WO2009043959A1 - Method for identifying patients with sporadic burkitt's lymphoma, identification method and use of compounds for the treatment of sporadic burkitt's lymphoma - Google Patents

Method for identifying patients with sporadic burkitt's lymphoma, identification method and use of compounds for the treatment of sporadic burkitt's lymphoma Download PDF

Info

Publication number
WO2009043959A1
WO2009043959A1 PCT/ES2008/070182 ES2008070182W WO2009043959A1 WO 2009043959 A1 WO2009043959 A1 WO 2009043959A1 ES 2008070182 W ES2008070182 W ES 2008070182W WO 2009043959 A1 WO2009043959 A1 WO 2009043959A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
lbe
expression
identification
gene
Prior art date
Application number
PCT/ES2008/070182
Other languages
Spanish (es)
French (fr)
Inventor
Miguel Ramón CAMPANERO GARCIA
Irene Molina Privado
Original Assignee
Consejo Superior De Investigaciones Cientificas
Universidad Autonoma De Madrid
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Consejo Superior De Investigaciones Cientificas, Universidad Autonoma De Madrid filed Critical Consejo Superior De Investigaciones Cientificas
Publication of WO2009043959A1 publication Critical patent/WO2009043959A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)

Definitions

  • PROCEDURE FOR IDENTIFICATION OF PATIENTS WITH SPURDIC BURKITT LYMPHOMA PROCEDURE FOR THE IDENTIFICATION AND USE OF COMPOUNDS FOR THE TREATMENT OF SPURDIC BURKITT LYMPHOMA
  • the present invention describes an efficient diagnostic procedure for patients with sporadic Burkett lymphoma based on the identification of the E2F1 protein in biological samples of said patients, which can be carried out by RT-PCR or western blot.
  • E2F1 has an etiopathogenic role in this disease, so E2F1-specific RNAi can be used to treat them.
  • the present invention is part of the biotechnology and pharmaceutical and reference sector for the development of new methods of diagnosis and treatment of a specific disease, sporadic Burkitt lymphoma (LBE).
  • LBE sporadic Burkitt lymphoma
  • Burkitt lymphoma endemic (occurs preferably in equatorial Africa), sporadic and associated with immunodeficiencies (Wright DH. What is Burkitt 's lymphoma and when is it endemic Blood 1999; 93 (2): 758).
  • the diagnosis of sporadic Burkitt lymphoma is based on morphological, immunohistochemical and in situ hybridization criteria. However, these criteria are not allowing an accurate diagnosis that would be desirable. In fact, there are some cases of misdiagnosis in which a Burkitt lymphoma has been diagnosed as diffuse large B-cell lymphoma and vice versa.
  • the characteristic genetic marker of BL is a reciprocal translocation between the c-myc gene of chromosome 8 and one of the three loci of the immunoglobulin genes (Dalla-Favera R, Bregni M, Erikson J, Patterson D, Gallo RC, Croce CM. Human c-myc onc gene is located on the region of chromosome 8 that is translocated in Burkitt lymphoma cells. Proc Nati Acad Sci USA 1982; 79 (24): 7824-7; Hecht JL, ⁇ ster JC. Molecular biology of Burkitt 's lymphoma.
  • c-myc expression in Epstein- Barr-virus- immortalized B-cells induces altered growth properties and surface phenotype but not tumorigenicity Int J Cancer 1990; 45 (3): 566-71).
  • this type of translocation also occurs in other types of lymphomas that are often confused with sporadic Burkitt lymphoma, as is the case with diffuse large B-cell lymphomas.
  • the determination of the relative expression level of c-myc would not result, so The relative relationship of c-myc would therefore not be of interest as a diagnostic criterion.
  • E2F1 expression has been qualitatively analyzed by immunohistochemistry in 124 cases of various types of non-Hodgkin lymphoma (Lai R, Medeiros LJ, Coupland R, McCourty A, Brynes RK. Immuno-histochemical detection of E2F-1 in non-Hodgkin 's lym- phomas: a survey of 124 cases Mod Pathol. 1998 May; 11 (5): 457-63) describing a relatively high expression in mantle cell lymphoma, lymphoblastic lymphoma, non-small cell lymphoma fragmented and gamma-delta T-cell hepatosplenic lymphoma.
  • E2F1 Overexpression of E2F1 has also been described using various techniques in other types of tumors.
  • the existence of an elevated expression of E2F1 in non-small cell carcinoma of the lung has been described (Kotsinas A, Evangelou K, Zacharatos P, Kittas C, Gorgoulis VG. Proliferation, but not apoptosis, is associated with distinct beta- catenin expression patters in nonsmall-cell lung carcinomas: Relationship with adenomatous polyposis coli and Gl-to S-phase cell-cycle regulators. Am J Pathol 2002; 161: 1619-34) and in some cases of pancreatic ductal carcinoma (Yamazaki K, Yaj ima T, Nagao T, et al.
  • Oncogene 2001; 20: 1678-87 by immunoblot and immunohistochemistry; in glioblastoma samples (Alonso MM, Fueyo J, Shay JW, Aldape KD, Jiang H, Lee OH, Johnson DG, Xu J, Kondo Y, Kanzawa T, Kyo S, Bekele BN, Zhou X, Nigro J, McDonald JM, Yung WK, Gómez-Manzano C. Expression of transcription factor E2F1 and telomerase in glioblastomas: Mechanistic linkage and prognostic significance.
  • Burkitt lymphoma a very aggressive non-Hodgkin B-cell lymphoma, is rapidly lethal if not treated in time, but is curable with intensive chemotherapy treatment (Blum KA, Lozanski G, Byrd JC Adult Burkitt leukemia and lymphoma Blood 2004; 104 (10): 3009-20). Because most of the times the side effects of this treatment are not very well tolerated (Divine M, Casassus P, Kosigny S, et al. Burkitt lymphoma in adults: a prospective study of 72 patients treated with an adapted pediatric LMB protocol Ann Oncol 2005; 16 (12): 1928-35) Patients would benefit from alternative therapies directed against specific molecular targets that could reduce the systemic toxicity of conventional treatment.
  • An object of the present invention is a method of identifying a sporadic Burkitt lymphoma, hereinafter a method of identifying LBE of the invention, based on the identification of the levels of the presence of E2F1 in a biological sample comprising the following stages: a) identification of expression levels of
  • E2F1 adjusting them with the levels of a control marker, preferably ACTINA beta where appropriate, in a biological sample, and b) comparison of the levels of E2F1 observed in a) with a biological control sample, and c) identification of a sample as LBE when the levels of E2F1 exceed those obtained in the control sample above a certain threshold.
  • a control marker preferably ACTINA beta where appropriate
  • a particular object of the invention is the identification procedure of a LBE in which the identification of E2F1 is carried out by quantitative RT-PCR of an E2F1 gene precursor and in which the levels of E2F1 are adjusted to those of ACTINA beta.
  • This procedure is based on the extraction of RNA, either RNA polyA + or total RNA or RNA polyA +, from a suspected biological sample of LBE and from a control tissue and amplification of the E2F1 sequence is carried out with suitable oligonucleotides or primers specific for both the coding or non-coding region of said messenger RNA (for example, against the 5 'or 3' untranslated regions of the RNA).
  • Another particular object of the invention is the identification procedure of an LBE in which the identification of E2F1 of a) refers to the protein form of the E2F1 gene (SEQ ID NO 2) and the identification of ACTINA beta refers to its protein form (SEQ ID NO 4) and is carried out by the use of antibodies specific for the E2F1 protein in techniques, for example, immunoblot or Western blot and immunohistochemistry.
  • Another object of the present invention is a method for identifying and evaluating the activity of inhibitor compounds of the E2F1 protein useful for the treatment of the LBE, hereinafter method of identifying compounds of the present invention, comprising the following steps: ) Contacting a biological system where there is an expression of E2F1 that produces partial or totally an LBE phenotype with the candidate compound object of this procedure, and incubation under the appropriate conditions, b) determination of a parameter indicative of decreased levels of E2F1 or regression of an LBE phenotype, ec) identification of an inhibitor compound of the activity of the E2F1 protein when a regression of said LBE phenotype or a decrease in E2F1 levels is observed.
  • Another object of the present invention is the use of a compound or agent that inhibits the activity of the E2F1 protein, hereinafter used of a compound of the present invention, in the preparation of medicaments or pharmaceutical compositions for the treatment of human patients with LBE
  • Another object of the present invention is a pharmaceutical composition or a medicament for the treatment of LBE, hereinafter pharmaceutical composition of the present invention, which comprises a therapeutically effective amount of an E2F1 protein inhibitor compound or agent, together with , optionally, one or more pharmaceutically acceptable adjuvants and / or vehicles.
  • Another object of the present invention is the use of the pharmaceutical composition of the invention in a method of treating a mammal, preferably a human being, affected by LBE, hereinafter use of the pharmaceutical composition of the present invention, consisting in the administration of said therapeutic composition that inhibits the pathological process of the LBE.
  • the present invention is based on the fact that the inventors have identified the etiopathogenic role of the E2F1 gene and its protein transcript in patients with sporadic Burkitt lymphoma (LBE) and, surprisingly, the utility for a diagnosis of LBE in determining expression levels of E2F1 compensating them with the levels of the beta actin gene and its transcript, unlike what was observed when other control genes were used, such as the ribosomal RNA of the 18S subunit of the ribosomes or the messenger RNA corresponding to the genes GAPDH and GUSB (data not shown).
  • LBE sporadic Burkitt lymphoma
  • the levels of E2F1 expression were completely anarchic for the purpose of distinguishing cases of LBE, without being able to define a specific pattern with any type of pathology.
  • the E2F1 expression signal has been compensated with the ACTINA beta signal for each sample analyzed, in particular using the equivalent value of plasmids expressing both markers, and it has been observed that it is possible to determine a minimum value that perfectly separates all samples of patients with LBE from controls; and more specifically and as an experimental example, that an expression level of E2F1 greater than the equivalent of 2.5 ng of plasmid is decisive for the identification of a sporadic Burkitt lymphoma, compared to that observed in control tissue samples (tonsils) or reactive lymph nodes or healthy tissue surrounding the tumor), and that even allows the identification of false positives identified by other methods (see example 1).
  • the data described in the present invention indicate that E2F1 expression is deregulated in BL cell lines and in LBE tumors, that its elevated expression is necessary for tumor formation in mice, the growth of Soft agar colonies and cell proliferation and suggest that this elevated expression might be necessary for the progression of these cells through G2 / M. More particularly, the results clearly indicated that the expression of E2F1 is much higher in these cell lines and tumor samples than in the LCL lines and control tissues or in other types of lymphoma, respectively.
  • E2F1 in LB cell lines and in the LBE tumor samples of the present invention does not appear to be due to a greater presence of cells capable of proliferating in these cases than in other cell lines or in other tumors because i) the LB and LCL cell lines analyzed showed practically identical proliferation levels and ii) E2F1 expression in LBE samples was much higher than in DLBCL samples with a similar proliferation level.
  • E2F1 could cooperate with the elevated expression of c-myc in the formation of LBE. Since E2F1 - / - mice develop normally, it seems clear that E2F1 expression is not necessary for normal cell proliferation. In particular, the expression of E2F1 is not necessary for the proliferation of T lymphocytes in response to homeostatic signals or in vivo stimulation (DeRyckere D, DeGregori J. E2F1 and E2F2 are diffe- rentially required for homeostasis-driven and antigen-induced T cell proliferation in vivo.
  • E2F1 can be considered a marker of the LBE and, therefore, its identification as a diagnosis of LBE can be used; and on the other hand, E2F1 can be considered as a therapeutic target of great utility in the identification of new drugs for the treatment of LBE, and even its gene inhibition as a form of therapy.
  • These therapeutic approaches are based on the use of compounds or agents that inhibit the activity of E2F1.
  • an object of the present invention is a method of identifying a sporadic Burkitt lymphoma, hereinafter a method of identifying LBE of the invention, based on the identification of the levels of the presence of E2F1 in a biological sample comprising the following steps: a) identification of the expression levels of E2F1, adjusting them with the levels of a marker with ⁇ trol, preferably ACTINA beta when appropriate, in a biological sample, and b) comparison of the levels of E2F1 observed in a ) with a biological control sample, ec) identification of a sample as LBE when the levels of E2F1 exceed those obtained in the control sample above a certain threshold.
  • E2F1 and ACTINA beta refers to both the E2F1 gene or protein (SEQ ID NO 1 and NO 2, respectively) (access codes are NM_005225 and NP_005216, respectively) as to the ACTINA beta gene or protein (SEQ ID NO 3 and NO 4, respectively) (access codes are NM_001101 and NP_001092, respectively), respectively, as well as any nucleotide or amino acid sequence (aás.) analogous to them.
  • analogous is intended to include any nucleotide or amino acid sequence that can be isolated or constructed based on nucleotide sequences or more.
  • nucleotide substitutions or aás. conservative or non-conservative, including the insertion of one or more nucleotides or aás, the addition of one or more nucleotides or aás. at either end of the molecule or the deletion of one or more nucleotides or more. at any end or within the sequence, and that constitutes a coding sequence or peptide with activity similar to the sequences of the invention, that is, is capable of inducing LBE.
  • an analogous nucleotide or amino acid sequence is substantially homologous to the amino acid sequence discussed above.
  • the term "substantially homologous” means that the nucleotide sequences or aás. in question they have a degree of identity of at least 40%, preferably of at least 85%, or more preferably of at least 95%.
  • control group or biological samples can be obtained from samples of healthy people, or even artificially developed biological sample control such as a plasmid containing the E2F1 cDNA.
  • a particular object of the invention is the identification procedure of an LBE in which the identification of E2F1 is carried out by quantitative RT-PCR of an E2F1 gene precursor and in which the levels of E2F1 are adjusted to those of ACTINA beta.
  • This procedure is based on the extraction of RNA, either RNA polyA + or total RNA or RNA polyA +, from a suspected biological sample of LBE and from a control tissue and amplification of the E2F1 sequence is carried out with suitable oligonucleotides or primers specific for both the coding or non-coding region of said messenger RNA (for example, against the 5 'or 3' untranslated regions of the RNA).
  • a particular embodiment of the invention is the process of the invention based on a quantitative RT-PCR where the distinctive threshold of LBE is an expression level of E2F1 higher than the equivalent of 2.5 ng plasmid, used as a control.
  • a particular embodiment of the invention is the process of the invention based on a quantitative RT-PCR with specific primers of E2F1 and ACTINA beta corresponding, by way of illustration and without limiting the scope of the invention, respectively, with the following E2F1 5 '(SEQ ID NO8), E2F1 3' (SEQ ID NO9), ACTINA beta 5 '(SEQ ID NOlO) and ACTINA beta 3' (SEQ ID NOIl), supplied by the Applied Biosystem commercial house and amplifying the region "AGCTCATTGCCAAGAAGTCCAAGAACCACATCCAGTGGCTGGGCAGCCACACCAC AGTGGGCGTCGGCGGACGGCTTGAGGGGT" Y
  • Another particular embodiment of the invention is the process of the invention based on a semi-quantitative PCR with specific primers of E2F1 and Actin beta as indicated above.
  • the semi-quantitative PCR reaction can be carried out using several serial dilutions of the complementary DNA (obtained as described in example 1) prepared from the samples to be analyzed or using a single dilution of this DNA but carrying out the PCR reaction during different number of cycles (for example: 24, 26, 28, 30, 32 and 34 cycles).
  • Another particular embodiment of the invention is the process of the invention based on the Northern blot technique with specific polynucleotide probes of the cDNAs of the E2F1 and ACTINA beta genes (SEQ ID NO1 and 3, see Example 2).
  • Another particular object of the invention is the identification procedure of an LBE in which the identification of E2F1 is carried out by in situ hybridization with an E2F1 precursor.
  • Another particular object of the invention is the identification procedure of an LBE in which the identification of E2F1 of a) refers to the protein form of the E2F1 gene (SEQ ID NO 2) and the identification of ACTINA beta refers to to its protein form (SEQ ID NO 4) and is carried out by the use of antibodies specific for the E2F1 protein in techniques, for example, immunoblot or Western blot and immunohistochemistry.
  • the antibodies can be monoclonal or polyclonal, fragments or derivatives thereof.
  • FIG. 6 The results of an immunoblot against E2F1 and beta actin are shown in Figure 6 where the expression levels of the E2F1 and beta actin proteins in LBE samples are perfectly distinguished (high and low levels of E2F1 and beta actin, respectively) when compared with control samples.
  • a total protein extract should be prepared from biopsies of the tumor tissue studied and the control tissues (healthy tissue surrounding the tumor or tonsils or reactive lymph nodes of other individuals). These samples are fractionated on an acrylamide gel with SDS, transferred to a nitrocellulose or PVDF membrane and hybridized with anti-E2Fl and anti-actin antibodies. These antibodies may or may not be conjugated to fluorochromes.
  • each of the antibodies In the case of being coupled to these fluorochromes, each of the antibodies must be coupled to a different fluorochrome so that they emit energy in non-overlapping wavelengths.
  • anti-E2Fl and anti-actin antibodies generated in different animal species for example, rabbit-generated anti-E2Fl and mouse-generated anti-actin.
  • the membrane Once the membrane is incubated with both antibodies, it will be incubated with anti- antibodies mouse immunoglobulin and rabbit anti-immunoglobulin conjugated to different fluorochromes that emit energy in non-overlapping wavelengths.
  • the energy emission of each antibody is measured with an image documentation system (such as the Lycor company Odyssey) and this signal is directly proportional to the amount of protein present in the sample.
  • the relationship between the E2F1 signal and the beta actin signal for each sample is then calculated and this relationship between the tumor samples and those of the control tissues is compared.
  • the E2F1 / Actin beta ratio in tumor tissues must be at least 2 times higher than that detected in control tissues.
  • the biggest problem with this method and a clear disadvantage with respect to the methods described above based on the PCR technique is to obtain sufficient amount of protein extract to carry out the assay.
  • the immunohistochemical analysis will be performed on tissue sections (either frozen or paraffin-containing) from tumor samples or control tissues (tonsils or reactive lymph nodes or healthy tissue surrounding the tumor).
  • Staining will be carried out with anti-E2Fl and anti-actin antibodies generated in different animal species (as in the case of the immunoblot). These antibodies can be coupled to fluorochromes that emit energy at non-overlapping wavelengths or not be conjugated and then employ secondary antibodies coupled to this type of fluorochromes.
  • the signal emitted by the antibodies is directly proportional to the amount of protein expressed in the cells and will be measured with detection equipment.
  • the relationship between the E2F1 signal and the beta actin signal for each sample is then calculated and this relationship between the tumor samples and those of the control tissues is compared.
  • the E2F1 / Actin ratio in tissues Tumors must be at least 2 times higher than that detected in control tissues.
  • this diagnostic procedure for an LBE can be performed using E2F1 as a single marker or in conjunction with other markers of LBE or other diseases, for example as part of a biological expression microarray, either in gene form - from mRNA- or protein form.
  • Another object of the present invention is a method for identifying and evaluating the activity of E2F1 protein inhibitor compounds useful for the treatment of LBE, hereinafter method of identifying compounds of the present invention, comprising the following steps : a) Contacting a biological system where there is an expression of E2F1 that partially or totally produces an LBE phenotype with the candidate compound object of this procedure, and incubation under the appropriate conditions, b) determination of an indicative parameter of decrease in E2F1 or regression levels of an LBE phenotype, ec) identification of a compound that inhibits the activity of the E2F1 protein when a regression of said LBE phenotype or a decrease in E2F1 levels is observed.
  • Another object of the present invention is an identification method of the invention where the biological system of a) consists of a cell line or a transgenic animal where the expression of the E2F1 protein is regulated, in a constant or conditioned manner, and where its expression causes an LBE phenotype or an increase in the E2F1 protein.
  • Another object of the present invention is an identification procedure of the invention.
  • the indicative regression parameter of an LBE phenotype of b) belongs, by way of illustration and without limiting the scope of the invention, to the following group: formation of colonies in soft agar or tumor formation in vivo; and in the case of decreased expression of E2F1 levels, it is carried out by the techniques indicated above: PCR, Northern blot, immunoblot, immunohistochemistry, etc.
  • Another object of the present invention is the use of a compound or agent that inhibits the activity of the E2F1 protein, hereinafter use of a compound of the present invention, in the preparation of medicaments or pharmaceutical compositions for the treatment of patients. humans with LBE.
  • the term "compound / inhibitor or antagonist agent” refers to a molecule that when bound or interacts with the E2F1 protein (eg, SEQ ID NO2), or with functional fragments thereof, decreases or eliminates the intensity or duration of the biological activity of said protein.
  • This definition also includes those compounds that prevent or decrease the expression of the E2F1 protein coding gene (SEQ ID NO1), that is, that prevent or diminish gene transcription, mRNA maturation, mRNA translation and post-translational modification.
  • An inhibitory agent may consist of a peptide, a protein, a nucleic acid or polynucleotide, a carbohydrate, an antibody, a chemical compound or any other type of molecule that diminishes or eliminates the effect and / or function of the E2F1 protein.
  • E2F1 inhibitors that could be used under the scope of the present invention
  • peptides that inhibit the interaction of any member of the E2F family have been described (there are 8 members) with DNA (with the sequences of promoters that normally regulate; Bandara LR, Girling R, La Thangue NB.
  • E2F1 antisense oligos have also been used for the treatment of an experimental murine model of inducible Parkinson's disease (Hoglinger GU, Breunig JJ, Depboylu C, Rouaux C, Michel PP, Alvarez-Fischer D, Boutillier AL, Degregori J, Oertel WH, Rakic P, Hirsch EC, Hunot S; The pRb / E2F cell-cycle pathway mediates cell death in Parkinson's disease; Proc Nati Acad Sci US A. 2007 Feb 27; 104 (9): 3585-90).
  • said polynucleotide can be a polynucleotide encoding a specific antisense nucleotide sequence of the gene or mRNA sequence of the E2F1 protein, or a polynucleotide encoding a ribozyme, an aptamer, an interfering RNA ("small RNA interference "or siRNA or” short hairpin RNA “or shRNA) or a specific microRNA of the mRNA of the E2F1 protein, or combinations thereof.
  • polynucleotides mentioned can be used in a gene therapy process in which by any technique or procedure the integration of them into the cells of a human patient is allowed.
  • This objective can be achieved by administering to these lymphoid cells a gene construct comprising one of the aforementioned polynucleotides in order to transform said cells allowing their expression inside them so that the expression of the E2F1 protein is inhibited.
  • said gene construct may be included within a vector, such as, for example, an expression vector or a transfer vector.
  • vector refers to systems used in the process of transferring an exogenous gene or an exogenous gene construct into a cell, thereby permitting the vehicle and gene constructs.
  • exogenous vectors can be non-viral vectors or viral vectors (Pfeifer A, Verma IM (2001) Gene therapy: promises and problems. Annu Rev Genomics Hum Genet 2: 177-211) and their administration can be prepared by an expert in subject according to the needs and specificities of each case.
  • said use of a compound of the invention is based on the fact that the inhibitor compound is a nucleic acid or polynucleotide that prevents or decreases the expression of the gene encoding the human E2F1 protein and that includes, at less, a nucleotide sequence selected from: a) an antisense nucleotide sequence is- pecifies from the sequence of the gene or mRNA of the E2F1 protein, b) a ribozyme specific to the mRNA of the E2F1 protein, c) a specific aptamer of the mRNA of the E2F1 protein, d) an interfering RNA (iRNA) specific to the mRNA of the E2F1 protein, and e) a specific microRNA of the E2F1 protein mRNA.
  • a nucleic acid or polynucleotide that prevents or decreases the expression of the gene encoding the human E2F1 protein and that includes, at less, a nucleotide
  • anti-E2F1 antisense oligonucleotides have been described (Hoglinger GU, Breunig JJ, Depboylu C, Rouaux C, Michel PP, Alvarez-Fischer D, Boutillier AL, Degregori J, Oertel WH, Rakic P, Hirsch EC, Hunot S; The pRb / E2F cell-cycle pathway mediates cell death in Parkinson's disease; Proc Nati Acad Sci US A. 2007 Feb 27; 104 (9): 3585-90.
  • Trinh E Boutillier AL, Loeffler JP .; Regulation of the retinoblastoma- dependent Mdm2 and E2F-1 signaling pathways during neuronal apoptosis; Mol Cell Neurosci .; 2001 Feb; 17 (2): 342-53. Prost S, Lu P, Caldwell H, Harrison D. E2F regulates DDB2: consequences for DNA repair in Rb-deficient cells, Oncogene, 2007 May 24; 26 (24): 3572-81), siRNAs that inhibit their expression (Rogoff HA, Picke-ring MT, Frame FM, Debat ⁇ s ME, Sánchez Y, Jones S, Kowalik TF.
  • Apoptosis associated with deregulated E2F activity is dependent on E2F1 and Atm / Nbsl / Chk2. Mol Cell Biol. 2004 Apr; 24 (7): 2968-77. Prost S, Lu P, Caldwell H, Harrison D. E2F regulates DDB2: consequences for DNA repair in Rb-deficient cells. Oncogene 2007 May 24; 26 (24): 3572-81) or microRNA (O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT. C-Myc-regulated microRNAs modulate E2F1 expression. Nature 2005; 435 (7043): 839-43 ).
  • these techniques of gene inhibition, and more specifically the vehiculization of the compounds - antisense oligonucleotides, iRNA, ribozymes or aptamers - can be carried out by using nanoparticles that increase the success of said transfer (Lu PV and Woodle MC, Adv Genet 54: 117-42, 2005; Hawker CJ and Wooley KL, Science 19 (309): 1200-5, 2005).
  • RNAi that preferentially binds to the E2F1 mRNA, or several RNAi, and which belongs, by way of illustration and without limiting the scope of the invention, to the following group: SEQ ID NO5, SEQ ID NO6 and SEQ ID NO7 (see Example 3).
  • SEQ ID NO5 AGGATGGATATGAGATGGGA (E2F1-1)
  • SEQ ID NO6 CTGAGGAGTTCATCAGCCTT (E2F1-2)
  • SEQ ID NO7 GTGGACTCTTCGGAGAACTT (E2F1-3)
  • RNAi bind to different regions of the E2F1 RNA).
  • the first of these sequences corresponds to the 3 'untranslated region of the E2F1 mRNA (E2F1-1), while the remaining two correspond to different areas of the coding region (E2F1-2 and 3).
  • nucleotide sequences a) to -e) mentioned above prevent the expression of the gene in mRNA or mRNA in the E2F1 protein, and therefore cancel its biological function, and can be developed by an expert in the genetic engineering sector depending on the existing knowledge on the state of the art on transgenesis and cancellation of gene expression (Clarke, AR (2002) transgenesis Techniques Principles and Protocols, 2nd Ed Humana Press, Cambridge University;.... Patent US20020128220 Gleave, Martin TRPM -2 antisense therapy; Puerta-Fernández E et al. (2003) Ribozymes: recent advances in the development of RNA tools. FEMS Microbiology Reviews 27: 75-97; Kikuchi, et al., 2003.
  • RNA aptamers targeted to domain II of Hepatitis C virus IRES that bind to its apical loop region J. Biochem. 133, 263-270; Reynolds A. et al., 2004. Rational siRNA design for RNA interference. Nature Biotechnology 22 (3): 326-330).
  • composition pharma ⁇ céutica of the present invention comprising a therapeutically effective amount of a compound or agent that inhibits protein E2F1, together with, optionally, one or more adjuvants and / or vehicles pharma ⁇ cally acceptable.
  • a particular embodiment of the present invention is a pharmaceutical composition in which the inhibitor compound is a nucleic acid or polynucleotide that prevents or decreases the expression of the gene encoding the human E2F1 protein and that includes at least one sequence of nucleotides selected between: a) an antisense nucleotide sequence is ⁇ pecifica of the gene sequence or mRNA of the pro- teina E2F1, b) a ribozyme specific mRNA ⁇ teina E2F1, c) a specific aptamer of the mRNA the protei ⁇ na E2F1, d) an interference RNA (iRNA) specific to the mRNA of E2F1 protein, and e) a microRNA specific to the mRNA of the protei ⁇ na E2F1.
  • the inhibitor compound is a nucleic acid or polynucleotide that prevents or decreases the expression of the gene encoding the human E2F1 protein and that
  • a particular embodiment of the invention is the pharmaceutical composition of the invention in which the E2F1 inhibitor is an RNAi that preferentially binds to the E2F1 mRNA sequence and belongs, by way of illustration and without limiting the scope of the invention, to the following group: SEQ ID NO5, SEQ ID NO6 and SEQ ID NO7 (see Example 3).
  • compositions are the adjuvants and vehicles known to those skilled in the art and commonly used in the elaboration of therapeutic compositions.
  • the term "therapeutically effective amount” refers to the amount of the agent or compound that inhibits the activity of the E2F1 protein, calculated to produce the desired effect and, in general, will be determined, among other causes. , due to the characteristics of the compounds, including the age, condition of the patient, the severity of the alteration or disorder, and the route and frequency of administration.
  • said therapeutic composition is prepared in the form of a solid form or aqueous suspension, in a pharmaceutically acceptable diluent.
  • the therapeutic composition provided by this invention may be administered by any appropriate route of administration, for which said composition will be formulated in the pharmaceutical form appropriate to the route of administration chosen.
  • the administration of the therapeutic composition provided by this invention is carried out parenterally, orally, intraperitoneally, subcutaneously, etc.
  • Another object of the present invention is the use of the pharmaceutical composition of the invention in a method of treating a mammal, preferably Recently, a human being, affected by LBE, hereinafter used the pharmaceutical composition of the present invention, consisting of the administration of said therapeutic composition that inhibits the pathological process of the LBE.
  • Figure 2. The expression of E2F1 is greater in BL cell lines than in LCL.
  • panel ⁇ tra Mues the Northern blot analysis of the expression of messenger RNA E2F1, E2F2, E2F3, and ACTIN in cell lines BL and LCL indicated.
  • Panel B shows the analysis of E2F1 expression by quantitative PCR in the indicated BL and LCL cell lines, represented as the average of three independent experiments ⁇ SD. The expression relative to that found in the LCL IB4 cell line is shown.
  • FIG. 1 A representative analysis of the expression of E2F1 protein and tubulin by immunoblot in the indicated BL and LCL cell lines is shown in panel C.
  • the E2F1 signal was normalized with respect to that of tubulin in each sample, and the value of the Dana LCL cell line was used as a reference.
  • the numbers under the tubulin panel indicate the expression of E2F1 in each cell line relative to that of Dana for this experiment.
  • Panel D shows the mean ⁇ SD of the E2F1 expression relative to that found in the Dana line in four independent experiments.
  • the growth curves are shown in panel E
  • Panel F shows a representative experiment of BrdU incorporation into DG75 and JY cells labeled with propidium iodide.
  • Panel G shows cell cycle profiles representative of DG75 cells and
  • FIG. 3 The expression of E2F1 is uncontrolled in LBE.
  • Panel A shows the ratio of the relative expression levels of E2F1 in tonsils (Tl and T2) and lymph nodes (LN1 to LN3), used as control tissues in relation to the LN3 sample.
  • Panels B and C show the ratio of the relative expression levels of E2F1 in different sporadic LB samples (LBEl to LBE30) (panel B) and other B-cell lymphomas (panel C) relative to the T2 sample.
  • LBEl to LBE30 sporadic LB samples
  • panel C B-cell lymphomas
  • FIG. 4 E2F1 is necessary for the formation of BL tumors.
  • A The soft agar growth capacity of DG75 and JY cells was determined. In the upper and lower rows, photographs of the wells and microphotographs of the well colonies are shown, respectively.
  • B The arrows indicate the presence of the tumor formed by DG75 cells and the absence of tumor formation by JY cells in a representative SCID mouse.
  • C Immunoblotting was performed with cellular extracts of DG75 cells transduced with lentiviruses bearing the shRNAs indicated with antibodies against the indicated proteins.
  • the first panel shows a representative mouse that developed tumors by DG75 cells infected with the empty lentivirus (None) or the carrier of the shRNA control.
  • the excised tumor mass formed by the carrier cells of the shRNA control is shown
  • a staining with hematoxylin and eosin of this tumor is shown
  • a staining with hematoxylin and eosin of this tumor is shown
  • a staining with E2F1 and Ki67 are shown, respectively, of this tumor.
  • H The number of large (> 100 mg) and small ( ⁇ 100 mg) tumors formed by DG75 cells transduced with the lentiviruses encoding the indicated shRNAs is shown.
  • Figure 5. Panel A shows the growth curves of DG75 cells transduced with lentiviruses carrying the indicated shRNAs.
  • panel B BrdU incorporation of these same cells is shown, relative to that of cells infected with the empty lentivirus (None), as the mean ⁇ OE of three independent experiments.
  • Representative cell cycle profiles of these same cells and non-transduced cells are shown in panel C. The percentage of each of these cells in G0 / G1, S, and G2 / M is indicated in panel D as the mean. ⁇ SD of three independent experiments.
  • Figure 6. The ratio of protein E2Fl / Actin- beta is much higher in LBS than in control tissues.
  • a representative analysis of the expression of protein E2F1, tubulin and beta actin is shown by immunoblot in three samples of LBS (BLl to BL3), a sample of reactive tonsil (Tl) and two samples of reactive lymph node (LNl, LN2 ).
  • the E2F1 signal was normalized with respect to that of beta actin in each sample, and the value of the LN1 sample was used as a reference.
  • the numbers under the Actin panel indicate the expression of E2F1 in each sample relative to that of LNl for this experiment.
  • Figure 7. High expression of EF21 is necessary to maintain the tumor-forming capacity of BL2 cells.
  • Figure 8. Growth curve of DG75 cells transduced with lentiviruses bearing the indicated shRNAs. 1Oe 5 DG75 cells infected with the indicated lentiviruses were cultured in 96-well plates in triplicate. Cell growth was measured by cell count 24, 48, 72 and 96 hours after seeding. Staining with trypan blue confirmed that more than 95% of the cells were viable.
  • Figure 9. Measurement of the proliferation capacity of different cell lines transduced with lentiviruses carrying the indicated shRNAs.
  • 50,000 cells of the DG75, Imr-90 and MCF-7 cell lines were cultured in triplicate 96-well plates in the presence of tritiated thymidite 10 ⁇ Ci for 20 hours. Thymidite incorporation was measured in a minimum of three experiments. The incorporation of thymidine relative to cells infected with the non-shRNA-bearing lentivirus (none) calculated for the average of a minimum of three experiments is represented.
  • FIG. 10 Relative expression of the levels of the E2F1 protein in the cell lines of Burkitt lymphoma (LB), immortalized B lymphocytes (LCL) and diffuse lymphoma of large B cells indicated.
  • the expression level of E2F1 was determined by quantitative immunoblot using actin-beta as reference. The data shows relative to the level of expression in the JY cell line.
  • Example 1 The analysis of the expression of the E2F1 gene and actin by quantitative PCR allows the identification of cells and patients with Burkitt lymphoma
  • the relative expression of the E2F1 gene has been analyzed by quantitative PCR in several biopsies of tonsils (Tl and T2) and reactive lymph nodes (LNl and LN2) - all of them as reference controls -, sporadic Burkitt lymphoma (LBE1-LBE6), and other types of lymphomas (follicular lymphomas, LFl and LF2; mantle cell lymphoma, LCMl and LCM2; and, marginal spleen lymphoma, SMZLl and SMZL2, see Table 3).
  • RNA messenger or total RNA was obtained from all these patient or tissue samples as well as from a cell culture of the DG75 cell line and the complementary DNA (cDNA) was generated from this mRNA. Subsequently, it has led to Perform quantitative PCR using serial dilutions of the cDNA sample (1: 4, 1: 8, 1:16 and 1:32) of DG75 cells, serial dilutions of plasmids carrying the cDNA of human ACTINA beta and E2F1 ( 0.1 ng, 1 ng, 10 ng and 100 ng) and cDNA samples from the various tissues indicated above undiluted. All quantitative PCR reactions were carried out in triplicate using primers or oligo and probes labeled with 6-FAM specific for E2F1 or for human beta ACTINA obtained from Applied Biosystems (SEQ ID NO8-11).
  • the Applied quantitative PCR Kit for ACTINA beta is the "beta Actin TaqMan Gene Expression Assay (4331182)", Ref. Hs99999903_ml (SEQ ID NOlO-Il), whose amplicon sequence of this kit is 171 base pairs:
  • the first forward (5 ') is part of the genomic DNA of the beta actin, but is outside the transcribed region indicated in NCBI.
  • the Applied Quantitative PCR Kit for E2F1 is the TaqMan Gene Expression Assay (4331182), Ref. Hs00153451_ml, whose amplicon sequence is 84 base pairs:
  • the fluorescence data obtained during the amplification are shown in a logarithmic graph that allows to know the cycle number in which the amplified product (Ct) begins to be detected.
  • Ct amplified product
  • This threshold can be chosen automatically by the system or manually by the user for each experiment, and is easily executable by a technician skilled in the art. For each sample, the average of the Ct value of each triplicate is calculated.
  • the Ct values for ACTINA beta and E2F1 obtained in the standard curves were analyzed to verify the existence of a linear relationship between these values and the corresponding plasmid and complementary DNA dilutions obtained from DG75 cells.
  • the average Ct value of E2F1 is subtracted based on the average Ct value of the ACTIN beta to obtain the compensated Ct value.
  • a standard line is obtained representing the amount of plasmid added in logarithmic scale versus the corresponding average Ct value in linear scale.
  • the equation corresponding to the line obtained is obtained. From this equation, the value corresponding to the logarithm in base 10 of the amount of plasmid is equivalent to the amount of mRNA present in each sample.
  • Example 2 The analysis of the expression of E2F1 by Northern and immunohistochemistry facilitates the identification of cells and patients with lymphomas 2.1.- The expression of E2F1 is greater in BL cell lines than in LCL
  • E2F1-E2F3 the activating members of the E2F family of transcription factors (E2F1-E2F3) could be involved in tumor formation (Dimova DK, Dyson NJ.
  • E2F1-E2F3 the activating members of the E2F family of transcription factors
  • E2F1 expression was then compared by quantitative PCR in 30 tumor samples of LBE patients with that of control tissues from tonsils (Tl and T2) and reactive lymph nodes (LN1-LN3) and that of biopsies of patients with LCM, SMZL, DLBCL and LF.
  • the relative expression of E2F1 was very similar between the different control tissues (Figure 3A). 100% of the LBE samples (1-30) showed an E2F1 expression level 5-45 times higher than the T2 control tissue ( Figure 3B), while the LCM, SMZL and LF samples showed expression levels of E2F1 very similar to that of the T2 control tissue ( Figure 3C).
  • Example 3 Reduction of E2F1 expression decreases the ability of BL cells to form tumors. It was already known that BL cell lines, but not those of LCL, were capable of forming soft agar colonies and producing malignant tumors when injected subcutaneously into immunodeficient mice. Based on these data, it was observed that the EBV ⁇ BL DG75 cell line, but not the LCL JY line, was capable of forming soft agar colonies and producing tumors in SCID mice ( Figures 4A and 4B).
  • DG75 line cells were infected with lentiviruses encoding no shRNA
  • E2F1-2 and E2F1-3 SEQ ID NO5, N6 and N7, respectively.
  • the interfering RNAs E2F1-1 and E2F1-2 markedly reduce the expression of E2F1 (more than 70%), which the interfering RNA E2F1-3 poorly reduced the expression of E2F1 and that the control shRNA practically did not modify the expression of E2F1 compared to the absence (None) of shRNA ( Figures 4C and 4D). None of these lentiviruses significantly affected the expression of E2F2, E2F3, c-myc or tubulin ( Figure 4C), suggesting that the effect of shRNAs against E2F1 were really specific for this gene.
  • E2F1 expression decreases the proliferation capacity of BL cells.
  • the growth capacity in culture of DG75 cells was compared with normal or reduced levels of E2F1 expression.
  • Cells infected with empty lentiviruses (None) or with a shRNA sequence against no target (Control) increased their number about 14 times after 4 days in culture, while cells expressing shRNA E2F1-1 barely increased their number 2 times in the same period of time ( Figure 5A). This reduction in growth capacity in culture could be due to a reduction in proliferation capacity or an increase in cell death.
  • RNA (20 ⁇ g) was analyzed by Northern Blot and hybridization with DNA fragments of E2F1, E2F2, E2F3 and ⁇ -actin labeled with 32P. Hybridization and washes were performed as described (9). Quantitative PCR (qPCR) was carried out according to the supplier's instructions (Applied Biosystems, Foster City, CA), using specific probes for human E2F1 and ACTINA. Patients and Cells All cases were selected from consultations made to the National Oncology Research Center (CNIO) and through the Spanish Network of Tumor Banks. The studies were approved by the relevant Ethical Commissions and the patients provided written consent after being informed.
  • qPCR Quantitative PCR
  • Biopsies of the different lymphomas were reviewed by MA Piris and his team of expert hematopathologists using the criteria of the World Health Organization (10). Thirty samples of sBL from non-immunodeficient patients and samples of reactive tonsils and lymph nodes and biopsies of mantle cell lymphomas (LCM), marginal spleen zone lymphomas (SMZL), diffuse large B-cell lymphoma (DLBCL) and Follicular lymphoma (LF) were finally selected.
  • LCM mantle cell lymphomas
  • SZL marginal spleen zone lymphomas
  • DLBCL diffuse large B-cell lymphoma
  • LF Follicular lymphoma
  • lymphoblast lines of B lymphocytes (LCL) X50-7, JY, Dana and IB4 and the lines of BL Raji, Rael, Mutu-I, Akata and DG75 were cultured in RPMI 1640, while the human kidney cell line while 293 -T was grown in Dulbecco's modified Eagle medium. Both media were supplemented with 10% heat-inactivated fetal bovine serum (GIBCO, Invitrogen Corp.), 2 mM glutamine, 100 U / ml penicillin and 100 ⁇ g / ml streptomycin.
  • GIBCO heat-inactivated fetal bovine serum
  • the 293-T cells were transfected with 20 ⁇ g of vector based on MISSION pLKO.l-pure, 15 ⁇ g of psPAX2 and 5 ⁇ g of pMD2G-VSVG using the calcium precipitation method with calcium phosphate.
  • the vectors used based on MISSION pLKO.l-pure were obtained from Sigma-Aldrich (St. Louis, Missouri) and did not contain any shRNA or encode for a control shRNA (a shRNA that generates a siRNA with an erroneous sequence of at least 5 base pairs with respect to any known human or mouse gene) or for different shRNAs specific for E2F1.
  • DG75 cells For the transduction of DG75 cells, we incubated the cells in the presence of medium containing the viral particles and 8 ⁇ g / ml protamine sulfate for 16 hours. The non-transduced cells were removed from the culture by incubation with 1 ⁇ g / ml of puromycin. Immunoblot and Immunohistochemistry
  • anti-E2Fl, anti-E2F2, anti-E2F3, anti-E2F4, or anti-c-myc antibodies from Santa Cruz Biotechnology (Santa Cruz, CA)
  • Sigma-Aldrich anti-tubulin were used followed of anti-mouse or anti-rabbit antibodies coupled to peroxidase
  • tissue samples included in paraffin were stained with anti-E2Fl (Santa Cruz) or with anti-Ki67 (DAKO, Copenhagen, Denmark) and were collated with hematoxylin or simply stained with hematoxylin and eosin.
  • the cells were resuspended at a concentration of 2 x 105 / ml and cultured in 24-well plates per triplicate. Growth was measured by cell count at different intervals. Cell viability was confirmed by exclusion of trypan blue.
  • BrdU the "FITC BrdU flow kit” kit (BDBiosciences, San Jose, CA) was used following the manufacturer's instructions. The cell cycle analysis was carried out as previously described (11) using propidium iodides. Apoptosis was determined by adnexin V-FITC (Bender MedSystems, Vienna, Austria). Cells stained with BrdU, propidium iodide and annexin-V were analyzed using a FACScan flow cytometer (BDBiosciences).
  • the 6-well plate wells were covered with RPMI 1640 medium containing 0.5% SeaPlaque agarose (FMC, Rockland, Maine) and 10% FCS.
  • RPMI 1640 medium embedded cells with 0.3% SeaPlaque agarose and 10% FCS were deposited on this base. The number of colonies grown after 2-3 weeks of planting the cells in triplicate plates was counted.
  • DG75 cells (2 x 106) resuspended in 0.1 ml of phosphate buffered saline were injected subcutaneously into 6-8 week old females of mice with severe combined immunodeficiency (SCID) CB. -17. Tumor masses were removed, weighed and included in paraffin for immunohistochemical analysis.
  • SCID severe combined immunodeficiency
  • E2F1 relative to that of actin-beta for differential diagnosis between Burkitt lymphoma and Diffuse large B-cell lymphoma.

Abstract

The invention relates to a method for the effective diagnosis of patients with sporadic Burkitt's lymphoma, based on identifying protein E2F1 in biological samples from said patients, which can be performed by RT-PCR or western blot. In addition, E2F1 has been shown to play an etiopathogenic role in the aforementioned disease and, as such, E2F1-specific RNAi can be used to treat said patients.

Description

PROCEDIMIENTO DE IDENTIFICACIÓN DE PACIENTES CON LINFOMA DE BURKITT ESPORÁDICO, PROCEDIMIENTO DE IDENTIFICACIÓN Y USO DE COMPUESTOS PARA EL TRATAMIENTO DE LINFOMA DE BURKITT ESPORÁDICO PROCEDURE FOR IDENTIFICATION OF PATIENTS WITH SPURDIC BURKITT LYMPHOMA, PROCEDURE FOR THE IDENTIFICATION AND USE OF COMPOUNDS FOR THE TREATMENT OF SPURDIC BURKITT LYMPHOMA
DESCRIPCIÓNDESCRIPTION
OBJETO DE LA INVENCIÓNOBJECT OF THE INVENTION
La presente invención describe un procedimiento de diagnóstico eficaz de pacientes con linfoma de Bur- kitt esporádico basado en la identificación de la pro- teina E2F1 en muestras biológicas de dichos pacientes, que puede ser llevado a cabo mediante RT-PCR o western blot. Además, se ha demostrado que E2F1 presenta un papel etiopatogénico en esta enfermedad por lo que RNAi especificos de E2F1 pueden ser utilizados para el trata- miento de los mismos.The present invention describes an efficient diagnostic procedure for patients with sporadic Burkett lymphoma based on the identification of the E2F1 protein in biological samples of said patients, which can be carried out by RT-PCR or western blot. In addition, it has been shown that E2F1 has an etiopathogenic role in this disease, so E2F1-specific RNAi can be used to treat them.
La presente invención se enmarca dentro del sector biotecnológico y farmacéutico y de referencia para el desarrollo de nuevos métodos de diagnóstico y de tratamiento de una enfermedad determinada, el linfoma de Burkitt esporádico (LBE) .The present invention is part of the biotechnology and pharmaceutical and reference sector for the development of new methods of diagnosis and treatment of a specific disease, sporadic Burkitt lymphoma (LBE).
ANTECEDENTES DE LA INVENCIÓNBACKGROUND OF THE INVENTION
La Organización Mundial de la Salud reconoce la existencia de tres variantes de linfoma de Burkitt (LB) : endémico (se da preferentemente en África ecuatorial) , esporádico y asociado a inmunodeficiencias (Wright DH. What is Burkitt' s lymphoma and when is it endemic? Blood 1999; 93 (2) : 758) . El diagnóstico del linfoma de Burkitt esporádico se basa en criterios morfológicos, inmunohistoquimicos y de hibridación in situ. Sin embargo, estos criterios no están permitiendo un diagnóstico todo lo preciso que seria deseable. De hecho, se producen algunos casos de diagnóstico erróneo en los que un linfoma de Burkitt ha sido diagnosticado como linfoma difuso de células B grandes y viceversa. Es deseable, por lo tanto, disponer de nuevos métodos que contribuyan a un diagnóstico más preciso de esta patología. El marcador genético característico de BL es una translocación reciproca entre el gen c-myc del cromosoma 8 y uno de los tres loci de los genes de las inmunoglobulinas (Dalla-Favera R, Bregni M, Erikson J, Patterson D, Gallo RC, Croce CM. Human c-myc onc gene is located on the región of chromosome 8 that is translocated in Burkitt lymphoma cells. Proc Nati Acad Sci U S A 1982; 79(24) : 7824-7; Hecht JL, Áster JC. Molecular biology of Burkitt 's lymphoma. J Clin Oncol 2000; 18(21) : 3707-21; Taub R, Kirsch I, Morton C, et al. Translocation of the c-myc gene into the immu- noglobulin heavy chain locus in human Burkitt lymphoma and murine plasmacytoma cells. Proc Nati Acad Sci U S A 1982; 79(24) : 7837-41) que causa un aumento notable de la expresión de c-myc. Sin embargo, diversos estudios examinando el papel de c-myc en la patogénesis de LB han concluido que la translocación de c-myc no es el único evento critico (Hotchin NA, Allday MJ, Crawford DH. Deregulated c-myc expression in Epstein-Barr-virus- immortalized B-cells induces altered growth properties and surface phenotype but not tumorigenicity . Int J Cáncer 1990; 45(3) : 566-71) . Además, este tipo de translocación también tiene lugar en otros tipos de linfomas que a menudo se confunden con el linfoma de Burkitt esporádico, como es el caso de los linfomas difusos de células B grandes. La determinación del nivel de expresión relativa de c-myc no resultarla, por lo sión relativa de c-myc no resultaría, por lo tanto, de interés como criterio diagnóstico.The World Health Organization recognizes the existence of three variants of Burkitt lymphoma (LB): endemic (occurs preferably in equatorial Africa), sporadic and associated with immunodeficiencies (Wright DH. What is Burkitt 's lymphoma and when is it endemic Blood 1999; 93 (2): 758). The diagnosis of sporadic Burkitt lymphoma is based on morphological, immunohistochemical and in situ hybridization criteria. However, these criteria are not allowing an accurate diagnosis that would be desirable. In fact, there are some cases of misdiagnosis in which a Burkitt lymphoma has been diagnosed as diffuse large B-cell lymphoma and vice versa. It is desirable, therefore, to have new methods that contribute to a more accurate diagnosis of this pathology. The characteristic genetic marker of BL is a reciprocal translocation between the c-myc gene of chromosome 8 and one of the three loci of the immunoglobulin genes (Dalla-Favera R, Bregni M, Erikson J, Patterson D, Gallo RC, Croce CM. Human c-myc onc gene is located on the region of chromosome 8 that is translocated in Burkitt lymphoma cells. Proc Nati Acad Sci USA 1982; 79 (24): 7824-7; Hecht JL, Áster JC. Molecular biology of Burkitt 's lymphoma. J Clin Oncol 2000; 18 (21): 3707-21; Taub R, Kirsch I, Morton C, et al. Translocation of the c-myc gene into the immunoglobulin heavy chain locus in human Burkitt lymphoma and murine plasmacytoma cells Proc Nati Acad Sci USA 1982; 79 (24): 7837-41) which causes a marked increase in c-myc expression. However, several studies examining the role of c-myc in the pathogenesis of LB have concluded that translocation of c-myc is not the only critical event (Hotchin NA, Allday MJ, Crawford DH. Deregulated c-myc expression in Epstein- Barr-virus- immortalized B-cells induces altered growth properties and surface phenotype but not tumorigenicity Int J Cancer 1990; 45 (3): 566-71). In addition, this type of translocation also occurs in other types of lymphomas that are often confused with sporadic Burkitt lymphoma, as is the case with diffuse large B-cell lymphomas. The determination of the relative expression level of c-myc would not result, so The relative relationship of c-myc would therefore not be of interest as a diagnostic criterion.
La expresión de E2F1 ha sido analizada cualita- tivamente mediante inmunohistoquímica en 124 casos de varios tipos de linfoma de tipo no-Hodgkin (Lai R, Medeiros LJ, Coupland R, McCourty A, Brynes RK. Immuno- histochemical detection of E2F-1 in non-Hodgkin ' s lym- phomas : a survey of 124 cases. Mod Pathol. 1998 May; 11 (5) : 457-63) describiéndose una expresión relativamente elevada en linfoma de células del manto, linfoma linfoblástico, linfoma de células pequeñas no fragmentadas y linfoma hepatoesplénico de células T gamma-delta. La sobre-expresión de E2F1 también ha sido descrita empleando diversas técnicas en otros tipos de tumores. Así, se ha descrito la existencia de una expresión elevada de E2F1 en carcinoma de células no-pequeñas de pulmón (Kotsinas A, Evangelou K, Zacharatos P, Kittas C, Gorgoulis VG. Proliferation, but not apoptosis, is associated with distinct beta-catenin expression pat- terns in nonsmall-cell lung carcinomas: Relationship with adenomatous polyposis coli and Gl-to S-phase cell- cycle regulators. Am J Pathol 2002; 161: 1619-34) y en algunos casos de carcinoma ductal pancreático (Yamazaki K, Yaj ima T, Nagao T, et al. Expression of transcription factor E2F-1 in pancreatic ductal carcinoma: an immuno- histochemical study. Pathol Res Pract 2003; 199(1) : 23- 8) mediante inmunohistoquímica; en carcinoma gastrointestinal y carcinoma de colon (Suzuki T, Yasui W, Yoko- zaki H, Naka K, Ishikawa T, Tahara E. Expression of the E2F family in human gastrointestinal carcinomas. Int J Cáncer 1999; 81:535-8) mediante northern e inmunoblot; en carcinoma de células pequeñas de pulmón (Eymin B, Gazzeri S, Brambilla C, Brambilla E. Distinct pattern of E2F1 expression in human lung tumours : E2F1 is upregu- lated in small cell lung carcinoma. Oncogene 2001; 20: 1678-87) mediante inmunoblot e inmunohistoquimica; en muestras de glioblastoma (Alonso MM, Fueyo J, Shay JW, Aldape KD, Jiang H, Lee OH, Johnson DG, Xu J, Kondo Y, Kanzawa T, Kyo S, Bekele BN, Zhou X, Nigro J, McDonald JM, Yung WK, Gómez-Manzano C. Expression of transcrip- tion factor E2F1 and telomerase in glioblastomas : Mecha- nistic linkage and prognostic significance . J Nati Cáncer Inst 2005; 97:1589-600), mediante inmunoblot y análisis global de expresión génica con microarrays y en tumores anaplásicos de tiroides y papilares (Onda M, Nagai H, Yoshida A, et al. Up-regulation of transcrip- tional factor E2F1 in papillary and anaplastic thyroid cancers. J Hum Genet 2004; 49(6) : 312-8) mediante PCR semi-cuantitativa y PCR cuantitativa empleando el gen GAPDH (no la ACTINA) como referencia.E2F1 expression has been qualitatively analyzed by immunohistochemistry in 124 cases of various types of non-Hodgkin lymphoma (Lai R, Medeiros LJ, Coupland R, McCourty A, Brynes RK. Immuno-histochemical detection of E2F-1 in non-Hodgkin 's lym- phomas: a survey of 124 cases Mod Pathol. 1998 May; 11 (5): 457-63) describing a relatively high expression in mantle cell lymphoma, lymphoblastic lymphoma, non-small cell lymphoma fragmented and gamma-delta T-cell hepatosplenic lymphoma. Overexpression of E2F1 has also been described using various techniques in other types of tumors. Thus, the existence of an elevated expression of E2F1 in non-small cell carcinoma of the lung has been described (Kotsinas A, Evangelou K, Zacharatos P, Kittas C, Gorgoulis VG. Proliferation, but not apoptosis, is associated with distinct beta- catenin expression patters in nonsmall-cell lung carcinomas: Relationship with adenomatous polyposis coli and Gl-to S-phase cell-cycle regulators. Am J Pathol 2002; 161: 1619-34) and in some cases of pancreatic ductal carcinoma (Yamazaki K, Yaj ima T, Nagao T, et al. Expression of transcription factor E2F-1 in pancreatic ductal carcinoma: an immuno-histochemical study Pathol Res Pract 2003; 199 (1): 23-8) by immunohistochemistry; in gastrointestinal carcinoma and colon carcinoma (Suzuki T, Yasui W, Yokozaki H, Naka K, Ishikawa T, Tahara E. Expression of the E2F family in human gastrointestinal carcinomas. Int J Cancer 1999; 81: 535-8) northern and immunoblot; in small cell carcinoma of the lung (Eymin B, Gazzeri S, Brambilla C, Brambilla E. Distinct pattern of E2F1 expression in human lung tumors: E2F1 is upregu- lated in small cell lung carcinoma. Oncogene 2001; 20: 1678-87) by immunoblot and immunohistochemistry; in glioblastoma samples (Alonso MM, Fueyo J, Shay JW, Aldape KD, Jiang H, Lee OH, Johnson DG, Xu J, Kondo Y, Kanzawa T, Kyo S, Bekele BN, Zhou X, Nigro J, McDonald JM, Yung WK, Gómez-Manzano C. Expression of transcription factor E2F1 and telomerase in glioblastomas: Mechanistic linkage and prognostic significance. J Nati Cancer Inst 2005; 97: 1589-600), by immunoblot and global gene expression analysis with microarray and anaplastic thyroid and papillary tumors (Onda M, Nagai H, Yoshida A, et al. Up-regulation of transcriptional factor E2F1 in papillary and anaplastic thyroid cancers. J Hum Genet 2004; 49 (6): 312- 8) by semi-quantitative PCR and quantitative PCR using the GAPDH gene (not ACTINA) as a reference.
Sin embargo, por el momento no se conoce ningún método diagnóstico del LBE basado en la determinación de la expresión relativa del gen E2F1 para el, con técnicas como la PCR cuantitativa que precisa pequeñas cantidades de muestra biológica y con el grado de exactitud que se describe en la presente invención.However, at the moment there is no known diagnostic method of LBE based on the determination of the relative expression of the E2F1 gene for it, with techniques such as quantitative PCR that requires small amounts of biological sample and with the degree of accuracy described in the present invention.
Por otro lado, el linfoma de Burkitt, un linfoma no-Hodgkin de células B muy agresivo, es rápidamente letal si no se trata a tiempo, pero es curable con un tratamiento intensivo de quimioterapia (Blum KA, Lozans- ki G, Byrd JC. Adult Burkitt leukemia and lymphoma. Blood 2004; 104(10) : 3009-20) . Debido a que la mayoria de las veces los efectos secundarios de este tratamiento no son muy bien tolerados (Divine M, Casassus P, Kos- cielny S, et al. Burkitt lymphoma in adults: a prospec- tive study of 72 patients treated with an adapted pedi- atric LMB protocol. Ann Oncol 2005; 16(12) : 1928-35) los pacientes se beneficiarían de terapias alternativas dirigidas contra dianas moleculares específicas que podrían reducir la toxicidad sistémica del tratamiento convencional .On the other hand, Burkitt lymphoma, a very aggressive non-Hodgkin B-cell lymphoma, is rapidly lethal if not treated in time, but is curable with intensive chemotherapy treatment (Blum KA, Lozanski G, Byrd JC Adult Burkitt leukemia and lymphoma Blood 2004; 104 (10): 3009-20). Because most of the times the side effects of this treatment are not very well tolerated (Divine M, Casassus P, Kosigny S, et al. Burkitt lymphoma in adults: a prospective study of 72 patients treated with an adapted pediatric LMB protocol Ann Oncol 2005; 16 (12): 1928-35) Patients would benefit from alternative therapies directed against specific molecular targets that could reduce the systemic toxicity of conventional treatment.
En este sentido, diversos descubrimientos sugieren que distintos mecanismos patogénicos están implicados en los distintos tipos de LB. Mientras que el virus de Epstein-Barr, la malaria, arbovirus y promotores tumorales de plantas están relacionados con el LB endémico (van den Bosch CA. Is endemic Burkitt's lymphoma an alliance between three infections and a tumour promoter? Lancet Oncol 2004; 5(12) : 738-46), se conoce muy poco sobre los mecanismos implicados en la formación de LBE. Así, un mayor conocimiento de las bases moleculares del proceso de linfomagénesis de LBE podría ayudar a desarrollar tratamientos de menor toxicidad. Dado que los factores E2F activadores pueden funcionar como oncogenes se procedió a analizar su papel en la formación del linforna de Burkitt.In this sense, several discoveries suggest that different pathogenic mechanisms are involved in different types of LB. While Epstein-Barr virus, malaria, arbovirus and plant tumor promoters are related to endemic LB (van den Bosch CA. Is endemic Burkitt's lymphoma an alliance between three infections and a tumour promoter? Lancet Oncol 2004; 5 ( 12): 738-46), very little is known about the mechanisms involved in the formation of LBE. Thus, greater knowledge of the molecular basis of the lymphomagenesis process of LBE could help develop treatments of lower toxicity. Since the activating E2F factors can function as oncogenes, their role in the formation of Burkitt's lymph was analyzed.
DESCRIPCIÓN DE LA INVENCIÓNDESCRIPTION OF THE INVENTION
Un objeto de la presente invención lo constitu- ye un procedimiento de identificación de un linfoma de Burkitt esporádico, en adelante procedimiento de identificación de LBE de la invención, basado en la identificación de los niveles de la presencia de E2F1 en una muestra biológica que comprende las siguientes etapas: a) identificación de los niveles de expresión deAn object of the present invention is a method of identifying a sporadic Burkitt lymphoma, hereinafter a method of identifying LBE of the invention, based on the identification of the levels of the presence of E2F1 in a biological sample comprising the following stages: a) identification of expression levels of
E2F1, ajusfándolos con los niveles de un marcador control, preferentemente ACTINA beta cuando proceda, en una muestra biológica, y b) comparación de los niveles de E2F1 observados en a) con una muestra biológica control, e c) identificación de una muestra como LBE cuando los niveles de E2F1 superan a los obtenidos en la muestra control por encima de un umbral determinado.E2F1, adjusting them with the levels of a control marker, preferably ACTINA beta where appropriate, in a biological sample, and b) comparison of the levels of E2F1 observed in a) with a biological control sample, and c) identification of a sample as LBE when the levels of E2F1 exceed those obtained in the control sample above a certain threshold.
Un objeto particular de la invención lo consti- tuye el procedimiento de identificación de un LBE en el que la identificación de E2F1 se lleva a cabo mediante RT-PCR cuantitativa de un precursor génico de E2F1 y en el que los niveles de E2F1 se ajustan a los de ACTINA beta. Este procedimiento está basado en la extracción de RNA, ya sea RNA polyA+ o RNA total o RNA polyA+, de una muestra biológica sospechosa de LBE y de un tejido control y la amplificación de la secuencia de E2F1 se lleva a cabo con adecuados oligonucleótidos o cebadores especificos tanto para la región codificante o no codi- ficante de dicho RNA mensajero (por ejemplo, frente a las regiones 5' o 3' no traducidas del RNA) .A particular object of the invention is the identification procedure of a LBE in which the identification of E2F1 is carried out by quantitative RT-PCR of an E2F1 gene precursor and in which the levels of E2F1 are adjusted to those of ACTINA beta. This procedure is based on the extraction of RNA, either RNA polyA + or total RNA or RNA polyA +, from a suspected biological sample of LBE and from a control tissue and amplification of the E2F1 sequence is carried out with suitable oligonucleotides or primers specific for both the coding or non-coding region of said messenger RNA (for example, against the 5 'or 3' untranslated regions of the RNA).
Otro objeto particular de la invención lo constituye el procedimiento de identificación de un LBE en el que la identificación de E2F1 de a) se refiere a la forma proteica del gen E2F1 (SEQ ID NO 2) y la identificación de ACTINA beta se refiere a su forma proteica (SEQ ID NO 4) y se lleva a cabo mediante el uso de anticuerpos especificos de la proteina E2F1 en técnicas, por ejemplo, de inmunoblot o Western blot y de inmu- nohistoquimica .Another particular object of the invention is the identification procedure of an LBE in which the identification of E2F1 of a) refers to the protein form of the E2F1 gene (SEQ ID NO 2) and the identification of ACTINA beta refers to its protein form (SEQ ID NO 4) and is carried out by the use of antibodies specific for the E2F1 protein in techniques, for example, immunoblot or Western blot and immunohistochemistry.
Otro objeto de la presente invención lo constituye un procedimiento de identificación y evaluación de la actividad de compuestos inhibidores de la proteina E2F1 útiles para el tratamiento del LBE, en adelante procedimiento de identificación de compuestos de la presente invención, que comprende los siguientes pasos: a) Puesta en contacto de un sistema biológico donde exista una expresión de E2F1 que produzca parcial o totalmente un fenotipo LBE con el compuesto candidato objeto de este procedimiento, e incubación en las condiciones adecuadas, b) determinación de un parámetro indicativo de disminución de los niveles de E2F1 o de regresión de un fenotipo LBE, e c) identificación de un compuesto inhibidor de la actividad de la proteina E2F1 cuando se observa una regresión de dicho fenotipo LBE o una disminución de los niveles de E2F1.Another object of the present invention is a method for identifying and evaluating the activity of inhibitor compounds of the E2F1 protein useful for the treatment of the LBE, hereinafter method of identifying compounds of the present invention, comprising the following steps: ) Contacting a biological system where there is an expression of E2F1 that produces partial or totally an LBE phenotype with the candidate compound object of this procedure, and incubation under the appropriate conditions, b) determination of a parameter indicative of decreased levels of E2F1 or regression of an LBE phenotype, ec) identification of an inhibitor compound of the activity of the E2F1 protein when a regression of said LBE phenotype or a decrease in E2F1 levels is observed.
Otro objeto de la presente invención lo constituye el uso de un compuesto o agente inhibidor de la actividad de la proteina E2F1, en adelante uso de un compuesto de la presente invención, en la elaboración de medicamentos o composiciones farmacéuticas para el tratamiento de pacientes humanos con LBE.Another object of the present invention is the use of a compound or agent that inhibits the activity of the E2F1 protein, hereinafter used of a compound of the present invention, in the preparation of medicaments or pharmaceutical compositions for the treatment of human patients with LBE
Otro objeto de la presente invención lo consti- tuye una composición farmacéutica o un medicamento para el tratamiento del LBE, en adelante composición farmacéutica de la presente invención, que comprende una cantidad terapéuticamente efectiva de un compuesto o agente inhibidor de la proteina E2F1, junto con, opcio- nalmente, uno o más adyuvantes y/o vehículos farmacéuticamente aceptables.Another object of the present invention is a pharmaceutical composition or a medicament for the treatment of LBE, hereinafter pharmaceutical composition of the present invention, which comprises a therapeutically effective amount of an E2F1 protein inhibitor compound or agent, together with , optionally, one or more pharmaceutically acceptable adjuvants and / or vehicles.
Otro objeto de la presente invención lo constituye el uso de la composición farmacéutica de la inven- ción en un método de tratamiento de un mamífero, preferentemente un ser humano, afectado por LBE, en adelante uso de la composición farmacéutica de la presente invención, consistente en la administración de dicha composición terapéutica que inhibe el proceso patológico del LBE. La presente invención se basa en que los inventores han identificado el papel etiopatogénico del gen E2F1 y su transcrito proteico en pacientes con linfoma de Burkitt esporádico (LBE) y, sorprendentemente, la utilidad para un diagnostico de LBE de la determinación de los niveles de expresión de E2F1 compensándolos con los niveles del gen de actina beta y su transcrito, al contrario que lo observado cuando se utilizó otros genes de control, como es el caso del ARN ribosómico de la subunidad 18S de los ribosomas o el ARN mensajero correspondiente a los genes GAPDH y GUSB (datos no mostrados) . En estos últimos casos los niveles de expresión E2F1 fueron completamente anárquicos para el objetivo de distinguir los casos de LBE, sin poder definir un patrón concreto con ningún tipo de patología. En la presente invención se ha compensado la señal de expresión E2F1 con la señal de ACTINA beta para cada muestra analizada, de forma particular utilizando el valor equivalente de plásmidos que expresan ambos marcadores, y se ha obser- vado que es posible determinar un valor minimo que separa perfectamente todas las muestras de pacientes con LBE de los controles; y de forma más concreta y como ejemplo experimental, que un nivel de expresión de E2F1 superior al equivalente de 2.5 ng de plásmido es deter- minante para la identificación de un linfoma de Burkitt esporádico, frente a lo observado en muestras de tejidos control (amígdalas o nodulos linfáticos reactivos o tejido sano circundante al tumor), y que incluso permite la identificación de falsos positivos identificados por otros métodos (ver ejemplo 1) .Another object of the present invention is the use of the pharmaceutical composition of the invention in a method of treating a mammal, preferably a human being, affected by LBE, hereinafter use of the pharmaceutical composition of the present invention, consisting in the administration of said therapeutic composition that inhibits the pathological process of the LBE. The present invention is based on the fact that the inventors have identified the etiopathogenic role of the E2F1 gene and its protein transcript in patients with sporadic Burkitt lymphoma (LBE) and, surprisingly, the utility for a diagnosis of LBE in determining expression levels of E2F1 compensating them with the levels of the beta actin gene and its transcript, unlike what was observed when other control genes were used, such as the ribosomal RNA of the 18S subunit of the ribosomes or the messenger RNA corresponding to the genes GAPDH and GUSB (data not shown). In these latter cases, the levels of E2F1 expression were completely anarchic for the purpose of distinguishing cases of LBE, without being able to define a specific pattern with any type of pathology. In the present invention, the E2F1 expression signal has been compensated with the ACTINA beta signal for each sample analyzed, in particular using the equivalent value of plasmids expressing both markers, and it has been observed that it is possible to determine a minimum value that perfectly separates all samples of patients with LBE from controls; and more specifically and as an experimental example, that an expression level of E2F1 greater than the equivalent of 2.5 ng of plasmid is decisive for the identification of a sporadic Burkitt lymphoma, compared to that observed in control tissue samples (tonsils) or reactive lymph nodes or healthy tissue surrounding the tumor), and that even allows the identification of false positives identified by other methods (see example 1).
En primer lugar, se han puesto a punto varios métodos de determinación de la expresión relativa del gen E2F1 mediante PCR en tiempo real (PCR cuantitativa) , PCR semicuantitativa e inmunoblot, que servirían para confirmar el diagnóstico de linfoma de Burkitt esporádi- co. Para ello, y en el caso de la PCR, se han basado en la relación entre la expresión del gen E2F1 y la del gen de la beta-ACTINA.First, several methods for determining the relative expression of the E2F1 gene have been developed using real-time PCR (quantitative PCR), semi-quantitative PCR and immunoblot, which would serve to confirm the diagnosis of sporadic Burkitt lymphoma co. For this, and in the case of PCR, they have been based on the relationship between the expression of the E2F1 gene and that of the beta-ACTINA gene.
En segundo lugar, los datos descritos en la pre- senté invención indican que la expresión de E2F1 se encuentra desregulada en lineas celulares de BL y en tumores de LBE, que su expresión elevada es necesaria para la formación de tumores en ratones, el crecimiento de colonias en agar blando y la proliferación celular y sugieren que esta expresión elevada podria ser necesaria para la progresión de éstas células a través de G2/M. Más particularmente, los resultados claramente indicaron que la expresión de E2F1 es mucho más elevada en estas lineas celulares y muestras de tumores que en las lineas de LCL y los tejidos control o en otros tipos de linfo- ma, respectivamente.Second, the data described in the present invention indicate that E2F1 expression is deregulated in BL cell lines and in LBE tumors, that its elevated expression is necessary for tumor formation in mice, the growth of Soft agar colonies and cell proliferation and suggest that this elevated expression might be necessary for the progression of these cells through G2 / M. More particularly, the results clearly indicated that the expression of E2F1 is much higher in these cell lines and tumor samples than in the LCL lines and control tissues or in other types of lymphoma, respectively.
Se ha descrito en la literatura que algunos genes implicados en el crecimiento y la proliferación celular se expresan altamente en algunos tumores. Sin embargo, la expresión elevada de E2F1 en lineas celulares de LB y en las muestras tumorales de LBE de la presente invención no parece ser debida a una mayor presencia de células capaces de proliferar en estos casos que en otras lineas celulares o en otros tumores porque i) las lineas celulares de LB y LCL analizadas mostraban niveles de proliferación prácticamente idénticos y ii) la expresión de E2F1 en muestras de LBE era mucho más elevada que en muestras de DLBCL con un nivel de proliferación similar. Los datos aqui descritos más bien sugieren que la expresión elevada de E2F1 es necesaria para la formación de tumores puesto que la reducción de su expresión en células de LB mediante la expresión de shRNAs especificos para E2F1 con lentivirus notablemente reducia la capacidad de estas células para formar colonias en agar blando y para formar tumores en ratones inmunodeficientes SCID. Apoyando esta conclusión, se ha descrito que la desactivación de uno o los dos alelos de E2fl retrasaba la aparición del linfomas generados por sobreexpresión de c-myc en un modelo murino transgénico (Baudino TA, Maclean KH, Brennan J, et al. Myc-mediated proliferation and lymphomagenesis, but not apoptosis, are compromised by E2fl loss. Mol CeIl 2003; 11 (4) : 905-14) .It has been described in the literature that some genes involved in cell growth and proliferation are highly expressed in some tumors. However, the elevated expression of E2F1 in LB cell lines and in the LBE tumor samples of the present invention does not appear to be due to a greater presence of cells capable of proliferating in these cases than in other cell lines or in other tumors because i) the LB and LCL cell lines analyzed showed practically identical proliferation levels and ii) E2F1 expression in LBE samples was much higher than in DLBCL samples with a similar proliferation level. The data described here rather suggests that high expression of E2F1 is necessary for tumor formation since the reduction of its expression in LB cells by the expression of shRNAs specific for E2F1 with lentivirus remarkably reduced the ability of these cells to form colonies in soft agar and to form tumors in SCID immunodeficient mice. Supporting this conclusion, it has been described that the deactivation of one or both E2fl alleles delayed the appearance of lymphomas generated by c-myc overexpression in a transgenic murine model (Baudino TA, Maclean KH, Brennan J, et al. Myc- mediated proliferation and lymphomagenesis, but not apoptosis, are compromised by E2fl loss, Mol CeIl 2003; 11 (4): 905-14).
Por otro lado, se sabe que la translocación de c-myc no es el único evento critico en la patogénesis deOn the other hand, it is known that c-myc translocation is not the only critical event in the pathogenesis of
BL (7) . De hecho, la sobreexpresión de c-myc en células normales induce su acumulación en la fase G2 del ciclo celular y normalmente las convierte en aneuploidesBL (7). In fact, overexpression of c-myc in normal cells induces its accumulation in the G2 phase of the cell cycle and normally converts them into aneuploids.
(Felsher DW, Zetterberg A, Zhu J, Tlsty T, Bishop JM. Overexpression of MYC causes p53-dependent G2 arrest of normal fibroblasts. Proc Nati Acad Sci U S A 2000; 97(19) : 10544-8) . En la presente invención se ha demostrado que la reducción de la expresión de E2F1 en células de LB no sólo disminuye su capacidad de prolifera- ción sino que induce su acumulación en la fase G2 o M del ciclo celular. Parece, por lo tanto, que la expresión elevada de E2F1 podria cooperar con c-myc en la formación de LBE ayudando a las células a pasar la fase G2 del ciclo celular. E2F1 llevarla a cabo este papel induciendo la expresión de genes necesarios para la progresión a través de G2 y M.(Felsher DW, Zetterberg A, Zhu J, Tlsty T, Bishop JM. Overexpression of MYC causes p53-dependent G2 arrest of normal fibroblasts. Proc Nati Acad Sci U S A 2000; 97 (19): 10544-8). In the present invention it has been shown that reducing the expression of E2F1 in LB cells not only decreases their proliferation capacity but also induces their accumulation in the G2 or M phase of the cell cycle. It seems, therefore, that the elevated expression of E2F1 could cooperate with c-myc in the formation of LBE by helping cells pass the G2 phase of the cell cycle. E2F1 perform this role by inducing the expression of genes necessary for progression through G2 and M.
Estos datos sugieren que la expresión elevada de E2F1 podria cooperar con la expresión elevada de c-myc en la formación de LBE. Dado que los ratones E2F1-/- se desarrollan normalmente, parece claro que la expresión de E2F1 no es necesaria para la proliferación de células normales. En concreto, la expresión de E2F1 no es necesaria para la proliferación de los linfocitos T en respuesta a señales homeostáticas o a la estimulación in vivo (DeRyckere D, DeGregori J. E2F1 and E2F2 are diffe- rentially required for homeostasis-driven and antigen- induced T cell proliferation in vivo. J Immunol 2005; 175(2) : 647-55) , por lo que parece probable, a priori, que la disminución de la expresión de E2F1 en pacientes de LBE no tendria porqué causar inmunodepresión . En conjunto, estos datos sugieren que E2F1 actúa como inductor del fenotipo patológico del LBE, es decir, que existe una relación directa -no sólo una asociación temporal- entre la actividad del gen E2F1 y la etiopatogenia de esta enfermedad. De esta forma, la presencia de E2F1, ya sea forma génica o proteina, puede considerarse un marcador del LBE y, por tanto, utilizarse su identificación como diagnóstico de LBE; y por otro lado, E2F1 puede considerarse como diana terapéutica de gran utilidad en la identificación de nuevos fármacos para el tratamiento del LBE, e incluso, su inhibición génica como una forma de terapia. Estas aproximaciones terapéuticas se basan en el uso de com¬ puestos o agentes inhibidores de la actividad de E2F1. Por lo tanto, un objeto de la presente invención lo constituye un procedimiento de identificación de un linfoma de Burkitt esporádico, en adelante procedimiento de identificación de LBE de la invención, basado en la identificación de los niveles de la presencia de E2F1 en una muestra biológica que comprende las siguientes etapas : a) identificación de los niveles de expresión de E2F1, ajusfándolos con los niveles de un marcador con¬ trol, preferentemente ACTINA beta cuando proceda, en una muestra biológica, y b) comparación de los niveles de E2F1 observados en a) con una muestra biológica control, e c) identificación de una muestra como LBE cuando los niveles de E2F1 superan a los obtenidos en la mues- tra control por encima de un umbral determinado. Tal como se utiliza en la presente invención el término "E2F1" y "ACTINA beta" se refieren tanto al gen o proteina E2F1 (SEQ ID NO 1 y NO 2, respectivamente) (códigos de acceso son NM_005225 y NP_005216, respecti- vamente) como al gen o proteina ACTINA beta (SEQ ID NO 3 y NO 4, respectivamente) (códigos de acceso son NM_001101 y NP_001092, respectivamente), respectivamente, asi como a cualquier secuencia de nucleótidos o de aminoácidos (aás.) análoga a éstas. En el sentido utili- zado en esta descripción, el término "análoga" pretende incluir cualquier secuencia de nucleótidos o aminoácidos que pueda ser aislada o construida en base a las secuencias de nucleótidos o aás. mostradas en la presente memoria, por ejemplo, mediante la introducción de susti- tuciones de nucleótidos o aás. conservativas o no conservativas, incluyendo la inserción de uno o más nucleótidos o aás, la adición de uno o más nucleótidos o aás. en cualquiera de los extremos de la molécula o la dele- ción de uno o más nucleótidos o aás. en cualquier extre- mo o en el interior de la secuencia, y que constituya una secuencia codificante o péptido con actividad similar a las secuencias de la invención, es decir, sea capaz de inducir el LBE.These data suggest that the elevated expression of E2F1 could cooperate with the elevated expression of c-myc in the formation of LBE. Since E2F1 - / - mice develop normally, it seems clear that E2F1 expression is not necessary for normal cell proliferation. In particular, the expression of E2F1 is not necessary for the proliferation of T lymphocytes in response to homeostatic signals or in vivo stimulation (DeRyckere D, DeGregori J. E2F1 and E2F2 are diffe- rentially required for homeostasis-driven and antigen-induced T cell proliferation in vivo. J Immunol 2005; 175 (2): 647-55), so it seems likely, a priori, that the decrease in E2F1 expression in LBE patients should not cause immunosuppression. Together, these data suggest that E2F1 acts as an inducer of the pathological phenotype of the LBE, that is, that there is a direct relationship - not just a temporary association - between the activity of the E2F1 gene and the pathogenesis of this disease. In this way, the presence of E2F1, either gene or protein form, can be considered a marker of the LBE and, therefore, its identification as a diagnosis of LBE can be used; and on the other hand, E2F1 can be considered as a therapeutic target of great utility in the identification of new drugs for the treatment of LBE, and even its gene inhibition as a form of therapy. These therapeutic approaches are based on the use of compounds or agents that inhibit the activity of E2F1. Therefore, an object of the present invention is a method of identifying a sporadic Burkitt lymphoma, hereinafter a method of identifying LBE of the invention, based on the identification of the levels of the presence of E2F1 in a biological sample comprising the following steps: a) identification of the expression levels of E2F1, adjusting them with the levels of a marker with ¬ trol, preferably ACTINA beta when appropriate, in a biological sample, and b) comparison of the levels of E2F1 observed in a ) with a biological control sample, ec) identification of a sample as LBE when the levels of E2F1 exceed those obtained in the control sample above a certain threshold. As used in the present invention, the term "E2F1" and "ACTINA beta" refers to both the E2F1 gene or protein (SEQ ID NO 1 and NO 2, respectively) (access codes are NM_005225 and NP_005216, respectively) as to the ACTINA beta gene or protein (SEQ ID NO 3 and NO 4, respectively) (access codes are NM_001101 and NP_001092, respectively), respectively, as well as any nucleotide or amino acid sequence (aás.) analogous to them. In the sense used in this description, the term "analogous" is intended to include any nucleotide or amino acid sequence that can be isolated or constructed based on nucleotide sequences or more. shown herein, for example, by introducing nucleotide substitutions or aás. conservative or non-conservative, including the insertion of one or more nucleotides or aás, the addition of one or more nucleotides or aás. at either end of the molecule or the deletion of one or more nucleotides or more. at any end or within the sequence, and that constitutes a coding sequence or peptide with activity similar to the sequences of the invention, that is, is capable of inducing LBE.
En general, una secuencia de nucleótidos o de aminoácidos análoga es sustancialmente homologa a la secuencia de aminoácidos comentada anteriormente. En el sentido utilizado en esta descripción, la expresión "sustancialmente homologa" significa que las secuencias de nucleótidos o aás. en cuestión tienen un grado de identidad de, al menos, un 40%, preferentemente de, al menos, un 85%, o más preferentemente de, al menos, un 95%.In general, an analogous nucleotide or amino acid sequence is substantially homologous to the amino acid sequence discussed above. In the sense used in this description, the term "substantially homologous" means that the nucleotide sequences or aás. in question they have a degree of identity of at least 40%, preferably of at least 85%, or more preferably of at least 95%.
El grupo o muestras biológicas control puede obtenerse a partir de muestras de personas sanas, o inclu- so desarrollarse artificialmente muestra biológica control como por ejemplo un plásmido que contiene el ADNc de E2F1.The control group or biological samples can be obtained from samples of healthy people, or even artificially developed biological sample control such as a plasmid containing the E2F1 cDNA.
Un objeto particular de la invención lo constituye el procedimiento de identificación de un LBE en el que la identificación de E2F1 se lleva a cabo mediante RT-PCR cuantitativa de un precursor génico de E2F1 y en el que los niveles de E2F1 se ajustan a los de ACTINA beta. Este procedimiento está basado en la extracción de RNA, ya sea RNA polyA+ o RNA total o RNA polyA+, de una muestra biológica sospechosa de LBE y de un tejido control y la amplificación de la secuencia de E2F1 se lleva a cabo con adecuados oligonucleótidos o cebadores especificos tanto para la región codificante o no codificante de dicho RNA mensajero (por ejemplo, frente a las regiones 5' o 3' no traducidas del RNA) .A particular object of the invention is the identification procedure of an LBE in which the identification of E2F1 is carried out by quantitative RT-PCR of an E2F1 gene precursor and in which the levels of E2F1 are adjusted to those of ACTINA beta. This procedure is based on the extraction of RNA, either RNA polyA + or total RNA or RNA polyA +, from a suspected biological sample of LBE and from a control tissue and amplification of the E2F1 sequence is carried out with suitable oligonucleotides or primers specific for both the coding or non-coding region of said messenger RNA (for example, against the 5 'or 3' untranslated regions of the RNA).
Una realización particular de la invención lo constituye el procedimiento de la invención basado en una RT-PCR cuantitativa donde el umbral distintivo de LBE es un nivel de expresión de E2F1 superior al equiva- lente de 2.5 ng de plásmido, utilizado como control.A particular embodiment of the invention is the process of the invention based on a quantitative RT-PCR where the distinctive threshold of LBE is an expression level of E2F1 higher than the equivalent of 2.5 ng plasmid, used as a control.
Una realización particular de la invención lo constituye el procedimiento de la invención basado en una RT-PCR cuantitativa con unos cebadores especificos de E2F1 y ACTINA beta que se corresponden, a titulo ilustrativo y sin que limite el alcance de la invención, respectivamente, con los siguientes E2F1 5' (SEQ ID NO8), E2F1 3' (SEQ ID NO9) , ACTINA beta 5' (SEQ ID NOlO) y ACTINA beta 3' (SEQ ID NOIl), suministrados por la casa comercial Applied Biosystem y que amplifican la región "AGCTCATTGCCAAGAAGTCCAAGAACCACATCCAGTGGCTGGGCAGCCACACCAC AGTGGGCGTCGGCGGACGGCTTGAGGGGT" Y A particular embodiment of the invention is the process of the invention based on a quantitative RT-PCR with specific primers of E2F1 and ACTINA beta corresponding, by way of illustration and without limiting the scope of the invention, respectively, with the following E2F1 5 '(SEQ ID NO8), E2F1 3' (SEQ ID NO9), ACTINA beta 5 '(SEQ ID NOlO) and ACTINA beta 3' (SEQ ID NOIl), supplied by the Applied Biosystem commercial house and amplifying the region "AGCTCATTGCCAAGAAGTCCAAGAACCACATCCAGTGGCTGGGCAGCCACACCAC AGTGGGCGTCGGCGGACGGCTTGAGGGGT" Y
"GCGCCCTATAAAACCCAGCGGCGCGACGCGCCACCACCGCCGAGACCGCGTCCGC CCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGTCCACACCCGCCGCC AGCTCACCATGGATGAATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTG CA" de E2F1 y ACTINA beta, respectivamente. El diseño y la preparación de oligos o cebadores para una amplificación de ambos genes por PCR es una tarea fácilmente posible para un experto medio en la materia, pudiéndose diseñar oligos tanto de la región codificante como de la no codificante de ambos genes."GCGCCCTATAAAACCCAGCGGCGCGACGCGCCACCACCGCCGAGACCGCGTCCGC CCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGTCCACACCCGCCGCC AGCTCACCATGGATGAATATCGCCGCTGTCGACGGGGGGGGGGGGGGGGGGGGG The design and The preparation of oligos or primers for an amplification of both genes by PCR is an easily possible task for an expert in the field, being able to design oligos from both the coding and non-coding regions of both genes.
Otra realización particular de la invención lo constituye el procedimiento de la invención basado en una PCR semi-cuantitativa con unos cebadores específicos de E2F1 y Actina beta tal como se indica anteriormente. En este último caso, la reacción de PCR semi- cuantitativa se puede llevar a cabo empleando varias diluciones seriadas del ADN complementario (obtenido como se describe en ejemplo 1) preparado a partir de las muestras que se van a analizar o empleando una dilución única de este ADN pero llevando a cabo la reacción de PCR durante distinto número de ciclos (por ejemplo: 24, 26, 28, 30, 32 y 34 ciclos) .Another particular embodiment of the invention is the process of the invention based on a semi-quantitative PCR with specific primers of E2F1 and Actin beta as indicated above. In the latter case, the semi-quantitative PCR reaction can be carried out using several serial dilutions of the complementary DNA (obtained as described in example 1) prepared from the samples to be analyzed or using a single dilution of this DNA but carrying out the PCR reaction during different number of cycles (for example: 24, 26, 28, 30, 32 and 34 cycles).
Otra realización particular de la invención lo constituye el procedimiento de la invención basado en la técnica de Northern blot con sondas de polinucleótidos especificas de los cDNAs de los genes E2F1 y ACTINA beta (SEQ ID NOl y 3, ver Ejemplo 2) .Another particular embodiment of the invention is the process of the invention based on the Northern blot technique with specific polynucleotide probes of the cDNAs of the E2F1 and ACTINA beta genes (SEQ ID NO1 and 3, see Example 2).
Otro objeto particular de la invención lo constituye el procedimiento de identificación de un LBE en el que la identificación de E2F1 se lleva a cabo mediante hibridación in situ con un precursor de E2F1.Another particular object of the invention is the identification procedure of an LBE in which the identification of E2F1 is carried out by in situ hybridization with an E2F1 precursor.
La realización de estos análisis de identificación de los niveles de expresión de E2F1 y Actina puede ser llevado a cabo por un experto medio del área de la biomedicina gracias a la información descrita en la presente invención y en el estado de la técnica por distintas técnicas (Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) . Molecular cloning: a laboratory manual, 2nd ed. CoId Spring Harbor Laboratory, CoId Spring Harbor, N. Y.) . Otro objeto particular de la invención lo constituye el procedimiento de identificación de un LBE en el que la identificación de E2F1 de a) se refiere a la forma proteica del gen E2F1 (SEQ ID NO 2) y la identifi- cación de ACTINA beta se refiere a su forma proteica (SEQ ID NO 4) y se lleva a cabo mediante el uso de anticuerpos específicos de la proteina E2F1 en técnicas, por ejemplo, de inmunoblot o Western blot y de inmu- nohistoquimica . Los anticuerpos pueden ser monoclonales o policlonales, fragmentos o derivados de los mismos. En la Figura 6 se presentan los resultados de un inmunoblot frente E2F1 y actina beta donde se observa como los niveles expresión de las proteínas E2F1 y actina beta en muestras de LBE se distinguen perfectamente (elevados y disminuidos niveles de E2F1 y actina beta, respectivamente) cuando se comparan con muestras control. Para llevar a cabo un inmunoblot habria que preparar un extracto total de proteínas a partir de biopsias del tejido tumoral estudiado y de los tejidos control (teji- do sano circundante al tumor o amígdalas o nodulos linfáticos reactivos de otros individuos) . Estas muestras se fraccionan en un gel de acrilamida con SDS, se transfieren a una membrana de nitrocelulosa o de PVDF y se hibridan con anticuerpos anti-E2Fl y anti-actina. Estos anticuerpos pueden estar o no conjugados a fluoro- cromos. En el caso de estar acoplados a estos fluorocro- mos, cada uno de los anticuerpos ha de estar acoplado a un fluorocromo diferente de modo que emitan energía en longitudes de onda no solapantes. En el caso de emplear anticuerpos no conjugados a ningún fluorocromo, será necesario emplear anticuerpos anti-E2Fl y anti-actina generados en distintas especies animales (por ejemplo, anti-E2Fl generado en conejo y anti-actina generado en ratón) . Una vez incubada la membrana con ambos anticuer- pos, se procederá a incubarla con anticuerpos anti- inmunoglobulina de ratón y anti-inmunoglobulina de conejo conjugados a fluorocromos diferentes que emitan energia en longitudes de onda no solapantes. La emisión de energia de cada anticuerpo se mide con un sistema de documentación de imágenes (como por ejemplo el Odyssey de la compañia Lycor) y esta señal es directamente proporcional a la cantidad de proteina presente en la muestra. Se calcula entonces la relación entre la señal de E2F1 y la de actina beta para cada muestra y se compara esta relación entre las muestras tumorales y las de los tejidos control. La relación E2F1/Actina beta en los tejidos tumorales ha de ser, por lo menos, 2 veces superior a la detectada en los tejidos control. El mayor problema de este método y una clara desventaja con respecto a los métodos descritos más arriba basados en la técnica de PCR es obtener suficiente cantidad de extracto de proteínas para llevar a cabo el ensayo. El análisis mediante inmunohistoquimica se realizarla sobre cortes de tejido (ya sea congelado o incluido en parafi- na) procedente de muestras tumorales o de tejidos control (amígdalas o nodulos linfáticos reactivos o tejido sano circundante al tumor) . Se llevará a cabo la tinción con anticuerpos anti-E2Fl y anti-actina generados en distintas especies de animales (como en el caso del inmunoblot) . Estos anticuerpos pueden estar acoplados a fluorocromos que emitan energia a longitudes de onda no solapantes o no estar conjugados y emplear, entonces, anticuerpos secundarios acoplados a este tipo de fluorocromos. La señal emitida por los anticuerpos es directa- mente proporcional a la cantidad de proteina expresada en las células y se medirá con equipos de detección. Se calcula entonces la relación entre la señal de E2F1 y la de actina beta para cada muestra y se compara esta relación entre las muestras tumorales y las de los tejidos control. La relación E2F1/Actina en los tejidos tumorales ha de ser, por lo menos, 2 veces superior a la detectada en los tejidos control.The performance of these analysis of identification of the expression levels of E2F1 and Actin can be carried out by an expert in the area of biomedicine thanks to the information described in the present invention and in the state of the art by different techniques ( Sambrook, J., Fritsch, EF, and Maniatis, T. (1989) Molecular cloning: a laboratory manual, 2nd ed. CoId Spring Harbor Laboratory, CoId Spring Harbor, NY). Another particular object of the invention is the identification procedure of an LBE in which the identification of E2F1 of a) refers to the protein form of the E2F1 gene (SEQ ID NO 2) and the identification of ACTINA beta refers to to its protein form (SEQ ID NO 4) and is carried out by the use of antibodies specific for the E2F1 protein in techniques, for example, immunoblot or Western blot and immunohistochemistry. The antibodies can be monoclonal or polyclonal, fragments or derivatives thereof. The results of an immunoblot against E2F1 and beta actin are shown in Figure 6 where the expression levels of the E2F1 and beta actin proteins in LBE samples are perfectly distinguished (high and low levels of E2F1 and beta actin, respectively) when compared with control samples. To carry out an immunoblot, a total protein extract should be prepared from biopsies of the tumor tissue studied and the control tissues (healthy tissue surrounding the tumor or tonsils or reactive lymph nodes of other individuals). These samples are fractionated on an acrylamide gel with SDS, transferred to a nitrocellulose or PVDF membrane and hybridized with anti-E2Fl and anti-actin antibodies. These antibodies may or may not be conjugated to fluorochromes. In the case of being coupled to these fluorochromes, each of the antibodies must be coupled to a different fluorochrome so that they emit energy in non-overlapping wavelengths. In the case of using antibodies not conjugated to any fluorochrome, it will be necessary to use anti-E2Fl and anti-actin antibodies generated in different animal species (for example, rabbit-generated anti-E2Fl and mouse-generated anti-actin). Once the membrane is incubated with both antibodies, it will be incubated with anti- antibodies mouse immunoglobulin and rabbit anti-immunoglobulin conjugated to different fluorochromes that emit energy in non-overlapping wavelengths. The energy emission of each antibody is measured with an image documentation system (such as the Lycor company Odyssey) and this signal is directly proportional to the amount of protein present in the sample. The relationship between the E2F1 signal and the beta actin signal for each sample is then calculated and this relationship between the tumor samples and those of the control tissues is compared. The E2F1 / Actin beta ratio in tumor tissues must be at least 2 times higher than that detected in control tissues. The biggest problem with this method and a clear disadvantage with respect to the methods described above based on the PCR technique is to obtain sufficient amount of protein extract to carry out the assay. The immunohistochemical analysis will be performed on tissue sections (either frozen or paraffin-containing) from tumor samples or control tissues (tonsils or reactive lymph nodes or healthy tissue surrounding the tumor). Staining will be carried out with anti-E2Fl and anti-actin antibodies generated in different animal species (as in the case of the immunoblot). These antibodies can be coupled to fluorochromes that emit energy at non-overlapping wavelengths or not be conjugated and then employ secondary antibodies coupled to this type of fluorochromes. The signal emitted by the antibodies is directly proportional to the amount of protein expressed in the cells and will be measured with detection equipment. The relationship between the E2F1 signal and the beta actin signal for each sample is then calculated and this relationship between the tumor samples and those of the control tissues is compared. The E2F1 / Actin ratio in tissues Tumors must be at least 2 times higher than that detected in control tissues.
Por otro lado, este procedimiento de diagnóstico de un LBE puede realizarse utilizándose a E2F1 como único marcador o de forma conjunta con otros marcadores de LBE o de otras enfermedades, por ejemplo formando parte de un microarray de expresión biológica, ya sea en forma génica -a partir de RNAm- o en forma de proteina.On the other hand, this diagnostic procedure for an LBE can be performed using E2F1 as a single marker or in conjunction with other markers of LBE or other diseases, for example as part of a biological expression microarray, either in gene form - from mRNA- or protein form.
Otro objeto de la presente invención lo consti- tuye un procedimiento de identificación y evaluación de la actividad de compuestos inhibidores de la proteina E2F1 útiles para el tratamiento del LBE, en adelante procedimiento de identificación de compuestos de la presente invención, que comprende los siguientes pasos: a) Puesta en contacto de un sistema biológico donde exista una expresión de E2F1 que produzca parcial o totalmente un fenotipo LBE con el compuesto candidato objeto de este procedimiento, e incubación en las condiciones adecuadas, b) determinación de un parámetro indicativo de disminución de los niveles de E2F1 o de regresión de un fenotipo LBE, e c) identificación de un compuesto inhibidor de la actividad de la proteina E2F1 cuando se observa una regresión de dicho fenotipo LBE o una disminución de los niveles de E2F1.Another object of the present invention is a method for identifying and evaluating the activity of E2F1 protein inhibitor compounds useful for the treatment of LBE, hereinafter method of identifying compounds of the present invention, comprising the following steps : a) Contacting a biological system where there is an expression of E2F1 that partially or totally produces an LBE phenotype with the candidate compound object of this procedure, and incubation under the appropriate conditions, b) determination of an indicative parameter of decrease in E2F1 or regression levels of an LBE phenotype, ec) identification of a compound that inhibits the activity of the E2F1 protein when a regression of said LBE phenotype or a decrease in E2F1 levels is observed.
Otro objeto de la presente invención lo constituye un procedimiento de identificación de la invención donde el sistema biológico de a) consiste en una linea celular o un animal transgénico donde se encuentre regulada, de forma constante o condicionada, la expresión de la proteina E2F1, y donde su expresión provoca un fenotipo LBE o un incremento de la proteina E2F1.Another object of the present invention is an identification method of the invention where the biological system of a) consists of a cell line or a transgenic animal where the expression of the E2F1 protein is regulated, in a constant or conditioned manner, and where its expression causes an LBE phenotype or an increase in the E2F1 protein.
Otro objeto de la presente invención lo consti- tuye un procedimiento de identificación de la invención donde el parámetro indicativo de regresión de un fenotipo LBE de b) pertenece, a titulo ilustrativo y sin que limite el alcance de la invención, al siguiente grupo: formación de colonias en agar blando o formación de tumores in vivo; y en el caso de la disminución de la expresión de los niveles de E2F1 se lleva a cabo por las técnicas indicadas anteriormente: PCR, Northern blot, inmunoblot, inmunohistoquimica, etc.Another object of the present invention is an identification procedure of the invention. where the indicative regression parameter of an LBE phenotype of b) belongs, by way of illustration and without limiting the scope of the invention, to the following group: formation of colonies in soft agar or tumor formation in vivo; and in the case of decreased expression of E2F1 levels, it is carried out by the techniques indicated above: PCR, Northern blot, immunoblot, immunohistochemistry, etc.
Otro objeto de la presente invención lo consti- tuye el uso de un compuesto o agente inhibidor de la actividad de la proteina E2F1, en adelante uso de un compuesto de la presente invención, en la elaboración de medicamentos o composiciones farmacéuticas para el tratamiento de pacientes humanos con LBE. Tal como se utiliza en la presente invención el término "compuesto/agente inhibidor o antagonista" se refiere a una molécula que cuando se une o interactúa con la proteina E2F1 (por ejemplo, SEQ ID NO2), o con fragmentos funcionales de la misma, disminuye o elimina la intensidad o la duración de la actividad biológica de dicha proteina. En esta definición se incluye además aquellos compuestos que impiden o disminuyen la expresión del gen codificante de la proteina E2F1 (SEQ ID NOl), es decir, que impiden o diminuyen la transcripción del gen, la maduración del RNAm, la traducción del RNAm y la modificación post-traduccional . Un agente inhibidor puede estar constituido por un péptido, una proteina, un ácido nucleico o polinucleótido, un carbohidrato, un anticuerpo, un compuesto quimico o cualquier otro tipo de molécula que disminuya o elimina el efecto y/o la función de la proteina E2F1.Another object of the present invention is the use of a compound or agent that inhibits the activity of the E2F1 protein, hereinafter use of a compound of the present invention, in the preparation of medicaments or pharmaceutical compositions for the treatment of patients. humans with LBE. As used herein, the term "compound / inhibitor or antagonist agent" refers to a molecule that when bound or interacts with the E2F1 protein (eg, SEQ ID NO2), or with functional fragments thereof, decreases or eliminates the intensity or duration of the biological activity of said protein. This definition also includes those compounds that prevent or decrease the expression of the E2F1 protein coding gene (SEQ ID NO1), that is, that prevent or diminish gene transcription, mRNA maturation, mRNA translation and post-translational modification. An inhibitory agent may consist of a peptide, a protein, a nucleic acid or polynucleotide, a carbohydrate, an antibody, a chemical compound or any other type of molecule that diminishes or eliminates the effect and / or function of the E2F1 protein.
A titulo de ejemplo de los inhibidores de E2F1 que se podrian utilizar bajo el alcance de la presente invención, se han descrito péptidos que inhiben la interacción de cualquier miembro de la familia E2F (hay 8 miembros) con el DNA (con las secuencias de promotores que normalmente regulan; Bandara LR, Girling R, La Thangue NB. Apoptosis induced in mammalian cells by small peptides that functionally antagonize the Rb- regulated E2F transcription factor. Nat Biotechnol. 1997 Sep; 15 (9) : 896-901; ver http : //www.patentstorm.us/patents/ 6841385.html) aunque no se describen datos concretos de tratamiento de enfermedades. También existe una patente para el uso de péptidos inhibidores de la actividad E2F (E2F en general, no E2F1 en particular) basados en la capacidad de éstos péptidos para inhibibir la formación de dimeros de E2F (las proteínas E2F tienen que dimerizar para ser funcionales) : http : //www.patentstorm.us/patents /6713449- fulltext .html . También se ha empleado oligos antisentido de E2F1 para el tratamiento de un modelo experimental murino de enfermedad de Parkinson inducible (Hoglinger GU, Breunig JJ, Depboylu C, Rouaux C, Michel PP, Alva- rez-Fischer D, Boutillier AL, Degregori J, Oertel WH, Rakic P, Hirsch EC, Hunot S; The pRb/E2F cell-cycle pathway mediates cell death in Parkinson 's disease; Proc Nati Acad Sci U S A. 2007 Feb 27; 104 ( 9) : 3585-90) .As an example of the E2F1 inhibitors that could be used under the scope of the present invention, peptides that inhibit the interaction of any member of the E2F family have been described (there are 8 members) with DNA (with the sequences of promoters that normally regulate; Bandara LR, Girling R, La Thangue NB. Apoptosis induced in mammalian cells by small peptides that functionally antagonize the Rb-regulated E2F transcription factor. Nat Biotechnol. 1997 Sep ; 15 (9): 896-901; see http: //www.patentstorm.us/patents/ 6841385.html) although no specific disease treatment data are described. There is also a patent for the use of peptides that inhibit E2F activity (E2F in general, not E2F1 in particular) based on the ability of these peptides to inhibit the formation of E2F dimers (E2F proteins have to dimerize to be functional) : http: //www.patentstorm.us/patents / 6713449- fulltext .html. E2F1 antisense oligos have also been used for the treatment of an experimental murine model of inducible Parkinson's disease (Hoglinger GU, Breunig JJ, Depboylu C, Rouaux C, Michel PP, Alvarez-Fischer D, Boutillier AL, Degregori J, Oertel WH, Rakic P, Hirsch EC, Hunot S; The pRb / E2F cell-cycle pathway mediates cell death in Parkinson's disease; Proc Nati Acad Sci US A. 2007 Feb 27; 104 (9): 3585-90).
El empleo de oligos anti-sentido para E2F1 ya está patentado (ver http : //www.patentstorm.us/patents/ 6187587.html y http : //www.patentstorm.us/patents /5759803.html) , pero no para LBE, por lo que podrian utilizarse.The use of anti-sense oligos for E2F1 is already patented (see http: //www.patentstorm.us/patents/ 6187587.html and http: //www.patentstorm.us/patents /5759803.html), but not for LBE, so they could be used.
A modo ilustrativo, dicho polinucleótido puede ser un polinucleótido que codifica una secuencia de nucleótidos antisentido especifica de la secuencia del gen o del mRNA de la proteina E2F1, o bien un polinucleótido que codifica una ribozima, un aptámero, un RNA de interferencia ("small interference RNA" o siRNA o "short hairpin RNA" o shRNA) o un microRNA especifico del mRNA de la proteína E2F1, o bien combinaciones de las mismos .By way of illustration, said polynucleotide can be a polynucleotide encoding a specific antisense nucleotide sequence of the gene or mRNA sequence of the E2F1 protein, or a polynucleotide encoding a ribozyme, an aptamer, an interfering RNA ("small RNA interference "or siRNA or" short hairpin RNA "or shRNA) or a specific microRNA of the mRNA of the E2F1 protein, or combinations thereof.
Estos polinucleótidos mencionados pueden ser utilizados en un proceso de terapia génica en el que mediante cualquier técnica o procedimiento se permita la integración de los mismos en las células de un paciente humano. Este objetivo puede conseguirse mediante la administración a estas células linfoides de una construcción génica que comprende uno de los polinucleótidos mencionados con el fin de transformar dichas células permitiendo su expresión en el interior de las mismas de manera que se inhiba la expresión de la proteína E2F1. Ventajosamente, dicha construcción génica puede estar incluida dentro de un vector, tal como, por ejemplo, un vector de expresión o un vector de transferencia.These polynucleotides mentioned can be used in a gene therapy process in which by any technique or procedure the integration of them into the cells of a human patient is allowed. This objective can be achieved by administering to these lymphoid cells a gene construct comprising one of the aforementioned polynucleotides in order to transform said cells allowing their expression inside them so that the expression of the E2F1 protein is inhibited. Advantageously, said gene construct may be included within a vector, such as, for example, an expression vector or a transfer vector.
Tal como se utiliza en la presente invención el término "vector" se refiere a sistemas utilizados en el proceso de transferencia de un gen exógeno o de una construcción génica exógena al interior de una célula, permitiendo de este modo la vehiculación de genes y construcciones génicas exógenas . Dichos vectores pueden ser vectores no virales o vectores virales (Pfeifer A, Verma IM (2001) Gene therapy: promises and problems . Annu Rev Genomics Hum Genet 2: 177-211) y su administra- ción puede ser preparada por un experto en la materia en función de las necesidades y especificidades de cada caso .As used in the present invention, the term "vector" refers to systems used in the process of transferring an exogenous gene or an exogenous gene construct into a cell, thereby permitting the vehicle and gene constructs. exogenous Such vectors can be non-viral vectors or viral vectors (Pfeifer A, Verma IM (2001) Gene therapy: promises and problems. Annu Rev Genomics Hum Genet 2: 177-211) and their administration can be prepared by an expert in subject according to the needs and specificities of each case.
Por tanto, en otra realización particular de la invención dicho uso de un compuesto de la invención se basa en que el compuesto inhibidor es un ácido nucleico o polinucleótido que impide o disminuye la expresión del gen codificante de la proteína E2F1 humana y que incluye, al menos, una secuencia de nucleótidos seleccionada entre : a) una secuencia de nucleótidos antisentido es- pecifica de la secuencia del gen o del mRNA de la proteína E2F1, b) una ribozima específica del mRNA de la proteína E2F1, c) un aptámero específico del mRNA de la proteína E2F1, d) un RNA de interferencia (iRNA) específico del mRNA de la proteína E2F1, y e) un microRNA específico del mRNA de la proteí- na E2F1.Therefore, in another particular embodiment of the invention said use of a compound of the invention is based on the fact that the inhibitor compound is a nucleic acid or polynucleotide that prevents or decreases the expression of the gene encoding the human E2F1 protein and that includes, at less, a nucleotide sequence selected from: a) an antisense nucleotide sequence is- pecifies from the sequence of the gene or mRNA of the E2F1 protein, b) a ribozyme specific to the mRNA of the E2F1 protein, c) a specific aptamer of the mRNA of the E2F1 protein, d) an interfering RNA (iRNA) specific to the mRNA of the E2F1 protein, and e) a specific microRNA of the E2F1 protein mRNA.
Con anterioridad se han descrito oligonucleóti- dos antisentido anti E2F1 (Hoglinger GU, Breunig JJ, Depboylu C, Rouaux C, Michel PP, Alvarez-Fischer D, Boutillier AL, Degregori J, Oertel WH, Rakic P, Hirsch EC, Hunot S; The pRb/E2F cell-cycle pathway mediates cell death in Parkinson's disease; Proc Nati Acad Sci U S A. 2007 Feb 27; 104(9) : 3585-90. Trinh E, Boutillier AL, Loeffler JP.; Regulation of the retinoblastoma- dependent Mdm2 and E2F-1 signaling pathways during neuronal apoptosis; Mol Cell Neurosci.; 2001 Feb; 17(2) : 342-53. Prost S, Lu P, Caldwell H, Harrison D. E2F regulates DDB2 : consequences for DNA repair in Rb- deficient cells. Oncogene . 2007 May 24; 26(24) : 3572- 81), siRNAs que inhiben su expresión (Rogoff HA, Picke- ring MT, Frame FM, Debatís ME, Sánchez Y, Jones S, Kowalik TF. Apoptosis associated with deregulated E2F activity is dependent on E2F1 and Atm/Nbsl/Chk2. Mol Cell Biol. 2004 Apr; 24(7) : 2968-77. Prost S, Lu P, Caldwell H, Harrison D. E2F regulates DDB2 : consequences for DNA repair in Rb-deficient cells. Oncogene. 2007 May 24; 26(24) : 3572-81) o microRNA (O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT. c-Myc-regulated microRNAs modulate E2F1 expression. Nature 2005; 435(7043) : 839-43) . Por otro lado, estas técnicas de inhibición génica, y más concretamente la vehiculización de los compuestos -oligonucleótidos antisentido, iRNA, ribozimas o aptameros- puede llevarse a cabo mediante el uso de nanoparticulas que incrementan el éxito de dicha transferencia (Lu PV and Woodle MC, Adv Genet 54: 117- 42, 2005; Hawker CJ and Wooley KL, Science 19 (309) : 1200-5, 2005) .Earlier, anti-E2F1 antisense oligonucleotides have been described (Hoglinger GU, Breunig JJ, Depboylu C, Rouaux C, Michel PP, Alvarez-Fischer D, Boutillier AL, Degregori J, Oertel WH, Rakic P, Hirsch EC, Hunot S; The pRb / E2F cell-cycle pathway mediates cell death in Parkinson's disease; Proc Nati Acad Sci US A. 2007 Feb 27; 104 (9): 3585-90. Trinh E, Boutillier AL, Loeffler JP .; Regulation of the retinoblastoma- dependent Mdm2 and E2F-1 signaling pathways during neuronal apoptosis; Mol Cell Neurosci .; 2001 Feb; 17 (2): 342-53. Prost S, Lu P, Caldwell H, Harrison D. E2F regulates DDB2: consequences for DNA repair in Rb-deficient cells, Oncogene, 2007 May 24; 26 (24): 3572-81), siRNAs that inhibit their expression (Rogoff HA, Picke-ring MT, Frame FM, Debatís ME, Sánchez Y, Jones S, Kowalik TF. Apoptosis associated with deregulated E2F activity is dependent on E2F1 and Atm / Nbsl / Chk2. Mol Cell Biol. 2004 Apr; 24 (7): 2968-77. Prost S, Lu P, Caldwell H, Harrison D. E2F regulates DDB2: consequences for DNA repair in Rb-deficient cells. Oncogene 2007 May 24; 26 (24): 3572-81) or microRNA (O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT. C-Myc-regulated microRNAs modulate E2F1 expression. Nature 2005; 435 (7043): 839-43 ). On the other hand, these techniques of gene inhibition, and more specifically the vehiculization of the compounds - antisense oligonucleotides, iRNA, ribozymes or aptamers - can be carried out by using nanoparticles that increase the success of said transfer (Lu PV and Woodle MC, Adv Genet 54: 117-42, 2005; Hawker CJ and Wooley KL, Science 19 (309): 1200-5, 2005).
Asi, una realización particular de la invención lo constituye el uso de un RNAi que se une preferentemente al RNAm de E2F1, o varios RNAi, y que pertenece, a titulo ilustrativo y sin que limite el alcance de la invención, al siguiente grupo: SEQ ID NO5, SEQ ID NO6 y SEQ ID NO7 (ver Ejemplo 3) .Thus, a particular embodiment of the invention is the use of an RNAi that preferentially binds to the E2F1 mRNA, or several RNAi, and which belongs, by way of illustration and without limiting the scope of the invention, to the following group: SEQ ID NO5, SEQ ID NO6 and SEQ ID NO7 (see Example 3).
SEQ ID NO5: AGGATGGATATGAGATGGGA (E2F1-1) SEQ ID NO6: CTGAGGAGTTCATCAGCCTT (E2F1-2) SEQ ID NO7: GTGGACTCTTCGGAGAACTT (E2F1-3)SEQ ID NO5: AGGATGGATATGAGATGGGA (E2F1-1) SEQ ID NO6: CTGAGGAGTTCATCAGCCTT (E2F1-2) SEQ ID NO7: GTGGACTCTTCGGAGAACTT (E2F1-3)
Estos RNAi se unen a distintas regiones del RNA de E2F1) . La primera de estas secuencias corresponde a la región 3' no traducida del ARNm de E2F1 (E2F1-1), mientras que las dos restantes corresponden a distintas zonas de la región codificante (E2F1-2 y 3) .These RNAi bind to different regions of the E2F1 RNA). The first of these sequences corresponds to the 3 'untranslated region of the E2F1 mRNA (E2F1-1), while the remaining two correspond to different areas of the coding region (E2F1-2 and 3).
Las secuencias de nucleótidos a) a -e) mencionadas previamente impiden la expresión del gen en mRNA o del mRNA en la proteina E2F1, y, por tanto, anulan su función biológica, y pueden ser desarrolladas por un experto en el sector de ingeniería genética en función del conocimiento existente en el estado del arte sobre transgénesis y anulación de la expresión génica (Clarke, A. R. (2002) Transgenesis Techniques. Principies and Protocols, 2a Ed. Humana Press, Cardiff University; Patente US20020128220. Gleave, Martin. TRPM-2 antisense therapy; Puerta-Fernández E et al. (2003) Ribozymes: recent advances in the development of RNA tools. FEMS Microbiology Reviews 27: 75-97; Kikuchi, et al., 2003. RNA aptamers targeted to domain II of Hepatitis C virus IRES that bind to its apical loop región. J. Biochem. 133, 263-270; Reynolds A. et al., 2004. Rational siRNA design for RNA interference . Nature Biotechnology 22 (3) : 326-330) .The nucleotide sequences a) to -e) mentioned above prevent the expression of the gene in mRNA or mRNA in the E2F1 protein, and therefore cancel its biological function, and can be developed by an expert in the genetic engineering sector depending on the existing knowledge on the state of the art on transgenesis and cancellation of gene expression (Clarke, AR (2002) transgenesis Techniques Principles and Protocols, 2nd Ed Humana Press, Cardiff University;.... Patent US20020128220 Gleave, Martin TRPM -2 antisense therapy; Puerta-Fernández E et al. (2003) Ribozymes: recent advances in the development of RNA tools. FEMS Microbiology Reviews 27: 75-97; Kikuchi, et al., 2003. RNA aptamers targeted to domain II of Hepatitis C virus IRES that bind to its apical loop region J. Biochem. 133, 263-270; Reynolds A. et al., 2004. Rational siRNA design for RNA interference. Nature Biotechnology 22 (3): 326-330).
Otro objeto de la presente invención lo consti- tuye una composición farmacéutica o un medicamento para el tratamiento del LBE, en adelante composición farma¬ céutica de la presente invención, que comprende una cantidad terapéuticamente efectiva de un compuesto o agente inhibidor de la proteina E2F1, junto con, opcio- nalmente, uno o más adyuvantes y/o vehículos farmacéuti¬ camente aceptables.Another object of the present invention it constitutes a pharmaceutical composition or a medicament for the treatment of LBE, hereinafter composition pharma ¬ céutica of the present invention comprising a therapeutically effective amount of a compound or agent that inhibits protein E2F1, together with, optionally, one or more adjuvants and / or vehicles pharma ¬ cally acceptable.
Una realización particular de la presente invención lo constituye una composición farmacéutica en la que el compuesto inhibidor es un ácido nucleico o poli- nucleótido que impide o disminuye la expresión del gen codificante de la proteina E2F1 humana y que incluye, al menos, una secuencia de nucleótidos seleccionada entre: a) una secuencia de nucleótidos antisentido es¬ pecifica de la secuencia del gen o del mRNA de la pro- teina E2F1, b) una ribozima especifica del mRNA de la pro¬ teina E2F1, c) un aptámero especifico del mRNA de la protei¬ na E2F1, d) un RNA de interferencia (iRNA) especifico del mRNA de la proteina E2F1, y e) un microRNA especifico del mRNA de la protei¬ na E2F1.A particular embodiment of the present invention is a pharmaceutical composition in which the inhibitor compound is a nucleic acid or polynucleotide that prevents or decreases the expression of the gene encoding the human E2F1 protein and that includes at least one sequence of nucleotides selected between: a) an antisense nucleotide sequence is ¬ pecifica of the gene sequence or mRNA of the pro- teina E2F1, b) a ribozyme specific mRNA ¬ teina E2F1, c) a specific aptamer of the mRNA the protei ¬ na E2F1, d) an interference RNA (iRNA) specific to the mRNA of E2F1 protein, and e) a microRNA specific to the mRNA of the protei ¬ na E2F1.
Al igual que lo comentado anteriormente, una realización particular de la invención lo constituye la composición farmacéutica de la invención en la que el inhibidor de E2F1 es un RNAi que se une preferentemente a la secuencia de RNAm de E2F1 y que pertenece, a titulo ilustrativo y sin que limite el alcance de la invención, al siguiente grupo: SEQ ID NO5, SEQ ID NO6 y SEQ ID NO7 (ver Ejemplo 3) .As discussed above, a particular embodiment of the invention is the pharmaceutical composition of the invention in which the E2F1 inhibitor is an RNAi that preferentially binds to the E2F1 mRNA sequence and belongs, by way of illustration and without limiting the scope of the invention, to the following group: SEQ ID NO5, SEQ ID NO6 and SEQ ID NO7 (see Example 3).
Los adyuvantes y vehículos farmacéuticamente aceptables que pueden ser utilizados en dichas composiciones son los adyuvantes y vehículos conocidos por los técnicos en la materia y utilizados habitualmente en la elaboración de composiciones terapéuticas.The pharmaceutically acceptable adjuvants and vehicles that can be used in said compositions are the adjuvants and vehicles known to those skilled in the art and commonly used in the elaboration of therapeutic compositions.
En el sentido utilizado en esta descripción, la expresión "cantidad terapéuticamente efectiva" se refiere a la cantidad del agente o compuesto inhibidor de la actividad de la proteína E2F1, calculada para producir el efecto deseado y, en general, vendrá determinada, entre otras causas, por las características propias de los compuestos, incluyendo la edad, estado del paciente, la severidad de la alteración o trastorno, y de la ruta y frecuencia de administración.In the sense used in this description, the term "therapeutically effective amount" refers to the amount of the agent or compound that inhibits the activity of the E2F1 protein, calculated to produce the desired effect and, in general, will be determined, among other causes. , due to the characteristics of the compounds, including the age, condition of the patient, the severity of the alteration or disorder, and the route and frequency of administration.
En una realización particular, dicha composición terapéutica se prepara en forma de una forma sólida o suspensión acuosa, en un diluyente farmacéuticamente aceptable. La composición terapéutica proporcionada por esta invención puede ser administrada por cualquier vía de administración apropiada, para lo cual dicha composición se formulará en la forma farmacéutica adecuada a la vía de administración elegida. En una realización particular, la administración de la composición terapéutica proporcionada por esta invención se efectúa por vía parenteral, por vía oral, por vía intraperitoneal, subcutánea, etc. Una revisión de las distintas formas farmacéuticas de administración de medicamentos y de los excipientes necesarios para la obtención de las mismas puede encontrarse, por ejemplo, en el "Tratado de Farmacia Galénica", C. Faulí i Trillo, 1993, Luzán 5, S. A. Ediciones, Madrid.In a particular embodiment, said therapeutic composition is prepared in the form of a solid form or aqueous suspension, in a pharmaceutically acceptable diluent. The therapeutic composition provided by this invention may be administered by any appropriate route of administration, for which said composition will be formulated in the pharmaceutical form appropriate to the route of administration chosen. In a particular embodiment, the administration of the therapeutic composition provided by this invention is carried out parenterally, orally, intraperitoneally, subcutaneously, etc. A review of the different pharmaceutical forms of drug administration and of the excipients necessary to obtain them can be found, for example, in the "Galician Pharmacy Treaty", C. Faulí i Trillo, 1993, Luzán 5, SA Ediciones , Madrid.
Otro objeto de la presente invención lo constituye el uso de la composición farmacéutica de la inven- ción en un método de tratamiento de un mamífero, prefe- rentemente un ser humano, afectado por LBE, en adelante uso de la composición farmacéutica de la presente invención, consistente en la administración de dicha composición terapéutica que inhibe el proceso patológico del LBE.Another object of the present invention is the use of the pharmaceutical composition of the invention in a method of treating a mammal, preferably Recently, a human being, affected by LBE, hereinafter used the pharmaceutical composition of the present invention, consisting of the administration of said therapeutic composition that inhibits the pathological process of the LBE.
DESCRIPCIÓN DE LOS DIBUJOSDESCRIPTION OF THE DRAWINGS
Se complementa la presente memoria descriptiva, con un juego de planos, ilustrativos del ejemplo prefe- rente y nunca limitativos de la invención.The present specification is complemented, with a set of drawings, illustrative of the preferred example and never limiting of the invention.
Figura 1.- Recta patrón de los valores de Ct de E2F1, cuya ecuación correspondiente es: y = -0.2805x + 7.5516, con un valor de R =0,994. Figura 2.- La expresión de E2F1 es mayor en lineas celulares de BL que en LCL. En el panel A se mues¬ tra el análisis mediante Northern blot de la expresión de RNA mensajero de E2F1, E2F2, E2F3, y ACTINA en las lineas celulares de BL y LCL indicadas. En el panel B se muestra el análisis de la expresión de E2F1 mediante PCR cuantitativa en las lineas celulares de BL y LCL indicadas, representado como la media de tres experimentos independientes ± DE . Se muestra la expresión relativa a la encontrada en la linea celular LCL IB4. En el panel C se muestra un análisis representativo de la expresión de proteina E2F1 y tubulina mediante inmunoblot en las lineas celulares de BL y LCL indicadas. La señal de E2F1 se normalizó respecto a la de tubulina en cada muestra, y se usó como referencia el valor de la linea celular LCL Dana. Los números bajo el panel de tubulina indican la expresión de E2F1 en cada linea celular relativa a la de Dana para este experimento. El panel D muestra la media ± DE de la expresión de E2F1 relativa a la encontrada en la linea Dana en cuatro experimentos indepen- dientes. En el panel E se muestran las curvas de creci- miento de la línea de BL DG75 y de la línea LCL JY. El panel F muestra un experimento representativo de incorporación de BrdU en células DG75 y JY marcadas con ioduro de propidio. En el panel G se muestran los perfi- les de ciclo celular representativos de células DG75 yFigure 1.- Straight pattern of the Ct values of E2F1, whose corresponding equation is: y = -0.2805x + 7.5516, with a value of R = 0.994. Figure 2.- The expression of E2F1 is greater in BL cell lines than in LCL. In panel ¬ tra Mues the Northern blot analysis of the expression of messenger RNA E2F1, E2F2, E2F3, and ACTIN in cell lines BL and LCL indicated. Panel B shows the analysis of E2F1 expression by quantitative PCR in the indicated BL and LCL cell lines, represented as the average of three independent experiments ± SD. The expression relative to that found in the LCL IB4 cell line is shown. A representative analysis of the expression of E2F1 protein and tubulin by immunoblot in the indicated BL and LCL cell lines is shown in panel C. The E2F1 signal was normalized with respect to that of tubulin in each sample, and the value of the Dana LCL cell line was used as a reference. The numbers under the tubulin panel indicate the expression of E2F1 in each cell line relative to that of Dana for this experiment. Panel D shows the mean ± SD of the E2F1 expression relative to that found in the Dana line in four independent experiments. The growth curves are shown in panel E The BL DG75 line and the LCL JY line. Panel F shows a representative experiment of BrdU incorporation into DG75 and JY cells labeled with propidium iodide. Panel G shows cell cycle profiles representative of DG75 cells and
JY.JY
Figura 3.- La expresión de E2F1 está descontrolada en LBE. En el panel A se muestra el ratio de los niveles de expresión relativa de E2F1 en amígdalas (Tl y T2) y nodulos linfáticos (LNl a LN3) reactivos, usados como tejidos control en relación a la muestra LN3. Los paneles B y C muestran el ratio de los niveles de expresión relativa de E2F1 en diferentes muestras de LB esporádico (LBEl a LBE30) (panel B) y otros linfomas de células B (panel C) relativos a la muestra T2. El panelFigure 3.- The expression of E2F1 is uncontrolled in LBE. Panel A shows the ratio of the relative expression levels of E2F1 in tonsils (Tl and T2) and lymph nodes (LN1 to LN3), used as control tissues in relation to the LN3 sample. Panels B and C show the ratio of the relative expression levels of E2F1 in different sporadic LB samples (LBEl to LBE30) (panel B) and other B-cell lymphomas (panel C) relative to the T2 sample. The panel
D muestra la apariencia morfológica clásica de un LBED shows the classic morphological appearance of a LBE
(BL3) , de un DLBCL (DLBCL4) y de una amígdala control(BL3), a DLBCL (DLBCL4) and a control tonsil
(T2) mediante tinción con hematoxilina-eosina y la tinción de E2F1 de las mismas muestras. Se muestra también la escala.(T2) by staining with hematoxylin-eosin and staining E2F1 of the same samples. The scale is also shown.
Figura 4.- E2F1 es necesario para la formación de tumores de BL. (A) Se determinó la capacidad de crecimiento en agar blando de las células DG75 y JY. En las filas superior e inferior se muestran fotografías de los pocilios y microfotografías de las colonias de los pocilios, respectivamente. (B) Las flechas indican la presencia del tumor formado por células DG75 y la ausencia de formación de tumor por células JY en un ratón SCID representativo. (C) Se realizó inmunoblot con extractos celulares de células DG75 transducidas con lentivirus portadores de los shRNAs indicados con anticuerpos frente a las proteínas indicadas. (D) A partir de cuatro experimentos independientes se calculó el porcentaje de expresión de E2F1 en células DG75 infecta- das con los lentivirus indicados relativo a las células DG75 infectadas con el lentivirus vacío (None) y se muestra como la media +OE . (E) Se analizó la capacidad de crecimiento en agar blando de células DG75 infectadas con los lentivirus indicados y muestran fotografías de los pocilios que contienen estas células. (F) Se muestra una cuantificación de cuatro experimentos independientes similares al mostrado en el panel E relativa a las células infectadas con el vector vacío (None) . (G) Se analizó la capacidad de células DG75 infectadas con los lentivirus indicados para formar tumores subcutáneos en ratones SCID. En el primer panel se muestra un ratón representativo que desarrolló tumores por las células DG75 infectadas con el lentivirus vacío (None) o el portador del shRNA control. En el 2_panel se muestra la masa tumoral extirpada formada por las células portadoras del shRNA control, mientras que en el tercer panel se muestra una tinción con hematoxilina y eosina de este tumor y en el 4_ y 5_ panel se muestran tinciones de E2F1 y Ki67, respectivamente, de este tumor. (H) Se muestra el número de tumores grandes (>100 mg) y pequeños (<100 mg) formados por las células DG75 transducidas con los lentivirus codificantes de los shRNAs indicados.Figure 4.- E2F1 is necessary for the formation of BL tumors. (A) The soft agar growth capacity of DG75 and JY cells was determined. In the upper and lower rows, photographs of the wells and microphotographs of the well colonies are shown, respectively. (B) The arrows indicate the presence of the tumor formed by DG75 cells and the absence of tumor formation by JY cells in a representative SCID mouse. (C) Immunoblotting was performed with cellular extracts of DG75 cells transduced with lentiviruses bearing the shRNAs indicated with antibodies against the indicated proteins. (D) From four independent experiments, the percentage of E2F1 expression in DG75 cells infected with the indicated lentiviruses relative to the cells was calculated DG75 infected with the empty lentivirus (None) and shown as the average + OE. (E) The soft agar growth capacity of DG75 cells infected with the indicated lentiviruses was analyzed and show photographs of the wells containing these cells. (F) A quantification of four independent experiments similar to that shown in panel E relative to cells infected with the empty vector (None) is shown. (G) The ability of DG75 cells infected with the indicated lentiviruses to form subcutaneous tumors in SCID mice was analyzed. The first panel shows a representative mouse that developed tumors by DG75 cells infected with the empty lentivirus (None) or the carrier of the shRNA control. In the 2_panel the excised tumor mass formed by the carrier cells of the shRNA control is shown, while in the third panel a staining with hematoxylin and eosin of this tumor is shown and in the 4_ and 5_ panel stains of E2F1 and Ki67 are shown, respectively, of this tumor. (H) The number of large (> 100 mg) and small (<100 mg) tumors formed by DG75 cells transduced with the lentiviruses encoding the indicated shRNAs is shown.
Figura 5.- El panel A muestra las curvas de crecimiento de células DG75 transducidas con lentivirus portadores de los shRNAs indicados. En el panel B, se muestra la incorporación de BrdU de estas mismas células, relativa a la de las células infectadas con el lentivirus vacío (None) , como la media ±OE de tres experimentos independientes. Los perfiles de ciclo celular representativos de estas mismas células y de células no transducidas se muestran en el panel C. El porcentaje de cada una de estas células en G0/G1, S, y G2/M se indica en el panel D como la media ± DE de tres experimentos independientes. Figura 6.- La relación de proteina E2Fl/Actina- beta es muy superior en LBS que en tejidos control. Se muestra un análisis representativo de la expresión de proteina E2F1, tubulina y actina beta mediante inmuno- blot en tres muestras de LBS (BLl a BL3) , una muestra de amígdala reactiva (Tl) y dos muestras de nodulo linfático reactivo (LNl, LN2) . La señal de E2F1 se normalizó respecto a la de actina beta en cada muestra, y se usó como referencia el valor de la muestra LNl . Los números bajo el panel de Actina indican la expresión de E2F1 en cada muestra relativa a la de LNl para este experimento.Figure 5.- Panel A shows the growth curves of DG75 cells transduced with lentiviruses carrying the indicated shRNAs. In panel B, BrdU incorporation of these same cells is shown, relative to that of cells infected with the empty lentivirus (None), as the mean ± OE of three independent experiments. Representative cell cycle profiles of these same cells and non-transduced cells are shown in panel C. The percentage of each of these cells in G0 / G1, S, and G2 / M is indicated in panel D as the mean. ± SD of three independent experiments. Figure 6.- The ratio of protein E2Fl / Actin- beta is much higher in LBS than in control tissues. A representative analysis of the expression of protein E2F1, tubulin and beta actin is shown by immunoblot in three samples of LBS (BLl to BL3), a sample of reactive tonsil (Tl) and two samples of reactive lymph node (LNl, LN2 ). The E2F1 signal was normalized with respect to that of beta actin in each sample, and the value of the LN1 sample was used as a reference. The numbers under the Actin panel indicate the expression of E2F1 in each sample relative to that of LNl for this experiment.
Figura 7.- La expresión elevada de EF21 es necesaria para mantener la capacidad de formación de tumores de las células BL2. Se determinó la capacidad de células BL2 infectadas con los lentivirus indicados para formar tumores subcutáneos en ratones SCID. 2e6 células fueron inoculadas subcutáneamente en hembras de 8 semanas de edad de ratones SCID. Se muestra el peso de los tumores extraídos al cabo de tres semanas.Figure 7.- High expression of EF21 is necessary to maintain the tumor-forming capacity of BL2 cells. The ability of BL2 cells infected with the indicated lentiviruses to form subcutaneous tumors in SCID mice was determined. 2e 6 cells were inoculated subcutaneously in 8-week-old females of SCID mice. The weight of the tumors removed after three weeks is shown.
Figura 8.- Curva de crecimiento de células DG75 transducidas con lentivirus portadores de los shRNA indicados. 1Oe5 células DG75 infectadas con los lentivirus indicados fueron cultivadas en placas de 96 pocilios por triplicado. El crecimiento celular fue medido mediante recuento celular 24, 48, 72 y 96 horas después de la siembra. La tinción con azul tripán confirmó que más del 95% de las células eran viables.Figure 8.- Growth curve of DG75 cells transduced with lentiviruses bearing the indicated shRNAs. 1Oe 5 DG75 cells infected with the indicated lentiviruses were cultured in 96-well plates in triplicate. Cell growth was measured by cell count 24, 48, 72 and 96 hours after seeding. Staining with trypan blue confirmed that more than 95% of the cells were viable.
Figura 9.- Medida de la capacidad de proliferación de distintas lineas celulares transducidas con lentivirus portadores de los shRNA indicados. 50.000 células de las lineas celulares DG75, Imr-90 y MCF-7 fueron cultivadas en placas de 96 pocilios por triplica- do en presencia de lOμCi de timidita tritiada durante 20 horas. La incorporación de timidita fue medida en un minimo de tres experimentos. Se representa la incorporación de timidina relativa a las células infectadas con el lentivirus no portador de shRNA (none) calculada para el promedio de un minimo de tres experimentos.Figure 9.- Measurement of the proliferation capacity of different cell lines transduced with lentiviruses carrying the indicated shRNAs. 50,000 cells of the DG75, Imr-90 and MCF-7 cell lines were cultured in triplicate 96-well plates in the presence of tritiated thymidite 10 µCi for 20 hours. Thymidite incorporation was measured in a minimum of three experiments. The incorporation of thymidine relative to cells infected with the non-shRNA-bearing lentivirus (none) calculated for the average of a minimum of three experiments is represented.
Figura 10.- Expresión relativa de los niveles de la proteina E2F1 en las lineas celulares de linfoma de Burkitt (LB) , linfocitos B inmortalizados (LCL) y linfo- ma difuso de células B grandes indicadas. El nivel de expresión de E2F1 se determinó mediante inmunoblot cuantitativo empleando como referencia actina-beta. Los datos muestran relativos al nivel de expresión en la linea celular JY.Figure 10.- Relative expression of the levels of the E2F1 protein in the cell lines of Burkitt lymphoma (LB), immortalized B lymphocytes (LCL) and diffuse lymphoma of large B cells indicated. The expression level of E2F1 was determined by quantitative immunoblot using actin-beta as reference. The data shows relative to the level of expression in the JY cell line.
REALIZACIÓN PREFERENTE DE LA INVENCIÓNPREFERRED EMBODIMENT OF THE INVENTION
Ejemplo 1.- El análisis de la expresión del gen E2F1 y actina mediante PCR cuantitativo permite la identificación de células y pacientes con linfoma de BurkittExample 1.- The analysis of the expression of the E2F1 gene and actin by quantitative PCR allows the identification of cells and patients with Burkitt lymphoma
De entre los distintos métodos posibles se muestra un ejemplo de análisis mediante PCR cuantitativa. Se ha analizado la expresión relativa del gen E2F1 mediante PCR cuantitativa en varias biopsias de amígdalas (Tl y T2) y nodulos linfáticos reactivos (LNl y LN2) -todos ellos como controles de referencia-, linfoma de Burkitt esporádico (LBE1-LBE6) , y otros tipos de linfomas (lin- fornas foliculares, LFl y LF2; linfoma de células de manto, LCMl y LCM2 ; y, linfoma de la zona marginal del bazo, SMZLl y SMZL2, ver Tabla 3) . Se obtuvieron ARN mensajero o total de todas estas muestras de pacientes o de tejidos asi como de un cultivo de células de la linea celular DG75 y se generaron el ADN complementario (ADNc) a partir de este ARNm. Posteriormente, se ha llevado a cabo la PCR cuantitativa empleando diluciones seriadas de la muestra de ADNc (1:4, 1:8, 1:16 y 1:32) de las células DG75, diluciones seriadas de plásmidos portadores del ADNc de la ACTINA beta y de E2F1 humanos (0.1 ng, 1 ng, 10 ng y 100 ng) y las muestras de ADNc de los distintos tejidos indicados anteriormente sin diluir. Todas las reacciones de PCR cuantitativa se llevaron a cabo por triplicado empleando cebadores u óligos y sondas marcadas con 6-FAM especificas para E2F1 o para ACTINA beta humanas obtenidas de Applied Biosystems (SEQ ID NO8-11) .Among the different possible methods is an example of quantitative PCR analysis. The relative expression of the E2F1 gene has been analyzed by quantitative PCR in several biopsies of tonsils (Tl and T2) and reactive lymph nodes (LNl and LN2) - all of them as reference controls -, sporadic Burkitt lymphoma (LBE1-LBE6), and other types of lymphomas (follicular lymphomas, LFl and LF2; mantle cell lymphoma, LCMl and LCM2; and, marginal spleen lymphoma, SMZLl and SMZL2, see Table 3). Messenger or total RNA was obtained from all these patient or tissue samples as well as from a cell culture of the DG75 cell line and the complementary DNA (cDNA) was generated from this mRNA. Subsequently, it has led to Perform quantitative PCR using serial dilutions of the cDNA sample (1: 4, 1: 8, 1:16 and 1:32) of DG75 cells, serial dilutions of plasmids carrying the cDNA of human ACTINA beta and E2F1 ( 0.1 ng, 1 ng, 10 ng and 100 ng) and cDNA samples from the various tissues indicated above undiluted. All quantitative PCR reactions were carried out in triplicate using primers or oligo and probes labeled with 6-FAM specific for E2F1 or for human beta ACTINA obtained from Applied Biosystems (SEQ ID NO8-11).
El Kit de PCR cuantitativa de Applied para ACTINA beta es el "beta Actin TaqMan Gene Expression Assay (4331182)", Ref. Hs99999903_ml (SEQ ID NOlO-Il), cuya secuencia del amplicón de este kit es de 171 pares de bases:The Applied quantitative PCR Kit for ACTINA beta is the "beta Actin TaqMan Gene Expression Assay (4331182)", Ref. Hs99999903_ml (SEQ ID NOlO-Il), whose amplicon sequence of this kit is 171 base pairs:
GCGCCCTATAAAACCCAGCGGCGCGACGCGCCACCACCGCCGAGACCGCGTCCGCC CCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGTCCACACCCGCCGCCA GCTCACCATGGATGAATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGC A. El primer forward (5') forma parte del DNA genómico de la ACTINA beta, pero se encuentra fuera de la región transcrita indicada en NCBI .GCGCCCTATAAAACCCAGCGGCGCGACGCGCCACCACCGCCGAGACCGCGTCCGCC CCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGTCCACACCCGCCGCCA GCTCACCATGGATGAATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGC A. The first forward (5 ') is part of the genomic DNA of the beta actin, but is outside the transcribed region indicated in NCBI.
El Kit de PCR cuantitativa de Applied para E2F1 es el TaqMan Gene Expression Assay (4331182), Ref. Hs00153451_ml, cuya secuencia del amplicón es de 84 pares de bases:The Applied Quantitative PCR Kit for E2F1 is the TaqMan Gene Expression Assay (4331182), Ref. Hs00153451_ml, whose amplicon sequence is 84 base pairs:
AGCTCATTGCCAAGAAGTCCAAGAACCACATCCAGTGGCTGGGCAGCCACACCACA GTGGGCGTCGGCGGACGGCTTGAGGGGT .AGCTCATTGCCAAGAAGTCCAAGAACCACATCCAGTGGCTGGGCAGCCACACCACA GTGGGCGTCGGCGGACGGCTTGAGGGGT.
Estas sondas llevan unido un inhibidor de la emisión de fluorescencia del fluorocromo 6-FAM de modo que mientras la sonda mantiene su integridad no emite fluorescencia. Sin embargo, a medida que aumenta la cantidad de producto amplificado aumenta (en relación directa) la cantidad de sonda degradada y el fluorocromo 6-FAM se libera de la inhibición de emisión de su fluo- rescencia por el inhibidor mencionado. Por lo tanto, la emisión de fluorescencia en la reacción de PCR es directamente proporcional a la cantidad de producto especifico amplificado. En lugar de este sistema de cebadores específicos y sonda proporcionados por Applied Biosys- tems, también sirve cualquier otro sistema que permita determinar la cantidad de producto amplificado en cada ciclo de la reacción de PCR. Se comprobó que la eficiencia de los cebadores específicos para E2F1 y para ACTINA beta era equivalente. Posteriormente, se construyeron curvas estándar empleando para ello diluciones seriadas de ADN complementario generado a partir de ARN total extraído de la linea celular de linfoma de Burkitt DG75 (o de cualquier otra linea celular que se encuentre proliferando) y/o diluciones seriadas a partir de muestras de concentración conocida de plásmidos que contengan el ADN complementario correspondiente o al ARN mensajero de ACTINA beta o al ARN mensajero de E2F1. También se llevó a cabo una reacción de amplificación con cada uno de los conjuntos de cebadores y sonda en ausencia de molde como control negativo. Todas las reacciones se llevaron a cabo por triplicado como mínimo empleando una máquina de PCR en tiempo real.These probes have a 6-FAM fluorochrome fluorescence emission inhibitor attached so that while the probe maintains its integrity it does not emit fluorescence. However, as the amount of amplified product increases (in direct relation) the amount of degraded probe increases and the 6-FAM fluorochrome is released from the emission inhibition of its fluoro- resistance by the mentioned inhibitor. Therefore, the fluorescence emission in the PCR reaction is directly proportional to the amount of amplified specific product. Instead of this system of specific primers and probe provided by Applied Biosystems, any other system that allows to determine the amount of amplified product in each cycle of the PCR reaction is also useful. The efficiency of the primers specific for E2F1 and for ACTINA beta was found to be equivalent. Subsequently, standard curves were constructed using serial dilutions of complementary DNA generated from total RNA extracted from the Burkitt DG75 lymphoma cell line (or from any other cell line that is proliferating) and / or serial dilutions from samples of known concentration of plasmids containing the corresponding complementary DNA or the ACTINA beta messenger RNA or the E2F1 messenger RNA. An amplification reaction was also carried out with each of the primer and probe sets in the absence of a template as a negative control. All reactions were carried out in triplicate at least using a real-time PCR machine.
Los datos de fluorescencia obtenidos durante la amplificación se muestran en una gráfica logarítmica que permite conocer el número de ciclo en el que empieza a detectarse el producto amplificado (Ct) . En este punto, es importante especificar el umbral en el que se debe interpretar los datos porque por debajo del valor umbral puede haber un ruido de fondo que interfiere en los valores de Ct y dificulta la interpretación. Este umbral puede ser elegido automáticamente por el sistema o manualmente por el usuario para cada experimento, y es fácilmente ejecutable por un técnico experto en la materia. Para cada muestra se calcula la media del valor Ct de cada triplicado. Asi, se analizaron los valores de Ct para la ACTINA beta y E2F1 obtenidos en las curvas estándar para comprobar la existencia de una relación lineal entre estos valores y las correspondientes diluciones de plásmido y de ADN complementario obtenido de las células DG75. Para cada muestra se resta el valor medio de Ct de E2F1 en función del valor medio de Ct de la ACTINA beta para obtener el valor Ct compensado. Se obtiene una recta patrón representando la cantidad de plásmido añadido en escala logaritmica frente al valor medio de Ct correspondiente en escala lineal. Se obtiene la ecuación correspondiente a la recta obtenida. A partir de esta ecuación se obtiene el valor correspon- diente al logaritmo en base 10 de la cantidad de plásmido a la que equivale la cantidad de ARNm presente en cada muestra. Para considerar que una muestra de tumor expresa niveles de E2F1 elevados, se consideró solamente valores superiores al equivalente de 2,5 ng de plásmido. La fórmula obtenida será del tipo: y = (a x Ct compensado) + kThe fluorescence data obtained during the amplification are shown in a logarithmic graph that allows to know the cycle number in which the amplified product (Ct) begins to be detected. At this point, it is important to specify the threshold at which the data should be interpreted because below the threshold value there may be background noise that interferes with Ct values and makes interpretation difficult. This threshold can be chosen automatically by the system or manually by the user for each experiment, and is easily executable by a technician skilled in the art. For each sample, the average of the Ct value of each triplicate is calculated. Thus, the Ct values for ACTINA beta and E2F1 obtained in the standard curves were analyzed to verify the existence of a linear relationship between these values and the corresponding plasmid and complementary DNA dilutions obtained from DG75 cells. For each sample, the average Ct value of E2F1 is subtracted based on the average Ct value of the ACTIN beta to obtain the compensated Ct value. A standard line is obtained representing the amount of plasmid added in logarithmic scale versus the corresponding average Ct value in linear scale. The equation corresponding to the line obtained is obtained. From this equation, the value corresponding to the logarithm in base 10 of the amount of plasmid is equivalent to the amount of mRNA present in each sample. To consider that a tumor sample expresses high levels of E2F1, only values greater than the equivalent of 2.5 ng of plasmid were considered. The formula obtained will be of the type: y = (ax Ct compensated) + k
Donde "y" es el logaritmo en base 10 de la cantidad de ADN presente en la muestra y "a" y "k" son la pendiente y la constante, respectivamente, de la recta patrón. Para calcular la cantidad de ADN presente en cada muestra sólo se tiene que emplear la siguiente fórmula : y Cantidad de ADN = 10Where "y" is the base 10 logarithm of the amount of DNA present in the sample and "a" and "k" are the slope and constant, respectively, of the standard line. To calculate the amount of DNA present in each sample, just use the following formula: and Amount of DNA = 10
De esta forma, se calcularon los valores medios de Ct de cada triplicado obtenidos para las diluciones de plásmido fueron los siguientes (Tabla 1) :Thus, the average Ct values of each triplicate obtained for the plasmid dilutions were calculated as follows (Table 1):
Figure imgf000033_0001
Figure imgf000034_0001
Figure imgf000033_0001
Figure imgf000034_0001
Con los valores de Ct de E2F1 se elaboró una recta patrón (ver Figura 1), cuya ecuación correspondiente es: y = -0.2805x + 7.5516With the Ct values of E2F1, a standard line was made (see Figure 1), whose corresponding equation is: y = -0.2805x + 7.5516
2 con un valor de R =0, 9942 with a value of R = 0.994
Los valores medios de Ct de cada triplicado obtenidos para las diluciones de ADNc de las células DG75 fueron los siguientes (Tabla 2) :The average Ct values of each triplicate obtained for the cDNA dilutions of DG75 cells were as follows (Table 2):
Figure imgf000034_0002
Figure imgf000034_0002
Aqui se indican los valores medios de Ct de cada triplicado obtenidos para las muestras de los distintos tejidos, Ct E2F1 y Ct Actina (Tabla 3) :Here are the average Ct values of each triplicate obtained for the samples of the different tissues, Ct E2F1 and Ct Actin (Table 3):
Figure imgf000034_0003
Figure imgf000034_0003
Figure imgf000035_0001
Figure imgf000035_0001
Al compensar el valor de Ct de E2F1 para los valores de Ct de Actina beta tomando como referencia, en este caso particular, el de la muestra BLl se obtuvieron los valores de Ct de E2F1 compensado (Ct comp) indicados en la Tabla 3:By compensating the Ct value of E2F1 for the Ct values of Actin beta taking as a reference, in this particular case, that of the BLl sample, the Ct values of compensated E2F1 (Ct comp) indicated in Table 3 were obtained:
Al sustituir el valor de Ct comp por la "x" en la fórmula obtenida a partir de la curva patrón (y = -By substituting the value of Ct comp for the "x" in the formula obtained from the standard curve (y = -
0.2805x + 7.5516) se obtuvieron los siguientes valores de "y" que corresponden al logaritmo en base 10 de la cantidad de ADN presente en la muestra equivalente a la cantidad de ADN de plásmido que se obtiene al efectuar y el siguiente cálculo: Cantidad de ADN = 10 (ver Tabla 3, columna "Cantidad ADN") . El valor de la "Cantidad de ADN" obtenido es directamente proporcional a la cantidad de ARN mensajero de E2F1 presente en cada muestra (Tabla 3, columna Y) .0.2805x + 7.5516) the following "y" values corresponding to the base 10 logarithm of the amount of DNA present in the sample equivalent to the amount of plasmid DNA that is obtained when performing and the following calculation were obtained: Amount of DNA = 10 (see Table 3, column "DNA Quantity"). The value of the "Amount of DNA" obtained is directly proportional to the amount of E2F1 messenger RNA present in each sample (Table 3, column Y).
Se observa que los valores de "y" obtenidos para los tejidos control (Tl, T2 y LNl a LN3) oscilan entre el equivalente de 0,26 ng y 1,15 ng de plásmido, mientras que los valores de "y" correspondientes a las muestras de linfoma folicular, linfoma de células del manto o linfoma de la zona marginal del bazo oscilan entre el equivalente de 0,47 y 1,30 ng de plásmido. En cambio, los valores de "y" obtenidos para las muestras de linfoma de Burkitt esporádico superan en todos los casos el equivalente a 3 ng de plásmido. Posteriormente, este estudio se amplió a un total de 30 muestras de linfoma de Burkitt esporádico, 5 casos de linfoma folicular, 6 casos de linfoma de células del manto y 4 casos de linfoma de la zona marginal del bazo (ver Ejemplo 3) . En todos los casos analizados de linfoma de Burkitt se obtuvieron siempre valores superiores al equivalente de 3 ng de plásmido, siendo 3,27 ng y 25,93 ng los valores más bajo y más alto, respectivamente. En ninguno de las muestras de los otros tipos de linfoma mencionado se superó el valor equiva- lente a 1,8 ng de plásmido.It is observed that the values of "and" obtained for the control tissues (Tl, T2 and LNl to LN3) range between the equivalent of 0.26 ng and 1.15 ng of plasmid, while the values of "y" corresponding to samples of follicular lymphoma, mantle cell lymphoma or lymphoma of the marginal area of the spleen ranges between the equivalent of 0.47 and 1.30 ng of plasmid. In contrast, the "y" values obtained for sporadic Burkitt lymphoma samples exceed in all cases the equivalent of 3 ng of plasmid. Subsequently, this study was extended to a total of 30 samples of sporadic Burkitt lymphoma, 5 cases of follicular lymphoma, 6 cases of mantle cell lymphoma and 4 cases of lymphoma in the marginal area of the spleen (see Example 3). In all cases analyzed for Burkitt lymphoma, values higher than the equivalent of 3 ng of plasmid were always obtained, with 3.27 ng and 25.93 ng being the lowest and highest values, respectively. In none of the samples of the other types of lymphoma mentioned was the value equivalent to 1.8 ng of plasmid exceeded.
Es interesante destacar que una de las muestras analizadas que estaba clasificada inicialmente en el BT del CNIO con el diagnóstico de linfoma de Burkitt esporádico proporcionó un valor de ADN equivalente a 0,38 ng de plásmido. Esto llevó a investigar en más profundidad esta muestra y se encontró que era positiva para protei- nas del virus de Epstein-Barr y que procedía de un paciente que habla recibido un transplante, por lo que el diagnóstico correcto era de linfoma de Burkitt aso- ciado a inmunodeficiencia y no de LBE.It is interesting to note that one of the analyzed samples that was initially classified in the BT of the CNIO with the diagnosis of sporadic Burkitt lymphoma provided a DNA value equivalent to 0.38 ng of plasmid. This led to further investigation of this sample and it was found that it was positive for Epstein-Barr virus proteins and that it came from a patient who had received a transplant, so the correct diagnosis was Burkitt lymphoma. immunodeficiency and not LBE.
En función de estos datos y metodología particular, se puede considerar suficiente margen de seguridad, establecer el valor del equivalente a 2,5 ng de plásmido como el valor mínimo para que el diagnóstico de una muestra sea compatible con el de linfoma de Burkitt esporádico .Based on these data and particular methodology, sufficient safety margin can be considered, establishing the value of the equivalent of 2.5 ng of plasmid as the minimum value so that the diagnosis of a sample is compatible with that of Burkitt lymphoma sporadic
Es necesario indicar que cuando se utilizaron niveles de expresión de genes distintos de la Actina beta, concretamente los genes GAPDH, GUSB o el corres- pondiente al ARN ribosómico de la subunidad 18S para ajustar los valores obtenidos de E2F1, los resultados asi obtenidos no permitían establecer ningún tipo de correlación con el diagnóstico de LBE y, por lo tanto, no eran capaces de discriminar de la forma conseguida con Actina beta, es decir, un 100% de sensibilidad y especificidad para el diagnóstico de LBE.It is necessary to indicate that when expression levels of genes other than Actin beta were used, specifically the GAPDH, GUSB genes or corresponding to the ribosomal RNA of the 18S subunit to adjust the values obtained from E2F1, the results thus obtained did not allow to establish any type of correlation with the diagnosis of LBE and, therefore, they were not able to discriminate in the way achieved with Actin beta, that is, 100% sensitivity and specificity for the diagnosis of LBE.
Ejemplo 2.- El análisis de la expresión de E2F1 mediante Northern e inmunohistoquimica facilita la identificación de células y pacientes con linfomas 2.1.- La expresión de E2F1 es mayor en lineas celulares de BL que en LCLExample 2.- The analysis of the expression of E2F1 by Northern and immunohistochemistry facilitates the identification of cells and patients with lymphomas 2.1.- The expression of E2F1 is greater in BL cell lines than in LCL
Dado que los miembros activadores de la familia de factores de transcripción E2F (E2F1-E2F3) podrian estar implicados en la formación de tumores (Dimova DK, Dyson NJ. The E2F transcriptional network: oíd acquaint- ances with new faces. Oncogene 2005; 24(17) : 2810-26), estos factores son candidatos potenciales para cooperar con c-myc en la formación de linfomas. Para comprobar esta hipótesis, se comparó la expresión de los genes E2F potencialmente oncogénicos entre lineas celulares de BLSince the activating members of the E2F family of transcription factors (E2F1-E2F3) could be involved in tumor formation (Dimova DK, Dyson NJ. The E2F transcriptional network: oid acquaint- ances with new faces. Oncogene 2005; 24 (17): 2810-26), these factors are potential candidates to cooperate with c-myc in lymphoma formation. To test this hypothesis, the expression of potentially oncogenic E2F genes between BL cell lines was compared.
(células B transformadas) y lineas LCL (inmortalizadas por el virus de Epstein-Barr) . El análisis mediante(transformed B cells) and LCL lines (immortalized by the Epstein-Barr virus). The analysis by
Northern blot de la expresión de E2F1-E2F3 en varias lineas de BL y LCL indicaba que la expresión de E2F1 sólo era detectada en lineas de BL y no en las de LCL, mientras que los niveles de expresión de E2F2, E2F3 y ACTINA gamma (empleada como un control de carga) eran similares en todas las lineas analizadas (Figura 2A) . Al comparar el nivel de expresión de E2F1 entre lineas celulares de BL y LCL mediante qPCR se encontró que éste era 6-20 veces más alto en las líneas de BL que en la línea de LCL IB4 (línea celular linfoblastoide B obtenida a partir de linfocitos B extraídos de cordón umbilical, inmortalizados mediante infección con el virus de Epstein-Barr y que ha sido descrita en King, W., A. L. Thomas-Powell, N. Raab-Traub, M. Hawke, and M. Kieff. 1980. Epstein-Barr virus RNA. V. Viral RNA in a restrin- gently infected, growth-transformed cell line. J. Virol. 36:506-518) mientras que la expresión era muy similar entre todas las líneas de LCL (Figura 2B) . El análisis de la expresión de la proteína E2F1 mediante inmunoblot indicaba que sus niveles también eran más elevados en la líneas de BL que en las de LCL (Figuras 2C y 2D) . Sin embargo, las diferencias en la expresión de E2F1 entre líneas de BL y LCL fueron menores a nivel de proteína que a nivel de mRNA (comparar Figuras 2B y 2D) . Este hallazgo podría ser debido a la capacidad de c-myc para inducir la expresión del conjunto de microRNAs (mir-17- 92) que regula negativamente la traducción de E2F1 (O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT. c-Myc-regulated microRNAs modulate E2F1 expression. Nature 2005; 435(7043) : 839-43) .Northern blot of the expression of E2F1-E2F3 in several lines of BL and LCL indicated that the expression of E2F1 was only detected in lines of BL and not in those of LCL, while the expression levels of E2F2, E2F3 and ACTINA gamma ( used as a load control) were similar in all the lines analyzed (Figure 2A). When comparing the level of E2F1 expression between BL and LCL cell lines using qPCR it was found that this It was 6-20 times higher in the BL lines than in the LCL IB4 line (B lymphoblast cell line obtained from B lymphocytes extracted from the umbilical cord, immortalized by infection with the Epstein-Barr virus and described in King, W., AL Thomas-Powell, N. Raab-Traub, M. Hawke, and M. Kieff. 1980. Epstein-Barr RNA virus V. Viral RNA in a restrictively infected, growth-transformed cell line J. Virol. 36: 506-518) while the expression was very similar between all LCL lines (Figure 2B). Analysis of the expression of the E2F1 protein by immunoblot indicated that its levels were also higher in the BL lines than in the LCL lines (Figures 2C and 2D). However, the differences in E2F1 expression between BL and LCL lines were smaller at the protein level than at the mRNA level (compare Figures 2B and 2D). This finding could be due to the ability of c-myc to induce the expression of the set of microRNAs (mir-17-92) that negatively regulates the translation of E2F1 (O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT. C-Myc-regulated microRNAs modulate E2F1 expression. Nature 2005; 435 (7043): 839-43).
En algunos casos se ha descrito la existencia de una correlación entre el nivel de expresión de genes implicados en el crecimiento y la proliferación celular y el nivel de proliferación de las células en cultivo. Para descartar que los niveles elevados de expresión de E2F1 en las líneas de BL fueran debidas a la presencia de un mayor porcentaje de células con capacidad de proliferación en los cultivos de líneas de BL que en los de LCL, se compararon el nivel de crecimiento de las líneas de BL DG75 y Mutu-1 con el de las líneas de LCL JY y X50-7 y se descubrió que éstos eran prácticamente idénticos (Figura 2E y datos no mostrados) . Más del 98% de las células presentes en los cultivos celulares eran viables, según se determinó mediante la exclusión de azul tripán. La incorporación de BrdU y la distribución entre las fases del ciclo celular también fueron prácticamente idénticas entre ambos tipos de lineas celulares (Figuras 2F, 2G y datos no mostrados) . En conjunto, estos datos indicaban que los cultivos de las lineas celulares de BL y LCL contenían niveles similares de células con capacidad proliferativa .In some cases the existence of a correlation between the level of expression of genes involved in cell growth and proliferation and the level of proliferation of cells in culture has been described. To rule out that the high levels of E2F1 expression in BL lines were due to the presence of a higher percentage of cells with proliferation capacity in BL line cultures than in LCL, the growth level of the BL DG75 and Mutu-1 lines with that of the LCL JY and X50-7 lines and these were found to be virtually identical (Figure 2E and data not shown). More than 98% of the cells present in cell cultures were viable, as determined by excluding trypan blue. The incorporation of BrdU and the distribution between the cell cycle phases were also practically identical between both types of cell lines (Figures 2F, 2G and data not shown). Together, these data indicated that BL and LCL cell line cultures contained similar levels of cells with proliferative capacity.
2.2.- La expresión de E2F1 en lineas celulares de BL y en tumores LBE está descontrolada.2.2.- The expression of E2F1 in BL cell lines and in LBE tumors is uncontrolled.
A continuación se comparó el nivel de expresión de E2F1 mediante PCR cuantitativa en 30 muestras tumora- les de pacientes de LBE con la de tejidos control procedentes de amígdalas (Tl y T2) y nodulos linfáticos reactivos (LN1-LN3) y con la de biopsias de pacientes de LCM, SMZL, DLBCL y LF. La expresión relativa de E2F1 fue muy similar entre los distintos tejidos control (Figura 3A) . El 100% de las muestras de LBE (1-30) mostraron un nivel de expresión de E2F1 5-45 veces superior al del tejido control T2 (Figura 3B), mientras que las muestras de LCM, SMZL y LF mostraron niveles de expresión de E2F1 muy similares al del tejido control T2 (Figura 3C) . En el caso de las muestras de DLBCL, la mitad de los casos mostraron una expresión de E2F1 similar a la del tejido control T2 mientras que la otra mitad de las muestras mostró un nivel de expresión de E2F1 3-4 veces superior al de la muestra T2 (Figura 3C) . Es de destacar que aunque la expresión de E2F1 en las muestras 3 y 4 de DLBCL era muy similar a la del tejido control, su Índice de proliferación era tan elevado como el de las muestras de LBE (más del 90%) , como se puede observar en inmuno- tinciones de Ki67 (datos no mostrados) . Los niveles de expresión de la proteina E2F1 también eran más elevados en una biopsia de LBE (LBE3) que en una muestra de DLBCL con un nivel de proliferación similar a los sBL (DLBCL4) o que en el tejido control T2, según se determinó mediante inmunohistoquimica (Figura 3D) . Por lo tanto, estos resultados sugieren que la expresión elevada de E2F1 podria ser caracteristica de la mayoria, sino de todos los casos, de LBE. Además, coincidiendo con las observaciones empleando lineas celulares de BL y LCL, parece que la expresión elevada de E2F1 no es un simple marcador de proliferación celular puesto que algunos casos de DLBCL que presentan un nivel de proliferación similar al de los casos de LBE muestran niveles de expresión de E2F1 mucho menores.The level of E2F1 expression was then compared by quantitative PCR in 30 tumor samples of LBE patients with that of control tissues from tonsils (Tl and T2) and reactive lymph nodes (LN1-LN3) and that of biopsies of patients with LCM, SMZL, DLBCL and LF. The relative expression of E2F1 was very similar between the different control tissues (Figure 3A). 100% of the LBE samples (1-30) showed an E2F1 expression level 5-45 times higher than the T2 control tissue (Figure 3B), while the LCM, SMZL and LF samples showed expression levels of E2F1 very similar to that of the T2 control tissue (Figure 3C). In the case of DLBCL samples, half of the cases showed an expression of E2F1 similar to that of the T2 control tissue while the other half of the samples showed an expression level of E2F1 3-4 times higher than the sample T2 (Figure 3C). It is noteworthy that although the expression of E2F1 in samples 3 and 4 of DLBCL was very similar to that of the control tissue, its proliferation index was as high as that of the LBE samples (more than 90%), as can be observe in Ki67 immuno- stations (data not shown). E2F1 protein expression levels were also higher in an LBE biopsy (LBE3) than in a DLBCL sample with a proliferation level similar to sBL (DLBCL4) or that in the T2 control tissue, as determined by immunohistochemistry (Figure 3D). Therefore, these results suggest that the elevated expression of E2F1 could be characteristic of most, if not all, of LBE. In addition, coinciding with the observations using BL and LCL cell lines, it seems that the elevated expression of E2F1 is not a simple marker of cell proliferation since some cases of DLBCL that have a proliferation level similar to that of LBE cases show levels of E2F1 expression much lower.
Ejemplo 3.- La reducción de la expresión de E2F1 disminuye la capacidad de las células de BL de formar tumores . Ya se sabia que las lineas celulares de BL, pero no las de LCL, eran capaces de formar colonias en agar blando y de producir tumores malignos al ser inyectadas subcutáneamente en ratones inmunodeficientes . De acuerdo con estos datos, se observó que la linea celular EBV~ de BL DG75, pero no la linea de LCL JY, era capaz de formar colonias en agar blando y de producir tumores en ratones SCID (Figuras 4A y 4B) .Example 3.- Reduction of E2F1 expression decreases the ability of BL cells to form tumors. It was already known that BL cell lines, but not those of LCL, were capable of forming soft agar colonies and producing malignant tumors when injected subcutaneously into immunodeficient mice. Based on these data, it was observed that the EBV ~ BL DG75 cell line, but not the LCL JY line, was capable of forming soft agar colonies and producing tumors in SCID mice (Figures 4A and 4B).
Para comprobar si era necesaria una expresión elevada de E2F1 en las células de BL para mantener su capacidad tumorogénica, se infectaron células de la linea DG75 con lentivirus codificantes para ningún shRNATo check if a high expression of E2F1 in BL cells was necessary to maintain its tumorigenic capacity, DG75 line cells were infected with lentiviruses encoding no shRNA
(None) , para un shRNA frente a ninguna diana (Control) o para 3 shRNAs diferentes especificos para E2F1 (E2F1-1,(None), for a shRNA against any target (Control) or for 3 different shRNAs specific for E2F1 (E2F1-1,
E2F1-2 y E2F1-3, SEQ ID NO5, N6 y N7, respectivamente) . Al determinar la expresión de E2F1 en células infectadas con estos lentivirus, tras una selección de las células transducidas con puromicina, se observó que los RNA interferentes E2F1-1 y E2F1-2 reduelan notablemente la expresión de E2F1 (más del 70%), que el RNA interferente E2F1-3 pobremente reducia la expresión de E2F1 y que el shRNA control prácticamente no modificaba la expresión de E2F1 en comparación con la ausencia (None) de shRNA (Figuras 4C y 4D) . Ninguno de estos lentivirus afectó significativamente la expresión de E2F2, E2F3, c-myc o tubulina (Figura 4C) , sugiriendo que el efecto de los shRNAs frente a E2F1 eran realmente especificos para este gen.E2F1-2 and E2F1-3, SEQ ID NO5, N6 and N7, respectively). When determining the expression of E2F1 in cells infected with these lentiviruses, after a selection of cells transduced with puromycin, it was observed that the interfering RNAs E2F1-1 and E2F1-2 markedly reduce the expression of E2F1 (more than 70%), which the interfering RNA E2F1-3 poorly reduced the expression of E2F1 and that the control shRNA practically did not modify the expression of E2F1 compared to the absence (None) of shRNA (Figures 4C and 4D). None of these lentiviruses significantly affected the expression of E2F2, E2F3, c-myc or tubulin (Figure 4C), suggesting that the effect of shRNAs against E2F1 were really specific for this gene.
Las células infectadas con el lentivirus vacio (None) o con el shRNA control eran capaces de formar colonias eficientemente en agar blando, mientras que las células que expresaban los shRNA E2F1-1 y E2F1-2 apenas formaban colonias y las células que expresaban el shRNA E2F1-3 mostraron una capacidad de formación de colonias en agar blando ligeramente reducida con respecto a las células que no expresaban ningún shRNA (Figuras 4E y 4F) . Las secuencias de E2F1 reconocidas por los shRNA:Cells infected with the empty lentivirus (None) or with the shRNA control were able to form colonies efficiently on soft agar, while the cells expressing the shRNA E2F1-1 and E2F1-2 barely formed colonies and the cells expressing the shRNA E2F1-3 showed a slightly reduced soft agar colony formation capacity with respect to cells that did not express any shRNA (Figures 4E and 4F). The E2F1 sequences recognized by shRNA:
- E2F1-1: AGGATGGATATGAGATGGGA- E2F1-1: AGGATGGATATGAGATGGGA
- E2F1-2: CTGAGGAGTTCATCAGCCTT- E2F1-2: CTGAGGAGTTCATCAGCCTT
- E2F1-3: GTGGACTCTTCGGAGAACTT A continuación se analizó el papel de la expresión elevada de E2F1 en células de BL sobre su capacidad para formar tumores in vivo. Para ello, se inoculó subcutáneamente células DG75 transducidas con los distintos lentivirus en ratones SCID. La inoculación de células infectadas con lentivirus vacios (None) o con la secuencia control indujo la formación de tumores en un plazo de 2-3 semanas en 9 de 9 ratones SCID (Figuras 4G y 4H) . Estos tumores consistían en masas sólidas (Figura 4G, 2_ panel) formadas por células linfoides tumorales (Figura 4G, tercer panel) que expresaban altos niveles de E2F1 (Figura 4G, 4_ panel) y Ki67 (Figura 4G, 5_ panel) . Por el contrario, ninguno de los 9 ratones inoculados con células DG75 que expresaban el shRNA E2F1-1 formaron tumores y la mayoria de los ratones inoculados con células DG75 que expresaban los shRNA E2F1-2 ó E2F1-3 o no formaron tumores o formaron tumores mucho más pequeños que los formados en los ratones inoculados con células DG75 infectadas con el lentivirus vacio (Figura 4H) . Estos datos indican que la reducción de la expresión de E2F1 notablemente inhibe la capacidad de formación de tumores de las células de BL y sugieren que la expresión elevada de E2F1 podria desempeñar un papel relevante en la formación de LBE.- E2F1-3: GTGGACTCTTCGGAGAACTT The role of elevated E2F1 expression in BL cells on their ability to form tumors in vivo was analyzed below. For this, DG75 cells transduced with the different lentiviruses were inoculated subcutaneously in SCID mice. Inoculation of cells infected with empty lentiviruses (None) or with the control sequence induced tumor formation within 2-3 weeks in 9 of 9 SCID mice (Figures 4G and 4H). These tumors consisted of solid masses (Figure 4G, 2_ panel) formed by tumor lymphoid cells (Figure 4G, third panel) expressing high levels of E2F1 (Figure 4G, 4_ panel) and Ki67 (Figure 4G, 5_ panel). In contrast, none of the 9 mice inoculated with DG75 cells expressing shRNA E2F1-1 formed tumors and most mice inoculated with DG75 cells expressing shRNAs E2F1-2 or E2F1-3 either did not form tumors or formed tumors much smaller than those formed in mice inoculated with DG75 cells infected with the empty lentivirus (Figure 4H). These data indicate that the reduction in E2F1 expression remarkably inhibits the tumor-forming capacity of BL cells and suggests that elevated E2F1 expression could play a relevant role in the formation of LBE.
Se extendieron los ensayos a una linea adicional de linfoma de Burkitt a una linea adicional de linfoma de Burkitt esporádico, BL2 (Figura7) . En este modelo animal, la inoculación subcutánea de células BL2 infectadas con lentivirus no portadores de ninguna secuencia de shRNA (None) o con lentivirus portadores de una secuencia de shRNA no dirigida frente a ninguna dianaTrials were extended to an additional Burkitt lymphoma line to an additional sporadic Burkitt lymphoma line, BL2 (Figure 7). In this animal model, subcutaneous inoculation of BL2 cells infected with lentiviruses not carrying any shRNA sequence (None) or with lentiviruses carrying a shRNA sequence not directed against any target
(Control) dio lugar a la formación de tumores en todos los casos (n=4) . En cambio la inoculación de células(Control) resulted in tumor formation in all cases (n = 4). Instead cell inoculation
BL2 infectadas con lentivirus portadores de la secuencia de shRNA E2F1-1 no produjo formación de tumores en ninguno de los casos (n=4) y la inoculación de células infectadas con virus portadores de la secuencia de shRNA E2F1-2 no dio lugar a la formación de tumores en 3 de los 4 casos estudiados (Figura 7) y solo se produjo un tumor de menor tamaño que los observados en presencia de los virus vacios (None) o control. Por lo tanto, una expresión elevada de E2F1 no solo es necesaria para la formación de tumores en la linea celular de linfoma de Burkitt esporádico DG75, sino que también es necesaria para la formación de tumores de la linea celular de linfoma de Burkitt esporádico BL2. Estos datos indican que la reducción de la expresión de E2F1 notablemente inhibe la capacidad de formación de tumores de las células de Linfoma de Burkitt esporádico y sugieren que la expresión elevada de E2F1 podria desempeñar un papel relevante en al formación de este tumor.BL2 infected with lentivirus carriers of the shRNA sequence E2F1-1 did not cause tumor formation in any of the cases (n = 4) and inoculation of cells infected with viruses carrying the shRNA sequence E2F1-2 did not give rise to tumor formation in 3 of the 4 cases studied (Figure 7) and only one tumor of smaller size than those observed in the presence of empty (None) or control viruses. Therefore, high expression of E2F1 is not only necessary for the formation of tumors in the sporadic Burkitt lymphoma cell line DG75, but is also necessary for the formation of tumors of the sporadic Burkitt lymphoma cell line BL2. These data indicate that the reduction of E2F1 expression remarkably inhibits the tumor-forming capacity of sporadic Burkitt Lymphoma cells and suggests that elevated E2F1 expression could play a role. relevant in the formation of this tumor.
La reducción de la expresión de E2F1 disminuye la capacidad de proliferación de las células de BL. Para investigar el mecanismo implicado en la inhibición de la formación de tumores por los shRNA específicos de E2F1, se comparó la capacidad de crecimiento en cultivo de las células DG75 con niveles de expresión de E2F1 normales o reducidos. Las células infectadas con lentivirus vacios (None) o con una secuencia de shRNA frente a ninguna diana (Control) aumentaron su número cerca de 14 veces tras 4 dias en cultivo, mientras que las células que expresaban el shRNA E2F1-1 apenas aumentaron su número 2 veces en el mismo periodo de tiempo (Figura 5A) . Esta reducción de la capacidad de crecimiento en cultivo podia ser debida a una reducción de la capacidad de proliferación o a un aumento de la muerte celular. Dado que más de un 98% de las células presentes en todos los cultivos de células infectadas con los distintos lentivirus eran viables, según se determinó mediante exclusión de azul tripán, parecia probable que la diferencia en la capacidad de crecimiento fuera debida a distintos niveles de proliferación. De hecho, al analizar la capacidad de incorporación de BrdU se descubrió que las células portadoras del shRNA E2F1-1 sólo incorporaban un 50% menos de BrdU que las células portadoras del shRNA control o que las células que no expresaban ningún shRNA (None) (Figura 4B) . Además, el análisis del ciclo celular mostraba que las células infectadas con un lentivirus vacio (None) o con el portador del shRNA control presentaban una distribución muy similar a la de las células no infectadas mientras que las células que expresaban el shRNA E2F1-1 mostraban una clara acumulación en la fases G2/M del ciclo celular (Figura 5D) . Se ha estudiado en mayor profundidad el efecto de los distintas secuencias de shRNA para E2F1 sobre el crecimiento in Vitro de las células de linfoma de Bur- kitt esporádico y se ha observado que las células infec- tadas con lentivirus vacios (None) o con una secuencia control (Control) aumentaron su número cerca de 14 veces tras 4 dias en cultivo, las células que expresaban los shRNA E2F1-1, E2F1-2 y E2F1-3 apenas aumentaron su número en 2, 4 y 5 veces, respectivamente (Figura 8) . De esta forma, se demuestra que no solo el shRNA E2F1-1 es capaz de inhibir la proliferación celular de las células de linfoma de Burkitt esporádico (Figura 5 A) , sino que también los shRNA E2F1-2 y E2F1-3 llevan a cabo el mismo efecto.Reduction of E2F1 expression decreases the proliferation capacity of BL cells. To investigate the mechanism involved in the inhibition of tumor formation by E2F1-specific shRNAs, the growth capacity in culture of DG75 cells was compared with normal or reduced levels of E2F1 expression. Cells infected with empty lentiviruses (None) or with a shRNA sequence against no target (Control) increased their number about 14 times after 4 days in culture, while cells expressing shRNA E2F1-1 barely increased their number 2 times in the same period of time (Figure 5A). This reduction in growth capacity in culture could be due to a reduction in proliferation capacity or an increase in cell death. Since more than 98% of the cells present in all cultures of cells infected with the different lentiviruses were viable, as determined by trypan blue exclusion, it seemed likely that the difference in growth capacity was due to different levels of proliferation. In fact, when analyzing BrdU incorporation capacity, it was discovered that the E2F1-1 shRNA carrier cells only incorporated 50% less BrdU than the control shRNA carrier cells or that cells that did not express any shRNA (None) ( Figure 4B). In addition, the cell cycle analysis showed that cells infected with an empty lentivirus (None) or with the carrier of the shRNA control had a distribution very similar to that of the non-infected cells while the cells expressing the shRNA E2F1-1 showed a clear accumulation in the G2 / M phases of the cell cycle (Figure 5D). The effect of the different shRNA sequences for E2F1 on the in vitro growth of sporadic Burkett lymphoma cells has been studied in greater depth and it has been observed that cells infected with empty lentiviruses (None) or with a Control sequence (Control) increased their number about 14 times after 4 days in culture, the cells expressing shRNA E2F1-1, E2F1-2 and E2F1-3 just increased their number 2, 4 and 5 times, respectively (Figure 8). Thus, it is demonstrated that not only shRNA E2F1-1 is capable of inhibiting cell proliferation of sporadic Burkitt lymphoma cells (Figure 5 A), but also shRNA E2F1-2 and E2F1-3 perform The same effect.
Se ha determinado que la reducción de la expresión de E2F1 en células de la linea celular de linfoma de Burkitt esporádico DG75 inhibia su capacidad de proliferación (Figura 5 B) . Además se ha podido demos- trar que la reducción de la expresión de E2F1 mediante las secuencias de shRNA empleadas no inhibe la capacidad proliferativa de la linea celular primaria de fibroblastos diploides humanos, Imr-90 (Figura 9) . Estos datos apoyan la hipótesis de que los tratamientos del linfoma de Burkitt basados en conseguir la reducción de la expresión de E2F1 podrian no presentar efectos secundarios adversos dado que no afectarla a células primarias. Esta hipótesis también se ve apoyada por datos publicados que demuestran que los ratones deficientes en E2F1 son viables hasta una edad avanzada (Field et al., 1996; Yamasaki et al., 1996) . Además, la falta de expresión de E2F1 podria no causar ni siquiera inmunosupresión puesto que se ha demostrado que la falta de expresión de E2F1 en ratones no inhibe la proliferación de linfocitos T (DeRyckere and DeGregori, 2005) . Materiales y MétodosIt has been determined that the reduction of E2F1 expression in sporadic Burkitt lymphoma cell line DG75 inhibited its proliferation capacity (Figure 5B). Furthermore, it has been shown that the reduction of E2F1 expression by the shRNA sequences employed does not inhibit the proliferative capacity of the primary cell line of human diploid fibroblasts, Imr-90 (Figure 9). These data support the hypothesis that Burkitt lymphoma treatments based on reducing the expression of E2F1 may not present adverse side effects since it does not affect primary cells. This hypothesis is also supported by published data demonstrating that E2F1-deficient mice are viable until an advanced age (Field et al., 1996; Yamasaki et al., 1996). In addition, the lack of expression of E2F1 may not even cause immunosuppression since it has been shown that the lack of expression of E2F1 in mice does not inhibit the proliferation of T lymphocytes (DeRyckere and DeGregori, 2005). Materials and methods
Northern blot y Análisis por PCR cuantitativo Se preparó RNA total según estaba descrito (9) .Northern blot and Quantitative PCR Analysis Total RNA was prepared as described (9).
Se analizó el RNA (20 μg) mediante Northern Blot e hibridación con fragmentos de DNA de E2F1, E2F2, E2F3 y γ-actina marcados con 32P. La hibridación y los lavados se realizaron según estaba descrito (9) . La PCR cuanti- tativa (qPCR) se llevó a cabo según las instrucciones del proveedor (Applied Biosystems, Foster City, CA) , usando sondas especificas para E2F1 y ACTINA humanos. Pacientes y Células Todos los casos fueron seleccionados de consul- tas efectuadas al Centro Nacional de Investigaciones Oncológicas (CNIO) y a través de la Red Española de Bancos de Tumores. Los estudios fueron aprobados por las Comisiones Éticas pertinentes y los pacientes aportaron consentimiento por escrito tras ser informados. Las biopsias de los distintos linfomas fueron revisadas por M. A. Piris y su equipo de expertos hematopatólogos usando los criterios de la Organización Mundial de la Salud (10) . Treinta muestras de sBL de pacientes no inmunodeficientes y muestras de amígdalas y nodulos linfáticos reactivos y biopsias de de linfomas de células del manto (LCM) , linfomas de la zona marginal del bazo (SMZL), linfoma difuso de células B grandes (DLBCL) y linfoma folicular (LF) fueron seleccionados finalmente. Las lineas linfoblastoides de linfocitos B (LCL) X50-7, JY, Dana e IB4 y las lineas de BL Raji, Rael, Mutu-I, Akata y DG75 fueron cultivadas en RPMI 1640, mientras que la linea celular de riñon humano mientras 293-T fue cultivada en Dulbecco's modified Eagle médium. Ambos medios fueron suplementados con 10% de suero bovino fetal inactivado por calor (GIBCO, Invitrogen Corp.), 2 mM de glutamina, 100 U/ml de penicilina y 100 μg/ml de estreptomicina.RNA (20 μg) was analyzed by Northern Blot and hybridization with DNA fragments of E2F1, E2F2, E2F3 and γ-actin labeled with 32P. Hybridization and washes were performed as described (9). Quantitative PCR (qPCR) was carried out according to the supplier's instructions (Applied Biosystems, Foster City, CA), using specific probes for human E2F1 and ACTINA. Patients and Cells All cases were selected from consultations made to the National Oncology Research Center (CNIO) and through the Spanish Network of Tumor Banks. The studies were approved by the relevant Ethical Commissions and the patients provided written consent after being informed. Biopsies of the different lymphomas were reviewed by MA Piris and his team of expert hematopathologists using the criteria of the World Health Organization (10). Thirty samples of sBL from non-immunodeficient patients and samples of reactive tonsils and lymph nodes and biopsies of mantle cell lymphomas (LCM), marginal spleen zone lymphomas (SMZL), diffuse large B-cell lymphoma (DLBCL) and Follicular lymphoma (LF) were finally selected. The lymphoblast lines of B lymphocytes (LCL) X50-7, JY, Dana and IB4 and the lines of BL Raji, Rael, Mutu-I, Akata and DG75 were cultured in RPMI 1640, while the human kidney cell line while 293 -T was grown in Dulbecco's modified Eagle medium. Both media were supplemented with 10% heat-inactivated fetal bovine serum (GIBCO, Invitrogen Corp.), 2 mM glutamine, 100 U / ml penicillin and 100 μg / ml streptomycin.
Producción de Lentivirus e InfeccionesLentivirus and Infection Production
Las células 293-T fueron transfectadas con 20 μg de vector basado en MISSION pLKO.l-puro, 15 μg de psPAX2 y 5 μg de pMD2G-VSVG usando el método de precipitación de DNA con fosfato calcico. Los vectores empleados basados en MISSION pLKO.l-puro se obtuvieron de Sigma- Aldrich (St. Louis, Missouri) y o no contenían ningún shRNA o codificaban para un shRNA control (un shRNA que genera un siRNA con una secuencia errónea de al menos 5 pares de bases con respecto a cualquier gen humano o de ratón conocido) o para distintos shRNA específicos para E2F1. Para la transducción de células DG75, incubamos las células en presencia de medio que contenia las partículas virales y 8 μg/ml de sulfato de protamina durante 16 horas. Las células no transducidas fueron eliminadas del cultivo mediante incubación con 1 μg/ml de puromicina. Inmunoblot e InmunohistoquimicaThe 293-T cells were transfected with 20 μg of vector based on MISSION pLKO.l-pure, 15 μg of psPAX2 and 5 μg of pMD2G-VSVG using the calcium precipitation method with calcium phosphate. The vectors used based on MISSION pLKO.l-pure were obtained from Sigma-Aldrich (St. Louis, Missouri) and did not contain any shRNA or encode for a control shRNA (a shRNA that generates a siRNA with an erroneous sequence of at least 5 base pairs with respect to any known human or mouse gene) or for different shRNAs specific for E2F1. For the transduction of DG75 cells, we incubated the cells in the presence of medium containing the viral particles and 8 μg / ml protamine sulfate for 16 hours. The non-transduced cells were removed from the culture by incubation with 1 μg / ml of puromycin. Immunoblot and Immunohistochemistry
Para la hibridación de las membranas se usaron anticuerpos anti-E2Fl, anti-E2F2, anti-E2F3, anti-E2F4, o anti-c-myc de Santa Cruz Biotechnology (Santa Cruz, CA) , anti-Tubulina de Sigma-Aldrich seguidos de anti- cuerpos anti-ratón o anti-conejo acoplados a peroxidasaFor hybridization of the membranes, anti-E2Fl, anti-E2F2, anti-E2F3, anti-E2F4, or anti-c-myc antibodies from Santa Cruz Biotechnology (Santa Cruz, CA), Sigma-Aldrich anti-tubulin were used followed of anti-mouse or anti-rabbit antibodies coupled to peroxidase
(Sigma-Aldrich) . Las muestras de tejido incluidas en parafina se tiñeron con anti-E2Fl (Santa Cruz) o con anti-Ki67 (DAKO, Copenhagen, Denmark) y fueron coteñidas con hematoxilina o simplemente teñidas con hematoxilina y eosina.(Sigma-Aldrich). The tissue samples included in paraffin were stained with anti-E2Fl (Santa Cruz) or with anti-Ki67 (DAKO, Copenhagen, Denmark) and were collated with hematoxylin or simply stained with hematoxylin and eosin.
Crecimiento Celular, Proliferación Celular, Análisis de Ciclo Celular y Apoptosis .Cell Growth, Cell Proliferation, Cell Cycle Analysis and Apoptosis.
Para determinar el nivel de crecimiento celular, se resuspendieron las células a una concentración de 2 x 105/ml y se cultivaron en placas de 24 pocilios por triplicado. Se midió el crecimiento mediante recuento de células a distintos intervalos. La viabilidad celular se confirmó mediante exclusión de azul tripán. Para el mareaje con BrdU, se usó el kit "FITC BrdU flow kit" (BDBiosciences, San José, CA) siguiendo las instrucciones del fabricante. El análisis del ciclo celular se llevó a cabo como se describió previamente (11) empleando yoduros de propidio. La apoptosis se determinó mediante mareaje con anexina V-FITC (Bender MedSystems, Viena, Austria) . Las células teñidas con BrdU, yoduro de propidio y anexina-V se analizaron empleando un citóme- tro de flujo FACScan (BDBiosciences) .To determine the level of cell growth, the cells were resuspended at a concentration of 2 x 105 / ml and cultured in 24-well plates per triplicate. Growth was measured by cell count at different intervals. Cell viability was confirmed by exclusion of trypan blue. For the marking with BrdU, the "FITC BrdU flow kit" kit (BDBiosciences, San José, CA) was used following the manufacturer's instructions. The cell cycle analysis was carried out as previously described (11) using propidium iodides. Apoptosis was determined by adnexin V-FITC (Bender MedSystems, Vienna, Austria). Cells stained with BrdU, propidium iodide and annexin-V were analyzed using a FACScan flow cytometer (BDBiosciences).
Ensayos de Transformación in vitro e in vivoTransformation assays in vitro and in vivo
Los pocilios de placas de 6 pocilios se cubrie- ron con medio RPMI 1640 que contenia 0.5% de agarosa SeaPlaque (FMC, Rockland, Maine) y FCS al 10%. Sobre esta base se depositaron 104 células embebidas medio RPMI 1640 con 0.3% de agarosa SeaPlaque y FCS al 10%. Se contó el número de colonias crecidas al cabo de 2-3 semanas de la siembra de las células en placas por triplicado. Células DG75 (2 x 106) resuspendidas en 0.1 mi de tampón fosfato salino fueron inyectadas subcutáneamente en hembras de 6-8 semanas de edad de ratones con inmunodeficiencia combinada severa (SCID) CB. -17. Se extirparon las masas tumorales, se pesaron y se incluyeron en parafina para su análisis inmunohistoqui- mico .The 6-well plate wells were covered with RPMI 1640 medium containing 0.5% SeaPlaque agarose (FMC, Rockland, Maine) and 10% FCS. 104 RPMI 1640 medium embedded cells with 0.3% SeaPlaque agarose and 10% FCS were deposited on this base. The number of colonies grown after 2-3 weeks of planting the cells in triplicate plates was counted. DG75 cells (2 x 106) resuspended in 0.1 ml of phosphate buffered saline were injected subcutaneously into 6-8 week old females of mice with severe combined immunodeficiency (SCID) CB. -17. Tumor masses were removed, weighed and included in paraffin for immunohistochemical analysis.
Por último se han llevado a cabo estudios compa- rando la relación entre la expresión de las proteínasFinally, studies have been carried out comparing the relationship between protein expression
E2F1 y Actina en varias lineas celulares de Linfoma deE2F1 and Actin in several lymphoma cell lines of
Burkitt, de linfoblastos B inmortalizados y de LinfomaBurkitt, immortalized B lymphoblasts and Lymphoma
Difuso de Células B grandes. Los resultados obtenidos indican que la relación E2F1/Actina es mucho más elevada en las lineas celulares de Linfoma de Burkitt que en las de linfoblastos inmortalizados (Figura 10A) y que también es mucho más elevada en las lineas de Burkitt que en las de Linfoma Difuso de Células B grandes (Figura 10B) .Diffuse of large B cells. The results obtained indicate that the E2F1 / Actin ratio is much higher in Burkitt lymphoma cell lines than in the of immortalized lymphoblasts (Figure 10A) and which is also much higher in Burkitt lines than in those of diffuse large B-cell lymphoma (Figure 10B).
Estos datos apoyan fuertemente la utilidad de métodos de determinación de la expresión proteica deThese data strongly support the usefulness of methods for determining protein expression of
E2F1 relativa a la de actina-beta para el diagnóstico diferencial entre Linfoma de Burkitt y el Linfoma Difuso de células B grandes.E2F1 relative to that of actin-beta for differential diagnosis between Burkitt lymphoma and Diffuse large B-cell lymphoma.
No alteran la esencialidad de esta invención variaciones en materiales, forma, tamaño y disposición de los elementos componentes, descritos de manera no limi- tativa, bastando ésta para proceder a su reproducción por un experto. Variations in materials, shape, size and arrangement of the component elements, described in a non-limiting manner, do not alter the essentiality of this invention, it being sufficient to be reproduced by an expert.

Claims

REIVINDICACIONES
1.- Procedimiento de identificación de un linfo- ma de Burkitt esporádico (LBE) caracterizado porque se basa en la identificación de los niveles de la presencia de la proteina E2F1 humana en una muestra biológica y porque comprende las siguientes etapas: a) identificación de los niveles de expresión de E2F1, ajustándolos con los niveles de un marcador con- trol, preferentemente ACTINA beta humana cuando proceda, en una muestra biológica, y b) comparación de los niveles de E2F1 observados en a) con una muestra biológica control, e c) identificación de una muestra como LBE cuando los niveles de E2F1 superan a los obtenidos en la muestra control por encima de un umbral determinado.1.- Procedure for identifying a sporadic Burkitt lymphoma (LBE) characterized in that it is based on the identification of the levels of the presence of the human E2F1 protein in a biological sample and because it comprises the following steps: a) identification of E2F1 expression levels, adjusting them with the levels of a control marker, preferably human ACTINA beta when appropriate, in a biological sample, and b) comparison of the E2F1 levels observed in a) with a control biological sample, ec) Identification of a sample as LBE when E2F1 levels exceed those obtained in the control sample above a certain threshold.
2.- Procedimiento de identificación según la reivindicación 1 caracterizado porque E2F1 y ACTINA beta se corresponden con el gen o proteina E2F1 (SEQ ID NO 1 y NO 2, respectivamente) y con el gen o proteina ACTINA beta (SEQ ID NO 3 y NO 4, respectivamente), respectivamente .2. Identification procedure according to claim 1 characterized in that E2F1 and ACTINA beta correspond to the gene or protein E2F1 (SEQ ID NO 1 and NO 2, respectively) and to the gene or protein ACTINA beta (SEQ ID NO 3 and NO 4, respectively), respectively.
3.- Procedimiento de identificación según la reivindicación 1 caracterizado porque la muestra bioló- gica control se desarrolla de forma artificial, preferentemente, un plásmido que contiene el ADNc del gen E2F1 humano.3. Identification procedure according to claim 1, characterized in that the control biological sample is artificially developed, preferably, a plasmid containing the human E2F1 gene cDNA.
4.- Procedimiento de identificación según la reivindicación 1 caracterizado porque la identificación de E2F1 se lleva a cabo mediante RT-PCR cuantitativa de un precursor génico de E2F1 y en el que los niveles de4. Identification procedure according to claim 1 characterized in that the identification of E2F1 is carried out by quantitative RT-PCR of an E2F1 gene precursor and wherein the levels of
E2F1 se ajustan a los de ACTINA beta.E2F1 conform to those of ACTINA beta.
5.- Procedimiento de identificación según la reivindicación 4 caracterizado porque se utiliza RNA, ya sea RNA polyA+ o RNA total o RNA polyA+, de una muestra biológica sospechosa de LBE y de un tejido control y la amplificación de la secuencia del RNAm del gen E2F1 y ACTINA beta se llevan a cabo con adecuados oligonucleó- tidos o cebadores específicos ya sean, tanto para la región codificante o no codificante del UNAM.5. Identification procedure according to claim 4, characterized in that RNA, either RNA polyA + or total RNA or RNA polyA +, of a sample is used Biological suspicion of LBE and a control tissue and amplification of the mRNA sequence of the E2F1 gene and ACTINA beta are carried out with suitable oligonucleotides or specific primers, whether for the coding or non-coding region of UNAM.
6.- Procedimiento de identificación según la reivindicación 5 caracterizado porque los oligos utilizados para la RT-PCR para la amplicación de E2F1 y ACTINA beta se corresponden con las SEQ ID NO8-9 y SEQ ID NOlO-Il, respectivamente.6. Identification procedure according to claim 5, characterized in that the oligos used for RT-PCR for the amplification of E2F1 and ACTINA beta correspond to SEQ ID NO8-9 and SEQ ID NOlO-Il, respectively.
7.- Procedimiento de identificación según la reivindicación 4 caracterizado porque el umbral distintivo de LBE es un nivel de expresión de E2F1 superior al equivalente de 2.5 ng de plásmido, utilizado como con- trol.7. Identification procedure according to claim 4, characterized in that the distinctive threshold of LBE is an expression level of E2F1 higher than the equivalent of 2.5 ng of plasmid, used as a control.
8.- Procedimiento de identificación según la reivindicación 1 caracterizado porque el procedimiento se lleva a cabo mediante la técnica de PCR semi- cuantitativa con unos cebadores específicos de E2F1 y Actina beta.8. Identification procedure according to claim 1, characterized in that the procedure is carried out by means of the semi-quantitative PCR technique with specific primers of E2F1 and Actin beta.
9.- Procedimiento de identificación según la reivindicación 1 caracterizado porque el procedimiento se lleva a cabo mediante la técnica de Northern blot con sondas de polinucleótidos específicas de los cDNAs de los genes E2F1 y ACTINA beta (SEQ ID NOl y 3) .9. Identification procedure according to claim 1, characterized in that the method is carried out by means of the Northern blot technique with specific polynucleotide probes of the cDNAs of the E2F1 and ACTINA beta genes (SEQ ID NO1 and 3).
10. Procedimiento de identificación según la reivindicación 1 caracterizado porque el procedimiento se lleva a cabo mediante la técnica de hibridación in situ con un precursor de E2F1. 10. Identification procedure according to claim 1, characterized in that the method is carried out by means of the in situ hybridization technique with an E2F1 precursor.
11. Procedimiento de identificación según la reivindicación 1 caracterizado porque la identificación de E2F1 de a) se refiere a la forma proteica del gen E2F1 (SEQ ID NO 2) y la identificación de ACTINA beta se refiere a su forma proteica (SEQ ID NO 4) y se lleva a cabo mediante el uso de anticuerpos específicos de la proteína E2F1 y ACTINA beta, respectivamente, en técnicas inmunológicas, por ejemplo, de inmunoblot o Western blot y de inmunohistoquímica .11. Identification procedure according to claim 1 characterized in that the identification of E2F1 of a) refers to the protein form of the E2F1 gene (SEQ ID NO 2) and the identification of ACTINA beta refers to its protein form (SEQ ID NO 4 ) and is carried out through the use of antibodies specific to the protein E2F1 and ACTINA beta, respectively, in immunological techniques, for example, immunoblot or Western blot and immunohistochemistry.
12.- Procedimiento de identificación según la reivindicación 11 caracterizado porque los anticuerpos son monoclonales o policlonales, fragmentos o derivados de los mismos.12. Identification method according to claim 11, characterized in that the antibodies are monoclonal or polyclonal, fragments or derivatives thereof.
13.- Procedimiento de identificación según las reivindicaciones 1 a la 12 caracterizado porque se realiza con el marcador E2F1 como único marcador o de forma conjunta con otros marcadores de LBE.13. Identification procedure according to claims 1 to 12, characterized in that it is carried out with the E2F1 marker as the sole marker or in conjunction with other LBE markers.
14.- Procedimiento de identificación según las reivindicaciones 1 a la 13 caracterizado porque se lleva a cabo formando parte de un microarray de expresión biológica, ya sea en forma génica -a partir de RNAm- o en forma de proteína.14. Identification procedure according to claims 1 to 13, characterized in that it is carried out as part of a biological expression microarray, either in gene form -from mRNA- or in the form of protein.
15.- Uso del procedimiento de identificación según las reivindicaciones 1 a la 14 para el diagnóstico de LBE a partir de muestras biológicas humanas aisladas del cuerpo humano.15. Use of the identification procedure according to claims 1 to 14 for the diagnosis of LBE from human biological samples isolated from the human body.
16.- Procedimiento de identificación y evaluación de la actividad de compuestos inhibidores de la proteína o del gen E2F1 útiles para el tratamiento del LBE caracterizado porque comprende los siguientes pasos: a) Puesta en contacto de un sistema biológico donde exista una expresión de E2F1 que produzca parcial o totalmente un fenotipo LBE con el compuesto candidato objeto de este procedimiento, e incubación en las condiciones adecuadas, b) determinación de un parámetro indicativo de disminución de los niveles de E2F1 o de regresión de un fenotipo LBE, e c) identificación de un compuesto inhibidor de la actividad de la proteína E2F1 cuando se observa una regresión de dicho fenotipo LBE o una disminución de los niveles de E2F1.16.- Procedure for the identification and evaluation of the activity of inhibitor compounds of the protein or of the E2F1 gene useful for the treatment of the LBE characterized in that it comprises the following steps: a) Contacting a biological system where there is an expression of E2F1 that partially or totally produce an LBE phenotype with the candidate compound object of this procedure, and incubation under the appropriate conditions, b) determination of an indicative parameter of decrease in E2F1 levels or regression of an LBE phenotype, ec) identification of a compound inhibiting the activity of the E2F1 protein when a regression of said LBE phenotype or a decrease in the E2F1 levels.
17.- Procedimiento de identificación y evaluación según la reivindicación 16 caracterizado porque el sistema biológico de a) consiste en una linea celular o un animal transgénico donde se encuentre regulada, de forma constante o condicionada, la expresión de la proteina E2F1, y donde su expresión provoca un fenotipo LBE o un incremento de E2F1.17. Identification and evaluation procedure according to claim 16, characterized in that the biological system of a) consists of a cell line or a transgenic animal where the expression of the E2F1 protein is regulated, in a constant or conditioned manner, and where its expression causes an LBE phenotype or an increase in E2F1.
18.- Procedimiento de identificación y evalua- ción según la reivindicación 16 caracterizado porque el parámetro indicativo de regresión de un fenotipo LBE de b) pertenece al siguiente grupo: formación de colonias en agar blando o formación de tumores in vivo; y en el caso de la disminución de la expresión de los niveles de E2F1 se lleva a cabo por las técnicas: PCR, Northern blot, inmunoblot e inmunohistoquímica .18. Identification and evaluation method according to claim 16, characterized in that the indicative regression parameter of an LBE phenotype of b) belongs to the following group: formation of soft agar colonies or in vivo tumor formation; and in the case of decreased expression of E2F1 levels it is carried out by the techniques: PCR, Northern blot, immunoblot and immunohistochemistry.
19.- Uso de un compuesto o agente inhibidor de la actividad de la proteina E2F1 en la elaboración de medicamentos o composiciones farmacéuticas para el tratamiento de pacientes humanos con LBE.19.- Use of a compound or agent that inhibits the activity of the E2F1 protein in the preparation of drugs or pharmaceutical compositions for the treatment of human patients with LBE.
20.- Uso de un compuesto o agente inhibidor de la actividad de la proteina E2F1 según la reivindicación 19 caracterizado porque es un ácido nucleico o polinu- cleótido que impide o disminuye la expresión del gen codificante de la proteina E2F1 humana y que incluye, al menos, una secuencia de nucleótidos seleccionada entre: a) una secuencia de nucleótidos antisentido especifica de la secuencia del gen o del mRNA de la proteina E2F1, b) una ribozima especifica del mRNA de la proteina E2F1, c) un aptámero especifico del mRNA de la proteina E2F1, d) un RNA de interferencia (iRNA) especifico del mRNA de la proteina E2F1, y e) un microRNA específico del mRNA de la proteína E2F1.20. Use of a compound or agent that inhibits the activity of the E2F1 protein according to claim 19, characterized in that it is a nucleic acid or polynucleotide that prevents or decreases the expression of the gene encoding the human E2F1 protein and that includes, at less, a nucleotide sequence selected from: a) a specific antisense nucleotide sequence of the gene or mRNA sequence of the E2F1 protein, b) a specific ribozyme of the E2F1 protein mRNA, c) a specific mRNA aptamer of the E2F1 protein, d) an interference RNA (iRNA) specific for the E2F1 protein mRNA, and e) a mRNA specific microRNA of the E2F1 protein.
21.- Uso de un compuesto o agente inhibidor de la actividad de la proteína E2F1 según la reivindicación 20 caracterizado porque el RNAi de d) es un RNAi, o mezcla de varios, perteneciente al siguiente grupo: SEQ21. Use of a compound or agent that inhibits the activity of the E2F1 protein according to claim 20, characterized in that the RNAi of d) is an RNAi, or mixture of several, belonging to the following group: SEQ
ID N05, SEQ ID N06 y SEQ ID N07.ID N05, SEQ ID N06 and SEQ ID N07.
22.- Composición farmacéutica o un medicamento para el tratamiento del LBE caracterizado porque com- prende una cantidad terapéuticamente efectiva de un compuesto o agente inhibidor de la proteína E2F1, junto con, opcionalmente, uno o más adyuvantes y/o vehículos farmacéuticamente aceptables.22.- Pharmaceutical composition or a medicament for the treatment of the LBE characterized in that it comprises a therapeutically effective amount of a compound or agent inhibiting the E2F1 protein, together with, optionally, one or more adjuvants and / or pharmaceutically acceptable carriers.
23.- Composición farmacéutica según la reivindi- cación 22 caracterizada porque el compuesto inhibidor es un ácido nucleico o polinucleótido que impide o disminuye la expresión del gen codificante de la proteína E2F1 humana y que incluye, al menos, una secuencia de nucleó- tidos seleccionada entre: a) una secuencia de nucleótidos antisentido especifica de la secuencia del gen o del mRNA de la proteína E2F1, b) una ribozima específica del mRNA de la proteína E2F1, c) un aptámero específico del mRNA de la proteína E2F1, d) un RNA de interferencia (iRNA) específico del mRNA de la proteína E2F1, y e) un microRNA específico del mRNA de la proteí- na E2F1.23.- Pharmaceutical composition according to claim 22 characterized in that the inhibitor compound is a nucleic acid or polynucleotide that prevents or decreases the expression of the gene encoding the human E2F1 protein and that includes at least one selected nucleotide sequence between: a) an antisense nucleotide sequence specific to the gene or mRNA sequence of the E2F1 protein, b) a specific m2NA ribozyme of the E2F1 protein, c) a specific mRNA aptamer of the E2F1 protein, d) a RNA interference (iRNA) specific for the mRNA of the E2F1 protein, and e) a microRNA specific for the mRNA of the E2F1 protein.
24.- Composición farmacéutica según la reivindicación 23 caracterizada porque el RNAi de d) es, al menos, un RNAi que pertenece al siguiente grupo: SEQ ID N05, SEQ ID N06 y SEQ ID N07. 24. Pharmaceutical composition according to claim 23, characterized in that the RNAi of d) is at least one RNAi belonging to the following group: SEQ ID N05, SEQ ID N06 and SEQ ID N07.
25.- Uso de la composición farmacéutica según las reivindicaciones 22 a la 24 en un método de tratamiento de un mamífero, preferentemente un ser humano, afectado por LBE, consistente en la administración de dicha composición terapéutica que inhibe el proceso patológico del LBE. 25.- Use of the pharmaceutical composition according to claims 22 to 24 in a method of treating a mammal, preferably a human being, affected by LBE, consisting in the administration of said therapeutic composition that inhibits the pathological process of the LBE.
PCT/ES2008/070182 2007-10-03 2008-10-02 Method for identifying patients with sporadic burkitt's lymphoma, identification method and use of compounds for the treatment of sporadic burkitt's lymphoma WO2009043959A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ESP200702595 2007-10-03
ES200702595 2007-10-03

Publications (1)

Publication Number Publication Date
WO2009043959A1 true WO2009043959A1 (en) 2009-04-09

Family

ID=40344540

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2008/070182 WO2009043959A1 (en) 2007-10-03 2008-10-02 Method for identifying patients with sporadic burkitt's lymphoma, identification method and use of compounds for the treatment of sporadic burkitt's lymphoma

Country Status (1)

Country Link
WO (1) WO2009043959A1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6187587B1 (en) * 2000-03-02 2001-02-13 Isis Pharmaceuticals, Inc. Antisense inhibition of e2f transcription factor 1 expression
US20060239990A1 (en) * 2003-04-30 2006-10-26 Nabel Elizabeth G Protein Arginine N-Methyltransferase 2 (PRMT-2)

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6187587B1 (en) * 2000-03-02 2001-02-13 Isis Pharmaceuticals, Inc. Antisense inhibition of e2f transcription factor 1 expression
US20060239990A1 (en) * 2003-04-30 2006-10-26 Nabel Elizabeth G Protein Arginine N-Methyltransferase 2 (PRMT-2)

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
AIELLO A ET AL: "Expression of differentiation and adhesion molecules in sporadic Burkitt's lymphoma.", HEMATOLOGICAL ONCOLOGY 1990 JUL-AUG, vol. 8, no. 4, July 1990 (1990-07-01), pages 229 - 238, XP002516044, ISSN: 0278-0232 *
FERRY JUDITH A: "Burkitt's lymphoma: clinicopathologic features and differential diagnosis.", THE ONCOLOGIST APR 2006, vol. 11, no. 4, April 2006 (2006-04-01), pages 375 - 383, XP002516045, ISSN: 1083-7159 *
LAI R ET AL: "Immunohistochemical detection of E2F-1 in non-Hodgkin's lymphomas: a survey of 124 cases.", MODERN PATHOLOGY : AN OFFICIAL JOURNAL OF THE UNITED STATES AND CANADIAN ACADEMY OF PATHOLOGY, INC MAY 1998, vol. 11, no. 5, May 1998 (1998-05-01), pages 457 - 463, XP008102537, ISSN: 0893-3952 *
MOLINA-PRIVADO ET AL.: "E2F1 expression is deregulated in Burkitt lymphoma cell lines and Tumour samples and might contribute to the lymphomagenesis of these Tumours", 19 February 2007 (2007-02-19), XP002516043, Retrieved from the Internet <URL:http://www.cnio.es/eventos/descargas/CCC/220242_1269,42_booklet.pdf> [retrieved on 20090218] *
PRIVADO I M ET AL: "Role of E2F1 in sporadic Burkitt lymphoma formation", EUROPEAN JOURNAL OF CANCER. SUPPLEMENT, PERGAMON, OXFORD, GB, vol. 6, no. 9, 1 July 2008 (2008-07-01), pages 74, XP022833805, ISSN: 1359-6349, [retrieved on 20080701] *

Similar Documents

Publication Publication Date Title
Wu et al. CircIRAK3 sponges miR-3607 to facilitate breast cancer metastasis
Lanfredini et al. RAS in pancreatic cancer
Ryu et al. Suppression of miRNA-708 by polycomb group promotes metastases by calcium-induced cell migration
Cui et al. Small nucleolar noncoding RNA SNORA23, up-regulated in human pancreatic ductal adenocarcinoma, regulates expression of spectrin repeat-containing nuclear envelope 2 to promote growth and metastasis of xenograft tumors in mice
Zhou et al. MiR-339-5p regulates the growth, colony formation and metastasis of colorectal cancer cells by targeting PRL-1
ES2900301T3 (en) Biomarkers associated with BRM inhibition
ES2447868T3 (en) BTK inhibitors for use in the treatment of epithelial tumors resistant to chemotherapeutic drugs
CN111278469A (en) Methods for treating triple negative breast cancer
Yu et al. AEG-1 contributes to metastasis in hypoxia-related ovarian cancer by modulating the HIF-1alpha/NF-kappaB/VEGF pathway
Tan et al. Interferon regulatory factor-1 suppresses DNA damage response and reverses chemotherapy resistance by downregulating the expression of RAD51 in gastric cancer
Dong et al. Decreased CUL4B expression inhibits malignant proliferation of glioma in vitro and in vivo
Zhu et al. SP1/AKT/FOXO3 signaling is involved in miR-362-3p-mediated inhibition of cell-cycle pathway and EMT progression in renal cell carcinoma
Wang et al. STK3 suppresses ovarian cancer progression by activating NF-κB signaling to recruit CD8+ T-cells
Luo et al. The function and clinical relevance of lncRNA UBE2CP3-001 in human gliomas
He et al. LncRNA‐EWSAT1 promotes hepatocellular carcinoma metastasis via activation of the Src‐YAP signaling axis
Yang et al. RETRACTED ARTICLE: MicroRNA-559 plays an inhibitory role in the malignant progression of glioblastoma cells by directly targeting metadherin
JP2016127833A (en) Fra-1 target gene as drug target for cancer treatment
ES2716241T3 (en) BARD1 isoforms in lung and colorectal cancer and their use
Luo et al. LncRNA CASC2 inhibits proliferation and migration of adenocarcinoma cells via miR‐4735‐3p and mTOR
CA2932910A1 (en) Methods for diagnosing and treating metastatic cancer
JP7249044B2 (en) Tumor cell malignant transformation inhibitor and antitumor agent
He et al. PPM1D accelerates proliferation and metastasis of osteosarcoma by activating PKP2
WO2009043959A1 (en) Method for identifying patients with sporadic burkitt&#39;s lymphoma, identification method and use of compounds for the treatment of sporadic burkitt&#39;s lymphoma
Liu et al. EZH2-mediated epigenetic suppression of SH3BGRL potently inhibits lung cancer progression
KR101083562B1 (en) Novel use of FLJ25416 gene

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08836288

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08836288

Country of ref document: EP

Kind code of ref document: A1