WO2009035554A2 - Superior structure stability and selectivity of hairpin nucleic acid probes with an l-dna stem - Google Patents

Superior structure stability and selectivity of hairpin nucleic acid probes with an l-dna stem Download PDF

Info

Publication number
WO2009035554A2
WO2009035554A2 PCT/US2008/010466 US2008010466W WO2009035554A2 WO 2009035554 A2 WO2009035554 A2 WO 2009035554A2 US 2008010466 W US2008010466 W US 2008010466W WO 2009035554 A2 WO2009035554 A2 WO 2009035554A2
Authority
WO
WIPO (PCT)
Prior art keywords
dna
stem
probe
mbs
hairpin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2008/010466
Other languages
French (fr)
Other versions
WO2009035554A3 (en
Inventor
Weihong Tan
Youngmi Kim
Chaoyong James Yang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Florida
University of Florida Research Foundation Inc
Original Assignee
University of Florida
University of Florida Research Foundation Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Florida, University of Florida Research Foundation Inc filed Critical University of Florida
Publication of WO2009035554A2 publication Critical patent/WO2009035554A2/en
Publication of WO2009035554A3 publication Critical patent/WO2009035554A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6832Enhancement of hybridisation reaction

Definitions

  • Hybridization assays are based on the very specific base pairing that is found in hybrids of DNA and RNA. Base sequences of analytical interest appearing along a strand of nucleic acid can be detected very specifically and sensitively by observing the formation of hybrids in the presence of a probe nucleic acid known to comprise a base sequence that is complementary with the sequence of interest.
  • Nucleic acid hybridization has been used for a wide variety of purposes including, for example, identification of specific clones from cDNA and genomic libraries, detecting single base pair polymorphisms in DNA, generating mutations by oligonucleotide mutagenesis, amplifying nucleic acids from single cells or viruses, or detecting microbial infections.
  • Molecular beacons are single-stranded nucleic acid probes composed of three different functional domains: stem, loop, and fluorophore/quencher pairs.
  • Stems function as lockers to maintain closed hairpin structures without hybridization with complementary targets so that the fluorescence is quenched with high quenching efficiency.
  • Loops are the recognizing elements to induce a conformational change upon the hybridization with complementary targets, resulting in an increasing fluorescence due to the elongated physical distance between the fluorophore and the quencher.
  • the fluorophore/quencher pairs produce the on/off signal depending on the conformational state of MBs.
  • the unique on/off signal mechanism has been very useful in the field of real time monitoring of RP-PCR (Kostrikis, L. G.; Tyagi, S.; Mhlanga, M. M.; Ho, D. D.; Kramer, F. R. Science 1998, 279, 1228-29; and Giesendorf, B. A. J.; Vet, J. A. M.; Tyagi, S.; Mensink, E. J. M. G.; Trijbels, F. J. M.; Blom, H. J. Clinical Chemistry 1998, 44, 482-86) and mRNA expression inside of living cells.
  • thermodynamic and kinetic properties of molecular beacons are dependent on its structure and sequence in complex ways.
  • signal-to-background ratio in target detection is dependent not only on design (length and sequence of the stem and probe) but also on the quality of oligonucleotide synthesis and purification, and the assay conditions employed.
  • the major difficulties often arise from the stems that are critical in maintaining a stable hairpin structure. Stems can cause two problems which severely affect MB's sensitivity and selectivity.
  • Table 1 summarizes the occurrence of a nucleic acid sequence with n base pairs. The theoretical calculations provided in Table 1 indicate that MBs can show significant amounts of false positive signalling, even though each MB targets only one complementary nucleic acid sequence.
  • Table 1 Copy numbers of each nucleic acid appearing in DNA and RNA targets in an average human cell (with 3 billion DNA bp and 44 billion RNA bases). Sequence Length Number ofOccurrence for Number ofOccurrence for
  • LNA MB The typical example is a LNA MB.
  • LNAs are known as extraordinary strong binders to nucleic acids.
  • LNA MBs have demonstrated ultra-high thermal stability, resulting in a low background signal.
  • LNA MBs tend to have extremely slow hybridization kinetics.
  • a self-reporting hairpin inversion probe was designed based on inverted junction between the loop and stem to ensure that hybridization would stop at the junction so that short stems do not hybridize with their complementary sequences.
  • HOMO DNA stem MBs have been explored. (Crey-Desbiolles, C; Ahn, D. R.; Leumann, C. J. Nucl.Acids Res. 2005, 33, ell) to address this problem.
  • the synthesis of such HOMO DNA MBs is not easy and requires optimization of the stem design. For example, problems associated with stem hybridization with complementary sequences within the probe still need to be addressed in the stem design with HOMO DNA MBs.
  • the subject invention provides novel nucleic acid probes that use a non-natural enantiomeric DNA termed L-DNA in the stem, and the natural D-DNA in the loop. Since L- DNA is the mirror-image form of the naturally occurring D-DNA, its duplexes have the same physical characteristics in terms of solubility and stability as D-DNA hybrids. In contrast to using naturally according D-DNA in the stem, L-DNA design minimizes stem invasions and enhances probe performance in many aspects, such as structural stability, sensitivity, and selectivity for nucleic acid studies. Thus, the subject invention provides novel nucleic acid probes useful for a variety of biological and biotechno logical applications.
  • Non-standard L-DNA bases do not hybridize with natural nucleic acids. That is because L-DNA bases form left-helical double helices.
  • the MB stem should not interact with the loop or any other complementary nucleic acid sequences. Since L-DNA designed stems are immune to naturally occurring nucleic acids either within the probe or in the sample matrix, little or no incidence of stem invasion is observed; thus, resulting in highly stable hairpin nucleic acid probes for analysis. Without being bound to any one theory, it appears that the stems made of L-DNA bases hybridize with each other but do not recognize any natural nucleic acids in the sample. In this way, a stable hairpin structure without affecting loop- target interaction is obtained.
  • Figures Ia-Ic are illustrations of a prior art molecular beacon (MB) that is: binding to target mRNA ( Figure Ia); opened by non-specific mRNA that binds to MB stem ( Figure Ib); and mis-folds into non-hairpin structure through the hybridization of loop sequence with stem sequence (c).
  • MB molecular beacon
  • Figure Id is an illustration of a molecular beacon having L-DNA in the stem and D- DNA in the loop of the MB.
  • Figures 2a-2b are illustrations of the responses of MB of the subject invention (LS MBl) and control MB (DS MBl) to a target.
  • LS MBl the subject invention
  • DS MBl control MB
  • Figures 3a-3b are illustrations of the melting temperature profiles of DS MBl and LS MB 1 ( Figure 3a) and comparisons of stem melting temperatures of DS MBl and LS MBl ( Figure 3b). As illustrated in Figure 3, LS MBs generally had higher melting temperature compared to their control counterparts.
  • Figures 4a-4d illustrate the elimination of stem and loop interaction using LS MBs of the subject invention.
  • the LS MB and its target sequences ( Figure 4a). Their possible conformations of MB-I sequence (LS MB and DS MB) were predicted by DNA/RNA folding program mfold ( Figure 4b) and ( Figure 4c). DS MB 1 folds into non-hairpin structure because of the stem-loop interaction ( Figure 4b). Use of L-DNA in the stem of LS MB 1 removes stem-loop interaction, forcing the probe to form a hairpin structure ( Figure 4c). The hybridization curves are shown ( Figure 4d).
  • Figures 5a-5b are graphical illustrations demonstrating the differences in selectivity of each MB (LS MB versus DS MB, Figure 5a).
  • the final concentration of MB is 10OnM and that of each target is l ⁇ M.
  • Figure 5b The calculated melting temperature of each target with its complementary sequence are provided.
  • Figures 6a-6f are illustrations characterizing LS OMe MBs (green) in comparison to DS MB (blue).
  • the response of LS OMe MBl with its target and DNase I was tested (Figure 6a).
  • Signal enhancement and stem melting temperature of each LS OMe MB were calculated ( Figure 6b).
  • Selectivity of LS OMe MBl was tested in the same way as LS MBs ( Figure 6c).
  • RNase H sensitivity of LS OMe MBl ( Figure 6d) and DS MBl ( Figure 6e) was experimented. First, each MB was incubated with its RNA target.
  • SEQ ID NO:1 is the polynucleotide sequence for a first example of a hairpin probe having L-DNA in the stem and prepared in accordance with the subject invention.
  • SEQ ED NO:2 is the polynucleotide sequence for a second example of a hairpin probe having L-DNA in the stem and prepared in accordance with the subject invention.
  • SEQ ID NO: 3 is the polynucleotide sequence for a third example of a hairpin probe having L-DNA in the stem and prepared in accordance with the subject invention.
  • SEQ ID NO:4 is the polynucleotide sequence for a fourth example of a hairpin probe having L-DNA in the stem and prepared in accordance with the subject invention
  • SEQ ID NO: 5 is the polynucleotide sequence for a first example of a hairpin probe having naturally occurring D-DNA in the stem, where this sequence represents a control sequence and corresponds to the first example of SEQ ID NO. 1.
  • SEQ DD NO:6 is the polynucleotide sequence for a second example of a hairpin probe having naturally occurring D-DNA in the stem, where this sequence represents a control sequence and corresponds to the second example of SEQ DD NO. 2.
  • SEQ DD NO:7 is the polynucleotide sequence for a third example of a hairpin probe having naturally occurring D-DNA in the stem, where this sequence represents a control sequence and corresponds to the third example of SEQ DD NO. 3.
  • SEQ ID NO:8 is the polynucleotide sequence for a fourth example of a hairpin probe having naturally occurring D-DNA in the stem, where this sequence represents a control sequence.
  • SEQ ID NO:9 is a random polynucleotide sequence.
  • SEQ ID NO: 10 is the polynucleotide sequence for a first example of a target sequence for the examples of SEQ ID NOS: 1-7.
  • SEQ ID NO: 11 is the polynucleotide sequence for a second example of a target sequence for the examples of SEQ ID NOS: 1-7.
  • the present invention provides nucleic acid probes and methods for nucleic acid hybridization analysis with improved specificity and speed. Central to this goal is the use of L-DNA bases in the stem portion of nucleic acid probes with hairpin structures. Natural D- DNA is used in the loop of the hairpin structure.
  • Figure Id represents a model of an MB design in accordance with the subject invention, where L-DNA is provided in the stem and D-DNA is provided in the loop.
  • non-natural enantiomeric DNA also termed L-DNA
  • L-DNA is used in the stem of hairpin structure nucleic acid probes. Since L-DNA is the mirror-image (enantiomer) form of naturally occurring D-DNA, its duplexes have the same physical characteristics in terms of solubility and stability as D-DNA hybrids. L-DNA is different from D-DNA in that L-DNA form a left-helical double-helix.
  • L-DNA was previously examined as a potential antisense reagent but failed to perform adequately because there is no interaction between the L-DNA and D-formed nucleic acids due to a chiral difference.
  • L-DNA and D-DNA mostly behave differently because, when L-DNA bound to proteins, sugars, and nucleic acids, the produced complexes were diastereomeric to those produced by D-DNA.
  • L-DNA was considered to be particularly advantageous when used to build stems because L-DNA prevented intramolecular and intermolecular nonspecific interactions in hairpin-structured DNA probes.
  • MBs are designed that demonstrate improved sensitivity and selectivity.
  • hairpin structure refers to a polynucleotide or nucleic acid that contains a double-stranded stem segment and a single-stranded loop segment wherein the two polynucleotide or nucleic acid strands that form the double-stranded stem segment is linked and separated by the single polynucleotide or nucleic acid strand that forms the loop segment.
  • the "hairpin structure” can also further comprise 3 1 and/or 5' single-stranded region(s) extending from the double-stranded stem segment.
  • stem or “stem segment” refers to a double stranded segment of a hairpin structure, wherein the double stranded segment is formed between two complementary or substantially complementary nucleotide sequences, wherein at least one portion of said nucleotide sequences located within the double stranded segment is formed of L-DNA sequences, hi certain embodiments, more than one portion of the nucleotide sequences located within the stem or substantially all of the stem is formed of L-DNA sequences.
  • complementary means that two nucleic acid sequences have at least 50% sequence identity. Preferably, the two nucleic acid sequences have at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of sequence identity. Alternatively, “complementary” means that two nucleic acid sequences can hybridize under low, middle, and/or high stringency conditions(s).
  • substantially complementary means that two nucleic acid sequences have at least 90% sequence identity. Preferably, the two nucleic acid sequences have at least 95%, 96%, 97%, 98%, 99%, or 100% of sequence identity. Alternatively, “substantially complementary” means that two nucleic acid sequences can hybridize under high stringency conditions.
  • stringency of hybridization in determining percentage mismatch is as follows: (1) high stringency: O.lxSSPE, 0.1% SDS, 65° C; (2) medium stringency: 0.2xSSPE, 0.1% SDS, 50° C (also referred to as moderate stringency); and (3) low stringency: 1. OxSSPE, 0.1% SDS, 50° C. It is understood that equivalent stringencies may be achieved using alternative buffers, salts, and temperatures (See, generally, Ausubel (Ed.) Current Protocols in Molecular Biology, 2.9A. Southern Blotting, 2.9B. Dot and Slot Blotting DNA and 2.10 Hybridization Analysis of DNA Blots, John Wiley & Sons, Inc. (2000)).
  • melting temperature refers to the midpoint of the temperature range over which nucleic acid duplex, i.e., DNA:DNA, DNA:RNA and RNA:RNA, is denatured.
  • intramolecular hybridization of the hairpin probe is accomplished by two complementary L-DNA sequences in the probe running in opposite directions to each other, such that the bases in each sequence hybridize intramolecularly under the appropriate conditions, forming a double stranded stem of the hairpin structure.
  • a D-DNA sequence complementary to a target nucleotide sequence is attached to the L-DNA sequences, forming the loop within the hairpin probe.
  • at least 60%, 70,%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the D-DNA nucleotide sequence complementary to the target nucleotide sequence to be detected is located within said loop segment.
  • the probe of the invention can comprise any kind of oligonucleotide or nucleic acid strand(s) containing genetically-coded and/or naturally occurring structures.
  • the hairpin probes used herein can comprise DNA, RNA, or a combination of DNA and RNA. Hairpin probes also can comprise non-natural elements such as non-natural bases, e.g., ionosin and xanthine, non-natural sugars, e.g., 2'-methoxy ribose, or non-natural phosphodiester linkages, e.g., methylphosphonates, phosphorothioates and peptides.
  • hairpin probes comprising L-DNA, D-DNA, and RNA are designed such that L-DNA of the probe contains a sequence of nucleotides that are complementary to an RNA sequence of the probe running in opposite directions, such that upon intramolecular hybridization, the stem/double stranded portion of the hairpin probe has L-DNA hybridized to RNA.
  • the D-DNA section of the probe remains within the loop.
  • one or both of the complementary sequences of the stem portion of the hairpin probe can be made resistant to a particular nuclease.
  • a methylphosphonate L-DNA sequence is resistant to cleavage by RNase H.
  • nucleotide sequence complementary to a target nucleotide sequence to be detected must be located in the loop segment.
  • the nucleotide sequence complementary to a target nucleotide sequence to be detected is a D- DNA sequence, but it can be of any genetically-coded and/or naturally occurring structures.
  • the probes of the invention can further comprise an element or a modification that facilitates intramolecular crosslinking of the probe upon suitable treatment.
  • an element can be a chemically or photoactively activatable crosslinking agent, e.g., furocoumarins.
  • such element can be a macromolecule having multiple ligand binding sites, e.g., component(s) of biotin-avidin binding system or an antigen-antibody binding system.
  • the probe can further comprise an element or a modification that renders the probe sensitive or resistant to nuclease digestion.
  • an element can be a restriction enzyme cleavage site.
  • at least a portion of the stem/double stranded segment of the probe is a duplex between an L-DNA strand and a RNA strand, said L-DNA strand contains methylphosphonates.
  • the methylphosphonate L-DNA:RNA hybrid in the probe itself is resistant to RNase H cleavage.
  • Probe sequences that are designed to detect a target sequence should be sufficiently complementary to hybridize with the target sequence using the loop segment under the selected conditions. Sufficient complementarity exists when an RNA or DNA strand will hybridize under selective hybridization conditions to its complement target sequence. Typically, selective hybridization will occur when there is at least about 65% complementarity over a stretch of at least 14 to 25 nucleotides, preferably at least about 75%, more preferably at least about 90% complementarity (See e.g., Kanehisa, Nucleic Acids Res., 12:203 (1984)).
  • a hairpin probe can be prepared by synthesizing each portion of the probe, i.e., the stem portions and the loop portion, and then coupling the portions together as a single hairpin probe by conjugation to each end of a separately prepared linker.
  • the linker can be an alkylene group (of from about 6 to about 24 carbons in length), a polyethyleneglycol group (of from about 2 to about 24 ethyleneglycol monomers in a linear configuration), a polyalcohol group, a polyamine group (e.g., spermine, spermidine and polymeric derivatives thereof), a polyester group (e.g., poly(ethyl acrylate) having from about 3 to 15 ethyl acrylate monomers in a linear configuration), a polyphosphodiester group, or a polynucleotide (having from about 2 to about 12 nucleic acids).
  • the linking group will be a polyethyleneglycol group which is at least a tetraethyleneglycol,
  • the linker When synthesizing the hairpin probe from separate sequence portions of the hairpin probe (i.e., stem and loop portions), the linker will be provided with functional groups at each end that can be suitably protected or activated.
  • the functional groups are covalently attached to each portion of the probe via an ether, ester, carbamate, phosphate ester or amine linkage to either the 5'-hydroxyl or the 3'-hydroxyl of the probe portions chosen such that the complementary sequences are in an anti-parallel configuration.
  • Preferred linkages are phosphate ester linkages similar to typical oligonucleotide linkages.
  • hexaethyleneglycol can be protected on one terminus with a photolabile protecting group (i.e., NVOC or MeNPOC) and activated on the other terminus with 2-cyanoethyl-N,N- diisopropylamino-chlorophosphite to form a phosphorarnidite.
  • a photolabile protecting group i.e., NVOC or MeNPOC
  • 2-cyanoethyl-N,N- diisopropylamino-chlorophosphite to form a phosphorarnidite.
  • This linking group can then be used for construction of the probe libraries in the same manner as photolabile-protected, phosphoramidite-activated nucleotides.
  • the present invention provides an array of oligonucleotide probes immobilized on a solid support for hybridization analysis, which array comprises a solid support suitable for use in nucleic acid hybridization having immobilized thereon a plurality of oligonucleotide probes, each of the probes comprising an L-DNA nucleotide sequence which, under suitable conditions, is capable of forming the stem segment of a hairpin structure and comprising a loop segment having a nucleotide sequence that is complementary to a target nucleotide sequence to be detected.
  • hairpin probes are immobilized to a solid support such as biochip.
  • the solid support may be biological, nonbiological, organic, inorganic, or a combination of any of these, existing as particles, strands, precipitates, gels, sheets, tubing, spheres, containers, capillaries, pads, slices, films, plates, slides, etc.
  • a solid support for immobilizing probes is preferably flat, but may take on alternative surface configurations.
  • the solid support may contain raised or depressed regions on which probe synthesis takes place or where probes are attached.
  • the solid support can be chosen to provide appropriate light-absorbing characteristics.
  • the support may be a polymerized Langmuir Blodgett film, glass or functionalized glass, Si, Ge, GaAs, GaP, SiO.sub.2, SiN.sub.4, modified silicon, or any one of a variety of gels or polymers such as (poly)tetrafluoroethylene, (poly)vinylidendifluoride, polystyrene, polycarbonate, or combinations thereof.
  • Other suitable solid support materials will be readily apparent to those of skill in the art.
  • the surface of the solid support can contain reactive groups, which could be carboxyl, amino, hydroxyl, thiol, or the like suitable for conjugating to a reactive group associated with an oligonucleotide or a nucleic acid.
  • the surface is optically transparent and will have surface Si-OH functionalities, such as are found on silica surfaces.
  • Hairpin probes can be attached to the solid support by chemical or physical means such as through ionic, covalent or other forces well known in the art. Immobilization of nucleic acids and oligonucleotides can be achieved by means well known in the art (see, e.g., Dattagupta et al., Analytical Biochemistry, 177:85-89(1989); Saiki et al., Proc. Natl. Acad. Sci. USA, 86:6230-6234(1989); and Gravitt et al., J. Clin. Micro., 36:3020-3027(1998)).
  • Hairpin probes can be attached to a solid support by means of a spacer molecule, e.g., essentially as described in U.S. Pat. No. 5,556,752 to Lockhart et al., to provide space between the double stranded portion of the probe as may be helpful in hybridization assays.
  • a spacer molecule typically comprises between 6-50 atoms in length and includes a surface attaching portion that attaches to the solid support. Attachment to the support can be accomplished by carbon—carbon bonds using, for example, supports having (poly)trifluorochloroethylene surfaces, or preferably, by siloxane bonds (using, for example, glass or silicon oxide as the solid support).
  • Siloxane bonding can be formed by reacting the support with trichlorosilyl or trialkoxysilyl groups of the spacer.
  • Aminoalkylsilanes and hydroxyalkylsilanes, bis(2-hydroxyethyl)-aminopropyltriethoxysilane, 2- hydroxyethylaminopropyltriethoxysilane, arninopropyltriethoxysilane or hydroxypropyltriethoxysilane are useful are surface attaching groups.
  • the spacer can also include an extended portion or longer chain portion that is attached to the surface attaching portion of the probe.
  • an extended portion or longer chain portion that is attached to the surface attaching portion of the probe.
  • amines, hydroxyl, thiol, and carboxyl groups are suitable for attaching the extended portion of the spacer to the surface attaching portion.
  • the extended portion of the spacer can be any of a variety of molecules which are inert to any subsequent conditions for polymer synthesis. These longer chain portions will typically be aryl acetylene:, ethylene glycol oligomers containing 2-14 monomer units, diamines, diacids, amino acids, peptides, or combinations thereof.
  • the extended portion of the spacer is a polynucleotide or the entire spacer can be a polynucleotide.
  • the extended portion of the spacer also can be constructed of polyethyleneglycols, polynucleotides, alkylene, polyalcohol, polyester, polyamine, polyphosphodiester and combinations thereof.
  • the spacer can have a protecting group, attached to a functional group, e.g., hydroxyl, amino or carboxylic acid) on the distal or terminal end of the spacer (opposite the solid support). After deprotection and coupling, the distal end can be covalently bound to an oligomer or probe.
  • hairpin probes can be attached to a single solid support to form a microarray by procedures well known in the art . This is also referred to as a "micro array biochip” or “DNA biochip.”
  • a microarry biochip containing a library of probes can be prepared by a number of well known approaches including, for example, light-directed methods, such as VLSEPSTM described in U.S. Pat. No. 5,143,854; mechanical methods such as described in PCT No. 92/10183 or U.S. Pat. No. 5,384,261; bead based methods such as described in U.S. Pat. No. 5,541,061; and pin based methods such as detailed in U.S. Pat. No. 5,288,514.
  • U.S. Pat. No. 5,556,752 to Lockhart which details the preparation of a library of different double stranded probes as a microarry using the VLSIPSTM also is suitable for preparing a library of hairpin probes in a microarray.
  • Flow channel methods such as described in U.S. Pat. Nos. 5,677,195 and 5,384,261, can be used to prepare a microarry biochip having a variety of different hairpin probes.
  • certain activated regions of the substrate are mechanically separated from other regions when the probes are delivered through a flow channel to the support.
  • a detailed description of the flow channel method can be found in U.S. Pat. No. 5,556,752 to Lockhart et al., including the use of protective coating wetting facilitators to enhance the directed channeling of liquids though designated flow paths.
  • Spotting methods also can be used to prepare a microarry biochip with a variety of hairpin probes immobilized thereon.
  • reactants are delivered by directly depositing relatively small quantities in selected regions of the support.
  • the entire support surface can be sprayed or otherwise coated with a particular solution.
  • a dispenser moves from region to region, depositing only as much probe or other reagent as necessary at each stop.
  • Typical dispensers include a micropipette, nanopippette, ink-jet type cartridge or pin to deliver the probe containing solution or other fluid to the support and, optionally, a robotic system to control the position of these delivery devices with respect to the support.
  • the dispenser includes a series of tubes or multiple well trays, a manifold, and an array of delivery devices so that various reagents can be delivered to the reaction regions simultaneously.
  • Spotting methods are well known in the art and include, for example those described in U.S. Pat. Nos. 5,288,514, 5,312,233 and 6,024,138.
  • a combination of flowing channel and "spotting" on predefined regions of the support also can be used to prepare microarry biochips with immobilized hairpin probes.
  • the present invention provides a method for detecting a target nucleotide sequence in a sample, comprising the steps of: a) providing an oligonucleotide probe having a hairpin structure, comprising an L-DNA nucleotide sequence in the stem segment of the hairpin structure, and wherein at least a portion of the loop segment comprises a nucleotide sequence that is complementary to a target nucleotide sequence to be detected; b) contacting the probe provided in step a) with a sample containing or suspected of containing the target nucleotide sequence under conditions that favor hybridization between the probe and the target nucleotide sequence; and c) assessing the hybrid formed in step b) whereby presence of the hybrid indicates the presence of the target nucleotide sequence in the sample.
  • the L-Deoxyphosphoramidites were obtained from ChemGenes Corporation (Wilmington, MA).
  • the other synthesis reagents were from Glen Research Corporation (Sterling, VA). All molecular beacons and their targets were synthesized using an ABI 3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA) at l ⁇ mol scale with the standard synthesis protocol. Dabcyl CPG was used for all MB preparation.
  • the background fluorescence from 200 ⁇ l of the buffer containing 2OmM of Tris- HCl (pH7.5), 5OmM NaCl and 5mM MgCl 2 , designated as MB buffer was monitored for about 1 minute, and then each stock MB solution (20 ⁇ M) was added to the hybridization buffer to reach final concentration of 65nM and the fluorescence was monitored. After a stable fluorescent signal was obtained from the MB, an excess of target oligonucleotide (65OnM) was added. The level of fluorescent intensity was recorded until the signal reached plateau. The excitation and emission wavelengths were set to 488nm and 520nm, respectively. Signal enhancement was calculated using the following equation:
  • F open fluorescence signals from opened MBs
  • Fciosed fluorescence signals from closed MBs fluorescence signal of buffer
  • T m Melting Temperature
  • Nuclease Sensitivity To test the nuclease digestion of MBs, Deoxynuclease I from Sigma-Aldrich, Inc. (St. Louis, MO) was chosen as a standard nuclease. The fluorescence of 65 nM of MBs in MB buffer was measured as a function of time at room temperature. Once the fluorescence is stabilized, two units of ribonuclease-free DNase I was added, and the fluorescence change was monitored until it reached to plateau.
  • Cell lysate was prepared using CCRF-CEM (CCL-119, T cell line, human ALL) obtained from American Type Culture Collection (Manassas, VA) and Cell culture lysis buffer containing 25mM Tris(pH 7.8 with H3PO4), 2mM CDTA, 2mM DTT, 10%glycerol and 1% Triton ® X-100 purchased from Promega (Madison, WT) with the protocol recommended by manufacture.
  • CCRF-CEM CCL-119, T cell line, human ALL
  • Cell culture lysis buffer containing 25mM Tris(pH 7.8 with H3PO4), 2mM CDTA, 2mM DTT, 10%glycerol and 1% Triton ® X-100 purchased from Promega (Madison, WT) with the protocol recommended by manufacture.
  • L-DNA stem MBs Stability and Sensitivity of L-DNA stem MBs (LS MBs).
  • LS MBs L-DNA stem MBs
  • three L-DNA stem MBs were synthesized using sequence MBl, MB2 and MB3 shown in Table 2 below. The same sequences were used to prepare control MBs, called DS MBs entirely made of D-DNA bases.
  • Hybridization of each MB to its corresponding natural DNA target was performed under the same conditions. In order to ensure all MBs are opened, 10 times more target DNAs were supplied. The signal enhancement was calculated with the S/B equation described herein.
  • the L-DNA stem duplex was able to maintain the hairpin conformation and dehybridize when the loop binds to its target with moderate hybridization kinetics. More interestingly, LS MB 1 produced a lower fluorescence signal in the absence of its target. Compared to DS MB 1 , the signal enhancement ratio of the LS MB 1 was more than twice higher than that of the DS MB 1, 46 folds as compared to 21 folds, respectively in Figure 2b. Such a high signal enhancement from LS MB 1 was consistently observed from the three MBs of different sequences, LS MB 2 and LS MB 3. They had 18 and 30 times enhancement compared to their counterparts MB 2 and MB 3, 9 and 18 times, respectively ( Figure 2b). Thus, the better S/B of L-DNA stem MBs over regular D-DNA MBs can be generalized regardless of oligo sequences.
  • the improved sensitivity is believed to be a result from the enhanced stability of the hairpin conformation in L-DNA MBs due to the lack of stem-loop interactions which could otherwise contribute to a significant background.
  • the better structural stability causing higher S/B was supported by the higher stem melting temperature of stems (T 111 ) for LS MBs than that of DS MBs.
  • the melting temperature (T m ) of each probe was examined and compared.
  • T m melting temperature
  • LS MBs showed higher melting temperatures than their counterparts did.
  • the LS MB 1 has a melting temperature of about 62 0 C while that for the DS MB 1 is about 58 °C ( Figure 3a). This difference is well above the errors in Tm measurement by instrument ( ⁇ 0.5 °C).
  • the other sequences, MB 2 and MB 3 also had consistent higher melting temperatures in the case of L-DNA stem design ( Figure 3 (b)).
  • L-DNA base pairs have comparable stability to that of their D-DNA counterparts, such an increase in T m is probably due to a more stable hairpin conformation of the LS MB than that of the DS MB rather than stronger base paring between L-DNA bases.
  • the improved stability of the L-DNA stem is consistent with the enhanced sensitivity of the probe observed in the hybridization experiments described herein.
  • thermodynamics the change of Gibbs energy ( ⁇ G) is defined as a function of entropy ( ⁇ S) and enthalpy change ( ⁇ H) with fixed temperature (T).
  • S is defined as the number of microscopic configurations that result in the observed macroscopic description of the thermodynamic system, hi both DS and LS MB, it may be assumed that ⁇ H would not be much different to form hairpin structure because the affinity of L-DNA bases to L-DNA bases is comparable to that of D-DNA bases toward D-DNA bases.
  • the value of ⁇ S for LS MB is much smaller than that for DS MB.
  • S of random configuration for DS MB is a lot larger than that for LS MB, resulting in small - ⁇ G value in DS MB compared to LS MB.
  • Such a difference makes LS MB form hairpin structures more favorable.
  • utilizing orthogonal-base paring can force MBs to form desired structure that are less affected by thermal conformational fluctuation.
  • the stem stabilities of chimeric MBs can increase.
  • a DS MB 1-1 was designed. This sequence has the purpose that non-hairpin structure is dominant because one of its stems can strongly interact with loop region (blue underline in the sequence), as shown in Figure 4a when built with DNA. Thus, DS MB 1-1 can have two dominant conformations, hairpin and non-hairpin structures ( Figure 4b and 4c), and their distributions are dependent on thermodynamic stability.
  • the LS MB 1-1 hybridized with the target much faster than that of DS MB 1-1. This is because the fully open loop region can be easily accessed for interaction to its target, resulting in a fast dynamic response.
  • the results described herein confirm that using L-DNA stem in designing MBs can effectively eliminate undesired stem-loop interactions in hairpin structured nucleic acid probes.
  • oligonucleotides were designed with different lengths that had 6 bases complementary to the stem of the MB, while the remaining sequence matched the loop region: 5'-CCTAGC-3', 5'-CCTAGCGC-3', 5- CCTAGCGCGA-3', and 5 ' -CCT AGCGCGACC-3 ' (underline is complementary to the stem sequence of the MB; the L-DNA sequences are in bold).
  • the thermodynamic stabilities of each target with their complementary sequences are shown in Table 2.
  • MB 1 target (LCD) 5'-GCGACCATAGTGATTTAGA-S ' (SEQ ID NO.9)
  • the loop complementary DNA target 5'-GCGACCATAGTGATTTAGA-S' (SEQ ID NO:9) was also prepared as a reference. These sequences were incubated with both LS and DS MB 1 for 1 hr, respectively. The responses of the MBs were recorded and the fluorescence signal of each sample was compared based on the fluorescence signal of MB loop cDNA mixture ( Figure 5 a). For DS MB 1, incubation with 10 fold excess of the 6mer DNA target failed to open the hairpin structure. This is as expected since intramolecular binding constant between the stem sequences is far greater than the intermolecular interaction between one arm of the stem and the 6mer DNA.
  • L-DNA MB does not have such a problem. None of the sequence except the full length target sequence was able to open up the L-DNA MB, indicating a superior selectivity and stability. The reduction of number of bases which can interact with the short sequences is the major reason preventing LS MB from false opening. Such an excellent selectivity from the L-DNA stem can be very useful in analyzing raw samples without purification for quantitative analysis and for living cell studies.
  • Biostable LS MBs In general, degradation of D-DNA MBs is one of the most important problems in intracellular applications. (Li, J. J.; Geyer, R.; Tan, W. Nucl. Acids Res. 2000, 28, e52). In order to solve this problem, non-standard nucleic acid bases have been explored to design MBs, such as peptide nucleic acid (PNA), (Kuhn, H., Demidov, V. V., Gildea, B. D., Fiandaca, M. J., Coull, J. C, and Frank-Kamenetskii, M. D.
  • PNA peptide nucleic acid
  • 2-OMe modified RNA bases were chosen for the loop design using the three MB sequences as a model system, designated as LS OMe MBs.
  • 2-OMe RNAs are known as non-standard nucleic acid bases which can recognize natural nucleic acid targets but are not biodegradable. The predictable behaviour of 2-OMe RNA bases is beneficial to design MBs.
  • the combination of L-DNA stem and 2-OMe RNA loop are an ideal molecular beacon design because the combination can eliminate a lot of problems that conventional MBs have.
  • this example established that the use of an L-DNA stem in a hairpin structured DNA probe, such as a MB, eliminates unwanted intra- and intermolecular interactions.
  • the exclusion of stem-loop interaction in an L-DNA stem MB ensures a hairpin structure to be dominant so that L-DNA stems improve hairpin DNA probe's sensitivity and stability.
  • the use of L-DNA stems prevents the probe from being opened by non-specific sequences that contains short sequences complementary to the stem. Thus, stem invasion causing false positive signal can be absolutely eliminated.
  • the advantages described above regarding L-DNA stems can be applied to any kind of chimeric MB design.
  • L-DNA stems can be universal to stabilize hairpin conformation of any nucleic acid probe, regardless of the types of nucleic acids in the probes.
  • nuclease resistant loop and L-DNA stems are an ideal molecular beacon design since it removes the possibility of false positive and negative reports coming from intracellular enzymatic activities and non-specific interactions of MBs and targets.
  • the subject L-DNA stem strategy is the simplest, most direct and most effective way to develop hairpin structured DNA probes with desired properties.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Hairpin-shaped nucleic acid probes capable of forming stable hybrids with target nucleic acid sequences are provided. In particular, an oligonucleotide probe for hybridization analysis is provided, wherein the probe comprises a non-natural enantiomeric DNA (L-DNA) that forms the stem and natural DNA (D-DNA) that forms the loop in the hairpin. The invention thereby provides stable probes that experience fewer stem invasions and demonstrate sensitive and selective hybridization to target nucleic acid sequences. The subject probes are useful for a variety of biological and biotechnological applications.

Description

DESCRIPTION
SUPERIOR STRUCTURE STABILITY AND SELECTIVITY OF HAIRPIN NUCLEIC
ACID PROBES WITH AN L-DNA STEM
BACKGROUND OF THE INVENTION
Nucleic acid hybridization, in the forty years since its discovery, has become a powerful tool with implications for biology, medicine and industry. Hybridization assays are based on the very specific base pairing that is found in hybrids of DNA and RNA. Base sequences of analytical interest appearing along a strand of nucleic acid can be detected very specifically and sensitively by observing the formation of hybrids in the presence of a probe nucleic acid known to comprise a base sequence that is complementary with the sequence of interest. Nucleic acid hybridization has been used for a wide variety of purposes including, for example, identification of specific clones from cDNA and genomic libraries, detecting single base pair polymorphisms in DNA, generating mutations by oligonucleotide mutagenesis, amplifying nucleic acids from single cells or viruses, or detecting microbial infections.
Molecular beacons (MBs) are single-stranded nucleic acid probes composed of three different functional domains: stem, loop, and fluorophore/quencher pairs. (Tyagi, S.; Kramer, F. R. Nat.Biotechnol. 1996, 14, 303-08) Stems function as lockers to maintain closed hairpin structures without hybridization with complementary targets so that the fluorescence is quenched with high quenching efficiency. Loops are the recognizing elements to induce a conformational change upon the hybridization with complementary targets, resulting in an increasing fluorescence due to the elongated physical distance between the fluorophore and the quencher.
In MBs, the fluorophore/quencher pairs produce the on/off signal depending on the conformational state of MBs. The unique on/off signal mechanism has been very useful in the field of real time monitoring of RP-PCR (Kostrikis, L. G.; Tyagi, S.; Mhlanga, M. M.; Ho, D. D.; Kramer, F. R. Science 1998, 279, 1228-29; and Giesendorf, B. A. J.; Vet, J. A. M.; Tyagi, S.; Mensink, E. J. M. G.; Trijbels, F. J. M.; Blom, H. J. Clinical Chemistry 1998, 44, 482-86) and mRNA expression inside of living cells. (Sokol, D. L.; Zhang, X. L.; Lu, P. Z.; Gewitz, A. M. Proceedings of the National Academy of Sciences of the United States of America 1998, 95, 11538-43; Matsuo, T. Biochimica et Biophysica Acta-General Subjects 1998, 1379, 178-84; and Santangelo, P. J.; Nix, B.; Tsourkas, A.; Bao, G. Nucleic Acids Research 2004, 32) Unlike traditional mRNA analysis, MBs do not require pre- or post-treatment of cells because, theoretically, they will not give any fluorescence signal unless hybridizing with their complementary targets. Waston-Crick base paring has been known as one of the most selective molecular recognition element for nucleic acids.
Although initial MB applications have demonstrated wide feasibility and great potential, challenges in probe design and applications remain. The thermodynamic and kinetic properties of molecular beacons are dependent on its structure and sequence in complex ways. Moreover, the signal-to-background ratio in target detection is dependent not only on design (length and sequence of the stem and probe) but also on the quality of oligonucleotide synthesis and purification, and the assay conditions employed. The major difficulties often arise from the stems that are critical in maintaining a stable hairpin structure. Stems can cause two problems which severely affect MB's sensitivity and selectivity.
One problem is the undesired intermolecular interactions between stems and their complementary sequences, called stem invasion (as illustrated in Figures Ia-Ic of the Prior Art, Figure Ib). Although the ideal molecular recognition scheme is between loops of MBs and their complementary targets (Figure Ia), there are always chances that, especially in complex cellular environments, the stems can hybridize with their matched sequences, resulting in a high background signal and a poor analytical selectivity (Figure Ib). This stem invasion by non-target sequences should not be underestimated in real biological samples since there could be high copy numbers of short sequences complementary to part of the MB stems. In theory, the expressed frequency of occurrence of any particular stretch of RNA or DNA sequence, such as n bases is 4 " (Leal, N. A.; Sukeda, M.; Benner, S. A. Nucl. Acids Res. 2006, 34, 4702-10). The average number of occurrences of each particular sequence in human genome is 3xl09x4~". (Leal, N. A.; Sukeda, M.; Benner, S. A. Nucl. Acids Res. 2006, 34, 4702-10)
Table 1 below summarizes the occurrence of a nucleic acid sequence with n base pairs. The theoretical calculations provided in Table 1 indicate that MBs can show significant amounts of false positive signalling, even though each MB targets only one complementary nucleic acid sequence.
Table 1 — Copy numbers of each nucleic acid appearing in DNA and RNA targets in an average human cell (with 3 billion DNA bp and 44 billion RNA bases). Sequence Length Number ofOccurrence for Number ofOccurrence for
(n) DNA RNA
6 732422 10742188
7 183105 2685547
8 45776 671387
9 11444 167847
10 2861 41962
11 715 10490
12 179 2623
13 45 656
14 11 164
15 3 41
16 1 10
Another problem arising from the stems is the thermodynamic conformational switch between hairpin and non-hairpin structures. This is a result of the unwanted intramolecular hybridization between the stem and part of the loop. In the case of MBs, this can cause a significant fluorescence background due to incomplete quenching. This problem often leads to a considerable amount of efforts required in designing and testing MBs for new target sequences with acceptable performance (Figure Ic). Sometimes the stem invasion cannot be avoided at all, resulting in low performance hairpin structures in nucleic acid monitoring.
There have been developments aimed at minimizing the aforementioned problems. For example, strengthening stem stability by increasing stem length or GC content of the stem may be able to ensure the dominance of the hairpin structure, so that background signal of MBs remains low. (Tsourkas, A.; Behlke, M. A.; Rose, S. D.; Bao, G. Nucl. Acids Res. 2003, 31, 1319-30) Unfortunately, a strong stem leads to slow hybridization kinetics and a high tendency of forming sticky-end pairing, reducing the fluorescence signal enhancement upon target hybridization. (Li, J. W. J.; Tan, W. H. Analytical Biochemistry 2003, 312, 251- 54).
The typical example is a LNA MB. (Wang, L.; Yang, C. Y. J.; Medley, C. D.; Benner, S. A.; Tan, W. H. Journal of the American Chemical Society 2005, 127, 15664-65). LNAs are known as extraordinary strong binders to nucleic acids. LNA MBs have demonstrated ultra-high thermal stability, resulting in a low background signal. However, LNA MBs tend to have extremely slow hybridization kinetics. To minimize unnecessary intermolecular interactions, a self-reporting hairpin inversion probe was designed based on inverted junction between the loop and stem to ensure that hybridization would stop at the junction so that short stems do not hybridize with their complementary sequences. (Browne, K. A. J.Am.Chem.Soc. 2005, 127, 1989-94) However, the necessity of longer stems due to the discontinued junction worsens sticky-end-paring problems. Thus, designing MB stems to solve these problems is critical for the convenient and effective applications of hairpin structured DNA probes in monitoring nucleic acids especially in complex cellular environments.
HOMO DNA stem MBs have been explored. (Crey-Desbiolles, C; Ahn, D. R.; Leumann, C. J. Nucl.Acids Res. 2005, 33, ell) to address this problem. Unfortunately, the synthesis of such HOMO DNA MBs is not easy and requires optimization of the stem design. For example, problems associated with stem hybridization with complementary sequences within the probe still need to be addressed in the stem design with HOMO DNA MBs.
Accordingly, a need exists for improved nucleic acid probes that exhibit high specificity and sensitivity.
BRIEF SUMMARY
The subject invention provides novel nucleic acid probes that use a non-natural enantiomeric DNA termed L-DNA in the stem, and the natural D-DNA in the loop. Since L- DNA is the mirror-image form of the naturally occurring D-DNA, its duplexes have the same physical characteristics in terms of solubility and stability as D-DNA hybrids. In contrast to using naturally according D-DNA in the stem, L-DNA design minimizes stem invasions and enhances probe performance in many aspects, such as structural stability, sensitivity, and selectivity for nucleic acid studies. Thus, the subject invention provides novel nucleic acid probes useful for a variety of biological and biotechno logical applications.
Non-standard L-DNA bases do not hybridize with natural nucleic acids. That is because L-DNA bases form left-helical double helices. According to the subject invention, by incorporating L-DNA into the stem of MBs, the MB stem should not interact with the loop or any other complementary nucleic acid sequences. Since L-DNA designed stems are immune to naturally occurring nucleic acids either within the probe or in the sample matrix, little or no incidence of stem invasion is observed; thus, resulting in highly stable hairpin nucleic acid probes for analysis. Without being bound to any one theory, it appears that the stems made of L-DNA bases hybridize with each other but do not recognize any natural nucleic acids in the sample. In this way, a stable hairpin structure without affecting loop- target interaction is obtained.
BRIEF DESCRIPTION OF THE DRAWINGS
The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawings(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.
Figures Ia-Ic are illustrations of a prior art molecular beacon (MB) that is: binding to target mRNA (Figure Ia); opened by non-specific mRNA that binds to MB stem (Figure Ib); and mis-folds into non-hairpin structure through the hybridization of loop sequence with stem sequence (c).
Figure Id is an illustration of a molecular beacon having L-DNA in the stem and D- DNA in the loop of the MB.
Figures 2a-2b are illustrations of the responses of MB of the subject invention (LS MBl) and control MB (DS MBl) to a target. The hybridization of LS MBl and DS MBl took place with 10 times excess target DNA, and their fluorescence change was recorded (Figure 2a). Signal enhancement(S/B) of each MB was calculated and compared (Figure 2b).
Figures 3a-3b are illustrations of the melting temperature profiles of DS MBl and LS MB 1 (Figure 3a) and comparisons of stem melting temperatures of DS MBl and LS MBl (Figure 3b). As illustrated in Figure 3, LS MBs generally had higher melting temperature compared to their control counterparts.
Figures 4a-4d illustrate the elimination of stem and loop interaction using LS MBs of the subject invention. The LS MB and its target sequences (Figure 4a). Their possible conformations of MB-I sequence (LS MB and DS MB) were predicted by DNA/RNA folding program mfold (Figure 4b) and (Figure 4c). DS MB 1 folds into non-hairpin structure because of the stem-loop interaction (Figure 4b). Use of L-DNA in the stem of LS MB 1 removes stem-loop interaction, forcing the probe to form a hairpin structure (Figure 4c). The hybridization curves are shown (Figure 4d).
Figures 5a-5b are graphical illustrations demonstrating the differences in selectivity of each MB (LS MB versus DS MB, Figure 5a). The final concentration of MB is 10OnM and that of each target is l μM. (Figure 5b) The calculated melting temperature of each target with its complementary sequence are provided.
Figures 6a-6f are illustrations characterizing LS OMe MBs (green) in comparison to DS MB (blue). The response of LS OMe MBl with its target and DNase I was tested (Figure 6a). Signal enhancement and stem melting temperature of each LS OMe MB were calculated (Figure 6b). Selectivity of LS OMe MBl was tested in the same way as LS MBs (Figure 6c). RNase H sensitivity of LS OMe MBl (Figure 6d) and DS MBl (Figure 6e) was experimented. First, each MB was incubated with its RNA target. Then, RNase H was added to the mixture and the fluorescence change was monitored, hi the case of DS MB (Figure 6e), DNA target was added to ensure the DS MBl had conformational change after the RNA targets were digested. Cell lysate sensitivity of each MB was tested (Figure 6T).
BRIEF DESCRIPTION OF THE SEQUENCES
SEQ ID NO:1 is the polynucleotide sequence for a first example of a hairpin probe having L-DNA in the stem and prepared in accordance with the subject invention.
SEQ ED NO:2 is the polynucleotide sequence for a second example of a hairpin probe having L-DNA in the stem and prepared in accordance with the subject invention.
SEQ ID NO: 3 is the polynucleotide sequence for a third example of a hairpin probe having L-DNA in the stem and prepared in accordance with the subject invention.
SEQ ID NO:4 is the polynucleotide sequence for a fourth example of a hairpin probe having L-DNA in the stem and prepared in accordance with the subject invention
SEQ ID NO: 5 is the polynucleotide sequence for a first example of a hairpin probe having naturally occurring D-DNA in the stem, where this sequence represents a control sequence and corresponds to the first example of SEQ ID NO. 1.
SEQ DD NO:6 is the polynucleotide sequence for a second example of a hairpin probe having naturally occurring D-DNA in the stem, where this sequence represents a control sequence and corresponds to the second example of SEQ DD NO. 2.
SEQ DD NO:7 is the polynucleotide sequence for a third example of a hairpin probe having naturally occurring D-DNA in the stem, where this sequence represents a control sequence and corresponds to the third example of SEQ DD NO. 3. SEQ ID NO:8 is the polynucleotide sequence for a fourth example of a hairpin probe having naturally occurring D-DNA in the stem, where this sequence represents a control sequence.
SEQ ID NO:9 is a random polynucleotide sequence.
SEQ ID NO: 10 is the polynucleotide sequence for a first example of a target sequence for the examples of SEQ ID NOS: 1-7.
SEQ ID NO: 11 is the polynucleotide sequence for a second example of a target sequence for the examples of SEQ ID NOS: 1-7.
DETAILED DISCLOSURE
The present invention provides nucleic acid probes and methods for nucleic acid hybridization analysis with improved specificity and speed. Central to this goal is the use of L-DNA bases in the stem portion of nucleic acid probes with hairpin structures. Natural D- DNA is used in the loop of the hairpin structure. Figure Id represents a model of an MB design in accordance with the subject invention, where L-DNA is provided in the stem and D-DNA is provided in the loop.
It is to be understood that this invention is not limited to any specific nucleic acid probes, specific nucleic acid targets, specific cell types, specific conditions, or specific methods, etc., as such may vary and the numerous modifications and variations therein will be apparent to those skilled in the art. It is to be understood that the terminology used herein is for the purpose of describing embodiments only and is not intended to be limiting.
As described above, non-natural enantiomeric DNA, also termed L-DNA, is used in the stem of hairpin structure nucleic acid probes. Since L-DNA is the mirror-image (enantiomer) form of naturally occurring D-DNA, its duplexes have the same physical characteristics in terms of solubility and stability as D-DNA hybrids. L-DNA is different from D-DNA in that L-DNA form a left-helical double-helix. (Urata,H., Shinohara,E., Ogura,K., Ueda,Y. and Akagi,M. 1991, J. Am. Chem. Soc, 113, 8174-8175; Damha,M.J., GiannarisJP.A., Marfey,P. and Reid,L.S. 1991, Tetrahedron Lett., 32, 2573-2576; Urata,H., Ogura,E., Shinohara,K., Ueda,Y. and Akagi,M. 1992, Nucleic Acids Res., 20, 3325-3332; Ashley,G.W. 1992, J. Am. Chem. Soc, 114, 9731-9736).
L-DNA was previously examined as a potential antisense reagent but failed to perform adequately because there is no interaction between the L-DNA and D-formed nucleic acids due to a chiral difference. (Garbesi, A.; Capobinanco, M. L.; Colonna, F. P.; Tondelli, L.; Arcamone, F.; Manzini, G.; hilbers, C. W.; Aelen, J. M. E.; Blommers, M. J. J. Nucl. Acids Res. 1993, 21, 4159-65). Further, in biological systems, L-DNA and D-DNA mostly behave differently because, when L-DNA bound to proteins, sugars, and nucleic acids, the produced complexes were diastereomeric to those produced by D-DNA.
The features of L-DNA were considered to be particularly advantageous when used to build stems because L-DNA prevented intramolecular and intermolecular nonspecific interactions in hairpin-structured DNA probes. As such, MBs are designed that demonstrate improved sensitivity and selectivity.
Definitions
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this invention belongs. All patents, applications, published applications and other publications and sequences from GenBank and other data bases referred to herein are incorporated by reference in their entirety.
As used herein, "hairpin structure" refers to a polynucleotide or nucleic acid that contains a double-stranded stem segment and a single-stranded loop segment wherein the two polynucleotide or nucleic acid strands that form the double-stranded stem segment is linked and separated by the single polynucleotide or nucleic acid strand that forms the loop segment. The "hairpin structure" can also further comprise 31 and/or 5' single-stranded region(s) extending from the double-stranded stem segment.
As used herein, "stem" or "stem segment" refers to a double stranded segment of a hairpin structure, wherein the double stranded segment is formed between two complementary or substantially complementary nucleotide sequences, wherein at least one portion of said nucleotide sequences located within the double stranded segment is formed of L-DNA sequences, hi certain embodiments, more than one portion of the nucleotide sequences located within the stem or substantially all of the stem is formed of L-DNA sequences.
As used herein, "complementary" means that two nucleic acid sequences have at least 50% sequence identity. Preferably, the two nucleic acid sequences have at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of sequence identity. Alternatively, "complementary" means that two nucleic acid sequences can hybridize under low, middle, and/or high stringency conditions(s).
As used herein, "substantially complementary" means that two nucleic acid sequences have at least 90% sequence identity. Preferably, the two nucleic acid sequences have at least 95%, 96%, 97%, 98%, 99%, or 100% of sequence identity. Alternatively, "substantially complementary" means that two nucleic acid sequences can hybridize under high stringency conditions.
As used herein, "stringency of hybridization" in determining percentage mismatch is as follows: (1) high stringency: O.lxSSPE, 0.1% SDS, 65° C; (2) medium stringency: 0.2xSSPE, 0.1% SDS, 50° C (also referred to as moderate stringency); and (3) low stringency: 1. OxSSPE, 0.1% SDS, 50° C. It is understood that equivalent stringencies may be achieved using alternative buffers, salts, and temperatures (See, generally, Ausubel (Ed.) Current Protocols in Molecular Biology, 2.9A. Southern Blotting, 2.9B. Dot and Slot Blotting DNA and 2.10 Hybridization Analysis of DNA Blots, John Wiley & Sons, Inc. (2000)).
As used herein, "melting temperature" ("Tm") refers to the midpoint of the temperature range over which nucleic acid duplex, i.e., DNA:DNA, DNA:RNA and RNA:RNA, is denatured.
Synthesis of Probes
According to the subject invention, intramolecular hybridization of the hairpin probe is accomplished by two complementary L-DNA sequences in the probe running in opposite directions to each other, such that the bases in each sequence hybridize intramolecularly under the appropriate conditions, forming a double stranded stem of the hairpin structure. A D-DNA sequence complementary to a target nucleotide sequence is attached to the L-DNA sequences, forming the loop within the hairpin probe. Preferably, at least 60%, 70,%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the D-DNA nucleotide sequence complementary to the target nucleotide sequence to be detected is located within said loop segment.
The probe of the invention can comprise any kind of oligonucleotide or nucleic acid strand(s) containing genetically-coded and/or naturally occurring structures. The hairpin probes used herein can comprise DNA, RNA, or a combination of DNA and RNA. Hairpin probes also can comprise non-natural elements such as non-natural bases, e.g., ionosin and xanthine, non-natural sugars, e.g., 2'-methoxy ribose, or non-natural phosphodiester linkages, e.g., methylphosphonates, phosphorothioates and peptides.
For example, in one embodiment of the invention, hairpin probes comprising L-DNA, D-DNA, and RNA are designed such that L-DNA of the probe contains a sequence of nucleotides that are complementary to an RNA sequence of the probe running in opposite directions, such that upon intramolecular hybridization, the stem/double stranded portion of the hairpin probe has L-DNA hybridized to RNA. The D-DNA section of the probe remains within the loop.
Alternatively, or in addition, one or both of the complementary sequences of the stem portion of the hairpin probe can be made resistant to a particular nuclease. For example, a methylphosphonate L-DNA sequence is resistant to cleavage by RNase H.
Within the probe, at least a portion of nucleotide sequence complementary to a target nucleotide sequence to be detected must be located in the loop segment. Preferably, the nucleotide sequence complementary to a target nucleotide sequence to be detected is a D- DNA sequence, but it can be of any genetically-coded and/or naturally occurring structures.
The probes of the invention can further comprise an element or a modification that facilitates intramolecular crosslinking of the probe upon suitable treatment. Such an element can be a chemically or photoactively activatable crosslinking agent, e.g., furocoumarins. Alternatively, such element can be a macromolecule having multiple ligand binding sites, e.g., component(s) of biotin-avidin binding system or an antigen-antibody binding system.
The probe can further comprise an element or a modification that renders the probe sensitive or resistant to nuclease digestion. For example, such an element can be a restriction enzyme cleavage site. In another example, at least a portion of the stem/double stranded segment of the probe is a duplex between an L-DNA strand and a RNA strand, said L-DNA strand contains methylphosphonates. The methylphosphonate L-DNA:RNA hybrid in the probe itself is resistant to RNase H cleavage.
Probe sequences that are designed to detect a target sequence should be sufficiently complementary to hybridize with the target sequence using the loop segment under the selected conditions. Sufficient complementarity exists when an RNA or DNA strand will hybridize under selective hybridization conditions to its complement target sequence. Typically, selective hybridization will occur when there is at least about 65% complementarity over a stretch of at least 14 to 25 nucleotides, preferably at least about 75%, more preferably at least about 90% complementarity (See e.g., Kanehisa, Nucleic Acids Res., 12:203 (1984)).
A hairpin probe can be prepared by synthesizing each portion of the probe, i.e., the stem portions and the loop portion, and then coupling the portions together as a single hairpin probe by conjugation to each end of a separately prepared linker. For example, the linker can be an alkylene group (of from about 6 to about 24 carbons in length), a polyethyleneglycol group (of from about 2 to about 24 ethyleneglycol monomers in a linear configuration), a polyalcohol group, a polyamine group (e.g., spermine, spermidine and polymeric derivatives thereof), a polyester group (e.g., poly(ethyl acrylate) having from about 3 to 15 ethyl acrylate monomers in a linear configuration), a polyphosphodiester group, or a polynucleotide (having from about 2 to about 12 nucleic acids). Preferably, the linking group will be a polyethyleneglycol group which is at least a tetraethyleneglycol, and more preferably, from about 1 to 4 hexaethyleneglycols linked in a linear array.
When synthesizing the hairpin probe from separate sequence portions of the hairpin probe (i.e., stem and loop portions), the linker will be provided with functional groups at each end that can be suitably protected or activated. The functional groups are covalently attached to each portion of the probe via an ether, ester, carbamate, phosphate ester or amine linkage to either the 5'-hydroxyl or the 3'-hydroxyl of the probe portions chosen such that the complementary sequences are in an anti-parallel configuration. Preferred linkages are phosphate ester linkages similar to typical oligonucleotide linkages. For example, hexaethyleneglycol can be protected on one terminus with a photolabile protecting group (i.e., NVOC or MeNPOC) and activated on the other terminus with 2-cyanoethyl-N,N- diisopropylamino-chlorophosphite to form a phosphorarnidite. This linking group can then be used for construction of the probe libraries in the same manner as photolabile-protected, phosphoramidite-activated nucleotides. Other methods of forming ether, carbamate or amine linkages are known to those of skill in the art and particular reagents and references can be found in such texts as March, Advanced Organic Chemistry, 4th Ed., Wiley-Interscience, New York, N.Y., 1992. Immobilization of Probes
In another aspect, the present invention provides an array of oligonucleotide probes immobilized on a solid support for hybridization analysis, which array comprises a solid support suitable for use in nucleic acid hybridization having immobilized thereon a plurality of oligonucleotide probes, each of the probes comprising an L-DNA nucleotide sequence which, under suitable conditions, is capable of forming the stem segment of a hairpin structure and comprising a loop segment having a nucleotide sequence that is complementary to a target nucleotide sequence to be detected.
In certain embodiments, hairpin probes are immobilized to a solid support such as biochip. The solid support may be biological, nonbiological, organic, inorganic, or a combination of any of these, existing as particles, strands, precipitates, gels, sheets, tubing, spheres, containers, capillaries, pads, slices, films, plates, slides, etc.
A solid support for immobilizing probes is preferably flat, but may take on alternative surface configurations. For example, the solid support may contain raised or depressed regions on which probe synthesis takes place or where probes are attached. In some embodiments, the solid support can be chosen to provide appropriate light-absorbing characteristics. For example, the support may be a polymerized Langmuir Blodgett film, glass or functionalized glass, Si, Ge, GaAs, GaP, SiO.sub.2, SiN.sub.4, modified silicon, or any one of a variety of gels or polymers such as (poly)tetrafluoroethylene, (poly)vinylidendifluoride, polystyrene, polycarbonate, or combinations thereof. Other suitable solid support materials will be readily apparent to those of skill in the art.
The surface of the solid support can contain reactive groups, which could be carboxyl, amino, hydroxyl, thiol, or the like suitable for conjugating to a reactive group associated with an oligonucleotide or a nucleic acid. Preferably, the surface is optically transparent and will have surface Si-OH functionalities, such as are found on silica surfaces.
Hairpin probes can be attached to the solid support by chemical or physical means such as through ionic, covalent or other forces well known in the art. Immobilization of nucleic acids and oligonucleotides can be achieved by means well known in the art (see, e.g., Dattagupta et al., Analytical Biochemistry, 177:85-89(1989); Saiki et al., Proc. Natl. Acad. Sci. USA, 86:6230-6234(1989); and Gravitt et al., J. Clin. Micro., 36:3020-3027(1998)).
Hairpin probes can be attached to a solid support by means of a spacer molecule, e.g., essentially as described in U.S. Pat. No. 5,556,752 to Lockhart et al., to provide space between the double stranded portion of the probe as may be helpful in hybridization assays. A spacer molecule typically comprises between 6-50 atoms in length and includes a surface attaching portion that attaches to the solid support. Attachment to the support can be accomplished by carbon—carbon bonds using, for example, supports having (poly)trifluorochloroethylene surfaces, or preferably, by siloxane bonds (using, for example, glass or silicon oxide as the solid support). Siloxane bonding can be formed by reacting the support with trichlorosilyl or trialkoxysilyl groups of the spacer. Aminoalkylsilanes and hydroxyalkylsilanes, bis(2-hydroxyethyl)-aminopropyltriethoxysilane, 2- hydroxyethylaminopropyltriethoxysilane, arninopropyltriethoxysilane or hydroxypropyltriethoxysilane are useful are surface attaching groups.
The spacer can also include an extended portion or longer chain portion that is attached to the surface attaching portion of the probe. For example, amines, hydroxyl, thiol, and carboxyl groups are suitable for attaching the extended portion of the spacer to the surface attaching portion. The extended portion of the spacer can be any of a variety of molecules which are inert to any subsequent conditions for polymer synthesis. These longer chain portions will typically be aryl acetylene:, ethylene glycol oligomers containing 2-14 monomer units, diamines, diacids, amino acids, peptides, or combinations thereof.
In some embodiments, the extended portion of the spacer is a polynucleotide or the entire spacer can be a polynucleotide. The extended portion of the spacer also can be constructed of polyethyleneglycols, polynucleotides, alkylene, polyalcohol, polyester, polyamine, polyphosphodiester and combinations thereof. Additionally, for use in synthesis of probes, the spacer can have a protecting group, attached to a functional group, e.g., hydroxyl, amino or carboxylic acid) on the distal or terminal end of the spacer (opposite the solid support). After deprotection and coupling, the distal end can be covalently bound to an oligomer or probe.
Microarray Formation
A variety of hairpin probes can be attached to a single solid support to form a microarray by procedures well known in the art . This is also referred to as a "micro array biochip" or "DNA biochip."
A microarry biochip containing a library of probes can be prepared by a number of well known approaches including, for example, light-directed methods, such as VLSEPS™ described in U.S. Pat. No. 5,143,854; mechanical methods such as described in PCT No. 92/10183 or U.S. Pat. No. 5,384,261; bead based methods such as described in U.S. Pat. No. 5,541,061; and pin based methods such as detailed in U.S. Pat. No. 5,288,514. U.S. Pat. No. 5,556,752 to Lockhart, which details the preparation of a library of different double stranded probes as a microarry using the VLSIPS™ also is suitable for preparing a library of hairpin probes in a microarray.
Flow channel methods, such as described in U.S. Pat. Nos. 5,677,195 and 5,384,261, can be used to prepare a microarry biochip having a variety of different hairpin probes. In this case, certain activated regions of the substrate are mechanically separated from other regions when the probes are delivered through a flow channel to the support. A detailed description of the flow channel method can be found in U.S. Pat. No. 5,556,752 to Lockhart et al., including the use of protective coating wetting facilitators to enhance the directed channeling of liquids though designated flow paths.
Spotting methods also can be used to prepare a microarry biochip with a variety of hairpin probes immobilized thereon. In this case, reactants are delivered by directly depositing relatively small quantities in selected regions of the support. In some steps, of course, the entire support surface can be sprayed or otherwise coated with a particular solution. In particular formats, a dispenser moves from region to region, depositing only as much probe or other reagent as necessary at each stop. Typical dispensers include a micropipette, nanopippette, ink-jet type cartridge or pin to deliver the probe containing solution or other fluid to the support and, optionally, a robotic system to control the position of these delivery devices with respect to the support. In other formats, the dispenser includes a series of tubes or multiple well trays, a manifold, and an array of delivery devices so that various reagents can be delivered to the reaction regions simultaneously. Spotting methods are well known in the art and include, for example those described in U.S. Pat. Nos. 5,288,514, 5,312,233 and 6,024,138. In some cases, a combination of flowing channel and "spotting" on predefined regions of the support also can be used to prepare microarry biochips with immobilized hairpin probes.
Methods for Detecting a Target Nucleotide Sequence in a Sample
In still another aspect, the present invention provides a method for detecting a target nucleotide sequence in a sample, comprising the steps of: a) providing an oligonucleotide probe having a hairpin structure, comprising an L-DNA nucleotide sequence in the stem segment of the hairpin structure, and wherein at least a portion of the loop segment comprises a nucleotide sequence that is complementary to a target nucleotide sequence to be detected; b) contacting the probe provided in step a) with a sample containing or suspected of containing the target nucleotide sequence under conditions that favor hybridization between the probe and the target nucleotide sequence; and c) assessing the hybrid formed in step b) whereby presence of the hybrid indicates the presence of the target nucleotide sequence in the sample.
Following is an example that illustrates procedures for practicing the invention. This example should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.
Example
Materials and Methods
Synthesis of MBs and Their Targets: To demonstrate L-DNA stem MBs, three oligonucleotide sequences were chosen, see Table 2 below. MBl sequence, which does not have any biological targets, is randomly designed since it is one of well-behaved MB sequence. The other two MBs, MB2 and MB3, were specially designed to target /2-actin mRNA (GenBank Accession No. BC014861) and MnSOD mRNA (Gen-Bank Accession No. NM-000636), respectively. (Medley, C. D.; Drake, T. J.; Tomasini, J. M.; Rogers, R. J.; Tan, W. Anal.Chem. 2005, 77, 4713-18).
The L-Deoxyphosphoramidites were obtained from ChemGenes Corporation (Wilmington, MA). The other synthesis reagents were from Glen Research Corporation (Sterling, VA). All molecular beacons and their targets were synthesized using an ABI 3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA) at lμmol scale with the standard synthesis protocol. Dabcyl CPG was used for all MB preparation.
To ensure high coupling yield, the coupling of FAM to 5' end of each molecular beacon was extended to 15 min. For the complete cleavage and deprotection, overnight incubation with ammonia was used. After ethanol precipitation, the precipitates were then dissolved in 0.5ml of 0.1 M triethylammonium acetate (TEAA, pH7.0) for further purification with high- pressure liquid chromatography (HPLC). The HPLC was performed on a ProStar HPLC Station (Varian, CA) equipped with a fluorescent detector and a photodiode array detector. A C-18 reverse phase column (Alltech, Cl 8, 5μM, 250x4.6mm) was used.
Hybridization Experiments: Fluorescence measurements were performed with a Fluorolog-3 Model FL3-22 spectra fluorometer (JOBIN YVON-SPEX Industries, Edison, NJ) using a 100 μl quartz cuvette. All hybridizations were performed at room temperature.
First, the background fluorescence from 200μl of the buffer containing 2OmM of Tris- HCl (pH7.5), 5OmM NaCl and 5mM MgCl2, designated as MB buffer, was monitored for about 1 minute, and then each stock MB solution (20 μM) was added to the hybridization buffer to reach final concentration of 65nM and the fluorescence was monitored. After a stable fluorescent signal was obtained from the MB, an excess of target oligonucleotide (65OnM) was added. The level of fluorescent intensity was recorded until the signal reached plateau. The excitation and emission wavelengths were set to 488nm and 520nm, respectively. Signal enhancement was calculated using the following equation:
S/B=(Fopen-Fbuffer)/(Fclosed-Fbuffer)
Fopen: fluorescence signals from opened MBs Fciosed : fluorescence signals from closed MBs fluorescence signal of buffer
Melting Temperature (Tm) Measurement of Molecular Beacons: Thermal denaturizing profiles of each MB were recorded to evaluate the stability of the stems using by a BioRad RT-PCR thermal cycler. The identical buffer to the one used for hybridization study was used. The solution was prepared with 10OnM final concentration of each MB. The fluorescence intensity of each MB in buffer at temperatures ranging from 10°C to 95 °C in the intervals of 1°C, was measured and plotted against the temperature to generate the melting temperature curve.
Nuclease Sensitivity. To test the nuclease digestion of MBs, Deoxynuclease I from Sigma-Aldrich, Inc. (St. Louis, MO) was chosen as a standard nuclease. The fluorescence of 65 nM of MBs in MB buffer was measured as a function of time at room temperature. Once the fluorescence is stabilized, two units of ribonuclease-free DNase I was added, and the fluorescence change was monitored until it reached to plateau.
RNase H sensitivity. To test the vulnerability of MB-RNA duplexes to ribonuclease H from Sigma-Aldrich, Inc. (St. Louis, MO) digestion, 65 nM of MBs and RNA targets were incubated in the MB buffer while the fluorescence intensity was monitored. After the hybridization reached equilibrium, two units of ribonuclease H were added, and the change in fluorescence was recorded as a function of time.
Preparation of Cell lysate. Cell lysate was prepared using CCRF-CEM (CCL-119, T cell line, human ALL) obtained from American Type Culture Collection (Manassas, VA) and Cell culture lysis buffer containing 25mM Tris(pH 7.8 with H3PO4), 2mM CDTA, 2mM DTT, 10%glycerol and 1% Triton®X-100 purchased from Promega (Madison, WT) with the protocol recommended by manufacture.
Results and Discussion
Stability and Sensitivity of L-DNA stem MBs (LS MBs). The features of chimeric MBs of the subject invention, where two different types of bases were used to construct MBs, were explored. To show the feasibility of an L-DNA stem, three L-DNA stem MBs were synthesized using sequence MBl, MB2 and MB3 shown in Table 2 below. The same sequences were used to prepare control MBs, called DS MBs entirely made of D-DNA bases.
Hybridization of each MB to its corresponding natural DNA target was performed under the same conditions. In order to ensure all MBs are opened, 10 times more target DNAs were supplied. The signal enhancement was calculated with the S/B equation described herein.
As shown in Figure 2a, the L-DNA stem duplex was able to maintain the hairpin conformation and dehybridize when the loop binds to its target with moderate hybridization kinetics. More interestingly, LS MB 1 produced a lower fluorescence signal in the absence of its target. Compared to DS MB 1 , the signal enhancement ratio of the LS MB 1 was more than twice higher than that of the DS MB 1, 46 folds as compared to 21 folds, respectively in Figure 2b. Such a high signal enhancement from LS MB 1 was consistently observed from the three MBs of different sequences, LS MB 2 and LS MB 3. They had 18 and 30 times enhancement compared to their counterparts MB 2 and MB 3, 9 and 18 times, respectively (Figure 2b). Thus, the better S/B of L-DNA stem MBs over regular D-DNA MBs can be generalized regardless of oligo sequences.
The improved sensitivity is believed to be a result from the enhanced stability of the hairpin conformation in L-DNA MBs due to the lack of stem-loop interactions which could otherwise contribute to a significant background. The better structural stability causing higher S/B was supported by the higher stem melting temperature of stems (T111) for LS MBs than that of DS MBs.
Improved structural stability. To evaluate the stem stability of MBs, the melting temperature (Tm) of each probe was examined and compared. For all MB sequences prepared, LS MBs showed higher melting temperatures than their counterparts did. For example, the LS MB 1 has a melting temperature of about 62 0C while that for the DS MB 1 is about 58 °C (Figure 3a). This difference is well above the errors in Tm measurement by instrument (<0.5 °C). The other sequences, MB 2 and MB 3, also had consistent higher melting temperatures in the case of L-DNA stem design (Figure 3 (b)).
As L-DNA:L-DNA base pairs have comparable stability to that of their D-DNA counterparts, such an increase in Tm is probably due to a more stable hairpin conformation of the LS MB than that of the DS MB rather than stronger base paring between L-DNA bases. (Hauser, N. C; Martinez, R.; Jacob, A.; Rupp, S.; Hoheisel, J. D.; Matysiak, S. Nucl.Acids Res. 2006, 34, 5101-11). The improved stability of the L-DNA stem is consistent with the enhanced sensitivity of the probe observed in the hybridization experiments described herein.
The partial replacement of stem bases to L-DNA bases caused dwindling of duplexes with their complementary sequences. While not being bound to any one theory, this could be due to the different folding tendency between L- and D-formed DNAs in destabilized chimeric duplexes. LS MBs do not have a junction of different twist in double strand regions; rather, homogeneous folding of L-DNA stems is observed, where the folding is left- handed. Thus, the L-DNA stems are strong enough to maintain the stable hairpin structure, and, actually, show better stability than the pure D-DNA probes.
Elimination of intramolecular interaction. As discussed above, intramolecular interactions between stem and loop domains can cause a high background due to thermal fluctuation since DNAs are flexible molecules and their conformation can not be fixed to be only one. In the case of other linear nucleic probes using FRET as signalling mechanism, the thermal fluctuation of conformation change would not be critical since FRET does not take place without proper binding moiety. In the case of hairpin structures such as the MBs, the minor contribution of non-hairpin conformation can, however, affect S/B more dramatically due to a high background signal from non-hairpin structured conformation. Thus, elimination of unnecessary intramolecular interaction between stem and loop domain and forcing hairpin formation of MBs can improve sensitivity of MBs as well as ease in designing MB stems. As a solution, decreasing the number of possible conformation of MBs can also force MBs to remain in the hairpin structure. In thermodynamics, the change of Gibbs energy (ΔG) is defined as a function of entropy (ΔS) and enthalpy change (ΔH) with fixed temperature (T). S is defined as the number of microscopic configurations that result in the observed macroscopic description of the thermodynamic system, hi both DS and LS MB, it may be assumed that ΔH would not be much different to form hairpin structure because the affinity of L-DNA bases to L-DNA bases is comparable to that of D-DNA bases toward D-DNA bases.
On the other hand, the value of ΔS for LS MB is much smaller than that for DS MB. The main reason is that S of random configuration for DS MB is a lot larger than that for LS MB, resulting in small -ΔG value in DS MB compared to LS MB. Such a difference makes LS MB form hairpin structures more favorable. Thus, utilizing orthogonal-base paring can force MBs to form desired structure that are less affected by thermal conformational fluctuation. As a result, the stem stabilities of chimeric MBs can increase.
To prove the hypothesis that the low affinity of L-DNA to D-DNA can eliminate the stem-loop interaction and stabilize hairpin structural more efficiently, a DS MB 1-1 was designed. This sequence has the purpose that non-hairpin structure is dominant because one of its stems can strongly interact with loop region (blue underline in the sequence), as shown in Figure 4a when built with DNA. Thus, DS MB 1-1 can have two dominant conformations, hairpin and non-hairpin structures (Figure 4b and 4c), and their distributions are dependent on thermodynamic stability.
Replacing the MB stem with an L-DNA stem can ensure a hairpin structure as a dominant structure, as shown in Figure 4c, since the L-DNA cannot hybridize with D-DNA. The major difference between the two MBs was observed in the hybridization kinetics with their targets. The DS MB 1-1 showed noticeably slow hybridization rate (Figure 4d). Without being bound to any one reason, it is believed that the reduction of exposed loop sequences to its target ensures minimized chances of interactions between a probe and its target. Another reason is the extra energy required for dehybridization of the partially hybridized loop region before the probe binds to the target.
The LS MB 1-1 hybridized with the target much faster than that of DS MB 1-1. This is because the fully open loop region can be easily accessed for interaction to its target, resulting in a fast dynamic response. The results described herein confirm that using L-DNA stem in designing MBs can effectively eliminate undesired stem-loop interactions in hairpin structured nucleic acid probes.
Elimination of false positive signal. The other major advantage of using L-DNA stem in MB construction is to prevent false reporting coming from the stem and non-target sequence interactions (Figure Ib, Prior Art). This is an intrinsic problem of all DS MBs. Typically a short sequence with only 5 to 6 base pairs, a DNA stem in MBs is vulnerable to the invasion of non-target sequences, causing non-selective opening of MB and false positive signal.
In order to evaluate the extent of such non-specific interactions, oligonucleotides were designed with different lengths that had 6 bases complementary to the stem of the MB, while the remaining sequence matched the loop region: 5'-CCTAGC-3', 5'-CCTAGCGC-3', 5- CCTAGCGCGA-3', and 5 ' -CCT AGCGCGACC-3 ' (underline is complementary to the stem sequence of the MB; the L-DNA sequences are in bold). The thermodynamic stabilities of each target with their complementary sequences are shown in Table 2.
Table 2 — Sequences of hairpin probes and their targets.
Name Sequence
S'-FAM-CCTAGCTCTAAATCACTATGGTCGCGCTAGG-Dabcyl-S ' (SEQ
LS MB 1
ID NO: 1)
S'-FAM-CCGAGCCAGTTACATTCTCCCAGTTGATTGCTCGG-Dabcvl-S'
LS MB 2
(SEQ ID NO:2)
5'-FAM-CCGTCGAGGAAGGAAGGCTGGAAGAGCGACGG-Dabcvl-3 '
LS MB 3
(SEQ ID N0:3)
S'-FAM-CCTAGCTCTAAATCAGCTAGGTCGCGCTAGG-Dabcyl-S ' (SEQ
LS MB 1-1
ID NO: 4)
5 '-FAM-CCTAGCTCTAAATCACTATGGTCGCGCTAGG-Dabcvl-S ' (SEQ
DS MB 1
ID NO:5)
5'-FAM-CCGAGCCAGTTACATTCTCCCAGTTGATTGCTCGG-Dabcyl-3 '
DS MB 2
(SEQ ID NO:6)
5'-FAM-CCGTCGAGGAAGGAAGGCTGGAAGAGCGACGG-Dabcvl-3'
DS MB 3
(SEQ ID NO:7)
5 '-FAM-CCTAGCTCTAAATCAGCTAGGTCGCGCTAGG-Dabcvl-S ' (SEQ
DS MB 1-1
ID NO:8)
MB 1 target (LCD) 5'-GCGACCATAGTGATTTAGA-S ' (SEQ ID NO.9)
51- CCGAGCAATCAACTGGGAGAATGTAACTG-S1
MB 2 target (SEQ ID NO: 10)
MB 3 target 51- CCGTCGCTCTTCCAGCCTTCCTTCCT -3' (SEQ ID NO: 11)
The loop complementary DNA target, 5'-GCGACCATAGTGATTTAGA-S' (SEQ ID NO:9) was also prepared as a reference. These sequences were incubated with both LS and DS MB 1 for 1 hr, respectively. The responses of the MBs were recorded and the fluorescence signal of each sample was compared based on the fluorescence signal of MB loop cDNA mixture (Figure 5 a). For DS MB 1, incubation with 10 fold excess of the 6mer DNA target failed to open the hairpin structure. This is as expected since intramolecular binding constant between the stem sequences is far greater than the intermolecular interaction between one arm of the stem and the 6mer DNA.
Similar result was obtained for the 8mer sequence. On the contrary, in the presence of a lOmer DNA, which was complementary to one arm of the stem and 4 adjacent bases in the loop, about 55% of the DS MB 1 opened up. The 12mer sequence, in 10 fold excess, was able to fully open the DS MB 1 (Figure 5 a). This result clearly demonstrates how severely the stem invasion sequence could compromise the MB's function and its selectivity in biological/biotechnological applications.
There are tremendously diversified sequences in a real sample matrix, and the copy number of this type of short complementary sequences could be very high. The chance of such a stem invasion is thus high. It can be one of reasons to limit the usage of MBs in quantitative analysis. In contrast, L-DNA MB does not have such a problem. None of the sequence except the full length target sequence was able to open up the L-DNA MB, indicating a superior selectivity and stability. The reduction of number of bases which can interact with the short sequences is the major reason preventing LS MB from false opening. Such an excellent selectivity from the L-DNA stem can be very useful in analyzing raw samples without purification for quantitative analysis and for living cell studies.
Biostable LS MBs. In general, degradation of D-DNA MBs is one of the most important problems in intracellular applications. (Li, J. J.; Geyer, R.; Tan, W. Nucl. Acids Res. 2000, 28, e52). In order to solve this problem, non-standard nucleic acid bases have been explored to design MBs, such as peptide nucleic acid (PNA), (Kuhn, H., Demidov, V. V., Gildea, B. D., Fiandaca, M. J., Coull, J. C, and Frank-Kamenetskii, M. D. 2001, Antisense & Nucleic Acid Drug Development 11, 265-270; Petersen, K., Vogel, U., Rockenbauer, E., Nielsen, K. V., Kolvraa, S., Bolund, L., and Nexo, B. 2004, MoI. Cell. Probes 18, 117-122; Seitz, O. 2000, Angewandte Chemie-International Edition 39, 3249-3251; Petersen, K.; Vogel, U.; Rockenbauer, E.; Nielsen, K. V.; Kolvraa, S.; Bolund, L.; Nexo, B. 2004, Molecular and Cellular Probes 18, 117-22), locked nucleic acid (LNA), (Wang, L.; Yang, C. Y. J.; Medley, C. D.; Benner, S. A.; Tan, W. H. Journal of the American Chemical Society 2005, 127, 15664-65; Koshkin, A. A., Rajwanshi, V. K., and Wengel, J. 1998, Tetrahedron Lett. 39, 4381-4384; Koshkin, A. A., Nielsen, P., Meldgaard, M., Rajwanshi, V. K., Singh, S. K., and Wengel, J. 1998, J. Am. Chem. Soc. 120, 13252-13253; Wengel, J. 1999, Ace. Chem. Res. 32, 301-310; and Vester, B. and Wengel, J. 2004, Biochemistry (Mosc). 43, 13233- 13241) and 2-OMe RNAs. (Kehlenbach, R. H. 2003, Nucleic Acids Res. 31; Marras, S. A. E., Gold, B., Kramer, F. R., Smith, I., and Tyagi, S. 2004, Nucleic Acids Res. 32; Mhlanga, M. M., Vargas, D. Y., Fung, C. W., Kramer, F. R., and Tyagi, S. 2005, Nucleic Acids Res. 33, 1902-1912; Molenaar, C, Marras, S. A., Slats, J. C. M., Truffert, J. C, Lemaitre, M., Raap, A. K., Dirks, R. W., and Tanke, H. J. 2001, Nucleic Acids Res. 29, art-e89; and Tsourkas,A., Behlke,M.A. and Bao,G. 2003, Nucleic Acids Res., 30, 5168-5174). Most of these bases showed greatly improved biostability. In addition, their stronger duplexes with their targets are very favourable in stable signal production. Thus, incorporation of L-DNA stems to such bases can be highly beneficial to intracellular monitoring since they will have high selectivity as well as stability to resist enzymatic degradation. 2-OMe modified RNA bases were chosen for the loop design using the three MB sequences as a model system, designated as LS OMe MBs. 2-OMe RNAs are known as non- standard nucleic acid bases which can recognize natural nucleic acid targets but are not biodegradable. The predictable behaviour of 2-OMe RNA bases is beneficial to design MBs. Thus, the combination of L-DNA stem and 2-OMe RNA loop are an ideal molecular beacon design because the combination can eliminate a lot of problems that conventional MBs have.
In order to demonstrate the feasibility of LS OMe MBs in intracellular measurement, their biostability, sensitivity, and selectivity were investigated. Three different sequences of LS OMe MBs were prepared and their characterization was done in the way as described above.
As shown in Figures 6a, b, and c, such a replacement of the loops did not affect structural stability and selectivity regardless of sequences. They still showed higher S/B and Tm compared to DS MBs. In addition, LS OMe MBs had much better resistance to nuclease digestion. DS MBs showed instant signal increase with the addition of DNase I (data not shown), but the LS OMe MBs did not show such an increase with DNase I but with target DNAs (Figure 6a). The nuclease resistance of LS OMe MBs can be more beneficial to detect low copy number of mRNAs since the false-positive signal coming from MB degradation will not be the case for LS-OMe MBs.
Next, the stability of DS and LS OMe MB/RNA target duplexes were inspected using RNase H. In the case of DS MBs, dramatic signal decrease was observed after RNase H was added to the duplexes. This means that the DS MB/RNA target duplexes are very vulnerable to RNase H digestion, resulting in signal fluctuation for intracellular measurement. LS OMe MBs/RNA target duplexes stay stable and resistant to RNase H activity due to 2-0Me RNA loops. Even though the biostability of LS OMe MBs was proved using DNase I and RNase H, it did not represent true cellular environments. Thus, cell lysate was used because all cellular components in freshly prepared cell lysate are still active, and it can be representative of intracellular environment.
The investigation of LS OMe MBs in terms of intracellular application clearly proved that such a strategy of designing MBs are very useful to design biostable MBs. LS OMe MBs can eliminate many sources of false positive and negative signals in intracellular measurement. Conclusion
In summary, this example established that the use of an L-DNA stem in a hairpin structured DNA probe, such as a MB, eliminates unwanted intra- and intermolecular interactions. The exclusion of stem-loop interaction in an L-DNA stem MB ensures a hairpin structure to be dominant so that L-DNA stems improve hairpin DNA probe's sensitivity and stability. The use of L-DNA stems prevents the probe from being opened by non-specific sequences that contains short sequences complementary to the stem. Thus, stem invasion causing false positive signal can be absolutely eliminated. hi addition, the advantages described above regarding L-DNA stems, can be applied to any kind of chimeric MB design. Thus, L-DNA stems can be universal to stabilize hairpin conformation of any nucleic acid probe, regardless of the types of nucleic acids in the probes. Moreover, the combination of nuclease resistant loop and L-DNA stems are an ideal molecular beacon design since it removes the possibility of false positive and negative reports coming from intracellular enzymatic activities and non-specific interactions of MBs and targets. Thus, the subject L-DNA stem strategy is the simplest, most direct and most effective way to develop hairpin structured DNA probes with desired properties.
All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.
It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application.

Claims

CLAIMS We claim:
1. A probe for detecting a target nucleotide sequence in a sample, said probe comprising a hairpin structure, said structure comprising a stem segment and a loop segment, wherein at least a portion of the stem segment comprises L-DNA bases and at least a portion of the loop segment comprises D-DNA bases that form a nucleotide sequence.
2. The probe according to claim 1, wherein the entire portion of the stem segment comprises L-DNA bases.
3. The probe according to claim 1, wherein more than one portion of the stem segment comprises L-DNA bases.
4. The probe according to claim 1 , wherein the entire portion of the loop segment comprises D-DNA bases.
5. The probe according to claim 1, wherein the D-DNA bases form a nucleotide sequence that is complementary to the target nucleotide sequence in the sample.
6. The probe according to claim 1, wherein the D-DNA bases form a nucleotide sequence that is substantially complementary to the target nucleotide sequence in the sample
7. The probe according to claim 1, wherein the probe is selected from the group consisting of SEQ ED NOS: 1-4.
8. A method for detecting a target nucleotide sequence in a sample, said method comprising the steps of: (a) providing a probe comprising a hairpin structure, said structure comprising a stem segment and a loop segment, wherein at least a portion of the stem segment comprises L-DNA bases and at least a portion of the loop segment comprises D- DNA bases; (b) contacting said probe provided in step (a) with a sample containing or suspected of containing the target nucleotide sequence under conditions that favor hybridization of the D-DNA bases within the loop with complementary bases of the target nucleotide sequence; (c) detecting whether the hybrid formed in step (b) is present, wherein the detection of the hybrid indicates the presence and/or amount of the target nucleotide sequence in the sample.
9. The method of claim 8, wherein the entire portion of the stem segment comprises L-DNA bases.
10. The method of claim 8, wherein more than one portion of the stem segment comprises L-DNA bases.
11. The method of claim 8, wherein the entire portion of the loop segment comprises D-DNA bases.
12. The method of claim 8, wherein the D-DNA bases form a nucleotide sequence that is complementary to the target nucleotide sequence in the sample.
13. The method of claim 8, wherein the D-DNA bases form a nucleotide sequence that is substantially complementary to the target nucleotide sequence in the sample
14. The method of claim 8, wherein the probe is selected from the group consisting of SEQ ID NOS: 1-4.
PCT/US2008/010466 2007-09-07 2008-09-08 Superior structure stability and selectivity of hairpin nucleic acid probes with an l-dna stem Ceased WO2009035554A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US96789407P 2007-09-07 2007-09-07
US60/967,894 2007-09-07

Publications (2)

Publication Number Publication Date
WO2009035554A2 true WO2009035554A2 (en) 2009-03-19
WO2009035554A3 WO2009035554A3 (en) 2009-05-14

Family

ID=40452748

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/010466 Ceased WO2009035554A2 (en) 2007-09-07 2008-09-08 Superior structure stability and selectivity of hairpin nucleic acid probes with an l-dna stem

Country Status (1)

Country Link
WO (1) WO2009035554A2 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012085282A1 (en) * 2010-12-23 2012-06-28 Mologen Ag Dna expression construct
AU2011347095B2 (en) * 2010-12-23 2016-04-28 Gilead Sciences, Inc. Non-coding immunomodulatory DNA construct
US11578331B2 (en) 2015-09-09 2023-02-14 Gilead Sciences, Inc. Combination comprising immunostimulatory oligonucleotides
US11583581B2 (en) 2015-09-21 2023-02-21 Gilead Sciences, Inc. Methods of treating a retroviral infection
CN116377136A (en) * 2023-03-14 2023-07-04 广东海洋大学 A fluorescent biosensor based on AIE materials for rapid detection of new crown Omicron strains and its application

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6596490B2 (en) * 2000-07-14 2003-07-22 Applied Gene Technologies, Inc. Nucleic acid hairpin probes and uses thereof

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012085282A1 (en) * 2010-12-23 2012-06-28 Mologen Ag Dna expression construct
CN103370413A (en) * 2010-12-23 2013-10-23 莫洛根股份公司 DNA expression construct
JP2014508512A (en) * 2010-12-23 2014-04-10 モロゲン・アーゲー DNA expression constructs
KR101517365B1 (en) 2010-12-23 2015-05-06 몰로젠 아게 Dna expression construct
AU2011347086B2 (en) * 2010-12-23 2015-07-16 Mologen Ag DNA expression construct
AU2011347095B2 (en) * 2010-12-23 2016-04-28 Gilead Sciences, Inc. Non-coding immunomodulatory DNA construct
CN103370413B (en) * 2010-12-23 2016-06-01 莫洛根股份公司 DNA expression construct
RU2604186C2 (en) * 2010-12-23 2016-12-10 Мологен Аг Dna construct for expression
JP2018007669A (en) * 2010-12-23 2018-01-18 モロゲン・アーゲー Dna expression constructs
US11578331B2 (en) 2015-09-09 2023-02-14 Gilead Sciences, Inc. Combination comprising immunostimulatory oligonucleotides
US11583581B2 (en) 2015-09-21 2023-02-21 Gilead Sciences, Inc. Methods of treating a retroviral infection
CN116377136A (en) * 2023-03-14 2023-07-04 广东海洋大学 A fluorescent biosensor based on AIE materials for rapid detection of new crown Omicron strains and its application
CN116377136B (en) * 2023-03-14 2023-09-15 广东海洋大学 A fluorescent biosensor based on AIE material to rapidly detect the new coronavirus Omicron strain and its application

Also Published As

Publication number Publication date
WO2009035554A3 (en) 2009-05-14

Similar Documents

Publication Publication Date Title
US6380377B1 (en) Nucleic acid hairpin probes and uses thereof
JP4527789B2 (en) Method for detection and amplification of nucleic acid sequences using modified oligonucleotides with increased target-specific TM
US20030077609A1 (en) Modified oligonucleotides and uses thereof
US20050112636A1 (en) Polymeric nucleic acid hybridization probes
US20140045716A1 (en) Methods and Systems for Detecting Nucleic Acids
US20120107820A1 (en) Multiplexed Quantitative PCR End Point Analysis of Nucleic Acid Targets
JPH11510709A (en) Optimal fluorescent oligonucleotide
Siddiquee et al. A review of peptide nucleic acid
WO2012053850A2 (en) Detection of target nucleic acid sequences using dual-labeled immobilized probes on solid phase
WO2009035554A2 (en) Superior structure stability and selectivity of hairpin nucleic acid probes with an l-dna stem
US6596489B2 (en) Methods and compositions for analyzing nucleotide sequence mismatches using RNase H
JP2003528315A (en) Mixed polynucleotide sequences as discrete assay ends
EP1692266A2 (en) Improved methods for detecting and measuring specific nucleic acid sequences
JP2005200405A (en) Oligonucleotides containing molecular rods
EP2058392B1 (en) Dna fragment used in the form attached to 5&#39;-terminus of primer for use in amplification reaction of nucleic acid, and use thereof
JP2003516166A (en) Standardized controls and duplex probes for hybridization reactions
US20230122281A1 (en) TNA-BASED PROBE FOR DETECTING AND IMAGING A TARGET miRNA IN LIVING CELLS
CN118234872A (en) Method for detecting sense and antisense strands in oligonucleotide duplex
US20110053146A1 (en) Compounds and methods for detecting ricin and uses thereof
Delair et al. Synthesis and characterization of nucleic acid–(co) polymer conjugates: application to diagnostics
WO2008048310A2 (en) Bimolecular constructs
AU2001249674A1 (en) Quality control reagents for nucleic acid microarrays
JP2000032999A (en) Pyrene-modified rna, and assay of rna
US20030219755A1 (en) Compositions and methods for performing hybridization assays using target enhanced signal amplification (TESA)
CN112955552B (en) Non-specific binding inhibitor of nucleic acid, hybridization reagent and nucleic acid hybridization method

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08830340

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08830340

Country of ref document: EP

Kind code of ref document: A2