WO2009026148A1 - Selective 5' ligation tagging of rna - Google Patents

Abstract

The present invention provides compositions, kits and methods for selective enrichment, isolation, purification, production, tagging, cloning, amplification, detection, quantification, characterization, and assay of nucleic acid molecules that either have a monophosphate group, a polyphosphate group, or a cap nucleotide on their 5' terminus. The resulting 5'-monophosphorylated RNA molecules generated using the method are 5' ligation tagged by ligating an RNA acceptor oligonucleotide to their 5' ends using RNA ligase. The tagged RNA can be used for full-length-selected synthesis of first-stand cDNA, or double-stranded cDNA for a variety of uses and applications.

Description

SELECTIVE 5' LIGATION TAGGING OF RNA

The present application claims priority to U.S. provisional patent application serial number 60/956,536, filed August 17, 2007, the entire disclosure of which is herein incorporated by reference in its entirety.

FIELD OF THE INVENTION

The invention relates to novel methods, compositions, and kits for selectively tagging the 5'-ends of RNA molecules using RNA ligase, a process referred to as "5' ligation tagging." The selectivity of the 5' ligation tagging methods is conferred by one or more specific enzymes that, alone or in combination, selectively convert only certain desired RNA molecules that have certain groups on their 5' ends to RNA molecules that have a 5' monophosphate, which RNA molecules can then serve as donors for ligation to an acceptor oligonucleotide (e.g., an RNA acceptor oligonucleotide) using RNA ligase. In some embodiments, the 5'-ligation-tagged RNA is used as a template for synthesis of first-strand cDNA or double-stranded cDNA. In some embodiments, the method further comprises cloning the cDNA, which method selects for full-length cDNA. The invention provides compositions, kits and methods for making full-length-selected 5'-ligation- tagged RNA and tagged cDNA for sequencing, gene expression analysis (e.g., using microarrays, real-time PCR, or sequencing), promoter identification, RNA processing analysis, 5' RACE, and many other applications for research, human or non-human diagnostics, or therapeutics.

BACKGROUND OF THE INVENTION

Recent studies have shown that almost all parts of the human genome, including even so-called "non-coding regions", are transcribed into RNA (e.g., see Genome Research Volume 17, Issue 6: June 2007). As a result, there is currently great interest in identifying, characterizing and determining the biological fate and functions of all transcribed RNAs, including mRNAs, non-coding RNAs, such as microRNAs (miRNAs) or their pri-miRNA or pre-miRNA precursors, and other RNA molecules, including those which have not been identified.

There is also continuing interest to identify and analyze expression of various RNA molecules in order to understand differentiation, biological responses to environment, and other biological processes in normal and abnormal cells in eukaryotes. For example, there is great interest to study disease-related RNA molecules in eukaryotic cells in order to understand the initiation and progression of each disease and, hopefully, to find treatments or ways to prevent the disease or the disease progression.

With respect to diseases of eukaryotes caused by pathogenic bacteria, mycoplasma, and viruses, there is great interest to identify, characterize and determine the biological functions of RNAs encoded by genomes of both the host and the pathogen during the course of infection, disease initiation, and disease progression.

The nature of the 5' ends of different RNA molecules plays an important role in their biological structure and function. The chemical moieties on the 5' ends of an RNA molecules influence their structure, stability, biochemical processing, transport, biological function and fate in a cell or organism. The chemical moieties commonly found at the 5' ends of RNA include triphosphates, monophosphates, hydroxyls, and cap nucleotides. The particular chemical moiety on the 5' end provides important clues to the origin, processing, maturation and stability of the RNA. Characterization of this moiety in a newly identified RNA could even suggest a role for the RNA in the cell. Therefore, methods that can discriminate between RNA molecules that contain different 5' end groups are important tools for characterizing, studying, and manipulating RNA.

For example, bacterial mRNAs typically have a triphosphate group on their 5' ends. Still further, many eukaryotic RNAs that are not translated into protein, referred to as "non-coding RNAs" or "ncRNAs," have been described, and many of these ncRNAs have a 5' triphosphate group. In addition, small prokaryotic and eukaryotic ribosomal RNAs (e.g., 5S rRNA), and transfer RNAs (tRNAs) typically have a 5' triphosphate group.

Most eukaryotic cellular mRNAs and most eukaryotic viral mRNA transcripts are blocked or "capped" at their 5' terminus. A "cap" or "cap nucleotide" consists of a guanine nucleoside that is joined via its 5 '-carbon to a triphosphate group that is, in turn, joined to the 5'-carbon of the most 5'-nucleotide of the primary mRNA transcript, and in most eukaryotes, the nitrogen at the 7 position of guanine in the cap nucleotide is methylated. Thus, most eukaryotic cellular mRNAs and most eukaryotic viral mRNAs have an "N⁷-methylguanosine" or "m⁷G" cap or cap nucleotide on their 5' ends.

In addition to eukaryotic cellular and viral mRNAs, some ncRNAs are also capped, and some capped ncRNAs also have a 3' poly(A) tail, like most eukaryotic mRNAs. For example, Rinn, JL et al. (Cell 129: 1311-1323, 2007) described one capped and polyadenylated 2.2-kilobase ncRNA encoded in the HOXC region of human chromosome 12, termed "HOTAIR," that has profound effects on expression of HOXD genes on chromosome 2. In addition, some other eukaryotic RNAs in a sample, such as small nuclear RNAs ("snRNAs"), and pre-miRNAs, can be capped.

The 5' caps of eukaryotic cellular and viral mRNAs (and some other forms of RNA) play important roles in mRNA metabolism, and are required to varying degrees for processing and maturation of an mRNA transcript in the nucleus, transport of mRNA from the nucleus to the cytoplasm, mRNA stability, and efficient translation of the mRNA to protein. For example, the cap plays a pivotal role in the initiation of protein synthesis and in eukaryotic mRNA processing and stability in vivo. The cap provides resistance to 5' exoribonuclease (XRN) activity and its absence results in rapid degradation of the mRNA (e.g., see MoI. Biol. Med. 5: 1-14, 1988; Cell 32: 681-694, 1983). Thus, mRNA prepared (e.g., in vitro) for introduction (e.g., via microinjection into oocytes or transfection into cells) and expression in eukaryotic cells should be capped.

Many eukaryotic viral RNAs are infectious only when capped, and when RNA molecules that are not capped (i.e., they are "uncapped") are introduced into cells via transfection or microinjection, they are rapidly degraded by cellular RNases (e.g., see Krieg, and Melton, Nucleic Acids Res. 12: 7057, 1984; Drummond, et al. Nucleic Acids Res. 13: 7375, 1979).

The primary transcripts of many eukaryotic cellular genes and eukaryotic viral genes require processing to remove intervening sequences (introns) within the coding regions of these transcripts, and the benefits of the cap also extend to stabilization of such pre-mRNA. For example, it was shown that the presence of a cap on pre-mRNA enhanced in vivo splicing of pre-mRNA in yeast, but was not required for splicing, either in vivo or using in vitro yeast splicing systems (Fresco, LD and Buratowski, S, RNA 2: 584-596, 1996; Schwer, B et al, Nucleic Acids Res. 26: 2050-2057, 1998; Schwer, B and Shuman, S, RNA 2: 574-583, 1996). The enhancement of splicing was primarily due to the increased stability of the pre-mRNA since, in the absence of a cap, the pre-mRNA was rapidly degraded by 5' exoribonuclease (Schwer, B, Nucleic Acids Res. 26: 2050- 2057, 1998). Thus, it is also beneficial that transcripts synthesized for in vitro RNA splicing experiments are capped.

While capped mRNA remains in the cytoplasm after being exported from the nucleus, some other RNAs, such as some snRNAs have caps that are further methylated and then imported back into the nucleus, where they are involved in splicing of introns from pre-mRNA to generate mRNA exons (Mattaj, Cell 46: 905-911, 1986; Hamm et al., Cell 62: 569-577, 1990; Fischer, et al., J. Cell Biol. 113: 705-714, 1991).

The splicing reaction generates spiced intron RNA that initially comprises RNA that has a 5' monophosphate group. Thus, at least some initially-generated intron RNA molecules from pre-mRNA splicing reactions also have a 5' phosphate group. In addition, some other RNAs, such as eukaryotic or viral-encoded micro RNAs (miRNAs), and both eukaryotic and prokaryotic large ribosomal RNA molecules (rRNA), including 18S and 26S or 28S eukaryotic rRNAs, or 16S and 23S prokaryotic rRNAs, have a monophosphate group on their 5' ends.

RNase A-degraded RNAs and some other endonucleolytically processed RNA molecules have a 5' hydroxyl group.

Enzymes that modify the 5' ends of RNA are useful tools for characterizing and manipulating various RNA molecules in vitro. For example, alkaline phosphatase (AP) (e.g., APEX™ alkaline phosphatase (EPICENTRE), shrimp alkaline phosphatase (USB, Cleveland, OH), or Arctic alkaline phosphatase (New England Biolabs, MA) converts the 5' triphosphates of uncapped primary RNA and the 5' monophosphates of rRNA to 5' hydroxyl groups, generating RNAs that have a 5' hydroxyl group, but does not affect capped RNA. Nucleic acid pyrophosphatase (PPase) (e.g., tobacco acid pyrophosphatase (TAP)) cleaves the triphosphate groups of both capped and uncapped RNAs to synthesize RNAs that have a 5' monophosphate group. The reaction specificity of RNA ligase can also be a useful tool to discriminate between RNA molecules that have different 5' end groups. This enzyme catalyzes phosphodiester bond formation specifically between a 5' monophosphate in a donor RNA and a 3'-hydroxyl group in an acceptor oligonucleotide (e.g., an RNA acceptor oligonucleotide). Thus, RNAs that have a monophosphate group on their 5' ends, whether present in a sample or obtained by treatment of 5'-triphosphorylated or 5'-capped RNA with TAP, are donor substrates for ligation to an acceptor nucleic acid that has a 3' hydroxyl group using RNA ligase. RNA molecules that contain triphosphate, diphosphate, hydroxyl or capped 5' end groups do not function as donor molecules for RNA ligase (e.g., T4 RNA ligase). Thus, RNAs that have a hydroxyl group on their 5' ends, whether present in a sample or obtained by treatment with AP, cannot serve as donor substrates for RNA ligase. Similarly, RNA molecules that contain a 3 '-terminal blocked group (e.g., RNA molecules that have a 3'-phosphate group or a 3'-beta- methoxyphenylphosphate group) do not function as acceptor substrates for RNA ligase.

Numerous publications disclose use of alkaline phosphatase (AP), tobacco acid pyrophosphatase (TAP), and RNA ligase to manipulate m⁷G-capped eukaryotic mRNAs using so-called "oligo capping methods." For example, but without limitation, oligo capping methods and their use are disclosed in: World Patent Applications WO0104286; and WO 2007/117039 Al; U.S. Patent 5,597,713; Suzuki, Y et al, Gene 200: 149-156, 1997; Suzuki, Y and Sugano, S, Methods in Molecular Biology, 175: 143 - 153, 2001, ed. by Starkey, MP and Elaswarapu, R, Humana Press, Totowa, NJ; Fromont-Racine, M et al., Nucleic Acids Res. 21 : 1683-4, 1993; and in Maruyama, K and Sugano, S, Gene 138: 171-174, 1994; all of which are incorporated herein by reference.

In those oligo capping methods, total eukaryotic RNA or isolated polyadenylated RNA is first treated with AP and then the AP is inactivated or removed. The AP converts RNA that has a 5' triphosphate (e.g., uncapped primary RNA) and RNA that has a 5' monophosphate to RNA that has a 5' hydroxyl. The sample is then treated with TAP, which converts the 5 '-capped eukaryotic mRNA to mRNA that has a 5' monophosphate. The resulting 5'-monophosphorylated mRNA is then "oligo-capped" (or "5' ligation tagged") with an acceptor oligonucleotide using RNA ligase. The "oligo-capped" mRNA that has a "tag" joined to its 5' end in turn serves as a template for synthesis of first-strand cDNA that has a tag joined to its 3' end. Then, double-stranded cDNA can be made using a second-strand cDNA synthesis primer that is complementary to the tag joined to the 3' end of the first-strand cDNA, and the resulting double-stranded cDNA can be used (e.g., to generate a full-length cDNA library). Oligo capping methods in the art are useful for 5' ligation tagging of m⁷G-capped RNA, for making full-length first-strand cDNA using the 5'-ligation-tagged RNA as a template, for making full-length double-stranded cDNA (including full-length cDNA libraries), and for identification of the 5' ends of eukaryotic mRNA (e.g., by sequencing or methods such as random amplification of cDNA ends (5' RACE).

However, one problem with the oligo capping and other methods presently in the art is that the AP step converts the 5' ends of all RNA molecules that have a 5' triphosphate or a 5' monophosphate group to a 5' hydroxyl group (e.g., see FIG 2 of World Patent Applications WOO 104286). Thus, although the AP step is beneficial for some applications because it results in dephosphorylation of 5'-monophosphorylated RNA molecules (e.g., 18S and 26S or 28S eukaryotic rRNA, or 16S and 23S prokaryotic rRNA, or miRNA) so they cannot serve as donors for ligation to the acceptor oligonucleotide by RNA ligase, the AP step also results in dephosphorylation of uncapped mRNA molecules and uncapped non-coding primary RNA molecules (which may have functional significance) so they cannot serve as a donors for ligation to the acceptor oligonucleotide. Therefore, what is needed in the art are methods for 5' ligation tagging of uncapped mRNA and non-coding primary RNA molecules, and for converting said 5'-ligation-tagged RNA molecules to cDNA.

What is needed in the art are methods, compositions, and kits for 5' ligation tagging of a desired population of RNA molecules with an acceptor oligonucleotide using RNA ligase for synthesizing cDNA from full-length desired RNA (e.g., but without limitation, full-length capped eukaryotic RNA, full-length uncapped eukaryotic primary RNA, and/or full-length prokaryotic primary mRNA, or 5'-monophosphorylated RNA molecules (e.g., non-coding RNA, e.g., miRNA) and for cloning said cDNA and for capture and identification of the exact 5' ends of said desired RNA (e.g., by sequencing, or by using methods such as random amplification of cDNA ends (RACE), exon arrays, or other microarrays). DESCRIPTION OF THE INVENTION

One aspect of the invention is a method for 5' ligation tagging of capped RNA and uncapped primary RNA that has a 5' polyphosphate group, comprising the steps of: (A) providing (i) a sample that contains at least capped RNA (e.g., m⁷G-capped RNA) and uncapped RNA that has a 5' polyphosphate group (e.g., RNA that has a 5' triphosphate or a 5' diphosphate group); (ii) an acceptor oligonucleotide (e.g., an RNA acceptor oligonucleotide); (iii) RNA ligase (e.g., T4 RNA ligase, EPICENTRE, or bacteriophage TS2126 RNA ligase); and (iv) nucleic acid pyrophosphatase (e.g., TAP); (B) contacting the sample, wherein the sample has not been contacted with an alkaline phosphatase, with the nucleic acid pyrophosphatase under conditions and for sufficient time wherein the capped RNA and the uncapped RNA that has a 5' polyphosphate group are converted to RNA that has a 5' monophosphate group; (C) contacting the sample from step (B) with the acceptor oligonucleotide and the RNA ligase under conditions and for sufficient time wherein the 3' end of the acceptor oligonucleotide is joined to the 5' end of the RNA that has a 5' monophosphate group and 5'-ligation-tagged RNA is generated.

In some embodiments, the sample additionally contains RNA that has a 5' monophosphate group, which is also 5' ligation tagged in step (C), or RNA that has a 5' hydroxyl group, which is not 5' ligation tagged in step (C).

The method differs from the oligo capping methods in the prior art because those methods use an AP, which converts the 5' ends of RNA that has a 5' triphosphate to RNA that has a 5' hydroxyl, which cannot be used as substrates for 5' ligation tagging (or oligo capping) by RNA ligase. The benefit of the present method is that it generates 5'-ligation- tagged RNA from RNA that has a 5' triphosphate and from RNA that has a 5'- monophosphate, which permits analysis of the identity (e.g., sequence), quantity or relative abundance of 5'-triphosphorylated and 5'-monophosphorylated molecules compared to other RNA molecules (e.g., compared to other RNA molecules within a sample and/or in one or more other samples), annotation, and biological function. Uncapped RNA that has a 5' triphosphate or a 5' monophosphate may have important biological functions. On the other hand, one potential disadvantage of the present method compared to methods in the art is that, since there is no step of treating the RNA in the sample with AP, all RNA molecules in the sample that have a 5' monophosphate group (e.g., 18S and 26S or 28S eukaryotic rRNA or prokaryotic 16S and 23S rRNA) will also be 5' ligation tagged, which 5'-ligation-tagged RNA molecules may not be of interest for a particular purpose.

In some embodiments of the method wherein a nucleic acid pyrophosphatase (e.g., TAP) is provided in step (A), the method further comprises the step of: inactivating or removing the nucleic acid pyrophosphatase following the step of contacting the sample that contains capped RNA or uncapped RNA that has a 5' polyphosphate group with the nucleic acid pyrophosphatase under conditions and for sufficient time wherein capped RNA and uncapped RNA that has a 5' polyphosphate group in the sample is converted to RNA that has a 5' monophosphate group. If possible with respect to a particular embodiment, it is preferable to inactivate the nucleic acid pyrophosphatase by changing the conditions of the reaction mixture following the reaction to new conditions wherein the nucleic acid pyrophosphatase is inactive, but the enzyme used in the next step of the method is active. For example, but without limitation, tobacco acid pyrophosphatase (TAP) is active in a reaction mixture consisting of 50 mM sodium acetate (pH 6.0), 1 mM EDTA, 0.1 % β-mercaptoethanol and 0.01 % Triton XlOO. Following the reaction, the TAP can be inactivated by adjusting the pH to about 7.5 by the addition of sodium phosphate (pH 7.8) to the TAP reaction mixture to a final concentration of 20 mM. Of course, it is important to verify that the enzyme used in the next step of the method is active under these conditions.

In some embodiments of the method the RNA molecules in the sample exhibit a sequence on the 3'-end of the coding sequence that was added post-transcriptionally, either in vivo in one or more cells of the sample or in vitro. In some embodiments, the sequence on the 3'-end of the coding sequence is a poly(A) sequence. In some embodiments wherein at least some of the RNA molecules of interest in a sample do not have a poly(A) tail, the method additionally comprises the step of: providing a poly(A) polymerase (e.g., Escherichia coli poly(A) polymerase or Saccharomyces poly(A) polymerase) and ATP; and contacting the sample with the poly(A) polymerase and the ATP under conditions and for sufficient time wherein a poly(A) tail is added to the 3' ends of the RNA molecules in the sample and RNA that has a poly(A) tail is generated.

In some embodiments, the poly(A) tail is added to the RNA in the sample before the RNA is 5' ligation tagged. In some other embodiments, the poly(A) tail is added to the 5'-ligation-tagged RNA generated using the method.

The addition of a poly(A) tail (or another homopolymeric tail) to the 3' ends of RNA in the sample provides a priming site for synthesis of first-strand cDNA from all of the RNA molecules in the sample, even if the RNA in the sample comprises a variety of different RNA molecules that exhibit different sequences. Also, since the poly(A) tail (or another homopolymeric tail) is added to the 3' end of the RNA in the sample or the 5'- ligation-tagged RNA generated using the method, the use of this tail as a priming site for a first-strand cDNA synthesis primer provides at least the potential for generating full- length first-strand cDNA, which would not be the case if an internal sequence with the RNA or the 5'-ligation-tagged RNA is used as a priming site.

In those embodiments of methods of the invention herein, wherein a poly(A) or other homopolymeric tail is added to the RNA in the sample or the 5'-ligation-tagged RNA, it will be understood herein that the term "5'-ligation-tagged RNA" refers to 5'- ligation-tagged RNA that has a poly(A) or other homopolymeric tail on its 3' end.

In some embodiments, the method further comprises synthesizing first-strand cDNA from the 5'-ligation-tagged RNA, wherein the method additionally comprises the steps of: providing an RNA-dependent DNA polymerase; and contacting the 5'-ligation- tagged RNA with the RNA-dependent DNA polymerase under conditions and for sufficient time wherein first-strand cDNA that is complementary to the 5'-ligation-tagged RNA is synthesized.

In some embodiments, a first-strand cDNA synthesis primer is provided for priming synthesis of the first-strand cDNA using the 5'-ligation-tagged RNA as a template (which 5'-ligation-tagged RNA includes any poly(A) or other homopolymeric tail or oligonucleotide tag sequence on its 3' end). Thus, in some embodiments, the method additionally comprises the steps of: providing a first-strand cDNA synthesis primer that is complementary to the 5'-ligation-tagged RNA; and contacting the 5'- ligation-tagged RNA with the first-strand cDNA synthesis primer and the RNA- dependent DNA polymerase under conditions and for sufficient time wherein cDNA that is complementary to the 5'-ligation-tagged RNA is synthesized.

In some embodiments, the first-strand cDNA synthesis primer comprises a sequence wherein at least its 3' end exhibits a sequence selected from the group consisting of: a sequence that is complementary to a homopolymeric sequence that was added post- transcriptionally, either in vivo in the cell or in vitro, to the 3' end of the RNA in the sample or to the 3' end of the 5 '-ligation- tagged RNA; a sequence that is complementary to a known sequence at the 3' end of one or more RNA molecules; a sequence that is complementary to one or more internal regions of one or more RNA molecules (e.g., that is complementary to one or more specific internal sequences); a collection of all possible sequences wherein each sequence is random (e.g., a random hexamer sequence or a random nonamer sequence, wherein at least one primer is present that is complementary to every sequence in the RNA); a sequence that is complementary to a poly(A) tail (e.g., a sequence selected from among an oligo(dT)n sequence, an oligo(dU)n sequence, an oligo(U)n sequence, an oligo(dT)nX anchored sequence, an oligo(dU)nX anchored sequence, and an oligo(U)nX anchored sequence of any length, but preferably wherein "n" is between about 6 and about 24 nucleotides, and "X" is a mixture of dG, dC and dA nucleotides); and a sequence that is complementary to an oligonucleotide tag that is added to the 3' end of the RNA in the sample or to the 3' end of the 5'-ligation-tagged RNA.

In some preferred embodiments, the first-strand cDNA synthesis primer is complementary to a poly(A) tail or other homopolymeric tail sequence or to an oligonucleotide tag sequence on the 3' end of the RNA of interest. These embodiments are preferred because a first-strand cDNA synthesis primer that anneals at the 3 ' end of the RNA molecules enables potential synthesis of full-length first-strand cDNA. Then, if the first-strand cDNA is used to make double-stranded cDNA, and the second-strand cDNA synthesis primer is complementary to the portion of the first-strand cDNA that is, in turn, complementary to the acceptor oligonucleotide that was joined to the 5' end of the RNA of interest, the double-stranded cDNA will also be full-length and will encompass the sequences that correspond to the true 5' and 3' ends of the RNA molecules of interest. In some embodiments, the method for priming a poly(A) tail is preferred because a poly(A) tail can be added to all of the RNA molecules in a population even if the RNA comprises different sequences. In some embodiments, the poly(A) tail is naturally occurring in the sample (e.g., eukaryotic mRNA, including oligo(dT)-selected poly(A)-tailed eukaryotic mRNA). These embodiments are useful, for example, for making cDNA from one or more (including all) full-length RNA molecules (e.g., mRNA molecules) in the sample (e.g., for cloning; or for gene expression analysis using an array or microarray; or for sequencing; or for other analysis).

In some other embodiments wherein the first-strand cDNA synthesis primer is a complementary to a known sequence within RNA in the sample (e.g., that is complementary to a known sequence at the 3' end of the coding region of the RNA), the method is useful for making cDNA from specific mRNAs for cloning or expression analysis of specific genes.

In other embodiments wherein the first-strand cDNA synthesis primer exhibits a random sequence (e.g., a random hexamer or a random nonamer primer), the method is used for making cDNA from degraded RNA, such as degraded mRNA from a formalin- fixed paraffin-embedded (FFPE) tissue section, e.g., for cloning or expression analysis of genes in the tissue section. A first-strand cDNA synthesis primer that exhibits a random sequence can also be used in embodiments for making cDNA wherein the sequence of the RNA is unknown, or the RNA comprises multiple different RNA molecules that exhibit different sequences.

The invention also comprises embodiments of method wherein the first-strand cDNA synthesis primer additionally exhibits a specific 5' sequence which is 5'-of the sequence exhibited at its 3' end, wherein said specific 5' sequence is capable of serving as a template for synthesis of second-strand cDNA that exhibits a specific 3' sequence that is complementary to the specific 5' sequence and that provides a site for specific priming of second-strand cDNA.

The invention also comprises embodiments wherein the method additionally comprises the steps of: providing RNase H (e.g., Escherichia coli RNase H or HYBRID ASE™ Thermostable RNase H, EPICENTRE, Madison, WI) and RNase I (e.g., Escherichia coli RNase I, EPICENTRE); and contacting the sample containing first- strand cDNA with the RNase H and the RNase I under conditions and for sufficient time wherein the RNA is digested. These embodiments are used for removing the RNA template and the unhybridized RNA following synthesis of the first-strand cDNA. In some preferred embodiments, the method further comprises the step of inactivating or removing the RNase H and the RNase I. In some embodiments, the RNase H and the RNase I are inactivated by heating the reaction prior to proceeding to the next step (e.g., at 7O⁰C for about 15-30 minutes for E. coli RNase H and RNase I). In some embodiments wherein the treatment with RNase H and RNase I is followed by one or more other steps wherein the presence of the RNase H and RNase I is not detrimental, the step of inactivating or removing the RNase H and the RNase I is omitted.

In some embodiments, the method additionally comprises the steps of: providing a DNA-dependent DNA polymerase; and contacting the first-strand cDNA with the DNA-dependent DNA polymerase under conditions and for sufficient time wherein double-stranded cDNA is synthesized. In some embodiments, the method additionally comprises synthesis of double-stranded cDNA, wherein the method additionally comprises the steps of: providing a second-strand cDNA synthesis primer that is complementary to the portion of the first-strand cDNA that is complementary to the acceptor oligonucleotide provided in step (A), and a DNA-dependent DNA polymerase; and contacting the second-strand cDNA synthesis primer and the DNA-dependent DNA polymerase with the first-strand cDNA under conditions and for sufficient time wherein double-stranded cDNA is synthesized. In some embodiments, the DNA-dependent DNA polymerase is the same as the RNA-dependent DNA polymerase provided for synthesis of first-strand cDNA.

In some embodiments, the DNA-dependent DNA polymerase is different from the RNA-dependent DNA polymerase provided for synthesis of first-strand cDNA.

In general, the sample provided in step (A) of the method can be from a eukaryote, a prokaryote, or from both one or more eukaryotes and/or one or more prokaryotes.

With respect to any of the methods of the present invention: If present in the sample, uncapped RNA that has a 5' polyphosphate group can consist of RNA that has a 5' triphosphate group selected from the group consisting of prokaryotic primary RNA and eukaryotic primary RNA In some embodiments, if present in the sample, the uncapped RNA that has a 5' triphosphate group comprises eukaryotic mRNA, eukaryotic non- coding RNA, prokaryotic mRNA, and/or prokaryotic non-coding RNA.

In some preferred embodiments of the method, the acceptor oligonucleotide is an RNA acceptor oligonucleotide (also referred to as an "RNA acceptor oligo" or "RNA acceptor" or "acceptor RNA" or "RNA acceptor molecule" or "RNA oligo acceptor" or the like). The acceptor oligonucleotide is not limited with respect to length, but, in general, the minimum size of an RNA acceptor oligonucleotide consists of a trinucleoside diphosphate. In some preferred embodiments the RNA acceptor oligonucleotide consists of between 3 ribonucleotides and about 25 ribonucleotides. An RNA acceptor oligonucleotide in this small size range is preferred over a larger one because it is possible to use a higher molar concentration of the RNA acceptor oligonucleotide for the RNA ligase step (e.g., to increase the efficiency of 5' ligation tagging of the RNA donor molecules), and because there is less likelihood that the shorter RNA acceptor oligonucleotide will anneal to itself or to one or more RNA sequences exhibited by the RNA donor molecules, either of which could decrease ligation efficiency or result in artifacts. Thus, in some preferred embodiments, it is preferred that the RNA acceptor oligonucleotide exhibits a sequence that is unlikely to anneal to itself (e.g., due to complementarity of intramolecular sequences) and that is unlikely to anneal to RNA donor molecules or other nucleic acids in the sample (e.g., due to complementarity of intermolecular sequences

In some preferred embodiments, the 5' end of the RNA acceptor oligonucleotide has a 5' hydroxyl group so that it cannot serve as an RNA donor for ligation. In some preferred embodiments, the 5' end of the RNA acceptor oligonucleotide has a 5' cap nucleotide, which 5'-capped RNA acceptor oligonucleotide cannot serve as an RNA donor for ligation.

With respect to the nucleoside composition, in some preferred embodiments wherein T4 RNA ligase is used as the ligase, the 3' terminal nucleotide of the RNA acceptor oligonucleotide consists of adenosine. In some preferred embodiments, the 3' terminal nucleotide of the RNA acceptor oligonucleotide does not consist of uridine. In some preferred embodiments, the last two nucleotides at the 3' end of the RNA acceptor oligonucleotide consist of adenosine. In some preferred embodiments, the last three nucleotides at the 3' end of the RNA acceptor oligonucleotide consist of adenosine. In some preferred embodiments, the 3' terminal nucleotide of the RNA acceptor oligonucleotide does not consist of uridine. Additional information for designing and using an RNA acceptor oligonucleotide and information related to the properties and use of the donor RNA that is to be 5' ligation tagged using the methods of the present invention have been disclosed in the art (e.g., Gumport RI and Uhlenbeck OC, Gene Amplif Anal. 2: 313-345, 1981; Gumport RI and Uhlenbeck OC, Gene Amplif Anal. 2: 313-345, 1981; Romaniuk E, McLaughlin LW, Neilson T, and Romaniuk PJ. Eur J Biochem. 125: 639-43, 1982; Romaniuk PJ and Uhlenbeck OC. Methods Enzymol.;100: 52-59, 1983; and Uhlenbeck OC and Gumport RI (1982) In: The Enzymes Vol. XV, pp. 31-58, (Boyer, P.D., ed.) Academic Press, New York, all of which references are incorporated herein by reference). In general, the particular nucleotide composition of the 5'-phosphorylated end of the donor molecule does not have nearly as much effect on the efficiency of 5' ligation tagging as the nucleotide composition of the 3 '-hydroxy lated end of the RNA acceptor oligonucleotide. With respect to the nucleoside composition, in some other preferred embodiments wherein another RNA ligase than T4 RNA ligase is used as the ligase (e.g., bacteriophage TS2126 RNA ligase), the 3' terminal nucleotide or nucleotides of the RNA acceptor oligonucleotide consists of one or more nucleosides other than adenosine. In such embodiments, the 3' nucleotides of the RNA acceptor oligonucleotide are optimal for ligation to 5'-monophosphorylated donor RNA molecules by the particular RNA ligase used.

A variety of different enzymes are used in the methods of the invention. In some embodiments of any of the methods of the invention wherein a nucleic acid pyrophosphatase is used, the pyrophosphatase is tobacco acid pyrophosphatase (TAP) (EPICENTRE). In some embodiments of any of the methods of the invention wherein an RNA ligase is used, the RNA ligase is selected from among T4 RNA ligase, EPICENTRE, and bacteriophage TS2126 RNA ligase. In some embodiments of any of the methods of the invention wherein a poly(A) polymerase is used, the poly(A) polymerase is selected from among E. coli poly(A) polymerase, (EPICENTRE) and Saccharomyces cerevisiae poly(A) polymerase. In some embodiments of any of the methods of the invention wherein an RNA-dependent DNA polymerase is used, the RNA-dependent DNA polymerase is selected from among SUPERSCRIPT RT (Invitrogen, Carlsbad, CA), AMV RT, and MMLV RT (EPICENTRE). In some embodiments of any of the methods of the invention wherein an RNase H is used, the RNase H is selected from among E. coli RNase H (EPICENTRE), Tth RNase H, TfI RNase H, and HYBRID ASE™ RNase H (EPICENTRE).

In some embodiments of any of the methods of the invention wherein a particular enzyme is provided and used, the method also further comprises the step of: inactivating or removing the particular enzyme following its use in the method. If possible with respect to a particular embodiment, it is preferable to inactivate the particular enzyme either by heating or by changing the conditions of the reaction mixture following the reaction to new conditions wherein the particular enzyme becomes inactive, but the enzyme used in the next step of the method is active. For example, but without limitation: tobacco acid pyrophosphatase (TAP) can be inactivated by adjusting the pH of the reaction mixture from pH 6.0 to about pH 7.5 by the addition of sodium phosphate (pH 7.8) to the TAP reaction mixture to a final concentration of about 10-20 mM. Of course, it is important to verify that the enzyme used in the next step of the method is active under the reaction conditions that result from the inactivation step for the particular enzyme.

One embodiment of the invention is a kit comprising RNA ligase (e.g., T4 RNA ligase, EPICENTRE, or bacteriophage TS2126 RNA ligase); an RNA acceptor oligonucleotide; and a nucleic acid pyrophosphatase (e.g., tobacco acid pyrophosphatase (TAP), EPICENTRE.

The methods, kits and compositions of the invention have wide applicability. For example, the nucleic acid molecules generated using them can be used for synthesizing cDNA from any desired full-length RNA (e.g., full-length capped eukaryotic mRNA, miRNA, full-length uncapped eukaryotic primary RNA, including non-coding RNA, or full-length prokaryotic primary mRNA) and for cloning said cDNA, and for capture and identification of the exact 5' ends of said desired RNA (e.g., by sequencing, or by using methods such as random amplification of cDNA ends (RACE), exon arrays, or other microarrays). In some embodiments of the invention, the methods or any of the kits and compositions disclosed herein is used, either separately or in combination, to generate nucleic acid molecules consisting of 5'-ligation-tagged RNA, first-strand cDNA, second- strand cDNA, or double- stranded cDNA from each of two different samples and said molecules are used to analyze, identify (e.g., sequence), quantify or determine the relative abundance of the nucleic acid molecules (e.g., by measuring the abundance of one or more nucleic acid molecules from or derived from one sample compared to the abundance of the nucleic acid molecules in another sample, e.g., using a microarray or real-time PCR), annotate, and find the biological function of the RNA molecules in the sample from which said nucleic acid molecules are generated. In some embodiments, the nucleic acid molecules are analyzed, identified, quantified, annotated, or the biological function is found for research purposes, whereas in other embodiments this work is performed for commercial purposes (e.g., to find and express genes for industrial, agricultural, or other commercial applications, or to use the information for medical, therapeutic, or diagnostic applications in humans or animals.)

DEFINITIONS

The present invention will be understood and interpreted based on the definitions of terms as defined below.

An "acceptor oligonucleotide", as used herein, means an oligonucleotide that has a 3' hydroxyl group that is capable of being joined to the 5' end of an RNA that has a 5' phosphate group by the action of an RNA ligase, wherein the RNA that has a 5' phosphate group is referred to as the "donor." An acceptor oligonucleotide that consists of ribonucleotides is referred to herein as an "RNA acceptor oligonucleotide" or an "RNA acceptor."

A "cap" or a "cap nucleotide" is a modified guanine nucleotide that is joined to the 5' end of a primary RNA transcript.

As used herein, the term "enzyme" refers to protein molecules or protein molecule aggregates that are responsible for catalyzing chemical and biological reactions. In general, a method, composition, or kit of the invention is not limited to use of a particular enzyme from a particular source. Rather, a method, composition, or kit of the present invention comprises any enzyme from any source that has an equivalent enzymatic activity to the particular enzyme disclosed herein with respect to the particular method, composition, or kit. By way of example, but not of limitation, an RNA-dependent DNA polymerase can be AMV reverse transcriptase; MMLV reverse transcriptase; SUPERSCRIPT I, SUPERSCRIPT II, SUPERSCRIPT III, or AMV THERMOSCRIPT reverse transcriptase (INVITROGEN); or MONSTERSCRIPT reverse transcriptase (EPICENTRE), or it can be another enzyme that can synthesize DNA using RNA as a template and an oligonucleotide primer that anneals to a complementary sequence therein under suitable reaction conditions; a poly(A) polymerase can be Escherichia coli poly(A) polymerase encoded by the pcnB gene or it can be another enzyme that, in the presence of ATP, can synthesize a poly(A) tail on the 3' end of RNA that has a 3' hydroxyl group in the absence of a nucleic acid template under suitable reaction conditions; ribonuclease H can be Escherichia coli RNase H or HYBRIDASE™ Thermostable RNase H (EPICENTRE, Madison, WI) or it can be another enzyme that, under suitable reaction conditions, digests RNA that is annealed to DNA but does not digest single-stranded RNA or RNA that is annealed to RNA; a nucleic acid pyrophosphatase can be tobacco acid pyrophosphatase or it can be another enzyme that, under suitable reaction conditions, generates RNA that has a 5' monophosphate group by cleaving the triphosphate bridge of m⁷G-capped RNA; and an alkaline phosphatase can be APEX™ Alkaline Phosphatase (EPICENTRE, Madison, WI) or shrimp alkaline phosphatase or Arctic Alkaline Phosphatase (New England Biolabs, MA) or it can be another enzyme that, under suitable reaction conditions, converts RNA that has a 5' polyphosphate group or RNA that has a 5' monophosphate group to RNA that has a 5' hydroxyl group. Still further, the methods of the present invention also include embodiments wherein any one particular enzyme that is provided and used in a step of the method is replaced by a combination of two or more enzymes which, when used in combination, whether used separately in a stepwise manner or used together at the same time reaction mixture, result in synthesis of RNA that is identical to the RNA that synthesized using the one particular enzyme. The methods, buffers, and reaction conditions presented herein, including in the examples, are presently preferred for the embodiments of the methods, compositions, and kits of the present invention. However, other enzyme storage buffers, reaction buffers, and reaction conditions for use of some of the enzymes of the invention are known in the art, which may also be suitable for use in the present invention, and are included herein.

Any enzyme that is used in a method, composition or kit of the present invention can be a native protein or a recombinant protein. The term "native protein" is used herein to indicate a protein isolated from a naturally occurring (i.e., a non-recombinant) source. The term "recombinant protein" or "recombinant polypeptide" as used herein refers to a protein molecule expressed from a recombinant DNA molecule. Molecular biological techniques may be used to produce a recombinant form of a protein with identical or similar properties as compared to the native form of the protein. Variants of the native sequence may also be made to, for example, improve expression, purification, or other desired properties of the polypeptide. A recombinant protein can be a fusion protein. As used herein, the term "fusion protein" refers to a chimeric protein containing the protein of interest joined to an exogenous protein fragment (e.g., the fusion partner). The fusion partner may enhance the solubility of the protein with the desired enzymatic activity as expressed in a host cell, may provide an affinity tag to allow purification of the recombinant fusion protein from the host cell or culture supernatant, or both. If desired, the fusion protein may be removed from the protein of interest by a variety of enzymatic or chemical means known to the art.

In preferred embodiments of the present invention, the enzyme composition that is used in a method, composition, or kit comprises a purified protein. As used herein, the term "purified" or "to purify" means the result of any process that removes some of a contaminant from the component of interest, such as the protein. For example, a particular desired protein is purified by removal of other contaminating undesired proteins, nucleic acid, carbohydrate, lipid and/or small biochemical molecules. The removal of contaminants results in an increase in the percentage of desired protein in the composition. For example, in preferred embodiments, the composition is purified so as to be free of contaminating nucleic acids and other enzymes with activity on nucleic acids.

The term "gene" as used herein, refers to a DNA sequence that comprises control and coding sequences necessary for the production of the encoded polypeptide or protein precursor. The polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence, as long as the desired protein activity is retained.

In preferred embodiments of the invention, the enzyme is "stabilized", by which we mean that the enzyme is sufficiently pure of proteases and other contaminants which contribute to degradation and loss of enzyme activity and is provided in a formulation of enzyme storage buffer in which there is no significant loss of activity during storage at minus 20 degrees C for six months. One suitable enzyme storage buffer for providing a stabilized composition of many enzymes (e.g., T4 RNA ligase) comprises a 50% glycerol solution containing 50 mM Tris-HCL (pH 7.5), 100 mM NaCl, 100 mM EDTA, 1 mM DTT and 0.1% of the non-ionic detergent Triton X-100.

Moreover, variant forms of the proteins of the invention are also contemplated as being equivalent to those peptides and DNA molecules that are set forth in more detail herein.

An "oligo cap" or "oligonucleotide cap" is an acceptor oligonucleotide that is joined to the 5' end of a 5'-monophosphorylated RNA molecule by the action of RNA ligase as part of an "oligo capping" method. In most embodiments of the oligo capping methods in the art, the oligo cap is an RNA acceptor oligonucleotide. An "oligo cap" differs from an "m⁷G cap" that is typically found on eukaryotic mRNA molecules. The cap on eukaryotic mRNA (e.g., m⁷G cap) and some other eukaryotic RNA molecules is sometimes referred to herein as an "m⁷G-cap" or a "cap nucleotide" or a "nucleotide cap" to distinguish it from an "oligonucleotide cap" or an "oligo cap." We sometimes refer to the RNA with the cap nucleotide (e.g., eukaryotic mRNA) herein as "m⁷G-capped RNA", even though the cap nucleotide may have other modifications besides the N7-methyl group of the guanine base.

As used herein a "nucleic acid pyrophosphatase" or "pyrophosphatase" ("PPase") means an enzyme that cleaves pyrophosphate bonds of the triphosphate bridge of m7G- capped RNA or of the 5' triphosphate in primary RNA that has a 5' triphosphate to generate RNA that has a 5' monophosphate. The nucleic acid pyrophosphatase can be tobacco acid pyrophosphatase ("TAP") or it can be any other enzyme that has similar activity in the method. Tobacco acid pyrophosphatase is a preferred nucleic acid pyrophosphatase for the methods of the present invention. "PoIyA polymerase" ("PAP") means a template-independent RNA polymerase found in most eukaryotes, prokaryotes, and eukaryotic viruses that selectively uses ATP to incorporate AMP residues to 3'-hydroxylated ends of RNA. Since PAP enzymes that have been studied from plants, animals, bacteria and viruses all catalyze the same overall reaction (e.g., see Edmonds, M, Methods Enzymol., 181; 161-180, 1990), are highly conserved structurally (e.g., see Gershon, P, Nature Structural Biol. 7: 819-821, 2000), and lack intrinsic specificity for particular sequences or sizes of RNA molecules if the PAP is separated from proteins that recognize AAUAAA polyadenylation signals (Wilusz, J and Shenk, T, Cell 52: 221, 1988), purified wild-type and recombinant PAP enzymes from any of a variety of sources can be used in the kits and methods of the present invention.

A "primary RNA" or "primary RNA transcript" means the RNA molecule that is synthesized by an RNA polymerase in vivo or in vitro and which RNA molecule has a triphosphate on the 5'-carbon of its most 5' nucleotide.

As defined herein, "RNA ligase" means an enzyme or composition of enzyme that is capable of catalyzing the joining of an RNA acceptor oligonucleotide, which has an hydroxyl group on its 3' end, to an RNA donor, which has a 5' phosphate group on its 5' end. The invention is not limited with respect to the RNA ligase, and any RNA ligase from any source can be used in an embodiment of the methods and kits of the present invention. For example, but without limitation, the RNA ligase can be a polypeptide encoded by the bacteriophage T4 RNA ligase gene, or it can be a polypeptide derived from or encoded by an RNA ligase gene from bacteriophage TS2126, which infects Thermus scotoductus, including either the native phage enzyme and polypeptides encoded by the nucleic acids as disclosed in U.S. Patent Application No. 20050266439 (i.e., bacteriophage TS2126 RNA ligase).

As defined herein, "RNase H" means an enzyme or composition of enzyme that specifically digests the RNA that is in an RNA: DNA hybrid without digesting DNA or unhybridized RNA that is present in the same reaction mixture. Exemplary RNase H enzymes include, but are not limited to E. coli RNase H, HYBRID ASE™ thermostable RNase H, and Thermus RNase H (e.g., Tth or TfI RNase H). However, the invention is not limited with respect to the RNase H so long as it functions for its intended purpose of specifically digesting RNA that is annealed to DNA in an RNA:DNA hybrid.

As defined herein, "RNase I" means an enzyme or composition of enzyme that is capable of specifically cleaving single-stranded RNA between all dinucleotide pairs to nucleoside-3'-monophosphates without digesting double-stranded RNA or single- stranded or double-stranded DNA that is present in the same reaction mixture. An exemplary RNase I enzyme includes, but is not limited to E. coli RNase I. However, the invention is not limited to the RNase I so long as the enzyme functions for its intended purpose of specifically digesting single-stranded RNA without digesting double-stranded RNA or single-stranded or double-stranded DNA that is present in the same reaction mixture.

"Nucleoside", as used herein, refers to a compound consisting of a purine (guanine (G) or adenine (A)) or pyrimidine (thymine (T), uridine (U), or cytidine (C)) base covalently linked to a pentose sugar, whereas "nucleotide" refers to a nucleoside phosphorylated at one of the hydroxyl groups of the pentose sugar.

A "nucleic acid" or a "polynucleotide", as used herein, is a covalently linked sequence of nucleotides in which the 3' position of the sugar moiety of one nucleotide is joined by a phosphodiester group to the 5' position of the sugar moiety of the next nucleotide, and in which the nucleotide residues (bases) are linked in specific sequence; i.e., a linear order of nucleotides. An "oligonucleotide", as used herein, is a short polynucleotide or a portion of a polynucleotide. An oligonucleotide typically contains a sequence of about two to about one hundred bases. The word "oligo" is sometimes used in place of the word "oligonucleotide". In some embodiments, the oligonucleotide is an acceptor oligonucleotide (also referred to as an "acceptor oligo" or "oligonucleotide acceptor" or "oligo acceptor" or "acceptor" or "acceptor molecule" or the like). An acceptor oligonucleotide has an hydroxyl group on its 3' end, which enables it to be ligated to an RNA molecule that has a 5' monophosphate (a "donor"). In some embodiments, the oligonucleotide consists of or comprises 2'-deoxyribonucleotides (DNA). In some embodiments, the oligonucleotide consists of or comprises ribonucleotides (RNA). In some preferred embodiments wherein the oligonucleotide consists of ribonucleotides (RNA), said oligonucleotide is an "RNA acceptor oligonucleotide" or an "RNA acceptor oligo" or an "RNA acceptor" or an "RNA oligonucleotide acceptor" (or the like), meaning that it has an hydroxyl group on its 3'- end and is capable of being ligated to an RNA molecule that has a monophosphate group on it 5' end (i.e., an "RNA donor" or an "RNA donor molecule" or the like) by an RNA ligase (e.g., T4 RNA ligase, EPICENTRE, or bacteriophage TS2126 RNA ligase).

Linear nucleic acid molecules are said to have a "5'-terminus" (5' end) and a "3'- terminus" (3' end) because nucleic acid phosphodiester linkages occur at the 5' carbon and 3' carbon of the sugar moieties of the substituent mononucleotides. The end of a polynucleotide at which a new linkage would be to a 5' carbon is its 5' terminal nucleotide. The end of a polynucleotide at which a new linkage would be to a 3' carbon is its 3' terminal nucleotide. A terminal nucleotide, as used herein, is the nucleotide at the end position of the 3'- or 5'-terminus.

Nucleic acid molecules are said to have "5' ends" and "3' ends" because, except with respect to a cap (as described elsewhere herein), mononucleotides are joined in one direction via a phosphodiester linkage to make oligonucleotides, in a manner such that a phosphate on the 5'-carbon of one mononucleotide sugar moiety is joined to an oxygen on the 3'-carbon of the sugar moiety of its neighboring mononucleotide. Therefore, an end of an oligonucleotide referred to as the "5' end" if its 5' phosphate is not linked to the oxygen of the 3'-carbon of a mononucleotide sugar moiety and as the "3' end" if its 3' oxygen is not linked to a 5' phosphate of the sugar moiety of a subsequent mononucleotide.

As used herein, the terms "5'-of" and "3'-of" refer to the position or orientation of a particular chemical group, nucleotide, or sequence of nucleotides relative to another chemical group, nucleotide, or sequence of nucleotides within a single strand of a nucleic acid. For example, the hydroxyl group at the 3' position of the 3' nucleotide at the 3' end of an RNA acceptor oligonucleotide, to which the 5' end of an RNA donor molecule can be ligated using an RNA ligase, is 3'-of any other group or nucleotide within the RNA acceptor oligonucleotide. All other chemical groups, nucleotides, or sequence of nucleotides are 5'-of the 3' end of the RNA acceptor oligonucleotide. If a first nucleic acid sequence is 3'-of a second sequence on one strand, the complement of the first sequence will be 5'-of the complement of the second sequence on the complementary strand.

Polypeptide molecules are said to have an "amino terminus" (N-terminus) and a "carboxy terminus" (C-terminus) because peptide linkages occur between the backbone amino group of a first amino acid residue and the backbone carboxyl group of a second amino acid residue.

The terms "sample" and "biological sample" are used in their broadest sense and encompass samples or specimens obtained from any source including biological and environmental sources. As used herein, the term "sample" when used to refer to biological samples obtained from organisms, includes, but it not limited to fluids, solids, tissues, and gases. In preferred embodiments of this invention, biological samples include bodily fluids, isolated cells, fixed cells, cell lysates and the like. For example, in some embodiments, the sample is a formalin-fixed paraffin-embedded (FFPE) tissue section, and the RNA contained in the sample comprises degraded RNA molecules, including degraded capped RNA, degraded RNA that has a 5' polyphosphate group, degraded RNA that has a 5' monophosphate group, and/or degraded RNA that has a 5' hydroxyl group. Thus, in some embodiments of any of the methods for 5' ligation tagging one or more RNA molecules in a sample, the sample contains degraded RNA, and the method is used for 5' ligation tagging one or more of the respective degraded RNA molecules (e.g., degraded capped RNA or degraded 5'-triphosphorylated RNA) in the sample. In some of these embodiments, the one or more RNA molecules that are obtained, isolated, purified, or analyzed comprise only or predominantly the 5' end portions of RNA molecules derived from the naturally occurring undegraded RNA molecules (e.g., only the 5' end portions of capped RNA molecules or of 5'- triphosphorylated RNA molecules). However, these examples are not to be construed as limiting the types of samples that find use with the present invention.

As used herein, the terms "buffer" or "buffering agents" refer to materials that when added to a solution, cause the solution to resist changes in pH. As used herein, the term "reaction buffer" refers to a buffering solution in which an enzymatic reaction is performed. As used herein, the term "storage buffer" refers to a buffering solution in which an enzyme is stored. As used herein, the terms "chelator" or "chelating agent" refer to any materials having more than one atom with a lone pair of electrons that are available to bond to a metal cation. As used herein, the term "divalent salt" or "divalent metal cation" refers to any salt in which a metal (e.g., Mg, Mn, Ca, or Sr) has a net 2+ charge in solution.

As used herein, the terms "complementary" or "complementarity" are used in reference to a sequence of nucleotides related by the base-pairing rules. For example, the sequence 5'-A-G-T-3', is complementary to the sequence 3'-T-C-A-5'. Complementarity may be "partial," in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be "complete" or "total" complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon hybridization of nucleic acids.

The term "homology" refers to a degree of complementarity of one nucleic acid sequence with another nucleic acid sequence. There may be partial homology or complete homology (i.e., complementarity). A partially complementary sequence is one that at least partially inhibits a completely complementary sequence from hybridizing to a target nucleic acid and is referred to using the functional term "substantially homologous." The inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or Northern blot, solution hybridization and the like) under conditions of low stringency. A substantially homologous sequence or probe will compete for and inhibit the binding (i.e., the hybridization) of a completely homologous sequence to a target under conditions of low stringency. This is not to say that conditions of low stringency are such that nonspecific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction. The absence of nonspecific binding may be tested by the use of a second target that lacks complementarity or that has only a low degree of complementarity (e.g., less than about 30% complementarity). In the case in which specific binding is low or non-existent, the probe will not hybridize to a nucleic acid target. When used in reference to a double-stranded nucleic acid sequence such as a cDNA or a genomic clone, the term "substantially homologous" refers to any probe which can hybridize to either or both strands of the double-stranded nucleic acid sequence under conditions of low stringency as described herein.

As used herein, the terms "hybridization" or "annealing" are used in reference to the pairing of complementary nucleic acid strands. Hybridization and the strength of hybridization (i.e., the strength of the association between nucleic acid strands) is impacted by many factors well known in the art including the degree of complementarity between the nucleic acids, stringency of the conditions involved affected by such conditions as the concentration of salts, the T_m (melting temperature) of the formed hybrid, the presence of other components (e.g., the presence or absence of polyethylene glycol or betaine), the molarity of the hybridizing strands and the G:C content of the nucleic acid strands.

The terms "isolated" or "purified" when used in relation to a nucleic acid, as in "isolated polynucleotide" or "isolated oligonucleotide" or "purified RNA" or a "capped RNA that is purified" refers to a nucleic acid that is identified and separated from at least one contaminant with which it is ordinarily associated in its source. Thus, an isolated or purified nucleic acid (e.g., DNA and RNA) is present in a form or setting that is different from that in which it is found in nature or that is different from that which existed prior to subjecting it to a treatment or purification method. For example, a given DNA sequence (e.g., a gene) is found on the host cell chromosome together with other genes, and a specific RNA (e.g., a specific mRNA encoding a specific protein), is found in the cell as a mixture with numerous other mRNAs that encode a multitude of proteins. The isolated or purified polynucleotide or nucleic acid or oligonucleotide or DNA or RNA may be present in single-stranded or double-stranded form. When an isolated or purified polynucleotide or nucleic acid is to be utilized to express a protein, the polynucleotide contains at a minimum, the sense or coding strand (i.e., the polynucleotide may be single- stranded), but may contain both the sense and anti-sense strands (i.e., the polynucleotide may be double-stranded).

EXAMPLES The following examples serve to illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.

Isolation of Total RNA from a Sample

In some embodiments, total RNA is isolated from a sample (e.g., using the MASTERPURE™ RNA purification kit, EPICENTRE, Madison, WI, according to protocols of the manufacturer, or another suitable method in the art). In some embodiments, the total RNA is from a culture of a bacterium. In some embodiments, the total RNA is from an environmental source. In some embodiments, the total RNA is from a legume root nodule containing a Rhizobium or other nitrogen-fixing symbiotic bacterium. In some embodiments, the total RNA is from an animal or human clinical sample of a tissue infected by a bacterial or mycoplasmal pathogen.

Polyadenylation of Total RNA

The following components are added sequentially at room temperature to 20 microliters of each reaction mix from the previous step for polyA tailing of the RNA:

1OX PolyA Polymerase Rxn Buffer: 0.5 M Tris-HCl (pH 8.0), 2.5 M NaCl, 10 mM DTT, and 100 mM MgCl₂.

The reaction mix was incubated at 37⁰C for 30 min.

In some embodiments, the reaction mix is extracted once with Phenol: Chloroform (1: 1 mix), once with Chloroform and the RNA is recovered from the aqueous phase by ethanol precipitation and dissolved in 10.0 microliters of 10 mM Tris-HCl (pH 8.0), 1 mM EDTA.

Tobacco Acid Pyrophosphatase Reaction

In some embodiments, one microgram of total RNA, which total RNA has not been treated with an alkaline phosphatase, was incubated with 10 Units of Tobacco Acid Pyrophosphatase (TAP) in 50 mM sodium acetate (pH 6.0), 1 mM EDTA, 0.1 % β- mercaptoethanol and 0.01 % Triton XlOO for 30 min at 37⁰C in a volume of 10 microliters. (In some embodiments the total RNA is tailed using poly(A) polymerase as described herein.) Control reactions were incubated in the same buffer without the enzyme.

Reaction for 5' Ligation Tagging of RNA that Has a 5' Monophosphate Group

Each sample containing RNA that was treated with TAP (whether with or without a poly(A) tailing reaction step) is then subjected to a 5' ligation tagging reaction. The following components are added sequentially at room temperature to the reaction mix from the previous step:

1OX RLRT Buffer:

500 mM Tris-HCl, pH 8.3, 750 mM KCl, and 30 mM MgCl₂.

Sequence of RNA Acceptor Oligonucleotide: TGrArGrCrGrGrCrCrGrCrCrUrGrCrArGrGrArArA

The reaction mix is incubated at 37⁰C for 30 min.

First-strand cDNA Synthesis Reaction

Following the 5' ligation tagging reaction, each 5'-ligation-tagged RNA sample is used as a template for synthesis of first-strand cDNA. This is accomplished by adding the following components to the reaction mix from the previous 5 ' ligation tagging reacton:

Sequence of First-strand cDNA Synthesis Primer:

TAGACTTAGAAATTAATACGACTCACTATAGGCGCGCCACCGGTGd(T)i₈

The reaction mix was incubated at 37⁰C for 30 min.

Removal of RNA after Synthesis of First-strand cDNA

Following the first-strand cDNA synthesis reaction, the RNA in the RNAxDNA hybrids and unused RNA acceptor oligo are digested with RNase I and RNase H to obtain only first-strand cDNA. This is accomplished by adding 1 microliter of RNAse mix (0.5 Units RNase I and 0.5 Units of HYBRID ASE™ Thermostable RNase H, EPICENTRE) to the previous first-strand cDNA synthesis reaction mixture and then incubating at 55⁰C for 5 min.

Second-strand cDNA Synthesis The first-strand cDNA, synthesized as described above, is used as a template for synthesis of second-strand cDNA:

Sequence of Second-strand cDNA Synthesis Primer:

TCATACACATACGATTTAGGTGACACTATAGAGCGGCCGCCTGCAGGAAA

The reaction mix is incubated at 72 ⁰C for 10 min.

The reaction mix is then extracted once with Phenol:Chloroform (1 :1 mix), once with Chloroform, and 100 microliters of DNA Fragment 2X Precipitation Solution (EPICENTRE) is added and chilled on ice for 10 min. The DNA is recovered by centrifugation and the pellet is washed once with 70 % ethanol and dissolved in 25 microliters of 10 mM Tris-HCl (pH 8.0), 1 mM EDTA.

PCR Amplification

In some other embodiments, the first-strand cDNA is amplified by PCR (e.g., for cloning) by adding the same components as described above for the Second-strand cDNA Synthesis, except that, in addition to the Second-strand cDNA Synthesis Primer (which serves as PCR Primer 1), 1 microliter of the following primer (PCR Primer 2) is also added to the PCR reaction in place of 1 microliter of water to amplify the tagged first- strand cDNA:

Sequence of PCR Primer 2:

5' TAGACTTAGAAATTAATACGACTCACTATAGGCGCGCCACCG The PCR reaction mix is cycled at the following temperatures Step I: 95°C/30 sec

Step II: (94°C/30 sec, 60°C/30 sec, 12⁰CIA min) for 15 cycles

The reaction mix is then extracted once with Phenol:Chloroform (1 :1 mix), once with Chloroform, and 100 microliters of DNA Fragment 2X Precipitation Solution (EPICENTRE) is added and chilled on ice for 10 min. The DNA is recovered by centrifugation and the pellet is washed once with 70 % ethanol and dissolved in 25 microliters of 10 mM Tris-HCl (pH 8.0), 1 mM EDTA.

Analysis of the 5' Ends of 5'-Ligation-Tagged RNA

In some other embodiments, the 3' end of the tagged first-strand cDNA (corresponding to the 5' end of the corresponding 5'-ligation-tagged RNA) is amplified by PCR. polymerase chain reaction (PCR) with PCR Primer 1 and different target-specific primers. For this purpose, an oligonucleotide primer complementary to the sequence of the tag that was added to the 3' end of the first-strand cDNA (PCR Primer 1) and a Target-specific Primer as a second PCR primer that is complementary to a known sequence of the first-strand cDNA (corresponding to the 5' end of the coding region for each of the different RNAs that are desired to be analyzed is used for the PCR as diagramed below:

PCR Primer 1 lst-strand cDNA <— 5'

Target specific primer

Conclusion:

Full-length first-strand or double-stranded cDNA can be prepared from uncapped primary

RNA molecules using the methods described above for synthesis of 5'- monophosphorylated RNA from primary RNA and capped RNA using TAP, polyadenylation of the RNA, 5' ligation tagging of the 5'-monophosphorylated RNA by ligation to an RNA acceptor oligonucleotide using RNA ligase, synthesizing first-strand cDNA using RNA-dependent DNA polymerase (reverse transcriptase) and a first-strand cDNA synthesis primer that anneals to the added poly(A) tail, removing the RNA using RNase I and RNase H, and synthesizing second-strand cDNA (and therefore, double- stranded cDNA) using DNA polymerase and a second-strand cDNA synthesis primer that anneals to the sequence of the portion of first-strand cDNA that is complementary to the 5' ligation tag that was added to the 5' end of the RNA molecules. If desired the double- stranded cDNA molecules synthesized as above can be cloned into a plasmid or other vector for preparation of cDNA libraries corresponding to full-length primary RNA molecules in the sample. Thus, the 5' ligation tagging method enables capture of biologically relevant cDNAs from transcripts that do not have a 5 '-cap and therefore would not be captured by oligo-capping cDNA synthesis methods previously known in the art.

Claims

CLAIMSWe claim:

1. A method for 5' ligation tagging of capped RNA and uncapped primary RNA that has a 5' polyphosphate group comprising the steps of:

(A) providing:

(i) a sample that contains at least capped RNA and uncapped RNA that has a 5' polyphosphate group;

(ii) an acceptor oligonucleotide;

(iii) RNA ligase; and

(iv) nucleic acid pyrophosphatase;

(B) contacting the sample, wherein the sample has not been contacted with an alkaline phosphatase, with the nucleic acid pyrophosphatase under conditions and for sufficient time wherein the capped RNA and the uncapped RNA that has a 5' polyphosphate group are converted to RNA that has a 5' monophosphate group;

(C) contacting the sample from step (B) with the acceptor oligonucleotide and the RNA ligase under conditions and for sufficient time wherein the 3' end of the acceptor oligonucleotide is joined to the 5' end of the RNA that has a 5' monophosphate group and 5'-ligation-tagged RNA is generated.

2. The method of claim 1, wherein the acceptor oligonucleotide is an RNA acceptor oligonucleotide; wherein the RNA ligase is T4 RNA ligase or bacteriophage TS2126 RNA ligase; and/or wherein the nucleic acid pyrophosphatase is tobacco acid pyrophosphatase .

3. The method of claim 1 or claim 2 wherein the method additionally comprises the steps of: providing a poly(A) polymerase and ATP; and contacting the sample with the poly(A) polymerase and ATP under conditions and for sufficient time wherein a poly(A) tail is added to the 3 '-ends of the RNA molecules in the sample and RNA that has a poly(A) tail is generated.

4. The method of any of claims 1 through 3 wherein the method further comprises synthesizing first-strand cDNA from the 5 '-ligation- tagged RNA, wherein the method additionally comprises the steps of: providing an RNA-dependent DNA polymerase; and contacting the 5'-ligation-tagged RNA with the RNA-dependent DNA polymerase under conditions and for sufficient time wherein first-strand cDNA that is complementary to the 5'-ligation-tagged RNA is synthesized.

5. The method of claim 4 wherein the method additionally comprises: providing a first-strand cDNA synthesis primer that is complementary to the 5'-ligation-tagged RNA and contacting the 5'-ligation-tagged RNA with the first-strand cDNA synthesis primer and the RNA-dependent DNA polymerase under conditions and for sufficient time wherein cDNA that is complementary to the 5 '-ligation- tagged RNA is synthesized.

6. The method of claim 5 wherein the first-strand cDNA synthesis primer comprises a sequence wherein at least its 3' end exhibits a sequence selected from the group consisting of: a sequence that is complementary to a homopolymeric sequence that was added post- transcriptionally, either in vivo in the cell or in vitro, to the 3' end of the RNA in the sample or to the 3' end of the 5 '-ligation- tagged RNA; a sequence that is complementary to a known sequence at the 3' end of one or more RNA molecules; a sequence that is complementary to one or more internal regions of one or more RNA molecules; a collection of all possible sequences wherein each sequence is random; a sequence that is complementary to a poly(A) tail, selected from among an oligo(dT)n sequence, an oligo(dU)n sequence, an oligo(U)n sequence, an oligo(dT)nX anchored sequence, an oligo(dU)nX anchored sequence, and an oligo(U)nX anchored sequence; and a sequence that is complementary to an oligonucleotide tag that is added to the 3' end of the RNA in the sample or to the 3' end of the 5 '-ligation- tagged RNA.

7. The method of claim 6 wherein the first-strand cDNA synthesis primer additionally exhibits a specific 5' sequence which is 5'-of the sequence exhibited at its 3' end, wherein said specific 5' sequence is capable of serving as a template for synthesis of second-strand cDNA that exhibits a specific 3' sequence that is complementary to the specific 5' sequence and that provides a site for specific priming of second-strand cDNA.

8. The method of any of claims 4 through 7 wherein the method additionally comprises the steps of: providing RNase H and RNase I; and contacting the sample containing first-strand cDNA with the RNase H and the RNase I under conditions and for sufficient time wherein the RNA is digested.

9. The method of any of claims 4 through 8 wherein the method additionally comprises the steps of: providing a DNA-dependent DNA polymerase; and contacting the first-strand cDNA with the DNA-dependent DNA polymerase under conditions and for sufficient time wherein double-stranded cDNA is synthesized.

10. The method of any of claims 4 through 9 wherein the method additionally comprises the steps of: providing a second-strand cDNA synthesis primer that is complementary to the portion of the first-strand cDNA that is complementary to the acceptor oligonucleotide provided in step (A), and a DNA-dependent DNA polymerase; and contacting the second-strand cDNA synthesis primer and the DNA-dependent DNA polymerase with the first-strand cDNA under conditions and for sufficient time wherein double-stranded cDNA is synthesized.

11. The method of claim 9 or claim 10 wherein the DNA-dependent DNA polymerase is the same as the RNA-dependent DNA polymerase provided for synthesis of first-strand cDNA; or wherein the DNA-dependent DNA polymerase is different from the RNA- dependent DNA polymerase provided for synthesis of first-strand cDNA.

12. A method for synthesizing cDNA, comprising the steps of:

(a) obtaining a first RNA sample;

(b) omitting treatment of the RNA sample with an alkaline phosphatase that removes 5'-monophosphate groups from the 5'-ends of RNA; (c) incubating the first RNA sample with an RNA ligase and an RNA acceptor oligonucleotide under conditions wherein the RNA acceptor oligonucleotide is ligated to the 5 '-ends of RNAs in the RNA sample that have a 5'-monophosphate group; and

(d) contacting the first RNA sample from step (c) with an oligonucleotide primer that is complementary to the RNA and an RNA-dependent DNA polymerase (reverse transcriptase) to obtain first cDNA.

13. The method of claim 12, further comprising the steps of:

(e) obtaining a second RNA sample;

(f) treating the second RNA sample with an alkaline phosphatase;

(g) incubating the second RNA sample the RNA ligase and the RNA acceptor oligonucleotide under conditions wherein the RNA acceptor oligonucleotide is ligated to the 5 '-ends of RNAs in the second RNA sample that have a 5'-monophosphate group; and

(h) contacting the second RNA sample from step (g) with the oligonucleotide primer used in step (d) and the RNA-dependent DNA polymerase to obtain a second cDNA, and

(i) comparing the second cDNA, if any, to the first cDNA obtained in step (d).

14. The method of claim 12 or claim 13 wherein, prior to step (d), the method further comprises the step of treating the first RNA sample and/or the second RNA sample with tobacco acid pyrophosphatase to convert 5'-capped RNAs and 5'-triphosphorylated RNAs to RNAs that have 5 '-monophosphate groups on their 5'-ends.

15. The method of claim 14 wherein, prior to step (h), the method further comprises the step of treating the RNA sample with tobacco acid pyrophosphatase to convert 5'-capped RNAs and 5'-triphosphorylated RNAs to RNAs that have 5 '-monophosphate groups on their 5 '-ends.

16. The method of any of claims 12 through 15 wherein the oligonucleotide primer is selected from the group consisting of:

(a) an oligo-d(T) primer;

(b) an oligonucleotide primer that is complementary to the 3'-end of one or more RNA coding regions;

(c) an oligonucleotide primer that is complementary to one or more internal sequences of one or more RNA molecules; and

(d) a random primer.

17. The method of any of claims 1 through 16 wherein the method is used to compare the presence, quantity, or relative abundance of one or more RNA molecules in one sample with the presence, quantity, or relative abundance of one or more RNA molecules in one or more other samples.

18. A kit comprising reagents sufficient, necessary, or useful for carrying out the method of any of claims 12 through 16.

19. The kit of claim 18, further comprising control RNA molecules including one or more of: 5'-monophosphorylated RNA, capped mRNA, and 5'-triphosphorylated RNA.

20. A kit comprising tobacco acid pyrophosphatase, an RNA acceptor oligonucleotide, and bacteriophage TS2126 RNA ligase.