are described for example in US 5,260,203, US 5,455,030, US 4,881 ,175, US 5,132,405, US 5,091 ,513, US 5,476,786, US 5,013,653, US 5,258,498 and US 5,482,858.
  • bispecific antibodies have been produced using leucine zippers (see for instance Kostelny et al., J. Immunol. 148(5), 1547-1553 (1992)).
  • Leucine zipper peptides from the Fos and Jun proteins may be linked to the Fab' portions of two different antibodies by gene fusion and the resulting antibody homodimers reduced at the hinge region to form monomers that may be re-oxidized to form the antibody heterodimers.
  • the "diabody” technology described by Hollinger et al., PNAS USA 90, 6444-6448 (1993) also has provided an alternative mechanism for making bispecific antibody fragments.
  • Another strategy for making bispecific antibody fragments by the use of single-chain Fv (sFv) dimers has also been reported. See for instance Gruber et al., J. Immunol. 152, 5368 (1994).
  • bispecific antibodies may be formed as "diabodies” (Holliger et al., PNAS USA, 90, 6444-6448 (1993)) or "Janusins” (Traunecker et al., EMBO J 10, 3655-3659 (1991) and Traunecker et al., lnt J Cancer Suppl 7, 51-52 (1992)).
  • Bispecific antibodies by definition, do not exist in the form of fragments having a single binding site (e.g., Fab, Fab', and Fv fragments, which also are provided by the present invention).
  • Binding of the bispecific and multispecific molecules to their specific targets may be confirmed by enzyme-linked immunosorbent assay (ELISA), a radioimmunoassay (RIA), FACS analysis, a bioassay (e.g., growth inhibition), or a Western Blot Assay.
  • ELISA enzyme-linked immunosorbent assay
  • RIA radioimmunoassay
  • FACS analysis e.g., FACS analysis
  • bioassay e.g., growth inhibition
  • Western Blot Assay e.g., Western Blot Assay.
  • Each of these assays generally detects the presence of protein-antibody complexes of particular interest by employing a labeled reagent (e.g., an antibody) specific for the complex of interest.
  • the FcR-antibody complexes may be detected using e.g., an enzyme-linked antibody or antibody fragment which recognizes and specifically binds to the antibody-FcR complexes.
  • the complexes may be detected using any of a variety of other immunoassays.
  • the antibody may be radioactively labeled and used in a radioimmunoassay (RIA) (see, for example, Weintraub, B., Principles of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March, 1986).
  • RIA radioimmunoassay
  • the radioactive isotope may be detected by such means as the use of a Y counter or a scintillation counter or by autoradiography.
  • antibodies interact with target antigens primarily through amino acid residues that are located in the six heavy and light chain complementarity determining regions (CDRs).
  • CDRs complementarity determining regions
  • the present invention provides antibodies having CDR regions identical to or otherwise derived from the CDR regions of the 1 F1 and 1 F22.
  • Such antibodies may be generated by constructing expression vectors that include CDR sequences from 1 F1 and 1 F22 grafted onto framework sequences from a different antibody with different properties.
  • Such framework sequences may be obtained from public DNA databases that include germline antibody gene sequences. These germline sequences will differ from mature antibody gene sequences because they will not include completely assembled variable genes, which are formed by V(D)J joining during B cell maturation. Germline gene sequences will also differ from the sequences of a high affinity secondary repertoire antibody which contains mutations throughout the variable gene but typically clustered in the CDRs. For example, somatic mutations are relatively infrequent in the amino terminal portion of framework region 1 and in the carboxy-terminal portion of framework region 4. For this reason, it is not necessary to obtain the entire DNA sequence of a particular antibody in order to recreate an intact recombinant antibody having binding properties similar to those of the original antibody (see WO 99/45962).
  • Partial heavy and light chain sequence spanning the CDR regions is typically sufficient for this purpose.
  • the partial sequence is used to determine which germline variable and joining gene segments contributed to the recombined antibody variable genes.
  • the germline sequence is then used to fill in missing portions of the variable regions.
  • Heavy and light chain leader sequences are cleaved during protein maturation and do not contribute to the properties of the final antibody.
  • cloned cDNA sequences may be combined with synthetic oligonucleotides by ligation or PCR amplification.
  • the entire variable region may be synthesized as a set of short, overlapping, oligonucleotides and combined by PCR amplification to create an entirely synthetic variable region clone. This process has certain advantages such as elimination or inclusion or particular restriction sites, or optimization of particular codons.
  • the nucleotide sequences of heavy and light chain transcripts from hybridomas are used to design an overlapping set of synthetic oligonucleotides to create synthetic V sequences with identical amino acid coding capacities as the natural sequences.
  • the synthetic heavy and kappa chain sequences can differ from the natural sequences in three ways: strings of repeated nucleotide bases are interrupted to facilitate oligonucleotide synthesis and PCR amplification; optimal translation initiation sites are incorporated according to Kozak's rules (Kozak, J. Biol. Chem. 266, 19867-19870 (1991 ); and H/ndlll sites are engineered upstream of the translation initiation sites.
  • the optimized coding and corresponding non-coding, strand sequences are broken down into 30-50 nucleotides approximately at the midpoint of the corresponding non-coding oligonucleotide.
  • the oligonucleotides may be assembled into overlapping double stranded sets that span segments of 150-400 nucleotides. The pools are then used as templates to produce PCR amplification products of 150-400 nucleotides.
  • a single variable region oligonucleotide set will be broken down into two pools which are separately amplified to generate two overlapping PCR products. These overlapping products are then combined by PCR amplification to form the complete variable region.
  • an overlapping fragment of the heavy or light chain constant region including the Bbs ⁇ site of the kappa light chain, or the Age ⁇ site of the gamma heavy chain
  • the reconstructed heavy and light chain variable regions are then combined with cloned promoter, leader, translation initiation, constant region, 3' untranslated, polyadenylation, and transcription termination, sequences to form expression vector constructs.
  • the heavy and light chain expression constructs may be combined into a single vector, co-transfected, serially transfected, or separately transfected into host cells which are then fused to form a host cell expressing both chains.
  • a similar procedure may be followed to graft novel antigen-specificity into an existing mature antibody.
  • an acceptor antibody is chosen which originates from the same variable germ-line gene as the CDR-donor antibody, but other acceptor antibodies may also be chosen.
  • One or more CDRs from the donor antibody are then transferred using the techniques described above.
  • the structural features of the 1 F1 and 1 F22 are used to create structurally related anti-IL-21 antibodies, for instance human anti- IL-21 antibodies, that retain at least one functional property of 1 F1 and 1 F22, namely binding to IL-21. More specifically, one or more CDR regions of 1 F1 and 1 F22 may be combined recombinantly with known human framework regions and CDRs to create additional, recombinantly-engineered, anti-IL-21 antibodies of the present invention. Exemplary plasmids for use in construction of expression vectors for human lgG ⁇ are described below.
  • the plasmids were constructed so that PCR amplified V kappa heavy and V kappa light chain cDNA sequences could be used to reconstruct complete heavy and light chain minigenes. These plasmids may be used to express completely human IgGI , K or lgG4, ⁇ antibodies. Similar plasmids may be constructed for expression of other heavy chain isotypes, or for expression of antibodies comprising lambda light chains.
  • the present invention provides transgenic and transchromosomal nonhuman animals, such as transgenic or transchromosomal mice, which are capable of expressing human antibodies that specifically bind to IL-21.
  • the present invention provides a transgenic or transchromosomal mouse having a genome comprising a human heavy chain transgene, such that the mouse produces human anti-IL-21 antibodies when immunized with IL-21.
  • the human heavy chain transgene may be integrated into the chromosomal DNA of the mouse, as is the case for transgenic, e.g., HuMAb mice, as described in detail herein.
  • the human heavy chain transgene may be maintained extrachromosomally, as is the case for transchromosomal (e.g., KM) mice as described in WO 02/43478.
  • transgenic and transchromosomal animals are capable of producing multiple isotypes of human monoclonal antibodies to IL-21 (e.g., IgG, IgA and/or IgE) by undergoing V-D-J/V-J recombination and isotype switching.
  • the design of a transgenic or transchromosomal nonhuman animal that responds to foreign antigen stimulation with a heterologous antibody repertoire requires that the heterologous immunoglobulin transgenes contained within the transgenic animal function correctly throughout the pathway of B cell development.
  • transgenes are constructed so that isotype switching may be induced and one or more of the following characteristics of antibody genes: (1) high level and cell-type specific expression, (2) functional gene rearrangement, (3) activation of and response to allelic exclusion, (4) expression of a sufficient primary repertoire, (5) signal transduction, (6) somatic hypermutation, and (7) domination of the transgene antibody locus during the immune response.
  • the transgene need not activate allelic exclusion.
  • the transgene comprises a functionally rearranged heavy and/or light chain immunoglobulin gene
  • the second criteria of functional gene rearrangement is unnecessary, at least for that transgene which is already rearranged.
  • the transgenic or transchromosomal nonhuman animals used to generate the human monoclonal antibodies of the present invention contain rearranged, unrearranged or a combination of rearranged and unrearranged heterologous immunoglobulin heavy and light chain transgenes in the germline of the transgenic animal.
  • Each of the heavy chain transgenes comprises at least one C H gene.
  • the heavy chain transgene may contain functional isotype switch sequences, which are capable of supporting isotype switching of a heterologous transgene encoding multiple C H genes in the B cells of the transgenic animal.
  • Such switch sequences may be those which occur naturally in the germline immunoglobulin locus from the species that serves as the source of the transgene C H genes, or such switch sequences may be derived from those which occur in the species that is to receive the transgene construct (the transgenic animal).
  • a human transgene construct that is used to produce a transgenic mouse may produce a higher frequency of isotype switching events if it incorporates switch sequences similar to those that occur naturally in the mouse heavy chain locus, as presumably the mouse switch sequences are optimized to function with the mouse switch recombinase enzyme system, whereas the human switch sequences are not.
  • Switch sequences may be isolated and cloned by conventional cloning methods, or may be synthesized de novo from overlapping synthetic oligonucleotides designed on the basis of published sequence information relating to immunoglobulin switch region sequences (Mills et al., Nucl. Acids Res. 1_5, 7305-7316
  • the transgenes used to generate the transgenic nonhuman animals of the present invention include a heavy chain transgene comprising DNA encoding at least one variable gene segment, one diversity gene segment, one joining gene segment and at least one constant region gene segment.
  • the immunoglobulin light chain transgene comprises DNA encoding at least one variable gene segment, one joining gene segment and at least one constant region gene segment.
  • the gene segments encoding the light and heavy chain gene segments are heterologous to the transgenic animal in that they are derived from, or correspond to, DNA encoding immunoglobulin heavy and light chain gene segments from a species not consisting of the transgenic nonhuman animal.
  • the transgene is constructed such that the individual gene segments are unrearranged, i.e., not rearranged so as to encode a functional immunoglobulin light or heavy chain.
  • Such unrearranged transgenes support recombination of the V, D, and J gene segments (functional rearrangement) and may support incorporation of all or a portion of a D region gene segment in the resultant rearranged immunoglobulin heavy chain within the transgenic animal when exposed to IL-21 antigen.
  • the transgenes comprise an unrearranged "mini-locus".
  • transgenes typically comprise a substantial portion of the C, D, and J segments as well as a subset of the V gene segments.
  • the various regulatory sequences e.g. promoters, enhancers, class switch regions, splice-donor and splice- acceptor sequences for RNA processing, recombination signals and the like, comprise corresponding sequences derived from the heterologous DNA.
  • Such regulatory sequences may be incorporated into the transgene from the same or a related species of the nonhuman animal used in the present invention.
  • human immunoglobulin gene segments may be combined in a transgene with a rodent immunoglobulin enhancer sequence for use in a transgenic mouse.
  • synthetic regulatory sequences may be incorporated into the transgene, wherein such synthetic regulatory sequences are not homologous to a functional DNA sequence that is known to occur naturally in the genomes of mammals.
  • Synthetic regulatory sequences are designed according to consensus rules, such as, for example, those specifying the permissible sequences of a splice-acceptor site or a promoter/enhancer motif.
  • a minilocus comprises a portion of the genomic immunoglobulin locus having at least one internal (i.e., not at a terminus of the portion) deletion of a non-essential DNA portion (e.g., intervening sequence; intron or portion thereof) as compared to the naturally-occurring germline Ig locus.
  • transgenic and transchromosomal nonhuman animals such as mice will exhibit immunoglobulin production with a significant repertoire, ideally substantially similar to that of a human after adjusting for volume.
  • the repertoire will ideally approximate that shown in a human when adjusted for volume, usually with a diversity at least about 10% as great, such as 25 to 50% or more.
  • immunoglobulins ideally IgG
  • 10 4 to 10 6 or more will be produced, depending on the number of different V, J and D regions introduced into the mouse genome and driven by the additional diversity generated by V(-D-)J gene segment rearrangements and random nucleotide additions at the joining regions.
  • the immunoglobulins will exhibit an affinity (K 0 ) for preselected antigens of below 10 '8 M, such as of below 10 '9 M, 10 10 M or 10 "11 M or even lower.
  • Transgenic and transchromosomal nonhuman animals e.g., mice, as described above, may be immunized with human IL-21 or DNA encoding human IL-21. The animals will then produce B cells which undergo class-switching via switch recombination (cis-switching) and express immunoglobulins reactive with IL-21.
  • the immunoglobulins will be human antibodies (also referred to as "human sequence antibodies”), wherein the heavy and light chain polypeptides are encoded by human transgene sequences, which may include sequences derived by somatic mutation and V region recombinatorial joints, as well as germline-encoded sequences; these human antibodies may be referred to as being substantially identical to a polypeptide sequence encoded by a human V L and J L or V H D H and J H gene segments, even though other non-germline sequences may be present as a result of somatic mutation and differential V-J and V-D-J recombination joints.
  • variable regions of each antibody chain are typically at least 80 percent similar to human germline V, and J gene segments, and, in the case of heavy chains, human germline V, D, and J gene segments; frequently at least 85 percent similar to human germline sequences present on the transgene; often 90 or 95 percent or more similar to human germline sequences present on the transgene.
  • the human sequence antibodies will frequently have some variable region sequences which are not encoded by human V, D, or J gene segments as found in the human transgene(s) in the germline of the mice.
  • non-germline sequences will cluster in or near CDRs, or in regions where somatic mutations are known to cluster.
  • the present invention also provides B cells derived from transgenic or transchromosomal nonhuman animals as described herein.
  • the B cells may be used to generate hybridomas expressing human monoclonal antibodies which bind with high affinity (for instance with a dissociation equilibrium constant (K D ) of lower than 10 '8 M) to human IL-21.
  • K D dissociation equilibrium constant
  • the present invention provides a hybridoma which produces a human antibody having an affinity (K D ) of below 10 '8 M, such as of below 10 '9 M, 10 10 M or 10 '11 M or even lower when determined by scatchard analysis of IL-21 expressing cells using a radio-actively labeled monoclonal antibody or by determination of the half-maximal binding concentration using FACS analysis, or by analysis using surface plasmon resonance as measured on a BIAcore instrument.
  • K D affinity
  • the present invention provides an anti-IL-21 antibody comprising a human sequence light chain composed of (1 ) a light chain variable region having a polypeptide sequence which is substantially identical to a polypeptide sequence encoded by a human V L gene segment and a human J L segment, and (2) a light chain constant region encoded by a human C L gene segment; and a human sequence heavy chain composed of a (1) a heavy chain variable region having a polypeptide sequence which is substantially identical to a polypeptide sequence encoded by a human V H gene segment, a D region, and a human J H segment, and (2) a constant region encoded by a human C H gene segment.
  • human D genes may be substantially altered by recombination and somatic mutation events such that the original human germ-line sequence may not be readily recognized.
  • V region transgene is a yeast artificial chromosome (YAC) comprising a portion of a human V H or V L (V ⁇ ) gene segment array, as may naturally occur in a human genome or as may be spliced together separately by recombinant methods, which may include out-of-order or omitted V gene segments.
  • YAC yeast artificial chromosome
  • V gene segments are contained on the YAC.
  • the V repertoire expansion method wherein the animal expresses an immunoglobulin chain comprising a variable region sequence encoded by a V region gene segment present on the V region transgene and a C region encoded on the human Ig transgene.
  • transgenic animals having at least 5 distinct V genes may be generated; as can animals containing at least about 24 V genes or more.
  • Some V gene segments may be nonfunctional (e.g., pseudogenes and the like); these segments may be retained or may be selectively deleted by recombinant methods available to the skilled artisan, if desired.
  • the trait may be propagated and bred into other genetic backgrounds, including backgrounds where the functional YAC having an expanded V segment repertoire is bred into a nonhuman animal germline having a different human Ig transgene.
  • Multiple functional YACs having an expanded V segment repertoire may be bred into a germline to work with a human Ig transgene (or multiple human Ig transgenes).
  • YAC transgenes when integrated into the genome may substantially lack yeast sequences, such as sequences required for autonomous replication in yeast; such sequences may optionally be removed by genetic engineering (e.g., restriction digestion and pulsed-field gel electrophoresis or other suitable method) after replication in yeast is no longer necessary (i.e., prior to introduction into a mouse ES cell or mouse prozygote).
  • Methods of propagating the trait of human sequence immunoglobulin expression include breeding a transgenic animal having the human Ig transgene(s), and optionally also having a functional YAC having an expanded V segment repertoire. Both V H and V L gene segments may be present on the YAC.
  • the transgenic animal may be bred into any background desired by the practitioner, including backgrounds harboring other human transgenes, including human Ig transgenes and/or transgenes encoding other human lymphocyte proteins.
  • the present invention also provides a high affinity human sequence immunoglobulin produced by a transgenic mouse having an expanded V region repertoire YAC transgene.
  • IL-21 BPs of the present invention may be isolated and characterized in a number of different ways.
  • selected hybridomas may be grown in suitable flasks for monoclonal antibody purification. Supernatants may then be filtered and concentrated before affinity chromatography with protein A-sepharose (for IgGI isotype antibodies) (Pharmacia, Piscataway, NJ) or anti-human IgG coated sepharose or protein G-sepharose in case of lgG3 isotype antibodies.
  • Eluted IgG may be checked by gel electrophoresis and high performance liquid chromatography to ensure purity.
  • the buffer solution may be exchanged into PBS, and the concentration may be determined by OD 28O using 1.43 extinction coefficient.
  • the monoclonal antibodies may be aliquoted and stored at -80 0 C. To determine if the selected IL-21 BPs, such as human anti-IL-21 monoclonal antibodies, bind to unique epitopes, site-directed or multi-site directed mutagenesis may be used.
  • isotype ELISAs may be performed. Wells of microtiter plates may be coated with 10 ⁇ g/ml of anti-human Ig overnight at 4°C. After blocking with 5% BSA (bovine serum albumin), the plates are reacted with 10 ⁇ g/ml of monoclonal antibodies or purified isotype controls, at ambient temperature for two hours. The wells may then be reacted with either human IgGI, lgG2, lgG3 or lgG4, IgE, IgAI , lgA2, or human IgM-specific alkaline phosphatase-conjugated probes. After washing, the plates are developed with pNPP substrate (1 mg/ml) and analyzed by OD at 405 nm.
  • BSA bovine serum albumin
  • IL-21 BPs such as anti-IL-21 human IgGs
  • IL-21 antigen may be transferred to nitrocellulose membranes, blocked with 20% non-fat milk, and probed with the IL-21 BPs to be tested.
  • Human IgG binding may be detected using anti-human IgG alkaline phosphatase and developed with BCIP/NBT substrate tablets (Sigma Chem. Co., St. Louis, MO), but detecting agents directed at other specific portions of the IL-21 BP may also be used.
  • IL-21 BPs may be tested for their ability to inhibit the IL-21 mediated activation of the IL-21 receptor.
  • the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of an IL-21 BP of the present invention.
  • the pharmaceutical compositions may be formulated with pharmaceutically acceptable carriers or diluents as well as any other known adjuvants and excipients in accordance with conventional techniques such as those disclosed in Remington: The Science and Practice of Pharmacy, 19th Edition, Gennaro, Ed., Mack Publishing Co., Easton, PA, 1995.
  • the pharmaceutically acceptable carriers or diluents as well as any other known adjuvants and excipients should be suitable for the chosen compound of the present invention and the chosen mode of administration. Suitability for carriers and other components of pharmaceutical compositions is determined based on the lack of significant negative impact on the desired biological properties of the chosen compound or pharmaceutical composition of the present invention (e.g., less than a substantial impact (10% or less relative inhibition, 5% or less relative inhibition, etc.) on antigen binding.
  • a pharmaceutical composition of the present invention may also include diluents, fillers, salts, buffers, detergents (e. g., a nonionic detergent, such as Tween-80), stabilizers, stabilizers (e. g., sugars or protein-free amino acids), preservatives, tissue fixatives, solubilizers, and/or other materials suitable for inclusion in a pharmaceutical composition.
  • detergents e. g., a nonionic detergent, such as Tween-80
  • stabilizers e. g., sugars or protein-free amino acids
  • preservatives e. g., tissue fixatives, solubilizers, and/or other materials suitable for inclusion in a pharmaceutical composition.
  • the actual dosage levels of the active ingredients in the pharmaceutical compositions of the present invention may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
  • the selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular compositions of the present invention employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.
  • the pharmaceutical composition may be administered by any suitable route and mode. Suitable routes of administering a compound of the present invention in vivo and in vitro are well known in the art and may be selected by those of ordinary skill in the art.
  • the compounds of the present invention may be administered via any suitable route, such as an oral, nasal, inhalable, topical (including buccal, transdermal and sublingual), rectal, vaginal and/or parenteral route.
  • a pharmaceutical composition of the present invention is administered orally, for example, with an inert diluent or an assimilable edible carrier.
  • the active ingredient may be enclosed in a hard or soft shell gelatin capsule, compressed into tablets, or incorporated directly into the subject's diet.
  • Pharmaceutical compositions of the present invention which are suitable for oral administration include ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like containing such carriers as are known in the art to be appropriate.
  • To administer a compound of the present invention by oral administration it may be necessary to coat the compound with, or coadminister the compound with, a material to prevent its inactivation.
  • a pharmaceutical composition of the present invention is administered nasally.
  • Pharmaceutical compositions of the present invention which are suitable for nasal administration are known in the art and typically include sprays, nose drops and inhalants containing such carriers as are known in the art to be appropriate.
  • compositions of the present invention are administered topically.
  • Pharmaceutical compositions of the present invention which are suitable for topical or transdermal administration include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants containing such carriers as are known in the art to be appropriate.
  • compositions of the present invention are administered rectally.
  • Pharmaceutical compositions of the present invention which are suitable for rectal administration are known in the art and include gels, pastes, spray formulations, suppositories containing such carriers as are known in the art to be appropriate.
  • a pharmaceutical composition of the present invention is administered vaginally.
  • Pharmaceutical compositions of the present invention which are suitable for vaginal administration include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate.
  • a pharmaceutical composition of the present invention is administered parenterally.
  • parenteral administration and “administered parenterally” as used herein means modes of administration other than enteral and topical administration, usually by injection, and include epidermal, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, intratendinous, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, intracranial, intrathoracic, epidural and intrasternal injection and infusion.
  • pharmaceutical composition is administered by intravenous or subcutaneous injection or infusion.
  • the compounds of the present invention are administered in crystalline form by subcutaneous injection, cf. Yang et al., PNAS USA 100(12), 6934-6939 (2003).
  • the pharmaceutical compositions of the present invention may be administered with medical devices known in the art.
  • a pharmaceutical composition of the present invention may be administered with a needleless hypodermic injection device, such as the devices disclosed in US 5,399,163, US 5,383,851 , US 5,312,335, US 5,064,413, US 4,941 ,880, US 4,790,824, or US 4,596,556.
  • Examples of well- known implants and modules useful in the present invention include: US 4,487,603, which discloses an implantable micro-infusion pump for dispensing medication at a controlled rate; US 4,486,194, which discloses a therapeutic device for administering medicants through the skin; US 4,447,233, which discloses a medication infusion pump for delivering medication at a precise infusion rate; US 4,447,224, which discloses a variable flow implantable infusion apparatus for continuous drug delivery; US 4,439,196, which discloses an osmotic drug delivery system having multi-chamber compartments; and US 4,475,196, which discloses an osmotic drug delivery system. Many other such implants, delivery systems, and modules are known to those skilled in the art.
  • compositions of the present invention may be formulated for particular routes of administration, such as oral, nasal, topical (including buccal, transdermal and sublingual), rectal, vaginal and/or parenteral administration.
  • routes of administration such as oral, nasal, topical (including buccal, transdermal and sublingual), rectal, vaginal and/or parenteral administration.
  • the pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any methods known in the art of pharmacy.
  • the amount of active ingredient which may be combined with a carrier material to produce a single dosage form will vary depending upon the subject being treated, and the particular mode of administration.
  • the amount of active ingredient which may be combined with a carrier material to produce a single dosage form will generally be that amount of the composition which produces a therapeutic effect. Generally, out of one hundred per cent, this amount will range from about 0.01% to about 99% of active ingredient, such as from about 0.1% to about 70%, for instance from about 1% to about 30%.
  • the compounds of the present invention which may be used in the form of a pharmaceutically acceptable salt or in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art.
  • a "pharmaceutically acceptable salt” refers to a salt that retains the desired biological activity of the parent compound and does not impart any undesired toxicological effects (see for instance Berge, S. M. et al., J. Pharm. Sci. 66, 1-19 (1977)). Examples of such salts include acid addition salts and base addition salts.
  • Acid addition salts include those derived from nontoxic inorganic acids, such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous acids and the like, as well as from nontoxic organic acids such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids and the like.
  • nontoxic inorganic acids such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous acids and the like
  • nontoxic organic acids such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids and the like.
  • Base addition salts include those derived from alkaline earth metals, such as sodium, potassium, magnesium, calcium and the like, as well as from nontoxic organic amines, such as N,N'-dibenzylethylenediamine, N-methylglucamine, chloroprocaine, choline, diethanol- amine, ethylenediamine, procaine and the like.
  • Pharmaceutically acceptable carriers include any and all suitable solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonicity agents, antioxidants and absorption delaying agents, and the like that are physiologically compatible with a compound of the present invention.
  • suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions of the present invention include water, saline, phosphate buffered saline, ethanol, dextrose, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, corn oil, peanut oil, cottonseed oil, and sesame oil, carboxymethyl cellulose colloidal solutions, tragacanth gum and injectable organic esters, such as ethyl oleate, and/or various buffers.
  • Other carriers are well known in the pharmaceutical arts.
  • Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • the use of such media and agents for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions of the present invention is contemplated.
  • Proper fluidity may be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
  • compositions of the present invention may also comprise pharmaceutically acceptable antioxidants for instance (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
  • water soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like
  • oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated
  • compositions of the present invention may also comprise isotonicity agents, such as sugars, polyalcohols such as mannitol, sorbitol, glycerol or sodium chloride in the compositions.
  • isotonicity agents such as sugars, polyalcohols such as mannitol, sorbitol, glycerol or sodium chloride in the compositions.
  • compositions of the present invention may also contain one or more adjuvants appropriate for the chosen route of administration such as preservatives, wetting agents, emulsifying agents, dispersing agents, preservatives or buffers, which may enhance the shelf life or effectiveness of the pharmaceutical composition.
  • Compounds of the present invention may for instance be admixed with lactose, sucrose, powders (e.g., starch powder), cellulose esters of alkanoic acids, stearic acid, talc, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulphuric acids, acacia, gelatin, sodium alginate, polyvinylpyrrolidine, and/or polyvinyl alcohol.
  • lactose sucrose
  • powders e.g., starch powder
  • cellulose esters of alkanoic acids e.g., stearic acid, talc, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulphuric acids, acacia, gelatin, sodium alginate, polyvinylpyrrolidine, and/or polyvinyl alcohol.
  • adjuvants are QS21 , GM-CSF, SRL-172, histamine dihydrochloride, thymocartin, Tio-TEPA, monophosphoryl-lipid A/micobacteria compositions, alum, incomplete Freund's adjuvant, montanide ISA, ribi adjuvant system, TiterMax adjuvant, syntex adjuvant formulations, immune-stimulating complexes (ISCOMs), gerbu adjuvant, CpG oligodeoxynucleotides, lipopolysaccharide, and polyinosinic:polycytidylic acid.
  • ISCOMs immune-stimulating complexes
  • Prevention of presence of microorganisms may be ensured both by sterilization procedures and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol, sorbic acid, and the like.
  • various antibacterial and antifungal agents for example, paraben, chlorobutanol, phenol, sorbic acid, and the like.
  • prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
  • compositions of the present invention comprising a compound of the present invention may also include a suitable salt therefor.
  • Any suitable salt such as an alkaline earth metal salt in any suitable form (e.g., a buffer salt), may be used in the stabilization of the compound of the present invention.
  • Suitable salts typically include sodium chloride, sodium succinate, sodium sulfate, potassium chloride, magnesium chloride, magnesium sulfate, and calcium chloride.
  • an aluminum salt is used to stabilize a compound of the present invention in a pharmaceutical composition of the present invention, which aluminum salt also may serve as an adjuvant when such a composition is administered to a patient.
  • Pharmaceutical compositions according to the present invention may be in a variety of suitable forms.
  • Such forms include, for example, liquid, semi-solid and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, emulsions, microemulsions, gels, creams, granules, powders, tablets, pills, powders, liposomes, dendrimers and other nanoparticles (see for instance Baek et al., Methods Enzymol. 362, 240-9 (2003), Nigavekar et al., Pharm Res. 21.(3), 476-83 (2004), microparticles, and suppositories.
  • liquid solutions e.g., injectable and infusible solutions
  • dispersions or suspensions emulsions, microemulsions, gels, creams, granules, powders, tablets, pills, powders, liposomes, dendrimers and other nanoparticles
  • Formulations may include, for instance, powders, pastes, ointments, jellies, waxes, oils, lipids, lipid (cationic or anionic) containing vesicles, DNA conjugates, anhydrous absorption pastes, oil-in-water and water-in-oil emulsions, emulsions carbowax (polyethylene glycols of various molecular weights), semisolid gels, and semi-solid mixtures containing carbowax.
  • any of the foregoing may be appropriate in treatments and therapies in accordance with the present invention, provided that the active ingredient in the pharmaceutical composition is not inactivated by the formulation and the formulation is physiologically compatible and tolerable with the route of administration. See also for instance Powell et al., "Compendium of excipients for parenteral formulations” PDA J Pharm Sci Technol. 52, 238-311 (1998) and the citations therein for additional information related to excipients and carriers well known to pharmaceutical chemists.
  • the compounds of the present invention may be prepared with carriers that will protect the compound against rapid release, such as a controlled release formulation, including implants, transdermal patches, and microencapsulated delivery systems.
  • Such carriers may include gelatin, glyceryl monostearate, glyceryl distearate, biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid alone or with a wax, or other materials well known in the art.. Methods for the preparation of such formulations are generally known to those skilled in the art. See e.g., Sustained and Controlled Release Drug Delivery Systems, J. R. Robinson, ed., Marcel Dekker, Inc., New York, 1978.
  • compositions of the present invention may be necessary to coat the compound with, or co-administer the compound with, a material to prevent its inactivation.
  • the compound of the present invention may be administered to a subject in an appropriate carrier, for example, liposomes, or a diluent.
  • Liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes (Strejan et al., J. Neuroimmunol. 7, 27 (1984)).
  • the active compound may be coated in a material to protect the compound from the action of acids and other natural conditions that may inactivate the compound.
  • the compound may be administered to a subject in an appropriate carrier, for example, liposomes.
  • liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes (Strejan et al., J. Neuroimmunol. 7, 27 (1984)).
  • the compounds of the present invention may be formulated to ensure proper distribution in vivo.
  • the blood-brain barrier (BBB) excludes many highly hydrophilic compounds.
  • BBB blood-brain barrier
  • the therapeutic compounds of the present invention may be formulated, for example, in liposomes.
  • liposomes For methods of manufacturing liposomes, see for instance US 4,522,81 1 , US 5,374,548 and US 5,399,331.
  • the liposomes may comprise one or more moieties which are selectively transported into specific cells or organs, thus enhance targeted drug delivery (see for instance V. V. Ranade J. Clin. Pharmacol. 29, 685 (1989)).
  • Exemplary targeting moieties include folate or biotin (see for instance US 5,416,016), mannosides (Umezawa et al., Biochem. Biophys. Res. Commun. 153, 1038 (1988)), antibodies (P. G. Bloeman et al., FEBS Lett. 357, 140 (1995), M. Owais et al., Antimicrob. Agents Chemother. 39, 180 (1995)), surfactant protein A receptor (Briscoe et al., Am. J. Physiol. 1233, 134 (1995)), different species of which may comprise the pharmaceutical compositions of the present inventions, as well as components of the invented molecules, p120 (Schreier et al., J.
  • the compounds of the present invention are formulated in liposomes.
  • the liposomes include a targeting moiety.
  • the compounds in the liposomes are delivered by bolus injection to a site proximal to the desired area, e.g., the site of inflammation or infection, or the site of a tumor.
  • the composition should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the compounds of the present invention may be formulated to prevent or reduce their transport across the placenta.
  • compositions of parenteral administation include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • the use of such media and agents for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions of the present invention is contemplated. Supplementary active compounds may also be incorporated into the compositions.
  • compositions for injection must typically be sterile and stable under the conditions of manufacture and storage.
  • the composition may be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration.
  • the carrier may be a aqueous or nonaqueous solvent or dispersion medium containing for instance water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate.
  • the proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • isotonic agents for example, sugars, polyalcohols such as glycerol, mannitol, sorbitol, or sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin.
  • Sterile injectable solutions may be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients e.g. as enumerated above, as required, followed by sterilization microfiltration.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients e.g.
  • sterile powders for the preparation of sterile injectable solutions examples of methods of preparation are vacuum drying and freeze-drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Sterile injectable solutions may be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by sterilization microfiltration.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • examples of methods of preparation are vacuum drying and freeze-drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile -filtered solution thereof.
  • the pharmaceutical composition of the present invention may contain one compound of the present invention or a combination of compounds of the present invention.
  • a pharmaceutical composition of the present invention includes a combination of multiple (e.g., two or more) compounds of the present invention which act by different mechanisms, e.g., one compound which predominately acts by inducing CDC in combination with another compound which predominately acts by inducing apoptosis.
  • the IL-21 BPs including anti-IL-21 antibodies, immunoconjugates, bispecific/- multispecific molecules, compositions and other derivatives described herein
  • of the present invention have numerous in vitro and in vivo diagnostic and therapeutic utilities involving the diagnosis and treatment of disorders involving IL-21.
  • the antibodies may be administered to cells in culture, e.g., in vitro or ex vivo, or to human subjects, e.g., in vivo, to treat, prevent and to diagnose a variety of disorders.
  • the term "subject" is intended to include human and non-human animals which respond to the IL-21 BP.
  • Subjects may for instance include human patients having disorders that may be corrected or ameliorated by inhibiting the IL-21 receptor, such as for instance graft rejection.
  • the present invention provides methods for detecting the presence of IL-21 antigen in a sample, or measuring the amount of IL-21 antigen, comprising contacting the sample, and a control sample, with an IL-21 BP which specifically binds to IL-21 , under conditions that allow for formation of a complex between the IL-21 BP or portion thereof and IL-21. The formation of a complex is then detected, wherein a difference complex formation between the sample compared to the control sample is indicative the presence of IL-21 antigen in the sample.
  • Examples of methods for detecting immunoassays include, without limitation, an ELISA, an RIA, FACS assays, plasmon resonance assays, chromatographic assays, tissue immunohistochemistry, Western blot, and/or immunoprecipitation.
  • IL-21 BPs of the present invention may be used to detect levels of circulating IL-21 , which levels can then be linked to certain disease symptoms.
  • the IL-21 BPs may be used to interact with the function of cells expressing the IL-21 receptor, thereby implicating these cells as important mediators of the disease. This may be achieved by contacting a sample and a control sample with the anti-IL-21 antibody under conditions that allow for the formation of a complex between the antibody and IL-21. Any complexes formed between the antibody and IL-21 are detected and compared in the sample and the control.
  • the present invention provides a method for detecting the presence or quantifying the amount of IL-21 in vivo or in vitro.
  • the method comprises (i) administering to a subject a composition (comprising e.g., IL-21 BPs, human anti-IL-21 antibodies, and/or bispecific/multispecific antibodies) of the present invention conjugated to a detectable marker; (ii) exposing the subject to a means for detecting said detectable marker to identify areas containing IL-21.
  • a composition comprising e.g., IL-21 BPs, human anti-IL-21 antibodies, and/or bispecific/multispecific antibodies
  • immunoconjugates of the present invention may be used to target compounds (e.g., therapeutic agents, labels, cytotoxins, immunosuppressants, etc.) to cells which have IL-21 bound to their surface by linking such compounds to the IL-21 BP.
  • the present invention provides methods for treating a disease or disorder in a subject, wherein said disease or disorder may be treatable by use of an IL-21 antagonist , which method comprises administation of a therapeutically effective amount of an IL-21 BP of the present invention to a subject in need thereof.
  • Such IL-21 BPs are used to inhibit IL-21 interaction with the IL-21 receptor.
  • Such a method involves administering to a subject an IL-21 BP of the present invention in an amount effective to treat or prevent the disorder.
  • the IL-21 BP may be administered alone or along with another therapeutic agent, which acts in conjunction with or synergistically with the IL-21 BP to treat or prevent the disease.
  • the present invention provides a method for treating autoimmune diseases or disorders in humans, which method comprises administation of a therapeutically effective amount of an IL-21 BP of the present invention to a subject in need thereof.
  • the present invention provides the use of an IL-21 BP of the present invention for the preparation of a pharmaceutical composition for treating autoimmune diseases or disorders.
  • vasculitides and other vessel disorders such as microscopic polyangiitis, Churg-Strauss syndrome, and other ANCA-associated vasculitides, polyarteritis nodosa, essential cryoglobulinaemic vasculitis, cutaneous leukocytoclastic angiitis, Kawasaki disease, Takayasu arteritis, giant cell arthritis, Henoch-Sch ⁇ nlein purpura, primary or isolated cerebral angiitis, erythema nodosum, thrombangiitis obliterans, thrombotic thrombocytopenic purpura (including hemolytic uremic syndrome), and secondary vasculitides, including cutaneous leukocytoclastic vasculitis (e.g., secondary to hepatitis B, hepatitis C, Waldenstrom's macro
  • the disease is a transplantation-derived disorder.
  • such disorder is derived from IL-21 mediated graft rejection, for instance allograft and xenograft rejection, and graft-versus-host disease.
  • the disease is rheumatoid arthritis (RA).
  • the disease is selected from inflammatory bowel disease (IBD), ulcerative colitis, Crohn's disease, juvenile onset diabetes, multiple sclerosis, immune- mediated thrombocytopenias, such as acute idiopathic thrombocytopenic purpura and chronic idiopathic thrombocytopenic purpura, hemolytic anemia (including autoimmune hemolytic anemia), myasthenia gravis, systemic sclerosis, and pemphigus vulgaris.
  • IBD inflammatory bowel disease
  • ulcerative colitis Crohn's disease
  • juvenile onset diabetes multiple sclerosis
  • immune- mediated thrombocytopenias such as acute idiopathic thrombocytopenic purpura and chronic idiopathic thrombocytopenic purpura
  • hemolytic anemia including autoimmune hemolytic anemia
  • myasthenia gravis systemic sclerosis
  • pemphigus vulgaris pemphigus vulgaris
  • the disease is selected from inflammatory bowel disease (IBD), ulcerative colitis, Crohn's disease, and multiple sclerosis.
  • IBD inflammatory bowel disease
  • ulcerative colitis Crohn's disease
  • multiple sclerosis multiple sclerosis
  • the present invention provides a method for treating or preventing systemic lupus erythematosus, rheumatoid arthritis or inflammatory bowel disease, which method comprises administation of a therapeutically effective amount of an IL-21 BP of the present invention to a subject in need thereof.
  • the present invention provides the use of an IL-21 BP of the present invention for the preparation of a pharmaceutical composition for treating systemic lupus erythematosus, rheumatoid arthritis or inflammatory bowel disease.
  • the IL-21 BPs of the present invention may be used in vivo or in vitro for diagnosing diseases wherein altered levels of IL-21 play an active role in the pathogenesis by detecting levels of IL-21. This may be achieved, for example, by contacting a sample to be tested, optionally along with a control sample, with the IL-21 BP under conditions that allow for formation of a complex between the antibody and IL-21. Complex formation is then detected (e.g., using an ELISA). When using a control sample along with the test sample, complex is detected in both samples and any statistically significant difference in the formation of complexes between the samples is indicative of the presence of IL-21 in the test sample.
  • the present invention provides methods for the identification of, and diagnosis of invasive cells and tissues, and other cells targeted by IL-21 BPs of the present invention, and for the monitoring of the progress of therapeutic treatments, status after treatment, risk of developing cancer, cancer progression, and the like.
  • the present invention provides a method of diagnosing the level of invasive cells in a tissue comprising forming an immunocomplex between an IL-21 BP and potential IL-21 containing tissues, and detecting formation of the immunocomplex, wherein the formation of the immunocomplex correlates with the presence of invasive cells in the tissue.
  • the contacting may be performed in vivo, using labeled isolated antibodies and standard imaging techniques, or may be performed in vitro on tissue samples.
  • IL-21 BPs may be used to detect IL-21-containing peptides and peptide fragments in any suitable biological sample by any suitable technique.
  • Examples of conventional immunoassays provided by the present invention include, without limitation, an ELISA, an RIA, FACS assays, plasmon resonance assays, chromatographic assays, tissue immunohistochemistry, Western blot, and/or immunoprecipitation using an IL-21 BP.
  • Anti- IL-21 antibodies of the present invention may be used to detect IL-21 and IL-21 -fragments from humans.
  • Suitable labels for the IL-21 BP and/or secondary antibodies used in such techniques include, without limitation, various enzymes, prosthetic groups, fluorescent materials, luminescent materials, and radioactive materials.
  • suitable enzymes include horseradish peroxidase, alkaline phosphatase, ⁇ -galactosidase, or acetylcholinesterase;
  • suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin;
  • suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; and examples of suitable radioactive material include 125 I, 131 I, 35 S, and 3 H.
  • IL-21 BPs may also be assayed in a biological sample by a competition immunoassay utilizing IL-21 peptide standards labeled with a detectable substance and an unlabeled IL-21 BP, such as an unlabelled anti-IL-21 antibody, for example.
  • a competition immunoassay utilizing IL-21 peptide standards labeled with a detectable substance and an unlabeled IL-21 BP, such as an unlabelled anti-IL-21 antibody, for example.
  • the biological sample, the labeled IL-21 peptide standard(s) and the IL-21 BP are combined and the amount of labeled IL-21 standard bound to the unlabeled IL-21 BP is determined.
  • the amount of IL-21 peptide in the biological sample is inversely proportional to the amount of labeled IL-21 standard bound to the IL-21 BP.
  • the present invention provides an in vivo imaging method wherein an IL-21 BP, such as an anti-IL-21 antibody, of the present invention is conjugated to a detection-promoting radio-opaque agent, the conjugated antibody is administered to a host, such as by injection into the bloodstream, and the presence and location of the labeled antibody in the host is assayed.
  • an IL-21 BP such as an anti-IL-21 antibody
  • the present invention provides a method for screening for the presence of disease-related cells in a human patient or a biological sample taken from a human patient.
  • radioisotopes may be bound to an IL-21 BP either directly, or indirectly by using an intermediary functional group.
  • Useful intermediary functional groups include chelators, such as ethylenediaminetetraacetic acid and diethylenetriaminepentaacetic acid (see for instance US 5,057,313).
  • chelators such as ethylenediaminetetraacetic acid and diethylenetriaminepentaacetic acid (see for instance US 5,057,313).
  • the dosage of conjugated peptide delivered to the patient typically is maintained at as low a level as possible through the choice of isotope for the best combination of minimum half-life, minimum retention in the body, and minimum quantity of isotope, which will permit detection and accurate measurement.
  • diagnostic methods may be performed using IL-21 BPs that are conjugated to dyes (such as with the biotin-streptavidin complex), contrast agents, fluorescent compounds or molecules and enhancing agents (e.g. paramagnetic ions) for magnetic resonance imaging (MRI) (see, e.g., US Pat. No. 6,331 ,175, which describes MRI techniques and the preparation of antibodies conjugated to a MRI enhancing agent).
  • dyes such as with the biotin-streptavidin complex
  • contrast agents e.g. paramagnetic ions
  • fluorescent compounds or molecules e.g. paramagnetic ions
  • enhancing agents e.g. paramagnetic ions
  • Such diagnostic/detection agents may be selected from agents for use in magnetic resonance imaging, and fluorescent compounds.
  • a reagent having a long tail to which are attached a multiplicity of chelating groups for binding the ions.
  • a tail may be a polymer such as a polylysine, polysaccharide, or other derivatized or derivatizable chain having pendant groups to which may be bound chelating groups such as, e.g., porphyrins, polyamines, crown ethers, bisthiosemicarbazones, polyoximes, and like groups known to be useful for this purpose.
  • Chelates may be coupled to IL-21 BPs using standard chemistries.
  • a chelate is normally linked to an IL-21 BP, such as an anti-IL-21 mAB, by a group, which enables formation of a bond to the molecule with minimal loss of immunoreactivity and minimal aggregation and/or internal cross-linking.
  • an IL-21 BP such as an anti-IL-21 mAB
  • Other, more unusual, methods and reagents for conjugating chelates to antibodies are disclosed in for instance US 4,824,659.
  • Examples of potentially useful metal-chelate combinations include 2-benzyl-DTPA and its monomethyl and cyclohexyl analogs, used with diagnostic isotopes in the general energy range of 60 to 4,000 keV, such as 125 I, 123 I, 124 1, 62 Cu, 64 Cu, 18 F, 111 In, 67 Ga, 67 Ga, 99 Tc, 94 Tc, 11 C, 13 N, 15 O, and 76 BR, for radio- imaging.
  • These and similar chelates, when complexed with non-radioactive metals, such as manganese, iron, and gadolinium may be useful for MRI diagnostic methods in connection with IL-21 BPs.
  • Macrocyclic chelates such as NOTA, DOTA, and TETA are of use with a variety of metals and radiometals, most particularly with radionuclides of gallium, yttrium, and copper, respectively. Such metal-chelate complexes may be made very stable by tailoring the ring size to the metal of interest.
  • Other ring-type chelates such as macrocyclic polyethers, which are of interest for stably binding nuclides, such as 223 Ra for RAIT may also be suitable in diagnostic methods.
  • the present invention provides diagnostic IL-21 BP conjugates, wherein the IL-21 BP is conjugated to a contrast agent (such as for magnetic resonance imaging, computed tomography, or ultrasound contrast-enhancing agent) or a radionuclide that may be, for example, a gamma-, beta-, alpha-, Auger electron-, or positron-emitting isotope.
  • a contrast agent such as for magnetic resonance imaging, computed tomography, or ultrasound contrast-enhancing agent
  • a radionuclide may be, for example, a gamma-, beta-, alpha-, Auger electron-, or positron-emitting isotope. Additional useful conjugated IL-21 BPs are described elsewhere herein, which may also be useful in diagnostic methods and compositions (e.g., diagnostic kits) provided by the present invention.
  • the present invention provides a kit for diagnosis of cancer comprising a container comprising an IL-21 BP, such as an anti-IL-21 antibody, and one or more reagents for detecting binding of the IL-21 BP to an IL-21 peptide.
  • Reagents may include, for example, fluorescent tags, enzymatic tags, or other detectable tags.
  • the reagents may also include secondary or tertiary antibodies or reagents for enzymatic reactions, wherein the enzymatic reactions produce a product that may be visualized.
  • the present invention provides a diagnostic kit comprising one or more IL-21 BPs, such as anti-IL-21 antibodies, of the present invention in labeled or unlabeled form in suitable container(s), reagents for the incubations for an indirect assay, and substrates or derivatizing agents for detection in such an assay, depending on the nature of the label. Control reagent(s) and instructions for use also may be included.
  • Diagnostic kits may also be supplied for use with an IL-21 BP, such as a conjugated/labeled anti-IL-21 antibody, for the detection of a cellular activity or for detecting the presence of IL-21 peptides in a tissue sample or host.
  • an IL-21 BP typically may be provided in a lyophilized form in a container, either alone or in conjunction with additional antibodies specific for a target cell or peptide.
  • a pharmaceutical acceptable carrier e.g., an inert diluent
  • components thereof such as a Tris, phosphate, or carbonate buffer, stabilizers, preservatives, biocides, biocides, inert proteins, e.g., serum albumin, or the like
  • additional reagents also typically in separate container(s)
  • a secondary antibody capable of binding to the anti-IL-21 antibody or other IL-21 BP is also included.
  • the second antibody is typically conjugated to a label and formulated in manner similar to the anti-IL-21 antibody or other IL-21 BP of the present invention.
  • IL-21 BPs may be used to define subsets of cancer/tumor cells and characterize such cells and related tissues/growths.
  • an IL-21 BP or anti-IL-21 antibody may be added to nitrocellulose, or other solid support which is capable of immobilizing cells, cell particles, or soluble proteins.
  • the support may then be washed with suitable buffers followed by treatment with the detectably labeled IL-21 peptide or antibody.
  • the solid phase support may then be washed with the buffer a second time to remove unbound peptide or antibody.
  • the amount of bound label on the solid support may then be detected by known method steps.
  • Linked enzymes that react with an exposed substrate may be used to generate a chemical moiety which may be detected, for example, by spectrophotometric, fluorometric or by visual means, in the context of an IL-21 BP conjugate and/or fusion protein.
  • Enzymes which may be used to detectably label IL-21 BPs and anti-IL-21 antibodies include malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta- galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase, and acetylcholinesterase.
  • fluorescent labeling compounds fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde, and fluorescamine.
  • the IL-21 BPS such as anti-IL-21 antibodies, may also be detectably labeled using fluorescence-emitting metals such as 152 Eu, or others of the lanthanide series. These metals may be attached to an anti-IL-21 antibody, for example, using such metal chelating groups as diethylenetriaminepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).
  • DTPA diethylenetriaminepentaacetic acid
  • EDTA ethylenediaminetetraacetic acid
  • IL-21 BPs and anti-IL-21 antibodies may also be detectably labeled by coupling to a chemiluminescent compound. The presence of the chemiluminescently labeled IL-21-BP is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole
  • a bioluminescent compound may be used to label an IL-21 BP.
  • Bioluminescence is a type of chemiluminescence found in biological systems in which a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting the presence of luminescence.
  • Important bioluminescent compounds for purposes of labeling are luciferin, luciferase, and aequorin. Detection of a labeled peptide or antibody, antibody fragment or derivative may be accomplished by a scintillation counter, for example, if the detectable label is a radioactive gamma emitter, or by a fluorometer, for example, if the label is a fluorescent material.
  • the detection may be accomplished by colorimetric methods which employ a substrate for the enzyme. Detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards.
  • IL-21 peptides or I L-21 -fragments examples include, for example, blood, serum, lymph, urine, inflammatory exudate, cerebrospinal fluid, amniotic fluid, a tissue extract or homogenate, and the like.
  • the present invention is not limited to assays using only these samples, it being possible for one of ordinary skill in the art to determine suitable conditions which allow the use of other samples.
  • In situ detection may be accomplished by removing a histological specimen from a patient, and providing the combination of labeled IL-21 BPs, such as anti-IL-21 antibodies, of the present invention to such a specimen.
  • the IL-21 BP, anti-IL-21 -antibody (or fragment) of the present invention may be provided by applying or by overlaying the labeled IL-21 BP, such as a labelled anti-IL-21 antibody (or fragment), of the present invention to a biological sample.
  • compositions of the present invention may include a "therapeutically effective amount” or a “prophylactically effective amount” of an IL-21 BP.
  • a “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired therapeutic result.
  • a therapeutically effective amount of an IL-21 BP may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the IL-21 BP to elicit a desired response in the individual.
  • a therapeutically effective amount is also one in which any toxic or detrimental effects of the antibody or antibody portion are outweighed by the therapeutically beneficial effects.
  • a “prophylactically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result (e.g., a reduction in the likelihood of developing a disorder, a reduction in the intensity or spread of a disorder, an increase in the likelihood of survival during an imminent disorder, a delay in the onset of a disease condition, etc.).
  • the prophylactically effective amount will be less than the therapeutically effective amount.
  • a "therapeutically effective amount" for rheumatoid arthritis may result in an at least ACR 2O Preliminary Definition of Improvement in the patients, such as in at least an ACR 50 Preliminary Definition of Improvement, for instance at least an ARC 70 Preliminary Definition of Improvement.
  • ACR 20 Preliminary Definition of Improvement is defined as:
  • TJC Tender Joint Count
  • SJC Swollen Joint Count
  • ACR 50 and ACR 70 are defined in the same way with ⁇ 50% and ⁇ 70% improvements, respectively.
  • a therapeutically effective amount for rheumatoid arthritis may be measured by DAS (disease activity score), including DAS28 and/or DAS56, as defined by The European League against Rheumatism (www.eular.org).
  • Dosage regimens of compounds of and/or used in the methods of the invention typically are selected or adjusted to provide the optimum desired response (e.g., a therapeutic response).
  • any suitable dosage regimen can be used.
  • a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation.
  • Parenteral compositions may be formulated in dosage unit form for ease of administration and uniformity of dosage.
  • Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subjects to be treated; each unit contains a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • the efficient dosages and the dosage regimens for the IL-21 BPs of the present invention depend on the disease or condition to be treated and may be determined by the persons skilled in the art.
  • An exemplary, non-limiting range for a therapeutically effective amount of a compound of the present invention is about 0.1 -100 mg/kg, such as about 0.1 -50 mg/kg, for example about 0.1 -20 mg/kg, such as about 0.1-10 mg/kg, for instance about 0.5, about such as 0.3, about 1 , or about 3 mg/kg.
  • a physician or veterinarian having ordinary skill in the art may readily determine and prescribe the effective amount of the pharmaceutical composition required.
  • the physician or veterinarian could start doses of the IL-21 BPs of the present invention employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
  • a suitable daily dose of a composition of the present invention will be that amount of the compound which is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above.
  • Administration may be intravenous, intramuscular, intraperitoneal, or subcutaneous, and for instance administered proximal to the site of the target.
  • the effective daily dose of a pharmaceutical composition may be administered as two, three, four, five, six or more sub- doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms. While it is possible for a compound of the present invention to be administered alone, it is preferable to administer the compound as a pharmaceutical composition as described above.
  • the IL-21 BPs of the present invention may be administered by infusion in a weekly dosage of from 10 to 500 mg/m 2 , such as of from 200 to 400 mg/m 2 . Such administration may be repeated, e.g., 1 to 8 times, such as 3 to 5 times. The administration may be performed by continuous infusion over a period of from 2 to 24 hours, such as of from 2 to 12 hours.
  • the IL-21 BPs of the present invention may be administered by slow continuous infusion over a long period, such as more than 24 hours, in order to reduce toxic side effects.
  • the IL-21 BPs of the present invention may be administered in a weekly dosage of from 250 mg to 2000 mg, such as for example 300 mg, 500 mg, 700 mg, 1000 mg, 1500 mg or 2000 mg, for up to 8 times, such as from 4 to 6 times.
  • the administration may be performed by continuous infusion over a period of from 2 to 24 hours, such as of from 2 to 12 hours. Such regimen may be repeated one or more times as necessary, for example, after 6 months or 12 months.
  • the dosage may be determined or adjusted by measuring the amount of compound of the present invention in the blood upon administration by for instance taking out a biological sample and using anti-idiotypic antibodies which target the antigen binding region of the IL-21 BPs of the present invention.
  • the IL-21 BPs of the present invention may be administered by maintenance therapy, such as, e.g., once a week for a period of 6 months or more.
  • the IL-21 BPs of the present invention may be administered by a regimen including one infusion of an IL-21 BP of the present invention followed by an infusion of an IL-21 BP of the present invention conjugated to a radioisotope.
  • the regimen may be repeated, e.g., 7 to 9 days later.
  • treatment according to the present invention may be provided as a daily dosage of a compound of the present invention in an amount of about 0.1 -100 mg/kg, such as 0.5, 0.9, 1.0, 1.1 , 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 45, 50, 60, 70, 80, 90 or 100 mg/kg, per day, on at least one of day 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40, or alternatively, at least one of week 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 after initiation of treatment, or any combination thereof, using single or divided doses of every 24, 12, 8, 6, 4, or 2 hours, or any combination thereof.
  • the IL-21 binding peptides of the present invention for therapeutic use may also be administered in combination therapy, i.e., combined with other therapeutic agents relevant for the disease or condition to be treated. Such administration may be simultaneous, separate or sequential. For simultaneous administration the agents may be administered as one compositons or as separate compositions, as appropriate.
  • the present invention thus also provides methods for treating a disease or disorder treatable by use of an IL-21 antagonist as described above, which methods comprise administration of an IL-21 BP of the present invention combined with one or more additional therapeutic agents as described below.
  • the present invention provides a method for treating adisease or disorder treatable by use of an IL-21 antagonist in a subject, which method comprises administation of a therapeutically effective amount of an IL-21 BP of the present invention and at least one anti-inflammatory agent to a subject in need thereof.
  • such an anti-inflammatory agent may be selected from a steroidal drug and a NSAID (nonsteroidal anti-inflammatory drug).
  • such an anti-inflammatory agent may be selected from aspirin and other salicylates, Cox-2 inhibitors (such as rofecoxib and celecoxib), NSAIDs (such as ibuprofen, fenoprofen, naproxen, sulindac, diclofenac, piroxicam, ketoprofen, diflunisal, nabumetone, etodolac, oxaprozin, and indomethacin), anti-IL6R antibodies, anti-IL8 antibodies, anti-IL15 antibodies, anti-IL15R antibodies, anti-CD4 antibodies, anti-CD1 1a antibodies (e.g., efalizumab), anti-alpha-4/beta-1 integrin (VLA4) antibodies (e.g natalizumab), CTLA4-lg for the treatment of inflammatory diseases, prednisolone, prednisone, disease modifying antirheumatic drugs (DMARDs) such as methotrex
  • the present invention provides a method for treating a disease or disorder treatable by use of an IL-21 antagonist in a subject, which method comprises administation of a therapeutically effective amount of an IL-21 BP of the present invention and at least one immunosuppressive and/or immunomodulatory agent to a subject in need thereof.
  • such an immunosuppressive and/or immunomodulatory agent may be selected from cyclosporine, azathioprine, mycophenolic acid, mycophenolate mofetil (such as Cellcept®), corticosteroids such as prednisone, methotrexate, gold salts, sulfasalazine, antimalarials, brequinar, leflunomide, mizoribine, 15-deoxyspergualine, 6-mercaptopurine, cyclophosphamide, rapamycin, tacrolimus (FK-506), OKT3, anti- thymocyte globulin, thymopentin, thymosin- ⁇ and similar agents.
  • cyclosporine azathioprine
  • mycophenolic acid such as Cellcept®
  • mycophenolate mofetil such as Cellcept®
  • corticosteroids such as prednisone, methotrexate, gold salts, sulfasalazine
  • such an immunosuppressive and/or immunomodulatory agent may be selected from immunosuppressive antibodies, such as antibodies binding to p75 of the IL-2 receptor, or antibodies binding to for instance MHC, CD2, CD3, CD4, CD7, CD28, B7, CD40, CD45, IFN ⁇ , TNF- ⁇ , IL-4, IL-5, IL-6R, IL-7, IL-8, IL-10, CD1 1a, or CD58, or antibodies binding to their ligands.
  • immunosuppressive antibodies such as antibodies binding to p75 of the IL-2 receptor, or antibodies binding to for instance MHC, CD2, CD3, CD4, CD7, CD28, B7, CD40, CD45, IFN ⁇ , TNF- ⁇ , IL-4, IL-5, IL-6R, IL-7, IL-8, IL-10, CD1 1a, or CD58, or antibodies binding to their ligands.
  • such an immunosuppressive and/or immunomodulatory agent may be selected from soluble IL-15R, IL-10, B7 molecules (B7-1 , B7-2, variants thereof, and fragments thereof), ICOS, and OX40, an inhibitor of a negative T cell regulator (such as an antibody against CTLA4) and similar agents.
  • the IL-21 BPs of the present invention may be administered in combination with two or more immunosuppressive and/or immunomodulatory agents, such as in combination with prednisone and cyclosporine; prednisone, cyclosporine and azathioprine; or prednisone, cyclosporine and mycophenolate mofetil.
  • immunosuppressive and/or immunomodulatory agents such as in combination with prednisone and cyclosporine; prednisone, cyclosporine and azathioprine; or prednisone, cyclosporine and mycophenolate mofetil.
  • the present invention provides an IL-21 BP that is conjugated to an immunomodulator, such as an immunomodulating cytokine, stem cell growth factor, lymphotoxin (such as a TNF such as TNF ⁇ ), or a hematopoietic factor.
  • an immunomodulator such as an immunomodulating cytokine, stem cell growth factor, lymphotoxin (such as a TNF such as TNF ⁇ ), or a hematopoietic factor.
  • Examples of such molecules that may be useful as conjugates include IL-2, IL-3, IL-10, , colony stimulating factors (such as granulocyte-colony stimulating factor (G-CSF) and granulocyte macrophage- colony stimulating factor (GM-CSF)), interferons (such as IFN ⁇ , and I FNY) the stem cell growth factor designated "S1 factor,” erythropoietin, and thrombopoietin, active fragments thereof, derivatives thereof, variants thereof, or a combination of any thereof.
  • G-CSF granulocyte-colony stimulating factor
  • GM-CSF granulocyte macrophage- colony stimulating factor
  • interferons such as IFN ⁇ , and I FNY
  • the present invention further provides method of promoting the sale and/or use of an IL-21 BP of the present invention, comprising distributing information (such as by printed materials that are handed out, mailed, etc., by advertising signage, by television programs and advertisements, by radio programs and advertisements, by internet site postings, by email, by telemarketing, by door-to-door or person-to-person marketing, by funding and/or hosting conferences, panels, forums, etc., by employing and/or contracting for the services of salespeople and/or medical/scientific liaisons, by funding and/or hosting scientific research and publications related to such uses, etc.) related to the use of the compound in the prevention or treatment of any condition or combination of conditions as described elsewhere herein to any persons or entities of potential interest (such as pharmaceutical chains, formulary managers, insurance companies, HMOs, hospitals and hospital chains, other health care companies, pharmacy benefit managers, potential patients, cancer patients, former cancer patients, patients in remission, primary care physicians, nurses, doctors of pharmacy, and/or key opinion leaders).
  • distributing information such as by
  • kits comprising a pharmaceutical composition of a compound of the present invention and instructions for use.
  • the kit may further contain one or more additional agents, such as an immunosuppressive reagent, a chemotherapeutic reagent, an anti-inflammatory agent or a radiotoxic agent as described above, or one or more additional IL-21 BPs of the present invention (such as an IL-21 BP having a complementary activity).
  • a kit of the present invention may also include diagnostic agents and/or other therapeutic agents.
  • a kit of the present invention includes an IL-21 BP of the present invention and a diagnostic agent that may be used in a diagnostic method for diagnosing the state or existence of a disorder involving IL-21 in a subject.
  • the kit includes an IL-21 BP of the present invention in a highly stable form (such as in a lyophilized form) in combination with pharmaceutically acceptable carrier(s) that may be mixed with the highly stabile composition to form an injectable composition.
  • a highly stable form such as in a lyophilized form
  • pharmaceutically acceptable carrier(s) that may be mixed with the highly stabile composition to form an injectable composition.
  • Embodiment 1 An IL-21 binding peptide, which is capable of antagonizing the action of IL-21 on the human IL-21 receptor.
  • Embodiment 2 An IL-21 binding peptide according to embodiment 1 , wherein said IL-21 binding peptide is capable of decreasing the activity of IL-21 on the human IL-21 receptor by at least 25%.
  • Embodiment 3 An IL-21 binding peptide according to embodiment 1 or embodiment 2, wherein said IL-21 binding peptide is capable of decreasing the activity of IL-21 on the human IL-21 receptor by at least 50%.
  • Embodiment 4 An IL-21 binding peptide according to any of embodiments 1 to 3, wherein said IL-21 binding peptide is capable of decreasing the activity of IL-21 on the human IL-21 receptor by at least 75%.
  • Embodiment 5 An IL-21 binding peptide according to any of embodiments 1 to 4, wherein said IL-21 binding peptide is capable of decreasing the activity of IL-21 on the human IL-21 receptor by at least 90%.
  • Embodiment 6 An IL-21 binding peptide according to any of embodiments 1 to 5, wherein the antagonism of said IL-21 binding peptide is determined by use of an assay as described in Example 3.
  • Embodiment 7 An IL-21 binding peptide, which competes with an anti-IL-21 antibody having an amino acid sequence for V L as presented in SEQ ID No. 1 and an amino acid sequence for V H as presented in SEQ ID No. 2 for binding to IL-21.
  • Embodiment 8 An IL-21 binding peptide according to any of embodiments 1 to 6, which competes with an anti-IL-21 antibody having an amino acid sequence for V L as presented in SEQ ID No. 1 and an amino acid sequence for V H as presented in SEQ ID No. 2 for binding to IL-21.
  • Embodiment 9 An IL-21 binding peptide according to embodiment 7 or embodiment
  • Embodiment 10 An IL-21 binding peptide, which IL-21 binding peptide specifically binds to i) a IL-21 epitope that also is specifically bound by an antibody having a V L sequence of SEQ ID No. 1 and a V H sequence of SEQ ID No. 2 and/or ii) an IL-21 epitope that also is specifically bound by an antibody having a V L sequence of SEQ ID No. 9 and a V H sequence of SEQ ID No. 10.
  • Embodiment 11 An IL-21 binding peptide according to any of embodiments 1 to 9, which IL-21 binding peptide specifically binds to i) a IL-21 epitope that also is specifically bound by an antibody having a V L sequence of SEQ ID No. 1 and a V H sequence of SEQ ID No. 2 and/or ii) an IL-21 epitope that also is specifically bound by an antibody having a V L sequence of SEQ ID No. 9 and a V H sequence of SEQ ID No. 10.
  • Embodiment 12 An IL-21 binding peptide according to any of embodiments 1 to 11 , which peptide comprises the amino acid sequence of SEQ ID No. 8.
  • Embodiment 13 An IL-21 binding peptide according to any of embodiments 1 to 12, which peptide comprises the amino acid sequence of SEQ ID No. 5.
  • Embodiment 14 An IL-21 binding peptide according to embodiment 12 or embodiment 13, which additionally comprises the amino acid sequence of SEQ ID No. 7.
  • Embodiment 15 An IL-21 binding peptide according to any of embodiments 12 to
  • Embodiment 16 An IL-21 binding peptide according to any of embodiments 12 to
  • Embodiment 17 An IL-21 binding peptide according to any of embodiments 12 to 16, which additionally comprises the amino acid sequence of SEQ ID No. 4.
  • Embodiment 18 An IL-21 binding peptide according to any of embodiments 12 to
  • Embodiment 19 An IL-21 binding peptide according to any of embodiments 12 to
  • Embodiment 20 An IL-21 binding peptide according to any of embodiments 1 to 11 , which peptide comprises the amino acid sequence of SEQ ID No. 16.
  • Embodiment 21 An IL-21 binding peptide according to any of embodiments 1 to 11 or embodiment 20, which peptide comprises the amino acid sequence of SEQ ID No. 13.
  • Embodiment 22 An IL-21 binding peptide according to embodiment 20 or embodiment 21 , which additionally comprises the amino acid sequence of SEQ ID No. 15.
  • Embodiment 23 An IL-21 binding peptide according to any of embodiments 20 to
  • Embodiment 24 An IL-21 binding peptide according to any of embodiments 20 to
  • Embodiment 25 An IL-21 binding peptide according to any of embodiments 20 to
  • Embodiment 26 An IL-21 binding peptide according to any of embodiments 20 to
  • Embodiment 27 An IL-21 binding peptide according to any of embodiments 20 to 26, which comprises the amino acid sequence of SEQ ID No. 9.
  • Embodiment 28 An IL-21 binding peptide according to any of embodiments 12 to 27, which IL-21 binding peptide is an anti-IL-21 antibody.
  • Embodiment 29 An IL-21 binding peptide according to any of embodiments 1 to 11 , which peptide is an anti-IL-21 antibody.
  • Embodiment 30 An anti-IL-21 antibody according to embodiment 29 comprising a V H CDR3 sequence comprising the amino acid sequence of SEQ ID No. 8.
  • Embodiment 31 An anti-IL-21 antibody according to embodiment 29 or embodiment 30 comprising a V L CDR3 sequence comprising the amino acid sequence of SEQ ID No. 5.
  • Embodiment 32 An anti-IL-21 antibody according to embodiment 30 or embodiment
  • V H CDR2 sequence comprising the amino acid sequence of SEQ ID No. 7.
  • Embodiment 33 An anti-IL-21 antibody according to any of embodiments 30 to 32, which additionally comprises a V H CDR1 sequence comprising the amino acid sequence of SEQ ID No. 6.
  • Embodiment 34 An anti-IL-21 antibody according to any of embodiments 30 to 33 comprising a V H comprising the amino acid sequence of SEQ ID No. 2.
  • Embodiment 35 An anti-IL-21 antibody according to any of embodiments 30 to 34, which additionally comprises a V L CDR2 sequence comprising the amino acid sequence of SEQ ID No. 4.
  • Embodiment 36 An anti-IL-21 antibody according to any of embodiments 30 to 35, which additionally comprises a V L CDR1 sequence comprising the amino acid sequence of SEQ ID No. 3.
  • Embodiment 37 An anti-IL-21 antibody according to any of embodiments 30 to 36 comprising a V H comprising the amino acid sequence of SEQ ID No. 1.
  • Embodiment 38 An anti-IL-21 antibody according to embodiment 29 comprising a V H CDR3 sequence comprising the amino acid sequence of SEQ ID No. 16.
  • Embodiment 39 An anti-IL-21 antibody according to embodiment 29 or embodiment 38 comprising a V L CDR3 sequence comprising the amino acid sequence of SEQ ID No. 13.
  • Embodiment 40 An anti-IL-21 antibody according to embodiment 38 or embodiment
  • V H CDR2 sequence comprising the amino acid sequence of SEQ ID No. 15.
  • Embodiment 41 An anti-IL-21 antibody according to any of embodiments 38 to 40, which additionally comprises a V H CDR1 sequence comprising the amino acid sequence of SEQ ID No. 14.
  • Embodiment 42 An anti-IL-21 antibody according to any of embodiments 38 to 41 comprising a V H comprising the amino acid sequence of SEQ ID No. 10.
  • Embodiment 43 An anti-IL-21 antibody according to any of embodiments 38 to 42, which additionally comprises a V L CDR2 sequence comprising the amino acid sequence of SEQ ID No. 12.
  • Embodiment 44 An anti-IL-21 antibody according to any of embodiments 38 to 43, which additionally comprises a V L CDR1 sequence comprising the amino acid sequence of SEQ ID No. 11.
  • Embodiment 45 An anti-IL-21 antibody according to any of embodiments 38 to 44 comprising a V H comprising the amino acid sequence of SEQ ID No. 9.
  • Embodiment 46 An anti-IL-21 antibody according to any of embodiments 28 to 45, which is a monoclonal antibody.
  • Embodiment 47 An anti-IL-21 antibody according to any of embodiments 28 to 45, which is a human antibody.
  • Embodiment 48 An anti-IL-21 antibody according to embodiment 47, which is a monoclonal antibody.
  • Embodiment 49 An anti-IL-21 antibody according to any of embodiments any of embodiments 28 to 45, which is a humanized antibody.
  • Embodiment 50 An anti-IL-21 antibody according to embodiment 49, which is a monoclonal antibody.
  • Embodiment 51 An anti-IL-21 antibody according to any of embodiments any of embodiments 28 to 45, which is a chimeric antibody.
  • Embodiment 52 An anti-IL-21 antibody according to embodiment 51 , which is a monoclonal antibody.
  • Embodiment 53 An anti-IL-21 antibody according to any of embodiments any of embodiments 28 to 52, wherein the antibody is an IgGI antibody.
  • Embodiment 54 An anti-IL-21 antibody according to embodiment 53, wherein the antibody is a IgGI , K antibody.
  • Embodiment 55 An anti-IL-21 antibody according to any of embodiments 28 to 52, wherein the antibody is an IgM antibody.
  • Embodiment 56 An anti-IL-21 antibody according to embodiment 55, wherein the antibody is a IgM 1 K antibody.
  • Embodiment 57 An anti-IL-21 antibody according to any of embodiments 28 to 56, which antibody is in substantially isolated form.
  • Embodiment 58 An anti-IL-21 antibody according to any of embodiments 28 to 57, which is an antibody fragment or a single chain antibody.
  • Embodiment 59 An IL-21 binding peptide according to any of embodiments 1 to 27, which IL-21 binding peptide is a fusion protein between an anti-IL-21 antibody according to any of embodiments 28 to 58 and at least one nonhomologous peptide comprising an amino acid sequence, that imparts a detectable biological function and/or characteristic to the fusion protein that cannot solely be attributed to the anti-IL-21 antibody sequence.
  • Embodiment 60 A nucleic acid encoding an IL-21 binding peptide according to any of embodiments 1 to 59.
  • Embodiment 61 A hybridoma which produces a human monoclonal anti-IL-21 antibody encoded by human heavy chain and human light chain nucleic acids comprising a nucleotide sequence in their variable heavy chain region as set forth in SEQ ID No. 18, or conservative sequence modifications thereof, and comprising a nucleotide sequence in their variable light chain region as set forth in SEQ ID No. 17, or conservative sequence modifications thereof.
  • Embodiment 62 A hybridoma which produces a human monoclonal anti-IL-21 antibody having human heavy chain and light chain variable regions which comprise a human heavy chain variable amino acid sequence as set forth in SEQ ID No. 2, or conservative sequence modifications thereof, and the human light chain variable amino sequence as set forth in SEQ ID No. 1 , or conservative sequence modifications thereof.
  • Embodiment 63 A transfectoma which produces a human monoclonal anti-IL-21 antibody encoded by human heavy chain variable nucleic acids as set forth in SEQ ID No. 18, and human light chain nucleic acids as set forth SEQ ID No. 17, or conservative sequence modifications thereof.
  • Embodiment 64 A transfectoma which produces a human monoclonal anti-IL-21 antibody having human heavy chain and light chain variable regions which comprise the human heavy chain variable amino acid sequence as set forth in SEQ ID No. 2, or conservative sequence modifications thereof, and the human light chain variable amino sequence as set forth in SEQ ID No. 1 , or conservative sequence modifications thereof.
  • Embodiment 65 A hybridoma which produces a human monoclonal anti-IL-21 antibody encoded by human heavy chain and human light chain nucleic acids comprising a nucleotide sequence in their variable heavy chain region as set forth in SEQ ID No. 20, or conservative sequence modifications thereof, and comprising a nucleotide sequence in their variable light chain region as set forth in SEQ ID No. 19, or conservative sequence modifications thereof.
  • Embodiment 66 A hybridoma which produces a human monoclonal anti-IL-21 antibody having human heavy chain and light chain variable regions which comprise a human heavy chain variable amino acid sequence as set forth in SEQ ID No. 10, or conservative sequence modifications thereof, and the human light chain variable amino sequence as set forth in SEQ ID No. 9, or conservative sequence modifications thereof.
  • Embodiment 67 A transfectoma which produces a human monoclonal anti-IL-21 antibody encoded by human heavy chain variable nucleic acids as set forth in SEQ ID No. 20, and human light chain nucleic acids as set forth SEQ ID No. 19, or conservative sequence modifications thereof.
  • Embodiment 68 A transfectoma which produces a human monoclonal anti-IL-21 antibody having human heavy chain and light chain variable regions which comprise the human heavy chain variable amino acid sequence as set forth in SEQ ID No. 10, or conservative sequence modifications thereof, and the human light chain variable amino sequence as set forth in SEQ ID No. 9, or conservative sequence modifications thereof.
  • Embodiment 69 An isolated or recombinant eukaryotic or prokaryotic host cell which produces an IL-21 binding protein according to any of embodiments 1 to 59.
  • Embodiment 70 An IL-21 binding peptide according to any of embodiments 1 to 59, further comprising a chelator linker for attaching a radioisotope.
  • Embodiment 71 An immunoconjugate comprising anti-IL-21 antibody according to any of embodiments 28 to 58 linked to a cytotoxic agent, a radioisotope, or a drug.
  • Embodiment 72 An immunoconjugate comprising an anti-IL-21 antibody according to embodiment 55 or embodiment 56, wherein the anti-IL-21 antibody is a monomeric IgM antibody linked to a cytotoxic agent, a radioisotope, or a drug.
  • Embodiment 73 A bispecific molecule comprising an IL-21 binding peptide according to any of embodiments 1 to 59 and a peptide capable of binding to IL-2, IL-4, IL, IL-9, or lL-15.
  • Embodiment 74 An expression vector comprising a nucleic acid according to embodiment 60.
  • Embodiment 75 An expression vector comprising the nucleotide sequence of SEQ ID No. 18, or conservative modifications thereof, and/or the nucleotide sequence of SEQ ID No. 17, or conservative modifications thereof.
  • Embodiment 76 An expression vector comprising the nucleotide sequence of SEQ ID No. 20, or conservative modifications thereof, and/or the nucleotide sequence of SEQ ID No. 19, or conservative modifications thereof.
  • Embodiment 77 A eukaryotic or prokaryotic host cell comprising an expression vector according to any of embodiments 74 to 76.
  • Embodiment 78 A pharmaceutical composition comprising an IL-21 binding peptide according to any of embodiments 1 to 59 and a pharmaceutically acceptable carrier.
  • Embodiment 79 A pharmaceutical composition according to embodiment 78 comprising one or more further therapeutic agents.
  • Embodiment 80 A pharmaceutical composition comprising an expression vector according to any of embodiments 74 to 76 and a pharmaceutically acceptable carrier.
  • Embodiment 81 An IL-21 binding peptide according to any one of embodiments 1 to 59 for use in therapy.
  • Embodiment 82 An immunoconjugate according to embodiment 71 or embodiment
  • Embodiment 83 A bispecific molecule according to embodiment 73 for use in therapy.
  • Embodiment 84 An expression vector according to any of embodiments 74 to 76 for use in therapy.
  • Embodiment 85 Use of an IL-21 binding peptide according to any one of embodiments 1 to 59 or a pharmaceutical composition according to any of embodiments 78 to 80, for use in treating a disease or disorder, wherein said disease or disorder may be treatable by use of an IL-21 antagonist.
  • Embodiment 86 Use of an IL-21 binding peptide according to any one of embodiments 1 to 59 for preparation of a pharmaceutical composition for treating a disease or disorder, wherein said disease or disorder may be treatable by use of an IL-21 antagonist.
  • Embodiment 87 Use of an immunoconjugate according to embodiment 71 or embodiment 72, a bispecific molecule according to embodiment 73, or an expression vector according to any of embodiments 74 to 76 for preparation of a pharmaceutical composition for treating a disease or disorder, wherein said disease or disorder may be treatable by use of an IL-21 antagonist.
  • Embodiment 88 Use according to any of embodiments 85 to 87, wherein said disease or disorder is an autoimmune and/or inflammatory disease.
  • Embodiment 89 Use according to embodiment 88, wherein said disease or disorder is systemic lupus erythematosus, rheumatoid arthritis or inflammatory bowel disease.
  • Embodiment 90 A method of treating a disease or disorder, wherein said disease or disorder may be treatable by use of an IL-21 antagonist., comprising administering to a subject an IL-21 binding peptide according to any of embodiments 1 to 59, a pharmaceutical composition according to any of embodiments 78 to 80, an immunoconjugate according to embodiment 71 or embodiment 72, a bispecific molecule according to embodiment 73, or an expression vector according to any of embodiments 74 to 76 in an amount effective to treat or prevent the disease.
  • Embodiment 91 A method according to embodiment 90, wherein the disease or disorder is an autoimmune and/or inflammatory disease.
  • Embodiment 92 A method according to embodiment 90, wherein the disease or disorder is systemic lupus erythematosus, rheumatoid arthritis or inflammatory bowel disease.
  • Embodiment 93 An in vitro method for detecting the presence of IL-21 antigen in a sample, which method comprises a) contacting the sample with an IL-21 binding peptide according to any of embodiments 1 to 59 under conditions that allow for formation of a complex between the IL-21 binding peptide and IL-21 ; and b) detecting the formation of a complex.
  • Embodiment 94 A kit for detecting the presence of IL-21 antigen in a sample comprising an IL-21 binding peptide according to any of embodiments 1 to 59.
  • Embodiment 95 An in vivo method for detecting IL-21 antigen in an subject comprising a) administering an IL-21 binding peptide according to any of embodiments 1 to 59 under conditions that allow for formation of a complex between the IL-21 binding peptide and IL-21 ; and b) detecting the formed complex.
  • Embodiment 96 An anti-idiotypic antibody binding to an antibody according to any of embodiments 28 to 58.
  • Embodiment 97 Use of an anti-idiotypic antibody according to embodiment 96 for detecting the level of human monoclonal antibody against IL-21 in a sample.
  • mice were screened by ELISA for I L-21 -specific antibodies. Mice with positive titers were boosted with 10 ⁇ g of human I L-21 by intravenous injection, and sacrificed after three days. The spleen was removed aseptically and dispersed to a single cell suspension. Fusion of spleen cells and mouse myeloma cells FOX-NY was done by PEG method. Cells were seeded in microtiter plates and cultured at 37 0 C, 5% CO 2 . The tissue-culture medium containing HAT/HT for selection was changed three times over a two week's period.
  • the forward primer for both heavy and light chain was universal primer mix (UPM) that was included in the SMART RACE kit.
  • the reverse primer sequence for heavy chain (HC) was designed as follows: 5'- GTCTACCACAACACACGTGAC and for light chain (LC) ⁇ '-GCTCTAGACTAACACTCATTCCTGTTGAAGCTC.
  • the PCR reactions were carried out using Phusion mastermix from Finnzymes and the PCR program was run with a single denaturing step at 98°C/30 sec followed by 29 cycles as given: 98°C/10 sec; 55°C/20 sec; 72°C/30 sec. The final extension step was 72°C/5 min.
  • the PCR products were identified on a 1 % agarose gel containing ethidiumbromide.
  • the PCR products were purified from the gel using GFX Purification kit from GE Healthcare followed by cloning into Zero Blunt TOPO PCR Cloning Kit (#K2875-40) and transformed into TOP10 E. coli cells from Invitrogen.
  • Plasmids were sequenced at MWG Biotech, Matinsried, Germany using the sequencing primers M13 rev (-29) and M13 uni (-21 ). HC and LC were verified from the identified sequences by using VectorNTI. All procedures based on kits were performed according to manufactures directions.
  • hybridoma F1 A2B2C1 (and F1 A2B2C6) is called 1 F1 and the antibody expressed by hybridoma F22 A6B6C3 is called 1 F22.
  • 1 F1 and 1 F22 were immobilized by standard amine coupling to a CM5 sensor chip (GE Healthcare).
  • the antibodies were immobilized in individual flow-cells to a level of 500 RU.
  • the hlL-21 was injected in all flow-cells followed by injection of either 1 F1 or 1 F22. The experiment demonstrated that the antibodies are not able to bind simultaneously to hlL-21.
  • BAF-3 cells are murine hematopoetic pre-B cells dependent of exogeneous addition of IL-3 for growth and survival in vitro.
  • the cells also express the common yC receptor which is one of the monomers constituting the heterodimeric IL-21 receptor.
  • Human IL-21 R ⁇ transfected BAF-3 cells BAF-3(hlL21 R) express the IL-21 heterodimeric receptor and proliferate in the absence of IL-3, when human IL-21 is added to the culture. . This fact can be used to assess proliferation of these cells upon stimulation with different concentrations of IL-21 and can also be used to test whether antibodies against IL-21 or other potential IL-21 antagonists are capable of inhibiting hlL-21 induced stimulation of IL-21 R-expressing cells, such as the IL-21 R ⁇ transfected BAF-3 cells.
  • IL-21 receptor is for instance a human IL-2 dependent cell line NK92 from ATCC (CRL-2407), which can be used as target cells in the same proliferation assay (stimulation as well as inhibition). These cells express the IL-21 R complex endogenously.
  • BAF-3(hlL-21 R) cells are kept in culture in RPMI 1640 with Glutamax, 10% heat inactivated FBS, 1% P/S, 1 mg/ml Geneticin, 200 ⁇ g/ml Zeocin and 1 nM IL-3 and should never exceed 10 6 c/ml. Fresh media is added to the culture three times a week and cells split accordingly.
  • BAF-3(hlL21 R) cells were washed thoroughly in Assay medium (RPMI 1640 with Glutamax, 10% heat inactivated FBS, 1% P/S, 1 mg/ml Geneticin, 200 ⁇ g/ml Zeocin) to get rid of residual IL-3.
  • the cells were then seeded into 96-well microtiter plates (flat-bottom view plate) at 10 4 - 5x10 4 c/w.
  • Serial dilutions of hlL-21 (10 8 M to 10 14 M) were added to the wells and additional wells with cells but no hlL-21 served as negative control. Total volume of the wells was 100 ⁇ l.
  • the cells were cultured for three days in 5% CO 2 at 37°C.
  • Inhibition assay to define neutralizing activity of the antibodies.
  • a constant concentration of hlL-21 was used to stimulate the BAF-3(hlL-21 R) cells. This concentration was chosen on basis of approximately 90% of max stimulation in the proliferation assay which for the purpose of this specification means 10 9 M hlL-21.
  • Inhibition assay to define neutralizing activity of the antibodies 10 4 - 5x10 4 c/w of washed BAF-3(hlL-21 R) cells were seeded into 96-well microtiter wells in assay medium. 10 '9 M (final concentration) of hlL-21 was added to each well (except some wells used as negative control containing only cells). Serial dilutions of antibody (i.e.100 ⁇ g and 2-fold dilutions) were added to the wells already containing cells and cytokine (except wells used for positive controls which should contain only cells + hlL-21). The mixture of cells, cytokine and antibody were incubated in 100 ⁇ l/w for 72 hours in 5% CO 2 at 37°C.

Abstract

Isolated human monoclonal antibodies and other proteins, which bind to human IL-21, and related antibody-based compositions and molecules, are disclosed. Also disclosed are pharmaceutical compositions comprising the human antibodies, and therapeutic and diagnostic methods for using the human antibodies, proteins, and other molecules.

Description

IL-21 ANTIBODIES
FIELD OF THE INVENTION
The field of the invention is generation of anti-IL-21 antibodies for use in treatment of inflammatory diseases, such as human autoimmune diseases, such as rheumatoid arthritis, systemic sclerosis and inflammatory bowel disease, and other immunologically related diseases, such as graft transplant rejection.
BACKGROUND OF THE INVENTION lnterleukin 21 (IL-21) is a 4-helical bundle cytokine produced by activated T cells and belonging to the family of cytokines signalling through the common γ-chain receptor in a complex with a private IL-21 R chain (Parrish-Novak et al., Nature 408, 57-63 (2000)).
IL-21 and/or IL-21 R has been shown to be upregulated in several human autoimmune diseases, for instance rheumatoid arthritis, systemic sclerosis and inflammatory bowel disease. In addition, IL-21 -antagonism has been shown to be beneficial in animal models for rheumatoid arthritis, systemic lupus erythematosus and inflammatory bowel disease (see for instance Young et al., Arthritis & Rheumatism 56, 1152-1163 (2007), Herber et al., J. Immunol. 178, 3822-3830 (2007), and Fina et al., Gastroenterology 134, 1038-1048 (2008)). Recently has IL-21 been shown to be important for induction of the subset of autoreactive T cells known as TH17-cells. This subset of T cells is also potent producers of IL-21 suggesting an autocrine loop of enhancing auto-aggression in inflammatory diseases (Korn T., Nature 448, 484-487 (2007), Nurieva R., Nature 448, 480-483 (2007) and Zhou L., Nat. Immunol. 8(9), 967-974 (2007)). It is suggested that antibodies specific for IL-21 can be used for treatment of such conditions. IL21 antagonism has also been implicated in graft rejection (Baan CC, Transplantation 83(11 ), 1485-1492 (2007).
WO2006057027 concerns antigenic epitopes of IL-21 and antibodies binding thereto. WO20071 11714 concerns anti-IL21 antibodies directed against specific epitopes
SUMMARY OF THE INVENTION
There are many aspects and features of the invention described herein. As such, this Summary of the Invention provides only a non-limiting description of certain advantageous aspects of the invention. In one aspect, this invention provides antibodies specific for IL-21 having an amino acid sequence comprising one or more of the CDR regions of an anti-IL-21 antibody having an amino acid sequence for VL as presented in SEQ ID No. 1 and an amino acid sequence for VH as presented in SEQ ID No. 2 or of an anti-IL-21 antibody having an amino acid sequence for VL as presented in SEQ ID No. 9 and an amino acid sequence for VH as presented in SEQ ID No. 10 as well as anti-IL-21 antibodies and other IL-21 binding proteins competing with such antibodies for binding to IL-21.
In one aspect, this invention provides nucleic acids encoding such peptides, expression vectors comprising such nucleic acid as well as host cells expressing them.
In one aspect, this invention provides methods of treating diseases and disorders, wherein said disease or disorder may be treatable by use of an IL-21 antagonist, such as autoimmune and/or inflammatory disease, such as systemic lupus erythematosus, rheumatoid arthritis or inflammatory bowel disease, using, either alone or in combination with other agents, the IL-21 binding peptides of the invention.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1. Binding analysis of NL-21-1 F1 and N-L21-1 F22 in a direct ELISA as described in Example 1.
Figure 2: BAF-3(hlL21 R) cells were stimulated with serial dilutions of two different preparations of hlL-21. As controls, BAF-3(hlL-21 R) cells were left unstimulated or stimulated with an irrelevant cytokine. From the generated curves the IC50 and maximal induced proliferative response was calculated (by GraphPad Prism software). Further information in Example 3.
Figure 3: BAF-3(hlL21 R) cells were initially stimulated with 10"9M hlL-21 and added serial dilutions of two different rabbit anti hlL-21 polyclonal antibodies. As negative control is shown cells with no stimulation by hlL-21. Further information in Example 3.
BRIEF DESCRIPTION OF SEQUENCE LISTING SEQ ID No. 1 is the amino acid sequence of VL of the antibody 1 F1.
SEQ ID No. 2 is the amino acid sequence of VH of the antibody 1 F1.
SEQ ID No. 3 is the amino acid sequence of VL-CDR1 of the antibody 1 F1.
SEQ ID No. 4 is the amino acid sequence of VL-CDR2 of the antibody 1 F1.
SEQ ID No. 5 is the amino acid sequence of VL-CDR3 of the antibody 1 F1. SEQ ID No. 6 is the amino acid sequence of VH-CDR1 of the antibody 1 F1.
SEQ ID No. 7 is the amino acid sequence of VH-CDR2 of the antibody 1 F1.
SEQ ID No. 8 is the amino acid sequence of VH-CDR3 of the antibody 1 F1.
SEQ ID No. 9 is the amino acid sequence of VL of the antibody 1 F22. SEQ ID No. 10 is the amino acid sequence of VH of the antibody 1 F22.
SEQ ID No. 11 is the amino acid sequence of VL-CDR1 of the antibody 1 F22.
SEQ ID No. 12 is the amino acid sequence of VL-CDR2 of the antibody 1 F22.
SEQ ID No. 13 is the amino acid sequence of VL-CDR3 of the antibody 1 F22. SEQ ID No. 14 is the amino acid sequence of VH-CDR1 of the antibody 1 F22.
SEQ ID No. 15 is the amino acid sequence of VH-CDR2 of the antibody 1 F22.
SEQ ID No. 16 is the amino acid sequence of VH-CDR3 of the antibody 1 F22.
SEQ ID No. 17 is the nucleic acid sequence encoding the VL of the antibody 1 F1.
SEQ ID No. 18 is the nucleic acid sequence encoding the VH of the antibody 1 F1. SEQ ID No. 19 is the nucleic acid sequence encoding the VL of the antibody 1 F22.
SEQ ID No. 20 is the nucleic acid sequence encoding the VH of the antibody 1 F22.
SEQ ID No. 21 is the amino acid sequence of human IL-21.
SEQ ID No. 22 is the amino acid sequence of CH for murine lgG2a.
SEQ ID No. 23 is the amino acid sequence of CH for murine IgGL SEQ ID No. 24 is the amino acid sequence of CL for the murine IgGI and lgG2a.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides IL-21 binding peptides ("IL-21 BPs"), which may be useful in the treatment, diagnosis and prevention of a variety of disorders, in which IL-21 antagonism is considered a potentially viable treatment. The terms "IL-21" and "IL-21 antigen" or "antigen IL-21" are used interchangeably herein, and is intended to describe an IL-21 polypeptide having an amino acid sequence as shown in SEQ ID No. 21.
In one embodiment, the present invention provides an IL-21 binding peptide, which is capable of antagonizing the action of IL-21 on the human IL-21 receptor. In one embodiment, such IL-21 binding peptide is capable of decreasing the activity of IL-21 on the human IL-21 receptor by at least 25%, such as at least 50%, for instance at least 75%, such as at least 90% In one embodiment, the antagonism of said IL-21 binding peptide is determined by use of an assay as described in Example 3.
The IL-21 BPs according to the present invention competes with an anti-IL21 antibody having a) a VL domain having the amino acid sequence of SEQ ID No. 1 and a VH domain having the amino acid sequence of SEQ ID No. 2 and/or b) an anti-IL21 antibody having a VL domain having the amino acid sequence of SEQ ID No. 9 and a VH domain having the amino acid sequence of SEQ ID No. 10 for binding to IL-21. The anti-IL21 antibody 1 F1 is a murine lgG2a antibody having a VL domain having the amino acid sequence of SEQ ID No. 1 and a VH domain having the amino acid sequence of SEQ ID No. 2. The CH region of murine lgG2a is presented in SEQ ID No. 22. The anti-IL21 antibody 1 F22 is a murine IgGI antibody having a VL domain having the amino acid sequence of SEQ ID No. 9 and a VH domain having the amino acid sequence of SEQ ID No. 10. The CH region of murine IgGI is presented in SEQ ID No. 23. The CL region of the two antibodies are identical and shown as SEQ ID No. 24. The generation of the anti-IL21 antibodies 1 F1 and 1 F22 are described in the examples.
Antibodies interact with target antigens primarily through amino acid residues that are located in the six heavy and light chain complementarity determining regions (CDRs). For this reason, the amino acid sequences within CDRs are more diverse between individual antibodies than sequences outside of CDRs. Because CDR sequences are responsible for most antibody-antigen interactions, it is possible to express recombinant antibodies that mimic the properties of specific naturally occurring antibodies by constructing expression vectors that include CDR sequences from the specific naturally occurring antibody grafted onto framework sequences from a different antibody with different properties (see for instance Riechmann, L. et al., Nature 332, 323-327 (1998), Jones, P. et al., Nature 321, 522-525 (1986) and Queen, C. et al., PNAS USA 86, 10029-10033 (1989)).
Since it is well known in the art that antibody heavy and light chain CDR3 domains play a particularly important role in the binding specificity/affinity of an antibody for an antigen (Barbas et al. J. Am. Chem. Soc. V\6, 2161-2162 (1994); Barbas et al. PNAS USA 92, 2529- 2533 (1995), Ditzel et al., J. of Immunol. 157, 739-749 (1996) and Park et al., Nature
Biotech. 18, 194-198 (2000)), the recombinant antibodies of the present invention prepared as set forth above may comprise the heavy and light chain CDR3s of 1 F1 and 1 F22. Antibodies of the present invention may further comprise the CDR2s of 1 F1 and 1 F22, and the antibodies of the present invention may further comprise the CDR1 s of 1 F1 and 1 F22.
For sake of convenience, a number of terms used in the description of this invention are provided here (others are provded in other portions of the specification). Unless otherwise stated or clearly indicated by context, such terms described in the plural are intended to encompass the singular and vice versa. The term "peptide" with respect to both I L-21 -binding peptides and non-IL-21 peptides described herein includes any suitable peptide and may be used synonymously with the terms polypeptide and protein, unless otherwise stated or contradicted by context; provided that the reader recognize that each type of respective amino acid polymer- containing molecules may be associated with significant differences and thereby form individual embodiments of the present invention (for example, a peptide such as an antibody, which is composed of multiple polypeptide chains, is significantly different from, for example, a single chain antibody, a peptide immunoadhesin, or single chain immunogenic peptide). Therefore, the term peptide herein should generally be understood as referring to any suitable peptide of any suitable size and composition (with respect to the number of amino acids and number of associated chains in a protein molecule). Moreover, peptides in the context of the inventive methods and compositions described herein may comprise non- naturally occurring and/or non-L amino acid residues, unless otherwise stated or contradicted by context.
As will be discussed further herein, unless otherwise stated or contradicted by context, the term peptide (and if discussed as individual embodiments of the term(s) polypeptide and/or protein) also encompasses derivatized peptide molecules. Briefly, in the context of the present invention, a derivative is a peptide in which one or more of the amino acid residues of the peptide have been chemically modified (for instance by alkylation, acylation, ester formation, or amide formation) and/or associated with one or more non- amino acid organic and/or inorganic atomic or molecular substituents (for instance a polyethylene glycol (PEG) group, a lipophilic substituent (which optionally may be linked to the amino acid sequence of the peptide by a spacer residue or group such as β-alanine, γ-aminobutyric acid (GABA), L/D-glutamic acid, succinic acid, and the like), a fluorophore, biotin, a radionuclide, etc.); a peptide may also or alternatively comprise non-essential, non- naturally occurring, and/or non-L amino acid residues, unless otherwise stated or contradicted by context. It should be recognized that derivatives may, in and of themselves, be considered independent features of the present invention and inclusion of such molecules within the meaning of peptide is done for the sake of convenience in describing the present invention rather than to imply any sort of equivalence between "naked" (underivatized) peptides and derivatives. Non-limiting examples of unusual amino acid residues that can be incorporated into a peptide include, for instance, 2-aminoadipic acid, 3-aminoadipic acid, β-alanine, β-aminopropionic acid, 2-aminobutyric acid, 4-aminobutyric acid, 6-aminocaproic acid, 2-aminoheptanoic acid, 2-aminoisobutyric acid, 3-aminoisobutyric acid, 2-aminopimelic acid, 2,4-diaminobutyric acid, desmosine, 2,2'-diaminopimelic acid, 2,3-diaminopropionic acid, N-ethylglycine, N-ethylasparagine, hydroxylysine, allohydroxylysine, 3-hydroxyproline, 4-hydroxyproline, isodesmosine, alloisoleucine, N-methylglycine, N-methylisoleucine, 6-N-methyllysine, N-methylvaline, norvaline, norleucine, ornithine, and statine halogenated amino acids.
"Antigen binding peptides" refers to any peptide that specifically binds to a portion of a given antigen under cellular and/or physiological conditions for an amount of time sufficient to induce, promote, enhance, and/or otherwise modulate a physiological effect associated with the antigen; to allow detection by ELISA, Western blot, or other similarly suitable protein binding technique described herein and/or known in the art; and/or to otherwise be detectably bound thereto after a relevant period of time (for instance at least about 15 minutes, at least about 30 minutes, at least about 45 minutes, at least about 1 hour, at least about 2 hours, at least about 4 hours, at least about 6 hours, at least about 12 hours, about 1-24 hours, about 1 -36 hours, about 1 -48 hours, about 1-72 hours, about one week, or longer).
A "IL-21 binding peptide", or "IL-21 BP", is an antigen binding peptide that specifically binds to the antigen IL-21.
The term "immunoglobulin" refers to a molecule belonging to a class of structurally related glycoproteins consisting of two pairs of polypeptide chains, one pair of light (L) low molecular weight chains and one pair of heavy (H) chains, all four inter-connected by disulfide bonds. The structure of immunoglobulins has been well characterized. See for instance Fundamental Immunology Ch. 7 (Paul, W., ed., 2nd ed. Raven Press, N. Y. (1989)). Briefly, each heavy chain typically is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. The heavy chain constant region typically is comprised of three domains, CH1 , CH2, and CH3. Each light chain typically is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The light chain constant region typically is comprised of one domain, CL. The VH and VL regions may be further subdivided into regions of hypervariability (or hypervariable regions which may be hypervariable in sequence and/or form of structurally defined loops), also termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs). Each VH and VL is typically composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1 , CDR1 , FR2, CDR2, FR3, CDR3, FR4 (see also Chothia and Lesk J. MoI. Biol. 196, 901-917 (1987)). Typically, the numbering of amino acid residues in this region is performed by the method described in Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. (1991 ) (phrases such as variable domain residue numbering "as in Kabat" or "according to Kabat" herein refer to this numbering system for heavy chain variable domains or light chain variable domains). Using this numbering system, the actual linear amino acid sequence of a peptide may contain fewer or additional amino acids corresponding to a shortening of, or insertion into, a FR or CDR of the variable domain. For example, a heavy chain variable domain may include a single amino acid insert (residue 52a according to Kabat) after residue 52 of VH CDR2 and inserted residues (for instance residues 82a, 82b, and 82c, etc. according to Kabat) after heavy chain FR residue 82. The Kabat numbering of residues may be determined for a given antibody by alignment at regions of homology of the sequence of the antibody with a "standard" Kabat numbered sequence.
The term "antibody" (abbreviated "Ab") in the context of the present invention refers to an immunoglobulin molecule, a fragment of an immunoglobulin molecule, or a derivative of either thereof, which has the ability to specifically bind to an antigen under typical physiological conditions for significant periods of time such as at least about 30 minutes, at least about 45 minutes, at least about one hour, at least about two hours, at least about four hours, at least about 8 hours, at least about 12 hours, about 24 hours or more, about 48 hours or more, about 3, 4, 5, 6, 7 or more days, etc., or any other relevant functionally- defined period (such as a time sufficient to induce, promote, enhance, and/or modulate a physiological response associated with antibody binding to the antigen). The variable regions of the heavy and light chains of the immunoglobulin molecule contain a binding domain that interacts with an antigen. The constant regions of the antibodies (Abs) may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (such as effector cells) and the first component (CIq) of the classical complement system. An anti-IL-21 antibody may be a bispecific antibody, diabody, or similar molecule
(see for instance PNAS USA 90(14), 6444-8 (1993) for a description of diabodies). Indeed, bispecific antibodies, diabodies, and the like, provided by the present invention may bind any suitable target in addition to a portion of IL-21.
As indicated above, the term antibody herein, unless otherwise stated or clearly contradicted by context, includes fragments of any suitable full lenght antibody, which fragment retains the ability to specifically bind to an antigen. It has been shown that the antigen-binding function of an antibody may be performed by fragments of a full-length antibody. Examples of binding fragments encompassed within the term "antibody" include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CH1 domains; (ii) F(ab)2 and F(ab')2 fragments, bivalent fragments comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting or consisting essentially of the VH and CH1 domains; (iv) a Fv fragment consisting or consisting essentially of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al., Nature 341 , 544-546 (1989)), which consists or consists essentially of a VH domain; and (vi) an isolated complementarity determining region (CDR). Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they may be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain antibodies or single chain Fv (scFv), see for instance Bird et al., Science 242, 423-426 (1988) and Huston et al., PNAS USA 85, 5879-5883 (1988)). Such single chain antibodies are also encompassed within the term antibody unless otherwise noted or clearly indicated by context. As already noted, other forms of single chain antibodies, such as diabodies are included within the term antibody. Although such fragments are generally included within the meaning of antibody, they collectively and each independently are unique features of the present invention, exhibiting different biological properties and utility. These and other useful antibody fragments in the context of the present invention are discussed further herein.
It also should be understood that the term antibody also generally includes antibodies that can be classified by various other structural properties, such as polyclonal antibodies, monoclonal antibodies (mAbs), antibody-like polypeptides, such as chimeric antibodies and humanized antibodies, anti-idiotypic (anti-Id) antibodies to antibodies, and antibody fragments retaining the ability to specifically bind to the antigen (antigen-binding fragments) provided by any known technique, such as enzymatic cleavage, peptide synthesis, and recombinant techniques. Unless otherwise stated or clearly contradicted by context, an antibody in the context of the invention can possess any isotype. An "anti-IL-21 antibody" is an antibody as described above, which binds specifically to the antigen IL-21.
The term "epitope" means a protein determinant capable of specific binding to an antibody. Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics. Conformational and nonconformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents. The epitope may comprise amino acid residues directly involved in the binding (also called immunodominant component of the epitope) and other amino acid residues, which are not directly involved in the binding, such as amino acid residues which are effectively blocked by the specifically antigen binding peptide (in other words, the amino acid residue is within the footprint of the specifically antigen binding peptide).
The term "bispecific molecule" is intended to include any agent, such as a protein, peptide, or protein or peptide complex, which has two different binding specificities. For example, the molecule may bind to, or interact with, (a) a cell surface antigen and (b) an Fc receptor on the surface of an effector cell. The term "multispecific molecule" is intended to include any agent, for instance a protein, peptide, or protein or peptide complex, which has more than two different binding specificities. For example, the molecule may bind to, or interact with, (a) a cell surface antigen, (b) an Fc receptor on the surface of an effector cell, and (c) at least one other component. Accordingly, the present invention includes, but is not limited to, bispecific, trispecific, tetraspecific, and other multispecific molecules which are directed to IL-21 , and to other cell surface antigens or targets, such as Fc receptors on effector cells.
The term "bispecific antibodies" is intended to include any anti-IL-21 antibody, which is a bispecific molecule. The term "bispecific antibodies" also includes diabodies. Diabodies are bivalent, bispecific antibodies in which the VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow for pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain and creating two antigen binding sites (see for instance Holliger, P. et al., PNAS USA 90, 6444-6448 (1993), Poljak, R.J. et al., Structure 2, 1121-1123 (1994)). As used herein, the term "effector cell" refers to an immune cell which is involved in the effector phase of an immune response, as opposed to the cognitive and activation phases of an immune response. Exemplary immune cells include cells of a myeloid or lymphoid origin, for instance lymphocytes (such as B cells and T cells including cytolytic T cells (CTLs)), killer cells, natural killer cells, macrophages, monocytes, eosinophils, neutronphils, polymorphonuclear cells, granulocytes, mast cells, and basophils. Some effector cells express specific Fc receptors (FcR) and carry out specific immune functions. In some embodiments, an effector cell is capable of inducing antibody-dependent cellular cytotoxicity (ADCC), such as a neutrophil capable of inducing ADCC. For example, monocytes, macrophages, which express FcR are involved in specific killing of target cells and presenting antigens to other components of the immune system, or binding to cells that present antigens. In some embodiments, an effector cell may phagocytose a target antigen, target cell, or microorganism. The expression of a particular FcR on an effector cell may be regulated by humoral factors such as cytokines. For example, expression of FcγRI has been found to be up-regulated by interferon Y (IFN-γ) and/or G-CSF. This enhanced expression increases the cytotoxic activity of FcγRI-bearing cells against targets. An effector cell can phagocytose or lyse a target antigen or a target cell.
The term "human antibody", as used herein, is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. The human antibodies of the present invention may include amino acid residues not encoded by human germline immunoglobulin sequences (for instance mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo). However, the term "human antibody", as used herein, is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences.
As used herein, a human antibody is "derived from" a particular germline sequence if the antibody is obtained from a system using human immunoglobulin sequences, for instance by immunizing a transgenic mouse carrying human immunoglobulin genes or by screening a human immunoglobulin gene library, and wherein the selected human antibody is at least 90%, such as at least 95%, for instance at least 96%, such as at least 97%, for instance at least 98%, or such as at least 99% identical in amino acid sequence to the amino acid sequence encoded by the germline immunoglobulin gene. Typically, a human antibody derived from a particular human germline sequence will display no more than 10 amino acid differences, such as no more than 5, for instance no more than 4, 3, 2, or 1 amino acid difference from the amino acid sequence encoded by the germline immunoglobulin gene.
The term "chimeric antibody" refers to an antibody that contains one or more regions from one antibody and one or more regions from one or more other antibodies. The term "chimeric antibody" includes monovalent, divalent, or polyvalent antibodies. A monovalent chimeric antibody is a dimer (HL)) formed by a chimeric H chain associated through disulfide bridges with a chimeric L chain. A divalent chimeric antibody is tetramer (H2L2) formed by two HL dimers associated through at least one disulfide bridge. A polyvalent chimeric antibody may also be produced, for example, by employing a CH region that aggregates (for instance from an IgM H chain, or μ chain). Typically, a chimeric antibody refers to an antibody in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (see for instance US 4,816,567 and Morrison et al., PNAS USA 81., 6851-6855 (1984)). Chimeric antibodies are produced by recombinant processes well known in the art (see for instance Cabilly et al., PNAS USA 8_1, 3273-3277 (1984), Morrison et al., PNAS USA 8J., 6851-6855 (1984), Boulianne et al., Nature 312, 643-646 (1984), EP125023, Neuberger et al., Nature 314, 268-270 (1985), EP171496, EP173494, WO86/01533, EP184187, Sahagan et al., J. Immunol. 137, 1066-1074 (1986), WO87/02671 , Liu et al., PNAS USA 84. 3439-3443 (1987), Sun et al., PNAS USA 84, 214-218 (1987), Better et al., Science 240, 1041 -1043 (1988) and Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1988)).
A "humanized antibody" is an antibody that is derived from a non-human species, in which certain amino acids in the framework and constant domains of the heavy and light chains have been mutated so as to avoid or abrogate an immune response in humans. Humanized forms of non-human (for instance murine) antibodies are chimeric antibodies which contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and capacity. In some instances, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues which are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. In general, a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin sequence. A humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature 32J., 522-525 (1986), Riechmann et al., Nature 332. 323-329 (1988) and Presta, Curr. Op. Struct. Biol. 2, 593-596 (1992).
The terms "monoclonal antibody" or "monoclonal antibody composition" as used herein refer to a preparation of antibody molecules of single molecular composition. A monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope. Accordingly, the term "human monoclonal antibody" refers to antibodies displaying a single binding specificity which have variable and constant regions derived from human germline immunoglobulin sequences. The human monoclonal antibodies may be generated by a hybridoma which includes a B cell obtained from a transgenic or transchromosomal nonhuman animal, such as a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene, fused to an immortalized cell.
The term "recombinant human antibody", as used herein, includes all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as (a) antibodies isolated from an animal (such as a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom (described further elsewhere herein), (b) antibodies isolated from a host cell transformed to express the antibody, such as from a transfectoma, (c) antibodies isolated from a recombinant, combinatorial human antibody library, and (d) antibodies prepared, expressed, created or isolated by any other means that involve splicing of human immunoglobulin gene sequences to other DNA sequences. Such recombinant human antibodies have variable and constant regions derived from human germline immunoglobulin sequences. In certain embodiments, however, such recombinant human antibodies may be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo. As used herein, a "heterologous antibody" is defined in relation to the transgenic non-human organism producing such an antibody. This term refers to an antibody having an amino acid sequence corresponding to that found in an organism not consisting of the non- human animal, and generally from a species other than that of the transgenic non-human animal. An "isolated antibody," as used herein, is intended to refer to an antibody which is substantially free of other antibodies having different antigenic specificities (for instance an isolated antibody that specifically binds to IL-21 is substantially free of antibodies that specifically bind antigens other than IL-21). An isolated antibody that specifically binds to an epitope, isoform or variant of human IL-21 may, however, have cross-reactivity to other related antigens, for instance from other species (such as IL-21 species homologs).
Moreover, an isolated antibody may be substantially free of other cellular material and/or chemicals. In one embodiment of the present invention, a combination of "isolated" monoclonal antibodies having different specificities are combined in a well defined composition. As used herein, "specific binding" refers to the binding of an antigen binding peptide, such as an antibody, to a predetermined antigen. Typically, the antigen binding peptide, such as an antibody, binds with an affinity corresponding to a KD of about 10'7 M or less, such as about 10'8 M or less, such as about 10'9 M or less, about 10'10 M or less, or about 10'11 M or even less when determined by for instance surface plasmon resonance (SPR) technology in a BIAcore 3000 instrument using the antigen as the ligand and the antibody as the analyte, and binds to the predetermined antigen with an affinity corresponding to a KD that is at least ten-fold lower, such as at least 100 fold lower, for instance at least 1000 fold lower, such as at least 10,000 fold lower, for instance at least 100,000 fold lower than its affinity for binding to a non-specific antigen (e.g., BSA, casein) other than the predetermined antigen or a closely-related antigen. The amount with which the affinity is lower is dependent on the KD of the antigen binding peptide, so that when the K0 of the antigen binding peptide is very low (that is, the antigen binding peptide is highly specific), then the amount with which the affinity for the antigen is lower than the affinity for a non-specific antigen may be at least 10,000 fold. The phrases "an antigen binding peptide recognizing an antigen" and "an antigen binding peptide specific for an antigen" are used interchangeably herein with the term "an antigen binding peptide which binds specifically to an antigen". Likewise, the phrases "an antibody recognizing an antigen" and "an antibody specific for an antigen" are used interchangeably herein with the term "an antibody which binds specifically to an antigen"
The term "kd" (sec 1), as used herein, refers to the dissociation equilibrium rate constant of a particular antibody-antigen interaction. Said value is also referred to as the koff value.
The term "ka" (M'1 x sec'1), as used herein, refers to the association equilibrium rate constant of a particular antibody-antigen interaction.
The term " K0" (M), as used herein, refers to the dissociation equilibrium constant of a particular antibody-antigen interaction.
The term "KA" (M'1), as used herein, refers to the association equilibrium constant of a particular antibody-antigen interaction and is obtained by dividing the ka by the kd.
As used herein, "isotype" refers to the immunoglobulin class (for instance IgGI , lgG2, lgG3, lgG4, IgD, IgA, IgE, or IgM) that is encoded by heavy chain constant region genes.
As used herein, "isotype switching" refers to the phenomenon by which the class, or isotype, of an antibody changes from one immunoglobulin class to one of the other immunoglobulin classes.
As used herein, "nonswitched isotype" refers to the isotypic class of heavy chain that is produced when no isotype switching has taken place; the CH gene encoding the nonswitched isotype is typically the first CH gene immediately downstream from the functionally rearranged VDJ gene. Isotype switching has been classified as classical or non- classical isotype switching. Classical isotype switching occurs by recombination events which involve at least one switch sequence region in the transgene. Non-classical isotype switching may occur by, for example, homologous recombination between human σμ and human ∑μ (δ-associated deletion). Alternative non-classical switching mechanisms, such as intertransgene and/or interchromosomal recombination, among others, may occur and effectuate isotype switching.
As used herein, the term "switch sequence" refers to those DNA sequences responsible for switch recombination. A "switch donor" sequence, typically a μ switch region, will be 5' (i.e., upstream) of the construct region to be deleted during the switch recombination. The "switch acceptor" region will be between the construct region to be deleted and the replacement constant region (for instance Y, ε, etc.). As there is no specific site where recombination always occurs, the final gene sequence will typically not be predictable from the construct.
As used herein, "glycosylation pattern" is defined as the pattern of carbohydrate units that are covalently attached to a protein, more specifically to an immunoglobulin (antibody) protein. A glycosylation pattern of a heterologous antibody may be characterized as being substantially similar to glycosylation patterns which occur naturally on antibodies produced by the species of the non-human transgenic animal, when one of ordinary skill in the art would recognize the glycosylation pattern of the heterologous antibody as being more similar to said pattern of glycosylation in the species of the non-human transgenic animal than to the species from which the CH genes of the transgene were derived.
The term "naturally-occurring" as used herein as applied to an object refers to the fact that an object may be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that may be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally-occurring.
The term "rearranged" as used herein refers to a configuration of a heavy chain or light chain immunoglobulin locus wherein a V segment is positioned immediately adjacent to a D-J or J segment in a conformation encoding essentially a complete VH or VL domain, respectively. A rearranged immunoglobulin (antibody) gene locus may be identified by comparison to germline DNA; a rearranged locus will have at least one recombined heptamer/nonamer homology element. The term "unrearranged" or "germline configuration" as used herein in reference to a
V segment refers to the configuration wherein the V segment is not recombined so as to be immediately adjacent to a D or J segment.
The term "nucleic acid molecule", as used herein, is intended to include DNA molecules and RNA molecules. A nucleic acid molecule may be single-stranded or double- stranded, but is preferably double-stranded DNA. The nucleic acids may be present in whole cells, in a cell lysate, or in a partially purified or substantially pure form. A nucleic acid is "isolated" or "rendered substantially pure" when purified away from other cellular components or other contaminants, such as other cellular nucleic acids or proteins, by standard techniques, including alkaline/SDS treatment, CsCI banding, column chromatography, agarose gel electrophoresis and others well known in the art. See, F. Ausubel et al., ed.
Current Protocols in Molecular Biology, Greene Publishing and Wiley InterScience New York (1987).
A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence. With respect to transcription of regulatory sequences, operably linked means that the DNA sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame. For switch sequences, operably linked indicates that the sequences are capable of effecting switch recombination. As used herein, the term "inhibits growth" (for instance when referring to cells) is intended to include any measurable decrease in the cell growth when contacted with an IL-21 BP, such as an anti-IL-21 antibody, as compared to the growth of the same cells not in contact with an IL-21 BP, such as an anti-IL-21 antibody, for instance an inhibition of growth of a cell culture by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99%, or 100%.
As used herein, the terms "inhibits binding" and "blocks binding" (for instance when referring to inhibition/blocking of binding of an IL-21 binding partner to IL-21) are used interchangeably and encompass both partial and complete inhibition/blocking. The inhibition/blocking of binding of an IL-21 binding partner to IL-21 may reduce or alter the normal level or type of cell signaling that occurs when an IL-21 binding partner binds to IL-21 without inhibition or blocking. Inhibition and blocking are also intended to include any measurable decrease in the binding affinity of an IL-21 binding partner to IL-21 when in contact with an IL-21 BP, such as an anti-IL-21 antibody, as compared to the ligand not in contact with an IL-21 BP, such as an anti-IL-21 antibody, for instance a blocking of binding of an IL-21 binding partner to IL-21 by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99%, or 100%.
The term "vector," as used herein, is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments may be ligated. Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (for instance bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (such as non-episomal mammalian vectors) may be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors" (or simply, "expression vectors"). In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. In the present specification, "plasmid" and "vector" may be used interchangeably as the plasmid is the most commonly used form of vector. However, the present invention is intended to include such other forms of expression vectors, such as viral vectors (such as replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.
The term "recombinant host cell" (or simply "host cell"), as used herein, is intended to refer to a cell into which a recombinant expression vector has been introduced. It should be understood that such terms are intended to refer not only to the particular subject cell but to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term "host cell" as used herein. Recombinant host cells include, for example, transfectomas, such as CHO cells, NS/0 cells, and lymphocytic cells.
The term "regulatory sequence" is intended to include promoters, enhancers and other expression control elements (for instance polyadenylation signals) that control the transcription or translation of the antibody chain genes. Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology. Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). It will be appreciated by those skilled in the art that the design of the expression vector, including the selection of regulatory sequences may depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. Examples of regulatory sequences for mammalian host cell expression include viral elements that direct high levels of protein expression in mammalian cells, such as promoters and/or enhancers derived from cytomegalovirus (CMV), Simian Virus 40 (SV40), adenovirus, (e.g., the adenovirus major late promoter (AdMLP)) and polyoma. Alternatively, nonviral regulatory sequences may be used, such as the ubiquitin promoter or β-globin promoter. As used herein, the term "subject" includes any human or non-human animal. The term "non-human animal" includes all vertebrates, for instance mammals and non-mammals, such as non-human primates, sheep, dog, cow, chickens, amphibians, reptiles, etc.
The various forms of the term "transfection" are intended to encompass a wide variety of techniques commonly used for the introduction of exogenous DNA into a prokaryotic or eukaryotic host cell, e.g., electroporation, calcium-phosphate precipitation, DEAE-dextran transfection, lipofectin transfection and the like.
The term "transfectoma", as used herein, includes recombinant eukaryotic host cells expressing the antibody, such as CHO cells, NS/0 cells, HEK293 cells, plant cells, or fungi, including yeast cells.
The terms "transgenic, non-human animal" refers to a non-human animal having a genome comprising one or more human heavy and/or light chain transgenes or transchromosomes (either integrated or non-integrated into the animal's natural genomic DNA) and which is capable of expressing fully human antibodies. For example, a transgenic mouse can have a human light chain transgene and either a human heavy chain transgene or human heavy chain transchromosome, such that the mouse produces human anti-IL-21 antibodies when immunized with IL-21 antigen. The human heavy chain transgene may be integrated into the chromosomal DNA of the mouse, as is the case for transgenic mice, for instance HuMAb mice, such as HCo7 or HCo12 mice, or the human heavy chain transgene may be maintained extrachromosomally, as is the case for transchromosomal KM mice as described in WO02/43478. Such transgenic and transchromosomal mice (collectively referred to herein as "transgenic mice") are capable of producing multiple isotypes of human monoclonal antibodies to a given antigen (such as IgG, IgA, IgM, IgD and/or IgE) by undergoing V-D-J recombination and isotype switching. Transgenic, nonhuman animal can also be used for production of antibodies against a specific antigen by introducing genes encoding such specific antibody, for example by operatively linking the genes to a gene which is expressed in the milk of the animal.
The term "specificity" herein refers to the ability of an IL-21 binding peptide, such as an anti-IL-21 antibody, to recognize an epitope within IL-21 , while only having little or no detectable reactivity with other portions of IL-21 (including other epitopes that are bound by other IL-21 BPs, such as anti-IL-21 antibodies). Specificity may be relatively determined by competition assays as described herein. Specificity can more particularly be determined by any of the epitope identification/characterization techniques described herein or their equivalents known in the art. An antibody with specificity for a particular antigenic determinant may nonetheless cross-react with other biomolecules that may be present in some biological context with IL-21. More typically, an IL-21 BP, such as an anti-IL-21 antibody, may cross-react with IL-21 homologues from other species. In either or both contexts, typically such cross-reactive antibodies are selective for human IL-21 with respect to relevant structure and/or environmental factors.
The term "selectivity" herein refers to the preferential binding of an IL-21 BP, such as an anti-IL-21 antibody, for a particular region, target, or peptide; typically a region or epitope in IL-21 , as opposed to one or more other biological molecules, structures, cells, tissues, etc. In one embodiment, an IL-21 BP, such as an anti-IL-21 antibody, of the present invention is selective for a portion of IL-21 in the context of colon cancer cells (i.e., the anti-IL-21 antibody will selectively bind to the portion of IL-21 over other components of a colon cancer cell). The IL-21 BPs of the present invention are typically used in and provided in an at least "substantially isolated form". A "substantially isolated" molecule is a molecule that is the predominant species in the composition wherein it is found with respect to the class of molecules to which it belongs (i.e., it makes up at least about 50% of the type of molecule in the composition and typically will make up at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more of the species of molecule, e.g., peptide, in the composition (e.g., the composition will exhibit at least about 98%, 98%, or 99% homogeneity for the IL-21 BP in the context of all present peptide species)).
An isolated molecule refers to a molecule that is not associated with significant levels (such as more than about 1%, more than about 2%, more than about 3%, or more than about 5%) of any extraneous and undesirable physiological factors, such as non-IL-21 binding biomolecules (or IL-21 binding molecules that may interfere with the binding and/or activity of an IL-21 BP of the present invention) contained within a cell or animal in which the IL-21 BP is produced. An isolated molecule also refers to any molecule that has passed through such a stage of purity due to human intervention (whether automatic, manual, or both). In many of the various compositions provided by the present invention, such as in a composition comprising one or more pharmaceutically acceptable carriers, an IL-21 BP may be present in relatively small amounts in terms of numbers of total molecular species in the composition (for instance in the case of a composition comprising a large amount of a pharmaceutically acceptable carrier, stabilizer, and/or preservative). In some cases additional peptides, such as BSA, may be included in such a composition with a previously purified IL-21 BP. However, provided that such additional constituents of the composition are acceptable for the intended application of the IL-21 BP, such a composition can still be described as comprising an isolated IL-21 BP.
The IL-21 BPs of the present invention are typically "substantially free" of other IL-21 BPs, such as IL-21 BPs having different antigenic specificities. However, the present invention does also provide a composition comprising a number of IL-21 BPs with different specificities and characteristics (for instance the present invention provides a "cocktail" of IL-21 BPs having different specificity and/or selectivity characteristics).
"Treatment" means the administration of an effective amount of a therapeutically active compound of the present invention with the purpose of easing, ameliorating, or eradicating (curing) symptoms or disease states.
In one embodiment, the present invention provides an IL-21 BP comprising a VL region consisting essentially of the sequence of SEQ ID No. 1.
In one embodiment, the present invention provides an IL-21 BP comprising a VH region consisting essentially of the sequence of SEQ ID No. 2. In one embodiment, the present invention provides an IL-21 BP comprising a VL region consisting essentially of the sequence of 1 and aVH region consisting essentially of the sequence of SEQ ID No. 2.
In one embodiment, the present invention provides an IL-21 BP comprising a VL CDR1 consisting essentially of the sequence of SEQ ID No. 3. In one embodiment, the present invention provides an IL-21 BP comprising a VL
CDR2 consisting essentially of the sequence of SEQ ID No. 4.
In one embodiment, the present invention provides an IL-21 BP comprising a VL CDR3 consisting essentially of the sequence of SEQ ID No. 5.
In one embodiment, the present invention provides an IL-21 BP comprising a VH CDR1 consisting essentially of the sequence of SEQ ID No. 6.
In one embodiment, the present invention provides an IL-21 BP comprising a VH CDR2 consisting essentially of the sequence of SEQ ID No. 7.
In one embodiment, the present invention provides an IL-21 BP comprising a VH CDR3 consisting essentially of the sequence of SEQ ID No. 8. In one embodiment, the present invention provides an IL-21 BP comprising VL CDRs
(VL CDR1 , CDR2, and CDR3) consisting essentially of SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No. 5, respectively.
In one embodiment, the present invention provides an IL-21 BP that comprises VH CDRs (VH CDR1 , CDR2, and CDR3) consisting essentially of SEQ ID No. 6, SEQ ID No. 7 and SEQ ID No. 8, respectively. In one embodiment, the present invention provides an IL-21 BP that comprises
(a) three VL CDRs, which independently consist essentially of SEQ ID No. 3, SEQ
ID No. 4 and SEQ ID No. 5 in close proximity to one another (e.g., near the spacing of VL CDRS in a wild-type anti-IL-21 antibody) in the IL-21 BP and (b) three VH CDRs which independently consist essentially of SEQ ID No. 6, SEQ ID
No. 7 and SEQ ID No. 8 in close proximity to one another (e.g., near the spacing of
VH CDRS in a wild-type anti-IL-21 antibody) in the IL-21 BP.
In a further embodiment, the present invention provides an IL-21 BP that comprises a flexible linker positioned between the VL region and VH region of the IL-21 BP. In another further embodiment, the present invention provides an IL-21 BP, wherein the VL and VH regions are presented on separate chains in the context of an immunoglobulin fold protein and oriented such that the VL CDR1 , CDR2, CDR3 and VH CDR1 , CDR2, and CDR3 cooperatively associate to contribute in selectively and/or specifically bind an antigenic determinant on IL-21. In another further embodiment, the present invention provides an IL-21 BP that comprises two sets of variable domains (sets of associated VL and VH domains on associated separate chains), such that the IL-21 BP comprises two identical antigenic determinant binding sites.
Any of such IL-21 BPs are expected to, at least in part, have similar epitope specificity, selectivity, and other characteristics as an antibody having a VL region comprising the sequence of SEQ ID No. 1 and a VH region comprising the sequence of SEQ ID No. 2, and, accordingly, may be useful in the treatment of multiple myeloma.
In one embodiment, the present invention provides an IL-21 BP comprising a VL region consisting essentially of the sequence of SEQ ID No. 9.
In one embodiment, the present invention provides an IL-21 BP comprising a VH region consisting essentially of the sequence of SEQ ID No. 10.
In one embodiment, the present invention provides an IL-21 BP comprising a VL region consisting essentially of the sequence of SEQ ID No. 9 and aVH region consisting essentially of the sequence of SEQ ID No. 10.
In one embodiment, the present invention provides an IL-21 BP comprising a VL CDR1 consisting essentially of the sequence of SEQ ID No. 1 1.
In one embodiment, the present invention provides an IL-21 BP comprising a VL CDR2 consisting essentially of the sequence of SEQ ID No. 12.
In one embodiment, the present invention provides an IL-21 BP comprising a VL CDR3 consisting essentially of the sequence of SEQ ID No. 13. In one embodiment, the present invention provides an IL-21 BP comprising a VH CDR1 consisting essentially of the sequence of SEQ ID No. 14.
In one embodiment, the present invention provides an IL-21 BP comprising a VH CDR2 consisting essentially of the sequence of SEQ ID No. 15. In one embodiment, the present invention provides an IL-21 BP comprising a VH
CDR3 consisting essentially of the sequence of SEQ ID No. 16.
In one embodiment, the present invention provides an IL-21 BP comprising VL CDRs (VL CDR1 , CDR2, and CDR3) consisting essentially of SEQ ID No. 11 , SEQ ID No. 12 and SEQ ID No. 13, respectively. In one embodiment, the present invention provides an IL-21 BP that comprises VH
CDRs (VH CDR1 , CDR2, and CDR3) consisting essentially of SEQ ID No. 14, SEQ ID No. 15 and SEQ ID No. 16, respectively.
In one embodiment, the present invention provides an IL-21 BP that comprises
(a) three VL CDRs, which independently consist essentially of SEQ ID No. 1 1 , SEQ ID No. 12 and SEQ ID No. 13 in close proximity to one another (e.g., near the spacing of VL CDRs in a wild-type anti-IL-21 antibody) in the IL-21 BP and
(b) three VH CDRs which independently consist essentially of SEQ ID No. 14, SEQ ID No. 15 and SEQ ID No. 16 in close proximity to one another (e.g., near the spacing of VH CDRs in a wild-type anti-IL-21 antibody) in the IL-21 BP. In a further embodiment, the present invention provides an IL-21 BP that comprises a flexible linker positioned between the VL region and VH region of the IL-21 BP. In another further embodiment, the present invention provides an IL-21 BP, wherein the VL and VH regions are presented on separate chains in the context of an immunoglobulin fold protein and oriented such that the VL CDR1 , CDR2, CDR3 and VH CDR1 , CDR2, and CDR3 cooperatively associate to contribute in selectively and/or specifically bind an antigenic determinant on IL-21. In another further embodiment, the present invention provides an IL-21 BP that comprises two sets of variable domains (sets of associated VL and VH domains on associated separate chains), such that the IL-21 BP comprises two identical antigenic determinant binding sites. Any of such IL-21 BPs are expected to, at least in part, have similar epitope specificity, selectivity, and other characteristics as an antibody having a VL region comprising the sequence of SEQ ID No. 9 and a VH region comprising the sequence of SEQ ID No. 10 and, accordingly, may be useful in the treatment of multiple myeloma.
In one embodiment, the present invention provides an IL-21 BP comprising a VL CDR1 consisting essentially of a sequence according to any one of SEQ ID No. 3 and SEQ ID No. 11 , wherein the N-terminal residue and/or one, two, or three of the C-terminal amino acid residues are missing.
In one embodiment, the present invention provides an IL-21 BP comprising a VL CDR2 consisting essentially of a sequence according to any one of SEQ ID No. 4 and SEQ ID No. 12, wherein one or two of the N-terminal residues and/or one, two, or three of the C-terminal residues are missing.
In one embodiment, the present invention provides an IL-21 BP comprising a VL CDR3 consisting essentially of a sequence according to any one of SEQ ID No. 5 and SEQ ID No. 13, wherein the N-terminal residue and/or one, two, three, or four of the C-terminal residues are missing.
In one embodiment, the present invention provides an IL-21 BP comprising a VH CDR1 consisting essentially of a sequence according to any one of SEQ ID No. 6 and SEQ ID No. 14, wherein one, two, three, or four of the N-terminal residues and/or one, two, three, or four C-terminal residues are missing. In one embodiment, the present invention provides an IL-21 BP comprising a VH
CDR2 consisting essentially of a sequence according to any one of SEQ ID No. 7 and SEQ ID No. 15, wherein one, two, three, four, or five of the N-terminal amino acids thereof and/or one, two, three, four, five, or six of the C-terminal amino acids thereof are missing.
In one embodiment, the present invention provides an IL-21 BP comprising a VH CDR3 consisting essentially of a sequence according to any one of SEQ ID No. 8 and SEQ ID No. 16, wherein the N-terminal one, two, or three amino acid residues and/or the C-terminal one, two, three, or four amino acid residues are missing.
The present invention also provides IL-21 BPs wherein these "truncated" CDR sequences are combined with each other and/or other CDR sequences described herein. In one embodiment, the present invention provides an IL-21 BP that comprises
(a) three VL CDRs, which independently consist essentially of SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No. 5 in close proximity to one another in the IL-21 BP (e.g., near the spacing of VL CDRs in a wild-type anti-IL-21 antibody) and
(b) three VH CDRs which independently consist essentially of SEQ ID No. 6, SEQ ID No. 7 and SEQ ID No. 8 in close proximity to one another (e.g., near the spacing of
VH CDRS in a wild-type anti-IL-21 antibody) in the IL-21 BP.
In a further embodiment, the present invention provides an IL-21 BP that comprises a flexible linker positioned between the VL region and VH region of the IL-21 BP.
In a further embodiment, the present invention provides an IL-21 BP wherein the VL and VH regions are presented on separate chains in the context of an immunoglobulin fold protein and oriented such that the VL CDR1 , CDR2, CDR3 and VH CDR1 , CDR2, and CDR3 cooperatively associate to contribute in selectively and/or specifically bind an antigenic determinant on IL-21. In a further embodiment, the present invention provides an IL-21 BP that comprises two sets of variable domains (sets of associated VL and VH domains on associated separate chains), such that the IL-21 BP comprises two identical antigenic determinant binding sites. Any of such IL-21 BPs described in this paragraph are expected to, at least in part, have similar epitope specificity, selectivity, and other characteristics with an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2.
In one embodiment, the present invention provides an IL-21 BP that comprises (a) three VL CDRs, which independently consist essentially of SEQ ID No. 1 1 , SEQ ID
No. 12 and SEQ ID No. 13 in close proximity to one another in the IL-21 BP (e.g., near the spacing of VL CDRs in a wild-type anti-IL-21 antibody) and (b) three VH CDRs which independently consist essentially of SEQ ID No. 14, SEQ ID
No. 15 and SEQ ID No. 16 in close proximity to one another (e.g., near the spacing of VH CDRS in a wild-type anti-IL-21 antibody) in the IL-21 BP.
In a further embodiment, the present invention provides an IL-21 BP that comprises a flexible linker positioned between the VL region and VH region of the IL-21 BP.
In a further embodiment, the present invention provides an IL-21 BP wherein the VL and VH regions are presented on separate chains in the context of an immunoglobulin fold protein and oriented such that the VL CDR1 , CDR2, CDR3 and VH CDR1 , CDR2, and CDR3 cooperatively associate to contribute in selectively and/or specifically bind an antigenic determinant on IL-21. In a further embodiment, the present invention provides an IL-21 BP that comprises two sets of variable domains (sets of associated VL and VH domains on associated separate chains), such that the IL-21 BP comprises two identical antigenic determinant binding sites. Any of such IL-21 BPs described in this paragraph are expected to, at least in part, have similar epitope specificity, selectivity, and other characteristics with an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10.
For the purpose of this specification, CDR's are determined as described by Kabat (ibid). The present invention also provides IL-21 BPs comprising functional variants of the
VL region, VH region, or one or more CDRs of the antibodies of the examples. A functional variant of a VL, VH, or CDR used in the context of an IL-21 BP still allows the IL-21 BP to retain at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the affinity/avidity and/or specificity/selectivity of the parent antibody and in some cases such an IL-21 BP may be associated with greater affinity, selectivity, and/or specificity than the parent antibody.
In one embodiment, the present invention provides an IL-21 BP comprising a variant VL consisting essentially of a sequence having at least about 50%, such as at least 60%, for instance at least about 70%, such as at least about 75%, for instance at least about 80%, such as at least about 85%, for instance at least about 90%, such as at least about 95% amino acid sequence identity to a sequence according to any one of SEQ ID No. 1 and SEQ ID No. 9, wherein the IL-21 BP has at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the epitope binding characteristics of an antibody having a VL sequence of SEQ ID No. 1 or SEQ ID No. 9, respectively, such as an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2, or an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10, respectively.
In one embodiment, the present invention provides an IL-21 BP comprising a variant VL CDR1 consisting essentially of a sequence having at least about 50%, such as at least 60%, for instance at least about 70%, such as at least about 75%, for instance at least about 80%, such as at least about 85%, for instance at least about 90%, such as at least about 95% amino acid sequence identity to a sequence according to any one of SEQ ID No. 3 or SEQ ID No. 11 , wherein the IL-21 BP has at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the epitope binding characteristics of an antibody having a VL CDR1 sequence of SEQ ID No. 3 or SEQ ID No. 1 1 , respectively, such as an antibody having a VL sequence of SEQ ID No. 1 or SEQ ID No. 9, respectively, such as an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2, or an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10, respectively. In one embodiment, the present invention provides an IL-21 BP comprising a variant
VL CDR2 consisting essentially of a sequence having at least about 50%, such as at least 60%, for instance at least about 70%, such as at least about 75%, for instance at least about 80%, such as at least about 85%, for instance at least about 90%, such as at least about 95% amino acid sequence identity to a sequence according to any one of SEQ ID No. 4 or SEQ ID No. 12, wherein the IL-21 BP has at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the epitope binding characteristics of an antibody having a VL CDR2 sequence of SEQ ID No. 4 or SEQ ID No. 12, respectively, such as an antibody having a VL sequence of SEQ ID No. 1 or SEQ ID No. 9, respectively, such as an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2 or an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10, respectively.
In one embodiment, the present invention provides an IL-21 BP comprising a variant VL CDR3 consisting essentially of a sequence having at least about 50%, such as at least 60%, for instance at least about 70%, such as at least about 75%, for instance at least about 80%, such as at least about 85%, for instance at least about 90%, such as at least about 95% amino acid sequence identity to a sequence according to any one of SEQ ID No. 5 or SEQ ID No. 13, wherein the IL-21 BP has at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the epitope binding characteristics of an antibody having a VL CDR3 sequence of SEQ ID No. 5 or SEQ ID No. 13, respectively, such as an antibody having a VL sequence of SEQ ID No. 1 or SEQ ID No. 9, respectively, such as an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2, or an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10, respectively. In one embodiment, the present invention provides an IL-21 BP comprising a variant
VH consisting essentially of a sequence having at least about 50%, such as at least 60%, for instance at least about 70%, such as at least about 75%, for instance at least about 80%, such as at least about 85%, for instance at least about 90%, such as at least about 95% amino acid sequence identity to a sequence according to any one of SEQ ID No. 2 or SEQ ID No. 10, wherein the IL-21 BP has at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the epitope binding characteristics of an antibody having a VH sequence of SEQ ID No. 2 or SEQ ID No. 10, respectively, such as an antibody having a VH sequence of SEQ ID No. 2 and a VL sequence of SEQ ID No. 1 , or an antibody having a VH sequence of SEQ ID No. 10 and a VL sequence of SEQ ID No. 9, respectively. In one embodiment, the present invention provides an IL-21 BP comprising a variant
VH CDR1 consisting essentially of a sequence having at least about 50%, such as at least 60%, for instance at least about 70%, such as at least about 75%, for instance at least about 80%, such as at least about 85%, for instance at least about 90%, such as at least about 95% amino acid sequence identity to a sequence according to any one of SEQ ID No. 6 or SEQ ID No. 14, wherein the IL-21 BP has at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the epitope binding characteristics of an antibody having a VH CDR1 sequence of SEQ ID No. 6 or SEQ ID No. 14, respectively, such as an antibody having a VH sequence of SEQ ID No. 2 or SEQ ID No. 10, respectively, such as an antibody having a VH sequence of SEQ ID No. 2 and a VL sequence of SEQ ID No. 1 , or an antibody having a VH sequence of SEQ ID No. 10 and a VL sequence of SEQ ID No. 9, respectively.
In one embodiment, the present invention provides an IL-21 BP comprising a variant VH CDR2 consisting essentially of a sequence having at least about 50%, such as at least 60%, for instance at least about 70%, such as at least about 75%, for instance at least about 80%, such as at least about 85%, for instance at least about 90%, such as at least about 95% amino acid sequence identity to a sequence according to any one of SEQ ID No. 7 or SEQ ID No. 15, wherein the IL-21 BP has at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the epitope binding characteristics of an antibody having a VH CDR2 sequence of SEQ ID No. 7 or SEQ ID No. 15, respectively, such as an antibody having a VH sequence of SEQ ID No. 2 or SEQ ID No. 10, respectively, such as an antibody having a VH sequence of SEQ ID No. 2 and a VL sequence of SEQ ID No. 1 , or an antibody having a VH sequence of SEQ ID No. 10 and a VL sequence of SEQ ID No. 9, respectively. In one embodiment, the present invention provides an IL-21 BP comprising a variant
VH CDR3 consisting essentially of a sequence having at least about 50%, such as at least 60%, for instance at least about 70%, such as at least about 75%, for instance at least about 80%, such as at least about 85%, for instance at least about 90%, such as at least about 95% amino acid sequence identity to a sequence according to any one of SEQ ID No. 8 or SEQ ID No. 16, wherein the IL-21 BP has at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the epitope binding characteristics of an antibody having a VH CDR3 sequence of SEQ ID No. 8 or SEQ ID No. 16, respectively, such as an antibody having a VH sequence of SEQ ID No. 2 or SEQ ID No. 10, respectively, such as an antibody having a VH sequence of SEQ ID No. 2 and a VL sequence of SEQ ID No. 1 , or an antibody having a VH sequence of SEQ ID No. 10 and a VL sequence of SEQ ID No. 9, respectively.
The percent identity between two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology = # of identical positions/total # of positions x 100), taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences may be accomplished using a mathematical algorithm, as described in the non-limiting examples below.
The percent identity between two nucleotide sequences may be determined using the GAP program in the GCG software package (available at http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1 , 2, 3, 4, 5, or 6. The percent identity between two nucleotide or amino acid sequences may also be determined using the algorithm of E. Meyers and W. Miller, Comput. Appl. Biosci 4, 11 -17 (1988)) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. In addition, the percent identity between two amino acid sequences may be determined using the Needleman and Wunsch, J. MoI. Biol. 48, 444-453 (1970)) algorithm which has been incorporated into the GAP program in the GCG software package (available at http://www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1 , 2, 3, 4, 5, or 6.
The nucleic acid and protein sequences of the present invention may further be used as a "query sequence" to perform a search against public databases to, for example, identify related sequences. Such searches may be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al., J. MoI. Biol. 215, 403-10 (1990). BLAST nucleotide searches may be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the present invention. BLAST protein searches may be performed with the XBLAST program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to the protein molecules of the present invention. To obtain gapped alignments for comparison purposes, Gapped BLAST may be utilized as described in Altschul et al., Nucleic Acids Res. 25(17), 3389-3402 (1997). When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) may be used. See http://www.ncbi.nlm.nih.gov.
The sequence of CDR variants may differ from the sequence of the CDR of the parent antibody sequences through mostly conservative substitutions; for instance at least about 35%, about 50% or more, about 60% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more (e.g., about 65-99%) of the substitutions in the variant are conservative amino acid residue replacements. In the context of the present invention, conservative substitutions may be defined by substitutions within the classes of amino acids reflected in one or more of the following three tables: Amino acid residue classes for conservative substitutions
Figure imgf000029_0001
Alternative conservative amino acid residue substitution classes
Figure imgf000029_0002
Alternative Physical and Functional Classifications of Amino Acid Residues
Figure imgf000029_0003
More conservative substitutions groupings include: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Additional groups of amino acids may also be formulated using the principles described in, e.g., Creighton (1984) Proteins: Structure and Molecular Properties (2d Ed. 1993), W.H. Freeman and Company. In one embodiment of the present invention, conservation in terms of hydropathic/hydrophilic properties and residue weight/size also is substantially retained in a variant CDR as compared to a CDR of an antibody of the examples (e.g., the weight class, hydropathic score, or both of the sequences are at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more (e.g., about 65-99%) retained). For example, conservative residue substitutions may also or alternatively be based on the replacement of strong or weak based weight based conservation groups, which are known in the art.
The retention of similar residues may also or alternatively be measured by a similarity score, as determined by use of a BLAST program (e.g., BLAST 2.2.8 available through the NCBI). Suitable variants typically exhibit at least about 45%, such as at least about 55%, at least about 65%, at least about 75%, at least about 85%, at least about 90%, at least about 95%, or more (e.g., about 70-99%) similarity to the parent peptide.
Substantial changes in function may be made by selecting substitutions that are less conservative than those shown in the defined groups, above. For example, non-conservative substitutions may be made which more significantly affect the structure of the peptide in the area of the alteration, for example, the alpha-helical, or beta-sheet structure; the charge or hydrophobicity of the molecule at the target site; or the bulk of the side chain. The substitutions which generally are expected to produce the greatest changes in the peptide's properties are those where 1) a hydrophilic residue, e.g., seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl, or alanyl; 2) a cysteine or proline is substituted for (or by) any other residue; 3) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histidyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or 4) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) a residue that does not have a side chain, e.g., glycine. Accordingly, these and other nonconservative substitutions may be introduced into peptide variants where significant changes in function/structure is desired and such changes avoided where conservation of structure/function is desired.
A convenient way for generating substitution variants is affinity maturation using phage using methods known in the art. In order to identify candidate hypervariable region sites for modification, alanine scanning mutagenesis may also be performed to identify hypervariable region residues contributing significantly to antigen binding. Alternatively or additionally, it may be beneficial to analyze a crystal structure of the antigen-antibody complex to identify contact points between the antibody and antigen. Such contact residues and neighboring residues are likely suitable candidates for substitution. Where hypervariable region insertions are made to generate a variant antibody, the typical range of lengths of the hypervariable region in question in known antibodies should be taken into consideration. For example, for the first hypervariable region of a light chain variable domain, insertions may be introduced into the VL CDR1 sequence of a parent antibody while retaining a substantially similar and thereby expected appropriate size, which according to Kabat et al., supra, e.g., typically has an overall of about 9-20 (e.g., about 10-17) residues. Similarly, VL CDR2 typically has an overall length from about 5-10 residues; VL CDR3 typically has a length of about 7-20 residues; VH CDR1 typically has a length of about 10-15 residues; VH CDR2 typically has a length of about 15-20 residues; and VH CDR3 typically has a length of about 6-30 residues (e.g., 3-25 residues). Insertions in the VH region typically are made in VH CDR3 and typically near the C-terminal of the domain, such as about residues 97-102 of the parent VH CDR3 (for instance adjacent to, or C-terminal in sequence to, residue number 100 of the parent VH CDR3 sequence) using the alignment and numbering as described in Kabat. Antibody variants with inserted amino acid residue(s) in a hypervariable region thereof may be prepared randomly, especially where the starting binding affinity of the parent antibody for the target antigen is such that randomly produced antibody variants may be readily screened. For example, phage display provides a convenient method of screening such random variants.
In the design, construction, and/or evaluation of CDR variants attention may be paid to the fact that CDR regions may be altered to enable a better binding to the epitope. Antibody CDRs typically operate by building a "pocket," or other paratope structure, into which the epitope fits. If the epitope is not fitting tightly, the antibody may not offer the best affinity. However, as with epitopes, there often are a few key residues in a paratope structure that account for most of this binding. Thus, CDR sequences may vary in length and composition significantly between antibodies for the same peptide. The skilled artisan will recognize that certain residues, such as tyrosine residues (e.g., in the context of VH CDR3 sequences), that are often significant contributors to such epitope binding, are typically retained in a CDR variant.
Variants of the CDR region may also increase the amino acid contacts between the antigen and an antibody variant, as compared to the amino acid contacts between the antigen and the parent antibody, by introducing one or more amino acid residues (either by substitution or insertions) which increase the contacts or energetically favorable interactions between one or more amino acid residues present in an antigen and one or more amino acid residues present in the antibody. The amino acid interactions of interest may be selected from hydrogen bonding interactions, van der Waals interactions, and ionic interactions. Those skilled in the art will be aware of additional principles useful in the design and selection of IL-21 BP comprising CDR variants of the antibodies of the present invention.
In the context of CDR variants, which are variants of the CDRs of the antibodies of the examples, particularly in the context of variant CDR in anti-IL-21 antibodies or fragments thereof, residues required to support and/or orientate the CDR structural loop structure(s) may typically be retained; residues which fall within about 10 angstroms of a CDR structural loop (but optionally only residues in this area that also possess a water solvent accessible surface of about 5 angstroms2 or greater) may typically be unmodified or modified only by conservative amino acid residue substitutions; and/or the amino acid sequence may typically be subject to only a limited number of insertions and/or deletions (if any), such that CDR structural loop-like structures are retained in the variant (a description of related techniques and relevant principles is provided in for instance Schiweck et al., J MoI Biol. 268(5), 934-51 (1997), Morea, Biophys Chem. 68(1-3), 9-16 (1997), Shirai et al., FEBS Lett. 399(1-2), 1 -8 (1996), Shirai et al., FEBS Lett. 455(1-2), 188-97 (1999), Reckzo et al., Protein Eng. 8(4), 389-95 (1995) and Eigenbrot et al., J MoI Biol. 229(4), 969-95 (1993). See also WO 03/048185, WO 03/070747 and WO 03/027246.
In one embodiment, this includes for instance an IL-21 BP that comprises a VL CDR1 that is a fusion of VL CDR1 sequences from an antibody having a VL sequence of SEQ ID No. 1 and VL CDR1 sequences from an antibody having a VL sequence of SEQ ID No. 9. In one embodiment, this includes for instance an IL-21 BP that comprises a VL CDR2 that is a fusion of VL CDR2 sequences from an antibody having a VL sequence of SEQ ID No. 1 and VL CDR2 sequences from an antibody having a VL sequence of SEQ ID No. 9.
In one embodiment, this includes for instance an IL-21 BP that comprises a VL CDR3 that is a fusion of VL CDR3 sequences from an antibody having a VL sequence of SEQ ID No. 1 and VL CDR3 sequences from an antibody having a VL sequence of SEQ ID No. 9
In one embodiment, this includes for instance an IL-21 BP that comprises a VH CDR1 that is a fusion of VH CDR1 sequences from an antibody having a VH sequence of SEQ ID No. 2 and VH CDR1 sequences from an antibody having a VH sequence of SEQ ID No. 10.
In one embodiment, this includes for instance an IL-21 BP that comprises a VH CDR2 that is a fusion of VH CDR2 sequences from an antibody having a VH sequence of SEQ ID No. 2 and VH CDR2 sequences from an antibody having a VH sequence of SEQ ID No. 10.
In one embodiment, this includes for instance an IL-21 BP that comprises a VH CDR3 that is a fusion of VH CDR3 sequences from an antibody having a VH sequence of SEQ ID No. 2 and VH CDR3 sequences from an antibody having a VH sequence of SEQ ID No. 10. In one embodiment, the present invention provides antibody and antibody like molecules derived from one of 1 F1 and 1 F22, wherein the VL CDR1 sequence of the derived antibody or antibody-like molecule is replaced with the VL CDR1 sequence of the other of 1 F1 and 1 F22. In one embodiment, the present invention provides antibody and antibody like molecules derived from one of 1 F1 and 1 F22, wherein the VL CDR2 sequence of the derived antibody or antibody-like molecule is replaced with the VL CDR2 sequence of the other of 1 F1 and 1 F22.
In one embodiment, the present invention provides antibody and antibody like molecules derived from one of 1 F1 and 1 F22, wherein the VL CDR3 sequence of the derived antibody or antibody-like molecule is replaced with the VL CDR3 sequence of the other of 1 F1 and 1 F22.
In one embodiment, the present invention provides antibody and antibody like molecules derived from one of 1 F1 and 1 F22, wherein the VH CDR1 sequence of the derived antibody or antibody-like molecule is replaced with the VH CDR1 sequence of the other of 1 F1 and 1 F22.
In one embodiment, the present invention provides antibody and antibody like molecules derived from one of 1 F1 and 1 F22, wherein the VH CDR2 sequence of the derived antibody or antibody-like molecule is replaced with the VH CDR2 sequence of the other of 1 F1 and 1 F22
In one embodiment, the present invention provides antibody and antibody like molecules derived from one of 1 F1 and 1 F22, wherein the VH CDR3 sequence of the derived antibody or antibody-like molecule is replaced with the VH CDR3 sequence of the other of 1 F1 and 1 F22. In one embodiment, the present invention provides a variant antibody derived from
1 F1 and 1 F22, wherein the light chain of the antibody comprises one or more substitutions, insertions, or deletions that correspond to the sequence of the other antibody (e.g., the present invention provides a variant of 1 F1 wherein one or more residue changes are introduced into the light chain of the derivative based upon the residues found at corresponding positions in the light chain of 1 F22).
In one embodiment, the present invention provides a variant antibody derived from 1 F1 and 1 F22, wherein the heavy chain of the antibody comprises one or more substitutions, insertions, or deletions that correspond to the sequence of the other antibody (e.g., the present invention provides a variant of 1 F1 , wherein one or more residue changes are introduced into the heavy chain of the derivative based upon the residues found at corresponding positions in the heavy chain of 1 F22).
Additional techniques that may be used to generate variant antibodies include the directed evolution and other variant generation techniques described in for instance US 20040009498, Marks et al., Methods MoI Biol. 248, 327-43 (2004), Azriel-Rosenfeld et al., J MoI Biol. 335(1), 177-92 (2004), Park et al., Biochem Biophys Res Commun. 275(2), 553-7 (2000), Kang et al., Proc Natl Acad Sci U S A. 88(24), 11 120-3 (1991), Zahnd et al., J Biol Chem. 279(18), 18870-7 (2004), Xu et al., Chem Biol. 9(8), 933-42 (2002), Border et al., Proc Natl Acad Sci U S A. 97(20), 10701-5 (2000), Crameri et al., Nat Med. 2(1), 100-2 (1996) and as more generally described in for instance WO 03/048185.
Generated antibody variants may be subjected to any suitable screening technique and antibodies with suitable and desirably superior properties in one or more relevant assays may be selected for further development.
IL-21 BPs comprising CDR sequences as described above may comprise any suitable number and combination of such VL and VH CDRs while retaining at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the affinity/avidity and/or specificity/selectivity of an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2 or an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10, but optionally differing in other characteristics, such as immunogenicity in a human patient, affinity for the epitope, increased half-life, etc. In some cases such an IL-21 BP may be associated with greater affinity, selectivity, and/or specificity than the parent antibody. In one embodiment, less than a full set of VL CDRs and/or VH CDRS is present in an IL-21 BP of the present invention. In one embodiment all of the VL CDRS and VH CDRs are present. Examples of other functional properties of antibodies, which may be altered or retained in variant IL-21 BPs of the present invention as compared to the antibodies of the examples, are:
(1) high affinity binding to IL-21 ;
(2) inhibition or blocking of IL-21 binding to the IL-21 receptor; (3) degree of inhibition of IL-21 activation of the IL-21 receptor;
(4) immunogenicity;
(5) pharmokinetic properties (such as half-life);and/or
(6) the biophysical properties e.g. biophysical stability (solubility, thermostability) and chemical stability (oxidation, deamidation. fragmentation. The present invention also provides IL-21 BPs which are characterized with respect to their ability to compete (competitively inhibit) or cross-compete (i.e., relatively partially inhibit epitope binding) with an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2 and/or an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10 for binding to IL-21.
Such an IL-21 BP may be, for instance, a Fab fragment, derived from an antibody that binds to an epitope identical to or overlapping with an epitope bound by an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2 or an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10. Such a Fab fragment, due to its relatively small size compared to the mAb molecules, may not significantly compete with said antibodies for binding to IL-21 although the antibody from which it derived does. Nonetheless, such an IL-21 BP may be useful in similarly targeting nearby regions of IL-21 (e.g., in the context of targeting a cytotoxin, radionuclide, or the like in the context of an immunoconjugate IL-21 BP). Therefore, such IL-21 BPs may be useful in the context of the methods of the present invention and, accordingly, are also provided by the present invention.
Competition for binding to IL-21 or a portion of IL-21 by two or more IL-21 binding peptides may be determined by any suitable technique. In one embodiment, competition is determined by an ELISA assay as described, for example, in Example 2.
Competition in the context of the present invention refers to any detectably significant reduction in the propensity for a particular molecule to bind a particular binding partner in the presence of another molecule that binds the binding partner. Typically, competition means an at least about 10% reduction, such as an at least about 15%, or an at least about 20% reduction in binding between an IL-21 BP and (a) a form of IL-21 (e.g.
"unprocessed", "not processed" or "immature" IL-21 ); (b) a form of free IL-21 (e.g., an IL-21 promigratory fragment and/or IL-21 fragment produced by in vivo processing); (c) a portion of IL-21 ; or (d) a portion of IL-21 , caused by the presence of another IL-21 BP as determined by, e.g., ELISA analysis using sufficient amounts of the two or more competing IL-21 BPs and IL-21. It may also be the case that competition may exist between IL-21 BPs with respect to more than one of IL-21 , and/or a portion of IL-21 , e.g. in a context where the binding properties of a particular region of IL-21 are retained in fragments thereof, such as in the case of a well-presented linear epitope located in various tested fragments or a conformational epitope that is presented in sufficiently large IL-21 fragments as well as in IL-21. Assessing competition typically involves an evaluation of relative inhibitory binding using a first amount of a first molecule; a second amount of a second molecule; and a third amount of a third molecule (or a standard determined by binding studies that may be reasonably compared to new binding data with respect to the first and second molecules as a surrogate for actual contemporaneous data), wherein the first, second, and third amounts all are sufficient (in quantity and properties) to make a comparison that imparts information about the selectivity and/or specificity of the molecules at issue with respect to the other present molecules. The first, second, and third amounts may vary with the nature of the IL-21 BP and potential targets therefore at issue. Usually, for ELISA assessments, similar to those described in Example 2, about 5-50 μg (e.g., about 10-50 μg, about 20-50 μg, about 5-20 μg, about 10-20 μg, etc.) of IL-21 BP and/or IL-21 targets are required to assess whether competition exists. Conditions also should be suitable for binding. Typically, physiological or near-physiological conditions (e.g., temperatures of about 20-400C, pH of about 7-8, etc.) are suitable for IL-21 BP:IL-21 binding. Often competition is marked by a significantly greater relative inhibition than about
5% as determined by ELISA analysis. It may be desirable to set a higher threshold of relative inhibition as a criteria/determinant of what is a suitable level of competition in a particular context (e.g., where the competition analysis is used to select or screen for new antibodies designed with the intended function of blocking the binding of another peptide or molecule binding to IL-21 or naturally occurring anti-IL-21 antibody)). Thus, for example, it is possible to set a criteria for competitiveness wherein at least about 10% relative inhibition is detected; at least about 15% relative inhibition is detected; or at least about 20% relative inhibition is detected before an antibody is considered sufficiently competitive. In cases where epitopes belonging to competing antibodies are closely located in an antigen, competition may be marked by greater than about 40% relative inhibition of IL-21 binding (e.g., at least about 45% inhibition, such as at least about 50% inhibition, for instance at least about 55% inhibition, such as at least about 60% inhibition, for instance at least about 65% inhibition, such as at least about 70% inhibition, for instance at least about 75% inhibition, such as at least about 80% inhibition, for instance at least about 85% inhibition, such as at least about 90% inhibition, for instance at least about 95% inhibition, or higher level of relative inhibition).
Competition may be considered the inverse of cross-reactivity between a molecule and two potential binding partners. In certain embodiments, an IL-21 BP of the present invention specifically binds to one or more residues or regions in IL-21 but also does not cross-react with other peptides, peptide regions, or molecules, e.g., the present invention provides an anti-IL-21 antibody that does not cross-react with for instance IL-2, IL-4, IL, IL-9, or IL-15, which all binds to a receptor comprising the common Y chain (but otherwise have low homology to IL-21). Typically, a lack of cross-reactivity means less than about 5% relative competitive inhibition between the molecules when assessed by ELISA using sufficient amounts of the molecules under suitable assay conditions. In one embodiment, the present invention provides an IL-21 BP that competes with an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2 for binding to IL-21 or a portion thereof.
In one embodiment, the present invention provides an IL-21 BP that cross-competes with 1 F1 and/or 1 F22 for binding to IL-21 or a portion thereof. As discussed elsewhere herein, unless otherwise stated or clearly contradicted by context, references to binding of an IL-21 BP to IL-21 are intended to refer to binding in any suitable context, such as in a conformational context where the structure of IL-21 is present; or in a linear epitope context (or a combination thereof). Of course, binding in a limited subset of such context(s) may be an important characteristic with respect to any IL-21 BP provided by the present invention. Cross-competition may be determined by any suitable method and criteria, but typically means the detection of competition among three molecules in an ELISA or other suitable assay (at similar or different levels).
Additional methods for determining IL-21 BP specificity by competitive inhibition may be found in for instance Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1988), Colligan et al., eds., Current Protocols in Immunology, Greene Publishing Assoc, and Wiley InterScience N. Y., (1992, 1993), and Muller, Meth. Enzymol. 92, 589-601 (1983)).
Human IL-21 comprises a number of different epitopes, which may include (1 ) peptide antigenic determinants that are comprised within single peptide chains within human IL-21 ; (2) conformational antigenic determinants which consist one or more noncontiguous amino acids on a particular chain and/or amino acids present on spatially contiguous but separate peptide chains (typically where the respective amino acid sequences of the chains are located disjointedly along the human IL-21 polypeptide sequence); (3) post-translational antigenic determinants which consist, either in whole or part, of molecular structures covalently attached to human IL-21 , such as carbohydrate groups; or (4) combinations of (1)-(3).
An epitope in the context of the present invention includes any peptide or peptide- derivative determinant capable of specific binding to an immunoglobulin. An epitope may comprise any suitable number of amino acids, in any suitable position (with respect to the linear sequence of IL-21) orientation (with respect to folded IL-21 , or a fragment thereof), amino acid composition (and consequently, at least in part, charge). Thus, for example, an epitope may be composed of about 3-10 amino acids, typically 3-8 amino acids, in one or more contiguous or noncontiguous locations with respect to the primary sequence of IL-21 (for instance an epitope may consist essentially of 2, 3, 4, 5, 6, 7, or 8 amino acid residues distributed in 1 , 2, 3, 4, or 5 noncontiguous locations in IL-21 ). Alternatively, for example, an epitope may be considered to be defined by a region of about 5-40 contiguous amino acid residues (e.g., about 7-30 amino acid residues, about 5-20 amino acid residues, or about 3-15 amino acid residues) in IL-21 (solely or in combination with a portion of an adjacent IL-21 domain). In some epitopes it may be the case that just one amino acid residue or only a few amino acid residues are critical to CDR or CDR(s) recognition (and thereby most important to IL-21 BP:IL-21 antigen affinity and avidity). As such, an epitope may be characterized on the basis of one or more of such critical residues, with the recognition that other residues may also make some lesser contribution to the epitope. In the case of an epitope defined by a region of amino acids, it may be that one or more amino acids in the region make only a minor contribution or even negligible contribution to antibody binding, such that the residue may be subject to substitution with an appropriate different residue without resulting in "a loss" of the epitope to at least some IL-21 BPs specific for it.
In one embodiment, the present invention provides an IL-21 BP, such as an anti- IL-21 antibody, that specifically binds to an IL-21 epitope that also is specifically bound by an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2 and/or an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10. It is possible that IL-21 BPs having one or more CDRs that differ from the CDRs of an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2, or the CDRs of an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10, may still be specific for the same epitope as an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2 and an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10, respectively. In some such cases, the IL-21 BP in question may recognize or be more specific/selective for particular structures or regions of the epitope than the antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2 and the antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10, respectively.
A IL-21 epitope bound by an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2 or an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10, may be identified via standard mapping and characterization techniques, further refinement of which may be identified by any suitable technique, numerous examples of which are available to the skilled artisan. These techniques may also be used to identify and/or characterize epitopes for IL-21 BPs generally. As one example of such mapping/characterization methods, an epitope for an anti-IL-21 antibody may be determined by epitope "foot-printing" using chemical modification of the exposed amines/carboxyls in the IL-21 protein. One specific example of such a foot-printing technique is the use of HXMS (hydrogen-deuterium exchange detected by mass spectrometry) wherein a hydrogen/deuterium exchange of receptor and ligand protein amide protons, binding, and back exchange occurs, wherein the backbone amide groups participating in protein binding are protected from back exchange and therefore will remain deuterated. Relevant regions may be identified at this point by peptic proteolysis, fast microbore high-performance liquid chromatography separation, and/or electrospray ionization mass spectrometry. See, e.g., Ehring H, Analytical Biochemistry, Vol. 267 (2) 252-259 (1999) and/or Engen, J. R. and Smith, D. L. (2001 ) Anal. Chem. 73, 256A-265A. Another example of a suitable epitope identification technique is nuclear magnetic resonance epitope mapping (NMR), where typically the position of the signals in two-dimensional NMR spectres of the free antigen and the antigen complexed with the antigen binding peptide, such as an antibody, are compared. The antigen typically is selectively isotopically labeled with 15N so that only signals corresponding to the antigen and no signals from the antigen binding peptide are seen in the NMR-spectrum. Antigen signals originating from amino acids involved in the interaction with the antigen binding peptide typically will shift position in the spectres of the complex compared to the spectres of the free antigen, and the amino acids involved in the binding may be identified that way. See for instance Ernst Schering Res Found Workshop. (44), 149-67 (2004), Huang et al., Journal of Molecular Biology 281.(1), 61-67 (1998) and Saito and Patterson, Methods. 9(3), 516-24 (1996). Epitope mapping/characterization may also be performed using mass spectrometry methods. See for instance Downward, J Mass Spectrom. 35(4), 493-503 (2000) and Kiselar and Downard, Anal Chem. 71.(9), 1792-801 (1999).
Protease digestion techniques may also be useful in the context of epitope mapping and identification. Antigenic determinant-relevant regions/sequences may be determined by protease digestion, e.g. by using trypsin in a ratio of about 1 :50 to IL-21 o/n digestion at 37°C and pH 7-8, followed by mass spectrometry (MS) analysis for peptide identification. The peptides protected from trypsin cleavage by the IL-21 BP may subsequently be identified by comparison of samples subjected to trypsin digestion and samples incubated with IL-21 BP and then subjected to digestion by e.g. trypsin (thereby revealing a foot print for the binder). Other enzymes like chymotrypsin, pepsin, etc. may also or alternatively be used in a similar epitope characterization methods. A IL-21 BP which gives the significantly same result as an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2 or an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10 in these measurements are deemed to be an antibody that bind the same epitope as an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2 or an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10, respectively. See for instance Manca, Ann 1st Super Sanita. 27(1), 15-9 (1991) for a discussion of similar techniques. In this respect (as well as in other respects), the invention provides a method for identifying new antibodies, sequences, and proteins that act as IL-21 BPs.
Epitope mapping by competitive binding to IL-21 with two antibodies where one is biotinylated is another method for identifying relevant antigenic determinant regions.
Various phage display techniques may also be used to identify epitopes. See for instance Wang and Yu, Curr Drug Targets. 5(1), 1-15 (2004), Burton, Immunotechnology. 1(2), 87-94 (1995 Aug), Cortese et al., Immunotechnology. 1(2), 87-94 (1995) and Irving et al., Curr Opin Chem Biol. 5(3), 314-24 (2001). Consensus epitopes may also be identified through modified phage display-related techniques (see, http://www.cs.montana.edu/~mumey/papers/jcb03.pdf) for discussion.
Other methods potentially helpful in mapping epitopes include crystallography techniques, X-ray diffraction techniques (such as the X-ray diffraction/sequence study techniques developed by Poljak and others in the 1970s-1980s), and the application of Multipin Peptide Synthesis Technology. Computer-based methods such as sequence analysis and three dimensional structure analysis and docking may also be used to identify antigenic determinants. For example, an epitope may also be determined by molecular modeling using a structure of IL-21 with docking of the structure of the Fab fragment of the individual monoclonal antibody. These and other mapping methods are discussed in Epitope Mapping A Practical Approach (Westwood and Hay Eds.) 2001 Oxford University Press.
In one embodiment, the present invention provides an IL-21 BP having substantially the same specific IL-21 -binding characteristics of one or more mAbs selected from an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2 and an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10. To identify more specific likely antigenic determinant regions in IL-21 , various predictive analytical methods may be applied. In a first analytical approach, IL-21 may be analyzed for (1) highly hydropathic regions (using the Kyte-Doolittle method); (2) antigenicity as measured by the Protrusion Index method; (3) antigenicity as determined by the Parker method; (4) antigenicity as determined by the Hopp/Woods method; and (5) hydrophilicity as measured by the methods of Goldman, Engleman, and Steitz. Sequences ranging from 10-40 amino acids in length may be selected based on exhibiting one or more of these properties. The rationale for this approach is the general consensus that many ideal B cell epitopes are hydrophilic, surface-oriented, and flexible sequences of about 8-10 amino acids in length.
The present invention provides IL-21 BPs specific for IL-21-regions of IL-21 identified in such a manner. Moreover, the termini of these sequences may be compared to predicted antigenic determinant regions located through the other analyses described herein to provide additional specific likely antigenic-determinant containing regions. Other similar comparisons may readily be made to provide additional likely antigenic determinant regions, where IL-21 BPs binding to these antigenic determinant regions may be considered another feature of the present invention.
In one embodiment, the IL-21 BP of the present invention is an antibody. Non-limiting examples of IL-21 binding antibodies provided by the present invention include (a) a complete functional, immunoglobulin molecule comprising: (i) two identical chimeric heavy chains comprising a variable region with a human B cell surface antigen specificity and human constant region and (ii) two identical all (i.e. non-chimeric) human light chains; (b) a complete, functional, immunoglobulin molecule comprising: (i) two identical chimeric heavy chains comprising a variable region as indicated, and a human constant region, and (ii) two identical all (i.e. non-chimeric) non-human light chains; (c) a monovalent antibody, i.e., a complete, functional immunoglobulin molecule comprising: (i) two identical chimeric heavy chains comprising a variable region as indicated, and a human constant region, and (ii) two different light chains, only one of which has the same specificity as the variable region of the heavy chains. The resulting antibody molecule binds only to one end thereof and is therefore incapable of divalent binding. As another illustration, antibody/immunoglobulin-related peptides provided by the present invention may be said to include the following: (a) a whole immunoglobulin molecule; (b) an scFv; (c) a monoclonal antibody; (d) a human antibody; (e) a chimeric antibody; (f) a humanized antibody; (g) a Fab fragment; (h) an Fab' fragment; (i) an F(ab')2 fragment; (j) an Fv molecule; and (k) a disulfide-linked Fv molecule.
In one embodiment, the IL-21 BP of the present invention is a polyclonal antibody. In one embodiment, the IL-21 BP of the present invention is an monoclonal antibody. In a further embodiment, the IL-21 BP of the present invention is a human monoclonal antibody. In another further embodiment, the IL-21 BP of the present invention is a humanized antibody. In another further embodiment, the IL-21 BP of the present invention is a chimeric antibody. In another further embodiment, the IL-21 BP of the present invention is a monoclonal antibody originating entirely from a mammalian species different from humans. In a further embodiment, the IL-21 BP of the present invention is a fully murine monoclonal antibody.
A monoclonal antibody refers to a composition comprising a homogeneous antibody population having a uniform structure and specificity. Typically a monoclonal antibody is an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific and each monoclonal antibody is typically directed against a single epitope, which is in contrast to polyclonal antibody preparations which typically include different antibodies directed against different epitopes. That an antibody is monoclonal is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies of the present invention may be produced by the hybridoma method first described by Kohler et al., Nature 256, 495 (1975), or may be produced by recombinant DNA methods. Monoclonal antibodies may also be isolated from phage antibody libraries using the techniques described in, for example, Clackson et al., Nature 352, 624-628 (1991) and Marks et al., J. MoI. Biol. 222, 581-597 (1991).
Monoclonal antibodies may be obtained from any suitable source. Thus, for example, monoclonal antibodies may be obtained from hybridomas prepared from murine splenic B cells obtained from mice immunized with an antigen of interest or a nucleic acid encoding an antigen of interest. Monoclonal antibodies may also be obtained from hybridomas derived from antibody-expressing cells of immunized humans or non-human mammals such as rats, dogs, primates, etc.
In one embodiment, human monoclonal antibodies directed against IL-21 may be generated using transgenic or transchromosomal mice carrying parts of the human immune system rather than the mouse system. Such transgenic and transchromosomic mice include mice referred to herein as HuMAb mice and KM mice, respectively, and are collectively referred to herein as "transgenic mice".
The HuMAb mouse contains a human immunoglobulin gene miniloci that encodes unrearranged human heavy (μ and Y) and K light chain immunoglobulin sequences, together with targeted mutations that inactivate the endogenous μ and K chain loci (Lonberg, N. et al., Nature 368, 856-859 (1994)). Accordingly, the mice exhibit reduced expression of mouse IgM or K and in response to immunization, the introduced human heavy and light chain transgenes, undergo class switching and somatic mutation to generate high affinity human IgG1K monoclonal antibodies (Lonberg, N. et al. (1994), supra; reviewed in Lonberg, N. Handbook of Experimental Pharmacology 113, 49-101 (1994) , Lonberg, N. and Huszar, D., Intern. Rev. Immunol. Vol. 13 65-93 (1995) and Harding, F. and Lonberg, N. Ann. N. Y. Acad. Sci 764 536-546 (1995)). The preparation of HuMAb mice is described in detail in Taylor, L. et al., Nucleic Acids Research 20, 6287-6295 (1992), Chen, J. et al., International Immunology 5, 647-656 (1993), Tuaillon et al., J. Immunol. 152, 2912-2920 (1994), Taylor, L. et al., International Immunology 6, 579-591 (1994), Fishwild, D. et al., Nature Biotechnology 14, 845-851 (1996). See also US 5,545,806, US 5,569,825, US 5,625,126, US 5,633,425, US 5,789,650, US 5,877,397, US 5,661 ,016, US 5,814,318, US 5,874,299, US 5,770,429, US 5,545,807, WO 98/24884, WO 94/25585, WO 93/1227, WO 92/22645, WO 92/03918 and WO 01/09187.
The HCo7 mice have a JKD disruption in their endogenous light chain (kappa) genes (as described in Chen et al., EMBO J. 12, 821 -830 (1993)), a CMD disruption in their endogenous heavy chain genes (as described in Example 1 of WO 01/14424), a KCo5 human kappa light chain transgene (as described in Fishwild et al., Nature Biotechnology 14, 845-851 (1996)), and a HCo7 human heavy chain transgene (as described in US 5,770,429).
The HCo12 mice have a JKD disruption in their endogenous light chain (kappa) genes (as described in Chen et al., EMBO J. 12, 821 -830 (1993)), a CMD disruption in their endogenous heavy chain genes (as described in Example 1 of WO 01/14424), a KCo5 human kappa light chain transgene (as described in Fishwild et al., Nature Biotechnology 14, 845-851 (1996)), and a HCo12 human heavy chain transgene (as described in Example 2 of WO 01/14424). In the KM mouse strain, the endogenous mouse kappa light chain gene has been homozygously disrupted as described in Chen et al., EMBO J. Vl, 811 -820 (1993) and the endogenous mouse heavy chain gene has been homozygously disrupted as described in Example 1 of WO 01/09187. This mouse strain carries a human kappa light chain transgene, KCo5, as described in Fishwild et al., Nature Biotechnology 14, 845-851 (1996). This mouse strain also carries a human heavy chain transchromosome composed of chromosome 14 fragment hCF (SC20) as described in WO 02/43478.
The KM mouse contains a human heavy chain transchromosome and a human kappa light chain transgene. The endogenous mouse heavy and light chain genes also have been disrupted in the KM mice such that immunization of the mice leads to production of human immunoglobulins rather than mouse immunoglobulins. Construction of KM mice and their use to raise human immunoglobulins is described in detail in WO 02/43478.
Splenocytes from these transgenic mice may be used to generate hybridomas that secrete human monoclonal antibodies according to well known techniques. Such transgenic mammals, mammals comprising an operable nucleic acid sequence coding for expression of an IL-21 BP, mammals stably transfected with one or more I L-21 -encoding nucleic acid sequences, and the like, are additional features of the present invention.
Human monoclonal or polyclonal antibodies of the present invention, or antibodies of the present invention originating from other species may also be generated transgenically through the generation of another non-human mammal or plant that is transgenic for the immunoglobulin heavy and light chain sequences of interest and production of the antibody in a recoverable form therefrom. In connection with the transgenic production in mammals, antibodies may be produced in, and recovered from, the milk of goats, cows, or other mammals. See for instance US 5,827,690, US 5,756,687, US 5,750,172 and US 5,741 ,957. Further, human antibodies of the present invention or antibodies of the present invention from other species may be generated through display-type technologies, including, without limitation, phage display, retroviral display, ribosomal display, and other techniques, using techniques well known in the art and the resulting molecules may be subjected to additional maturation, such as affinity maturation, as such techniques are well known in the art (see for instance Hoogenboom et al., J. MoI. Biol. 227, 381 (1991 ) (phage display),
Vaughan et al., Nature Biotech 14, 309 (1996) (phage display), Hanes and Plucthau, PNAS USA 94, 4937-4942 (1997) (ribosomal display), Parmley and Smith, Gene 73, 305-318 (1988) (phage display), Scott TIBS 17, 241 -245 (1992), Cwirla et al., PNAS USA 87, 6378-6382 (1990), Russel et al., Nucl. Acids Research 21, 1081-1085 (1993), Hoganboom et al., Immunol. Reviews 130, 43-68 (1992), Chiswell and McCafferty TIBTECH 10, 80-84
(1992), and US 5,733,743). If display technologies are utilized to produce antibodies that are not human, such antibodies may be humanized, for instance as described elsewhere herein.
Humanized monoclonal antibodies of the present invention may be generated by fusing the constant domains from a human antibody to the variable domains of a non-human species. Examples of how to make humanized antibodies may be found in for instance US 6,054,297, US 5,886,152 and US 5,877,293. A humanized antibody is designed to have greater homology to a human immunoglobulin than animal-derived monoclonal antibodies. Non-human amino acid residues from an "import" (animal) variable domain typically are transfected into a human "backbone". Humanization may essentially be performed following the method of Winter and co-workers (Jones et al., Nature 321, 522-525 (1986), Riechmann et al., Nature 332, 323-327 (1988), Verhoeyen et al., Science 239, 1534-1536 (1988)), by substituting rodent complementarity determining regions ("CDRs") or CDR sequences for the corresponding sequences of a human antibody. Accordingly, in such "humanized" antibodies, the CDR portions of the human variable domain have been substituted by the corresponding sequence from a non-human species. Thus, humanized antibodies are typically human antibodies in which some CDR residues and possibly some framework residues are substituted by residues from analogous sites in rodent antibodies. The choice of human variable domains, both light and heavy, to be used in making the humanized antibodies is important to reduce antigenicity. According to the so-called "best-fit" method, the sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable-domain sequences. The human sequence which is closest to that of the rodent is then accepted as the human framework (FR) for the humanized antibody (Sims et al., J. Immunol. 151, 2296 (1993), Chothia et al., J. MoI. Biol. 196, 901 (1987)). Another method uses a particular framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework may be used for several different humanized antibodies (Carter et al., PNAS USA 89, 4285 (1992), Presta et al., J. Immunol. 151, 2623 (1993)).
It is typically also important that humanized antibodies retain high affinity for the antigen and other favorable biological properties. To achieve this goal, humanized antibodies may be prepared by a process of analysis of the parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences. Three-dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays permits analysis of the likely role of certain residues in the functioning of the candidate immunoglobulin sequence, i.e., the analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen. In this way, FR residues may be selected and combined from the recipient and import sequences so that the desired antibody characteristic, such as increased affinity for the target antigen(s), is maximized, although it is the CDR residues that directly and most substantially influence antigen binding.
Murine antibodies or antibodies from other species may be humanized or primatized using any suitable techniques, a number of suitable techniques being already well known in the art (see for instance Winter and Harris Immunol Today 14, 43-46 (1993) and Wright et al., Crit. Reviews in Immunol. 125-168 (1992)). The antibody of interest may be engineered by recombinant DNA techniques to substitute the CH1 , CH2, CH3, hinge domains, and/or the framework domain with the corresponding human sequence (see WO 92/02190 and US
5,530,101 , US 5,585,089, US 5,693,761 , US 5,693,792, US 5,714,350, and US 5,777,085).
Humanization of antibodies may also be performed following the method of Winter and co-workers (Jones et al., Nature 321, 522-525 (1986), Riechmann et al., Nature 332, 323-327 (1988), Verhoeyen et al., Science 239, 1534-1536 (1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such "humanized" antibodies are, in a sense, chimeric antibodies (US 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
Also, the use of Ig cDNA for construction of chimeric immunoglobulin genes is known in the art (see for instance Liu et al., PNAS USA 84, 3439 (1987) and J.Immunol. 139, 3521 (1987)). mRNA is isolated from a hybridoma or other cell producing the antibody and used to produce cDNA: The cDNA of interest may be amplified by the polymerase chain reaction using specific primers (US 4,683,195 and US 4,683,202). Alternatively, a library is made and screened to isolate the sequence of interest. The DNA sequence encoding the variable region of the antibody is then fused to human constant region sequences.
Sequences of human constant regions (as well as variable regions) may be found in Kabat et al., (1991) Sequences of Proteins of Immunological Interest, N. I. H. publication no. 91 -3242 and more recent and related data may be accessed at http://www.biochem.ucl.ac.uk/~martin/abs/Generallnfo.html. The choice of isotype typically will be guided by the desired effector functions, such as complement fixation, or activity in antibody-dependent cellular cytotoxicity. Exemplary isotypes are IgGI , lgG2, lgG3, and lgG4. Either of the human light chain constant regions, kappa or lambda, may be used. The chimeric, humanized antibody may then be expressed by conventional methods.
IL-21 BPs of the present invention may be in any suitable form with respect to multimerization. Anti-IL-21 antibodies and antibody fragments may be at least in heterotrimeric form if not in higher multimeric forms such as those associated with IgM antibodies. In other embodiments, an IL-21 BP may be presented as a dimer or monomer. Monomeric IL-21 BPs of the present invention may be, for example, modified by any suitable technique so as to form multimeric peptide compositions. If desired, the class of a anti-IL-21 antibody of the present invention may be switched by known methods. For example, an antibody of the present invention that was originally IgM may be class switched to an IgG antibody of the present invention. Further, class switching techniques may be used to convert one IgG subclass to another, for instance from IgGI to lgG2. Thus, the effector function of the antibodies of the present invention may be changed by isotype switching to, e.g., an IgGI , lgG2, lgG3, lgG4, IgD, IgA, IgE, or IgM antibody for various therapeutic uses.
In one embodiment an antibody of the present invention is an IgGI antibody, for instance an IgGI ,κ or IgGI ,λ isotype. In another embodiment an antibody of the present invention is an lgG3 antibody, for instance an lgG3,κ or lgG3,λ isotype. In another embodiment an antibody of the present invention is an lgG4 antibody, for instance an lgG4,κ or lgG4,λ isotype. In another embodiment an antibody of the present invention is an IgAI or lgA2 antibody. In another embodiment an antibody of the present invention is an IgM antibody. Anti-IL-21 antibodies may be recovered from recombinant combinatorial antibody libraries, such as a scFv phage display library, which may be made with human VL and VH cDNAs prepared from mRNA derived from human lymphocytes. Methods for preparing and screening such libraries are known in the art. There are a number of commercially available kits for generating phage display libraries. There are also other methods and reagents that may be used in generating and screening antibody display libraries (see for instance US
5,223,409, WO 92/18619, WO 91/17271 , WO 92/20791 , WO 92/15679, WO 93/01288, WO 92/01047, WO 92/09690, Fuchs et al., Bio/Technology 9,1370-1372 (1991), Hay et al., Hum. Antibod. Hybridomas 3, 81-85 (1992), Huse et al., Science 246,1275-1281 (1989), McCafferty et al., Nature 348, 552-554 (1990), Griffiths et al., EMBO J 12, 725-734 (1993), Hawkins et al., J. MoI. Biol. 226, 889-896 (1992), Clackson et al., Nature 352, 624-628 (1991), Gram et al., PNAS USA 89, 3576-3580 (1992), Garrad et al., Bio/Technology 9, 1373-1377 (1991), Hoogenboom et al., Nuc Acid Res 19, 4133-4137 (1991 ) and Barbas et al., PNAS USA 88, 7978-7982 (1991)). Suitable VL and VH nucleic acid sequences may be selected using any appropriate method. For example, VL and VH nucleic acids may be selected by employing the epitope imprinting methods described in WO 93/06213. Antibody libraries, such as scFv libraries may be prepared and screened using known and suitable methods (with human IL-21-containing peptides as antigen(s)), such as those described in for instance WO92/01047, McCafferty et al., Nature 348, 552-554 (1990) and Griffiths et al., EMBO J 12, 725-734 (1993). Such antibody libraries and other combinations of IL-21 BPs (libraries, pools, etc.) are features of the present invention that may be used therapeutically to provide a more comprehensive immune response; as tools in screening methods for immunogenic peptides, small molecules, other anti-IL-21 antibodies (e.g., by way of competition assays), and the like; and/or in diagnostic methods and compositions (e.g., an immunoassay chip comprising a panel of such antibodies optionally in association with other antibodies may be prepared by standard techniques). Once initial human VL and VH segments are selected, "mix and match" experiments, in which different pairs of the initially selected VL and VH segments are screened for I L-21 -containing peptide binding, may be performed to select desirable VL/VH pair combinations. For example, reactivity of the peptides may be determined by ELISA or other suitable epitope analysis methods (see for instance Scott, J. K. and Smith, G. P. Science 249, 386-390 (1990), Cwirla et al., PNAS USA 87,
6378-6382 (1990), Felici et al., J. MoI. Biol. 222, 301-310 (1991) and Kuwabara et al., Nature Biotechnology 15, 74-78 (1997) for discussion of such techniques and principles). Antibodies may be selected by their affinity for antigen and/or by their kinetics of dissociation (off-rate) from antigen (see for instance Hawkins et al., J. MoI. Biol. 226, 889-896 (1992)). To further improve the quality and/or diversity of anti-IL-21 antibodies, the VL and VH segments of VL/VH pair(s) may be randomly mutated, for instance within the CDR3 region of VH and/or VL, in a process analogous to the in vivo somatic mutation process responsible for affinity maturation of antibodies during a natural immune response. This in vitro affinity maturation may be accomplished by amplifying VH and VL regions using PCR primers complimentary to the VH CDR3 or VL CDR3, respectively, which primers typically are "spiked" with a random mixture of the four nucleotide bases at certain positions, such that the resultant PCR products encode VH and VL segments into which random mutations have been introduced into the VH and/or VL CDR3 regions. These randomly mutated VH and VL segments may be re-screened for binding to I L-21 -containing peptides. Following screening, nucleic acid encoding a selected antibody may be recovered from the display package (e.g., from the phage genome) and subcloned into an appropriate vector by standard recombinant DNA techniques. If desired, such an antibody-encoding nucleic acid may be further manipulated to create other antibody forms or IL-21 BPs. To express a recombinant antibody isolated by screening of a combinatorial library, typically a nucleic acid comprising a sequence encoding the antibody is cloned into a recombinant expression vector and introduced into appropriate host cells (mammalian cells, yeast cells, etc.) under conditions suitable for expression of the nucleic acid and production of the antibody.
High-affinity antibody peptides, such as human single-chain Fv (scFv) and Fab antibody fragments, may also be isolated from such libraries using a panning technique in which the antigen of interest is immobilized on a solid surface, such as microtiter plates or beads (see for instance Barbas and Burton, Trends. Biotechnol. 14, 230-234 (1996) and Aujame et al., Hum. Antibodies 8, 155-68 (1997). Phage display of large naϊve libraries also makes it possible to isolate human antibodies directly without immunization (see for instance de Haard et al., J. Biol. Chem. 274(26), 18218-18230 (1999)). In these respects, the invention provides a method for producing anti-IL21 antibodies with increased affinity.
In one embodiment, the present invention provides variant anti-IL-21 antibodies. A "variant" anti-IL-21 antibody is an antibody that differs from a parent antibody (typically generated by immunization) by one or more suitable amino acid residue alterations, that is substitutions, deletions, insertions, or terminal sequence additions, in the CDRs or other VH and/or VL sequences (provided that at least a substantial amount of the epitope binding characteristics of the parent antibody are retained, if not improved upon, by such changes). Variations in an antibody variant may be made in each of the framework regions, the constant domain, and/or the variable regions (or any one or more CDRs thereof) in a single variant antibody. Alternatively, variations may be made in only one of the framework regions, the variable regions (or single CDR thereof), or the constant domain in an antibody. Alanine scanning mutagenesis techniques, such as described by Cunningham and Wells, Science 244, 1081-1085 (1989), may be used to identify suitable residues for substitution or deletion in generating IL-21 BPs comprising variant VL, VH, or particular CDR sequences, although other suitable mutagenesis techniques also may be applied. Multiple amino acid substitutions may also be made and tested using known methods of mutagenesis and screening, such as those disclosed by Reidhaar-Olson and Sauer, Science 241 , 53-57 (1988) or Bowie and Sauer, PNAS USA 86, 2152-2156 (1989). Thus, for example, in an antibody variant one or more amino acid residues may be introduced or inserted in or adjacent to one or more of the hypervariable regions of a parent antibody, such as in one or more CDRs. An anti-IL-21 antibody variant may comprise any number of inserted amino acid residues, provided again that at least a substantial amount of the epitope binding characteristics of the parent antibody are retained. An anti-IL-21 antibody variant of the present invention may for example comprise from about 1 -30 inserted amino acid residues, for instance from about 1 -10, such as for instance from about 2-10, for instance from 2-5 or such as from about 1-5 inserted amino acid residues. Likewise, an anti- IL-21 antibody variant of the present invention may for example comprise from about 1-30 deleted amino acid residues, for instance from about 1-10, such as for instance from about 2-10, for instance from 2-5 or such as from about 1 -5 deleted amino acid residues. Likewise, an anti-IL-21 antibody variant of the present invention may for example comprise from about 1-30 substituted amino acid residues, for instance from about 1-10, such as for instance from about 2-10, for instance from 2-5 or such as from about 1-5 substituted amino acid residues. Likewise, an anti-IL-21 antibody variant of the present invention may for example comprise from about 1-30 terminal sequence amino acid residue additions , for instance from about 1-10, such as for instance from about 2-10, for instance from 2-5 or such as from about 1 -5 terminal sequence amino acid residue additions. A antibody variant of the present invention may also comprise a combination of two or more of such insertions, deletings, substitutions and terminal sequence amino acid residue additions, provided that the variant possesses at least a substantial proportion of the parent antibodies affinity, specificity, and/or selectivity with respect to one or more IL-21 epitopes.
Considerations in the selection of antibody variants (e.g., conservation of amino acid residue functional characteristics, conservation of amino acid residues based on hydropathic characteristics, and/or conservation of amino acid residues on the basis of weight/size), are described elsewhere herein. Typically, amino acid sequence alterations, such as conservative substitution variations, desirably do not substantially change the structural characteristics of the parent sequence (e.g., a replacement amino acid should not tend to disrupt secondary structure that characterizes the function of the parent sequence). Examples of art-recognized polypeptide secondary and tertiary structures are described in, e.g., Proteins, Structures and Molecular Principles (Creighton, Ed., W. H. Freeman and Company, New York (1984)), Introduction to Protein Structure (C. Branden and J. Tooze, eds., Garland Publishing, New York, N. Y. (1991)) and Thornton et at., Nature 354, 105 (1991). Additional principles relevant to the design and construction of peptide variants is discussed in for instance Collinet et al., J Biol Chem 275(23), 17428-33 (2000). Amino acid sequence variants of an antibody may be obtained by introducing appropriate nucleotide changes into the antibody-encoding nucleic acid (e.g., by site directed mutagenesis) or by chemical peptide synthesis. Such variants include, for example, deletions from, and/or insertions into and/or substitutions of and/or terminal sequence additions of residues within the amino acid sequences of the antibodies of the examples herein. Any combination of deletions, insertions, and substitutions may be made to arrive at a desired variant, provided that the variant possesses at least a substantial proportion of epitope binding characteristics of the parent antibody. Amino acid sequence changes, with respect to a parent antibody, also may alter post-translational processes of the variant antibody with respect to a parent antibody, such as by changing the number or position of glycosylation sites.
Variant antibodies of the present invention may comprise alterations in the hypervariable region, such as in the CDRs. Examples of IL-21 BPs comprising such CDR variants are described elsewhere herein, and, as described above, such IL-21 BPs may be antibodies. Variant antibodies of the present invention may comprise framework (FR) alterations, that is outside the hypervariable region, for instance in the Fc region, which alterations may be associated with advantageous properties, such as changing the functional or pharmacokinetic properties of the antibodies. For example, a substitution or other modification (insertion, deletion, terminal sequence additions or combination of any thereof) in a framework region or constant domain may be associated with an increase in the half-life of the variant antibody with respect to the parent antibody, or may be made to alter the immunogenicity of the variant antibody with respect to the parent antibody, to provide a site for covalent or non-covalent binding to another molecule, or to alter such properties as complement fixation, for instance resulting in a decrease or increase of C1q binding and CDC or of FcyR binding and antibody-dependent cellular cytotoxicity (ADCC). Substitutions may for example be made in one or more of the amino acid residues 234, 235, 236, 237, 297, 318, 320, and 322 of the heavy chain constant region, thereby causing an alteration in an effector function while retaining binding to antigen as compared with the unmodified antibody, cf. US 5,624,821 and US 5,648,260. Further reference may be had to WO 00/42072 disclosing antibodies with altered Fc regions that increase ADCC, and WO 94/29351 disclosing antibodies having mutations in the N-terminal region of the CH2 domain that alter the ability of the antibodies to bind to FcRI and thereby decreases the ability of the antibodies to bind to C1q which in turn decreases the ability of the antibodies to fix complement. Furthermore, Shields et al., J. Biol. Chem. 276, 6591-6604 (2001) teaches combination variants, that improve FcγRIII binding, for instance T256A/S298A, S298A/E333A, and S298A/E333A/K334A, .
The in vivo half-life of the antibodies may also be improved by modifying the salvage receptor epitope of the Ig constant domain or an Ig-like constant domain such that the molecule does not comprise an intact CH2 domain or an intact Ig Fc region, cf. US 6,121 ,022 and US 6,194,551. The in vivo half-life may furthermore be increased by making mutations in the Fc region, e.g. by substituting threonine for leucine at position 252, threonine for serine at position 254, or threonine for phenylalanine at position 256, cf. US 6,277,375.
In one embodiment, the present invention provides variant anti-IL-21 antibodies wherein potential T cell epitopes in the antibody have been reduced or eliminated through rationale design. Thus, for example, in one embodiment the present invention provides a "deimmunized" anti-IL-21 antibody in which the potential T cell epitopes have been eliminated. The design and construction of deimmunized anti-IL-21 antibodies may be accomplished by any suitable known technique (see for instance WO9852976 with respect to methods for preparing deimmunized antibodies). Immunogenicity in humans is expected to be eliminated or substantially reduced when such IL-21 BPs (e.g., anti-IL-21 variant antibodies) are administered according to the present invention.
Other framework mutations may include sequence changes which may reduce susceptibility to proteolysis, reduce susceptibility to oxidation, and/or confer or modify other physicochemical or functional properties on the associated variant antibody.
Amino acid sequence variations in the framework may also result in an altered glycosylation pattern in the variant antibody with respect to a parent antibody. By altering is meant deleting one or more carbohydrate moieties found in the parent antibody, and/or adding one or more glycosylation sites that are not present in the parent antibody. Glycosylation of antibodies is typically either N-linked or O-linked. N-linked refers to the attachment of the carbohydrate moiety to the side chain of an asparagine residue. The tripeptide sequences asparagine-X-serine and asparagine-X-threonine, where X is any amino acid except proline, are common recognition sequences for enzymatic attachment of the carbohydrate moiety to the asparagine side chain. Thus, the presence of either of these tripeptide sequences in a polypeptide may create a potential glycosylation site. O-linked glycosylation refers to the attachment of sugars such as N-aceylgalactosamine, galactose, or xylose to a hydroxyamino acid, most commonly serine or threonine, although 5-hydroxy- proline or 5-hydroxylysine may also be used. Addition of glycosylation sites to the antibody may be conveniently accomplished by altering the amino acid sequence such that it contains one or more of the above-described tripeptide sequences (for N-linked glycosylation sites). The alteration may also be made by the addition of, or substitution by, one or more serine or threonine residues to the sequence of the original antibody (for O-linked glycosylation sites).
The antibodies may also be expressed in a transfectoma which does not add the fucose unit normally attached to the carbohydrate attched to Asn at position 297 of Fc in order to enhance the affinity of Fc for FcγRIII which in turn will result in an increased ADCC of the antibodies in the presence of NK cells, cf. Shield et al., J. Biol. Chem. 277, 26733 (2002). Furthermore, modification of galactosylation may be made in order to modify CDC. Further reference may be had to WO 99/54342 and Umana et al., Nat. Biotechnol. X7_, 176 (1999) disclosing a CHO cell line engineered to express Gntlll resulting in the expression of monoclonal antibodies with altered glycoforms and improved ADCC activity.
Other potentially suitable techniques for preparing novel anti-IL-21 antibodies include CDR walking mutagenesis, antibody chain shuffling, "parsimonious mutagenesis" (Balint and Larrick, Gene 137, 109-118 (1993)), and other affinity maturation techniques (see for instance Wu et al., PNAS USA 95, 6037-42 (1998)). Repertoire cloning procedures may also be useful in the production of variant antibodies (see for instance WO 96/33279). There are a number of techniques known for generating CDR variants, any suitable technique or combination of which may be used in the context of the present invention for generating CDR variants of the CDRs of the antibodies of the examples. Examples of such techniques include the removal of nonessential residues as described in Studnicka et al., Protein Engineering 7, 805-814 (1994) (see also Soderlind et al., Immunotechnology. 4(3-4), 279-85 (1999), CDR walking mutagenesis and other artificial affinity maturation techniques (see for instance Yang et al., Journal of Molecular Biology 254(3), 392-403 (1995), CDR shuffling techniques wherein typically CDRs are amplified from a diverse set of gene templates optionally comprising synthetic oligonucleotides, the constant regions of the VL, VH, and/or CDRs are amplified, and the various fragments mixed (in single-stranded or double- stranded format) and assembled by polymerase chain reaction (PCR) to produce a set of antibody-fragment encoding gene products carrying shuffled CDR introduced into the master framework, which is amplified using external primers annealing to sites beyond inserted restriction sites to ensure production of full-length products, which are inserted into a vector of choice and used to expressed variant CDR-containing proteins. Appropriate structure may be determined by superimposition of the variant/mimetic structures and those of the parent sequences, e.g., by comparison of NMR solution structures. Useful methods for rational design of CDR sequence variants are described in for instance WO 91/09967 and WO 93/16184. Additional examples of such methods are provided elsewhere herein. The present invention also provides "fragments" of antibodies (including variant antibodies) of the present invention, which fragments has the ability to bind to IL-21 (IL-21 binding fragments). IL-21 BPs thus include antibody-like molecules that comprise less than the full tetrameric structure associated with naturally-occurring antibodies. An antibody "fragment" may be any peptide that comprises a portion of a full length antibody, generally the antigen binding or variable region thereof (this includes, for example, fragments of humanized antibodies comprising CDRs from an antibody of the present invention, variants thereof, or other CDRs that allow the antigen fragment to compete with an antibody of the present invention for IL-21 binding). In one embodiment, an antibody fragment refers to a peptide that consists essentially or consists only of a portion of an antibody molecule. In one embodiment, the present invention provides an antibody fragment comprising at least a portion of a heavy chain variable domain containing one or more VH CDRs of an antibody of the present invention and optionally also a light chain-variable domain comprising one or more VL CDRs of an antibody of the present invention, wherein the heavy chain variable domain, and optionally the light chain variable domain, optionally is (are) fused to an additional moiety, such as an immunoglobulin constant domain. Constant domain sequences may be added to the heavy chain and/or light chain sequence(s) to form species with partial length heavy and/or light chain(s). Constant regions, or portions thereof, of any antibody isotype may be used for this purpose, including IgG, IgM, IgA, IgD, and IgE constant regions.
Examples of IL-21-binding antibody fragments include Fab, Fab', F(ab')2, and Fv fragments. An antibody fragment in the context of the present invention may also include a a peptide comprising a CDR, and the like. In one embodiment, the present invention provides an antibody fragment comprising a first polypeptide chain that comprises any of the heavy chain CDRs described herein and a second polypeptide chain that comprises any of the light chain CDRs described herein, wherein the two polypeptide chains are covalently linked by one or more interchain disulfide bonds. In one embodiment, the present invention provides a two-chain antibody fragment having such features wherein the antibody fragment is selected from Fab, Fab', Fab'-SH, Fv, and/or F(ab')2 fragments.
Antibodies may be fragmented using conventional techniques, and the fragments screened for utility in the same manner as described above for whole antibodies. For example, F(ab')2 fragments may be generated by treating antibody with pepsin. The resulting F(ab')2 fragment may be treated to reduce disulfide bridges to produce Fab' fragments. Fab fragments may be obtained by treating an IgG antibody with papain; F(ab') fragments may be obtained with pepsin digestion of IgG antibody. A F(ab') fragment may also be produced by binding Fab' described below via a thioether bond or a disulfide bond. A Fab' fragment is an antibody fragment obtained by cutting a disulfide bond of the hinge region of the F(ab')2. A Fab' fragment may be obtained by treating a F(ab')2 fragment with a reducing agent, such as dithiothreitol. Antibody fragment peptides may also be generated by expression of nucleic acids encoding such peptides in recombinant cells (see for instance Evans et al., J. Immunol. Meth. 184, 123-38 (1995)). For example, a chimeric gene encoding a portion of a F(ab')2 fragment could include DNA sequences encoding the CH1 domain and hinge region of the H chain, followed by a translational stop codon to yield such a truncated antibody fragment molecule. From the aforegoing, it is understood that the term "fragment" does not imply any method of production (e.g., a "fragment" need not be made by "fragmentation").
IL-21 BPs also include univalent antibodies and single chain antibodies. Single chain antibodies are peptides in which the heavy and light chain Fv regions are connected. In one embodiment, the present invention provides a single-chain Fv (scFv) wherein the heavy and light chains in the Fv of an anti-IL-21 antibody of the present invention are joined with a flexible peptide linker (typically of about 10, 12, 15 or more amino acid residues) in a single peptide chain. Methods of producing such antibodies are described in for instance US 4,946,778, Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds. Springer-Verlag, New York, pp. 269-315 (1994), Bird et al., Science 242, 423-426 (1988), Huston et al., PNAS USA 85, 5879-5883 (1988) and McCafferty et al., Nature 348, 552-554 (1990). The single chain antibody may be monovalent, if only a single VH and VL are used, bivalent, if two VH and VL are used, or polyvalent, if more than two VH and VL are used.
In one embodiment of the present invention, an IL-21 BP may be derivatized or linked to another functional molecule, for instance another peptide or protein (such as a Fab' fragment) to generate a bispecific or multispecific molecule which binds to multiple binding sites or target epitopes (examples of bispecific and multispecific antibodies are discussed elsewhere herein). For example, an antibody of the present invention may be functionally linked (for instance by chemical coupling, genetic fusion, noncovalent association or otherwise) to one or more other binding molecules, such as another antibody, peptide or binding mimetic. In one embodiment, the IL-21 BP is an antibody of the present invention.
Bispecific and multispecific molecules of the present invention may further include a third binding specificity, in addition to the anti-IL-21 binding specificity. Such molecules may for instance be prepared as described in WO2006/072620.
In one embodiment, the bispecific and multispecific molecules of the present invention comprise as a binding specificity at least one further antibody, including, e.g., an Fab, Fab', F(ab')2, Fv, or a scFv. The further antibody may also be a light chain or heavy chain dimer, or any minimal fragment thereof such as a Fv or a single chain construct as described in Ladner et al., in US 4,946,778. The antibody may also be a binding-domain immunoglobulin fusion protein as disclosed in US 2003/0118592 and US 2003/0133939.
In one embodiment, an IL-21 BP of the present invention is a multispecific anti-IL-21 antibody or antibody-like molecule, a particular example of which is a bispecific antibody comprising at least one pair of VH sequence and VL sequence chains specific for an epitope comprised at least in part in IL-21 and a second at least one pair of VH and VL sequence chains specific for a second epitope. The VH and VL sequences in a bispecific antibody may comprise complete VH and VL sequences corresponding to anti-IL-21 VH and VL regions, variant VH and/or VL sequences, or suitable portions of VH and/or VL regions, such as a suitable combination of CDR sequences and other sequences sufficient to provide binding to the epitopes of interest.
In one embodiment, a bispecific antibody of the present invention is a diabody. Bispecific antibodies also include cross-linked or "heteroconjugate" antibodies. For example, one of the antibodies in a heteroconjugate may be coupled to avidin and the other to biotin. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells (see for instance US 4,676,980). Heteroconjugate antibodies may be made using any convenient cross-linking methods. Suitable peptide cross-linking agents and techniques are well known in the art, and examples of such agents and techniques are disclosed in for instance US 4,676,980. Thus, although the discussion herein may focus on antibodies, it should be understood that the embodiments and features of the antibodies may equally be applied to antibody fragments, such as Fab fragments, Fab' fragments, and scFv peptides, antibody- like peptides (peptides comprising a CDR), bi- and multi-specific antibodies and other IL-21 BPs, as appropriate, provided that the IL-21 BP of the present invention retains at least a substantial proportion of the antigen-binding properties of the corresponding complete antibody. In some instances, antibody fragments may be associated with lower antigen- binding affinity, but may offer other advantageous features that may offset for any such loss in affinity.
IL-21 BPs of the present invention, and particularly anti-IL-21 antibodies may be selected based on their ability to provide the ability of complement fixation, or not. There are a number of isotypes of antibodies that are capable of complement fixation and CDC, including, without limitation, the following: murine IgM, murine lgG2a, murine lgG2b, murine lgG3, human IgM, human IgGI , and human lgG3. Those isotypes that do not include, without limitation, human lgG2 and human lgG4. lsotype determination and other methods for modifying the complement fixation and CDC functional characteristics of antibodies are known in the art.
IL-21 BPs of the present invention also include immunoadhesins, which are molecules wherein one or more CDRs of an anti-IL-21 antibody are covalently or noncovalently associated with the molecule. An immunoadhesin may incorporate the CDR(s) as part of a larger polypeptide chain, may covalently link the CDR(s) to another polypeptide chain, or may incorporate the CDR(s) noncovalently. The CDRs permit the immunoadhesin to specifically bind to an IL-21.
The present invention also provides IL-21 BP fusion proteins. IL-21 BP fusion proteins may comprise any suitable amino acid sequence or combination of sequences that are specific and/or selective for at least one domain that is at least partially comprised within IL-21 (e.g., an anti-IL-21 antibody VH domain, VL domain, or particular CDRs thereof) and at least one nonhomologous and typically substantially nonsimilar amino acid sequence (e.g., less than about 40%, less than about 35%, less than about 30%, less than about 25%, or less than about 20% amino acid sequence identity to the IL-21 -specific/selective sequence) that imparts a detectable biological function and/or characteristic to the fusion protein that cannot solely be attributed to the I L-21 -specific/selective sequence (e.g., increased in vivo half-life, fluorescence, increased targeting to a particular type of cell, etc.). Functional sequences of such a fusion protein may be separated by flexible linker(s). Secondary sequence(s) may also be derived from cytotoxic or apoptotic peptides. Secondary sequences may also confer diagnostic properties. Examples of such sequences include those derived from easily visualized enzymes such as horseradish peroxidase.
IL-21 BP fusion proteins may also be characterized by comprising an epitope tag. An epitope tag sequence is an amino acid sequence having enough residues to provide an epitope against which an antibody may be made, in the context of the IL-21 BP, yet is short enough such that it does not substantially interfere with the activity (selectivity, specificity, affinity, and/or biological activity) of the IL-21 BP (as compared to a parent IL-21 BP lacking the epitope tag). An epitope tag desirably is sufficiently unique so that the anti-epitope tag antibody does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least about 6 amino acid residues and usually between about 8-50 amino acid residues (e.g., about 9-30 residues). Examples of epitope tags include the flu HA tag polypeptide and its antibody 12CA5 (Field et al., MoI. Cell. Biol. 8, 2159-2165 (1988)); the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto (Evan et al., MoI. Cell. Biol. 5(12), 3610-3616 (1985)) and the Herpes Simplex virus glycoprotein D (gD) tag and its antibody (Paborsky et al., Protein Engineering 3(6), 547-553 (1990)). In certain embodiments, the epitope tag is a "salvage receptor binding epitope". As used herein, the term "salvage receptor binding epitope" refers to an epitope of the Fc region of an IgG molecule (for instance IgGI , lgG2, lgG3, or lgG4) that is responsible for increasing the in vivo serum half-life of the IgG molecule.
IL-21 BPs of the present invention also include IL-21 BP derivatives. IL-21 BP derivatives may be produced by chemically conjugating a radioisotope, protein, or other agent/moiety/compound to the N-terminal side or C-terminal side of the I L-21 BP or subunit thereof (e.g., an anti-IL-21 antibody H chain, L chain, or anti-IL-21 specific/selective fragment thereof), an appropriate substituent group or side chain or to a sugar chain in the IL-21 BP (see, e.g., Antibody Engineering Handbook, edited by Osamu Kanemitsu, published by Chijin Shokan (1994)). Derivatives may also be generated by conjugation at internal residues or sugars, where appropriate.
A derivative may for instance be a peptide in which one or more of the amino acid residues of the peptide have been chemically modified (e.g. by alkylation, acylation, ester formation, or amide formation) or covalently associated with one or more heterologous substituents (e.g., a lipophilic substituent, a PEG moiety, a peptide side chain linked by a suitable organic moiety linker, etc.). The peptide may also be conjugated to a therapeutic moiety, such as a cytotoxin, a chemotherapeutic drug, an immunosuppressant, or a radioisotope (a socalled immunoconjugate). In general, IL-21 BPs described herein may be modified by inclusion of any suitable number of such modified amino acids and/or associations with such conjugated substituents. Suitability in this context is generally determined by the ability to at least substantially retain IL-21 selectivity and/or specificity associated with the non-derivatized parent IL-21 BP. The inclusion of one or more modified amino acids may be advantageous in, for example, increasing polypeptide serum half-life, reducing polypeptide antigenicity, or increasing polypeptide storage stability. Amino acid(s) are modified, for example, co-translationally or post-translationally during recombinant production (e. g., N-linked glycosylation at N-X-S/T motifs during expression in mammalian cells) or modified by synthetic means. Non-limiting examples of a modified amino acid include a glycosylated amino acid, a sulfated amino acid, a prenlyated (e. g., farnesylated, geranylgeranylated) amino acid, an acetylated amino acid, an acylated amino acid, a PEGylated amino acid, a biotinylated amino acid, a carboxylated amino acid, a phosphorylated amino acid, and the like. References adequate to guide one of skill in the modification of amino acids are replete throughout the literature. Example protocols are found in Walker (1998) Protein Protocols On Cd-Rom, Humana Press, Towata, NJ. The modified amino acid may for instance be selected from a glycosylated amino acid, a PEGylated amino acid, a farnesylated amino acid, an acetylated amino acid, a biotinylated amino acid, an amino acid conjugated to a lipid moiety, or an amino acid conjugated to an organic derivatizing agent.
For instance, antibodies may be chemically modified by covalent conjugation to a polymer to for instance increase their circulating half-life. Exemplary polymers, and methods to attach them to peptides, are illustrated in for instance US 4,766,106, US 4,179,337, US 4,495,285 and US 4,609,546. Additional illustrative polymers include polyoxyethylated polyols and polyethylene glycol (PEG) (e.g., a PEG with a molecular weight of between about 1 ,000 and about 40,000, such as between about 2000 and about 20,000, e.g., about 3,000-12,000). In one embodiment, the present invention provides an IL-21 BP that is conjugated to a second molecule that is selected from a radionuclide, an enzyme, an enzyme substrate, a cofactor, a fluorescent marker, a chemiluminescent marker, a peptide tag, or a magnetic particle. In one embodiment, an IL-21 BP may be conjugated to one or more antibody fragments, nucleic acids (oligonucleotides), nucleases, hormones, immunomodulators, chelators, boron compounds, photoactive agents, dyes, and the like. These and other suitable agents may be coupled either directly or indirectly to IL-21 BPs of the present invention. One example of indirect coupling of a second agent is coupling by a spacer moiety. These spacers, in turn, may be either insoluble or soluble (see for instance Diener et al., Science 231 , 148 (1986)) and may be selected to enable drug release from the IL-21 BP at a target site and/or under particular conditions. Additional examples of therapeutic agents that may be coupled to IL-21 BPs include lectins and fluorescent peptides.
In one embodiment, IL-21 BP derivatives comprising one or more radiolabeled amino acids are provided. A radiolabeled IL-21 BP may be used for both diagnostic and therapeutic purposes (conjugation to radiolabeled molecules is another possible feature). Nonlimiting examples of labels for polypeptides include, but are not limited to 3H, 14C, 15N, 35S, 9OY, 99Tc, and 1251, 1311, and 186Re. Methods for preparing radiolabeled amino acids and related peptide derivatives are known in the art (see for instance Junghans et al., in Cancer Chemotherapy and Biotherapy 655-686 (2d edition, Chafner and Longo, eds., Lippincott Raven (1996)) and US 4,681 ,581 , US 4,735,210, US 5,101 ,827, US 5,102,990 (US RE35,500), US 5,648,471 and US 5,697,902. For example, a radioisotope may be conjugated by a chloramine T method.
Advantageous radionuclides in diagnostic contexts are indium isotopes and in the context of therapeutic applications yttrium isotopes, which are cytotoxic. Photon-emitting radioisotopes, in general, are advantageous in diagnostic (radioimmunoscintigraphy (RIS)) methods. Auger electrons have a very short path length (5-10 nm) and need to be internalized to be cytotoxic (see for instance Adelstein et al., Nucl. Med. Biol. 14, 165-169 (1987)). Accordingly, peptides conjugated to such isotopes may be useful in diagnostic methods, but only peptides that are internalized should be considered for radioisotopes that emit Auger electrons in therapeutic contexts. Alpha particles need to be close to a cell (within 3-4 cell diameters) to be effective as therapeutic agents (Vriesendorp et al.,
"Radioimmunoglobulin therapy," in High Dose Cancer Therapy Armitage et al., (eds). (Williams & Wilkins, Baltimore, Md. 1992)). Both Auger electrons and alpha emitters may be considered to have high selectivity because their short-range emission typically will not irradiate neighboring normal cells. The radiometals 111In and 90Y are, respectively, a pure γ-emitter and a pure β-emitter. lodine-125, the most commonly used emitter of Auger electrons, has a half-life of about 60 days and frequently is released by immunoconjugates in vivo (due to dehalogenation). The most commonly considered alpha emitters for clinical use, astatine-21 1 and bismuth-212, have relatively short half-lives (7.2 h and 1.0 h, respectively) and decay into radioactive isotopes that may not be retained by the immunoconjugate after the first alpha emission (Wilbur, Antibiot. Immunoconjug. Radiopharm. 4, 5-97 (1991)). For diagnostic applications, IL-21 BPs labeled with indium-11 1 or technetium-99m may be used. Both of these isotopes emit gamma rays within the appropriate energy range for imaging, (100-250 keV). Energies below this range typically are not penetrating enough to reach an external imaging device. Higher energy levels are difficult to collimate and provide diagnostic images with poor resolution. The short-half life of 99Tc typically restricts its use to immunoconjugates with rapid tumor uptake.
In one embodiment, first and second IL-21 BPs conjugated with first and second radioisotopes are provided. In another embodiment, a single IL-21 BP conjugated with two radioisotopes is provided. An advantage of using two separate radioisotopes, e.g., one for imaging and one for therapy, is that it facilitates outpatient treatment. The low amount of radioactivity used diagnostically does not represent a radiation hazard, while the radiation emitted by a therapeutic isotope, such as a pure β-emitter, typically will largely be absorbed in the vicinity of the targeted cells. Radioisotopes may be attached directly or indirectly to an IL-21 BP. The radioisotopes 125I, 131I, 99Tc, 186Re, and 188Re may be, for example, covalently bound to proteins (including antibodies) through amino acid functional groups. For radioactive iodine it is usually through the phenolic group found on tyrosine. There are numerous methods to accomplish this: chloramine-T (see for instance Greenwood et al., Biochem J. 89, 114-123 (1963) and lodogen (Salacinski et al., Anal. Biochem. V\l_, 136-146 (1981)). Tc and Re isotopes may be covalently bound through the sulfhydryl group of cysteine (see for instance Griffiths et al., Cancer Res. 51., 4594-4602 (1991)). However, such compositions may be relatively better suited for diagnostic purposes as the body often can break these covalent bonds, releasing the radioisotopes to the circulatory system. A IL-21 BP may also be labeled with enzymes that are useful for detection, such as horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase, glucose oxidase, and the like. A IL-21 BP may also be labeled with biotin, and accordingly detected through indirect measurement of avidin or streptavidin binding. A IL-21 BP may also be labeled with a predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags, etc.). Additional examples of enzyme conjugate candidates include malate dehydrogenase, staphylococcal nuclease, delta-V-steroid isomerase, yeast alcohol dehydrogenase, α-glycerophosphate dehydrogenase, triose phosphate isomerase, asparaginase, glucose oxidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase, and acetylcholinesterase. Additional exemplary labeling moieties generally include, but are not limited to spin- labeled molecules and other labeling moieties of diagnostic value.
In one embodiment, the present invention provides crosslinked IL-21 BP derivatives. For example, such an IL-21 BP derivative may be produced by crosslinking two or more antibodies, at least one of which is specific/selective for IL-21 (of the same type or of different types, e.g., to create bispecific antibodies). Suitable crosslinkers include those that are heterobifunctional, having two distinctly reactive groups separated by an appropriate spacer (e.g., m-maleimidobenzoyl-N-hydroxysuccinimide ester) or homobifunctional (e.g., disuccinimidyl suberate). Such linkers are available from Pierce Chemical Company, Rockford, III.
IL-21 BPs may also be derivatized with a detection agents, for instance fluorescent compounds, including fluorescein, fluorescein isothiocyanate, rhodamine, 5-dimethylamine- 1-napthalenesulfonyl chloride, lanthanide phosphors, and the like. Additional examples of suitable fluorescent labels include a 125Eu label, an isothiocyanate label, a phycoerythrin label, a phycocyanin label, an allophycocyanin label, an o-phthaldehyde label, a fluorescamine label, etc. Examples of chemiluminescent labels include luminal labels, isoluminal labels, aromatic acridinium ester labels, imidazole labels, acridinium salt labels, oxalate ester labels, a luciferin labels, luciferase labels, aequorin labels, etc.
In one embodiment, an IL-21 BP derivative comprises a conjugated nucleic acid or nucleic acid-associated molecule. In one such facet of the present invention, the conjugated nucleic acid is a cytotoxic ribonuclease. In one embodiment, the conjugated nucleic acid is an antisense nucleic acid (for instance a S100A10 targeted antisense molecule, which may also be an independent component in a combination composition or combination administration method of the present invention - see for instance Zhang et al., J Biol Chem. 279(3), 2053-62 (2004)). In one embodiment, the conjugated nucleic acid is an inhibitory RNA molecule (e.g., a siRNA molecule). In one embodiment, the conjugated nucleic acid is an immunostimulatory nucleic acid (e.g., an immunostimulatory CpG motif-containing DNA molecule). In one embodiment, the conjugated nucleic acid is an expression cassette coding for expression of a tumor suppressor gene, anti-cancer vaccine, anti-cancer cytokine, or apoptotic agent. Such derivatives also may comprise conjugation of a nucleic acid coding for expression of one or more cytotoxic proteins, such as plant and bacterial toxins.
In one embodiment, an IL-21 BP is conjugated to a functional nucleic acid molecule. Functional nucleic acids include antisense molecules, interfering nucleic acid molecules (e.g., siRNA molecules), aptamers, ribozymes, triplex forming molecules, and external guide sequences. The functional nucleic acid molecules may act as affectors, inhibitors, modulators, and stimulators of a specific activity possessed by a target molecule, or the functional nucleic acid molecules may possess a de novo activity independent of any other molecules. A representative sample of methods and techniques which aid in the design and use of antisense molecules may be found in the following non-limiting list of US patents: US 5,135,917, US 5,294,533, US 5,627,158, US 5,641 ,754, US 5,691 ,317, US 5,780,607, US 5,786,138, US 5,849,903, US 5,856,103, US 5,919,772, US 5,955,590, US 5,990,088, US 5,994,320, US 5,998,602, US 6,005,095, US 6,007,995, US 6,013,522, US 6,017,898, US 6,018,042, US 6,025,198, US 6,033,910, US 6,040,296, US 6,046,004, US 6,046,319 and US 6,057,437. In one embodiment, an IL-21 BP is conjugated to an aptamer. Aptamers are molecules that interact with a target molecule, for instance in a specific way. Typically aptamers are small nucleic acids ranging from 15-50 bases in length that fold into defined secondary and tertiary structures, such as stem-loops or G-quartets. Aptamers can bind small molecules, such as ATP (US 5,631 ,146) and theophiline (US 5,580,737), as well as large molecules, such as reverse transcriptase (US 5,786,462) and thrombin (US 5,543,293). Representative examples of how to make and use aptamers to bind a variety of different target molecules may be found in the following non-limiting list of US patents: US 5,476,766, US 5,503,978, US 5,631 ,146, US 5,731 ,424, US 5,780,228, US 5,792,613, US 5,795,721 , US 5,846,713, US 5,858,660, US 5,861 ,254, US 5,864,026, US 5,869,641 , US 5,958,691 , US 6,001 ,988, US 6,01 1 ,020, US 6,013,443, US 6,020,130, US 6,028,186, US 6,030,776 and US 6,051 ,698.
In one embodiment, the present invention provides an IL-21 BP which is conjugated to a ribozyme. Ribozymes are nucleic acid molecules that are capable of catalyzing a chemical reaction, either intramolecularly or intermolecularly. Ribozymes are thus catalytic nucleic acids. There are a number of different types of ribozymes that catalyze nuclease or nucleic acid polymerase type reactions which are based on ribozymes found in natural systems, such as (a) hammerhead ribozymes, (described in for example US 5,334,711 , US 5,436,330, US 5,616,466, US 5,633,133, US 5,646,020, US 5,652,094, US 5,712,384, US 5,770,715, US 5,856,463, US 5,861 ,288, US 5,891 ,683, US 5,891 ,684, US 5,985,621 , US 5,989,908, US 5,998,193, US 5,998,203, WO 9858058, WO 9858057 and WO 9718312), (b) hairpin ribozymes (described in for instance US 5,631 , 115, US 5,646,031 , US 5,683,902, US 5,712,384, US 5,856,188, US 5,866,701 , US 5,869,339 and US 6,022,962), and (c) tetrahymena ribozymes (described in for instance US 5,595,873 and US 5,652,107). There are also a number of ribozymes that are not found in natural systems, but which have been engineered to catalyze specific reactions de novo (examples of which are described in for instance US 5,580,967, US 5,688,670, US 5,807,718 and US 5,910,408). Ribozymes typically cleave RNA or DNA substrates, and more commonly cleave RNA substrates. Ribozymes typically cleave nucleic acid substrates through recognition and binding of the target substrate with subsequent cleavage. This recognition is often based mostly on canonical or non-canonical base pair interactions. This property makes ribozymes particularly good candidates for target specific cleavage of nucleic acids because recognition of the target substrate is based on the target substrates sequence. Representative examples of how to make and use ribozymes to catalyze a variety of different reactions may be found in the following non-limiting list of US patents: US 5,646,042, US 5,693,535, US 5,731 ,295, US 5,811,300, US 5,837,855, US 5,869,253, US 5,877,021, US 5,877,022, US 5,972,699, US 5,972,704, US 5,989,906 and US 6,017,756.
In one embodiment, the present invention provides an IL-21 BP that is conjugated to a triplex forming function nucleic acid. Such nucleic acid molecules can interact with either double-stranded or single-stranded nucleic acid. When triplex molecules interact with a target region, a structure called a triplex is formed, in which three strands of DNA form a complex dependant on both Watson-Crick and Hoogsteen base-pairing. Triplex molecules can bind target regions with high affinity and specificity. Representative examples of how to make and use triplex forming molecules to bind a variety of different target molecules may be found in the following non-limiting list of US patents: US 5,176,996, US 5,645,985, US 5,650,316, US 5,683,874, US 5,693,773, US 5,834,185, US 5,869,246, US 5,874,566 and US 5,962,426.
In one embodiment, an IL-21 BP is conjugated to an external guide sequence. External guide sequences (EGSs) are molecules that bind a target nucleic acid molecule forming a complex that is recognized by RNase P, which cleaves the target molecule. EGSs may be designed to specifically target a RNA molecule of choice. RNAse P aids in processing transfer RNA (tRNA) within a cell. Bacterial RNAse P may be recruited to cleave virtually any RNA sequence by using an EGS that causes the target RNA:EGS complex to mimic the natural tRNA substrate, (see for instance WO 92/03566 and Forster and Altman, Science 238, 407-409 (1990) for discussion). Representative examples of how to make and use EGS molecules to facilitate cleavage of a variety of different target molecules are provided in the following non-limiting list of US patents: US 5,168,053, US 5,624,824, US 5,683,873, US 5,728,521 , US 5,869,248 and US 5,877,162.
In one embodiment, an IL-21 BP is conjugated to an interfering nucleic acid molecule, such as a siRNA or other RNAi molecule (e.g., an inhibitory double stranded (ds) RNA molecule of about 20-25 nucleotides), which is targeted to interfere with the action of a target gene expression product, such as a gene expression product involved in an IL-21 mediated disease or condition. Methods for the production and use of interfering nucleic acid molecules are provided in for instance Nishikura, Cell. 107(4), 415-8 (2001), Fjose et al., Biotechnol Annu Rev. 7, 31-57 (2001 ), Hanon, Nature 418, 244-51 (2002), Brantl, Biochim Biophys Acta. 1575(1-3). 15-25 (2002), Tuschl, Chembiochem. 2(4), 239-45 (2001), Caplen, Expert Opin Biol Ther. 3(4), 575-86 (2003), Lu et al., Curr Opin MoI Ther. 5(3), 225-34 (2003), Shuey et al., Drug Discov Today. 7(20), 1040-6 (2002), Shi, Trends Genet. 19(1), 9-12 (2003), Kovar et al., Semin Cancer Biol. 13(4), 275-81 (2003), Lavrey et al., Curr Opin Drug Discov Devel. 6(4), 561 -9 (2003), Clewey, Commun Dis Public Health. 6(2), 162-3 (2003), Duxbury et al., J Surg Res. H7(2), 339-44 (2004), Caplen et al., Ann N Y Acad Sci. 1002, 56-62 (2003), WO 01/75164, US 6,506,559, US 20040086884, US 20040077574, US 20040063654, US 20040033602, US 20030167490, US 20030157030, US 200301 14409, US 20030108923, US 200400141 13 and US 20020132788.
In one embodiment, an IL-21 BP is conjugated to a tumor targeting domain peptide or molecule. In one embodiment, an IL-21 BP is conjugated to a tumor targeting factor VII sequence.
Any method known in the art for conjugating the IL-21 BP to the conjugated molecule(s), such as those described above, may be employed, including those methods described by Hunter et al., Nature 144, 945 (1962), David et al., Biochemistry 13, 1014 (1974), Pain et al., J. Immunol. Meth. 40, 219 (1981 ) and Nygren, J. Histochem. and Cytochem. 30, 407 (1982). Linkage/conjugation may be accomplished in any suitable way. For example, a covalent linkage may take the form of a disulfide bond (if necessary and suitable, an IL-21 BP could be engineered to contain an extra cysteine codon, which desirably does not interfere with the IL-21 binding activity of the molecule. A toxin molecule, derivatized with a sulfhydryl group reactive with the cysteine of the modified IL-21 BP, may form an immunoconjugate with the IL-21 BP peptide. Alternatively, a sulfhydryl group may be introduced directly to an IL-21 BP using solid phase polypeptide techniques. For example, the introduction of sulfhydryl groups into peptides is described by Hiskey, Peptides 3, 137 (1981). The introduction of sulfhydryl groups into proteins is described in Maasen et al., Eur. J. Biochem. 134, 32 (1983). Once the correct sulfhydryl groups are present, the cytotoxin and IL-21 BP may be purified, both sulfur groups reduced; cytotoxin and ligand mixed (for instance in a ratio of about 1 :5 to 1 :20); and disulfide bond formation allowed to proceed to completion (generally about 20 to 30 minutes) at room temperature. The mixture may then be dialyzed against phosphate buffered saline or chromatographed in a resin such as Sephadex to remove unreacted ligand and toxin molecules. Numerous types of cytotoxic compounds may be joined to proteins through the use of a reactive group on the cytotoxic compound or through the use of a cross-linking agent. A common reactive group that will form a stable covalent bond in vivo with an amine is isothiocyanate (Means et al., Chemical modifications of proteins (Holden-Day, San Francisco 1971 ) pp. 105-1 10). This group preferentially reacts with the ε-amine group of lysine.
Maleimide is a commonly used reactive group to form a stable in vivo covalent bond with the sulfhydryl group on cysteine (Ji., Methods Enzymol 91., 580-609 (1983)). Monoclonal antibodies typically are incapable of forming covalent bonds with radiometal ions, but they may be attached to the antibody indirectly through the use of chelating agents that are covalently linked to the antibodies. Chelating agents may be attached through amines
(Meares et al., Anal. Biochem. 142, 68-78 (1984)) and sulfhydral groups (Koyama, Chem. Abstr. 120, 217262t (1994)) of amino acid residues and also through carbohydrate groups (Rodwell et al., PNAS USA 83, 2632-2636 (1986), Quadri et al., Nucl. Med. Biol. 20, 559-570 (1993)). Since these chelating agents contain two types of functional groups, one to bind metal ions and the other to joining the chelate to the antibody, they are commonly referred as bifunctional chelating agents (Sundberg et al., Nature 250, 587-588 (1974)).
Crosslinking agents that have two reactive functional groups are classified as being homo or heterobifunctional. Examples of homobifunctional crosslinking agents include bismaleimidohexane (BMH) which is reactive with sulfhydryl groups (Chen et al., J Biol Chem 266, 18237-18243 (1991)) and ethylene glycolbis[succinimidylsucciate] (EGS) which is reactive with amino groups (Browning et al., J. Immunol. 143, 1859-1867 (1989)). An example of a heterobifunctional crosslinker is m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS) (Myers et al., J. Immunol. Meth.121, 129-142 (1989)). These methodologies are simple and are commonly employed. A therapeutic or diagnostic agent may also or alternatively be attached at the hinge region of a reduced antibody component via disulfide bond formation. As an alternative, such peptides may be attached to the antibody component using a heterobifunctional cross-linker, such as N-succinyl 3-(2-pyridyldithio)proprionate (SPDP). Yu et al., Int. J. Cancer 56, 244 (1994). General techniques for such conjugation are well known in the art. See, for example, Wong, Chemistry Of Protein Conjugation And Cross-Linking (CRC Press 1991 ), Upeslacis et al., "Modification of Antibodies by Chemical Methods," In Monoclonal Antibodies: Principles And Applications, Birch et al., (eds.) (Wiley-Liss, Inc. 1995), Price, "Production and Characterization of Synthetic Peptide-Derived Antibodies," in Monoclonal Antibodies: Production, Engineering And Clinical Application, Ritter et al., (eds.) (Cambridge University Press 1995). In some embodiments, labels or other conjugated substituents are attached to the IL-21 BP amino acid sequence by spacer arms of various lengths to reduce potential steric hindrance.
Unlabeled IL-21 BP(s) may be used in combination with other labeled antibodies (second antibodies) that are reactive with the IL-21 BP(s), such as antibodies specific for human immunoglobulin constant regions that bind to anti-IL-21 mAbs. Alternatively, an IL-21 BP may be directly labeled. A wide variety of labels may be employed for direct or indirect labeling of IL-21 BPs, such as labeling with radionuclides, fluors, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, ligands (particularly haptens), etc. Amino acid sequence insertions include amino- and/or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Examples of terminal insertions include an antibody with an N-terminal methionyl residue or the antibody fused to an epitope tag. Other insertion variants of the antibody molecule include the fusion to the N- or C-terminus of the antibody of an enzyme or a polypeptide or PEG which increases the serum half-life of the antibody. Such anti-IL-21 antibody fusion proteins and similar fusion proteins comprising IL-21 BP sequences are another feature of the present invention.
A cytotoxin or cytotoxic agent includes any agent that is detrimental to (e.g., kills) cells. For a description of these classes of drugs which are well known in the art, and their mechanisms of action, see Goodman et al., Goodman and Gilman's The Pharmacological Basis Of Therapeutics, 8th Ed., Macmillan Publishing Co., 1990. Additional techniques relevant to the preparation of antibody immunotoxins are provided in for instance Vitetta, Immunol. Today 14, 252 (1993) and US 5,194,594. Suitable therapeutic agents for forming immunoconjugates of the present invention include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydro- testosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin, antimetabolites (such as methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, fludarabin, 5-fluorouracil, decarbazine, hydroxyurea, asparaginase, gemcitabine, cladribine), alkylating agents (such as mechlorethamine, thioepa, chlorambucil, melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, dacarbazine (DTIC), procarbazine, mitomycin C, cisplatin and other platinum derivatives, such as carboplatin), antibiotics (such as dactinomycin (formerly actinomycin), bleomycin, daunorubicin (formerly daunomycin), doxorubicin, idarubicin, mithramycin, mitomycin, mitoxantrone, plicamycin, anthramycin (AMC)), diphtheria toxin and related molecules (such as diphtheria A chain and active fragments thereof and hybrid molecules), ricin toxin (such as ricin A or a deglycosylated ricin A chain toxin), cholera toxin, a Shiga-like toxin (SLT-I, SLT-II, SLT-IIV), LT toxin, C3 toxin, Shiga toxin, pertussis toxin, tetanus toxin, soybean Bowman- Birk protease inhibitor, Pseudomonas exotoxin, alorin, saporin, modeccin, gelanin, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolacca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, and enomycin toxins. Therapeutic agents, which may be administered in combination with an IL-21 BP of the present invention as described elsewhere herein, may also be candidates for therapeutic moieties useful for conjugation to an IL-21 BP of the present invention.
Other examples of therapeutic cytotoxins that may be conjugated to an IL-21 BP of the present invention include calicheamicins and duocarmycins. As indicated above, the drug moiety need not be construed as limited to classical chemical therapeutic agents. For example, the drug moiety may be a protein or polypeptide possessing a desired biological activity. Such proteins may include, for example, an agent active at the cell surface, such as phospholipase enzymes, e.g. phospholipase C.
The lysing portion of a toxin typically may be readily joined to the Fab fragment of an antibody or antibody fragment of the present invention. Other suitable conjugated molecules include ribonuclease (RNase), DNase I, Staphylococcal enterotoxin-A, pokeweed antiviral protein, diphtherin toxin, and Pseudomonas endotoxin. See, for example, Pastan et al., Cell 47, 641 (1986) and Goldenberg, Calif. A Cancer Journal for Clinicians 44, 43 (1994). Additional toxins suitable for use in the present invention are known to those of skill in the art (seefor instance US 6,077,499).
Conjugates of IL-21 BPs, such as antibodies, and such cytotoxic moieties may be made using a variety of bifunctional protein coupling agents. Examples of such reagents include SPDP, IT, bifunctional derivatives of imidoesters such a dimethyl adipimidate HCI, active esters such as disuccinimidyl suberate, aldehydes such as glutaraldehyde, bis-azido compounds such as bis (p-azidobenzoyl) hexanediamine, bis-diazonium derivatives such as bis-(p-diazoniumbenzoyl)-ethylenediamine, diisocyanates such as tolylene 2,6-diisocyanate, and bis-active fluorine compounds such as 1 ,5-difluoro-2,4-dinitrobenzene and anti-mitotic agents (e.g., vincristine, vinblastine, docetaxel, paclitaxel and vinorelbin).
Techniques for conjugating such therapeutic moieties to IL-21 BPs, such as antibodies, are well known, see for instance Arnon et al., "Monoclonal Antibodies For lmmunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al., (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985), Hellstrom et al., "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al., (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987), Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies '84: Biological And Clinical
Applications, Pinchera et al., (eds.), pp. 475-506 (1985), "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al., (eds.), pp. 303-16 (Academic Press 1985) and Thorpe et al., "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates", Immunol. Rev. 62, 119-58 (1982).
In one embodiment, the present invention provides an IL-21 BP that is conjugated to a mixed toxin. A mixed toxin molecule is a molecule derived from two different (typically polypeptide) toxins. Generally, peptide toxins comprise one or more domains responsible for generalized eukaryotic cell binding, at least one enzymatically active domain, and at least one translocation domain. The binding and translocation domains are required for cell recognition and toxin entry respectively. Naturally-occurring proteins which are known to have a translocation domain include diphtheria toxin, Pseudomonas exotoxin A, and possibly other peptide toxins. The translocation domains of diphtheria toxin and Pseudomonas exotoxin A are well characterized (see for instance Hoch et al., PNAS USA 82, 1692 (1985), Colombatti et al., J. Biol. Chem. 26J., 3030 (1986) and Deleers et al., FEBS Lett. 160, 82 (1983)), and the existence and location of such a domain in other molecules may be determined by methods such as those employed by Hwang et al., Cell 48, 129 (1987) and Gray et al., PNAS USA 8J. 2645 (1984). In view of these techniques, a useful mixed toxin hybrid molecule may be formed, for example, by fusing the enzymatically active A subunit of E. coli Shiga-like toxin (Calderwood et al., PNAS USA 84, 4364 (1987)) to the translocation domain (amino acid residues 202 through 460) of diphtheria toxin, and to a molecule targeting a particular cell type, as described in US 5,906,820. The targeting portion of the three-part hybrid can cause the molecule to attach specifically to the targeted cells, and the diphtheria toxin translocation portion can act to insert the enzymatically active A subunit of the Shiga-like toxin into a targeted cell. The enzymatically active portion of Shiga-like toxin, like diphtheria toxin, acts on the protein synthesis machinery of the cell to prevent protein synthesis, thus killing the targeted cell.
Immunoconjugates according to the present invention may also comprise a radioisotope, e.g., iodine-131 , yttrium-90 or indium-1 11 , to generate cytotoxic radiopharmaceuticals for treating an I L-21 -related disorder. In one embodiment, the IL-21 BPs, such as the human antibodies of the present invention are attached to a linker-chelator, e.g., tiuxetan, which allows for the antibody to be conjugated to a radioisotope.
Additionally useful conjugate substituents include anti-cancer retinoids. Taxane conjugates (see for instance Jaime et al., Anticancer Res. 21.(2A), 1 119-28 (2001), cisplatin conjugates, thapsigargin conjugates, linoleic acid conjugates, calicheamicin conjugates (see for instance Damle et al., Curr Opin Pharmacol. 3(4), 386-90 (2003), doxorubicin conjugates, geldanamycin conjugates, and the like, also may be useful in promoting the treatment of cancer (see, generally, Trail et al., Cancer Immunol Immunother. 52(5), 328-37 (2003)). In one embodiment, the present invention provides secondary and anti-idiotypic antibodies raised against anti-IL-21 antibodies of the present invention. A secondary antibody refers to an antibody specific for, and typically raised against, an anti-IL-21 antibody. An anti-idiotypic (Id) antibody is an antibody which recognizes unique determinants generally associated with the antigen-binding site of an antibody. An Id antibody may be prepared by immunizing an animal of the same species and genetic type as the source of an anti-IL-21 mAb with the mAb to which an anti-Id is being prepared. The immunized animal typically can recognize and respond to the idiotypic determinants of the immunizing antibody by producing an antibody to these idiotypic determinants (the anti-Id antibody). Such antibodies are described in for instance US 4,699,880. Such antibodies are further features of the present invention.
An anti-Id antibody may also be used as an "immunogen" to induce an immune response in yet another animal, producing a so-called anti-anti-ld antibody. An anti-anti-ld may be epitopically identical to the original mAb, which induced the anti-Id. Thus, by using antibodies to the idiotypic determinants of a mAb, it is possible to identify other clones expressing antibodies of identical specificity. Anti-Id antibodies may be varied (thereby producing anti-Id antibody variants) and/or derivatized by any suitable technique, such as those described elsewhere herein with respect to anti-IL-21 antibodies and other IL-21 BPs of the present invention. For example, anti-Id mAbs may be coupled to a carrier such as keyhole limpet hemocyanin (KLH) and used to immunize BALB/c mice. Sera from these mice typically will contain anti-anti-ld antibodies that have the binding properties similar if not identical to an original/parent IL-21 antibody.
In one embodiment, the present invention provides a nucleic acid encoding an IL-21 BP. A IL-21 BP-encoding nucleic acid may have any suitable characteristics and comprise any suitable features or combination thereof. Thus, for example, an IL-21 BP- encoding nucleic acid may be in the form of DNA, RNA, or a hybrid thereof, and may include nonnaturally-occurring bases, a modified backbone (e.g., a phosphothioate backbone that promotes stability of the nucleic acid), or both. The nucleic acid advantageously comprises features that promote desired expression in target host cell(s), replication, and/or selection. Examples of such features include an origin of replication component, a selection gene component, a promoter component, an enhancer element component, a polyadenylation sequence component, a termination component, and the like.
In one embodiment, the present invention provides a vector comprising an IL-21 BP- encoding nucleic acid. A vector refers to a delivery vehicle that promotes the expression of an IL-21 BP-encoding nucleic acid, the production of an IL-21 BP peptide, the transfection/transformation of target cells, the replication of the IL-21 BP-encoding nucleic acid, promotes stability of the nucleic acid, promotes detection of the nucleic acid and/or transformed/transfected cells, or otherwise imparts advantageous biological function to the IL-21 BP-encoiding nucleic acid. A vector in the context of the present invention may be any suitable vector, including chromosomal, non-chromosomal, and synthetic nucleic acid vectors (a nucleic acid sequence comprising a suitable set of expression control elements). Examples of such vectors include derivatives of SV40, bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, and viral nucleic acid (RNA or DNA) vectors. In one embodiment, an IL-21 BP-encoding nucleic acid is comprised in a naked DNA or RNA vector, including, for example, a linear expression element (as described in for instance Sykes and Johnston, Nat Biotech X7_,
355-59 (1997)), a compacted nucleic acid vector (as described in for instance US 6,077, 835 and/or WO 00/70087), a plasmid vector such as pBR322, pUC 19/18, or pUC 118/119, a "midge" minimally-sized nucleic acid vector (as described in for instance Schakowski et al., MoI Ther 3, 793-800 (2001)), or as a precipitated nucleic acid vector construct, such as a CaP04-precipitated construct (as described in for instance WO 00/46147, Benvenisty and Reshef, PNAS USA 83, 9551-55 (1986), Wigler et al., Cell 14, 725 (1978), and Coraro and Pearson, Somatic Cell Genetics 7, 603 (1981)). Such nucleic acid vectors and the usage thereof are well known in the art (see for instance US 5,589,466 and US 5,973,972). In one embodiment, the vector is suitable for expression of the IL-21 BP in a bacterial cell. Examples of such vectors include, for example, vectors which direct high level expression of fusion proteins that are readily purified (for instance multifunctional E. coli cloning and expression vectors such as BlueScript (Stratagene), pi N vectors (Van Heeke & Schuster, J Biol Chem 264, 5503-5509 (1989), pET vectors (Novagen, Madison Wl) and the like). An expression vector may also or alternatively be a vector suitable for expression in a yeast system. Any vector suitable for expression in a yeast system may be employed. Suitable vectors for use in for instance Saccharomyces cerevisiae include, for example, vectors comprising constitutive or inducible promoters such as alpha factor, alcohol oxidase and PGH (reviewed in: F. Ausubel et al., ed. Current Protocols in Molecular Biology, Greene Publishing and Wiley InterScience New York (1987), and Grant et al., Methods in Enzymol 153. 516-544 (1987)).
A nucleic acid and/or vector may also comprises a nucleic acid sequence encoding a secretion/ localization sequence, which can target a polypeptide, such as a nascent polypeptide chain, to a desired cellular compartment, membrane, or organelle, or which directs polypeptide secretion to periplasmic space or into cell culture media. Such sequences are known in the art, and include secretion leader or signal peptides, organelle targeting sequences (e. g., nuclear localization sequences, ER retention signals, mitochondrial transit sequences, chloroplast transit sequences), membrane localization/anchor sequences (e. g., stop transfer sequences, GPI anchor sequences), and the like.
IL-21 BP-encoding nucleic acids may comprise or be associated with any suitable promoter, enhancer, and other expression-facilitating elements. Examples of such elements include strong expression promoters (e. g., human CMV IE promoter/enhancer as well as RSV, SV40, SL3-3, MMTV, and HIV LTR promoters), effective poly (A) termination sequences, an origin of replication for plasmid product in E. coli, an antibiotic resistance gene as selectable marker, and/or a convenient cloning site (e.g., a polylinker). Nucleic acids may also comprise an inducible promoter as opposed to a constitutive promoter such as CMV IE (the skilled artisan will recognize that such terms are actually descriptors of a degree of gene expression under certain conditions). In one embodiment, the nucleic acid may be positioned in and/or delivered to the host cell or host animal via a viral vector. Any suitable viral vector may be used in this respect, and several are known in the art. A viral vector may comprise any number of viral polynucleotides, alone or in combination with one or more viral proteins, which facilitate delivery, replication, and/or expression of the nucleic acid of the present invention in a desired host cell. The viral vector may be a polynucleotide comprising all or part of a viral genome, a viral protein/nucleic acid conjugate, a virus-like particle (VLP), a vector similar to those described in US 5,849, 586 and WO 97/04748, or an intact virus particle comprising viral nucleic acids and the nucleic acid of the present invention. A viral particle viral vector may comprise a wild-type viral particle or a modified viral particle. The viral vector may be a vector which requires the presence of another vector or wild-type virus for replication and/or expression (i.e., it may be a helper-dependent virus), such as an adenoviral vector amplicon. Typically, such viral vectors consist essentially of a wild-type viral particle, or a viral particle modified in its protein and/or nucleic acid content to increase transgene capacity or aid in transfection and/or expression of the nucleic acid (examples of such vectors include the herpes virus/AAV amplicons). Typically, a viral vector is similar to and/or derived from a virus that normally infects humans. Suitable viral vector particles in this respect, include, for example, adenoviral vector particles (including any virus of or derived from a virus of the adenoviridae), adeno-associated viral vector particles (AAV vector particles) or other parvoviruses and parvoviral vector particles, papillomaviral vector particles, flaviviral vectors, alphaviral vectors, herpes viral vectors, pox virus vectors, retroviral vectors, including lentiviral vectors. Examples of such viruses and viral vectors are in ofr instance Fields et al., eds., Virology Raven Press, Ltd., New York (3rd ed., 1996 and 4th ed., 2001), Encyclopedia of Virology, R. G. Webster et al.,eds., Academic Press (2nd ed., 1999), Fundamental Virology, Fields et al., eds., Lippincott- Raven (3rd ed., 1995), Levine, "Viruses," Scientific American Library No. 37 (1992), Medical Virology, D. O. White et al., eds., Acad. Press (2nd ed. 1994), and Introduction to Modern Virology, Dimock, N. J. et al., eds., Blackwell Scientific Publications, Ltd. (1994).
Viral vectors that may be employed with polynucleotides of the present invention and the methods described herein include adenovirus and adeno-associated vectors, as in for instance Carter, Curr Opinion Biotech 3, 533-539 (1992) and Muzcyzka, Curr Top Microbiol Immunol 158, 97-129 (1992). Additional types and aspects of AAV vectors are described in for instance Carter, Contrib. Microbiol. 4, 85-86 (2000), Smith-Arica, Curr. Cardiol. Rep. 3(1), 41-49 (2001), Taj, J. Biomed. Sci. 7(4), 279- 91 (2000), Vigna et al., J. Gene Med. 2(5), 308-16 (2000), Klimatcheva et al., Front. Biosci. 4, D481-96 (1999), Lever et al., Biochem. Soc. Trans. 27(6), 841-47 (1999), Snyder, J Gene Med. 1(3), 166-75 (1999), Gerich et al., Knee Surg. Sports Traumatol. Arthrosc. 5(2), 118-23 (1998), and During, Adv. Drug DeNv. Review 27(1), 83-94 (1997) and US 4,797,368, US 5,139,941 , US 5,173, 414, US 5,614,404, US 5,658,785, US 5,858,775 and US 5,994,136). Adeno-associated viral vectors may be constructed and/or purified using the methods set forth, for example, in US 4,797,368 and Laughlin et al., Gene 23, 65-73 (1983).
Another type of viral vector that may be employed with polynucleotides and methods of the present invention is a papillomaviral vector. Suitable papillomaviral vectors are known in the art and described in, e. g., Hewson, MoI Med Today 5(1), 8 (1999), Stephens, Biochem J. 248(1), 1-11 (1987) and US 5,719, 054. Examples of papillomaviral vectors are provided in for instance WO 99/21979. Alphavirus vectors may be gene delivery vectors in other contexts. Alphavirus vectors are known in the art and described in for instance Carter, Curr Opinion Biotech 3, 533-539 (1992), Muzcyzka, Curr Top Microbiol Immunol. 158, 97-129 (1992), Schlesinger, Expert Opin Biol Ther. 1(2), 177-91 (2001), Polo et al., Dev Biol (Basel). 104. 181-5 (2000), Wahlfors et al., Gene Ther. 7(6), 472-80 (2000), Colombage et al., Virology. 250(1), 151 -63 (1998) and WO 01/81609, WO 00/39318, WO 01/81553, WO 95/07994 and WO 92/10578.
Another group of viral vectors are herpes viral vectors. Examples of herpes viral vectors are described in for instance Lachmann et al., Curr Opin MoI Ther 1(5), 622-32 (1999), Fraefel et al., Adv Virus Res. 55, 425-51 (2000), Huard et al., Neuromuscul 7(5), 299-313 (1997), Glorioso et al., Annu Rev Microbiol. 49, 675-710 (1995), Latchman, MoI
Biotechnol. 2(2), 179-95 (1994), and Frenkel et al., Gene Ther. KSuppl 1 ), S40-6 (1994), as well as US 6,261 ,552 and US 5,599,691.
Retroviral vectors, including lentiviral vectors, also may be advantageous gene delivery vehicles in particular contexts. There are numerous retroviral vectors known in the art. Examples of retroviral vectors are described in for instance Miller, Curr Top Microbiol Immunol 158, 1-24 (1992), Salmons and Gunzburg, Human Gene Therapy 4, 129-141 (1993), Miller et al., Methods in Enzvmolosv 2T7, 581-599 (1994), Weber et al., Curr Opin MoI Ther. 3(5), 439-53 (2001 ), Hu et al., Pharmacol Rev. 52(4), 493-511 (2000), Kim et al., Adv Virus Res. 55, 545-63 (2000), PaIu et al., Rev Med Virol. 10(3), 185-202 (2000) and Takeuchi et al., Adv Exp Med Biol. 465, 23-35 (2000), as well as US 6,326,195, US 5,888,502, US 5,580,766, and US 5,672, 510.
Adenoviral vectors may also be suitable viral vectors for gene transfer. Adenoviral vectors are well known in the art and described in for instance Graham et al, MoI Biotechnol 33(3), 207-220 (1995), Stephenson, Clin Diagn Virol 10(2-3), 187-94 (1998), Jacobs, Clin Sci (Lond). 85(2), 117-22 (1993), US 5,922, 576, US 5,965,358 and US 6,168, 941 and
WO98/22588, WO98/56937, WO99/15686, WO99/54441 , and WO00/32754. Adenoviral vectors, herpes viral vectors and Sindbis viral vectors, useful in the practice of the present invention, are described in for instance Jolly Cancer Gene Therapy 1, 51-64 (1994), Latchman Molec Biotechnol 2, 179-195 (1994) and Johanning et al., Nucl Acids Res 23, 1495-1501 (1995).
Other suitable viral vectors include pox viral vectors. Examples of such vectors are discussed in for instance Berencsi et al., J Infect Dis 183(8), 1171-9 (2001), Rosenwirth et al., Vaccine 19(13-14), 1661 -70 (2001), Kittlesen et al., J Immunol 164(8), 4204-11 (2000), Brown et al., Gene Ther 7(19), 1680-9 (2000), Kanesa-thasan et al., Vaccine 19(4- 5), 483-91 (2000), Sten, Drua 60(2), 249-71 (2000). Vaccinia virus vectors may be pox virus vectors. Examples of such vectors and uses thereof are provided in for instance Venugopal et al., Res Vet Sci 57(2), 188-193 (1994), Moss Dev Biol Stand 82, 55-63 (1994), Weisz et al., MoI Cell Biol 43, 137-159 (1994), Mahr and Payne, Immunobioloev 184(2-3), 126-146 (1992), Hruby, Clin Microbiol Rev 3(2), 153-170 (1990) and WO92/07944, WO98/13500, and WO89/08716.
Other features of the present invention include recombinant cells, such as yeast, bacterial, and mammalian cells (e.g., immortalized mammalian cells) comprising such a nucleic acid, vector, or combinations of either or both thereof. For example, in one embodiment, the present invention provides a cell comprising a nucleic acid stably integrated into the cellular genome that comprises a sequence coding for expression of an IL-21 BP of the present invention. In one embodiment, the present invention provides a cell comprising a non-integrated nucleic acid, such as a plasmid, cosmid, phagemid, or linear expression element, which comprises a sequence coding for expression of an IL-21 BP.
The present invention also provides immunogenic peptides comprising any of the above-described antigenic determinant portions of IL-21 specific for the IL-21 BPs of the present invention, such as the antigenic determinant portions of IL-21 specific for 1 F1 and 1 F22. Such immunogens may be used to elicit a direct immune response in a method comprising an active immunotherapy regimen. The present invention further provides a fusion protein comprising such an IL-21 immunogen and a fusion partner sequence that improves the half-life of the fusion protein (e.g., by inclusion of an immunoglobulin domain sequence); facilitates detection and/or purification of the fusion protein (by comprising, e.g., a fluorescent peptide sequence, a reporter enzyme sequence, an epitope tag, a hexa-histidine sequence, or the like); promotes the targeting of the fusion protein (e.g., by comprising a ligand or portion of a ligand specific for a receptor on a target cell); promotes induction of a distinct immune response (e.g., corresponds to a cancer antigen or an immunogenic fragment thereof); is a cytotoxic agent; or achieves any combination thereof (e.g., a heat shock fusion protein partner can increase an immune response generated against a non- similar, heterologous antigen portion of a fusion protein, while also increasing the in vivo half- life of a fusion protein). Fusion proteins may also comprise one or more cleavage sites, particularly between domains.
Variants of such peptides, and derivatives of such immunogenic peptides or immunogenic peptide variants are additional features of the present invention (e.g., such IL-21 immunogenic peptide derivatives may be modified by chemical coupling, genetic fusion, non-covalent association, and the like, to other molecular entities such as antibodies, toxins, radioisotope, cytotoxic agents, or cytostatic agents). Peptide mimitopes, comprising IL-21 epitope sequences may also, for example, be useful as vaccine candidates. Such peptides may also be useful in the purification of anti-IL-21 antibodies. In addition to the B-cell epitope sequences described herein, such peptides may be engineered or selected to also or alternatively comprise one or more anti-IL-21 T cell epitopes. Such epitopes may be identified by any suitable technique known in the art (e.g., by T cell epitope prediction software applications).
In one embodiment, the present invention provides a nucleic acid encoding such an immunogenic peptide. Such a nucleic acid may be delivered to a host in a suitable vector, such as a replication-deficient targeted vector (e.g., a targeted nucleic acid vector or a replication-deficient, targeted adenovirus vector). The present invention also provides compositions of one or more of such immunogenic peptides and/or immunogenic peptide- encoding nucleic acids.
IL-21 BPs of the present invention include "neutralizing" IL-21 BPs, such as neutralizing antibodies. The terms "neutralizing" IL-21 BP" and "neutralizing antibody" refer to an IL-21 BP or an antibody that is capable of substantially inhibiting or eliminating a biological activity of an IL-21 -associated peptide. Typically, a neutralizing IL-21 BP, such as a neutralizing anti-IL-21 antibody will inhibit IL-21 binding to the IL-21 receptor in a degree that is about equal or greater than the inhibition of such cells due to administration of an approximately equal amount of the antibodies of the examples. A IL-21 BP of the present invention may have any suitable affinity and/or avidity for one or more epitopes contained at least partially in IL-21. Affinity refers to the strength of binding of the IL-21 BP to such an epitope. Typically, affinity is measured by dissociation constant Kd, defined as [Ab] x [Ag] / [Ab-Ag] where [Ab-Ag] is the molar concentration of the antibody-antigen complex (or the IL-21 BP-antigen complex), [Ab] is the molar concentration of the unbound antibody (or IL-21 BP) and [Ag] is the molar concentration of the unbound antigen. The affinity constant Ka is defined by 1/Kd. Suitable methods for determining specificity and affinity by competitive inhibition may be found in for instance Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1988), Colligan et al., eds., Current Protocols in Immunology, Greene Publishing Assoc, and Wiley InterScience N. Y., (1992, 1993) and Muller, Meth. Enzymol. 92, 589-601 (1983).
A IL-21 BP, and particularly anti-IL-21 antibodies of the present invention may have an affinity for at least one epitope at least partially comprised in IL-21 in the range of about 104 to about 1010 M"1. The term immunoreact herein typically refers to binding of an IL-21 BP to an IL-21 epitope with a dissociation constant Kd lower than about 10'4 M. A IL-21 BP may have an affinity that is at least as great for IL-21 as 1 F1 and 1 F22, and in some embodiments have an affinity that is at least about as great as 1 F1 and 1 F22. Affinity may be determined by any of the methods described elsewhere herein or their known equivalents in the art. An example of one method that may be used to determine affinity is provided in Scatchard analysis of Munson & Pollard, Anal. Biochem. 107, 220 (1980).
Binding affinity also may be determined by equilibrium methods (for instance enzyme-linked immunoabsorbent assay (ELISA) or radioimmunoassay (RIA)) or kinetics analysis (for instance BIACORE™ analysis).
Typically, the disassociation constant for IL-21 BPs, such as anti-IL-21 antibodies, of the present invention is less than about 100 nM, less than about 50 nM, less than about 10 nM, about 5 nM or less, about 1 nM or less, about 0.5 nM or less, about 0.1 nM or less, about 0.01 nM or less, or even about 0.001 nM or less.
Anti-IL-21 antibodies of the present invention, as well as other IL-21 BPs of the present invention, may be prepared by recombinant expression in any suitable type of cells or animals.
Recombinant IL-21 BPs, such as recombinant antibodies, such as recombinant human antibodies, include IL-21 BPs, such as antibodies, such as human antibodies that are prepared, expressed, created or isolated by recombinant means, such as IL-21 BPs, such as antibodies, such as human antibodies expressed using a recombinant expression vector transfected into a host cell.
Recombinant antibodies, such as recombinant human antibodies also include antibodies isolated from a recombinant, combinatorial human antibody library, antibodies isolated from an animal, such as a transgenic animal, or antibodies prepared, expressed, created or isolated by any other means that involves splicing of human immunoglobulin- encoding nucleic acid sequences to other nucleic acid sequences exogenous to the human immunoglobulin-encoding nucleic acids and human immunoglobulin-encoding genes. Recombinant human antibodies typically have variable and constant regions derived from human germline immunoglobulin sequences. In certain embodiments, however, such recombinant human antibodies are subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and, thus, the amino acid sequences of the VH and VL regions of the recombinant antibodies may be sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo. Both types of human antibodies are provided by the present invention. Suitable methods for recombinant protein production are known in the art, see for instance (Sambrook and Russell (eds.), Molecular cloning, third edition, 2001 , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA.
Likewise, suitable methods for antibody production are known in the art and include those described in for instance Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., (1988), Harlow and Lane: Using Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press (1999)), US 4,376,110 and Ausubel et al., eds., Current Protocols In Molecular Biology, Greene Publishing Assoc, and Wiley InterScience N. Y., (1987, 1992). Monoclonal antibodies may be made using the hybridoma method first described by Kohler et al., Nature 256, 495 (1975), or by other well-known, subsequently-developed methods (see, e.g., Goding, Monoclonal Antibodies: Principles and Practice, pp.59-103 (Academic Press, 1986)). Hybridomas useful in the production of anti-IL-21 antibodies of the present invention are also provided by the present invention. Such hybridomas may be formed by chemical fusion, electrical fusion, or any other suitable technique, with any suitable type of myeloma, heteromyeloma, phoblastoid cell, plasmacytoma or other equivalent thereof and any suitable type of antibody-expressing cell. Transformed immortalized B cells may also be used to efficiently produce antibodies of the present invention and are also provided by the present invention. Such cells may be produced by standard techniques, such as transformation with an Epstein Barr Virus, or a transforming gene. (See, e.g., "Continuously Proliferating Human Cell Lines Synthesizing Antibody of Predetermined Specificity," Zurawaki, V. R. et al., in Monoclonal Antibodies, ed. by Kennett R. H. et al., Plenum Press, N. Y. 1980, pp 19-33.). Thus, stable and continuous and/or immortalized anti-IL-21 antibody expressing cells and cell lines are a feature of the present invention. Eukaryotic and prokaryotic cells (e.g., yeast cells, continuous and/or immortalized mammalian cell lines (e.g., lymphoid antibody-producing cell derived cell lines), plant cells, insect cells, and bacterial cells such as E. coli cells, etc.) comprising IL-21 BP- encoding or IL-21 BP-fragment-encoding nucleic acids are provided by the present invention. Transgenic animals, such as non-human primates, rodents (e.g., hamsters, guinea pigs, and rats - including modified strains thereof such as severe combined immunodeficient (SCID) mice and other immunocompromised animal strains), dogs, etc., expressing human anti- IL-21 antibodies of the present invention also are provided by the present invention.
Recombinant cells comprising exogenous nucleic acids encoding IL-21 BPs may be prepared by any suitable technique (e.g., transfection/transformation with a naked DNA plasmid vector, viral vector, invasive bacterial cell vector or other whole cell vector, etc., comprising an IL-21 BP-encoding sequence (or sequences) delivered into the cell by calcium phosphate-precipitation facilitated transfection, receptor-mediated targeting and transfection, biolistic delivery, electroporation, dextran-mediated transfection, liposome-mediated transformation, protoplast fusion, direct microinjection, etc.). Methods of transforming/transfecting cells are well known in the art (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (2d Edition, 1989 and 3rd Edition, 2001) and F. Ausubel et al., ed. Current Protocols in Molecular Biology, Greene Publishing and Wiley InterScience New York (1987). Such recombinant cells are a feature of the present invention.
Cell lines available as hosts for recombinant protein expression are well known in the art and include many immortalized cell lines available from the American Type Culture Collection (ATCC). These include, inter alia, Chinese hamster ovary (CHO) cells, NSO, SP2 cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), A549 cells, and a number of other cell lines. Other cell lines that may be used are insect cell lines, such as Sf9 cells. When nucleic acids (or nucleic acid-containing vectors) encoding proteins, such as IL-21 BPs (including anti-IL-21 antibodies), are introduced into mammalian host cells, proteins, such as IL-21 BPs, may be produced by culturing the host cells for a period of time sufficient to allow for expression of the protein, such as an IL-21 BP, in the host cells or by secretion of the protein, such as an IL-21 BP, into the culture medium in which the host cells are grown. IL-21 BPs may be recovered from the culture medium using standard protein purification methods. IL-21 BPs may also be recovered from host cell lysates when directly expressed without a secretory signal.
IL-21 BPs, such as anti-IL-21 antibodies, may also be produced in bacterial cells and eukaryotic unicellular microorganisms, such as yeast. Bacterial cell produced IL-21 BPs, such as anti-IL-21 antibodies, typically lack normal glycosylation and bacterial cell produced anti- IL-21 antibodies may thus be more or less deficient in terms of ADCC functions and other aspects of the immune response associated with anti-IL-21 antibodies produced in mammalian cells and/or animals (e.g., the recruitment of NK cells). Yeast cell produced IL-21 BPs, such as anti-IL-21 antibodies normally exhibit different types of glycosylation patterns than antibodies produced in mammalian cells. However, methods for producing antibodies with effective glycosylation in yeast are currently being developed by companies such as Glycofi, Inc. (Lebanon, NH, USA). See also Wildt S et al., Nat Rev Microbiol. 3(2), 119-28 (2005).
When recombinant expression vectors encoding IL-21 BP genes (including anti-IL-21 antibody genes) are introduced into mammalian host cells, the IL-21 BPs are produced by culturing the host cells for a period of time sufficient to allow for expression of the IL-21 BP in the host cells or for secretion of the antibody into the culture medium in which the host cells are grown. The purification of antibodies and other IL-21 BPs from cell cultures, cell lysates, and animals (e.g., from the ascites fluid of a transgenic animal producing anti-IL-21 antibodies) may be achieved by application of any number of suitable techniques known in the art including, e.g., immunoaffinity column purification; sulfate precipitation; chromatofocusing; preparative SDS-PAGE, and the like.
Human monoclonal antibodies of the present invention may also be produced by a variety of other techniques, including conventional monoclonal antibody methodology, e.g., the standard somatic cell hybridization technique of Kohler and Milstein, Nature 256, 495 (1975). Other techniques for producing monoclonal antibody may also be employed, e.g. phage display techniques using libraries of human antibody genes. In one embodiment, anti- IL-21 antibodies of the present invention produced by use of hybridomas generated in a murine system. Hybridoma production in the mouse is a very well established procedure. Immunization protocols and techniques for isolation of immunized splenocytes for fusion are known in the art. Fusion partners (e.g., murine myeloma cells) and fusion procedures are also known.
To generate fully human monoclonal antibodies to IL-21 , transgenic or transchromosomal mice containing human immunoglobulin genes (e.g., HCo12, HCo7 or KM mice) may be immunized with an enriched preparation of IL-21 antigen, as described, for example, by Lonberg et al., (1994), supra, Fishwild et al., (1996), supra, and WO 98/24884. Alternatively, mice may be immunized with DNA encoding human IL-21. The mice may be 6-16 weeks of age upon the first infusion. For example, an enriched preparation (5-50 μg) of the IL-21 antigen may be used to immunize the HuMAb mice intraperitoneal^. Cumulative experience with various antigens has shown that the HuMAb transgenic mice respond best when initially immunized intraperitoneal^ (i.p.) or subcutaneously (s.c.) with IL-21 expressing cells in complete Freund's adjuvant, followed by every other week i.p. immunizations (up to a total of 10) with IL-21 expressing cells in PBS. The immune response may be monitored over the course of the immunization protocol with plasma samples being obtained by retroorbital bleeds. The plasma may be screened by FACS analysis, and mice with sufficient titers of anti-IL-21 human immunoglobulin may be used for fusions. Mice may be boosted intravenously with IL-21 expressing cells, for example 4 and 3 days before sacrifice and removal of the spleen..
To generate hybridomas producing human monoclonal antibodies to human IL-21 , splenocytes and lymph node cells from immunized mice may be isolated and fused to an appropriate immortalized cell line, such as a mouse myeloma cell line. The resulting hybridomas may then be screened for the production of antigen-specific antibodies. For example, single cell suspensions of splenic lymphocytes from immunized mice may be fused to SP2/0 nonsecreting mouse myeloma cells (ATCC, CRL 1581) with 50% PEG (w/v). Cells may be plated at approximately 1 x 105 per well in flat bottom microtiter plate, followed by a two week incubation in selective medium containing besides usual reagents 10% fetal Clone Serum, 5-10% origen hybridoma cloning factor (IGEN) and 1X HAT (Sigma). After approximately two weeks, cells may be cultured in medium in which the HAT is replaced with HT. Individual wells may then be screened by ELISA for human kappa-light chain containing antibodies and by FACS analysis using IL-21 expressing cells for IL-21 specificity. Once extensive hybridoma growth occurs, medium may be observed usually after 10-14 days. The antibody secreting hybridomas may be replated, screened again, and if still positive for human IgG, anti-IL-21 monoclonal antibodies may be subcloned at least twice by limiting dilution. The stable subclones may then be cultured in vitro to generate antibody in tissue culture medium for characterization.
Human antibodies of the present invention may also be produced in a host cell transfectoma using, for example, a combination of recombinant DNA techniques and gene transfection methods as is well known in the art, see for instance Morrison, S., Science 229, 1202 (1985). For example, to express the antibodies, or antibody fragments thereof, DNAs encoding partial or full-length light and heavy chains, may be obtained by standard molecular biology techniques (for instance PCR amplification, site directed mutagenesis) and may be inserted into expression vectors such that the genes are operatively linked to transcriptional and translational control sequences. In this context, the term "operatively linked" is intended to mean that an antibody gene is ligated into a vector such that transcriptional and translational control sequences within the vector serve their intended function of regulating the transcription and translation of the antibody gene. The expression vector and expression control sequences are chosen to be compatible with the expression host cell used. The antibody light chain gene and the antibody heavy chain gene may be inserted into separate vectors or, more typically, both genes are inserted into the same expression vector. The antibody genes may be inserted into the expression vector by standard methods (e.g., ligation of complementary restriction sites on the antibody gene fragment and vector, or blunt end ligation if no restriction sites are present). The light and heavy chain variable regions of the antibodies described herein may be used to create full-length antibody genes of any antibody isotype by inserting them into expression vectors already encoding heavy chain constant and light chain constant regions of the desired isotype such that the VH segment is operatively linked to the CH segment(s) within the vector and the VL segment is operatively linked to the CL segment within the vector. Additionally or alternatively, the recombinant expression vector may encode a signal peptide that facilitates secretion of the antibody chain from a host cell. The antibody chain gene may be cloned into the vector such that the signal peptide is linked in-frame to the amino terminus of the antibody chain gene. The signal peptide may be an immunoglobulin signal peptide or a heterologous signal peptide (i.e., a signal peptide from a non-immunoglobulin protein).
In addition to the antibody chain genes, the recombinant expression vectors of the present invention carry regulatory sequences that allows and control the expression of the antibody chain genes in a host cell.
In addition to the antibody chain genes and regulatory sequences, the recombinant expression vectors of the present invention may carry additional sequences, such as sequences that regulate replication of the vector in host cells (e.g., origins of replication) and selectable marker genes. The selectable marker gene facilitates selection of host cells into which the vector has been introduced (see for instance US 4,399,216, US 4,634,665 and US 5,179,017). For example, typically the selectable marker gene confers resistance to drugs, such as G418, hygromycin or methotrexate, on a host cell into which the vector has been introduced. Examples of selectable marker genes include the dihydrofolate reductase (DHFR) gene (for use in dhfr-host cells with methotrexate selection/amplification) and the neo gene (for G418 selection).
For expression of the light and heavy chains, the expression vector(s) encoding the heavy and light chains is transfected into a host cell by standard techniques. The host cells may be prokaryotic or eukaryotic, such as mammalian, host cells. For instance antigen binding fragments may be expressed in prokaryotic host cells and full-length antibodies may be expressed in eukaryotic host cells.
In one embodiment the antibodies are expressed in eukaryotic cells, such as mammalian host cells. Examples of mammalian host cells for expressing the recombinant antibodies of the present invention include CHO cells (including dhfr-CHO cells, described in Urlaub and Chasin, PNAS USA 77, 4216-4220 (1980), used with a DHFR selectable marker, for instance as described in R. J. Kaufman and P. A. Sharp, MoI. Biol. 159, 601-621 (1982)), NS/0 myeloma cells, COS cells, HEK293 cells and SP2.0 cells. In particular for use with NS/0 myeloma cells, another example of a expression system is the GS (glutamine synthetase) gene expression system disclosed in WO87/04462, WO89/01036 and EP338841. The IL-21 BP genes may be expressed in other expression systems, including prokaryotic cells, such as microorganisms, e.g. E. coli for the production of scFv antibodies, algi, as well as insect cells. Furthermore, the IL-21 BPs may be produced in transgenic non- human animals, such as in milk from sheep and rabbits or eggs from hens, or in transgenic plants. See for instance Verma, R. et al., J. Immunol. Meth. 2J6, 165-181 (1998), Pollock et al., J. Immunol. Meth. 231, 147-157 (1999) and Fischer, R. et al., Biol.Chem. 380, 825-839 (1999).
Bispecific and multispecific IL-21 BPs of the present invention may be made using chemical techniques (see for instance D. M. Kranz et al., PNAS USA 78, 5807 (1981)), "polydoma" techniques (See US 4,474,893) or recombinant DNA techniques.
Bispecific antibodies of the present invention may be produced by a variety of known methods including fusion of hybridomas or linking of Fab' fragments (see for instance Songsivilai & Lachmann, Clin. Exp. Immunol. 79, 315-321 (1990) and Kostelny et al., J. Immunol. 148, 1547-1553 (1992)). Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain-light chain pairs, where the two heavy chains have different specificities (see for instance Milstein and Cuello, Nature 305, 537 (1983)). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, of which only one has the correct bispecific structure. Similar procedures are disclosed in WO 93/08829 and Traunecker et al., EMBO J. 10, 3655 (1991).
According to a different approach, antibody variable domains with the desired binding specificities (antibody-antigen combining sites) are fused to immunoglobulin constant domain sequences by recombinant or synthetic methods. The variable domain sequence is typically fused to an immunoglobulin heavy chain constant domain, comprising at least part of the hinge, CH2, and CH3 regions. Also typically, a first heavy-chain constant region (CH1), containing the site necessary for light chain binding, also is present in at least one of the fusion peptides. In a more specific example of this type of approach, a bispecific antibody is produced comprising a hybrid immunoglobulin heavy chain with a first binding specificity in one arm, and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm. Such an asymmetric structure can facilitate the separation of the desired bispecific compound from unwanted immunoglobulin chain combinations (such an approach is described in WO 94/04690). For further details of generating bispecific antibodies see, for example, Suresh et al., Methods in Enzymology 121 , 210 (1986). In another approach, the interface between a pair of antibody molecules may be engineered to maximize the percentage of heterodimers that are recovered from recombinant cell culture so as to form a population of bispecific antibody molecules. Typically, such an interface comprises at least a part of the CH3 domain of an antibody constant region. Normally in such a method, one or more amino acid residues with smaller side chains from the interface of the first antibody molecule are replaced with amino acid residues with larger side chains (such as tyrosine or tryptophan). Compensatory "cavities" of identical or similar size to the large side chain amino acid residue(s) are created on the interface of the second antibody molecule by replacing large amino acid side chain residues with smaller ones (such as alanine or threonine). This provides a mechanism for increasing the yield of the heterodimer over other unwanted end-products such as homodimers.
Bispecific and multispecific molecules of the present invention may be prepared by conjugating the constituent binding specificities, e.g., the anti-FcR and anti-IL-21 binding specificities, using methods known in the art. For example, each binding specificity of the bispecific and multispecific molecule may be generated separately and then conjugated to one another. When the binding specificities are proteins or peptides, a variety of coupling or cross-linking agents may be used for covalent conjugation. Examples of cross-linking agents include protein A, carbodiimide, N-succinimidyl-S-acetyl-thioacetate (SATA), 5,5'-dithiobis(2- nitrobenzoic acid) (DTNB), o-phenylenedimaleimide (oPDM), N-succinimidyl-3-(2-pyridyldi- thio)propionate (SPDP) and sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1 -carboxy- late (sulfo-SMCC), see for instance Karpovsky et al., J. Exp. Med. 160, 1686 (1984), Liu, M. A. et al., PNAS USA 82, 8648 (1985). In another example, Brennan et al., Science 229, 81 (1985) describe a procedure wherein intact antibodies are proteolytically cleaved to generate F(ab')2 fragments. These fragments are reduced in the presence of the dithiol complexing agent sodium arsenite to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The Fab' fragments generated may then converted to thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB derivatives may then be reconverted to the Fab'-thiol by reduction with mercaptoethylamine and mixed with an equimolar amount of the other Fab'- TNB derivative to form a bispecific antibody. Shalaby et al., J. Exp. Med. 175, 217-225 (1992) describes the production of a fully humanized bispecific antibody F(ab')2 molecule, according to a related technique. Other methods include those described by Paulus (Behring Ins. Mitt. No. 78, 1 18-132 (1985)) and Glennie et al., J. Immunol. 139, 2367-2375 (1987). Examples of conjugating agents are SATA and sulfo-SMCC, both available from Pierce Chemical Co. (Rockford, IL). When the binding specificities are antibodies, they may be conjugated via sulfhydryl bonding of the C-terminus hinge regions of the two heavy chains. In one embodiment, the hinge region is modified to contain an odd number of sulfhydryl residues, for instance one, prior to conjugation. Alternatively, both binding specificities may be encoded in the same vector and expressed and assembled in the same host cell. This method is particularly useful where the bispecific and multispecific molecule is a mAb x mAb, mAb x Fab, Fab x F(ab')2 or ligand x Fab fusion protein. A bispecific and multispecific molecule of the present invention, e.g., a bispecific molecule may be a single chain molecule, such as a single chain bispecific antibody, a single chain bispecific molecule comprising one single chain antibody and a binding determinant, or a single chain bispecific molecule comprising two binding determinants. Bispecific and multispecific molecules may also be single chain molecules or may comprise at least two single chain molecules. Methods for preparing bi- and multispecific molecules are described for example in US 5,260,203, US 5,455,030, US 4,881 ,175, US 5,132,405, US 5,091 ,513, US 5,476,786, US 5,013,653, US 5,258,498 and US 5,482,858.
Various techniques for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described. For example, bispecific antibodies have been produced using leucine zippers (see for instance Kostelny et al., J. Immunol. 148(5), 1547-1553 (1992)). Leucine zipper peptides from the Fos and Jun proteins may be linked to the Fab' portions of two different antibodies by gene fusion and the resulting antibody homodimers reduced at the hinge region to form monomers that may be re-oxidized to form the antibody heterodimers. The "diabody" technology described by Hollinger et al., PNAS USA 90, 6444-6448 (1993) also has provided an alternative mechanism for making bispecific antibody fragments. Another strategy for making bispecific antibody fragments by the use of single-chain Fv (sFv) dimers has also been reported. See for instance Gruber et al., J. Immunol. 152, 5368 (1994).
In addition, bispecific antibodies may be formed as "diabodies" (Holliger et al., PNAS USA, 90, 6444-6448 (1993)) or "Janusins" (Traunecker et al., EMBO J 10, 3655-3659 (1991) and Traunecker et al., lnt J Cancer Suppl 7, 51-52 (1992)). Bispecific antibodies, by definition, do not exist in the form of fragments having a single binding site (e.g., Fab, Fab', and Fv fragments, which also are provided by the present invention).
Binding of the bispecific and multispecific molecules to their specific targets may be confirmed by enzyme-linked immunosorbent assay (ELISA), a radioimmunoassay (RIA), FACS analysis, a bioassay (e.g., growth inhibition), or a Western Blot Assay. Each of these assays generally detects the presence of protein-antibody complexes of particular interest by employing a labeled reagent (e.g., an antibody) specific for the complex of interest. For example, the FcR-antibody complexes may be detected using e.g., an enzyme-linked antibody or antibody fragment which recognizes and specifically binds to the antibody-FcR complexes. Alternatively, the complexes may be detected using any of a variety of other immunoassays. For example, the antibody may be radioactively labeled and used in a radioimmunoassay (RIA) (see, for example, Weintraub, B., Principles of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March, 1986). The radioactive isotope may be detected by such means as the use of a Y counter or a scintillation counter or by autoradiography.
As stated earlier, antibodies interact with target antigens primarily through amino acid residues that are located in the six heavy and light chain complementarity determining regions (CDRs). The present invention provides antibodies having CDR regions identical to or otherwise derived from the CDR regions of the 1 F1 and 1 F22. Such antibodies may be generated by constructing expression vectors that include CDR sequences from 1 F1 and 1 F22 grafted onto framework sequences from a different antibody with different properties.
Such framework sequences may be obtained from public DNA databases that include germline antibody gene sequences. These germline sequences will differ from mature antibody gene sequences because they will not include completely assembled variable genes, which are formed by V(D)J joining during B cell maturation. Germline gene sequences will also differ from the sequences of a high affinity secondary repertoire antibody which contains mutations throughout the variable gene but typically clustered in the CDRs. For example, somatic mutations are relatively infrequent in the amino terminal portion of framework region 1 and in the carboxy-terminal portion of framework region 4. For this reason, it is not necessary to obtain the entire DNA sequence of a particular antibody in order to recreate an intact recombinant antibody having binding properties similar to those of the original antibody (see WO 99/45962). Partial heavy and light chain sequence spanning the CDR regions is typically sufficient for this purpose. The partial sequence is used to determine which germline variable and joining gene segments contributed to the recombined antibody variable genes. The germline sequence is then used to fill in missing portions of the variable regions. Heavy and light chain leader sequences are cleaved during protein maturation and do not contribute to the properties of the final antibody. To add missing sequences, cloned cDNA sequences may be combined with synthetic oligonucleotides by ligation or PCR amplification. Alternatively, the entire variable region may be synthesized as a set of short, overlapping, oligonucleotides and combined by PCR amplification to create an entirely synthetic variable region clone. This process has certain advantages such as elimination or inclusion or particular restriction sites, or optimization of particular codons.
The nucleotide sequences of heavy and light chain transcripts from hybridomas are used to design an overlapping set of synthetic oligonucleotides to create synthetic V sequences with identical amino acid coding capacities as the natural sequences. The synthetic heavy and kappa chain sequences can differ from the natural sequences in three ways: strings of repeated nucleotide bases are interrupted to facilitate oligonucleotide synthesis and PCR amplification; optimal translation initiation sites are incorporated according to Kozak's rules (Kozak, J. Biol. Chem. 266, 19867-19870 (1991 ); and H/ndlll sites are engineered upstream of the translation initiation sites.
For both the heavy and light chain variable regions, the optimized coding and corresponding non-coding, strand sequences are broken down into 30-50 nucleotides approximately at the midpoint of the corresponding non-coding oligonucleotide. Thus, for each chain, the oligonucleotides may be assembled into overlapping double stranded sets that span segments of 150-400 nucleotides. The pools are then used as templates to produce PCR amplification products of 150-400 nucleotides. Typically, a single variable region oligonucleotide set will be broken down into two pools which are separately amplified to generate two overlapping PCR products. These overlapping products are then combined by PCR amplification to form the complete variable region. It may also be desirable to include an overlapping fragment of the heavy or light chain constant region (including the Bbs\ site of the kappa light chain, or the Age\ site of the gamma heavy chain) in the PCR amplification to generate fragments that can easily be cloned into the expression vector constructs.
The reconstructed heavy and light chain variable regions are then combined with cloned promoter, leader, translation initiation, constant region, 3' untranslated, polyadenylation, and transcription termination, sequences to form expression vector constructs. The heavy and light chain expression constructs may be combined into a single vector, co-transfected, serially transfected, or separately transfected into host cells which are then fused to form a host cell expressing both chains.
A similar procedure may be followed to graft novel antigen-specificity into an existing mature antibody. Typically, an acceptor antibody is chosen which originates from the same variable germ-line gene as the CDR-donor antibody, but other acceptor antibodies may also be chosen. One or more CDRs from the donor antibody are then transferred using the techniques described above.
In one embodiment of the present invention, the structural features of the 1 F1 and 1 F22 are used to create structurally related anti-IL-21 antibodies, for instance human anti- IL-21 antibodies, that retain at least one functional property of 1 F1 and 1 F22, namely binding to IL-21. More specifically, one or more CDR regions of 1 F1 and 1 F22 may be combined recombinantly with known human framework regions and CDRs to create additional, recombinantly-engineered, anti-IL-21 antibodies of the present invention. Exemplary plasmids for use in construction of expression vectors for human lgGκ are described below. The plasmids were constructed so that PCR amplified V kappa heavy and V kappa light chain cDNA sequences could be used to reconstruct complete heavy and light chain minigenes. These plasmids may be used to express completely human IgGI , K or lgG4,κ antibodies. Similar plasmids may be constructed for expression of other heavy chain isotypes, or for expression of antibodies comprising lambda light chains.
In one embodiment, the present invention provides transgenic and transchromosomal nonhuman animals, such as transgenic or transchromosomal mice, which are capable of expressing human antibodies that specifically bind to IL-21. In a particular embodiment, the present invention provides a transgenic or transchromosomal mouse having a genome comprising a human heavy chain transgene, such that the mouse produces human anti-IL-21 antibodies when immunized with IL-21. The human heavy chain transgene may be integrated into the chromosomal DNA of the mouse, as is the case for transgenic, e.g., HuMAb mice, as described in detail herein. Alternatively, the human heavy chain transgene may be maintained extrachromosomally, as is the case for transchromosomal (e.g., KM) mice as described in WO 02/43478. Such transgenic and transchromosomal animals are capable of producing multiple isotypes of human monoclonal antibodies to IL-21 (e.g., IgG, IgA and/or IgE) by undergoing V-D-J/V-J recombination and isotype switching. The design of a transgenic or transchromosomal nonhuman animal that responds to foreign antigen stimulation with a heterologous antibody repertoire, requires that the heterologous immunoglobulin transgenes contained within the transgenic animal function correctly throughout the pathway of B cell development. This includes, for example, isotype switching of the heterologous heavy chain transgene. Accordingly, transgenes are constructed so that isotype switching may be induced and one or more of the following characteristics of antibody genes: (1) high level and cell-type specific expression, (2) functional gene rearrangement, (3) activation of and response to allelic exclusion, (4) expression of a sufficient primary repertoire, (5) signal transduction, (6) somatic hypermutation, and (7) domination of the transgene antibody locus during the immune response.
Not all of the foregoing criteria need be met. For example, in those embodiments wherein the endogenous immunoglobulin loci of the transgenic animal are functionally disrupted, the transgene need not activate allelic exclusion. Further, in those embodiments wherein the transgene comprises a functionally rearranged heavy and/or light chain immunoglobulin gene, the second criteria of functional gene rearrangement is unnecessary, at least for that transgene which is already rearranged. For background on molecular immunology, see, Fundamental Immunology, 2nd edition (1989), Paul William E., ed. Raven Press, N.Y.
In certain embodiments, the transgenic or transchromosomal nonhuman animals used to generate the human monoclonal antibodies of the present invention contain rearranged, unrearranged or a combination of rearranged and unrearranged heterologous immunoglobulin heavy and light chain transgenes in the germline of the transgenic animal. Each of the heavy chain transgenes comprises at least one CH gene. In addition, the heavy chain transgene may contain functional isotype switch sequences, which are capable of supporting isotype switching of a heterologous transgene encoding multiple CH genes in the B cells of the transgenic animal. Such switch sequences may be those which occur naturally in the germline immunoglobulin locus from the species that serves as the source of the transgene CH genes, or such switch sequences may be derived from those which occur in the species that is to receive the transgene construct (the transgenic animal). For example, a human transgene construct that is used to produce a transgenic mouse may produce a higher frequency of isotype switching events if it incorporates switch sequences similar to those that occur naturally in the mouse heavy chain locus, as presumably the mouse switch sequences are optimized to function with the mouse switch recombinase enzyme system, whereas the human switch sequences are not. Switch sequences may be isolated and cloned by conventional cloning methods, or may be synthesized de novo from overlapping synthetic oligonucleotides designed on the basis of published sequence information relating to immunoglobulin switch region sequences (Mills et al., Nucl. Acids Res. 1_5, 7305-7316
(1991) Sideras et al., Intl. Immunol. !, 631 -642 (1989)). For each of the foregoing transgenic animals, functionally rearranged heterologous heavy and light chain immunoglobulin transgenes are found in a significant fraction of the B cells of the transgenic animal (at least 10%). The transgenes used to generate the transgenic nonhuman animals of the present invention include a heavy chain transgene comprising DNA encoding at least one variable gene segment, one diversity gene segment, one joining gene segment and at least one constant region gene segment. The immunoglobulin light chain transgene comprises DNA encoding at least one variable gene segment, one joining gene segment and at least one constant region gene segment. The gene segments encoding the light and heavy chain gene segments are heterologous to the transgenic animal in that they are derived from, or correspond to, DNA encoding immunoglobulin heavy and light chain gene segments from a species not consisting of the transgenic nonhuman animal. In one embodiment of the present invention, the transgene is constructed such that the individual gene segments are unrearranged, i.e., not rearranged so as to encode a functional immunoglobulin light or heavy chain. Such unrearranged transgenes support recombination of the V, D, and J gene segments (functional rearrangement) and may support incorporation of all or a portion of a D region gene segment in the resultant rearranged immunoglobulin heavy chain within the transgenic animal when exposed to IL-21 antigen. In an alternate embodiment, the transgenes comprise an unrearranged "mini-locus".
Such transgenes typically comprise a substantial portion of the C, D, and J segments as well as a subset of the V gene segments. In such transgene constructs, the various regulatory sequences, e.g. promoters, enhancers, class switch regions, splice-donor and splice- acceptor sequences for RNA processing, recombination signals and the like, comprise corresponding sequences derived from the heterologous DNA. Such regulatory sequences may be incorporated into the transgene from the same or a related species of the nonhuman animal used in the present invention. For example, human immunoglobulin gene segments may be combined in a transgene with a rodent immunoglobulin enhancer sequence for use in a transgenic mouse. Alternatively, synthetic regulatory sequences may be incorporated into the transgene, wherein such synthetic regulatory sequences are not homologous to a functional DNA sequence that is known to occur naturally in the genomes of mammals. Synthetic regulatory sequences are designed according to consensus rules, such as, for example, those specifying the permissible sequences of a splice-acceptor site or a promoter/enhancer motif. For example, a minilocus comprises a portion of the genomic immunoglobulin locus having at least one internal (i.e., not at a terminus of the portion) deletion of a non-essential DNA portion (e.g., intervening sequence; intron or portion thereof) as compared to the naturally-occurring germline Ig locus.
Examples of transgenic and transchromosomal nonhuman animals, such as mice, will exhibit immunoglobulin production with a significant repertoire, ideally substantially similar to that of a human after adjusting for volume.
The repertoire will ideally approximate that shown in a human when adjusted for volume, usually with a diversity at least about 10% as great, such as 25 to 50% or more. Generally, at least about a thousand different immunoglobulins (ideally IgG), such as 104 to 106 or more, will be produced, depending on the number of different V, J and D regions introduced into the mouse genome and driven by the additional diversity generated by V(-D-)J gene segment rearrangements and random nucleotide additions at the joining regions. Typically, the immunoglobulins will exhibit an affinity (K0) for preselected antigens of below 10'8 M, such as of below 10 '9 M, 10 10 M or 10"11 M or even lower. Transgenic and transchromosomal nonhuman animals, e.g., mice, as described above, may be immunized with human IL-21 or DNA encoding human IL-21. The animals will then produce B cells which undergo class-switching via switch recombination (cis-switching) and express immunoglobulins reactive with IL-21. The immunoglobulins will be human antibodies (also referred to as "human sequence antibodies"), wherein the heavy and light chain polypeptides are encoded by human transgene sequences, which may include sequences derived by somatic mutation and V region recombinatorial joints, as well as germline-encoded sequences; these human antibodies may be referred to as being substantially identical to a polypeptide sequence encoded by a human VL and JL or VH DH and JH gene segments, even though other non-germline sequences may be present as a result of somatic mutation and differential V-J and V-D-J recombination joints. The variable regions of each antibody chain are typically at least 80 percent similar to human germline V, and J gene segments, and, in the case of heavy chains, human germline V, D, and J gene segments; frequently at least 85 percent similar to human germline sequences present on the transgene; often 90 or 95 percent or more similar to human germline sequences present on the transgene. However, since non-germline sequences are introduced by somatic mutation and VJ and VDJ joining, the human sequence antibodies will frequently have some variable region sequences which are not encoded by human V, D, or J gene segments as found in the human transgene(s) in the germline of the mice. Typically, such non-germline sequences (or individual nucleotide positions) will cluster in or near CDRs, or in regions where somatic mutations are known to cluster. The present invention also provides B cells derived from transgenic or transchromosomal nonhuman animals as described herein. The B cells may be used to generate hybridomas expressing human monoclonal antibodies which bind with high affinity (for instance with a dissociation equilibrium constant (KD) of lower than 10'8 M) to human IL-21. Thus, in one embodiment, the present invention provides a hybridoma which produces a human antibody having an affinity (KD) of below 10'8 M, such as of below 10'9 M, 10 10 M or 10'11 M or even lower when determined by scatchard analysis of IL-21 expressing cells using a radio-actively labeled monoclonal antibody or by determination of the half-maximal binding concentration using FACS analysis, or by analysis using surface plasmon resonance as measured on a BIAcore instrument. The present invention provides an anti-IL-21 antibody comprising a human sequence light chain composed of (1 ) a light chain variable region having a polypeptide sequence which is substantially identical to a polypeptide sequence encoded by a human VL gene segment and a human JL segment, and (2) a light chain constant region encoded by a human CL gene segment; and a human sequence heavy chain composed of a (1) a heavy chain variable region having a polypeptide sequence which is substantially identical to a polypeptide sequence encoded by a human VH gene segment, a D region, and a human JH segment, and (2) a constant region encoded by a human CH gene segment. It should be noted that human D genes may be substantially altered by recombination and somatic mutation events such that the original human germ-line sequence may not be readily recognized.
The development of high affinity human monoclonal antibodies against IL-21 may be facilitated by a method for expanding the repertoire of human variable region gene segments in a transgenic nonhuman animal having a genome comprising an integrated human immunoglobulin transgene, said method comprising introducing into the genome a V gene transgene comprising V region gene segments which are not present in said integrated human immunoglobulin transgene. Often, the V region transgene is a yeast artificial chromosome (YAC) comprising a portion of a human VH or VL (Vκ) gene segment array, as may naturally occur in a human genome or as may be spliced together separately by recombinant methods, which may include out-of-order or omitted V gene segments. Often at least five or more functional V gene segments are contained on the YAC. In this variation, it is possible to make a transgenic animal produced by the V repertoire expansion method, wherein the animal expresses an immunoglobulin chain comprising a variable region sequence encoded by a V region gene segment present on the V region transgene and a C region encoded on the human Ig transgene. By means of the V repertoire expansion method, transgenic animals having at least 5 distinct V genes may be generated; as can animals containing at least about 24 V genes or more. Some V gene segments may be nonfunctional (e.g., pseudogenes and the like); these segments may be retained or may be selectively deleted by recombinant methods available to the skilled artisan, if desired. Once the mouse germline has been engineered to contain a functional YAC having an expanded V segment repertoire, substantially not present in the human Ig transgene containing the J and C gene segments, the trait may be propagated and bred into other genetic backgrounds, including backgrounds where the functional YAC having an expanded V segment repertoire is bred into a nonhuman animal germline having a different human Ig transgene. Multiple functional YACs having an expanded V segment repertoire may be bred into a germline to work with a human Ig transgene (or multiple human Ig transgenes). Although referred to herein as YAC transgenes, such transgenes when integrated into the genome may substantially lack yeast sequences, such as sequences required for autonomous replication in yeast; such sequences may optionally be removed by genetic engineering (e.g., restriction digestion and pulsed-field gel electrophoresis or other suitable method) after replication in yeast is no longer necessary (i.e., prior to introduction into a mouse ES cell or mouse prozygote). Methods of propagating the trait of human sequence immunoglobulin expression, include breeding a transgenic animal having the human Ig transgene(s), and optionally also having a functional YAC having an expanded V segment repertoire. Both VH and VL gene segments may be present on the YAC. The transgenic animal may be bred into any background desired by the practitioner, including backgrounds harboring other human transgenes, including human Ig transgenes and/or transgenes encoding other human lymphocyte proteins. The present invention also provides a high affinity human sequence immunoglobulin produced by a transgenic mouse having an expanded V region repertoire YAC transgene. Although the foregoing describes a specific embodiment of the transgenic animal of the present invention, other embodiments are contemplated which have been classified in three categories:
I. Transgenic animals containing an unrearranged heavy and rearranged light chain immunoglobulin transgene; II. Transgenic animals containing an unrearranged heavy and unrearranged light chain immunoglobulin transgene; and
III. Transgenic animal containing rearranged heavy and an unrearranged light chain immunoglobulin transgene.
IL-21 BPs of the present invention, such as human anti-IL-21 antibodies of the present invention, may be isolated and characterized in a number of different ways. For example, selected hybridomas may be grown in suitable flasks for monoclonal antibody purification. Supernatants may then be filtered and concentrated before affinity chromatography with protein A-sepharose (for IgGI isotype antibodies) (Pharmacia, Piscataway, NJ) or anti-human IgG coated sepharose or protein G-sepharose in case of lgG3 isotype antibodies. Eluted IgG may be checked by gel electrophoresis and high performance liquid chromatography to ensure purity. The buffer solution may be exchanged into PBS, and the concentration may be determined by OD28O using 1.43 extinction coefficient. The monoclonal antibodies may be aliquoted and stored at -800C. To determine if the selected IL-21 BPs, such as human anti-IL-21 monoclonal antibodies, bind to unique epitopes, site-directed or multi-site directed mutagenesis may be used.
To determine the isotype of purified antibodies, isotype ELISAs may be performed. Wells of microtiter plates may be coated with 10 μg/ml of anti-human Ig overnight at 4°C. After blocking with 5% BSA (bovine serum albumin), the plates are reacted with 10 μg/ml of monoclonal antibodies or purified isotype controls, at ambient temperature for two hours. The wells may then be reacted with either human IgGI, lgG2, lgG3 or lgG4, IgE, IgAI , lgA2, or human IgM-specific alkaline phosphatase-conjugated probes. After washing, the plates are developed with pNPP substrate (1 mg/ml) and analyzed by OD at 405 nm.
IL-21 BPs, such as anti-IL-21 human IgGs, may be further tested for reactivity with IL-21 antigen by Western blotting. For instance, antigen may be transferred to nitrocellulose membranes, blocked with 20% non-fat milk, and probed with the IL-21 BPs to be tested. Human IgG binding may be detected using anti-human IgG alkaline phosphatase and developed with BCIP/NBT substrate tablets (Sigma Chem. Co., St. Louis, MO), but detecting agents directed at other specific portions of the IL-21 BP may also be used.
In addition to binding specifically to IL-21 , IL-21 BPs (including human anti-IL-21 antibodies) may be tested for their ability to inhibit the IL-21 mediated activation of the IL-21 receptor. In one embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of an IL-21 BP of the present invention. The pharmaceutical compositions may be formulated with pharmaceutically acceptable carriers or diluents as well as any other known adjuvants and excipients in accordance with conventional techniques such as those disclosed in Remington: The Science and Practice of Pharmacy, 19th Edition, Gennaro, Ed., Mack Publishing Co., Easton, PA, 1995.
The pharmaceutically acceptable carriers or diluents as well as any other known adjuvants and excipients should be suitable for the chosen compound of the present invention and the chosen mode of administration. Suitability for carriers and other components of pharmaceutical compositions is determined based on the lack of significant negative impact on the desired biological properties of the chosen compound or pharmaceutical composition of the present invention (e.g., less than a substantial impact (10% or less relative inhibition, 5% or less relative inhibition, etc.) on antigen binding.
A pharmaceutical composition of the present invention may also include diluents, fillers, salts, buffers, detergents (e. g., a nonionic detergent, such as Tween-80), stabilizers, stabilizers (e. g., sugars or protein-free amino acids), preservatives, tissue fixatives, solubilizers, and/or other materials suitable for inclusion in a pharmaceutical composition.
The actual dosage levels of the active ingredients in the pharmaceutical compositions of the present invention may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. The selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular compositions of the present invention employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.
The pharmaceutical composition may be administered by any suitable route and mode. Suitable routes of administering a compound of the present invention in vivo and in vitro are well known in the art and may be selected by those of ordinary skill in the art.
The compounds of the present invention may be administered via any suitable route, such as an oral, nasal, inhalable, topical (including buccal, transdermal and sublingual), rectal, vaginal and/or parenteral route. In one embodiment, a pharmaceutical composition of the present invention is administered orally, for example, with an inert diluent or an assimilable edible carrier. The active ingredient may be enclosed in a hard or soft shell gelatin capsule, compressed into tablets, or incorporated directly into the subject's diet. Pharmaceutical compositions of the present invention which are suitable for oral administration include ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like containing such carriers as are known in the art to be appropriate. To administer a compound of the present invention by oral administration, it may be necessary to coat the compound with, or coadminister the compound with, a material to prevent its inactivation.
In one embodiment, a pharmaceutical composition of the present invention is administered nasally. Pharmaceutical compositions of the present invention which are suitable for nasal administration are known in the art and typically include sprays, nose drops and inhalants containing such carriers as are known in the art to be appropriate.
In one embodiment, a pharmaceutical composition of the present invention is administered topically. Pharmaceutical compositions of the present invention which are suitable for topical or transdermal administration include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants containing such carriers as are known in the art to be appropriate.
In one embodiment, a pharmaceutical composition of the present invention is administered rectally. Pharmaceutical compositions of the present invention which are suitable for rectal administration are known in the art and include gels, pastes, spray formulations, suppositories containing such carriers as are known in the art to be appropriate.
In one embodiment, a pharmaceutical composition of the present invention is administered vaginally. Pharmaceutical compositions of the present invention which are suitable for vaginal administration include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate.
In one embodiment, a pharmaceutical composition of the present invention is administered parenterally.
The phrases "parenteral administration" and "administered parenterally" as used herein means modes of administration other than enteral and topical administration, usually by injection, and include epidermal, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, intratendinous, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, intracranial, intrathoracic, epidural and intrasternal injection and infusion. In one embodiment that pharmaceutical composition is administered by intravenous or subcutaneous injection or infusion.
In one embodiment the compounds of the present invention are administered in crystalline form by subcutaneous injection, cf. Yang et al., PNAS USA 100(12), 6934-6939 (2003). The pharmaceutical compositions of the present invention may be administered with medical devices known in the art. For example, in one embodiment, a pharmaceutical composition of the present invention may be administered with a needleless hypodermic injection device, such as the devices disclosed in US 5,399,163, US 5,383,851 , US 5,312,335, US 5,064,413, US 4,941 ,880, US 4,790,824, or US 4,596,556. Examples of well- known implants and modules useful in the present invention include: US 4,487,603, which discloses an implantable micro-infusion pump for dispensing medication at a controlled rate; US 4,486,194, which discloses a therapeutic device for administering medicants through the skin; US 4,447,233, which discloses a medication infusion pump for delivering medication at a precise infusion rate; US 4,447,224, which discloses a variable flow implantable infusion apparatus for continuous drug delivery; US 4,439,196, which discloses an osmotic drug delivery system having multi-chamber compartments; and US 4,475,196, which discloses an osmotic drug delivery system. Many other such implants, delivery systems, and modules are known to those skilled in the art.
Pharmaceutical compositions of the present invention may be formulated for particular routes of administration, such as oral, nasal, topical (including buccal, transdermal and sublingual), rectal, vaginal and/or parenteral administration. The pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any methods known in the art of pharmacy. The amount of active ingredient which may be combined with a carrier material to produce a single dosage form will vary depending upon the subject being treated, and the particular mode of administration. The amount of active ingredient which may be combined with a carrier material to produce a single dosage form will generally be that amount of the composition which produces a therapeutic effect. Generally, out of one hundred per cent, this amount will range from about 0.01% to about 99% of active ingredient, such as from about 0.1% to about 70%, for instance from about 1% to about 30%.
Regardless of the route of administration selected, the compounds of the present invention, which may be used in the form of a pharmaceutically acceptable salt or in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art. A "pharmaceutically acceptable salt" refers to a salt that retains the desired biological activity of the parent compound and does not impart any undesired toxicological effects (see for instance Berge, S. M. et al., J. Pharm. Sci. 66, 1-19 (1977)). Examples of such salts include acid addition salts and base addition salts. Acid addition salts include those derived from nontoxic inorganic acids, such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous acids and the like, as well as from nontoxic organic acids such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids and the like. Base addition salts include those derived from alkaline earth metals, such as sodium, potassium, magnesium, calcium and the like, as well as from nontoxic organic amines, such as N,N'-dibenzylethylenediamine, N-methylglucamine, chloroprocaine, choline, diethanol- amine, ethylenediamine, procaine and the like.
Pharmaceutically acceptable carriers include any and all suitable solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonicity agents, antioxidants and absorption delaying agents, and the like that are physiologically compatible with a compound of the present invention. Examples of suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions of the present invention include water, saline, phosphate buffered saline, ethanol, dextrose, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, corn oil, peanut oil, cottonseed oil, and sesame oil, carboxymethyl cellulose colloidal solutions, tragacanth gum and injectable organic esters, such as ethyl oleate, and/or various buffers. Other carriers are well known in the pharmaceutical arts.
Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions of the present invention is contemplated.
Proper fluidity may be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
Pharmaceutical compositions of the present invention may also comprise pharmaceutically acceptable antioxidants for instance (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
Pharmaceutical compositions of the present invention may also comprise isotonicity agents, such as sugars, polyalcohols such as mannitol, sorbitol, glycerol or sodium chloride in the compositions.
Pharmaceutically acceptable diluents include saline and aqueous buffer solutions. The pharmaceutical compositions of the present invention may also contain one or more adjuvants appropriate for the chosen route of administration such as preservatives, wetting agents, emulsifying agents, dispersing agents, preservatives or buffers, which may enhance the shelf life or effectiveness of the pharmaceutical composition. Compounds of the present invention may for instance be admixed with lactose, sucrose, powders (e.g., starch powder), cellulose esters of alkanoic acids, stearic acid, talc, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulphuric acids, acacia, gelatin, sodium alginate, polyvinylpyrrolidine, and/or polyvinyl alcohol. Other examples of adjuvants are QS21 , GM-CSF, SRL-172, histamine dihydrochloride, thymocartin, Tio-TEPA, monophosphoryl-lipid A/micobacteria compositions, alum, incomplete Freund's adjuvant, montanide ISA, ribi adjuvant system, TiterMax adjuvant, syntex adjuvant formulations, immune-stimulating complexes (ISCOMs), gerbu adjuvant, CpG oligodeoxynucleotides, lipopolysaccharide, and polyinosinic:polycytidylic acid.
Prevention of presence of microorganisms may be ensured both by sterilization procedures and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol, sorbic acid, and the like. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
Pharmaceutical compositions of the present invention comprising a compound of the present invention may also include a suitable salt therefor. Any suitable salt, such as an alkaline earth metal salt in any suitable form (e.g., a buffer salt), may be used in the stabilization of the compound of the present invention. Suitable salts typically include sodium chloride, sodium succinate, sodium sulfate, potassium chloride, magnesium chloride, magnesium sulfate, and calcium chloride. In one embodiment, an aluminum salt is used to stabilize a compound of the present invention in a pharmaceutical composition of the present invention, which aluminum salt also may serve as an adjuvant when such a composition is administered to a patient. Pharmaceutical compositions according to the present invention may be in a variety of suitable forms. Such forms include, for example, liquid, semi-solid and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, emulsions, microemulsions, gels, creams, granules, powders, tablets, pills, powders, liposomes, dendrimers and other nanoparticles (see for instance Baek et al., Methods Enzymol. 362, 240-9 (2003), Nigavekar et al., Pharm Res. 21.(3), 476-83 (2004), microparticles, and suppositories.
The optima form depends on the chosen mode of administration, the nature of the composition, and the therapeutic application. Formulations may include, for instance, powders, pastes, ointments, jellies, waxes, oils, lipids, lipid (cationic or anionic) containing vesicles, DNA conjugates, anhydrous absorption pastes, oil-in-water and water-in-oil emulsions, emulsions carbowax (polyethylene glycols of various molecular weights), semisolid gels, and semi-solid mixtures containing carbowax. Any of the foregoing may be appropriate in treatments and therapies in accordance with the present invention, provided that the active ingredient in the pharmaceutical composition is not inactivated by the formulation and the formulation is physiologically compatible and tolerable with the route of administration. See also for instance Powell et al., "Compendium of excipients for parenteral formulations" PDA J Pharm Sci Technol. 52, 238-311 (1998) and the citations therein for additional information related to excipients and carriers well known to pharmaceutical chemists. The compounds of the present invention may be prepared with carriers that will protect the compound against rapid release, such as a controlled release formulation, including implants, transdermal patches, and microencapsulated delivery systems. Such carriers may include gelatin, glyceryl monostearate, glyceryl distearate, biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid alone or with a wax, or other materials well known in the art.. Methods for the preparation of such formulations are generally known to those skilled in the art. See e.g., Sustained and Controlled Release Drug Delivery Systems, J. R. Robinson, ed., Marcel Dekker, Inc., New York, 1978.
To administer compositions of the present invention by certain routes of administration, it may be necessary to coat the compound with, or co-administer the compound with, a material to prevent its inactivation. For example, the compound of the present invention may be administered to a subject in an appropriate carrier, for example, liposomes, or a diluent. Liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes (Strejan et al., J. Neuroimmunol. 7, 27 (1984)). Depending on the route of administration, the active compound may be coated in a material to protect the compound from the action of acids and other natural conditions that may inactivate the compound. For example, the compound may be administered to a subject in an appropriate carrier, for example, liposomes. Liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes (Strejan et al., J. Neuroimmunol. 7, 27 (1984)).
In one embodiment, the compounds of the present invention may be formulated to ensure proper distribution in vivo. For example, the blood-brain barrier (BBB) excludes many highly hydrophilic compounds. To ensure that the therapeutic compounds of the present invention cross the BBB (if desired), they may be formulated, for example, in liposomes. For methods of manufacturing liposomes, see for instance US 4,522,81 1 , US 5,374,548 and US 5,399,331. The liposomes may comprise one or more moieties which are selectively transported into specific cells or organs, thus enhance targeted drug delivery (see for instance V. V. Ranade J. Clin. Pharmacol. 29, 685 (1989)). Exemplary targeting moieties include folate or biotin (see for instance US 5,416,016), mannosides (Umezawa et al., Biochem. Biophys. Res. Commun. 153, 1038 (1988)), antibodies (P. G. Bloeman et al., FEBS Lett. 357, 140 (1995), M. Owais et al., Antimicrob. Agents Chemother. 39, 180 (1995)), surfactant protein A receptor (Briscoe et al., Am. J. Physiol. 1233, 134 (1995)), different species of which may comprise the pharmaceutical compositions of the present inventions, as well as components of the invented molecules, p120 (Schreier et al., J. Biol. Chem. 269, 9090 (1994)), see also K. Keinanen, M. L. Laukkanen, FEBS Lett. 346, 123 (1994) and J.J. Killion, I.J. Fidler, Immunomethods 4, 273 (1994).
In one embodiment of the present invention, the compounds of the present invention are formulated in liposomes. In a further embodiment, the liposomes include a targeting moiety. In a further embodiment, the compounds in the liposomes are delivered by bolus injection to a site proximal to the desired area, e.g., the site of inflammation or infection, or the site of a tumor. The composition should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. In one embodiment, the compounds of the present invention may be formulated to prevent or reduce their transport across the placenta. This may be done by methods known in the art, e.g., by PEGylation of the compounds or by use of F(ab')2 fragments. Further reference can be made to Cunningham-Rundles C et al., J Immunol Methods. 152, 177-190 (1992) and to Landor M., Ann Allergy Asthma Immunol 74, 279-283 (1995).
Pharmaceutically acceptable carriers for parenteral administation include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions of the present invention is contemplated. Supplementary active compounds may also be incorporated into the compositions.
Pharmaceutical compositions for injection must typically be sterile and stable under the conditions of manufacture and storage. The composition may be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration. The carrier may be a aqueous or nonaqueous solvent or dispersion medium containing for instance water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. The proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as glycerol, mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin. Sterile injectable solutions may be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients e.g. as enumerated above, as required, followed by sterilization microfiltration. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients e.g. from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, examples of methods of preparation are vacuum drying and freeze-drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
Sterile injectable solutions may be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by sterilization microfiltration. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, examples of methods of preparation are vacuum drying and freeze-drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile -filtered solution thereof.
The pharmaceutical composition of the present invention may contain one compound of the present invention or a combination of compounds of the present invention. Thus, in one embodiment, a pharmaceutical composition of the present invention includes a combination of multiple (e.g., two or more) compounds of the present invention which act by different mechanisms, e.g., one compound which predominately acts by inducing CDC in combination with another compound which predominately acts by inducing apoptosis. The IL-21 BPs (including anti-IL-21 antibodies, immunoconjugates, bispecific/- multispecific molecules, compositions and other derivatives described herein) of the present invention have numerous in vitro and in vivo diagnostic and therapeutic utilities involving the diagnosis and treatment of disorders involving IL-21. For example, the antibodies may be administered to cells in culture, e.g., in vitro or ex vivo, or to human subjects, e.g., in vivo, to treat, prevent and to diagnose a variety of disorders. As used herein, the term "subject" is intended to include human and non-human animals which respond to the IL-21 BP. Subjects may for instance include human patients having disorders that may be corrected or ameliorated by inhibiting the IL-21 receptor, such as for instance graft rejection.
In one embodiment, the present invention provides methods for detecting the presence of IL-21 antigen in a sample, or measuring the amount of IL-21 antigen, comprising contacting the sample, and a control sample, with an IL-21 BP which specifically binds to IL-21 , under conditions that allow for formation of a complex between the IL-21 BP or portion thereof and IL-21. The formation of a complex is then detected, wherein a difference complex formation between the sample compared to the control sample is indicative the presence of IL-21 antigen in the sample. Examples of methods for detecting immunoassays include, without limitation, an ELISA, an RIA, FACS assays, plasmon resonance assays, chromatographic assays, tissue immunohistochemistry, Western blot, and/or immunoprecipitation.
In one embodiment, IL-21 BPs of the present invention may be used to detect levels of circulating IL-21 , which levels can then be linked to certain disease symptoms. Alternatively, the IL-21 BPs may be used to interact with the function of cells expressing the IL-21 receptor, thereby implicating these cells as important mediators of the disease. This may be achieved by contacting a sample and a control sample with the anti-IL-21 antibody under conditions that allow for the formation of a complex between the antibody and IL-21. Any complexes formed between the antibody and IL-21 are detected and compared in the sample and the control.
In one embodiment, the present invention provides a method for detecting the presence or quantifying the amount of IL-21 in vivo or in vitro. The method comprises (i) administering to a subject a composition (comprising e.g., IL-21 BPs, human anti-IL-21 antibodies, and/or bispecific/multispecific antibodies) of the present invention conjugated to a detectable marker; (ii) exposing the subject to a means for detecting said detectable marker to identify areas containing IL-21.
In one embodiment, immunoconjugates of the present invention may be used to target compounds (e.g., therapeutic agents, labels, cytotoxins, immunosuppressants, etc.) to cells which have IL-21 bound to their surface by linking such compounds to the IL-21 BP. The present invention provides methods for treating a disease or disorder in a subject, wherein said disease or disorder may be treatable by use of an IL-21 antagonist , which method comprises administation of a therapeutically effective amount of an IL-21 BP of the present invention to a subject in need thereof. Such IL-21 BPs are used to inhibit IL-21 interaction with the IL-21 receptor. By contacting the IL-21 BP with IL-21 (e.g., by administering the antibody to a subject), the ability of IL-21 to induce such activities is inhibited and, thus, the associated disorder is treated.
Such a method involves administering to a subject an IL-21 BP of the present invention in an amount effective to treat or prevent the disorder. The IL-21 BP may be administered alone or along with another therapeutic agent, which acts in conjunction with or synergistically with the IL-21 BP to treat or prevent the disease.
In one embodiment, the present invention provides a method for treating autoimmune diseases or disorders in humans, which method comprises administation of a therapeutically effective amount of an IL-21 BP of the present invention to a subject in need thereof.
In one embodiment, the present invention provides the use of an IL-21 BP of the present invention for the preparation of a pharmaceutical composition for treating autoimmune diseases or disorders.
Examples of inflammatory, immune and/or autoimmune disorders, which may be treatable with IL-21 binding peptides according to the invention, include the following: vasculitides and other vessel disorders, such as microscopic polyangiitis, Churg-Strauss syndrome, and other ANCA-associated vasculitides, polyarteritis nodosa, essential cryoglobulinaemic vasculitis, cutaneous leukocytoclastic angiitis, Kawasaki disease, Takayasu arteritis, giant cell arthritis, Henoch-Schόnlein purpura, primary or isolated cerebral angiitis, erythema nodosum, thrombangiitis obliterans, thrombotic thrombocytopenic purpura (including hemolytic uremic syndrome), and secondary vasculitides, including cutaneous leukocytoclastic vasculitis (e.g., secondary to hepatitis B, hepatitis C, Waldenstrom's macroglobulinemia, B-cell neoplasias, rheumatoid arthritis, Sjogren's syndrome, and systemic lupus erythematosus), erythema nodosum, allergic vasculitis, panniculitis, Weber- Christian disease, purpura hyperglobulinaemica, and Buerger's disease; skin disorders, such as contact dermatitis, linear IgA dermatosis, vitiligo, pyoderma gangrenosum, epidermolysis bullosa acquisita, pemphigus vulgaris (including cicatricial pemphigoid and bullous pemphigoid), alopecia areata (including alopecia universalis and alopecia totalis), dermatitis herpetiformis, erythema multiforme, and chronic autoimmune urticaria (including angioneurotic edema and urticarial vasculitis); immune-mediated cytopenias, such as autoimmune neutropenia, and pure red cell aplasia; connective tissue disorders, such as CNS lupus, discoid lupus erythematosus, CREST syndrome, mixed connective tissue disease, polymyositis/dermatomyositis, inclusion body myositis, secondary amyloidosis, cryoglobulinemia type I and type II, fibromyalgia, phospholipid antibody syndrome, secondary hemophilia, relapsing polychondritis, sarcoidosis, stiff man syndrome, rheumatic fever, and eosinophil fasciitis; arthritides, such as ankylosing spondylitis, juvenile chronic arthritis, adult Still's disease, SAPHO syndrome, sacroileitis, reactive arthritis, Still's disease, and gout; hematologic disorders, such as aplastic anemia, primary hemolytic anemia (including cold agglutinin syndrome), hemolytic anemia with warm autoantibodies, hemolytic anemia secondary to CLL or systemic lupus erythematosus; POEMS syndrome, pernicious anemia, Waldemstrόm's purpura hyperglobulinaemica, Evans syndrome, agranulocytosis, autoimmune neutropenia, Franklin's disease, Seligmann's disease, μ chain disease, factor VIII inhibitor formation, factor IX inhibitor formation, and paraneoplastic syndrome secondary to thymoma and lymphomas; endocrinopathies, such as polyendocrinopathy, and Addison's disease; further examples are autoimmune hypoglycemia, autoimmune hypothyroidism, autoimmune insulin syndrome, de Quervain's thyroiditis, and insulin receptor antibody- mediated insulin resistance; hepato-gastrointestinal disorders, such as celiac disease, Whipple's disease, primary biliary cirrhosis, chronic active hepatitis, primary sclerosing cholangiitis, and autoimmune gastritis; nephropathies, such as rapid progressive glomerulonephritis, post-streptococcal nephritis, Goodpasture's syndrome, membranous glomerulonephritis, cryoglobulinemic nephritis, minimal change disease, and steroid- dependent nephritic syndrome; neurological disorders, such as autoimmune neuropathies, mononeuritis multiplex, Lambert-Eaton's myasthenic syndrome, Sydenham's chorea, tabes dorsalis, and Guillain-Barre's syndrome; further examples are myelopathy/tropical spastic paraparesis, myasthenia gravis, acute inflammatory demyelinating polyneuropathy, and chronic inflammatory demyelinating polyneuropathy; cardiac and pulmonary disorders, such as fibrosing alveolitis, bronchiolitis obliterans, allergic aspergillosis, cystic fibrosis, Lόffler's syndrome, myocarditis, and pericarditis; further examples are hypersensitivity pneumonitis, and paraneoplastic syndrome secondary to lung cancer; allergic disorders, such as bronchial asthma, hyper-lgE syndrome, and angioneurotic syndrome; ophthalmologic disorders, such as idiopathic chorioretinitis, and amaurosis fugax; infectious diseases, such as parvovirus B infection (including hands-and-socks syndrome); gynecological-obstretical disorders, such as recurrent abortion, recurrent fetal loss, intrauterine growth retardation, and paraneoplastic syndrome secondary to gynaecological neoplasms; male reproductive disorders, such as paraneoplastic syndrome secondary to testicular neoplasms; and transplantation-derived disorders, such as IL-21 mediated graft rejection, for instance allograft and xenograft rejection, and graft-versus-host disease.
In one embodiment, the disease is a transplantation-derived disorder. In one embodiment, such disorder is derived from IL-21 mediated graft rejection, for instance allograft and xenograft rejection, and graft-versus-host disease. In one embodiment, the disease is rheumatoid arthritis (RA). In one embodiment, the disease is selected from inflammatory bowel disease (IBD), ulcerative colitis, Crohn's disease, juvenile onset diabetes, multiple sclerosis, immune- mediated thrombocytopenias, such as acute idiopathic thrombocytopenic purpura and chronic idiopathic thrombocytopenic purpura, hemolytic anemia (including autoimmune hemolytic anemia), myasthenia gravis, systemic sclerosis, and pemphigus vulgaris.
In one embodiment, the disease is selected from inflammatory bowel disease (IBD), ulcerative colitis, Crohn's disease, and multiple sclerosis.
In one embodiment, the present invention provides a method for treating or preventing systemic lupus erythematosus, rheumatoid arthritis or inflammatory bowel disease, which method comprises administation of a therapeutically effective amount of an IL-21 BP of the present invention to a subject in need thereof.
In one embodiment, the present invention provides the use of an IL-21 BP of the present invention for the preparation of a pharmaceutical composition for treating systemic lupus erythematosus, rheumatoid arthritis or inflammatory bowel disease.
In one embodiment, the IL-21 BPs of the present invention may be used in vivo or in vitro for diagnosing diseases wherein altered levels of IL-21 play an active role in the pathogenesis by detecting levels of IL-21. This may be achieved, for example, by contacting a sample to be tested, optionally along with a control sample, with the IL-21 BP under conditions that allow for formation of a complex between the antibody and IL-21. Complex formation is then detected (e.g., using an ELISA). When using a control sample along with the test sample, complex is detected in both samples and any statistically significant difference in the formation of complexes between the samples is indicative of the presence of IL-21 in the test sample. More specifically, the present invention provides methods for the identification of, and diagnosis of invasive cells and tissues, and other cells targeted by IL-21 BPs of the present invention, and for the monitoring of the progress of therapeutic treatments, status after treatment, risk of developing cancer, cancer progression, and the like.
In one example of such a diagnostic assay, the present invention provides a method of diagnosing the level of invasive cells in a tissue comprising forming an immunocomplex between an IL-21 BP and potential IL-21 containing tissues, and detecting formation of the immunocomplex, wherein the formation of the immunocomplex correlates with the presence of invasive cells in the tissue. The contacting may be performed in vivo, using labeled isolated antibodies and standard imaging techniques, or may be performed in vitro on tissue samples. IL-21 BPs may be used to detect IL-21-containing peptides and peptide fragments in any suitable biological sample by any suitable technique. Examples of conventional immunoassays provided by the present invention include, without limitation, an ELISA, an RIA, FACS assays, plasmon resonance assays, chromatographic assays, tissue immunohistochemistry, Western blot, and/or immunoprecipitation using an IL-21 BP. Anti- IL-21 antibodies of the present invention may be used to detect IL-21 and IL-21 -fragments from humans. Suitable labels for the IL-21 BP and/or secondary antibodies used in such techniques include, without limitation, various enzymes, prosthetic groups, fluorescent materials, luminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; and examples of suitable radioactive material include 125I, 131I, 35S, and 3H.
IL-21 BPs may also be assayed in a biological sample by a competition immunoassay utilizing IL-21 peptide standards labeled with a detectable substance and an unlabeled IL-21 BP, such as an unlabelled anti-IL-21 antibody, for example. In such an assay, the biological sample, the labeled IL-21 peptide standard(s) and the IL-21 BP are combined and the amount of labeled IL-21 standard bound to the unlabeled IL-21 BP is determined. The amount of IL-21 peptide in the biological sample is inversely proportional to the amount of labeled IL-21 standard bound to the IL-21 BP.
In one embodiment, the present invention provides an in vivo imaging method wherein an IL-21 BP, such as an anti-IL-21 antibody, of the present invention is conjugated to a detection-promoting radio-opaque agent, the conjugated antibody is administered to a host, such as by injection into the bloodstream, and the presence and location of the labeled antibody in the host is assayed. Through this technique and any other diagnostic method provided herein, the present invention provides a method for screening for the presence of disease-related cells in a human patient or a biological sample taken from a human patient. For diagnostic imaging, radioisotopes may be bound to an IL-21 BP either directly, or indirectly by using an intermediary functional group. Useful intermediary functional groups include chelators, such as ethylenediaminetetraacetic acid and diethylenetriaminepentaacetic acid (see for instance US 5,057,313). In such diagnostic assays involving radioisotope-conjugated IL-21 BPs, the dosage of conjugated peptide delivered to the patient typically is maintained at as low a level as possible through the choice of isotope for the best combination of minimum half-life, minimum retention in the body, and minimum quantity of isotope, which will permit detection and accurate measurement.
In addition to radioisotopes and radio-opaque agents, diagnostic methods may be performed using IL-21 BPs that are conjugated to dyes (such as with the biotin-streptavidin complex), contrast agents, fluorescent compounds or molecules and enhancing agents (e.g. paramagnetic ions) for magnetic resonance imaging (MRI) (see, e.g., US Pat. No. 6,331 ,175, which describes MRI techniques and the preparation of antibodies conjugated to a MRI enhancing agent). Such diagnostic/detection agents may be selected from agents for use in magnetic resonance imaging, and fluorescent compounds. In order to load an IL-21 BP, such as an antibody, component with radioactive metals or paramagnetic ions, it may be necessary to react it with a reagent having a long tail to which are attached a multiplicity of chelating groups for binding the ions. Such a tail may be a polymer such as a polylysine, polysaccharide, or other derivatized or derivatizable chain having pendant groups to which may be bound chelating groups such as, e.g., porphyrins, polyamines, crown ethers, bisthiosemicarbazones, polyoximes, and like groups known to be useful for this purpose. Chelates may be coupled to IL-21 BPs using standard chemistries. A chelate is normally linked to an IL-21 BP, such as an anti-IL-21 mAB, by a group, which enables formation of a bond to the molecule with minimal loss of immunoreactivity and minimal aggregation and/or internal cross-linking. Other, more unusual, methods and reagents for conjugating chelates to antibodies are disclosed in for instance US 4,824,659. Examples of potentially useful metal-chelate combinations include 2-benzyl-DTPA and its monomethyl and cyclohexyl analogs, used with diagnostic isotopes in the general energy range of 60 to 4,000 keV, such as 125I, 123I, 1241, 62Cu, 64Cu, 18F, 111In, 67Ga, 67Ga, 99Tc, 94Tc, 11C, 13N, 15O, and 76BR, for radio- imaging. These and similar chelates, when complexed with non-radioactive metals, such as manganese, iron, and gadolinium may be useful for MRI diagnostic methods in connection with IL-21 BPs. Macrocyclic chelates such as NOTA, DOTA, and TETA are of use with a variety of metals and radiometals, most particularly with radionuclides of gallium, yttrium, and copper, respectively. Such metal-chelate complexes may be made very stable by tailoring the ring size to the metal of interest. Other ring-type chelates such as macrocyclic polyethers, which are of interest for stably binding nuclides, such as 223Ra for RAIT may also be suitable in diagnostic methods.
Thus, the present invention provides diagnostic IL-21 BP conjugates, wherein the IL-21 BP is conjugated to a contrast agent (such as for magnetic resonance imaging, computed tomography, or ultrasound contrast-enhancing agent) or a radionuclide that may be, for example, a gamma-, beta-, alpha-, Auger electron-, or positron-emitting isotope. Additional useful conjugated IL-21 BPs are described elsewhere herein, which may also be useful in diagnostic methods and compositions (e.g., diagnostic kits) provided by the present invention. In one embodiment, the present invention provides a kit for diagnosis of cancer comprising a container comprising an IL-21 BP, such as an anti-IL-21 antibody, and one or more reagents for detecting binding of the IL-21 BP to an IL-21 peptide. Reagents may include, for example, fluorescent tags, enzymatic tags, or other detectable tags. The reagents may also include secondary or tertiary antibodies or reagents for enzymatic reactions, wherein the enzymatic reactions produce a product that may be visualized. In one embodiment, the present invention provides a diagnostic kit comprising one or more IL-21 BPs, such as anti-IL-21 antibodies, of the present invention in labeled or unlabeled form in suitable container(s), reagents for the incubations for an indirect assay, and substrates or derivatizing agents for detection in such an assay, depending on the nature of the label. Control reagent(s) and instructions for use also may be included.
Diagnostic kits may also be supplied for use with an IL-21 BP, such as a conjugated/labeled anti-IL-21 antibody, for the detection of a cellular activity or for detecting the presence of IL-21 peptides in a tissue sample or host. In such diagnostic kits, as well as in kits for therapeutic uses described elsewhere herein, an IL-21 BP typically may be provided in a lyophilized form in a container, either alone or in conjunction with additional antibodies specific for a target cell or peptide. Typically, a pharmaceutical acceptable carrier (e.g., an inert diluent) and/or components thereof, such as a Tris, phosphate, or carbonate buffer, stabilizers, preservatives, biocides, biocides, inert proteins, e.g., serum albumin, or the like, also are included (typically in a separate container for mixing) and additional reagents (also typically in separate container(s)). In certain kits, a secondary antibody capable of binding to the anti-IL-21 antibody or other IL-21 BP, which typically is present in a separate container, is also included. The second antibody is typically conjugated to a label and formulated in manner similar to the anti-IL-21 antibody or other IL-21 BP of the present invention.
Using the methods described above and elsewhere herein IL-21 BPs may be used to define subsets of cancer/tumor cells and characterize such cells and related tissues/growths.
In one example, an IL-21 BP or anti-IL-21 antibody, may be added to nitrocellulose, or other solid support which is capable of immobilizing cells, cell particles, or soluble proteins. The support may then be washed with suitable buffers followed by treatment with the detectably labeled IL-21 peptide or antibody. The solid phase support may then be washed with the buffer a second time to remove unbound peptide or antibody. The amount of bound label on the solid support may then be detected by known method steps.
Linked enzymes that react with an exposed substrate may be used to generate a chemical moiety which may be detected, for example, by spectrophotometric, fluorometric or by visual means, in the context of an IL-21 BP conjugate and/or fusion protein. Enzymes which may be used to detectably label IL-21 BPs and anti-IL-21 antibodies include malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta- galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase, and acetylcholinesterase. It is also possible to label an IL-21 BP with a fluorescent compound. When the fluorescent labeled antibody is exposed to light of the proper wave length, its presence may be detected due to fluorescence. Among the most commonly used fluorescent labeling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde, and fluorescamine.
The IL-21 BPS, such as anti-IL-21 antibodies, may also be detectably labeled using fluorescence-emitting metals such as 152Eu, or others of the lanthanide series. These metals may be attached to an anti-IL-21 antibody, for example, using such metal chelating groups as diethylenetriaminepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA). IL-21 BPs and anti-IL-21 antibodies may also be detectably labeled by coupling to a chemiluminescent compound. The presence of the chemiluminescently labeled IL-21-BP is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt, and oxalate ester.
Likewise, a bioluminescent compound may be used to label an IL-21 BP. Bioluminescence is a type of chemiluminescence found in biological systems in which a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting the presence of luminescence. Important bioluminescent compounds for purposes of labeling are luciferin, luciferase, and aequorin. Detection of a labeled peptide or antibody, antibody fragment or derivative may be accomplished by a scintillation counter, for example, if the detectable label is a radioactive gamma emitter, or by a fluorometer, for example, if the label is a fluorescent material. In the case of an enzyme label, the detection may be accomplished by colorimetric methods which employ a substrate for the enzyme. Detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards.
These and other diagnostic techniques may be used to screen any suitable material for IL-21 peptides or I L-21 -fragments. Examples of materials that may be screened include, for example, blood, serum, lymph, urine, inflammatory exudate, cerebrospinal fluid, amniotic fluid, a tissue extract or homogenate, and the like. However, the present invention is not limited to assays using only these samples, it being possible for one of ordinary skill in the art to determine suitable conditions which allow the use of other samples.
In situ detection may be accomplished by removing a histological specimen from a patient, and providing the combination of labeled IL-21 BPs, such as anti-IL-21 antibodies, of the present invention to such a specimen. The IL-21 BP, anti-IL-21 -antibody (or fragment) of the present invention may be provided by applying or by overlaying the labeled IL-21 BP, such as a labelled anti-IL-21 antibody (or fragment), of the present invention to a biological sample. Through the use of such a procedure, it is possible to determine not only the presence of IL-21 or I L-21 -fragment but also the distribution of such peptides in the examined tissue (e.g., in the context of assessing the spread of cancer cells). Using the present invention, those of ordinary skill will readily perceive that any of a wide variety of histological methods (such as staining procedures) may be modified in order to achieve such in situ detection. Compositions of the present invention may include a "therapeutically effective amount" or a "prophylactically effective amount" of an IL-21 BP. A "therapeutically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired therapeutic result. A therapeutically effective amount of an IL-21 BP may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the IL-21 BP to elicit a desired response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects of the antibody or antibody portion are outweighed by the therapeutically beneficial effects. A "prophylactically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result (e.g., a reduction in the likelihood of developing a disorder, a reduction in the intensity or spread of a disorder, an increase in the likelihood of survival during an imminent disorder, a delay in the onset of a disease condition, etc.). Typically, because a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount. A "therapeutically effective amount" for rheumatoid arthritis may result in an at least ACR2O Preliminary Definition of Improvement in the patients, such as in at least an ACR50 Preliminary Definition of Improvement, for instance at least an ARC70 Preliminary Definition of Improvement. ACR20 Preliminary Definition of Improvement is defined as:
≥ 20% improvement in: Tender Joint Count (TJC) and Swollen Joint Count (SJC) and ≥ 20% improvement in 3 of following 5 assessments: Patient Pain Assessment (VAS), Patient Global assessment (VAS), Physician Global Assessment (VAS), Patent Self- Assessed Disability (HAQ), Acute Phase Reactant (CRP or ESR). ACR50 and ACR70 are defined in the same way with ≥ 50% and ≥ 70% improvements, respectively. For further details see Felson et al., in American College of Rheumatology Preliminary Definition of Improvement in Rheumatoid Arthritis; Arthritis Rheumatism 38, 727-735 (1995).
Alternatively, a therapeutically effective amount for rheumatoid arthritis may be measured by DAS (disease activity score), including DAS28 and/or DAS56, as defined by The European League Against Rheumatism (www.eular.org).
Dosage regimens of compounds of and/or used in the methods of the invention typically are selected or adjusted to provide the optimum desired response (e.g., a therapeutic response). In general, any suitable dosage regimen can be used. For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. Parenteral compositions may be formulated in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subjects to be treated; each unit contains a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the present invention are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individuals.
The efficient dosages and the dosage regimens for the IL-21 BPs of the present invention depend on the disease or condition to be treated and may be determined by the persons skilled in the art. An exemplary, non-limiting range for a therapeutically effective amount of a compound of the present invention is about 0.1 -100 mg/kg, such as about 0.1 -50 mg/kg, for example about 0.1 -20 mg/kg, such as about 0.1-10 mg/kg, for instance about 0.5, about such as 0.3, about 1 , or about 3 mg/kg.
A physician or veterinarian having ordinary skill in the art may readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the IL-21 BPs of the present invention employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. In general, a suitable daily dose of a composition of the present invention will be that amount of the compound which is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above.
Administration may be intravenous, intramuscular, intraperitoneal, or subcutaneous, and for instance administered proximal to the site of the target. If desired, the effective daily dose of a pharmaceutical composition may be administered as two, three, four, five, six or more sub- doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms. While it is possible for a compound of the present invention to be administered alone, it is preferable to administer the compound as a pharmaceutical composition as described above.
In one embodiment, the IL-21 BPs of the present invention may be administered by infusion in a weekly dosage of from 10 to 500 mg/m2, such as of from 200 to 400 mg/m2. Such administration may be repeated, e.g., 1 to 8 times, such as 3 to 5 times. The administration may be performed by continuous infusion over a period of from 2 to 24 hours, such as of from 2 to 12 hours.
In one embodiment, the IL-21 BPs of the present invention may be administered by slow continuous infusion over a long period, such as more than 24 hours, in order to reduce toxic side effects.
In one embodiment the IL-21 BPs of the present invention may be administered in a weekly dosage of from 250 mg to 2000 mg, such as for example 300 mg, 500 mg, 700 mg, 1000 mg, 1500 mg or 2000 mg, for up to 8 times, such as from 4 to 6 times. The administration may be performed by continuous infusion over a period of from 2 to 24 hours, such as of from 2 to 12 hours. Such regimen may be repeated one or more times as necessary, for example, after 6 months or 12 months. The dosage may be determined or adjusted by measuring the amount of compound of the present invention in the blood upon administration by for instance taking out a biological sample and using anti-idiotypic antibodies which target the antigen binding region of the IL-21 BPs of the present invention. In one embodiment, the IL-21 BPs of the present invention may be administered by maintenance therapy, such as, e.g., once a week for a period of 6 months or more.
In one embodiment, the IL-21 BPs of the present invention may be administered by a regimen including one infusion of an IL-21 BP of the present invention followed by an infusion of an IL-21 BP of the present invention conjugated to a radioisotope. The regimen may be repeated, e.g., 7 to 9 days later.
As non-limiting examples, treatment according to the present invention may be provided as a daily dosage of a compound of the present invention in an amount of about 0.1 -100 mg/kg, such as 0.5, 0.9, 1.0, 1.1 , 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 45, 50, 60, 70, 80, 90 or 100 mg/kg, per day, on at least one of day 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40, or alternatively, at least one of week 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 after initiation of treatment, or any combination thereof, using single or divided doses of every 24, 12, 8, 6, 4, or 2 hours, or any combination thereof.
The IL-21 binding peptides of the present invention for therapeutic use may also be administered in combination therapy, i.e., combined with other therapeutic agents relevant for the disease or condition to be treated. Such administration may be simultaneous, separate or sequential. For simultaneous administration the agents may be administered as one compositons or as separate compositions, as appropriate. The present invention thus also provides methods for treating a disease or disorder treatable by use of an IL-21 antagonist as described above, which methods comprise administration of an IL-21 BP of the present invention combined with one or more additional therapeutic agents as described below. In one embodiment, the present invention provides a method for treating adisease or disorder treatable by use of an IL-21 antagonist in a subject, which method comprises administation of a therapeutically effective amount of an IL-21 BP of the present invention and at least one anti-inflammatory agent to a subject in need thereof.
In one embodiment such an anti-inflammatory agent may be selected from a steroidal drug and a NSAID (nonsteroidal anti-inflammatory drug).
In one embodiment such an anti-inflammatory agent may be selected from aspirin and other salicylates, Cox-2 inhibitors (such as rofecoxib and celecoxib), NSAIDs (such as ibuprofen, fenoprofen, naproxen, sulindac, diclofenac, piroxicam, ketoprofen, diflunisal, nabumetone, etodolac, oxaprozin, and indomethacin), anti-IL6R antibodies, anti-IL8 antibodies, anti-IL15 antibodies, anti-IL15R antibodies, anti-CD4 antibodies, anti-CD1 1a antibodies (e.g., efalizumab), anti-alpha-4/beta-1 integrin (VLA4) antibodies (e.g natalizumab), CTLA4-lg for the treatment of inflammatory diseases, prednisolone, prednisone, disease modifying antirheumatic drugs (DMARDs) such as methotrexate, hydroxychloroquine, sulfasalazine, pyrimidine synthesis inhibitors (such as leflunomide), IL-1 receptor blocking agents (such as anakinra), TNF-α blocking agents (such as etanercept, infliximab, and adalimumab) and similar agents.
In one embodiment, the present invention provides a method for treating a disease or disorder treatable by use of an IL-21 antagonist in a subject, which method comprises administation of a therapeutically effective amount of an IL-21 BP of the present invention and at least one immunosuppressive and/or immunomodulatory agent to a subject in need thereof.
In one embodiment, such an immunosuppressive and/or immunomodulatory agent may be selected from cyclosporine, azathioprine, mycophenolic acid, mycophenolate mofetil (such as Cellcept®), corticosteroids such as prednisone, methotrexate, gold salts, sulfasalazine, antimalarials, brequinar, leflunomide, mizoribine, 15-deoxyspergualine, 6-mercaptopurine, cyclophosphamide, rapamycin, tacrolimus (FK-506), OKT3, anti- thymocyte globulin, thymopentin, thymosin-α and similar agents.
In one embodiment, such an immunosuppressive and/or immunomodulatory agent may be selected from immunosuppressive antibodies, such as antibodies binding to p75 of the IL-2 receptor, or antibodies binding to for instance MHC, CD2, CD3, CD4, CD7, CD28, B7, CD40, CD45, IFNγ, TNF-α, IL-4, IL-5, IL-6R, IL-7, IL-8, IL-10, CD1 1a, or CD58, or antibodies binding to their ligands.
In one embodiment, such an immunosuppressive and/or immunomodulatory agent may be selected from soluble IL-15R, IL-10, B7 molecules (B7-1 , B7-2, variants thereof, and fragments thereof), ICOS, and OX40, an inhibitor of a negative T cell regulator (such as an antibody against CTLA4) and similar agents.
In one embodiment, the IL-21 BPs of the present invention may be administered in combination with two or more immunosuppressive and/or immunomodulatory agents, such as in combination with prednisone and cyclosporine; prednisone, cyclosporine and azathioprine; or prednisone, cyclosporine and mycophenolate mofetil.
In one embodiment, the present invention provides an IL-21 BP that is conjugated to an immunomodulator, such as an immunomodulating cytokine, stem cell growth factor, lymphotoxin (such as a TNF such as TNFα), or a hematopoietic factor. Examples of such molecules that may be useful as conjugates include IL-2, IL-3, IL-10, , colony stimulating factors (such as granulocyte-colony stimulating factor (G-CSF) and granulocyte macrophage- colony stimulating factor (GM-CSF)), interferons (such as IFNβ, and I FNY) the stem cell growth factor designated "S1 factor," erythropoietin, and thrombopoietin, active fragments thereof, derivatives thereof, variants thereof, or a combination of any thereof.
The present invention further provides method of promoting the sale and/or use of an IL-21 BP of the present invention, comprising distributing information (such as by printed materials that are handed out, mailed, etc., by advertising signage, by television programs and advertisements, by radio programs and advertisements, by internet site postings, by email, by telemarketing, by door-to-door or person-to-person marketing, by funding and/or hosting conferences, panels, forums, etc., by employing and/or contracting for the services of salespeople and/or medical/scientific liaisons, by funding and/or hosting scientific research and publications related to such uses, etc.) related to the use of the compound in the prevention or treatment of any condition or combination of conditions as described elsewhere herein to any persons or entities of potential interest (such as pharmaceutical chains, formulary managers, insurance companies, HMOs, hospitals and hospital chains, other health care companies, pharmacy benefit managers, potential patients, cancer patients, former cancer patients, patients in remission, primary care physicians, nurses, doctors of pharmacy, and/or key opinion leaders).
The present invention also provides kits comprising a pharmaceutical composition of a compound of the present invention and instructions for use. The kit may further contain one or more additional agents, such as an immunosuppressive reagent, a chemotherapeutic reagent, an anti-inflammatory agent or a radiotoxic agent as described above, or one or more additional IL-21 BPs of the present invention (such as an IL-21 BP having a complementary activity). A kit of the present invention may also include diagnostic agents and/or other therapeutic agents. In one embodiment, a kit of the present invention includes an IL-21 BP of the present invention and a diagnostic agent that may be used in a diagnostic method for diagnosing the state or existence of a disorder involving IL-21 in a subject. In one embodiment, the kit includes an IL-21 BP of the present invention in a highly stable form (such as in a lyophilized form) in combination with pharmaceutically acceptable carrier(s) that may be mixed with the highly stabile composition to form an injectable composition. The following is a non-limiting list of embodiments of the present invention.
Embodiment 1 : An IL-21 binding peptide, which is capable of antagonizing the action of IL-21 on the human IL-21 receptor.
Embodiment 2: An IL-21 binding peptide according to embodiment 1 , wherein said IL-21 binding peptide is capable of decreasing the activity of IL-21 on the human IL-21 receptor by at least 25%. Embodiment 3: An IL-21 binding peptide according to embodiment 1 or embodiment 2, wherein said IL-21 binding peptide is capable of decreasing the activity of IL-21 on the human IL-21 receptor by at least 50%.
Embodiment 4: An IL-21 binding peptide according to any of embodiments 1 to 3, wherein said IL-21 binding peptide is capable of decreasing the activity of IL-21 on the human IL-21 receptor by at least 75%.
Embodiment 5: An IL-21 binding peptide according to any of embodiments 1 to 4, wherein said IL-21 binding peptide is capable of decreasing the activity of IL-21 on the human IL-21 receptor by at least 90%. Embodiment 6: An IL-21 binding peptide according to any of embodiments 1 to 5, wherein the antagonism of said IL-21 binding peptide is determined by use of an assay as described in Example 3.
Embodiment 7: An IL-21 binding peptide, which competes with an anti-IL-21 antibody having an amino acid sequence for VL as presented in SEQ ID No. 1 and an amino acid sequence for VH as presented in SEQ ID No. 2 for binding to IL-21.
Embodiment 8: An IL-21 binding peptide according to any of embodiments 1 to 6, which competes with an anti-IL-21 antibody having an amino acid sequence for VL as presented in SEQ ID No. 1 and an amino acid sequence for VH as presented in SEQ ID No. 2 for binding to IL-21. Embodiment 9: An IL-21 binding peptide according to embodiment 7 or embodiment
8, wherein the competition is determined as described in Example 2.
Embodiment 10: An IL-21 binding peptide, which IL-21 binding peptide specifically binds to i) a IL-21 epitope that also is specifically bound by an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2 and/or ii) an IL-21 epitope that also is specifically bound by an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10.
Embodiment 11 : An IL-21 binding peptide according to any of embodiments 1 to 9, which IL-21 binding peptide specifically binds to i) a IL-21 epitope that also is specifically bound by an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2 and/or ii) an IL-21 epitope that also is specifically bound by an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10.
Embodiment 12: An IL-21 binding peptide according to any of embodiments 1 to 11 , which peptide comprises the amino acid sequence of SEQ ID No. 8. Embodiment 13: An IL-21 binding peptide according to any of embodiments 1 to 12, which peptide comprises the amino acid sequence of SEQ ID No. 5.
Embodiment 14: An IL-21 binding peptide according to embodiment 12 or embodiment 13, which additionally comprises the amino acid sequence of SEQ ID No. 7. Embodiment 15: An IL-21 binding peptide according to any of embodiments 12 to
14, which additionally comprises the amino acid sequence of SEQ ID No. 6.
Embodiment 16: An IL-21 binding peptide according to any of embodiments 12 to
15, which comprises the amino acid sequence of SEQ ID No. 2.
Embodiment 17: An IL-21 binding peptide according to any of embodiments 12 to 16, which additionally comprises the amino acid sequence of SEQ ID No. 4.
Embodiment 18: An IL-21 binding peptide according to any of embodiments 12 to
17, which additionally comprises the amino acid sequence of SEQ ID No. 3.
Embodiment 19: An IL-21 binding peptide according to any of embodiments 12 to
18, which comprises the amino acid sequence of SEQ ID No. 1. Embodiment 20: An IL-21 binding peptide according to any of embodiments 1 to 11 , which peptide comprises the amino acid sequence of SEQ ID No. 16.
Embodiment 21 : An IL-21 binding peptide according to any of embodiments 1 to 11 or embodiment 20, which peptide comprises the amino acid sequence of SEQ ID No. 13.
Embodiment 22: An IL-21 binding peptide according to embodiment 20 or embodiment 21 , which additionally comprises the amino acid sequence of SEQ ID No. 15. Embodiment 23: An IL-21 binding peptide according to any of embodiments 20 to
22, which additionally comprises the amino acid sequence of SEQ ID No. 14.
Embodiment 24: An IL-21 binding peptide according to any of embodiments 20 to
23, which comprises the amino acid sequence of SEQ ID No. 10. Embodiment 25: An IL-21 binding peptide according to any of embodiments 20 to
24, which additionally comprises the amino acid sequence of SEQ ID No. 12.
Embodiment 26: An IL-21 binding peptide according to any of embodiments 20 to
25, which additionally comprises the amino acid sequence of SEQ ID No. 11.
Embodiment 27: An IL-21 binding peptide according to any of embodiments 20 to 26, which comprises the amino acid sequence of SEQ ID No. 9.
Embodiment 28: An IL-21 binding peptide according to any of embodiments 12 to 27, which IL-21 binding peptide is an anti-IL-21 antibody.
Embodiment 29: An IL-21 binding peptide according to any of embodiments 1 to 11 , which peptide is an anti-IL-21 antibody. Embodiment 30: An anti-IL-21 antibody according to embodiment 29 comprising a VH CDR3 sequence comprising the amino acid sequence of SEQ ID No. 8.
Embodiment 31 : An anti-IL-21 antibody according to embodiment 29 or embodiment 30 comprising a VL CDR3 sequence comprising the amino acid sequence of SEQ ID No. 5. Embodiment 32: An anti-IL-21 antibody according to embodiment 30 or embodiment
31 , which additionally comprises a VH CDR2 sequence comprising the amino acid sequence of SEQ ID No. 7.
Embodiment 33: An anti-IL-21 antibody according to any of embodiments 30 to 32, which additionally comprises a VH CDR1 sequence comprising the amino acid sequence of SEQ ID No. 6.
Embodiment 34: An anti-IL-21 antibody according to any of embodiments 30 to 33 comprising a VH comprising the amino acid sequence of SEQ ID No. 2.
Embodiment 35: An anti-IL-21 antibody according to any of embodiments 30 to 34, which additionally comprises a VL CDR2 sequence comprising the amino acid sequence of SEQ ID No. 4.
Embodiment 36: An anti-IL-21 antibody according to any of embodiments 30 to 35, which additionally comprises a VL CDR1 sequence comprising the amino acid sequence of SEQ ID No. 3.
Embodiment 37: An anti-IL-21 antibody according to any of embodiments 30 to 36 comprising a VH comprising the amino acid sequence of SEQ ID No. 1.
Embodiment 38: An anti-IL-21 antibody according to embodiment 29 comprising a VH CDR3 sequence comprising the amino acid sequence of SEQ ID No. 16.
Embodiment 39: An anti-IL-21 antibody according to embodiment 29 or embodiment 38 comprising a VL CDR3 sequence comprising the amino acid sequence of SEQ ID No. 13. Embodiment 40: An anti-IL-21 antibody according to embodiment 38 or embodiment
39, which additionally comprises a VH CDR2 sequence comprising the amino acid sequence of SEQ ID No. 15.
Embodiment 41 : An anti-IL-21 antibody according to any of embodiments 38 to 40, which additionally comprises a VH CDR1 sequence comprising the amino acid sequence of SEQ ID No. 14.
Embodiment 42: An anti-IL-21 antibody according to any of embodiments 38 to 41 comprising a VH comprising the amino acid sequence of SEQ ID No. 10.
Embodiment 43: An anti-IL-21 antibody according to any of embodiments 38 to 42, which additionally comprises a VL CDR2 sequence comprising the amino acid sequence of SEQ ID No. 12. Embodiment 44: An anti-IL-21 antibody according to any of embodiments 38 to 43, which additionally comprises a VL CDR1 sequence comprising the amino acid sequence of SEQ ID No. 11.
Embodiment 45: An anti-IL-21 antibody according to any of embodiments 38 to 44 comprising a VH comprising the amino acid sequence of SEQ ID No. 9.
Embodiment 46: An anti-IL-21 antibody according to any of embodiments 28 to 45, which is a monoclonal antibody.
Embodiment 47: An anti-IL-21 antibody according to any of embodiments 28 to 45, which is a human antibody. Embodiment 48: An anti-IL-21 antibody according to embodiment 47, which is a monoclonal antibody.
Embodiment 49: An anti-IL-21 antibody according to any of embodiments any of embodiments 28 to 45, which is a humanized antibody.
Embodiment 50: An anti-IL-21 antibody according to embodiment 49, which is a monoclonal antibody.
Embodiment 51 : An anti-IL-21 antibody according to any of embodiments any of embodiments 28 to 45, which is a chimeric antibody.
Embodiment 52: An anti-IL-21 antibody according to embodiment 51 , which is a monoclonal antibody. Embodiment 53: An anti-IL-21 antibody according to any of embodiments any of embodiments 28 to 52, wherein the antibody is an IgGI antibody.
Embodiment 54: An anti-IL-21 antibody according to embodiment 53, wherein the antibody is a IgGI , K antibody.
Embodiment 55: An anti-IL-21 antibody according to any of embodiments 28 to 52, wherein the antibody is an IgM antibody.
Embodiment 56: An anti-IL-21 antibody according to embodiment 55, wherein the antibody is a IgM1K antibody.
Embodiment 57: An anti-IL-21 antibody according to any of embodiments 28 to 56, which antibody is in substantially isolated form. Embodiment 58: An anti-IL-21 antibody according to any of embodiments 28 to 57, which is an antibody fragment or a single chain antibody.
Embodiment 59: An IL-21 binding peptide according to any of embodiments 1 to 27, which IL-21 binding peptide is a fusion protein between an anti-IL-21 antibody according to any of embodiments 28 to 58 and at least one nonhomologous peptide comprising an amino acid sequence, that imparts a detectable biological function and/or characteristic to the fusion protein that cannot solely be attributed to the anti-IL-21 antibody sequence.
Embodiment 60: A nucleic acid encoding an IL-21 binding peptide according to any of embodiments 1 to 59. Embodiment 61 : A hybridoma which produces a human monoclonal anti-IL-21 antibody encoded by human heavy chain and human light chain nucleic acids comprising a nucleotide sequence in their variable heavy chain region as set forth in SEQ ID No. 18, or conservative sequence modifications thereof, and comprising a nucleotide sequence in their variable light chain region as set forth in SEQ ID No. 17, or conservative sequence modifications thereof.
Embodiment 62: A hybridoma which produces a human monoclonal anti-IL-21 antibody having human heavy chain and light chain variable regions which comprise a human heavy chain variable amino acid sequence as set forth in SEQ ID No. 2, or conservative sequence modifications thereof, and the human light chain variable amino sequence as set forth in SEQ ID No. 1 , or conservative sequence modifications thereof.
Embodiment 63: A transfectoma which produces a human monoclonal anti-IL-21 antibody encoded by human heavy chain variable nucleic acids as set forth in SEQ ID No. 18, and human light chain nucleic acids as set forth SEQ ID No. 17, or conservative sequence modifications thereof. Embodiment 64: A transfectoma which produces a human monoclonal anti-IL-21 antibody having human heavy chain and light chain variable regions which comprise the human heavy chain variable amino acid sequence as set forth in SEQ ID No. 2, or conservative sequence modifications thereof, and the human light chain variable amino sequence as set forth in SEQ ID No. 1 , or conservative sequence modifications thereof. Embodiment 65: A hybridoma which produces a human monoclonal anti-IL-21 antibody encoded by human heavy chain and human light chain nucleic acids comprising a nucleotide sequence in their variable heavy chain region as set forth in SEQ ID No. 20, or conservative sequence modifications thereof, and comprising a nucleotide sequence in their variable light chain region as set forth in SEQ ID No. 19, or conservative sequence modifications thereof.
Embodiment 66: A hybridoma which produces a human monoclonal anti-IL-21 antibody having human heavy chain and light chain variable regions which comprise a human heavy chain variable amino acid sequence as set forth in SEQ ID No. 10, or conservative sequence modifications thereof, and the human light chain variable amino sequence as set forth in SEQ ID No. 9, or conservative sequence modifications thereof. Embodiment 67: A transfectoma which produces a human monoclonal anti-IL-21 antibody encoded by human heavy chain variable nucleic acids as set forth in SEQ ID No. 20, and human light chain nucleic acids as set forth SEQ ID No. 19, or conservative sequence modifications thereof. Embodiment 68: A transfectoma which produces a human monoclonal anti-IL-21 antibody having human heavy chain and light chain variable regions which comprise the human heavy chain variable amino acid sequence as set forth in SEQ ID No. 10, or conservative sequence modifications thereof, and the human light chain variable amino sequence as set forth in SEQ ID No. 9, or conservative sequence modifications thereof. Embodiment 69: An isolated or recombinant eukaryotic or prokaryotic host cell which produces an IL-21 binding protein according to any of embodiments 1 to 59.
Embodiment 70: An IL-21 binding peptide according to any of embodiments 1 to 59, further comprising a chelator linker for attaching a radioisotope.
Embodiment 71 : An immunoconjugate comprising anti-IL-21 antibody according to any of embodiments 28 to 58 linked to a cytotoxic agent, a radioisotope, or a drug.
Embodiment 72: An immunoconjugate comprising an anti-IL-21 antibody according to embodiment 55 or embodiment 56, wherein the anti-IL-21 antibody is a monomeric IgM antibody linked to a cytotoxic agent, a radioisotope, or a drug.
Embodiment 73: A bispecific molecule comprising an IL-21 binding peptide according to any of embodiments 1 to 59 and a peptide capable of binding to IL-2, IL-4, IL, IL-9, or lL-15.
Embodiment 74: An expression vector comprising a nucleic acid according to embodiment 60.
Embodiment 75: An expression vector comprising the nucleotide sequence of SEQ ID No. 18, or conservative modifications thereof, and/or the nucleotide sequence of SEQ ID No. 17, or conservative modifications thereof.
Embodiment 76: An expression vector comprising the nucleotide sequence of SEQ ID No. 20, or conservative modifications thereof, and/or the nucleotide sequence of SEQ ID No. 19, or conservative modifications thereof. Embodiment 77: A eukaryotic or prokaryotic host cell comprising an expression vector according to any of embodiments 74 to 76.
Embodiment 78: A pharmaceutical composition comprising an IL-21 binding peptide according to any of embodiments 1 to 59 and a pharmaceutically acceptable carrier.
Embodiment 79: A pharmaceutical composition according to embodiment 78 comprising one or more further therapeutic agents. Embodiment 80: A pharmaceutical composition comprising an expression vector according to any of embodiments 74 to 76 and a pharmaceutically acceptable carrier.
Embodiment 81 : An IL-21 binding peptide according to any one of embodiments 1 to 59 for use in therapy. Embodiment 82: An immunoconjugate according to embodiment 71 or embodiment
72 for use in therapy.
Embodiment 83: A bispecific molecule according to embodiment 73 for use in therapy.
Embodiment 84: An expression vector according to any of embodiments 74 to 76 for use in therapy.
Embodiment 85: Use of an IL-21 binding peptide according to any one of embodiments 1 to 59 or a pharmaceutical composition according to any of embodiments 78 to 80, for use in treating a disease or disorder, wherein said disease or disorder may be treatable by use of an IL-21 antagonist. Embodiment 86: Use of an IL-21 binding peptide according to any one of embodiments 1 to 59 for preparation of a pharmaceutical composition for treating a disease or disorder, wherein said disease or disorder may be treatable by use of an IL-21 antagonist.
Embodiment 87: Use of an immunoconjugate according to embodiment 71 or embodiment 72, a bispecific molecule according to embodiment 73, or an expression vector according to any of embodiments 74 to 76 for preparation of a pharmaceutical composition for treating a disease or disorder, wherein said disease or disorder may be treatable by use of an IL-21 antagonist.
Embodiment 88: Use according to any of embodiments 85 to 87, wherein said disease or disorder is an autoimmune and/or inflammatory disease. Embodiment 89: Use according to embodiment 88, wherein said disease or disorder is systemic lupus erythematosus, rheumatoid arthritis or inflammatory bowel disease.
Embodiment 90: A method of treating a disease or disorder, wherein said disease or disorder may be treatable by use of an IL-21 antagonist., comprising administering to a subject an IL-21 binding peptide according to any of embodiments 1 to 59, a pharmaceutical composition according to any of embodiments 78 to 80, an immunoconjugate according to embodiment 71 or embodiment 72, a bispecific molecule according to embodiment 73, or an expression vector according to any of embodiments 74 to 76 in an amount effective to treat or prevent the disease.
Embodiment 91 : A method according to embodiment 90, wherein the disease or disorder is an autoimmune and/or inflammatory disease. Embodiment 92: A method according to embodiment 90, wherein the disease or disorder is systemic lupus erythematosus, rheumatoid arthritis or inflammatory bowel disease.
Embodiment 93: An in vitro method for detecting the presence of IL-21 antigen in a sample, which method comprises a) contacting the sample with an IL-21 binding peptide according to any of embodiments 1 to 59 under conditions that allow for formation of a complex between the IL-21 binding peptide and IL-21 ; and b) detecting the formation of a complex. Embodiment 94: A kit for detecting the presence of IL-21 antigen in a sample comprising an IL-21 binding peptide according to any of embodiments 1 to 59.
Embodiment 95: An in vivo method for detecting IL-21 antigen in an subject comprising a) administering an IL-21 binding peptide according to any of embodiments 1 to 59 under conditions that allow for formation of a complex between the IL-21 binding peptide and IL-21 ; and b) detecting the formed complex.
Embodiment 96: An anti-idiotypic antibody binding to an antibody according to any of embodiments 28 to 58. Embodiment 97: Use of an anti-idiotypic antibody according to embodiment 96 for detecting the level of human monoclonal antibody against IL-21 in a sample.
All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
All headings and sub-headings are used herein for convenience only and should not be construed as limiting the present invention in any way.
Any combination of the above-described elements in all possible variations thereof is encompassed by the present invention unless otherwise indicated herein or otherwise clearly contradicted by context.
The use of the terms "a" and "an" and "the" and similar referents in the context of describing the present invention are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.
Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. Unless otherwise stated, all exact values provided herein are representative of corresponding approximate values (e.g., all exact exemplary values provided with respect to a particular factor or measurement may be considered to also provide a corresponding approximate measurement, modified by "about," where appropriate).
All methods described herein may be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context.
The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the present invention and does not pose a limitation on the scope of the present invention unless otherwise indicated. No language in the specification should be construed as indicating any element is essential to the practice of the present invention unless as much is explicitly stated.
The citation and incorporation of patent documents herein is done for convenience only and does not reflect any view of the validity, patentability, and/or enforceability of such patent documents.
The description herein of any embodiment of the present invention using terms such as "comprising", "having," "including," or "containing" with reference to an element or elements is intended to provide support for a similar embodiment of the present invention that "consists of", "consists essentially of", or "substantially comprises" that particular element or elements, unless otherwise stated or clearly contradicted by context (e.g., a composition described herein as comprising a particular element should be understood as also describing a composition consisting of that element, unless otherwise stated or clearly contradicted by context). The present invention includes all modifications and equivalents of the subject matter recited in the embodiments presented herein to the maximum extent permitted by applicable law.
All patents, pending patent applications and other publications cited herein are hereby incorporated by reference in their entirety. The present invention is further illustrated by the following examples which should not be construed as further limiting. EXAMPLES
Example 1
Generation of anti-IL-21 antibodies 1 F1 and 1 F22
Immunization and fusion RBF-mice were immunized three times with 20 μg soluble hlL-21 (aa 30-162 of SEQ
ID No. 21 ) in Freunds adjuvant. Ten days after the last immunisation, eye-bleeds from immunized mice were screened by ELISA for I L-21 -specific antibodies. Mice with positive titers were boosted with 10 μg of human I L-21 by intravenous injection, and sacrificed after three days. The spleen was removed aseptically and dispersed to a single cell suspension. Fusion of spleen cells and mouse myeloma cells FOX-NY was done by PEG method. Cells were seeded in microtiter plates and cultured at 370C, 5% CO2. The tissue-culture medium containing HAT/HT for selection was changed three times over a two week's period. Primary screening of hybridomas Nunc immunoplates were coated with 1 μg/ml of human I L-21 in PBS and incubated overnight at 4°C. Plates were blocked with blocking buffer (PBS with 0.05% Tween20) for 15 min and were washed with PBS/0.05% Tween20. Culture supernatants from the hybridoma cells were added and the plates were incubated for 1 hour at room temperature. After washing, gt-anti-mouse-lgG HRP-labelled antibody was added in a dilution as described by the manufacturer. Plates were incubated 1 h, washed and developed with TMB-substate (Kem-EN-Tec). Absorbance at 450 nm was measured on an ELISA-reader. Selected clones were continued and protein was purified. The specificity of the antibodies was then confirmed by a direct ELISA. In Figure 1 , the concentration dependent binding to plate coated hi L-21 is shown.
Sub-cloning of hybridomas In order to generate monoclonal and stable hybridomas, cells were subcloned using limited dilution method. Cells were seeded into a 96 well plates by a density of 1 cell/well. After two weeks, supernatants from each well were screened in a direct ELISA, as described above. Cells from positive wells were transferred to a larger culture volume, expanded and subcloned again until a stable and two monoclonal cell lines was obtained. Antibody cloning and sequencing:
Total RNA was extracted from three hybridomas (hlL-21-1 F22 A6B6C3, hlL-21-1 F1 A2B2C1 , hlL-21-1 F1 A2B2C6) using RNeasy (#634914) from Qiagen. cDNA was synthesized from 1 μg total RNA using SMART-RACE cDNA amplification kit from Clonetech. The reaction was run at 42°C for 114 h and the samples were diluted in 75 μl tricine-EDTA. PCR amplification of the target was carried out in 50 μl reactions using 5 μl of cDNA as template. The forward primer for both heavy and light chain was universal primer mix (UPM) that was included in the SMART RACE kit. The reverse primer sequence for heavy chain (HC) was designed as follows: 5'- GTCTACCACAACACACGTGAC and for light chain (LC) δ'-GCTCTAGACTAACACTCATTCCTGTTGAAGCTC.
The PCR reactions were carried out using Phusion mastermix from Finnzymes and the PCR program was run with a single denaturing step at 98°C/30 sec followed by 29 cycles as given: 98°C/10 sec; 55°C/20 sec; 72°C/30 sec. The final extension step was 72°C/5 min. The PCR products were identified on a 1 % agarose gel containing ethidiumbromide. The PCR products were purified from the gel using GFX Purification kit from GE Healthcare followed by cloning into Zero Blunt TOPO PCR Cloning Kit (#K2875-40) and transformed into TOP10 E. coli cells from Invitrogen. Plasmids were sequenced at MWG Biotech, Matinsried, Germany using the sequencing primers M13 rev (-29) and M13 uni (-21 ). HC and LC were verified from the identified sequences by using VectorNTI. All procedures based on kits were performed according to manufactures directions.
From the hybridoma F1 A2B2C1 and F1 A2B2C6 cells a single kappa LC and a single lgG2a HC were cloned and from the F22 A6B6C3 cells a single kappa LC and a single IgGI HC were cloned. The cloned sequence of the kappa LC and the lgG2a HC of the hybridomas F1 A2B2C1 and F1 A2B2C6 can be seen as SEQ ID No. 17 and 18 respectively. The cloned sequence of the kappa LC and the IgGI HC of the hybridoma F22 A6B6C3 can be seen as SEQ ID No. 19 and 20 respectively. The antibody expressed by hybridoma F1 A2B2C1 (and F1 A2B2C6) is called 1 F1 and the antibody expressed by hybridoma F22 A6B6C3 is called 1 F22.
Example 2
Analysis of 1 F1 and 1 F22 using a competition experiment using Surface Plasmon Resonance (SPR). All SPR experiments described were performed on a Biacore T100 (GE Healthcare).
1 F1 and 1 F22 were immobilized by standard amine coupling to a CM5 sensor chip (GE Healthcare). The antibodies were immobilized in individual flow-cells to a level of 500 RU. In order to test for simultaneous binding of the two antibodies to hlL-21 , the hlL-21 was injected in all flow-cells followed by injection of either 1 F1 or 1 F22. The experiment demonstrated that the antibodies are not able to bind simultaneously to hlL-21.
The kinetic parameters for the interaction between hlL-21 and the immobilized antibodies 1 F1 and 1 F22, were determined by injecting a concentration series of hlL-21 across the antibody surfaces. Each cone, of hlL-21 was injected for 4 min, followed by a 10 min. dissociation period with constant buffer flow. Both antibodies demonstrated affinities in the subnanomolar range - both with an apparent KD value of -0.5 nM.
Example 3
Neutralizing activity of anti-21 antibodies IL21R transfected BAF-3 cells:
BAF-3 cells are murine hematopoetic pre-B cells dependent of exogeneous addition of IL-3 for growth and survival in vitro. The cells also express the common yC receptor which is one of the monomers constituting the heterodimeric IL-21 receptor. BAF-3 cells transfected with the genes encoding the human private chain of the IL-21 receptor, IL-21 Rβ, was received from Zymogenetics Institute, Seattle (transfection as described by Genetics lnstitue in WO9947675 and as it is known in the art). Human IL-21 Rβ transfected BAF-3 cells BAF-3(hlL21 R) express the IL-21 heterodimeric receptor and proliferate in the absence of IL-3, when human IL-21 is added to the culture. . This fact can be used to assess proliferation of these cells upon stimulation with different concentrations of IL-21 and can also be used to test whether antibodies against IL-21 or other potential IL-21 antagonists are capable of inhibiting hlL-21 induced stimulation of IL-21 R-expressing cells, such as the IL-21 Rβ transfected BAF-3 cells. Other alternatives for cells expressing the IL-21 receptor is for instance a human IL-2 dependent cell line NK92 from ATCC (CRL-2407), which can be used as target cells in the same proliferation assay (stimulation as well as inhibition). These cells express the IL-21 R complex endogenously.
Defining the optimal concentration of hlL-21 inducing maximal response in BAF- 3(h IL-21 R) cell and calculating IC50.
BAF-3(hlL-21 R) cells are kept in culture in RPMI 1640 with Glutamax, 10% heat inactivated FBS, 1% P/S, 1 mg/ml Geneticin, 200 μg/ml Zeocin and 1 nM IL-3 and should never exceed 106 c/ml. Fresh media is added to the culture three times a week and cells split accordingly.
For the assay, BAF-3(hlL21 R) cells were washed thoroughly in Assay medium (RPMI 1640 with Glutamax, 10% heat inactivated FBS, 1% P/S, 1 mg/ml Geneticin, 200 μg/ml Zeocin) to get rid of residual IL-3. The cells were then seeded into 96-well microtiter plates (flat-bottom view plate) at 104 - 5x104c/w. Serial dilutions of hlL-21 (10 8M to 10 14M) were added to the wells and additional wells with cells but no hlL-21 served as negative control. Total volume of the wells was 100 μl. The cells were cultured for three days in 5% CO2 at 37°C. For the last 6 hours of the culture period, 10 μl AlamarBlue was added to each well. The cells were analyzed for fluorescence intensity on a spectrofluorometer at excitation 555-12 nm and emission 590 nm. In Figure 2, an example of a typical stimulation of BAF-3 (hlL21 R) induced by hlL-21 is shown.
Inhibition assay to define neutralizing activity of the antibodies. For the inhibition analysis, a constant concentration of hlL-21 was used to stimulate the BAF-3(hlL-21 R) cells. This concentration was chosen on basis of approximately 90% of max stimulation in the proliferation assay which for the purpose of this specification means 10 9M hlL-21.
Inhibition assay to define neutralizing activity of the antibodies. 104 - 5x104c/w of washed BAF-3(hlL-21 R) cells were seeded into 96-well microtiter wells in assay medium. 10'9M (final concentration) of hlL-21 was added to each well (except some wells used as negative control containing only cells). Serial dilutions of antibody (i.e.100 μg and 2-fold dilutions) were added to the wells already containing cells and cytokine (except wells used for positive controls which should contain only cells + hlL-21). The mixture of cells, cytokine and antibody were incubated in 100 μl/w for 72 hours in 5% CO2 at 37°C. The last 6 hours of incubation included 10 μl/w of AlamarBlue. The plates were analysed for fluorescence intensity on a spectrofluorometer at excitation 555-12nm and emission 590nm. Figure 3 shows an example of test for neutralizing activity of anti-hlL-21 antibodies.

Claims

1. An IL-21 binding peptide, which is capable of antagonizing the action of IL-21 on the human IL-21 receptor.
2. An IL-21 binding peptide according to claim 1 , wherein the antagonism of said IL-21 binding peptide is determined by use of an assay as described in Example 3.
3. An IL-21 binding peptide, which competes with an anti-IL-21 antibody, wherein said antibody has an amino acid sequence for VL as presented in SEQ ID No. 1 and an amino acid sequence for VH as presented in SEQ ID No. 2 for binding to IL-21.
4. An IL-21 binding peptide according to claim 1 or claim 2, which competes with an anti-IL- 21 antibody, wherein said antibody has an amino acid sequence for VL as presented in SEQ ID No. 1 and an amino acid sequence for VH as presented in SEQ ID No. 2 for binding to IL- 21.
5. An IL-21 binding peptide according to claim 3 or claim 4, wherein the competition is determined as described in Example 2.
6. An IL-21 binding peptide, which IL-21 binding peptide specifically binds to i) a IL-21 epitope that also is specifically bound by an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2 and/or ii) an IL-21 epitope that also is specifically bound by an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10.
7. An IL-21 binding peptide according to any of claims 1 to 5, which IL-21 binding peptide specifically binds to i) a IL-21 epitope that also is specifically bound by an antibody having a VL sequence of SEQ ID No. 1 and a VH sequence of SEQ ID No. 2 and/or ii) an IL-21 epitope that also is specifically bound by an antibody having a VL sequence of SEQ ID No. 9 and a VH sequence of SEQ ID No. 10.
8. An IL-21 binding peptide according to any of claims 1 to 7, which peptide comprises the amino acid sequence of SEQ ID No. 8.
9. An IL-21 binding peptide according to any of claims 1 to 8, which peptide comprises the amino acid sequence of SEQ ID No. 5.
10. An IL-21 binding peptide according to claim 8 or claim 9, which comprises the amino acid sequence of SEQ ID No. 2.
11. An IL-21 binding peptide according to any of claims 8 to 10, which comprises the amino acid sequence of SEQ ID No. 1.
12. An IL-21 binding peptide according to any of claims 1 to 7, which peptide comprises the amino acid sequence of SEQ ID No. 16.
13. An IL-21 binding peptide according to any of claims 1 to 7 or claim 12, which peptide comprises the amino acid sequence of SEQ ID No. 13.
14. An IL-21 binding peptide according to claim 12 or claim 13, which comprises the amino acid sequence of SEQ ID No. 10.
15. An IL-21 binding peptide according to any of claims 12 to 14, which comprises the amino acid sequence of SEQ ID No. 9.
16. An IL-21 binding peptide according to any of claims 8 to 15, which IL-21 binding peptide is an anti-IL-21 antibody.
17. An IL-21 binding peptide according to any of claims 1 to 7, which peptide is an anti-IL-21 antibody.
18. A nucleic acid encoding an IL-21 binding peptide according to any of claims 1 to 17.
19. An isolated or recombinant eukaryotic or prokaryotic host cell which produces an IL-21 binding protein according to any of claims 1 to 17.
20. An expression vector comprising a nucleic acid according to claim 18.
21. A pharmaceutical composition comprising an IL-21 binding peptide according to any of claims 1 to 17 and a pharmaceutically acceptable carrier.
22. An IL-21 binding peptide according to any one of claims 1 to 17 for use in therapy.
23. Use of an IL-21 binding peptide according to any one of claims 1 to 17 or a pharmaceutical composition according to claims 21 , for use in treating a disease or disorder, wherein said disease or disorder may be treatable by use of an IL-21 antagonist.
24. Use of an IL-21 binding peptide according to any one of claims 1 to 17 for preparation of a pharmaceutical composition for treating a disease or disorder, wherein said disease or disorder may be treatable by use of an IL-21 antagonist.
25. A method of treating a disease or disorder, wherein said disease or disorder may be treatable by use of an IL-21 antagonist., comprising administering to a subject an IL-21 binding peptide according to any of claims 1 to 17, a pharmaceutical composition according to claim 21 in an amount effective to treat or prevent the disease.
26. An in vitro method for detecting the presence of IL-21 antigen in a sample, which method comprises a) contacting the sample with an IL-21 binding peptide according to any of claims 1 to 17 under conditions that allow for formation of a complex between the IL-21 binding peptide and IL-21 ; and b) detecting the formation of a complex.
27. A kit for detecting the presence of IL-21 antigen in a sample comprising an IL-21 binding peptide according to any of claims 1 to 17.
28. An in vivo method for detecting IL-21 antigen in an subject comprising a) administering an IL-21 binding peptide according to any of claims 1 to 17 under conditions that allow for formation of a complex between the IL-21 binding peptide and IL-21 ; and b) detecting the formed complex.
29. An anti-idiotypic antibody binding to an antibody according to claim 17.
PCT/EP2008/063723 2007-10-11 2008-10-13 Il-21 antibodies WO2009047360A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP07118285 2007-10-11
EP07118285.1 2007-10-11

Publications (2)

Publication Number Publication Date
WO2009047360A1 WO2009047360A1 (en) 2009-04-16
WO2009047360A9 true WO2009047360A9 (en) 2010-05-06

Family

ID=40229825

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2008/063723 WO2009047360A1 (en) 2007-10-11 2008-10-13 Il-21 antibodies

Country Status (1)

Country Link
WO (1) WO2009047360A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10588969B2 (en) 2014-04-08 2020-03-17 Boston Pharmaceuticals, Inc. Antibodies specific for IL-21 and uses thereof

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011032119A1 (en) 2009-09-14 2011-03-17 The Regents Of The University Of Colorado Modulation of yeast-based immunotherapy products and responses
CN101701039B (en) * 2009-11-06 2011-10-26 中国人民解放军第四军医大学 Variable regions of light chains and heavy chains of FMU-EPCAM-2A9 monoclonal antibodies
CN101817882B (en) * 2010-01-22 2011-10-26 中国人民解放军第四军医大学 Light-chain variable region and heavy-chain variable region of FMU-EPCAM-4E4 monoclonal antibody
CN101899112B (en) * 2010-03-09 2011-10-26 中国人民解放军第四军医大学 Light chain and heavy chain variable region of FMU-EPCAM-2D7 monoclonal antibody
EP2665750A1 (en) * 2011-01-17 2013-11-27 Novo Nordisk A/S Il-21 ligands
CN103702721A (en) * 2011-05-31 2014-04-02 诺沃—诺迪斯克有限公司 IL-21 epitope and IL-21 ligands
US9657059B2 (en) * 2013-09-09 2017-05-23 Canimguide Therapeutics Ab Immune system modulators
CN107249633A (en) * 2014-12-19 2017-10-13 迈博太科公司 For composition, kit and the method for the people's cell activation for suppressing the mediations of IL 21
ES2853582T3 (en) 2015-03-06 2021-09-16 Canimguide Therapeutics Ab Immune system modulators and compositions

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ITRM20040586A1 (en) * 2004-11-29 2005-02-28 Giuliani Spa ANTIGENIC EPITOPES OF INTERLEUCHINA-21, RELATIVE ANTIBODIES AND THEIR USE IN MEDICAL FIELD.
WO2006105538A2 (en) * 2005-03-31 2006-10-05 Centocor, Inc. Methods and compositions for treating il-21 related pathologies
GT200600148A (en) * 2005-04-14 2006-11-22 METHODS FOR THE TREATMENT AND PREVENTION OF FIBROSIS
WO2007111714A2 (en) * 2005-11-28 2007-10-04 Zymogenetics, Inc. Il-21 antagonists

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10588969B2 (en) 2014-04-08 2020-03-17 Boston Pharmaceuticals, Inc. Antibodies specific for IL-21 and uses thereof
US11529415B2 (en) 2014-04-08 2022-12-20 Boston Pharmaceuticals Inc. Antibodies specific for IL-21 and uses thereof

Also Published As

Publication number Publication date
WO2009047360A1 (en) 2009-04-16

Similar Documents

Publication Publication Date Title
US20200283542A1 (en) Antibodies against cd38 for treatment of multiple myeloma
US20090076249A1 (en) Antibodies against CD38 for treatment of multiple myeloma
WO2009047360A9 (en) Il-21 antibodies
KR20140033240A (en) Antibodies against cd38 for treatment of multiple myeloma

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08837493

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct app. not ent. europ. phase

Ref document number: 08837493

Country of ref document: EP

Kind code of ref document: A1