WO2009039586A2

WO2009039586A2 - Biomarkers for parkinson's disease

Info

Publication number: WO2009039586A2
Application number: PCT/AU2008/001437
Authority: WO
Inventors: Yue Huang; Dominic Rowe; Glenda Halliday
Original assignee: Powmri Limited
Priority date: 2007-09-28
Filing date: 2008-09-26
Publication date: 2009-04-02
Also published as: WO2009039586A3

Abstract

The present invention relates to biomarkers for Parkinson's disease (PD). In particular the biomarkers may be used in prognostic testing, to evaluate the effects of drugs and to assist in tailoring individual patient treatment.

Description

"Biomarkers for Parkinson's Disease"

Field of the Invention The present invention relates to biomarkers for Parkinson's disease (PD). In particular the biomarkers may be used in prognostic testing, to evaluate the effects of drugs and to assist in tailoring individual patient treatment.

Background of the Invention Any discussion of the prior art throughout the specification should in no way be considered as an admission that such prior art is widely known or forms part of the common general knowledge in the field.

Where references are cited throughout the specification, the relevant agents and/or methods disclosed in those cited references necessary to support the working of the invention disclosed herein are incorporated by reference into the present specification and no other material contained in those references is to be read into the disclosure of the present specification.

Parkinson 's disease (PD)

PD is a progressive neurodegenerative movement disorder that leads to severe difficulties with body motions, characterised by levodopa-responsive resting tremor, rigidity and/or bradykinesia. It is not fatal but progressive and incurable and, with time, severely affects quality of life. The incidence and prevalence of PD is similar throughout the world. It generally commences in middle or later life, affecting 1 to 2 per 1000 of the general population and up to 2 per 100 amongst people over 65 years of age. Approximately 78 000 Australians are affected by PD and 4 000 are diagnosed each year making it the second most common neurodegenerative disease after Alzheimer's disease. Similarly, 1.5 million Americans have PD, with 60,000 new cases diagnosed each year. In Europe, about 800,000 people are estimated to have PD, with about 75,000 new cases diagnosed every year. Studies also show that about 10% of elderly people who pass away from a non-brain illness have pre-symptomatic PD, indicating that there may be an additional 5 to 20 million people in the above regions who are unaware that they are developing PD. PD has an average age of onset of about 60 years, although younger people may also be diagnosed with "early-onset" PD with approximately 5 to 10 percent of patients being below the age of 40. Diagnosis and therapy There is no way to definitively diagnose PD in a living person. Currently, the diagnosis of PD is based on a combination of symptoms exhibited and eliminating other possible causes. Apart from the major symptoms of levodopa-responsive resting tremor, rigidity and/or bradykinesia, patients often suffer with depression, anxiety and emotional turmoil, and some severe cases can have intellectual impairment. Patients with PD experience the disease in difference ways, because the disease progression varies from patient to patient. At the time of diagnosis, a patient is faced with a vast array of information to take in at the same time as taking in the shock of the news. However, there is no test available to conclusively and non-invasively determine an individual stage of disease progression. The decision about treatment is difficult from the patient perspective and the different options in terms of management are characterised by various short and long term outcomes, which patients may value differently. Currently available therapies aim to improve the functional capacity of the patient for as long as possible. Even if medication and surgery are ever successful, they only relieve symptoms for a period of time. However, they do not halt progression of the disease. For example, L-dopa is currently the most prescribed medicine for PD but does not change the disease course or its progression. Medications are also typically effective over a limited period. They then become less effective due to disabling side-effects as the disease progresses, and the treatment becomes more difficult and complicated. There is no test available to determine when it is an appropriate time for a patient to start a particular treatment. Social impact of PD

PD causes significant personal, social and economic impact. It is estimated that a PD patient spends an average of $2,500 a year on medications. The economic burden of PD comes from indirect costs such as lost productivity, informal care provided by family members, nursing home expenditures and lost income, which are several times higher than direct medical costs. The total cost of PD is estimated to exceed $5.6,billion annually in the US, A$l billion in Australia, and about £1 billion in UK. Disease risk

Mutations in several genes (parkin, Omi, UCHLl, Pink 1, a-synuclein, DJ-I, LRRK2, ATPl 3 A2, Nurrl, GBA, synphilin-1) give rise to the disease in a small proportion of familial and sporadic PD patients. Out of the approximately 20,000- 25,000 genes in human DNA, polymorphisms of the above PD causative genes, and other genes such as MAPT, TH, DBH, D2 receptor, HOl, TNFa, iNOS, IL-I β, IFN-y, and IL-10 etc (as detailed in a review by Huang Y, Chan P and Halliday G, 2007), are known to be associated with the risk of contracting PD.

Disease progression

Once PD is contracted, the rate of disease progression can differ greatly between individuals (Lewis et al., 2005). Accordingly, some patients may experience only minor motor disruptions, while others become severely disabled. As such, assessing whether a patient is likely to experience slower or faster disease progression is of significant clinical importance, especially when determining individual treatments and appropriate care. Some known causative genetic risk factors do not seem to change the progression of the disease. For example, patients carrying LRRK2 G2019S or G2385R mutations have typical clinical manifestation indistinguishable from idiopathic PD patients, and polymorphisms associated with the causal risk or age at onset of PD, such as Parkin-258 T/G, also do not appear to be associated with changes in the progression of PD (unpublished data). Accordingly, while genetic variation plays a clear role in risk of acquiring PD, there is currently little evidence to suggest that genetic variation and disease progression are associated.

The severity of clinical disease and the rate of progression may be estimated using the Unified Parkinson's Disease Rating Scale (UPDRS) combined with the annualised change in the motor exam component. This is often used as an index to assess improvement in disease progression in clinical trials (Jankovic and Kapadia 2001). While this method is useful for determining the rate of PD progression, UPDRS is still a clinically intensive and a somewhat subjective method. In addition, the motor examinations must be repeated on at least two different occasions, preferably annually, in order to assess the likely rate of disease progression. It is an aim of the present invention to overcome or ameliorate at least one of the disadvantages of the prior art, or to provide a useful alternative.

Summary of the invention It has now been surprisingly found that certain a-synucleinltau haplotypes are associated with the rate of PD progression. More particularly, it has been found that a-synuclein and tau genotypes thought to associate with the level of expression of these genes are particularly useful for assessing the likely rate of PD progression. The genotyping information provides a relatively simple and rapid molecular prognostic test for estimating the likely rate of disease progression. In addition, the genotyping information may also be used as a biomarker for screening drugs for efficacy in the treatment of PD and to assist in the choice of individualised patient treatment.

According to a first aspect, there is provided a method of predicting the rate of PD progression and/or the relative risk of slow, intermediate or fast PD progression in a subject having PD including the steps of:

(a) determining the a-synuclein genotype of the subject; and/or

(b) determining the tau genotype of the subject; and

(c) using the a-synuclein and/or tau genotype determined in (a) and/or (b) to predict the likely rate at which said PD will progress in said subject and/or the subject's relative risk of slow, intermediate or fast PD progression by comparing the genotypes of the subject with predetermined data on association of the genotypes with PD progression.

Any part of the a-synuclein or tau genes, including their upstream and downstream non-coding and regulatory regions, that associate with the likely rate of PD progression may be used. Genotyping may be carried out by any suitable method known in the art, for example by using the polymerase chain reaction (PCR) to amplify the relevant nucleic acid sequences followed by restriction fragment length polymorphism analysis (RFLP), capillary electrophoresis, nucleic acid probe hybridisation, or matrix assisted laser desorption/ionisation-time of flight (MALDI- TOF) mass spectrometry. Real-time PCR with probe hybridisation and/or melt curve analysis may also be used. These and other methods of analysing repeat length polymorphisms and single nucleotide polymorphisms are well known in the art ( Lai Poh San and Eric P H Yap, 2000).

Any means by which to obtain genotype information can be used. A sample can be taken from the subject and tested. For example, blood or blood spots, buccal swabs, hair shaft, biopsies and the like may be used for DNA extraction. Preferably, a blood or buccal swab sample is used.

Preferably, one or more of the genotypes correlate with expression levels of genes encoding a-synuclein or tau. The a-synuclein genotype is preferably determined using the NACP-Repl promoter region of the a-synuclein gene, or REPl associated haplotypes. There is also a correlation between Repl and a set of SNPs lying between intron 4 and the 3 'region of the gene, with the risk alleles being present on two common haplotypes (Goris A. et al., 2007). The micro-satellite repeat (designated NACP-Repl), 10.7 kb region upstream of the a-synuclein translational start site, exhibits 5 common allele sizes in human populations. The locus consists of an

motif, with demonstrated size-related expression differences (Chiba-Falek O, et al. 2001; Farrer M, et al. 2001).

The tail genotype can be detected by any suitable means and is preferably determined by detecting the presence of the 238 bp intron 9 deletion corresponding to the tau H2 haplotype. The deletion is positioned between -951 and -713 nucleotides upstream of exon 10, which is inherited as part of the less common H2 extended haplotype (Baker et al. 1999). An individual either carries tau Hl /Hl genotype or non-Hl/Hl genotypes (including H1/H2 and H2/H2).

Preferably, the a-synuclein and tau genotype information is combined to predict whether PD will progress at a relatively slow, intermediate or fast rate and/or determine the subject's relative risk of slow, intermediate or fast PD progression. In one embodiment, the combined a-synuclein and tau genotype information is used to predict the rate of disease progression in a subject, whereby if the subject exhibits α- synuclein genotype 0/1 or 2/2 in combination with the tau HI/HI genotype, then the subject's disease is likely to progress at a relatively slow rate. In another embodiment, the combined a-synuclein and tau genotype information is used to predict the rate of disease progression in a subject, whereby if the subject exhibits a- synuclein genotype 0/1 or 2/2 in combination with the tau non-Hl/Hl genotype, the subject's disease is likely to progress at a relatively intermediate rate. In another embodiment, the combined a-synuclein and tau genotype information is used to predict the rate of disease progression in a subject, whereby if the subject exhibits a- synuclein genotype 0/0 or 2/2 in combination with the tau Hl /Hl genotype, the subject's disease is likely to progress at a relatively fast rate.

In the context of the present invention, we have assigned the terms slow, intermediate and fast rate of PD progression by reference to annual motor progression scores. Accordingly, in the context of the present invention a slow rate of PD progression has an assigned score of 3 or less (<3), an intermediate rate of progression has an assigned score of between 3-10 (>3 but <10), while a rapid rate has an assigned score of 10 or more (>10). However, the skilled addressee will appreciate that cut-off points in each category may be determined within other limits eg. a "slow" rate could be defined as ≤4 and other categories adjusted accordingly.

Moreover, the number of categories may be adjusted to less than or more than 3. For example, if appropriate, only two categories i.e. slow and fast may be used. In another alternative form, four or more categories within relevant limits may be used.

As such, a "predetermined rate" of PD progression may be slow, intermediate or fast, but it may also be any other appropriately designated rate as identified by the skilled addressee in light of the data available.

Accordingly, the interaction between the a-synuclein and tau genes appears to modify the rate of disease progression and the combinations indicated above are indicative of an interaction between the genotypes/haplo types that correlates with a slow, intermediate, or fast rate of disease progression.

According to a second aspect, there is provided a method of predicting the likely rate of PD progression and/or the relative risk of slow, intermediate or fast PD progression in a subject having PD from one or more samples taken from the subject including the steps of:

(a) determining the level of α-synuclein protein in the one or more samples; and/or (b) determining the level of tau protein in the one or more samples; and

(c) using the a-synuclein and/or tau protein levels to predict the rate at which the subject's disease is likely to progress and/or the subject's relative risk of slow, intermediate or fast PD progression by comparing the protein levels to predetermined data on association of protein levels with PD progression.

Data from blood samples of a-synuclein gene triplication and duplication cases show that α-synuclein and tau protein levels also relate to the level of gene expression (Miller, et al. 2004). Accordingly, α-synuclein and tau protein levels may also be used to predict the rate of PD progression by the methods of the present invention. For example, a blood sample may be used to determine the level of α- synuclein protein, and cerebrospinal fluid may be used to determine tau protein levels.

Preferably, the protein levels are determined using a method selected from the group consisting of: enzyme-linked immunosorbent assay (ELIZA), radioimmunoassay (RlA), Western blotting, and antibody array.

In one embodiment, the method is used to predict the likely rate of disease progression in a subject from one or more samples taken from the subject, whereby when the one or more samples exhibit either: (a) relatively low tau protein levels in combination with relatively low α- synuclein protein levels; or (b) relatively high tau protein levels in combination with relatively intermediate α-synuclein protein levels, then the subject's disease is likely to progress at a relatively slow rate.

In another embodiment, the method is used to predict the likely rate of disease progression in a subject from one or more samples taken from the subject, whereby when the sample or samples exhibit relatively low tau protein levels combined with δ

relatively high α-synuclein protein levels, the subject's disease is likely to progress at a relatively intermediate rate.

In a further embodiment, the method is used to predict the likely rate of disease progression in a subject from one or more samples taken from the subject, whereby, when the sample or samples exhibits relatively high tau protein levels combined with relatively low α-synuclein protein levels, the subject's disease is likely to progress at a relatively fast rate.

According to a third aspect, there is provided a method of predicting the rate of PD disease progression and/or the relative risk of slow, intermediate or fast PD progression in a subject having PD including determining the a-synuclein and/or the tau genotype and determining the α-synuclein and/or the tau protein level to obtain combined α-synuclein and tau genotype and protein information, wherein the information is used to predict the likely rate at which the subject's disease is likely to progress and/or the subject's relative risk of slow, intermediate or fast PD progression.

Genotype information and protein information for the genes of interest may be combined to predict the rate of PD progression. For example, α-synuclein protein levels and specific tau genotypes may both be determined from a blood sample and then used to predict the rate of progression. Alternatively, tau protein levels and the a-synuclein genotype of the subject may be determined.

According to a fourth aspect, there is provided a kit/gene chip including one or more nucleic acid primers specific for the a-synuclein gene and one or more nucleic acid primers specific for the tau gene for use in the method according to the first or third aspect.

Any suitable primers may be used to amplify a sequence from the a-synuclein or tau genes in the coding/non-coding/regulatory regions and it is well within the competence of the skilled addressee to identify suitable primers (Mueller JC, et al. 2005). The kit may also include reagents to assist in PCR or real-time PCR amplification and analysis, such as enzymes, buffer, fluorogenic probes and dyes and the like, or to assist in RFLP, capillary electrophoresis or MALDI-TOF mass spectrometry.

According to a fifth aspect, there is provided a kit including an antibody specific for the α-synuclein protein and an antibody specific for the tau protein for use in the method according to the second or third aspect.

Any antibody that is specific for the α-synuclein or tau protein may be used, for example, an α-synuclein antibody specific for the human α-synuclein protein (Masliah E et al., 2005).

According to a sixth aspect, there is provided a method of slowing the rate of

PD progression and/or reducing the relative risk of fast PD progression in a subject in need thereof including administering a therapeutically effective amount of an a- synuclein gene expression inhibitor and/or a tau gene expression inhibitor to the subject. In one embodiment, the a-synuclein gene expression inhibitor is preferably PARP-I.

Any therapeutically acceptable a-synuclein or tau gene inhibitor may be used. For example a short-interfering RNA specific for either gene may be used, or a suitable transcriptional regulator may be employed such as poly (ADP-ribose) polymerase family, member 1 (PARP-I), which regulates a-synuclein gene expression (Chiba-Falek et al., 2005).

According to a seventh aspect, there is provided a method of slowing the rate of PD progression and/or reducing the relative risk of fast PD progression in a subject in need thereof including administering a therapeutically effective amount of an α- synuclein protein inhibitor and/or a tau protein inhibitor to the subject. Preferably, the protein inhibitor is an antibody specific for the α-synuclein or tau protein, e.g., an α- synuclein antibody specific for the human α-synuclein protein (Masliah E et al., 2005). However, any reagent that performs the required function is contemplated.

According to an eighth aspect, there is provided the use of a therapeutically effective amount of an a-synuclein or tau gene expression inhibitor and/or an α- synuclein or tau protein inhibitor in the manufacture of a medicament for the treatment of PD to slow the progression of PD and/or reduce the relative risk of fast PD progression.

According to a ninth aspect, there is provided a method of screening a compound for efficacy in the treatment of PD including:

(a) contacting a cell that expresses the a-synuclein and/or tau gene with a compound; and

(b) measuring the expression of said the gene or genes to determine whether the compound modulates the expression level of the gene or genes in response to the treatment.

Preferably the compound decreases the expression level of the gene or genes in response to the treatment.

According to a tenth aspect, there is provided a method of screening a compound for efficacy in the treatment of PD including:

(a) obtaining a sample from a subject;

(b) determining the level of a-synuclein and/or tau gene expression from the sample; or measuring α-synuclein and/or tau protein levels from the sample;

(c) administering a compound to the subject;

(d) obtaining a further sample from the subject;

(e) determining the level of a-synuclein and/or tau gene expression from the sample; or measuring α-synuclein and/or tau protein levels from the sample; (f) comparing the difference in gene expression or protein levels between the samples to determine whether the compound modulates the expression or the protein levels.

Preferably, the efficacy relates to the ability of the compound to slow the progression of PD and/or reduce the relative risk of fast PD progression.

According to an eleventh aspect, there is provided a method of determining the likelihood that a subject that exhibits an observed rate of PD progression also suffers from a second neurological disease including: predicting the subject's rate of PD progression using any one of the methods of the first, second or third aspects and comparing the predicted rate with the observed rate, whereby when the observed rate is substantially faster than the predicted rate, the likelihood that the subject is also suffering from a second neurological disease is increased.

Preferably the method further includes at least one clinical motor examination to observe the rate of disease progression. More preferably, the at least one clinical motor examination is the motor component of UPRDS-III examination.

The method can be used to evaluate a subject's co-existing disorders to reduce unnecessary medication cost. For example, as people age, they may have one or many cerebral disorders at the same time. Accordingly, where the method of the invention is used to predict that a subject's PD will progress slowly, yet the subject exhibits what appears to be a more rapid rate of PD progression, this may be used to deteπnine the likelihood that the subject is also suffering from another cerebral disorder or at least to indicate to a physician when further tests for other conditions should be conducted. Accordingly, additional testing may then be done to deteπnine the nature of the other disorder or disorders to assist in determining the appropriate treatment for the subject.

In a further embodiment, the methods of the invention are used to determine a therapeutic regimen for the subject.

According to a twelfth aspect, there is provided a method of predicting the rate of PD progression and/or the relative risk of slow, intermediate or fast PD progression in a subject having PD from a sample taken from the subject including determining the NCAP-REPl "O"allele dosage in the subject from the sample and using the NCAP-REPl "(Tallele dosage information or REPl associated NCAP haplotype to estimate the likely rate at which the PD will progress in the subject or to estimate the subject's relative risk of slow, intermediate or fast PD progression.

According to a thirteenth aspect, there is provided a method of predicting the rate of PD progression in a subject having PD including the steps of:

(a) determining the a-synuclein genotype of the subject; and/or (b) determining the tau genotype of the subject; and

(c) using the a-synuclein and/or the tau genotype determined in (a) and/or

(b) to predict the likely rate at which the PD will progress in the subject by comparing the genotypes of the subject with predetermined data on association of the genotypes with PD progression.

According to a fourteenth aspect, there is provided a method of predicting the rate of PD progression in a subject having PD including the steps of:

(a) determining the a-synuclein genotype of the subject; and

(b) determining the lau genotype of the subject; and (c) using the a-synuclein and the ton genotype determined in (a) and (b) to predict the likely rate at which the PD will progress in the subject by comparing the genotypes of the subject with predetermined data on association of the genotypes with PD progression.

According to a fifteenths aspect, there is provided a method of predicting the relative risk of a subject's PD progressing at a predetermined rate including the steps of:

(a) determining the a-synuclein genotype of the subject; and/or

(b) determining the tau genotype of the subject; and (c) using the a-synuclein and/or the tau genotype determined in (a) and/or

(b) to predict the likely rate at which the PD will progress in the subject by comparing the genotypes of the subject with predetermined data on association of the genotypes with PD progression. According to a sixteenth aspect, there is provided a method of predicting the relative risk of a subject's PD progressing at a predetermined rate including the steps of: (a) determining the a-synuclein genotype of the subject; and

(b) determining the tau genotype of the subject; and

(c) using the a-synuclein and the tau genotype determined in (a) and (b) to predict the likely rate at which the PD will progress in the subject by comparing the genotypes of the subject with predetermined data on association of the genotypes with PD progression.

According to a seventeenth aspect, there is provided a method of predicting the relative risk of a subject's PD progressing at a predetermined rate including the steps of: (a) determining the level of a-synuclein protein in the one or more samples; and/or

(b) determining the level of tau protein in the one or more samples; and

(c) using the a-synuclein and/or tau protein levels to predict the rate at which the subject's disease is likely to progress and/or the subject's relative risk of slow, intermediate or fast disease progression by comparing the protein levels of the subject with predetermined data on association of the genotypes with PD progression.

According to a eighteenth aspect, there is provided a method of predicting the relative risk of a subject's PD progressing at a predetermined rate including the steps of:

(a) determining the level of a-synuclein protein in the one or more samples: and

(b) determining the level of tau protein in the one or more samples; and (c) using the a-synuclein and lew protein levels to predict the rate at which the subject's PD is likely to progress by comparing the protein levels of the subject with predetermined data on association of the genotypes with PD progression. A preferred embodiment of the invention will now be described, by way of example only.

Detailed Description of the Invention

The invention will now be described with reference to the following examples to illustrate preferred embodiments only and does not serve to limit the invention.

Example 1 In this pilot study, the variation in the NACP-Repl promoter region of the a- synuclein gene and its interaction with tau haplotype were analysed to determine any association between the genotypes/haplotypes and PD disease progression.

Methods Between 2002 and 2005, one hundred and twenty-three PD patients (66 male,

57 female) satisfying the UK PD Society Brain Bank Clinical Diagnostic Criteria for PD were recruited from the movement disorder clinic at the Royal North Shore Hospital (RNH), Sydney, Australia for neurological examination and blood donation for research purposes. The study was approved by the Human Ethics committees of the participating institutions, and all patients were followed up by movement disorder neurologists for at least one year to exclude other parkinsonism (progressive supranuclear palsy, multiple system atrophy, and dementia with Lewy body, etc). At recruitment, a standard questionnaire was completed to obtain detailed information on disease onset (age when two of the three cardinal PD symptoms was obtained), symptoms at onset, levodopa administration and response. The motor part of the

UPDRS was used to assess the patient's disease severity in the "on" state and disease progression calculated using their motor UPDRS score divided by disease duration. The average age at recruitment (±standard deviation) was 68±9 years with an average onset age of 60±l 1 years and average disease duration of 8±7 (1-40 years). Between 2006 and 2008, a further sixty-four PD patients (40 male, 24 female) were recruited from the RNH through the same standardised procedure as the above. UPDRS score of each patient was assessed. The average age at recruitment (±standard deviation) was 68±11 years with an average onset age of 60±13 years and average disease duration of 8±7 (1-33 years).

NACP-Repl genotyping and allele designations followed those previously described (Farrer M, 2001). Briefly, genomic DNA was extracted from blood leukocytes and the appropriate target amplified using the following primer sequences: [Hex]5'-CCTGGCATATTTGATTGCAA-3' (sense);

GACTGGCCCAAGATTAACCA-3' (antisense). Genotypes were determined by realtime gel electrophoresis (Gel-Scan 2000, Corbett Research, Australia) and confirmed by capillary electrophoresis at the Australian Genome Research Facility (AGRF,

Melbourne, Australia). The micro -satellite repeat (designated NACP-Repl), 10.7 kb region upstream of a-synuclein translational start site, exhibits 5 common allele sizes in human populations. PCR product length of 265bp=allele -1, 267bp=allele 0, 269bp=allele 1, 271bp=allele 2, 273bp=allele 3. The locus consists of a (TC),(T)₂(TC)y(TA)₂(CA)_lr motif, with demonstrated size-related expression differences (Chiba-Falek O₃ et al. 2001; Farrer M, et al. 2001). While not wishing to be bound by theory, allelic variability within the a-synuclein gene promoter at the NACP-Repl site is considered to regulate gene expression and is implicated as a causal risk factor for sporadic PD (Farrer, et al., 2001 ; Chiba-Falek and Nussbaum RL, 2001; Pals et al., 2004). The (+1) allele is considered to exhibit a three-fold greater expression relative to the (0) allele. Similarly, the (+2) and (+3) alleles show 1.5-fold and 2.5-fold increases relative to the (0) allele, respectively (Chiba-Falek O and Nussbaum RL, 2001; Xia Y. et al., 1996).

Tau haplo types were determined by the presence of the 238 bp intron 9 deletion (between -951 and -713 nucleotides upstream of exon 10) of the H2 haplotype. The region spanning the deletion was amplified using PCR primers, GGAAGACGTTCTCACTGATCTG (sense) and AGGAGTCTGGCTTCAGTCTCTC (antisense), and PCR products visualized and sized on agarose gels (Baker M, et al. 1999). Alternatively, SNPl (rsl7650901) lies in exon 1 and has been shown to be in complete linkage disequilibrium (LD) with the 238 bp insertion deletion polymorphism in intron 9 used in this study to define the Hl and H2 haplotypes (Barker et al. 1999). Polymorphisms in the tau gene are in LD with its promoter, with higher tau expression associated with the Hl haplotype (Kwok J. et al. 2004). The Hl haplotype of the tau gene is significantly over-represented in patients with sporadic PD (Kwok J. et al. 2004). Again, neither gene expression nor genotypes have been directly correlated with prognostic outcomes.

PD cases were grouped according to allele variants and their predicted a-synuclein expression levels into low (genotype 0/0 and 0/2), intermediate (genotype 0/1 and 2/2), and high (genotype 1/1 and 1/2) expressors. The rarely occurring H1/H2 and H2/H2 tau genotypes display distinctive expression of tau when compared to the HI/HI genotype. While the HI/HI genotype represents high expression of tau, the "non-Hl/Hl" genotype represents low expression of tau and combines data from H1/H2 and H2/H2 genotypes. SPSS-multivariate analysis was used to assess the association between disease progression and gene expressors. Two way SPSS- ANOVA was used to analyse the association between allele frequency and disease progression. Relative risk analysis was carried out in terms of gene expressors and genotypes, respectively.

Results on the first cohort

No +3 or -1 NACP-Repl alleles were identified. NACP-Repl allele frequencies of 27% for 0, 62% for 1, and 11% for 2. NACP-Repl genotype frequencies were 11.5%, 28%, 4%, 42%, 12%, and 2.5% for genotypes 0/0, 0/1, 0/2, 1/1, 1/2, and 2/2 respectively. The frequency of tau HI/HI genotype was 69.7% and tau Hl haplotype was 84.4%. Disease progression varied from 0.5 to 24.0, with an average progression of 4.8 UPDRS points/year.

There was a high variation in disease progression for the same NACP-Repl genotype carriers (Table IA). Some differences between the rates of PD progression are associated with the a-synuclein gene alone. The tau gene alone did not appear to have a significant effect on disease progression (Table IB) and, indeed, if there was any effect it would appear to indicate that low tau is associated with a higher progression score. However, the a-synuclein and tau genotypes and inferred expression levels surprisingly appear to interact to modify the rate of PD progression (Table IA) in a manner not previously known, (ANOVA_sy_nucι_eι_n ⁼1.89, p=0.16,

p=0.04). In patients with lower tau expression, there was an increase in the rate of disease progression with increasing α- synuclein expression. In patients with higher tau expression, there was a significant increase in the rate of disease progression only for patients also with low α-synuclein expression.

Table IA. The effect of the a-synuclein gene (AS) alone or the a-synuclein gene in combination with the tau HI/HI gene on the progression of PD

AS NACP- AS alone In tau Hl /Hl subgroup In te/ non-Hl/H I

Expression Repl with high tau subgroup with low tau

Level Genotype expression expression

Number PD Number PD Number PD of progression of progression of progression subjects score subjects score subjects score

(±SEM) (±SEM) (±SEM)

Low 0/0 20 6.1 ± 1.4 14 7.8 ± 1.8 6 2.2±0.57

0/2

Intermediate 0/1 37 3.1 ± 0.6 21 2.3 ± 15 4.1±l.l

2/2 * 0.3***

High 1/2 66 5.4 ± 0.6 51 5.6 ± 0.7 15 4.7±0.8

1/1

* p=0.03; ***p=0.005

Table IB. The effect of the tau gene alone on the progression of PD

Tau Expression Tau alone

Level Number of subjects PD progression score (±SEM)

Low (non-Hl/Hl) 37 5.1 ± 0.5

High (Hl/Hl) 86 4.0 ± 0.6

It should be noted that the progression score values shown in Tables IA, IB and 2 (below) represent average values in each group with error bars based on the standard error of the mean (SEM) and the overall average progression score across all subjects was 4.8 ± 0.4. Accordingly, several of these groups include some subjects that have slow progression (having a PD progression score of 3 or less (<3), intermediate progression (a score of >3 but <10) or fast progression (having a score of >10).

To address the allelic contribution to disease progression, the genotypes were grouped according to individual allele number of a-synuclein and tau. Cases with one rather than two or no '0' allele of NACP-Repl have significantly slower disease progression (p<0.05, Table 2). However, when stratified for tau haplotype, given that '0' homozygotes (low expressors) have a reduced risk for developing PD (Mellick, et al. 2005), their progression could surprisingly be more than three times different depending on the expression level of tau (Table 2; noting that Table 2 provides means and not absolute numbers).

Table 2. Correlation between progression of PD and the NACP-Repl "0"allele dosage

*/K0.05

Genotypes were again grouped to observe their contribution to the relative risk of fast progression as shown in Table 3 A. Table 3A. Relative risk (RR) analysis of a-synuclein and tau expression on PD progression with a-synuclein genotypes having similar expression levels grouped.

The numbers of subjects in each category is shown in Table 3 A. Percentages indicate the number of subjects in each category as a percentage of the total number of subjects in the slow/intermediate or fast progression groups, which indicates where slow/intermediate or fast progressing subjects are clustered with regard to haplotype. A relative risk of >1 indicates an increased likelihood of a subject having rapid disease progression and a relative risk of <1 indicates a decreased risk of rapid progression. Referring to Table 3A, eighteen PD patients (15%) had a rapid progression of disease. Patients with low a-synuclein and high tau expression had 4.38 times greater probability of developing a rapid disease progression. Those carrying the 0/0 genotype of NACP-Repl and the Hl /Hl genotype of tau had the highest probability of developing rapid disease progression (RR=5.84 Table 3B). Patients with intermediate a-synuclein and high tau expression tend to have slower disease progression, particularly patients carrying the 01 genotype of NACP-Repl and Hl /Hl genotype of tau. Table 3B. Relative risk analysis of a-synuclein and tau genotypes on PD progression.

Results for the combined cohort:

The trends observed for the first data set (Table 3B) have been strengthened with additional data and the calculated relative risks are detailed in Table 3 C.

Table 3C. Relative risk analysis of a-synuclein and tau genotypes on PD progression

The number of subjects in each category is shown in Table 3B and 3C. Percentages indicate the number of subjects in each category as a percentage of the total number of subjects for the said group with slow/intermediate or fast disease progression. As can be seen, approximately 85% of all subjects exhibited slow/intermediate disease progression, while about 15% of subjects had a rapid disease progression. The relative risk is estimated in relation to the risk ratio of the proportion of subjects in fast disease progression group vs. the proportion of subjects in slow/intermediate disease progression group in each category with a combination genotype of a-synuclein and tau. A relative risk of >1 indicates an increased likelihood of a subject having a rapid disease progression and a relative risk of <1 indicates a decreased risk of rapid progression. Tables 3B and 3C refer in some categories to the relative risks of developing fast PD progression as "uncertain". This is a result of the cohort sizes and the low numbers of subjects in these categories. It is well within the competence of the skilled addressee to expand the cohort size in order to obtain sufficient data for analysing the relative risks in the respective categories.

While tables 3A, 3B and 3C show the slow and intermediate expression groups combined, the likely rate of progression and the relative risk of slow/intermediate or fast progression can each be ascertained by the methods of the invention. It can be seen that genotyping a-synuclein alone or tau alone provides some predictive value in regard to the likely rate of progression and the relative risk of slow/intermediate and fast progression. However, the predictive accuracy is increased when the a-synuclein and tau genotype/inferred expression data is combined.

Example 2

Due to the disease progression rate varying among patients, it is always difficult for a pharmaceutical company to evaluate a new drug for PD. This invention can stratify PD patients before clinical trial, which will make the clinical trial more reliable and informative, because it reduces the major influential factor of patient variations in the trial. For example, subjects could be ranked or grouped by their predicted rate of disease progression and/or relative risk of developing fast disease progression and the effect of the treatment could then be assessed in view of the risk profile and likely rate of progression for a given subject or group.

Example 3

The method of the invention was used to determine whether a subject that exhibited a rapid observed rate of PD progression also suffered from a second neurological disease.

Firstly, the rate of PD progression was estimated by genotyping, as per Example 1 and the test indicated that the patient/subject's PD would be likely to progress slowly. Clinical motor examination (UPDRS-III) was also used to compare the estimated likely rate with the observed rate, whereupon it was noted that the patient's condition was deteriorating more rapidly than expected, such that the observed rate of progression was faster than the predicted rate. This indicated that the subject may also have been suffering from a second neurological disease (or possibly more than one other disorder), which also contributed to their deterioration. As such, a CT scan was conducted for the patient, which confirmed that they also suffered from multiple lacunes (stroke) in the basal ganglia (a region that is also affected by PD). Accordingly, the most appropriate treatment could then be determined.

Although the invention has been described with reference to specific examples, it will be appreciated by those skilled in the art that the invention may be embodied in many other forms.

References:

1. Jankovic J, Kapadia AS: Functional decline in Parkinson disease, Arch Neurol 2001, 58:161 1-1615

2. Lewis SJ, Foltynie T, Blackwell AD, Robbins TW, Owen AM. Barker RA: Heterogeneity of Parkinson's disease in the early clinical stages using a data driven approach, J Neurol Neurosurg Psychiatry 2005, 76:343-348

3. Farrer M, Maraganore DM, Lockhart P, Singleton A, Lesnick TG, de Andrade M, West A, de Suva R, Hardy J, Hernandez D: alpha- Synuclein gene haplotypes are associated with Parkinson's disease, Hum MoI Genet 2001, 10:1847- 1851

4. Chiba-Falek O, Nussbaum RL: Effect of allelic variation at the NACP- Repl repeat upstream of the alpha-synuclein gene (SNCA) on transcription in a cell culture luciferase reporter system, Hum MoI Genet 2001, 10:3101-3109

5. Pals P, Lincoln S, Manning J, Heckman M, Skipper L, Hulihan M, Van den Broeck M, De Pooter T, Cras P, Crook J, Van Broeckhoven C, Farrer MJ: alpha-

Synuclein promoter confers susceptibility to Parkinson's disease, Ann Neurol 2004, 56:591-595

6. Xia Y, Rohan de Silva HA, Rosi BL, Yamaoka LH, Rimmler JB, Pericak-Vance MA, Roses AD, Chen X, Masliah E, DeTeresa R₃ Iwai A, Sundsmo M, Thomas RG, Hofstetter CR, Gregory E, Hansen LA, Katzman R, Thai LJ, Saitoh T: Genetic studies in Alzheimer's disease with an NACP/alpha-synuclein polymorphism, Ann Neurol 1996, 40:207-215

7. Baker M, Litvan I, Houlden H, Adamson J, Dickson D, Perez-Tur J₃ Hardy J, Lynch T, Bigio E, Hutton M. Association of an extended haplotype in the tau gene with progressive supranuclear palsy. Hum MoI Genet 1999, 8(4):711-5.

8. Mellick GD, Maraganore DM, Silburn PA: Australian data and metaanalysis lend support for alpha-synuclein (NACP-Repl) as a risk factor for Parkinson's disease, Neurosci Lett 2005, 375:112-116

9. Masliah E, Rockenstein E, Adame A, Alford M, Crews L, Hashimoto M, Seubert P, Lee M, Goldstein J, Chilcote T, Games D, Schenk D: Effects of alpha- synuclein immunization in a mouse model of Parkinson's disease, Neuron 2005, 46:857-868

10. Chiba-Falek O, Kowalak JA, Smulson ME, Nussbaum RL: Regulation of alpha-synuclein expression by poly (ADP ribose) poIymerase-1 (PARP-I) binding to the NACP-Repl polymorphic site upstream of the SNCA gene, Am J Hum Genet 2005, 76:478-492

11. Huang Y, Chan P, Halliday G. Chapter of "Genetics of Parkinson's disease" in the book of "Oxidative stress and neurological disorders". Qureshi GA and Parvez SH, Elsevier Publication Company, The Netherland, page: 663-688, 2007.

12. Kwok JB, Teber ET, Loy C, Hallupp M, Nicholson G, Mellick GD, Buchanan DD, Silburn PA, Schofield PR.Tau haplotypes regulate transcription and are associated with Parkinson's disease. Ann Neurol 2004, 55(3):329-34.

13. Miller DW, Hague SM, Clarimon J, Baptista M, Gwinn-Hardy K, Cookson MR, Singleton AB. Alpha-synuclein in blood and brain from familial

Parkinson disease with SNCA locus triplication. Neurology 2004, 25;62(10): 1835-8.

14. Goris A, Williams-Gray CH, Clark GR, Foltynie T, Lewis SJ, Brown J, Ban M, Spillantini MG, Compston A, Burn DJ, Chinnery PF, Barker RA, Sawcer SJ.. Tau and alpha-synuclein in susceptibility to. and dementia in, Parkinson's disease. Ann Neurol 2007, 62(2): 145-53.

15. Lai Poh San and Eric P H Yap. Frontiers in Human Genetics: Diseases and Technologies. Page: 3-79, 2000

16. Mueller JC, Fuchs J, Hofer A, Zimprich A, Lichtner P, Illig T, Berg D, Wϋllner U, Meitinger T, Gasser T. Multiple regions of alpha-synuclein are associated with Parkinson's disease. Ann Neurol. 2005, 57(4):535-41.

Claims

THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS:-

1. A method of predicting the rate of PD progression and/or the relative risk of slow, intermediate or fast PD progression in a subject having PD including the steps of:

(a) determining the a-synuclein genotype of the subject; and/or

(b) determining the tau genotype of the subject; and

(c) using the a-synuclein and/or the tau genotype determined in (a) and/or (b) to predict the likely rate at which said PD will progress in said subject and/or the subject's relative risk of slow, intermediate or fast PD progression by comparing the genotypes of the subject with predetermined data on association of the genotypes with PD progression.

2. The method of claim 1, wherein one or more of said genotypes correlate with expression levels of genes encoding a-synuclein or tau.

3. The method according to claim 1 or claim 2, wherein said a-synuclein genotype is determined using the NACP-REPl promoter region of the a-synuclein gene, or REPl associated haplotypes.

4. The method according to any one of the preceding claims, wherein said tau genotype is determined by detecting the presence or absence of the 238 bp intron 9 deletion corresponding to the tau H2 haplotype.

5. The method according to any one of the preceding claims, wherein information obtained in (a) and (b) relating to said a-synuclein and tau genotypes is combined to predict whether said PD will progress at a relatively slow, intermediate or fast rate and/or determine said subject's relative risk of slow/intermediate or fast PD progression.

6. Use of the method according to claim 5 to predict the rate of disease progression in a subject, whereby if the subject exhibits a-synuclein genotype 0/1 or 2/2 in combination with the tau HI/HI genotype, the subject's disease is likely to progress at a relatively slow rate.

7. Use of the method according to claim 5 to predict the rate of disease progression in a subject, whereby if the subject exhibits a-synuclein genotype 0/1 or 2/2 in combination with the tau non-Hl/Hl genotype , the subject's disease is likely to progress at a relatively intermediate rate.

8. Use of the method according to claim 5 to predict the rate of disease progression in a subject, whereby if the subject exhibits a-synuclein genotype 0/0 or 2/2 in combination with the tau Hl /Hl genotype, the subject's disease is likely to progress at a relatively fast rate.

9. A method of predicting the likely rate of PD progression and/or the relative risk of slow, intermediate or fast PD progression in a subject having PD from one or more samples taken from the subject including the steps of:

(a) determining the level of α-synuclein protein in said one or more samples; and/or

(b) determining the level of tau protein in said one or more samples; and (c) using the α-synuclein and/or tau protein levels to predict the rate at which said subject's disease is likely to progress and/or the subject's relative risk of slow, intermediate or fast disease progression by comparing the protein levels of the subject with predetermined data on association of the genotypes with PD progression.

10. The method according to claim 9, wherein said protein levels are determined using a method selected from the group consisting of: enzyme-linked immunosorbent assay (ELIZA), radioimmunoassay (RIA), western blotting, and antibody array.

11. Use of the method of claim 9 or claim 10 to predict the likely rate of disease progression in a subject from one or more samples taken from the subject, whereby when said one or more samples exhibit either:

(a) relatively low tau protein levels in combination with relatively low α- synuclein protein levels; or (b) relatively high tau protein levels in combination with relatively intermediate α-synuclein protein levels, then said subject's disease is likely to progress at a relatively slow rate.

12. Use of the method of claim 9 or claim 10 to predict the likely rate of disease progression in a subject from one or more samples taken from the subject, whereby when said one or more samples exhibit relatively low tau protein levels combined with relatively high α-synuclein protein levels, the subject's disease is likely to progress at a relatively intermediate rate.

13. Use of the method of claim 9 or claim 10 to predict the likely rate of disease progression in a subject from one or more samples taken from the subject, whereby when said one or more samples exhibit relatively high tau protein levels combined with relatively low α-synuclein protein levels, the subject's disease is likely to progress at a relatively fast rate.

14. A method of predicting the rate of PD disease progression and/or the relative risk of slow, intermediate or fast PD progression in a subject having PD including determining the a-synuclein and/or the tau genotype and determining the α-synuclein and/or the tau protein level to obtain combined α-synuclein and tau genotype and protein information, wherein said information is used to predict the rate at which said subject's disease is likely to progress and/or the subject's relative risk of slow, intermediate or fast PD progression.

15. A kit/gene chip including one or more nucleic acid primers specific for the a- synuclein gene and one or more nucleic acid primers specific for the tau gene for use in the method of any one of claims 1 to 8 or 14.

16. A kit including an antibody specific for the α-synuclein protein and an antibody specific for the tau protein for use in the method of any one of claims 9-14.

17. A method of slowing the rate of PD progression and/or reducing the relative risk of fast PD progression in a subject in need thereof including administering a therapeutically effective amount of an a-synuclein gene expression inhibitor and/or a tau gene expression inhibitor to said subject.

18. The method of claim 17, wherein said a-synuclein gene expression inhibitor is PARP-I.

19. A method of slowing the rate of PD progression and/or reducing the relative risk of fast PD progression in a subject in need thereof including administering a therapeutically effective amount of an α-synucleih protein inhibitor and/or a tau protein inhibitor to said subject.

20. The method of claim 19, wherein said protein inhibitor is an antibody specific for said α-synuclein or tau protein. .

21. Use of a therapeutically effective amount of an a-synuclein or tau gene expression inhibitor and/or a α-synuclein or tau protein inhibitor in the manufacture of a medicament for the treatment of PD to slow the progression of PD and/or reduce the relative risk of fast PD progression.

22. A method of screening a compound for efficacy in the treatment of PD including:

(b) measuring the expression of said gene or genes to determine whether said compound modulates the expression level of said gene or genes in response to said treatment.

23. A method of screening a compound for efficacy in the treatment of PD wherein said compound decreases the expression level of said gene or genes in response to said treatment.

24. A method of screening a compound for efficacy in the treatment of PD including:

(a) obtaining a sample from a subject; (b) determining the level of a-synuclein and/or tau gene expression from said sample; or measuring α-synuclein and/or tau protein levels from said sample;

(c) administering a compound to said subject;

(d) obtaining a further sample from said subject; (e) determining the level of α-synuclein and/or tau gene expression from said sample; or measuring α-synuclein and/or tau protein levels from said sample;

(f) comparing the difference in gene expression or protein levels between said samples to determine whether said compound modulates said expression or said protein levels.

25. The method of claim 23 or claim 24, wherein said efficacy relates to the ability of said compound to slow the progression of PD and/or to reduce the relative risk of fast PD progression.

26. A method of determining the likelihood that a subject that exhibits an observed rate of PD progression also suffers from a second neurological disease including: predicting the subject's rate of PD progression using any one of the methods of claims 1 to 14 and comparing the predicted rate with the observed rate, whereby when said observed rate is substantially faster than said predicted rate, the likelihood that said subject is also suffering from a second neurological disease is increased.

27. The method according to claim 26, further including at least one clinical motor examination to observe the rate of disease progression.

28. The method according to claim 27, wherein said at least one clinical motor examination is the motor component of the UPDRS-III examination.

29. The method of any one of claims 1 to 14, 24, or 26 to 28, to determine a therapeutic regimen for said subject.

30. A method of predicting the rate of PD progression and/or the relative risk of slow, intermediate or fast PD progression in a subject having PD from a sample taken from the subject including determining the NCAP-REPl "0"allele dosage in the subject from the sample and using the NCAP-REPl "O"allele dosage information or REPl associated NCAP haplotype to estimate the likely rate at which said PD will progress in said subject or to estimate the subject's relative risk of slow, intermediate or fast PD progression.

31. A method of predicting the rate of PD progression in a subject having PD including the steps of:

(a) determining the a-synuclein genotype of the subject; and/or

(b) to predict the likely rate at which said PD will progress in said subject by comparing the genotypes of the subject with predetermined data on association of the genotypes with PD progression.

32. A method of predicting the rate of PD progression in a subject having PD including the steps of:

(a) determining the a-synuclein genotype of the subject; and

(b) determining the tau genotype of the subject; and

(c) using the a-synuclein and the tau genotype determined in (a) and (b) to predict the likely rate at which said PD will progress in said subject by comparing the genotypes of the subject with predetermined data on association of the genotypes with PD progression.

33. A method of predicting the relative risk of a subject's PD progressing at a predetermined rate including the steps of:

(a) determining the a-synuclein genotype of the subject; and/or

(b) determining the tau genotype of the subject; and

(c) using the a-synuclein and/or the tau genotype determined in (a) and/or (b) to predict the likely rate at which said PD will progress in said subject by comparing the genotypes of the subject with predetermined data on association of the genotypes with PD progression.

34. A method of predicting the relative risk of a subject's PD progressing at a predetermined rate including the steps of:

(a) determining the a-synuclein genotype of the subject; and

(b) determining the tau genotype of the subject; and (c) using the a-synuclein and the tau genotype determined in (a) and (b) to predict the likely rate at which said PD will progress in said subject by comparing the genotypes of the subject with predetermined data on association of the genotypes with PD progression.

35. A method of predicting the relative risk of a subject's PD progressing at a predetermined rate including the steps of:

(a) determining the level of a-synuclein protein in said one or more samples; and/or

(b) determining the level of tan protein in said one or more samples; and (c) using the a-synuclein and/or tau protein levels to predict the rate at which said subject's disease is likely to progress and/or the subject's relative risk of slow, intermediate or fast disease progression by comparing the protein levels of the subject with predetermined data on association of the genotypes with PD progression.

36. A method of predicting the relative risk of a subject's PD progressing at a predetermined rate including the steps of:

(a) determining the level of a-synuclein protein in said one or more samples; and (b) determining the level oϊtau protein in said one or more samples; and _'

(c) using the a-synuclein and tau protein levels to predict the rate at which said subject's PD is likely to progress by comparing the protein levels of the subject with predetermined data on association of the genotypes with PD progression.