WO2009015107A1

WO2009015107A1 - Modulation of toll-like receptors for controlling neurogenesis

Info

Publication number: WO2009015107A1
Application number: PCT/US2008/070687
Authority: WO
Inventors: Michal Eisenbach-Schwartz; Asya Rolls; Ravid Shechter; Anat London; Yaniv Ziv
Original assignee: Yeda Research And Development Co. Ltd.; Geraghty, Erin
Priority date: 2007-07-20
Filing date: 2008-07-21
Publication date: 2009-01-29

Abstract

Downregulation of the Toll-like receptor TLR4 and/or upregulation of the Toll-like receptor TLR2 on cells of the CNS, and preferably on adult neural stem/progenitor cells (NPCs) cause stimulation or promotion of neurogenesis, including retinogenesis. Upregulation of TLR4 and/or downregulation of TLR2 on cells of the CNS, and particularly on brain tumor cells, causes inhibition of neurogenesis and inhibition of proliferation of the neuro/glial tumor cells.

Description

MODULATION OF TOLL-LIKE RECEPTORS FOR CONTROLLING

NEUROGENESIS

BACKGROUND OF THE INVENTION

Field of the Invention The invention in the field of biochemistry and medicine relates to the presence of Toll-like receptors, for example TLR2 and TLR4, on cells of the central nervous system (CNS), their role in neurogenesis and the modulation of these receptors in controlling neurogenesis and growth of neuro/glial tumors such as neuroblastomas, glioblastomas, and astrocytomas. Susceptibility for developing such tumors is tested analyzing relevant tissues or body fluids for mutant or abnormally expressed TLR2.

Description of the Background Art

Neurogenesis, the formation of new neurons from stem/progenitor cells, is considered to be one of the mechanisms by which the brain maintains its plasticity throughout life. The hippocampus, a brain structure with a crucial role in learning and memory processes, is one of two sites in which adult neurogenesis takes place (Cameron HA &

McKay, RD (2001); Kempermann, G & Gage, FH (2000); Seki, T (2003)). The levels of hippocampal neurogenesis vary in response to different external factors such as stress (Tanapat, P et al. (1998); Fuchs, E et al. (1998)) physical activity (Kempermann, G et al. (1998); Bruel-Jungerman, E et al. (2005); Olson, AK et al. (2006)) and learning (Leuner, B et al. (2006); Prickaerts, J et al. (2004)). However, the mechanisms that regulate neurogenesis are largely unknown. The human Toll-like receptor-2 (TLR2) protein and gene is a member of the TLR family which has been described as playing a fundamental role in pathogen recognition and activation of innate immunity. (The discovery of TLR2 function as described herein has not been previously recognized.) TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. The TLR2 gene is expressed most abundantly in peripheral blood leukocytes, and mediates host response to Gram-positive bacteria and yeast via stimulation of NF-κB. TLR2 is one of the most common Toll-like receptors in the CNS (Kielian, T (2006); Rivest, S (2003); Bsibsi, M et al. (2002); Olson, JK et al. (2004)). This family of pattern-recognizing receptors is utilized by the immune system to identify deviation from homeostasis or detect "danger" (for example, by binding to infectious organisms) and thereby contribute to "innate immunity" (Hargreaves, DC & Medzhitov, R (2005); Uematsu, S & Akira, S (2006a); Uematsu S & Akira S. (2006b); Akira S. (2006).

Similarly, the human Toll-like receptor-4 (TLR4) protein and gene is a member of the TLR family which plays a similar fundamental role as above. (Again, the discovery of TLR4 function as described herein has not been previously recognized.) TLR4 is most abundantly expressed in placenta, and in the myelomonocytic subpopulation of leukocytes. It has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. Mutations in this gene have been associated with differences in LPS responsiveness. Also, several transcript variants of this gene have been found, but the protein coding potential of most of them is uncertain.

Retino genesis During retinal development, multipotent progenitor cells give rise to the neurons and Mϋller glia of the mature retina. In mammals, retinal neurogenesis ceases by the early postnatal period (Reh and Fischer, 2006). While a small number of quiescent retinal stem/progenitor cells persist at the margin of the mature retina near the junction of the ciliary epithelium (Ahmad et al., 2000; Tropepe et al., 2000), progenitor cell proliferation and neuronal differentiation are no longer evident. As retinal stem cell therapy in eye pathology has promising therapeutic potential (Banin et al., 2006; MacLaren et al., 2006; Nickerson et al., 2007; Pellegrini et al., 2007; Young, 2005), it is necessary to identify the factors that regulate retinal progenitor cell (RPC) proliferative capacity.

The expression of Toll-like receptor 4 (TLR4) has been recently documented in the ciliary body of the mammalian eye (Brito et al., 2004). TLR4 is primarily identified as an innate immune receptor (Takeda and Akira, 2005); therefore, its function in the eye has been commonly attributed to the immune response against pathogens (Chang et al., 2006;

Ebihara et al., 2007, Chang, 2004 #6; Elner et al., 2005; Kumar et al., 2004; Song et al.,

2001). However, since TLRs recognize patterns rather than specific molecules, along with their ability to recognize physiological compounds (Asea et al., 2002; Johnson et al., 2003;

Ohashi et al., 2000; Okamura et al., 2001; Quintana and Cohen, 2005), they are endowed with the innate ability to mediate a rapid response to a wide range of signals in the microenvironment, and not merely to pathogens.

Non-immune functions of the TLR receptor family have been reported in Drosophila melanogaster in establishing the dorsal-ventral axis polarity, in synaptogenesis and in axon pathfmding during embryogenesis (Anderson et al, 1985a; Anderson et al., 1985b; Halfon et al., 1995; Rose et al., 1997). Such non-immune functions of this family have only recently emerged in mammals. In mammalian brain development, other members of the TLR family, TLR3 and TLR8, were identified as negative regulators of axonal/neurite outgrowth (Cameron et al., 2007; Ma et al., 2006). TLR4, on the other hand, was found to be absent in neurons during the developmental stages of CNS formation (Lehnardt et al., 2003); however, with age, its expression levels increase (Wadachi and Hargreaves, 2006).

RNA Interference

RNA interference (RNAi) is a phenomenon that was initially exploited as an approach for elucidating gene function, but in recent years, has been developed as an approach to inhibit expression of genes the expression of which is deleterious, in vitro and in vivo in mammalian subjects including humans.

RNA is an important target for disease intervention. The messenger RNA (mRNA) molecule, an intermediary in the transfer of information from DNA to proteins, offers a highly promising and potentially versatile means of directing therapeutic intervention. It is possible to target mRNA to effectively intervene prior to protein formation without altering the genetic material itself. This provides the means to counteract changes in protein concentration and activity that are associated with disease without the risk associated with making permanent changes in the genome.

As its name suggests, RNA interference (RNAi) is a cellular mechanism to regulate the expression of genes (and the replication of viruses). It is a sequence-specific, post-transcriptional, gene-silencing mechanism that is effected through double-stranded RNA (dsRNA) molecules homologous to a sequence of the target gene (Elbashir, SM (2001a); Fire, A (1998); Tuschl, T et al. (1999). This mechanism is mediated by fragments of double- stranded RNA (dsRNA) called "small interfering RNA" (siRNA) molecules. siRNAs can rapidly induce loss of function, and only a few molecules are required in a cell to produce the effect (Fire et al. (1998)) through hybrid formation between a homologous siRNA and mRNA (Lin, SL et al. (2001)). mRNA provides the means of implementing the set of instructions contained within the genetic material to produce the cell's machinery. Therefore, by altering the function, the mRNA can be used to modulate the cell's machinery. RNAi technology is believed to constitute an important aspect of a cell's natural defense mechanism against parasitic viruses. Critically, the cell responds to a foreign (double stranded) form of siRNA introduced into the cell by destroying all internal mRNA with the same sequence as the siRNA.

RNAi has been harnessed in laboratory cell culture systems and widely applied to identify the function of genes and their respective proteins. Moreover, this natural process of RNAi holds promise for the development of a new class of drugs, capable of turning off disease-causing genes. These drugs could have specificity and applications in a number of therapeutic indications. RNAi provides a faster and more effective way to turn off genes than other known methods because it takes advantage of a natural cellular process. RNAi-based therapeutics have potentially significant advantages over traditional approaches to treating diseases, including the following:

Broad Therapeutic Application. All diseases for which an abnormal gene function can be identified as a cause or as an essential contributing factor are potentially treatable with RNAi-based drugs that would be engineered to target those specific genes.

Therapeutic Precision. Side effects associated with traditional drugs may be reduced or avoided by using RNAi-based drugs designed to destroy only disease associated and targeted RNA, without affecting other genes.

Target RNA Destruction. Compared to most drugs that only temporarily prevent targeted gene function, RNAi-based drugs can destroy the target RNA and stop the associated undesirable protein production required for disease progression.

The Mechanism of RNA Interference (RNAi)

Long double-stranded RNAs (dsRNAs; typically >200 nt) can be used to silence the expression of target genes in a variety of organisms and cell types (ranging from worms to fruit flies to plants to mammals). Upon introduction, the long dsRNAs enter an RNAi pathway. First, the dsRNAs are processed into 20-25 nucleotide (nt) small interfering RNAs (siRNAs) by an RNase Ill-like enzyme called Dicer (initiation step) (Bernstein, E et al. (2001)). Then, the siRNAs assemble into endoribonuc lease-containing complexes known as RNA-induced silencing complexes (RISCs). The siRNA strands are then unwound to form activated RISCs. The siRNA strands subsequently guide the RISCs to complementary RNA molecules, where they cleave and destroy the cognate RNA (effector step). Cleavage of cognate RNA takes place near the middle of the region bound by the siRNA strand.

In mammalian cells, introduction of dsRNA longer than about 30 nucleotides can provoke a potent antiviral interferon-type response, exemplified by nonspecific inhibition of protein synthesis and RNA degradation. The mammalian antiviral response can be bypassed, however, by the introduction of siRNAs or their "endogenous" expression after transduction of DNA encoding such RNA' s .

RNAi has been used as a tool by scientists to understand gene function in Caenorhabditis elegans and Drosophila. In these organisms, RNAi can be induced by introducing long dsRNA complementary to the target mRNA to be degraded. In mammalian cells and organisms, however, as stated above, introducing dsRNA longer than 30 bp activates a potent antiviral response. To circumvent this, siRNAs are used to induce RNAi in mammalian cells and organisms. These siRNAs can be prepared by chemical synthesis, in vitro transcription, or digestion of long dsRNA by RNase III or Dicer, and can then be introduced into the cell by transfection, electroporation, or other methods. Alternatively, siRNAs can be expressed within cells after transfection of an siRNA expression vector. DNA vector-mediated RNAi technology has made it possible to develop therapeutic applications for use in mammalian cells (Sui, G et al. (2002); McCaffrey, AP et al. (2002); Lee, NS et al. (2002)). There have been several reports of delivery by retroviral vectors for stable expression (Barton, GM et al. (2002); Paddison, PJ et al. (2002c); Rubinson, DA et al. (2003); Tiscornia, G et al. (2003)) or adenoviral vectors for transient expression (Xia, H et al. (2002)). SUMMARY OF THE INVENTION

The present inventors have discovered, and disclose herein, a roll for Toll-like receptors, particularly TLR2 and TLR4. Based on this, and other results exemplified herein, the present invention relates to a number of compositions and methods to modulate the presence or activity of these receptors. The present inventors have discovered that the Toll- like receptors TLR2 and TLR4 play a key role in neurogenesis measured in the hippocampus. Thus, the present invention further relates to upregulation of TLR2 so as to cause an increase of neurogenesis. The present invention further relates to downregulation of TLR4 so as to cause an increase of neurogenesis. Thus, in one aspect of the present invention, neurogenesis can be promoted and upregulated, preferably by downregulation of TLR4 and/or upregulation of TLR2. Among the diseases and conditions that can be treated by this aspect of the present invention is any disease or condition, including that which results from acute trauma, that would be benefitted by promotion of neurogenesis, including retinogenesis. Thus, any neurodegenerative disease can be so treated in order to promote neurogenesis and thus at least ameliorate symptoms of such disease or condition. Neuronal injury or death due to acute trauma, or due to any other disease or condition that results in such neuronal injury or death, may be treated by means of the upregulation of neurogenesis in accordance with the present invention. Other conditions that are benefitted by promotion of neurogenesis are mental dysfunctions, such as depression, post-traumatic stress disorder, etc.

In another aspect of the present invention, neurogenesis can be inhibited and downregulated, preferably by upregulation of TLR4 and/or downregulation of TLR2. Among the diseases and conditions that can be treated by this aspect of the present invention is any disease or condition that would be benefitted by inhibition of neurogenesis. For example, it would be advantageous to inhibit growth of neuronal and even more so, astroglial cells in the context of cancer, where astroglial tumors make up a significant proportion of virulent, rapidly progressing and fatal brain tumors, such as glioblastomas. Thus, this aspect of the present invention can be used for inhibiting the development and growth of such tumors. This will cause an inhibition of proliferation of the neuronal cells and thus inhibition of the proliferation of the neuronal tumor cells. The present inventors have further discovered that TLR2 are expressed on neural progenitor cells (NPCs) and regulate neurogenesis. Thus, a genetic TLR2-defϊciency impairs adult hippocampal neurogenesis and consequent learning abilities. In vitro, TLR2 is directly involved in the cell-fate decision of neural progenitor cells (NPCs) that occurs via activation of the transcription factor NF -KB in a protein kinase C (PKC)-dependent manner.

The present inventors also discovered that deficiency of another member of the TLR family, TLR4, does not result in the inhibition of neurogenesis; rather NPCs proliferate and differentiate when this receptor is lacking.

Accordingly, another aspect of the present invention is methods and compositions to modulate TLR2 and TLR4 to stimulate or inhibit various events related to neurogenesis, differentiation of neural progenitor cells (NPCs) and development and growth of neuro/glial tumors.

A key observation was that, although proliferation of NPCs (in the hippocampal dentate gyrus) was not affected by TLR2-deficiency, neuronal differentiation was significantly lower. TLR2 expressed by the NPCs themselves was found to be required for their differentiation into neurons. While undifferentiated (wild-type) NPCs express mRNA of different members of the TLR family (TLR 1-9), the expression of TLR2 was most pronounced. TLR2 was thus shown to act as an intrinsic regulator of NPC differentiation: its absence impaired neurogenesis while its activation promoted neurogenesis. Thus, yet another aspect of the present invention is the activation of TLR2 pharmacologically or its overexpression using recombinant technology in order to promote neuronal differentiation of progenitor cells. Still another aspect of the present invention is the stimulation or upregulation of this receptor in treating diseases and conditions associated with a deficit in such neuronal differentiation or deficits in dendritic arborization, or generally in any disease or condition for which a stimulation of neurogenesis would be appropriate. On those occasions when neurogenesis, or proliferation of neuronal cells, is to be downregulated, such as, for example, in certain brain tumors, TLR2 should advantageously be downregulated. This may be accomplished by causing a TLR2 antagonist to come into contact with the TLR2. Any pharmacological activator or agonist of TLR2 may be used in the present invention in order to upregulate neurogenesis. Many such agonists are known in the art. For example, one such synthetic activator is the lipopeptide Pam3CysSK4 (P3C). Another such agonist is any member of the peptidoglycan (PG) family. Peptidoglycan is a component of the gram-positive bacterial cell walls. Peptidoglycan, also known as murein, is a polymer consisting of sugars and amino acids that forms a mesh-like layer outside the plasma membrane of eubacteria (cell- wall). The peptidoglycan layer in the bacterial cell wall is a crystal lattice structure formed from linear chains of two alternating amino sugars, namely N- acetylglucosamine (GIcNAc or NAG) and N-acetylmuramic acid (MurΝAc or ΝAM). The alternating sugars are connected by a β-(l,4)-glycosidic bond. Each MurΝAc is attached to a short (4- to 5-residue) amino acid chain, normally containing D-alanine, D-glutamic acid, and mesodiaminopimelic acid. These three amino acids do not occur in proteins and are thought to help protect against attacks by most peptidases. Cross-linking between amino acids in different linear amino sugar chains by an enzyme known as transpeptidase results in a 3- dimensional structure that is strong and rigid. The specific amino acid sequence and molecular structure vary with the bacterial species. However, PG of any bacterial species can be used as a TLR2 agonist in accordance with the present invention.

The TLR2 receptor can also be activated by causing its natural activating ligand to come into contact with it. It is known that among the natural ligands for TLR2 are: Bacterial: lipoprotein stereoisomers, PGΝ, LTA, phenol-soluble modulin (S. epidermidis), porins (Neisseria); LPS (Leptospira, Pseudomonas Helicobacter); lipoarabino-mannan (M. tb);

Fungal: zymosan;

Viral: HCV core and ΝS3 proteins, measles virus, human CMV, HSV-I;

Parasitic: trypanosomal, treponemal phospholipids, MALP-2; and

Endogenous: HSP70, HSP60, defensins; Cys3pam, pam2csk4, peptidoglycan, Hyaluronan, and CSPG.

Thus, another aspect of the present invention is the activation of TLR2 by causing one of the above listed ligands (or any other known natural ligand for TLR2) to come into contact with the TLR2.

Other materials that can be used to activate TLRs can be found, for example at the World Wide Web URL www-personal.umich.edu/~ino/List/TOLLRE.htm. Wang, Y et al. (2005), describes activities of a TLR7 agonist, imiquimod, and a TLR9 agonist, CpG ODN. Kumar, A et al. (2006), describes the TLR3 agonist poly(LC). The World Wide Web URL biotech-weblog.com/5022671 l/peptide_vaccine_with_tolllike_receptor_agonists_against_bre ast cancer.php describes vaccine that combines (1) a TLR agonist, and (2) antibodies to blunt other aspects of the immune system that might interfere with a strong killer T cell response.

TLR2 activators such as those as discussed above were shown to stimulate dose-dependent increases in the percentage of cells expressing the neuronal marker and in a reduction in the percentage of cells expressing a glial marker. This action was mediated by NF -KB as inhibition of NF-κB attenuated the differentiation of NPCs to neurons (both in the absence and the presence of the TLR2 activators).

Since in the TLR2-deficient state astrocytic, as opposed to neuronal, differentiation progressed normally, another aspect of the present invention is the selective promotion of such processes by blocking or inhibiting signaling via TLR2.

In examining the receptor specificity of some of the above processes, the present inventors examined TLR4-deficient mice for cell proliferation and differentiation. In contrast to the observation in TLR2-deficient mice, TLR4-deficient mice exhibited markedly increased levels of proliferation and neuronal differentiation. Thus, yet another aspect of he present invention is the blocking of the expression of TLR4, for example using inhibitor nucleic acids such as siRNA or antisense DNA, to cause transient or long term deficits in TLR4 expression on cells.

Still a further aspect of the present invention is to inhibit actions mediated by TLR's that utilize MyD88 as a signaling molecule by inhibiting MyD88 directly; this can be achieved, for example, with a peptide that inhibits homodimerization, a necessary step in MyD88 function. Thus, according to the present invention the action of any antagonist acting at any TLR that utilizes MyD88 as an intracellular signaling protein may be mimicked by using such a MyD88 inhibitor.

Thus, in one embodiment, the present invention is directed to a method of inhibiting expression of TLR4 in a cell, tissue, or organ in vitro or in a subject in vivo. As discussed in detail below, preferred approaches to such inhibition include delivery to the cell, tissue, or organ of an inhibitory agent that blocks gene expression or which locally neutralize the TLR4. Examples of such agents include various types of inhibitory nucleic acids (NAi), preferably inhibitory RNA (RNAi), most preferably small inhibitory RNA (siRNA) molecules. Also included are antisense nucleic acid inhibitors of TLR4, or protein, such as antibody, or small molecule inhibitors acting at the receptor (antagonists). On those occasions when neurogenesis, or proliferation of neuronal cells, is to be downregulated, such as, for example, in certain brain tumors, TLR4 should advantageously be upregulated. This may be accomplished by causing a TLR4 agonist to come into contact with the TLR4.

The agonists or antagonists, as the case may be, are preferably targeted to the cell type on which the TLR4 or TLR2 is to be up- or downregulated. Such targeting may be by any means known in the art, such as linkage to a cell-type specific antibody or other ligand.

The known ligands for TLR4 include:

Bacterial: LPS; Pseudomonas exoS; C. pneumoniae, H.pyloή HSP 60; Viral: RSV F protein, MMTV envelope protein;

Parasitic: T. cruzi lipids;

Endogenous: HSP 70, HSP 90, fϊbronectin, heparin, hyaluronic acid, fibrinogen, beta- defensin 2; and

Synthetic: taxol (murine); MPL (LPS mimetic), and CSPG. Thus, when it is desired to upregulate TLR4, such ligands can be caused to come into contact with endogenous TLR4 in the CNS. When it is desired to downregulate TL4, such ligands can be sequestered or otherwise removed from the vicinity of the TLR4. It is preferable to use ligands that are specific to TLR4 or, when used in the context ofTLR2 up- or downregulation, specific to TLR2. Those ligands that activate both receptors should not be used for this purpose.

The present invention further includes methods for stimulating expression or activity of TLR2 in cells and tissues, particularly in tissue undergoing neurogenesis, in order to promote this process. The present invention is also directed to a method for growing and maintaining desired types of NPCs in culture, and for inducing neuronal differentiation of NPCs but also of more readily obtained stem cells — hematopoietic stem cells (HSCs)

In cases in which it is desired to inhibit neurogenesis, the present invention provides a method for determining whether a subject has an excess of inhibitory neurons responsible for this state. Excessive inhibition may be monitored by examining levels of inhibitory neurotransmitters, such as γ-amino butyric acid (GABA) in the blood or in the brain. GABA is the chief inhibitory neurotransmitter in the vertebrate central nervous system. Brain sampling is preferably accomplished by assaying cerebrospinal fluid (CSF) for GABA content, although other, more invasive means may be used. Excess GABA is indicative of overproduction or overactivity of GABA-ergic (inhibitory) neurons or the presence of a GABA-producing neuroblastoma. It is known, for example, that immortalized astrocyte cells lines synthesize and release GABA (Behrstock, SP et al. (2000)).

GABA is quantitated using methods well known in the art, for example, an early method involved high resolution mass spectrometric analysis (Wu, PH et al. (1979)). Measurement of GAD67 mRNA, which encodes glutamate decarboxylase (GAD), the enzyme that catalyzes synthesis of GABA, can also serve as a marker of GABA production,

Although GABA expression has previously not been described in oligodendrocyte lineage cells, GAD expression by these cells may reflect their potential to generate GABAergic neurons (Nunes et al. (2003)).

According to the present invention, a predisposition for the development of neuro/glial tumors is related to a defect in the TLR2 gene (e.g., a mutation, abnormal expression, etc.). Thus, the present invention includes a method to test or screen subjects for such a predisposition - both in normal subjects and in those known to be at risk (e.g., patients that have already been diagnosed and treated and family members of such patients) by assessing the expression of TLR2, by measuring transcription of TLR2 mRNA, production of the TLR2 protein or biochemical or functional evaluation of receptors on the surface of cells, using conventional methods for such assays.

The present invention also includes modulation ex vivo of stem cells before their administration in the treatment of any of a number of diseases or conditions. For example, inhibition of MyD88 results in increases in oligodendrocytes that would improve the efficacy of this approach for treating multiple sclerosis in comparison to untreated stem cells.

Using appropriate activation or inhibition of cells via TLRs using pharmacological inhibitors, siRNA, or activating agents, the present invention may be implemented in the treatment of various other diseases.

Also included is a method to modulate the activity of endogenous stem cells using activation or inhibition at the TLR of any of a number of these receptors.

The present methods may combine the activation or inhibition of two or more TLRs, preferably TLR2 and TLR4, although the data shows that combined upregulation of TLR2 and downregulation of TLR4 provides results no better than downregulation of TLR4 alone. Nevertheless, such combined treatment is also an aspect of the present invention.

Also included is the modulation of downstream signaling, preferably via MyD88, which is common to most of the TLR pathways. Such modulation is described in the Examples.

More specifically, the present invention provides an interfering or inhibitory nucleic acid (NAi) having a sequence that is sufficiently complementary to the sequence of mRNA corresponding to the DNA sequence encoding human TLR4 (SEQ ID NO:5) or TLR4 of another mammalian source, so that expression of the NAi molecule in a cell that normally expresses TLR4 results in diminution or loss of expression of TLR4.

Furthermore, when inhibition of neurogenesis is sought, the interfering or inhibitory nucleid acid will have a sequence that is sufficiently complementary to the sequence of mRNA corresponding to the DNA sequence encoding human TLR2 (SEQ ID NO: 6) or TLR2 of another mammalian source, so that expression of the NAi molecule in a cell that normally expresses TLR2 results in diminution or loss of expression of TLR2.

The NAi is preferably interfering RNA (RNAi) molecule, such as a single stranded siRNA that forms a hairpin structure or a double stranded siRNA.

The above RNAi molecule preferably (i) consists of between about 6 and about 50 nucleotides, or (ii) hybridizes to, a TLR4 (or TLR2) target subsequence of between about 6 and 50 nucleotides, such that binding of the RNAi molecule to the target inhibits expression of TLR4 (or TLR2) in the cell results in inhibition. In another embodiment, the above RNAi molecule consists of between about 15 and about 30 nucleotides or is complementary to a human TLR4 mRNA sequence of between about 15 and about 30 nucleotides. The RNAi molecule preferably consists of between about 20 and about 25 nucleotides or is complementary to a human TLR4 mRNA sequence of between about 20 and about 25 nucleotides.

Also included is a DNA molecule encoding the above NAi or RNAi molecule and an expression construct comprising this DNA molecule, operatively linked to a promoter that drives the expression of the NAi or RNAi in TLR4- (or TLR2-) expressing cells, such as in the vicinity of a pathological condition in the CNS, such as a trauma or a neurodegenerative disease (or a brain tumor in the case of TLR2). A preferred promoter is a polIII promoter such as a U6 promoter.

In one embodiment, a viral vector comprises the above expression construct; this may be a transient or a stable expression vector. One preferred viral vector is an adenoviral vector.

The present invention is also directed to a method for inhibiting TLR4 (or TLR2) expression in a TLR4- (or TLR2-) expressing cell, comprising:

(a) modifying the cell to express the above NAi or RNAi; or (b) providing to the cell the above DNA molecule or expression construct; or

(c) infecting the cell with a viral vector as above, wherein the above modifying of (a), providing of (b) and infecting of (c) is preferably performed under conditions that are effective for expression of the NAi or RNAi molecule, and thereby for inhibition of TLR4 (or TLR2) expression.

Also provided is a method for inhibiting TLR4 (or TLR2) action in a TLR4- (or TLR2-) expressing cell comprising exposing the cell to a pharmacological inhibitor or antagonist that blocks binding of a TLR4 (or TLR2) ligand to TLR4 (or TLR2) or postbinding activation of TLR4 (or TLR2) or inhibits downstream signalling through MyD88.

The above cell is preferably a human cell and may be any TLR4 expressing cell in the vicinity of a pathological condition that warrants promotion of neurogenesis or any TLR2-expressing cell in a brain tumor whose neuroproliferation is to be inhibited.

The foregoing method preferably reduces the ability of the cell to bind, and respond to stimulation by a ligand for TLR4.

In one embodiment of the above method, the RNAi molecule is expressed in the cell in vivo or the inhibitor or antagonists blocks the binding or activation in vivo.. In another embodiment of the above method, the cell and the expression occurs in a subject who is susceptible to, or bears a neuro/glial tumor or suffers from another form of brain cancer, in which case TLR4 is upregulated and/or TLR2 is downregulated. In the foregoing method, the NAi or RNAi molecule that silences TLR2 is preferably expressed in the cell in vivo, preferably in a subject with cancer. The cancer to which this aspect of the present invention is directed includes neuroblastoma, glioblastoma; glioblastoma multiformae; anaplastic astrocytoma, pilocytic astrocytoma, pleomorphic xanthoastrocytoma, subependymal giant cell astrocytoma, fibrillary astrocytoma, gemistocytic astrocytoma, protoplasmic astrocytoma; mixed oligoastrocytoma and malignant oligoastrocytoma; oligodendroglioma and anaplastic oligodendroglioma; anaplastic ependymoma, myxopapillary ependymoma, and subependymoma.

Also provided is a method of treating a TLR2+ neuro/glial tumor or cancer in a subject, comprising administering to the subject by an effective route, an amount of the above viral vector effective for inhibiting expression of TLR2 and thereby inhibiting the growth and proliferation of cells of the tumor or cancer. The present invention includes use of a NAi or RNAi molecule as above, a

DNA molecule as above, an expression construct as above or a viral vector as above for the preparation of a medicament for therapeutic inhibition of TLR4 (or TLR2) expression in a TLR4- (or TLR2-) expressing cell. In the foregoing use, the NAi or RNAi molecule is preferably expressed in the cell in vivo. Also provided is use of a pharmacological inhibitor or antagonist that blocks binding of a TLR4 ligand to TLR4 or postbinding activation of TLR4 for the preparation of a medicament for therapeutic inhibition of TLR4 expression in a TLR4-expressing cell, most preferably a human cell in which neurogenesis is to be stimulated. In one embodiment, the inhibition reduces the ability of the cell to bind and respond to stimulation by an agonist ligand of TLR4.

This invention also provides a method for promoting neurogenesis in a subject in need thereof, comprising administering to the subject an effective amount of an agent that increases expression and/or activity of TLR2 in the subject. The agent is preferably lipopeptide Pam3CysSK4 (P3C), or a peptidoglycan (PG). In this method the agent is administered by one of the following routes: oral, intravenous, subcutaneous, intracranial, lumbar, intrathecal, intracerebroventricular, although any known route of administration is intended.

Also provided is a method for promoting neuronal differentiation of neural progenitor cells (NPCs) comprising exposing NPCs to an effective amount of an agent that increases expression of TLR2, binding of a TLR2 ligand to TLR2, or postbinding activation of TLR2. Examples of useful agents are lipopeptide Pam3CysSK4 (P3C), or a peptidoglycan. The agent is preferably administered to a subject in vivo. In one embodiment, the agent is administered in vivo in combination with a source of NPCs. Any of the known routes, such as those noted above, may be used.

Another aspect of the present invention is the influence of Toll- like receptors, such as TLR4 and TLR2 on retinogenesis. The data in the present specification shows that in the adult mammalian central nervous system (CNS), TLRs, including TLR4, regulate adult hippocampal neurogenesis (see also Rolls et al., 2007, the entire contents of which are specifically hereby incorporated by reference, and particularly the full color figures therein that correspond to Figs. 1-10 of the present application). Taken together, the functions that have been recently attributed to TLRs in the mammalian CNS, the changes in TLR expression pattern with development, and the evidence of TLR4 expression in the retinal ciliary body, a location known to harbor RPCs, raised the possibility that TLR4 may play a role in the mammalian retina in RPC fate decision. The data in Example II herein establish that TLR4 does indeed play such a role. Accordingly, a further aspect of the present invention is the downregulation of TLR4 so as to induce neurogenesis in the adult eye under pathological conditions. The pathological conditions that can be treated in this manner include any disease or condition that results in a loss of vision, such as macular degeneration (also known as AMC or age- related macular degeneration), glaucoma, vision problems associated with Alzheimer 's disease, etc. Also included as such a pathological condition is trauma to the eye.

It is known that following injury to the eye, growth factors are upregulated in the host as part of the immune response to the injury. This includes an increase of IGF-I and BDNF. Such is also expected as a result of the inflammation accompanying other pathological conditions that result in reduced retinal nerve activity. The experimentation herein establishes that downregulation of TLR4 alone will not suffice to activate PRCs in the absence of growth factors that are known to activate RPCs. However, the endogenous upregulation of growth factors following injury or accompanying other pathological conditions is expected to be sufficient to create a microenvironment around the PRCs that will permit activation of the PRCs and promotion of retinogenesis once the inhibitory activity of TLR4 is eliminated by the downregulation thereof in accordance with the present invention. Thus, therapeutic downregulation of TLR4 in a patient in need of retinogenesis, without addition of exogenous growth factors, would be expected to permit endogenous activation of PRCs in that patient, and promotion of retinogenesis. While addition of growth factors is not necessarily required for promotion of retinogenesis in accordance with the present invention, for the reasons discussed above, they may optionally be added or the patient may otherwise be treated so as to cause growth factors known to activate RPCs to come into contact with the RPCs in the host patient. Such growth factors include FGF-2, insulin, IGF-I, BDNF, and other such growth factors known in the art to activate RPCs. When the TLR4 inhibition of activation is eliminated by downregulation of TLR4 in accordance with the present invention, growth factors for activation of RPCs may optionally be added or otherwise caused to be present in the vicinity of the RPCs.

The term "cause" to be present includes direct and indirect addition of such substance. For example, the substance in question may be directly administered to the patient in a manner that will allow it to be present in the vicinity of the RPCs, or another substance may be administered that will indirectly cause release of the substance in question in a way that it will find its way to the vicinity of the RPCs, all as is well known to those of ordinary skill in the art.

Because the experimentation with retinal neurons establish that TLR4 acts in the same manner as has been found in the earlier experiments on the hippocampus, it is expected that the effect of TLR2 will also be the same in the retinal neuron environment (the eye) as has been shown in the hippocampal experiments. Thus, upregulation of TLR2 is expected to promote activation of PRCs and promotion of retinogenesis, just as it promotes neurogenesis in the hippocampal environment. Accordingly, the present invention is further directed to the promotion of retinogenesis in patients in need thereof by adding or otherwise upregulating TLR2, either alone or also accompanied by downregulation of TLR4, and/or causing growth factors to be provided to the vicinity of the PCR'sΛ

DESCRIPTION OF THE DRAWINGS Figure la-Ik. Impaired neurogenesis in TLR2-defϊcient mice. Fig. Ia:

Low-scale magnification of the dentate gyrus (DG) of the hippocampus immunostained for TLR2 (darker cells), and propidium iodide (PI) (brighter cells). The arrows indicate TLR2+ cell in the subgranular zone (SGZ). Fig Ib: Z-axis projections of the boxed area in Fig. Ia. Fig. Ic: Low-scale magnification of the subventricular zone (SVZ) of the lateral ventricle, labeled for TLR2 (darker cells) and PI (brighter cells). Fig. Id: Split image of TLR2 (upper left box), DCX (upper right box) and PI (lower boxes) labeling of cells in the SVZ. The arrows indicate TLR2+ cell co-expressing DCX. Fig. Ie: 3-dimentional, split view of cells in the SVZ labeled for TLR2 (left box), DCX (second box from the left) and PI (third box from the left) The fourth box from the left shows all of the labels. Fig. If: GFAP (brighter) and TLR2-labeling (darker) in the SVZ. Arrow indicates double-labeled cell. Fig. Ig:

Photomicrograph of the lateral ventricle of a CX3CR1GFP mouse immunostained for TLR2 (darker). The brighter colored cells are myeloid-derived cells expressing green fluorescent protein (GFP). Fig. Ih: Quantification of BrdU-labeled cells 1, 7, or 28 days after the first BrdU injection in TLR2-deficient (TLR2D) and wild-type (C57BL/6) mice. No significant differences were observed at any tested time point (Student's t-test; n = 4 per group; results are expressed as the numbers (mean ± SEM) of BrdU+ cells per dentate gyrus). Fig. Ii: Quantifϊcation of BrdU+ cells differentiating into all three neural cell lineages, expressed as percentages (mean ± SEM) of the total number of BrdU+ cells, in the dentate gyrus 7 d after the first BrdU injection; Asterisks denote statistical differences between the indicated groups; *p < 0.05;** p < 0.01; *** p < 0.001, Student's t-test; n = 4 for all tested groups. Fig. Ij: Representative photomicrographs of the dentate gyrus of wild-type and TLR2D mice that were stained, 7d after BrdU injection, for BrdU (brighter spots) and DCX (most of the imaged portions) and for GFAP (the imaged portions) (Fig. Ik). Note the difference in dendritic arborization, examined by DCX staining, between wild-type and TLR2D mice (Fig. Ij). Scale bar (Figs. Ia, Ic, Ij, and Ik) lOOμm; (Figs. Ib, Ie, If and Ig) 10μm (Fig. Id) 20μm.

Figure 2. Activation of TLR2 on NPCs increases their neuronal differentiation in vitro. Fig. 2a: Expression of TLR2 (red) on adult NPCs isolated from wild-type C57BL/6 mice using anti-TLR2 antibodies. Figs. 2b and 2c: Self-renewal capacity of NPCs isolated from TLR2-deficient mice. Clonal and subclonal efficiencies of NPCs isolated from TLR2D mice relative to their matched wild-type controls (C57BL/6) were assessed in three different neurosphere preparations by counting the numbers of sphere- forming single clones (Fig. 2b) in cells isolated from the adult SVZ (obtained as described in Supplementary information, Methods; primary culture (PO)) or (Fig. 2c) in NPCs from passage 15 (P 15), which were mechanically dissociated as single cells and replated in growth medium. Results are expressed as mean percentages ± SD. No significant differences were observed between TLR2D mice and wild-type controls (Student's t-test). Fig. 2d: Survival of NPCs derived from wild-type and TLR2D mice that were cultured for 7 days with Aphidicolin, a reversible inhibitor of eukaryotic nuclear DNA replication that blocks cell division. Numbers of surviving cells were determined by the XTT assay, and are expressed by arbitrary units (means ± SD; n=4-5 repeats). Results are from one of five independent experiments, each carried out in quadruplicate (*p < 0.05; F= 64.394; Factorial ANOVA; Fisher's test). Figs. 2e and 2f: Newly formed DCX+ (red, (Fig. 2e)) or GF AP+ cells (green, (Fig. 2f)) originated from BrdU-prelabeled NPCs isolated from the wild type (left panels) or from TLR2D mice (right panels) following their co-culturing for 3 days with mixed glial cells from wild-type (upper panels) or from TLR2D mice (lower panels). Fig. 2g: Percentages (means ± SD) of NPCs differentiation (wild-type or TLR2D) to βIII-tubulin+ cells (black bars), GF AP+ cells (gray bars), or NG2 cells (white bars), activated by peptidoglycan (PG; 10 μg/ml) or Pam3CysSK4 (P3C; 10 μg/ml) in the absence or presence of TLR2 -neutralizing antibodies in differentiation-inducing medium (without fibroblast- or epidermal growth factor). Asterisks above bars indicate significant differences relative to wild-type untreated controls. Significant differences between relevant groups are indicated by lines between them (*p < 0.05; F= 15.047 for GFAP and F=9.115 for βHIT; factorial ANOVA; Fisher test). Fig. 2h: Representative βHIT-labeled cells (red) from wild-type NPCs without or with P3C- treatment (10 μg/ml). Scale bars: (Fig. 2a) 10 μm; (Figs. 2e and 2f) 100 μm; (Fig. 2h) 50 μm.

Figure 3. Activation of TLR2 on NPCs is MyD88 and NF-κB dependent. Fig. 3a: Neuronal differentiation of wild-type NPCs, assayed by βHIT-labeled cells in the presence or absence of MyD88 homodimerization inhibitory peptide, with or without P3C. The control peptide was also tested. Results are recorded as βIIIT+ cells expressed as percentages (mean ± SD) of the total number of Hoechst-stained cells. MyD88 inhibitory peptide reduced neuronal differentiation even in the absence of activator (*p < 0.05; F=15.047; factorial ANOVA; Fisher test). Fig. 3b: Immunoblots with anti-phospho-IKK

(pIKK) and anti-total IKK (tIKK) antibodies of NPCs (cell lysates) after exposure to P3C (10 μg/ml) for 15 min. Fig. 3c: Immunoblots with anti-NF-κB (p65 subunit) and lamin B antibodies, of NPCs (extract of nuclear proteins) following treatment (30 min, 1 h) with Pam3Cys (10 μg/ml) in the presence or absence of TLR2 neutralizing antibody. Fig. 3d: Immunocytochemical analysis of the cellular localization of NF-κB subunits p50 (green) and p65 (red), in untreated cells or cells that were treated for 30 min with PG (10 μg/ml). Hoechst staining (blue) indicates nuclear localization. Boxed: large-scale magnification of a single representative cell. Fig. 3e: Quantitative analysis of βHIT-labeling of NPCs derived from wild-type mice in the absence or presence of NF-κB (2 μM) or PKC (5 μM) inhibitors (black bars indicate cultures without inhibitors; gray bars indicate cultures with NF -KB inhibitor and white bars indicate cultures with PKC inhibitor). Results are recorded as βIIIT+ cells expressed as percentages (mean ± SD) of the total number of Hoechst-stained cells. Lines above bars indicate significant differences between the indicated groups (*p < 0.05; F=7.728; factorial ANOVA; Fisher's exact test). Scale bar: (Fig. d) 20 μm. Each in vitro differentiation assay presented shows the results of one of three or four independent experiments, cells were counted in at least five randomly chosen fields of view. See Figure 9, left half, for full scan images. Figure 4. TLR4 involvement in adult neurogenesis. Fig. 4a: Semiquantitative PCR analysis of wild-type NPCs and microglia for expression of the indicated members of the TLR family. TLR2 and TLR4 expression on NPCs was higher than on microglia (1.6 and 2.4 fold of increase for TLR2 and TLR4, respectively). Fig. 4b: TLR4- immunoreactivity (red) on wild-type NPCs. Fig. 4c: Clonal efficiency of wild-type NPCs (mechanically dissociated as single cells; P 15) in the absence or presence of ultra purified LPS or treated with siRNA for TLR4, assessed by counting the numbers of sphere-forming single clones (four different neurosphere preparations). Results are expressed as mean percentages (± SD) of the total cell number (*p < 0.05; F=23.743; factorial ANOVA; Fisher's exact test). Fig. 4d: Representative neural stem-cell spheres from wild-type NPCs treated with siRNA for TLR4. Fig. 4e: Survival of dissociated wild-type NPCs in the presence of Aphidicolin, an inhibitor of cell proliferation, cultured for 7 days with LPS or with siRNA for TLR4. Numbers of surviving cells were determined by the XTT assay, and are expressed by arbitrary units (means ± SD). Fig. 4f: Clonal efficiency of primary cultures (PO) of NPCs isolated from TLR4D mice relative to their matched wild-type controls (C57BL/10) was assessed by counting the number of sphere-forming single clones in cells isolated from the adult SVZ (obtained as described in Methods). Results are expressed as mean percentages ± SD (**p<0.01, Student's t-test). Fig. 4g: Differentiation of wild-type NPCs into neurons, astrocytes, or oligodendrocytes in the presence or absence of LPS, TLR4-neutralizing antibodies (αTLR4), siRNA for TLR4, and siRNA control (non-targeting 20-25 nt siRNA). Cells expressing the indicated marker are expressed as percentages (means ± SD) of the total number of Hoechst-labeled cells. Treatment groups that differ significantly according to Factorial ANOVA are listed (F=2.158 for GFAP; F=20.875 for βHIT). Fig. 4h: Representative βHIT-labeled cells (red) obtained from dissociated wild-type NPCs, without or with siRNA treatment specific to TLR4. Fig. 4i: Immunoblots, with anti-NF-κB (p65 subunit), and lamin B antibodies, of NPCs (extracts of nuclear proteins) following treatment with LPS in the presence or absence of TLR4 neutralizing antibody. Fig. 4j: Immunoblots, with anti-phospho-IKK (pIKK), anti-total IKK (tIKK), or (Fig. 4k) anti-phospho-IRF-3, anti- total -IRF-3 antibodies, of NPCs (cell lysates) following treatment with LPS. Fig. 41: Immuno labeling of the dentate gyrus (DG) of wild-type mice for TLR4. Images show staining of TLR4 (blue) and PI (red). Arrows indicate double-labeled cells. Fig. 4m: Boxed area is presented in Z-axis projections. Fig. 4n: Low-scale magnification of the subventricular zone (SVZ) of the lateral ventricle, labeled for TLR4 (blue) and PI (red). Fig. 4o: Split image of the boxed area in Fig. 4n stained for TLR4 (blue), DCX (green) and PI labeling (red) of cells in the SVZ. Lines above bars denote significant differences between the indicated groups (*P <0.05; factorial ANOVA; Fisher's test). Scale bars: (Fig. 4b) 10 μm; (Fig. 4h) 20μm; (Figs. 4d, 41, 4o) lOOμm; (Fig. 4n) 200μm. See Figure 9, right half, for full scan images.

Figure 5. Adult hippocampal neurogenesis is TLR4 and MyD88 dependent. Fig. 5a: Quantification of BrdU-labeled cells in the dentate gyrus 1, 7, or 28 days after the first BrdU injection in TLR4D and wild-type mice. Fig. 5b: Quantification of BrdU+ cells differentiating into all three neural cell lineages, expressed as percentages (means ± SEM) of the total number of BrdU+ cells in the dentate gyrus 7 d after the first BrdU injection. Fig. 5c: Representative pictures of the dentate gyrus of wild-type and TLR4D mice that were stained for BrdU (red) 1 day after BrdU injection, and for BrdU+/DCX+ (red/green) 7 d after the first BrdU injection. Quantification of (Fig. 5d) BrdU-labeled cells, and of (Fig. 5e) BrdU+ cells differentiating into all three neural cell lineages (expressed as percentages (means ± SEM) of the total number of BrdU+ cells) in the SGZ of the dentate gyrus, 7 days after the first BrdU injection, in wild-type and MyD88- deficient (MyD88D) mice. Fig. 5f: Representative pictures of the dentate gyrus of wild-type and MyD88D mice that were stained for BrdU (red), and for BrdU+/DCX+ (red/green) 7 days after BrdU injection. All in vitro assays were carried out in triplicate. Results of one of three experiments are presented. Lines above bars denote significant differences between the indicated groups (*P <0.05; factorial ANOVA; Fisher's test). Asterisks above bars denote significant differences relative to untreated controls. In figures illustrating the results of experiments in vivo, asterisks denote statistical differences between the groups (*p < 0.05;**p < 0.01; ***p < 0.001, Student's t-test; n = 4 for all tested groups). Scale bars: lOOμm.

Figure 6a-h. Characterization of TLR2D mice and their controls. Figs. 6a-c: Verification that C57BL/6 mice are the appropriate wild-type controls for TLR2D mice. The TLR2D mice were created by microinjection of a genomic DNA fragment from a 129Sv/J mouse genomic library (Stratagene) into C57BL/6 blastocysts. The resulting chimeric mice were bred with C57BL/6 females to produce Fl heterozygous mice.

Heterozygous mice were then interbred to obtain homozygotes, which were then backcrossed with C57BL/6 for 10 generations (Takeuchi, O et al. (1999)). Thus, C57BL/6 mice have been considered the appropriate control for these TLR2D mice. However, since differences in neurogenesis were found between different strains (Kempermann, G et al. (1997)), we verified that the observed difference between TLR2D mice and C57BL/6 resulted from the deficiency in TLR2, and did not reflect the presence of any residual 129Sv/J genomic sequences. Quantification of BrdU-labeled cells (Fig. 6a) and of BrdU+ cells co-expressing DCX (Fig. 6b), presented as percentages (mean ± SE) of the total number of BrdU+ cells, in the dentate gyrus 7 days after the first BrdU injection (50 mg/kg; 3 injections given every 8 hours) in C57BL/6 and 129Sv/J mice (*p <0.05; Student's t-test; n = 4 mice per group). Decreased proliferation was evident in the 129Sv/J animals relative to C57BL/6, with no differences in neuronal differentiation; these results are consistent with the reported variation between these two mouse strains (Kemperman, G et al. (1997)). Since the difference between the two wild-type strains was at the level of proliferation and not at the level of neuronal differentiation, and since the effect of TLR2 deficiency was only on neuronal differentiation, we were able to rule out the effect of any residual contribution of the 129Sv/J background to the NPC differentiation of the TLR2D mice. Fig. 6c: RNA of Frizzled- related protein was sequenced in both TLR2D and a C57BL/6 control mouse, from before the ATG through the coding region and into the 3' UTR, for a total of 1287 bp. The gene encoding for frizzled-related protein, which is located in close proximity to the TLR2 gene, can affect neurogenesis. It was shown that both Wnt and secreted frizzled-related proteins (SFRPs), which function as negative regulators of Wnt signaling, have important effects on hippocampal neurogenesis (Lie, DC et al. (2005)). Moreover, Wnt expression was shown to be affected by TLR signaling (Blumenthal, A et al. (2006)). To rule out the possibility that the gene encoding frizzled-related protein, located at a distance of 56.2 kbase from TLR2, was damaged in the TLR2-deficient mice, we sequenced the coding region of the gene for

Frizzled-related protein in the TLR2D mice and compared it to that of the C57BL/6. The two sequences were identical, and comparison to the mouse genome from C57BL/6, resulted in a perfect match of the entire sequence. Figs. 6d-g: Comparison of cytokine profiles in TLR2D mice and C57BL/6 mice. TLR2D mice maintained under pathogen-free conditions were reported to have normal thymocyte and splenocyte composition (CD3, B220, CD4, and CD8); their surface expression of B220, IgM, and IgD on splenocytes and their cytokines levels are also almost identical to those of wild-type mice. In the present study, the profile of key cytokines in the TLR2D mice was further confirmed: IFN-γ (Fig. 6d), TNF-α (Fig. 6e), IL-4 (Fig. 6f), and IL-2 (Fig. 6g). Results are presented as pg/ml in the serum (mean ±SD; n=8). No statistical differences were found (student's t-test). Fig. 6h: Assessment of cell proliferation in the dentate gyrus in TLR2D and wild-type mice following 2-hourly injections of BrdU. Wild-type and TLR2D mice were injected intraperitoneally (i.p.) with BrdU at 2-h intervals for 16 h. Immediately after the last injection the mice were killed and the SGZ of the dentate gyrus of each mouse was analyzed for BrdU+ cells. No differences were detectable in the numbers of proliferating cells (1720 ± 129, mean ± SEM, in the wild type compared to 1728 ± 222 in TLR2D mice; p = 0.97, Student's t-test; n = 4 mice per group). Figure 7a- f. In vitro characterization of TLR2 involvement in NPC differentiation. Fig. 7a: Quantitative analysis of neuronal differentiation of NPCs in the presence of increasing doses of the TLR2 activators Pam3CysSK4 (P3C) (black squares) and a peptidoglycan (PG) (white circles; *p < 0.05 compared to untreated control; F=16.784; Factorial ANOVA; Fisher's test)). Results are from one of four independent experiments, each carried out in triplicate. Fig. 7b: Representative βIIIT+ cells in cultures of NPCs derived from wild-type mice treated with the TLR2-activators P3C or PG (10 μg/ml); Also shown are NPCs derived from TLR2D mice. Fig 7 c, d: Quantitative analysis of morphological changes detected in βIIIT+ cells in cultures of wild-type NPCs after treatment with the two TLR2 activators. For each treatment group we determined (Fig. 7c) the numbers of neurites per βIIIT+ cell (means ± SD; F=22.028; Factorial ANOVA), and (Fig. 7d) the mean length (black bars) and the mean of the longest neurite per cell (gray bars); NPCs from TLR2D mice (without activators) were similarly analyzed (*p<0.05; F= 27.343 for longest neurite length and F=26.964 for average length; Factorial ANOVA; Fisher's test). Fig.7e: Sub-clonal efficiencies of wild-type NPCs, in the presence of the TLR2 activators (PG or P3C; 10 μg/ml), were assessed by counting the sphere-forming single clones in three different experiments. Results are expressed as mean percentages ± SD; differences were not significant according to Factorial ANOVA test. Fig. 7f: Survival of wild-type-derived NPCs that were cultured for 7 days with Aphidicolin in the presence of the NF -KB inhibitor (2 μM) and PKC inhibitor (5 μM). Numbers of surviving cells were determined by XTT, and are expressed by arbitrary units (mean values ± SD; F=276.421; Factorial ANOVA). Results are from one of four independent experiments, each carried out in quadruplicate (*p<0.05; Factorial ANOVA; Fisher's test). Scale bar: (Fig. 7b) 20μm. Note, differences between groups are indicated by asterisks (*p <0 .05). Asterisks above the bars indicate differences from control.

Figures 8a-e. TLR4D mice complementary data. Fig. 8a: Expression of mRNA encoding for TLR4 by adult NPCs, measured by real time PCR, following suppression using TLR4-targeted siRNA. The results are expressed relative to GAPDH levels (one of 3 independent experiments). Silencing efficiency ranged between 40% and 70% (***p<0.001; Student's t-test). Functional effects were evident even when silencing was approximately 40%. Fig. 8b: Assessment of cell proliferation in the dentate gyrus in TLR4D and wild-type mice following 2-hourly injections of BrdU. Wild-type (C57BL/10) and TLR4D mice were injected i.p. with BrdU at 2-hourly intervals for 16 h. Immediately after the last injection the mice were killed and the SGZ of the dentate gyrus in each mouse was analyzed for BrdU+ cells (**p < 0.01; Student's t-test; n=5). One would expect to observe a greater number of labeled cells with the 2-hourly injection BrdU protocol than with the 8-hourly injection protocol. It is possible that cell division of BrdU-labeled cells occurred during the 24-hour interval between the final BrdU injection and the tissue excision in the 8- hourly injection protocol; this interval did not exist in the more frequent 2-hourly injection protocol. Alternatively, the decreased proliferation may be due to toxicity of the increased cumulative BrdU levels in the 2-hourly protocol (Gould, E et al. (2002); Reome, JB et al. (2000)). Fig. 8c: Assessment of cell proliferation in the subventricular zone in TLR2D and TLR4D and their respective wild-type controls. BrdU+ cells in the SVZ of TLR2D and

TLR4D mice were quantified relative to their matched wild-type controls (C57BL/6 (B 1/6J) and C57BL/10 (Bl/10), respectively) immediately after receiving the last of seven BrdU injections administered at 2-hourly intervals (n = 5 mice per group). Differences between the TLR2D and their controls mice were not significant, but significant differences were seen between the TLR4D and their controls (*p < 0.05, Student's t-test). Figs. 8d and e:

Combined effect of TLR2 and TLR4 neutralization on sphere formation and differentiation. Wild-type NPCs were mechanically dissociated as single cells, and their clonal efficiencies in the presence of TLR2 and TLR4 neutralizing antibodies were assessed by expressing the numbers of sphere-forming single clones as a percentage of the total cell number. Fig. 8d: The results are expressed as mean percentages ± SD; *p < 0.05, Student's t-test. Dissociated wild-type NPCs were cultured for 4-6 days in differentiation-inducing medium (without fibroblast growth factor or epidermal growth factor) in the presence or absence of the relevant TLR-neutralizing antibodies (Fig. 8e). Percentages (means ± SD) of NPC differentiation to βIIIT+ (black bars), to GFAP+ cells (gray bars), or to NG2 (white bars) are presented (*p < 0.05 for βlll-tubulin, Student's t-test, and was not significant for GFAP or NG2). Representative results from one of three experiments are shown. Figure 9 is a set of full scan images showing results supporting Figure 3 (left half) and Figure 4 (right half).

Figure 10: Spatial learning and memory are impaired in TLR2-defϊcient mice but not in TLR4-defϊcient mice. Performance of TLR2-defϊcient mice (TLR2D; red) and their relevant wild-type controls in) acquisition (Fig. 10a; WT blue) and reversal phases of a spatial learning and memory task (Fig 10b) in the Morris water maze. (*p<0.05;

ANOVA followed by Scheffe test, indicating significant differences between individual groups). Results are expressed as mean ± SEM (n=15 animals in each group; one representative experiment is shown out of two repeats).

Figure 11. Deficiency in TLR4 results in increased proliferation of cells reminiscent of RPCs in the early postnatal mammalian retina. Fig. HA: RNA was isolated from whole eyes of PN6 wild-type mice. Semi-quantitative PCR of TLR 1 through 9 is presented. Note the high expression of TLR4. Fig. HB: Immunolabeling for TLR4 (green) and Hoechst (blue) of a PN6 eye. Figs. HC and HD: Representative pictures of the ciliary epithelium (CE) labeled with TLR4 (green) and the endothelial marker, CD34 (red; Fig. HC), or the epithelial markers cytokeratin 18 and AE1/AE3 (boxed) (red; Fig. HD). Fig. HE: Split images of nestin (red), TLR4 (green) and Hoechst (blue) in the CE. Fig. HF: Split images of BrdU (blue), ChxlO (red) and TLR4 (green) in the CE. Arrows indicate BrdU+ cells co-expressing ChxlO and TLR4. Fig. HG: Split images of BrdU (red) and TLR4 (green) in the CE. Arrows indicate cells co-expressing TLR4 and BrdU; right panel is a z-axis projection of the boxed area. Fig. HH: Representative micrograph of BrdU (green) and Ki67 (red) in the CE and the peripheral retina of wild-type (upper panels) and TLR4D (lower panels) PN6 mice. Figs. HI and HJ: Quantification of the total number of proliferating cells in the CE (Fig. I ll) and in the peripheral retina (Fig. 1 IJ) of TLR4D and wild-type mice, as assessed by BrdU+ and Ki67+ cells. Fig. HK: Quantification of the total number of BrdU+/Nestin+, BrdU+/Pax6+ and BrdU+/Chx 10+ cells in the CE of PN6 TLR4D and wild-type mice. Figs. HL-HN: Representative immunohistochemichal staining of Fig. HL: Nestin(red)/BrdU(green), Fig. HM: Pax6(red)/BrdU(green) and Fig. HN: ChxlO(red)/BrdU(green) in the CE and the peripheral retina of PN6 wild-type (upper panels) and TLR4D (lower panels) mice. Arrows indicate double labeled cells. Asterisks denote significant differences between the indicated groups; Student's t-test;*P < 0.05; **P < 0.01; ***P < 0.001, n = 4 for all tested groups. Scale bar in Fig. 1 IB is 100 μm; in Figs. 1 IC-I IG is 20μm; and in Figs. 1 IH, 1 IL, 1 IM, 1 IN represents 50μm. For the individual cell in Fig 1 IG, scale bar is lOμm.

Figure 12. Deficiency in TLR4 in the early postnatal mammalian retina results in increased neuronal differentiation. Fig. 12A: Representative pictures of eyes stained 7 days after BrdU injection, for BrdU (green) and the linage specific markers (red; neurons, βlll-tubulin (βHIT); astrocytes, GFAP and SlOOβ; oligodendrocytes, RIP and NG2) or the apoptotic marker, cleaved caspase3 (red). Arrow indicates cell co-expressing BrdU and the tested marker. Fig. 12B: Quantification of BrdU+ cells differentiating into each of the three neural lineages, or apoptotic cells, expressed as percentages (mean± S.E.M.) of the total number of BrdU+ cells, in the peripheral retina 7 days after BrdU injection. Asterisks denote significant differences between the indicated groups; Student's t-test; *P < 0.05, n=4 for all tested groups. Fig. 12C: Representative pictures of the retinas of wild-type and TLR4D mice that were stained, 7 days after BrdU injection, for neuronal marker (red) and BrdU (green). Arrows indicate double labeled cells. Scale bar in Figs. 12A and 12C is 20μm; for individual cells, the scale bar represents lOμm.

Figure 13. Activation of TLR4 on the RPCs directly restricts their proliferation and neuronal differentiation in-vitro. Fig. 13A: Semi-quantitive PCR analysis of retinal progenitor cells (RPCs) for Toll like receptor (TLRs) expression. (Fig. 13B-Fig,-13D) TLR4 immunoreactivity (red) on wild type RPC spheres that express the neural progenitor marker, nestin (green; Fog. 13B), and the retinal progenitor markers, Pax6 (green; Fig. 13C) and ChxlO (green; Fig. 13D). Fig. 13E: Representative spheres from wild-type RPCs with and without treatment of ultra-purified lipopolysaccharide (upLPS). Fig. 13F: Quantification of RPC sphere diameter in the presence of upLPS (Factorial ANOVA, F=177.5, P=0.0001). Fig. 13G: Proliferation of RPCs in the presence of upLPS determined by XTT assay. Treatment with upLPS resulted in decreased proliferation

(Factorial ANOVA, F=7.434, P=0.0008). Fig. 13H: Survival of RPC in the presence of upLPS determined by XTT assay (Factorial ANOVA, F=46.27, P=O.0001). Treatment with upLPS did not affect cell viability. Fig. 131: Representative spheres from wild-type RPCs treated with siRNA for TLR4. Fig. 13 J: Representative pictures of βlll-tubulin (βHIT)- labeled cells (red) from wild-type RPCs with or without upLPS-treatment. Fig. 13K: Percentages of RPC differentiation to βIII-tubulin+ (βHIT) or doublecortin+ (DCX) cells in the presence or absence of upLPS. Treatment with upLPS resulted in decreased differentiation to neurons (Factorial ANOVA,βIIIT: F=16.92, P=0.0001 and DCX: F=14.73, P=O.0003). Results are expressed as mean±S.E.M.; Factorial ANOVA followed by Fisher's exact test *P=0.05. Scale bar in Figs. 13B, 13C, 13D is 20μm; For individual cells, scale bar represents lOμm; in Fig. 13E, lOOμm, and in Figs 131 and 13 J, 50μm.

Figure 14. The intracellular adaptors MyD88 and TICAMl down- regulate proliferation in the retinas of PN6 mice. MyD88-defϊcient (MyD88D), TICAMl- deficient (TICAMlD) and wild-type PN6 mice were injected with BrdU and killed 6 hours later. Fig 14A: Representative immunolabeling of MyD88D, TICAMlD and wild-type peripheral retinas (upper panels) and ciliary epithelium (CE; lower panels) with BrdU (green; scale bar 50μm and 20μm, respectively). Figs. 14B and 14C: Quantification of the total number of BrdU+ cells in the peripheral retina (Fig. 14B; Factorial ANOVA, F= 7.529, P=0.0064) or the CE (Fig. 14C; Factorial ANOVA, F=24.2, P=0.0002). Fig. 14D: Quantification of the total number of BrdU+/nestin+ (Factorial ANOVA, F=I 1.2, P=0.003); BrdU+/Pax6+ (Factorial ANOVA, F=6.32, P= 0.019) and BrdU+/ChxlO+ (Factorial

ANOVA, F=43.8, P=0.0001) cells in the CE of PN6 MyD88D, TICAMlD and wild-type mice. Results are expressed as mean±S.E.M.; factorial ANOVA followed by Fisher's exact test, *P=0.05; n = 4-8 for all tested groups.

Figure 15. TLR4 regulates the responsiveness of retinal progenitor cells following administration of growth factors. Fig. 15 A: RNA was isolated from whole eyes of PN6 and PN 14 wild-type mice. Semi-quantitative PCR analysis of TLR4 expression is presented. A 1.51 fold increase in TLR4 expression was observed at PN14 relative to PN6. β-actin served as a loading control. Fig. 15B: Representative photomicrographs of CE stained for TLR4 (red) in PN6 and PN 14 wild-type mice. Note the increased intensity at PN14. Fig. 15C: TLR4 immunoreactivity (intensity) as measured in CE of PN6, PN8,

PN12, PN14 and PN21 wild-type mice (Factorial ANOVA, F=4.069, P=0.0434). Figs. 15D and 15E: Quantification of the total number of BrdU+ cells in the peripheral retina of PN6, PN8, and PNlO (Fig. 15D) and in CE of PN6, PN14, and PN21 (Fig. 15E) TLR4D and wild- type mice (Factorial ANOVA, F= 323, P=0.0001 in Fig. 15D and F= 128, P=0.0001 in Fig. 15E). Fig. 15F: Scheme showing experimental design; TLR4D and wild-type PN15 mice received intravitreal injections of FGF-2 and insulin together with BrdU for 4 consecutive days, and were killed 24 hours after the last injection. Fig. 15G: Immunolabeling of BrdU in CE and peripheral retina of TLR4D and wild-type mice following growth factor treatment. Figs. 15H and 151: Quantification of the total number of BrdU+ cells in the CE (Fig. 15H), and in the peripheral retina (Fig. 151) (Student's t-test; *P < 0.05, **P < 0.01). Fig. 15J: Quantification of untreated (control) and treated (growth factor) CE stained for Ki67 in TLR4D and wild-type mice (Factorial ANOVA, F= 7.529, P=0.0064). Fig. 15K: Quantification of the total number of BrdU+/Pax6+ and BrdU+/ChxlO+ cells in the CE of TLR4D and wild-type mice following growth factor treatment (Student's t-test; *P < 0.05, ***P < 0.001). Fig. 15L: Representative pictures taken of retinas from TLR4D mice following growth factor treatment, labeled for BrdU (green) and Pax6 (red; upper panels) or ChxlO (red; lower panels). Fig. 15M: Fold increase in the number of BrdU+ cells in TLR4D relative to control, in PN6 and the PN 15 growth factor treated mice. Factorial ANOVA followed by Fisher's exact test *P=0.05; n=4-6 for all tested groups. Asterisks denote significant differences between TLR4D and the relevant controls. Results are expressed as mean±S.E.M. Scale bars in Figs. 15B, 15G, and 15L) is 25μm.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention includes siRNA and antisense DNA sequences, and constructs and vectors that deliver such inhibitory nucleic acids to target cells for the purpose of disrupting expression of TLR4. Such siRNA sequences hybridize to mRNA and block expression of TLR4 genes. The present invention is directed to the siRNA molecules (sequences), vectors, preferably adenovirus vectors, with a suitable promoter, such as the U6 promoter, that drives transcription of siRNA sequences that are "specific" for sequences of TLR4 (or TLR2 if that is the target to be inhibited). siRNA "hairpin" sequences (or shRNA) are preferred because of their stability and binding to the target mRNA. Human TLR4

The human TLR4 nucleotide sequence is shown below (SEQ ID NO:1) and has the Genbank accession number BCl 17422 [gi:109659093]. The coding sequence (bold) begins at nt 21 (the first codon is shown as bold, italic, all caps ATG) and runs through nt 2540 (including the stop codon TGA which is also bolded, italicized and all caps ).

According to Genbank AccessionNo. NM_138554 [gi:88758616] - also human TLR4 - nt's 142-210 are indicated as encoding the signal peptide (amino acid residues 1-69, below) whereas the mature peptide is encoded by nt's 211-2658 ofSEQ ID NO:1

1 gcagtgagga tgatgccagg Λ7Satqtctq cctcgcgcct ggctgggact ctgatcccag 61 ccatggcctt cctctcctgc gtgagaccag aaagctggga gccctgcgtg gaggtggttc

121 ctaatattac ttatcaatgc atggagctga atttctacaa aatccccgac aacctcccct

181 tctcaaccaa gaacctggac ctgagcttta atcccctgag gcatttaggc agctatagct

241 tcttcagttt cccagaactg caggtgctgg atttatccag gtgtgaaatc cagacaattg

301 aagatggggc atatcagagc ctaagccacc tctctacctt aatattgaca ggaaacccca 361 tccagagttt agccctggga gccttttctg gactatcaag tttacagaag ctggtggctg

421 tggagacaaa tctagcatct ctagagaact tccccattgg acatctcaaa actttgaaag

481 aacttaatgt ggctcacaat cttatccaat ctttcaaatt acctgagtat ttttctaatc

541 tgaccaatct agagcacttg gacctttcca gcaacaagat tcaaagtatt tattgcacag

601 acttgcgggt tctacatcaa atgcccctac tcaatctctc tttagacctg tccctgaacc 661 ctatgaactt tatccaacca ggtgcattta aagaaattag gcttcataag ctgactttaa

721 gaaataattt tgatagttta aatgtaatga aaacttgtat tcaaggtctg gctggtttag

781 aagtccatcg tttggttctg ggagaattta gaaatgaagg aaacttggaa aagtttgaca

841 aatctgctct agagggcctg tgcaatttga ccattgaaga attccgatta gcatacttag

901 actactacct cgatgatatt attgacttat ttaattgttt gacaaatgtt tcttcatttt 961 ccctggtgag tgtgactatt gaaagggtaa aagacttttc ttataatttc ggatggcaac

1021 atttagaatt agttaactgt aaatttggac agtttcccac attgaaactc aaatctctca

1081 aaaggcttac tttcacttcc aacaaaggtg ggaatgcttt ttcagaagtt gatctaccaa

1141 gccttgagtt tctagatctc agtagaaatg gcttgagttt caaaggttgc tgttctcaaa

1201 gtgattttgg gacaaccagc ctaaagtatt tagatctgag cttcaatggt gttattacca 1261 tgagttcaaa cttcttgggc ttagaacaac tagaacatct ggatttccag cattccaatt

1321 tgaaacaaat gagtgagttt tcagtattcc tatcactcag aaacctcatt taccttgaca

1381 tttctcatac tcacaccaga gttgctttca atggcatctt caatggcttg tccagtctcg

1441 aagtcttgaa aatggctggc aattctttcc aggaaaactt ccttccagat atcttcacag

1501 agctgagaaa cttgaccttc ctggacctct ctcagtgtca actggagcag ttgtctccaa 1561 cagcatttaa ctcactctcc agtcttcagg tactaaatat gagccacaac aacttctttt

1621 cattggatac gtttccttat aagtgtctga actccctcca ggttcttgat tacagtctca

1681 atcacataat gacttccaaa aaacaggaac tacagcattt tccaagtagt ctagctttct

1741 taaatcttac tcagaatgac tttgcttgta cttgtgaaca ccagagtttc ctgcaatgga

1801 tcaaggacca gaggcagctc ttggtggaag ttgaacgaat ggaatgtgca acaccttcag 1861 ataagcaggg catgcctgtg ctgagtttga atatcacctg tcagatgaat aagaccatca

1921 ttggtgtgtc ggtcctcagt gtgcttgtag tatctgttgt agcagttctg gtctataagt

1981 tctattttca cctgatgctt cttgctggct gcataaagta tggtagaggt gaaaacatct

2041 atgatgcctt tgttatctac tcaagccagg atgaggactg ggtaaggaat gagctagtaa

2101 agaatttaga agaaggggtg cctccatttc agctctgcct tcactacaga gactttattc 2161 ccggtgtggc cattgctgcc aacatcatcc atgaaggttt ccataaaagc cgaaaggtga

2221 ttgttgtggt gtcccagcac ttcatccaga gccgctggtg tatctttgaa tatgagattg

2281 ctcagacctg gcagtttctg agcagtcgtg ctggtatcat cttcattgtc ctgcagaagg

2341 tggagaagac cctgctcagg cagcaggtgg agctgtaccg ccttctcagc aggaacactt

2401 acctggagtg ggaggacagt gtcctggggc ggcacatctt ctggagacga ctcagaaaag 2461 ccctgctgga tggtaaatca tggaatccag aaggaacagt gggtacagga tgcaattggc

2521 aggaagcaac atctatcTGA agaggaaaaa taaaaacctc ctgaggcatt tcttgcccag

2581 ct

The amino acid sequence of the human TLR4 protein is shown below and is SEQ ID NO:2 (Genbank BCl 17422). The signal peptide is shown as underscored. MMSASRLAGT LIPAMAFLSC VRPESWEPCV EVVPNITYQC MELNFYKIPD NLPFSTKNLD 60

LSFNPLRHLG SYSFFSFPEL QVLDLSRCEI QTIEDGAYQS LSHLSTLILT GNPIQSLALG 120 AFSGLSSLQK LVAVETNLAS LENFPIGHLK TLKELNVAHN LIQSFKLPEY FSNLTNLEHL 180 DLSSNKIQSI YCTDLRVLHQ MPLLNLSLDL SLNPMNFIQP GAFKEIRLHK LTLRNNFDSL 240 NVMKTCIQGL AGLEVHRLVL GEFRNEGNLE KFDKSALEGL CNLTIEEFRL AYLDYYLDDI 300 IDLFNCLTNV SSFSLVSVTI ERVKDFSYNF GWQHLELVNC KFGQFPTLKL KSLKRLTFTS 360 NKGGNAFSEV DLPSLEFLDL SRNGLSFKGC CSQSDFGTTS LKYLDLSFNG VITMSSNFLG 420 LEQLEHLDFQ HSNLKQMSEF SVFLSLRNLI YLDISHTHTR VAFNGIFNGL SSLEVLKMAG 480 NSFQENFLPD IFTELRNLTF LDLSQCQLEQ LSPTAFNSLS SLQVLNMSHN NFFSLDTFPY 540 KCLNSLQVLD YSLNHIMTSK KQELQHFPSS LAFLNLTQND FACTCEHQSF LQWIKDQRQL 600 LVEVERMECA TPSDKQGMPV LSLNITCQMN KTIIGVSVLS VLWSVVAVL VYKFYFHLML 660 LAGCIKYGRG ENIYDAFVIY SSQDEDWVRN ELVKNLEEGV PPFQLCLHYR DFIPGVAIAA 720 NIIHEGFHKS RKVIVVVSQH FIQSRWCIFE YEIAQTWQFL SSRAGIIFIV LQKVEKTLLR 780 QQVELYRLLS RNTYLEWEDS VLGRHIFWRR LRKALLDGKS WNPEGTVGTG CNWQEATSI 839

The human TLR2 nucleotide sequence is shown below (SEQ ID NO:3) and has the Genbank accession number NM 003264 [gi:68160956]. The coding sequence (bold) begins at nt 220 of this particular sequence (the first codon is shown as bold, italic, all caps ATG) and runs through nt 2574 (including the stop codon TAG which is also bolded, italicized and all caps). The TLR2 coding sequence and amino acid sequence may also be found under Genbank Accession No.DQ894005 which describes a synthetic construct (clone IMAGE:5213439; FLH166452.01L; RZPDo839H0185D Toll-like receptor 2 gene).

i cggaggcagc gagaaagcgc agccaggcgg ctgctcggcg ttctctcagg tgactgctcg

61 gagttctccc agtgtttggt gttgcaagca ggatccaaag gagacctata gtgactccca

121 ggagctctta gtgaccaagt gaaggtacct gtggggctca ttgtgcccat tgctctttca

181 ctgctttcaa ctggtagttg tgggttgaag cactggacaA TGccacatac tttgtggatg

241 gtgtgggtct tgggggtcat catcagcctc tccaaggaag aatcctccaa tcaggcttct

301 ctgtcttgtg accgcaatgg tatctgcaag ggcagctcag gatctttaaa ctccattccc

361 tcagggctca cagaagctgt aaaaagcctt gacctgtcca acaacaggat cacctacatt

421 agcaacagtg acctacagag gtgtgtgaac ctccaggctc tggtgctgac atccaatgga

481 attaacacaa tagaggaaga ttctttttct tccctgggca gtcttgaaca tttagactta

541 tcctataatt acttatctaa tttatcgtct tcctggttca agcccctttc ttctttaaca

601 ttcttaaact tactgggaaa tccttacaaa accctagggg aaacatctct tttttctcat

661 ctcacaaaat tgcaaatcct gagagtggga aatatggaca ccttcactaa gattcaaaga

721 aaagattttg ctggacttac cttccttgag gaacttgaga ttgatgcttc agatctacag

781 agctatgagc caaaaagttt gaagtcaatt cagaatgtaa gtcatctgat ccttcatatg

841 aagcagcata ttttactgct ggagattttt gtagatgtta caagttccgt ggaatgtttg

901 gaactgcgag atactgattt ggacactttc catttttcag aactatccac tggtgaaaca

961 aattcattga ttaaaaagtt tacatttaga aatgtgaaaa tcaccgatga aagtttgttt

1021 caggttatga aacttttgaa tcagatttct ggattgttag aattagagtt tgatgactgt

1081 acccttaatg gagttggtaa ttttagagca tctgataatg acagagttat agatccaggt

1141 aaagtggaaa cgttaacaat ccggaggctg catattccaa ggttttactt attttatgat

1201 ctgagcactt tatattcact tacagaaaga gttaaaagaa tcacagtaga aaacagtaaa

1261 gtttttctgg ttccttgttt actttcacaa catttaaaat cattagaata cttggatctc

1321 agtgaaaatt tgatggttga agaatacttg aaaaattcag cctgtgagga tgcctggccc

1381 tctctacaaa ctttaatttt aaggcaaaat catttggcat cattggaaaa aaccggagag

1441 actttgctca ctctgaaaaa cttgactaac attgatatca gtaagaatag ttttcattct

1501 atgcctgaaa cttgtcagtg gccagaaaag atgaaatatt tgaacttatc cagcacacga

1561 atacacagtg taacaggctg cattcccaag acactggaaa ttttagatgt tagcaacaac

1621 aatctcaatt tattttcttt gaatttgccg caactcaaag aactttatat ttccagaaat 1681 aagttgatga ctctaccaga tgcctccctc ttacccatgt tactagtatt gaaaatcagt 1741 aggaatgcaa taactacgtt ttctaaggag caacttgact catttcacac actgaagact 1801 ttggaagctg gtggcaataa cttcatttgc tcctgtgaat tcctctcctt cactcaggag 1861 cagcaagcac tggccaaagt cttgattgat tggccagcaa attacctgtg tgactctcca 1921 tcccatgtgc gtggccagca ggttcaggat gtccgcctct cggtgtcgga atgtcacagg 1981 acagcactgg tgtctggcat gtgctgtgct ctgttcctgc tgatcctgct cacgggggtc 2041 ctgtgccacc gtttccatgg cctgtggtat atgaaaatga tgtgggcctg gctccaggcc 2101 aaaaggaagc ccaggaaagc tcccagcagg aacatctgct atgatgcatt tgtttcttac 2161 agtgagcggg atgcctactg ggtggagaac cttatggtcc aggagctgga gaacttcaat 2221 ccccccttca agttgtgtct tcataagcgg gacttcattc ctggcaagtg gatcattgac 2281 aatatcattg actccattga aaagagccac aaaactgtct ttgtgctttc tgaaaacttt 2341 gtgaagagtg agtggtgcaa gtatgaactg gacttctccc atttccgtct ttttgatgag 2401 aacaatgatg ctgccattct cattcttctg gagcccattg agaaaaaagc cattccccag 2461 cgcttctgca agctgcggaa gataatgaac accaagacct acctggagtg gcccatggac 2521 gaggctcagc gggaaggatt ttgggtaaat ctgagagctg cgataaagtc cTAGgttccc 2581 atatttaaga ccagtctttg tctagttggg atctttatgt cactagttat agttaagttc 2641 attcagacat aattatataa aaactacgtg gatgtaccgt catttgagga cttgcttact 2701 aaaactacaa aacttcaaat tttgtctggg gtgctgtttt ataaacatat gccagattta 2761 aaaattggtt tttggttttt cttttttcta tgagataacc atgatcataa gtctattact 2821 gatatctgaa tatagtccct tggtatccaa gggaattggt tgcaggatcc tcgtggatat 2881 caaaattcat agatgatcaa gtcccttata agagtggcat agtatttgca tataacctgt 2941 gtacattctc ctgtatactt taaatcatct ctagattact tatgataccc aatacaatgt 3001 aaatactatg taaatagttg tactgtcttt ttatttatat tattattgtt attttttatt 3061 ttcaaaattt ttaaaacata cttttgatcc acagttggtt gacttcatgg atgcagaacc 3121 catggatata gagggccaac tgtaatctgt agcaactggc ttagttcatt aggaaacagc 3181 acaaatgaac ttaagattct caatgactgt gtcattcttt cttcctgcta agagactcct 3241 ctgtggccac aaaaggcatt ctctgtccta cctagctgtc acttctctgt gcagctgatc 3301 tcaagagcaa caaggcaaag tatttggggc actccccaaa acttgttgct attcctagaa 3361 aaaagtgctg tgtatttcct attaaacttt acaggatgag aaaaaaaaaa aaaaaaa

The amino acid sequence of the human TLR2 protein (784 residues) is shown below and is SEQ ID NO:4 (from Genbank NM 003264).

MPHTLWMVWV LGVIISLSKE ESSNQASLSC DRNGICKGSS GSLNSIPSGL TEAVKSLDLS 60

NNRITYISNS DLQRCVNLQA LVLTSNGINT IEEDSFSSLG SLEHLDLSYN YLSNLSSSWF 120

KPLSSLTFLN LLGNPYKTLG ETSLFSHLTK LQILRVGNMD TFTKIQRKDF AGLTFLEELE 180

IDASDLQSYE PKSLKSIQNV SHLILHMKQH ILLLEIFVDV TSSVECLELR DTDLDTFHFS 240

ELSTGETNSL IKKFTFRNVK ITDESLFQVM KLLNQISGLL ELEFDDCTLN GVGNFRASDN 300

DRVIDPGKVE TLTIRRLHIP RFYLFYDLST LYSLTERVKR ITVENSKVFL VPCLLSQHLK 360

SLEYLDLSEN LMVEEYLKNS ACEDAWPSLQ TLILRQNHLA SLEKTGETLL TLKNLTNIDI 420

SKNSFHSMPE TCQWPEKMKY LNLSSTRIHS VTGCIPKTLE ILDVSNNNLN LFSLNLPQLK 480

ELYISRNKLM TLPDASLLPM LLVLKISRNA ITTFSKEQLD SFHTLKTLEA GGNNFICSCE 540

FLSFTQEQQA LAKVLIDWPA NYLCDSPSHV RGQQVQDVRL SVSECHRTAL VSGMCCALFL 600

LILLTGVLCH RFHGLWYMKM MWAWLQAKRK PRKAPSRNIC YDAFVSYSER DAYWVENLMV 660

QELENFNPPF KLCLHKRDFI PGKWIIDNII DSIEKSHKTV FVLSENFVKS EWCKYELDFS 720

HFRLFDENND AAILILLEPI EKKAIPQRFC KLRKIMNTKT YLEWPMDEAQ REGFWVNLRA 780

AIKS 784

The coding nucleotide sequences of TLR4 and TLR2 without any flanking nt's and without the stop codon appear below as SEQ ID NO:5 and SEQ ID NO:6, respectively, arranged in triplets.

SEQ ID NO: 5 (human TLR4 coding sequence) ATG atg tct gcc teg cgc ctg get ggg act ctg ate cca gcc atg gcc 48 ttc etc tec tgc gtg aga cca gaa age tgg gag ccc tgc gtg gag gtg 96 gtt cct aat att act tat caa tgc atg gag ctg aat ttc tac aaa ate 144 ccc gac aac etc ccc ttc tea ace aag aac ctg gac ctg age ttt aat 192 ccc ctg agg cat tta ggc age tat age ttc ttc agt ttc cca gaa ctg 240 cag gtg ctg gat tta tec agg tgt gaa ate cag aca att gaa gat ggg 288 gca tat cag age eta age cac etc tct ace tta ata ttg aca gga aac 336 ccc ate cag agt tta gcc ctg gga gcc ttt tct gga eta tea agt tta 384 cag aag ctg gtg get gtg gag aca aat eta gca tct eta gag aac ttc 432 ccc att gga cat etc aaa act ttg aaa gaa ctt aat gtg get cac aat 480 ctt ate caa tct ttc aaa tta cct gag tat ttt tct aat ctg ace aat 528 eta gag cac ttg gac ctt tec age aac aag att caa agt att tat tgc 576 aca gac ttg egg gtt eta cat caa atg ccc eta etc aat etc tct tta 624 gac ctg tec ctg aac cct atg aac ttt ate caa cca ggt gca ttt aaa 672 gaa att agg ctt cat aag ctg act tta aga aat aat ttt gat agt tta 720 aat gta atg aaa act tgt att caa ggt ctg get ggt tta gaa gtc cat 768 cgt ttg gtt ctg gga gaa ttt aga aat gaa gga aac ttg gaa aag ttt 816 gac aaa tct get eta gag ggc ctg tgc aat ttg ace att gaa gaa ttc 864 cga tta gca tac tta gac tac tac etc gat gat att att gac tta ttt 912 aat tgt ttg aca aat gtt tct tea ttt tec ctg gtg agt gtg act att 960 gaa agg gta aaa gac ttt tct tat aat ttc gga tgg caa cat tta gaa 1008 tta gtt aac tgt aaa ttt gga cag ttt ccc aca ttg aaa etc aaa tct 1056 etc aaa agg ctt act ttc act tec aac aaa ggt ggg aat get ttt tea 1104 gaa gtt gat eta cca age ctt gag ttt eta gat etc agt aga aat ggc 1152 ttg agt ttc aaa ggt tgc tgt tct caa agt gat ttt ggg aca ace age 1200 eta aag tat tta gat ctg age ttc aat ggt gtt att ace atg agt tea 1248 aac ttc ttg ggc tta gaa caa eta gaa cat ctg gat ttc cag cat tec 1296 aat ttg aaa caa atg agt gag ttt tea gta ttc eta tea etc aga aac 1344 etc att tac ctt gac att tct cat act cac ace aga gtt get ttc aat 1392 ggc ate ttc aat ggc ttg tec agt etc gaa gtc ttg aaa atg get ggc 1440 aat tct ttc cag gaa aac ttc ctt cca gat ate ttc aca gag ctg aga 1488 aac ttg ace ttc ctg gac etc tct cag tgt caa ctg gag cag ttg tct 1536 cca aca gca ttt aac tea etc tec agt ctt cag gta eta aat atg age 1584 cac aac aac ttc ttt tea ttg gat acg ttt cct tat aag tgt ctg aac 1632 tec etc cag gtt ctt gat tac agt etc aat cac ata atg act tec aaa 1680 aaa cag gaa eta cag cat ttt cca agt agt eta get ttc tta aat ctt 1728 act cag aat gac ttt get tgt act tgt gaa cac cag agt ttc ctg caa 1776 tgg ate aag gac cag agg cag etc ttg gtg gaa gtt gaa cga atg gaa 1824 tgt gca aca cct tea gat aag cag ggc atg cct gtg ctg agt ttg aat 1872 ate ace tgt cag atg aat aag ace ate att ggt gtg teg gtc etc agt 1920 gtg ctt gta gta tct gtt gta gca gtt ctg gtc tat aag ttc tat ttt 1968 cac ctg atg ctt ctt get ggc tgc ata aag tat ggt aga ggt gaa aac 2016 ate tat gat gcc ttt gtt ate tac tea age cag gat gag gac tgg gta 2064 agg aat gag eta gta aag aat tta gaa gaa ggg gtg cct cca ttt cag 2112 etc tgc ctt cac tac aga gac ttt att ccc ggt gtg gcc att get gcc 2160 aac ate ate cat gaa ggt ttc cat aaa age cga aag gtg att gtt gtg 2208 gtg tec cag cac ttc ate cag age cgc tgg tgt ate ttt gaa tat gag 2256 att get cag ace tgg cag ttt ctg age agt cgt get ggt ate ate ttc 2304 att gtc ctg cag aag gtg gag aag ace ctg etc agg cag cag gtg gag 2352 ctg tac cgc ctt etc age agg aac act tac ctg gag tgg gag gac agt 2400 gtc ctg ggg egg cac ate ttc tgg aga cga etc aga aaa gcc ctg ctg 2448 gat ggt aaa tea tgg aat cca gaa gga aca gtg ggt aca gga tgc aat 2496 tgg cag gaa gca aca tct ate 2517 SEQ ID NO: 6 (human TLR2 coding sequence)

ATG cca cat act ttg tgg atg gtg tgg gtc ttg ggg gtc ate ate age 48 etc tec aag gaa gaa tec tec aat cag get tct ctg tct tgt gac cgc 96 aat ggt ate tgc aag ggc age tea gga tct tta aac tec att ccc tea 144 ggg etc aca gaa get gta aaa age ctt gac ctg tec aac aac agg ate 192 ace tac att age aac agt gac eta cag agg tgt gtg aac etc cag get 240 ctg gtg ctg aca tec aat gga att aac aca ata gag gaa gat tct ttt 288 tct tec ctg ggc agt ctt gaa cat tta gac tta tec tat aat tac tta 336 tct aat tta teg tct tec tgg ttc aag ccc ctt tct tct tta aca ttc 384 tta aac tta ctg gga aat cct tac aaa ace eta ggg gaa aca tct ctt 432 ttt tct cat etc aca aaa ttg caa ate ctg aga gtg gga aat atg gac 480 ace ttc act aag att caa aga aaa gat ttt get gga ctt ace ttc ctt 528 gag gaa ctt gag att gat get tea gat eta cag age tat gag cca aaa 576 agt ttg aag tea att cag aat gta agt cat ctg ate ctt cat atg aag 624 cag cat att tta ctg ctg gag att ttt gta gat gtt aca agt tec gtg 672 gaa tgt ttg gaa ctg cga gat act gat ttg gac act ttc cat ttt tea 720 gaa eta tec act ggt gaa aca aat tea ttg att aaa aag ttt aca ttt 768 aga aat gtg aaa ate ace gat gaa agt ttg ttt cag gtt atg aaa ctt 816 ttg aat cag att tct gga ttg tta gaa tta gag ttt gat gac tgt ace 864 ctt aat gga gtt ggt aat ttt aga gca tct gat aat gac aga gtt ata 912 gat cca ggt aaa gtg gaa acg tta aca ate egg agg ctg cat att cca 960 agg ttt tac tta ttt tat gat ctg age act tta tat tea ctt aca gaa 1008 aga gtt aaa aga ate aca gta gaa aac agt aaa gtt ttt ctg gtt cct 1056 tgt tta ctt tea caa cat tta aaa tea tta gaa tac ttg gat etc agt 1104 gaa aat ttg atg gtt gaa gaa tac ttg aaa aat tea gee tgt gag gat 1152 gee tgg ccc tct eta caa act tta att tta agg caa aat cat ttg gca 1200 tea ttg gaa aaa ace gga gag act ttg etc act ctg aaa aac ttg act 1248 aac att gat ate agt aag aat agt ttt cat tct atg cct gaa act tgt 1296 cag tgg cca gaa aag atg aaa tat ttg aac tta tec age aca cga ata 1344 cac agt gta aca ggc tgc att ccc aag aca ctg gaa att tta gat gtt 1392 age aac aac aat etc aat tta ttt tct ttg aat ttg ccg caa etc aaa 1440 gaa ctt tat att tec aga aat aag ttg atg act eta cca gat gcc tec 1488 etc tta ccc atg tta eta gta ttg aaa ate agt agg aat gca ata act 1536 acg ttt tct aag gag caa ctt gac tea ttt cac aca ctg aag act ttg 1584 gaa get ggt ggc aat aac ttc att tgc tec tgt gaa ttc etc tec ttc 1632 act cag gag cag caa gca ctg gcc aaa gtc ttg att gat tgg cca gca 1680 aat tac ctg tgt gac tct cca tec cat gtg cgt ggc cag cag gtt cag 1728 gat gtc cgc etc teg gtg teg gaa tgt cac agg aca gca ctg gtg tct 1776 ggc atg tgc tgt get ctg ttc ctg ctg ate ctg etc acg ggg gtc ctg 1824 tgc cac cgt ttc cat ggc ctg tgg tat atg aaa atg atg tgg gcc tgg 1872 etc cag gcc aaa agg aag ccc agg aaa get ccc age agg aac ate tgc 1920 tat gat gca ttt gtt tct tac agt gag egg gat gcc tac tgg gtg gag 1968 aac ctt atg gtc cag gag ctg gag aac ttc aat ccc ccc ttc aag ttg 2016 tgt ctt cat aag egg gac ttc att cct ggc aag tgg ate att gac aat 2064 ate att gac tec att gaa aag age cac aaa act gtc ttt gtg ctt tct 2112 gaa aac ttt gtg aag agt gag tgg tgc aag tat gaa ctg gac ttc tec 2160 cat ttc cgt ctt ttt gat gag aac aat gat get gcc att etc att ctt 2208 ctg gag ccc att gag aaa aaa gcc att ccc cag cgc ttc tgc aag ctg 2256 egg aag ata atg aac ace aag ace tac ctg gag tgg ccc atg gac gag 2304 get cag egg gaa gga ttt tgg gta aat ctg aga get gcg ata aag tec 2352 siRNAs siRNAs suppress gene expression through a highly regulated enzyme- mediated process called RNA interference (RNAi) (Sharp, PA (2001); Bernstein, E et al. (2001); Nykanen, A et al. (2001); Elbashir, SM et al. (200Ib)). RNAi involves multiple RNA-protein interactions characterized by four major steps: assembly of siRNA with the

RNA-induced silencing complex (RISC), activation of the RISC, target recognition and target cleavage. These interactions may bias strand selection during siRNA-RISC assembly and activation, and contribute to the overall efficiency of RNAi (Khvorova, A et al. (2003); Schwarz, DS et al. (2003)). Two publications that describe preferred approaches and algorithms for selecting siRNA sequences are: Far, RK et al. (2003), and Reynolds, A et al. (2004). Far et al. suggests options for assessing target accessibility for siRNA and supports the design of active siRNA constructs. This approach can be automated, adapted to high throughput and is open to include additional parameters relevant to the biological activity of siRNA. To identify siRNA- specific features likely to contribute to efficient processing at each of the steps pf RNAi noted above, Reynolds; A et al. (2004) performed a systematic analysis of 180 siRNAs targeting the mRNA of two genes. Eight characteristics associated with siRNA functionality were identified: low G/C content, a bias towards low internal stability at the sense strand 3 '-terminus, lack of inverted repeats, and sense strand base preferences (positions 3, 10, 13 and 19). Application of an algorithm incorporating all eight criteria significantly improves potent siRNA selection. This highlights the utility of rational design for selecting potent siRNAs that facilitate functional gene knockdown.

Candidate siRNA sequences against TLR4, preferably human TLR4, are selected using a process that involves running a BLAST search against the sequence of TLR4, and selecting sequences that "survive" to ensure that these sequences will not be cross matched with any other genes. siRNA sequences selected according to such a process and algorithm may be cloned into an expression plasmid and tested for their activity in abrogating TLR4 function in TLR4-expressing cells of the appropriate animal species. Those sequences that show RNAi activity are preferably recloned into a viral vector. A variety of viral vectors for transducing siRNA or short hairpin RNA (shRNA) that is processed intracellularly into siRNA are useful in the present invention (e.g., Miyagishi M et al. (2002a)). Examples of viral vectors for use in the present invention are: lentiviruses (Qin XF et al. (2003); Scherr M et al. (2003)) such as retroviruses (Devroe, E (2004)); HCV subgenomic replicon (Wilson JA et al. (2003)); Sindbis viral vectors (Tseng JC et al. (2004)); and others discussed below.

Examples of promoters that drive the expression of the sequences encoding the siNA include Pol III promoter, the small nuclear RNA U6 (e.g., tetracycline controlled), or the human RNase P RNA HI promoter and may be selected according to type of siRNA (e.g., tandem-type vs. stem type) (Miyagishi, M et al. (2002a)).

I. Verma's group (e.g., Tiscornia, G et al. (2004)) described a lentiviral- mediated siRNA delivery system that can be induced by CRE recombinase. The system consists of a lentiviral vector carrying a mouse U6 promoter that is separated from a small hairpin RNA by a random DNA stuffer sequence flanked by modified loxP sites. The silencing cassette is not expressed until activated by addition of CRE recombinase delivered by a lentiviral vector. This system was used to show specific down-regulation of an exogenous gene (GFP) and two endogenous genes (the tumor suppressor p53 and the NF -KB transcription factor subunit p65), the latter two of which had the expected effect on downstream genes and cellular phenotype. Such a system is applicable both in vitro and in vzVo to down-regulate specific targets in a tissue-specific and localized manner. Delivery of siRNA using self-complementary recombinant adeno-associated virus vectors are effective agents for efficient delivery of therapeutic siRNA (Xu, D et al. (2005)).

An especially preferred viral vector is replication-defective human adenovirus. See, for example, (Shen, C et al. (2003). Arts, GJ et al. (2003) describe the validation of adenoviral vectors that express hairpin RNAs that are further processed to siRNAs. A preferred adenovirus is serotype 5 (Ad5) (Shinomiya, N et al. (2004); Int'l Patent Publication WO05/095622). Bantounas, I et al. (2005) describe adenoviral hammerhead ribozyme and small hairpin RNA (shRNA) cassettes in neurons (primary hippocampal neurons). shRNAs were more effective gene-silencing agents than ribozymes . Anticancer activity of an adenoviral vector expressing siRNA have been described by Sabbioni, S et al. (2007). One reason for selection of this viral vector the high titer obtainable (in the range of 1010) and therefore the high multiplicities-of infection that can be attained. For example, infection with 100 infectious units/ cell ensures all cells are infected. Another advantage of this virus is the high susceptibility and infectivity and the host range (with respect to cell types). Even if expression is transient, cells can go through multiple replication cycles before TLR4 activity is recovered. Moreover, it is expected that some tumors will undergo apoptosis in response to expression of the present siRNAs, so that even transient expression will be adequate to kill the cells.

RNA interference to treat for neurological disorders using various vectors as a way to penetrate the blood-brain barrier is described by Federici, T et al. (2007). Such approaches are described as useful in the treatment of a variety of disorders including dominant genetic diseases, neurodegenerative diseases, malignant brain tumors, pain, and viral-induced encephalopathies.

In a most preferred embodiment, the inhibitory molecule is a double stranded nucleic acid (preferably an RNA), used in a method of RNA interference. RNA interference is the sequence-specific degradation of homologues in an mRNA of a targeting sequence in an siNA. As used herein, the term siNA (small, or short, interfering nucleic acid) is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi (RNA interference), for example short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically-modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), translational silencing and others.

Long double stranded interfering RNAs, such a miRNAs, appear to tolerate mismatches more readily than do short double stranded RNAs. In addition, as used herein, the term RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, or epigenetic silencing. For example, siNA molecules of the invention can be used to epigenetically silence genes at both the post-transcriptional level or the pre -transcriptional level. In a non-limiting example, epigenetic regulation of gene expression by siNA molecules of the invention can result from siNA mediated modification of chromatin structure and thereby alter gene expression (see, for example, Allshire, R (2002); Volpe, TA et al. (2002); Jenuwein, T (2002); and Hall, IM et al. (2002).

An siNA can be designed to target any region of the mRNA, preferably a coding sequence. An siNA is a double-stranded polynucleotide molecule comprising self- complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region has a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The siNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary. The siNA can be assembled from a single oligonucleotide, where the self-complementary sense and antisense regions of the siNA are linked by means of a nucleic acid based or non-nucleic acid-based linker(s). The siNA can be a polynucleotide with a hairpin secondary structure, having self- complementary sense and antisense regions. The siNA can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self- complementary sense and antisense regions, wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siNA molecule capable of mediating RNAi. The siNA can also comprise a single stranded polynucleotide having nucleotide sequence complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof (or can be an siNA molecule that does not require the presence within the siNA molecule of nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof), wherein the single stranded polynucleotide can further comprise a terminal phosphate group, such as a 5 '-phosphate (see for example Martinez, J et al. (2002) and Schwarz, DS et al. (2002), or 5 ',3 '-diphosphate. In certain embodiments, the siNA molecule of the invention comprises separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non-nucleotide linkers molecules as is known in the art, or are alternately non-covalently linked by ionic interactions, hydrogen bonding, Van der Waal's interactions, hydrophobic interactions, and/or stacking interactions. As used herein, siNA molecules need not be limited to those molecules containing only RNA, but further encompasses chemically-modified nucleotides and non- nucleotides. In certain embodiments, siNAs do not require the presence of nucleotides having a 2 '-hydroxy (2'-OH)-containing group for mediating RNAi and, thus, siNA molecules of the invention optionally may not include any ribonucleotide units (e.g., nucleotides having a 2'-OH group). Such siNA molecules that do not require the presence of ribonucleotides to support RNAi can, however, have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with T- OH groups.

For example, an siNA molecule can comprise ribonucleotides at least about 5, 10, 20, 30, 40, or 50% of the nucleotide positions. The modified siNA molecules of the invention can also be referred to as short interfering modified oligonucleotides "siMON." Other chemical modifications, e.g., as described by McSwiggen et al. U.S. Pat. 7,176,304, U.S. Pat. 7,022,828 WO 03/070918, and US Pub 20050020525, which are incorporated by reference in their entirety, can be applied to any siNA sequence of the invention.

Preferably a molecule mediating RNAi has a 2 nucleotide 3' overhang. If the RNAi molecule is expressed in a cell from a construct, for example from a hairpin molecule or from an inverted repeat of the desired sequence, then the endogenous cellular machinery will create the overhangs.

Considerations to be taken into account when designing an RNAi molecule include, e.g., the sequence to be targeted, secondary structure of the RNA target and binding of RNA binding proteins. Methods of optimizing siRNA sequences will be evident to those skilled in the art. Typical algorithms and methods are described in Vickers, TA et al. (2003); Yang, D et al. (2002); Kretschmer-Kazemi Far, R et al. (2003); and Reynolds, A et al. (2004).

Methods of making siRNAs are conventional. In vitro methods include processing the polyribonucleotide sequence in a cell-free system (e.g., digesting long dsRNAs with RNAse III or Dicer), transcribing recombinant double stranded DNA in vitro, and, preferably, chemical synthesis of nucleotide sequences homologous to the TLR4 sequence. See, e.g., Tuschl, T et al. (1999).

In vivo methods include

(1) transfecting DNA vectors into a cell such that a substrate is converted into siRNA in vzVo. See, for example, Kawasaki, H et al. (2003); Miyagishi, M et al. (2002b); Lee, NS et al. (2002); Brummelkamp, TR et al. (2002); McManus, MT et al. (2002a); Paddison, PJ et al. (2002a); Paddison, PJ et al. (2002b); Paul, CP et al. (2002); Sui, G et al. (2002); Yu, JY et al. (2002);

(2) expressing short hairpin RNAs from plasmid systems using RNA polymerase III (pol III) promoters. See, for example, Kawasaki, H et al. (2003); Miyagishi, M et al. (2002b);

Lee, NS et al. (2002); Brummelkamp, TR et al. (2002); McManus, MT et al. (2002a), Paddison, PJ et al. (2002a and 2002b); Paul, CP et al. (2002), Sui, G et al. (2002); and Yu, JY et al. (2002); and/or

(3) expressing short RNA from tandem promoters. See, for example, Miyagishi, M et al. (2002b); Lee, NS et al. (2002).

When synthesized in vitro, a typical μM scale RNA synthesis provides about 1 mg of siRNA, which is sufficient for about 1000 transfection experiments using a 24-well tissue culture plate format. In general, inhibition of TLR4 expression can be examined in cells in culture, for example, human glioblastoma cells of a cell line such as DBTRG (Kruse, CA et al. (1992)) or human neuroblastoma cells such as lines SK-N-SH, SH-SY5Y, SK-N- MC and IMR-32 (Odelstad, L et al. (1981). Such cell lines can differentiate in vitro (Pahlman, S et al. (1981)). Neuroblastoma cells can be of either the neuroblast-form (SH- SY5Y) or the non-neuronal form (SH-EP) which are interconvertible (Cohen, N et al. (2004). One or more siRNAs can be added to cells in culture medium, typically at about 1 ng/ml to about 10 μg siRNA/ml.

For reviews and more general description of inhibitory RNAs, see Lau, NC et al. (2003); McManus, MT et al. (2002b); and Dykxhoorn, DM et al. (2003). For further guidance regarding methods of designing and preparing siRNAs, testing them for efficacy, and using them in methods of RNA interference (both in vitro and in vivo), see, e.g., Allshire, R (2002); Volpe, TA et al. (2002); Jenuwein, T (2002); Hall, IM et al. (2002); Hutvagner, G et al. (2002); McManus, MT et al. (2002b); Reinhart, BJ et al. (2002a); Reinhart, BJ et al. (2002b); Fire, A et al. (1998); Moss, EG (2001); Brummelkamp, TR et al. (2002); Bass, BL (2001); and Elbashir, SM et al. (2001a and 2001b); US Pat. 6,506,559; US Pat App. 20030206887; and PCT publications WO99/07409, WO99/32619, WO 00/01846, WO 00/44914, WO00/44895, WO01/29058, WO01/36646, WO01/75164, WO01/92513, WO 01/29058, WO01/89304, WO01/90401, WO02/16620, and WO02/29858. Ribozymes and siNAs can take any of the forms, including modified versions, described for antisense nucleic acid molecules; and they can be introduced into cells as oligonucleotides (single or double stranded), or in an expression vector.

In a preferred embodiment, an antisense nucleic acid, siNA (e.g., siRNA) or ribozyme comprises a single stranded polynucleotide comprising a sequence that is at least about 90% (e.g., at least about 93%, 95%, 97%, 98% or 99%) identical to (i) a segment of SEQ ID NO:5 or SEQ ID NO:1 (in the case of a TLR4 siNA) , or a complement thereof or (ii) a segment of SEQ ID NO:6 or SEQ ID NO:3 (in the case of a TLR2 siNA) , or a complement thereof. As used herein, a DNA and an RNA encoded by it are said to contain the same "sequence," taking into account that the thymine bases in DNA are replaced by uracil bases in RNA.

Active variants (e.g., length variants, including fragments; and sequence variants) of the nucleic acid-based inhibitors discussed herein are included. An "active" variant is one that retains an activity of the inhibitor from which it is derived (preferably the ability to inhibit expression). It is routine to test a variant to determine for its activity using conventional procedures.

As for length variants, an antisense nucleic acid or siRNA may be of any length that is effective for inhibition of a gene of interest. Typically, an siNA or antisense nucleic acid is between about 6 and about 50 nucleotides (preferably at least about 12, 15, 20, 25, 30, 35, 40, 45 or 50 nt), and may be as long as from about 100 to about 200 nucleotides, or more. Antisense nucleic acids having about the same length as the gene or coding sequence to be inhibited may be used. When referring to length, the terms bases and base pairs (bp) are used interchangeably, and will be understood to correspond to single stranded (ss) and double stranded (ds) nucleic acids. The length of an effective siNA is generally between about 15 bp and about 30 bp in length, (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 bp), with shorter and longer sequences being acceptable. Sequences of 20 — 25 bp are preferred. Generally, siNAs are 30 bases or shorter to avoid eliciting interferon (anti-viral) response in cells. For example, an active variant of an siRNA having, for one of its strands, a nucleotide sequence of between about 15 and 30 bases (e.g., with any of the intermediate lengths given above), of SEQ ID NO: 1 or 5 (for TLR4) or SEQ ID NO: 3 or 6 for TLR2) herein can lack base pairs from either, or both, of ends of the dsRNA; or can comprise additional base pairs at either, or both, ends of the ds RNA, provided that the total of length of the siRNA is between about 15 and about 29 bp, inclusive.

One embodiment of the invention is an siRNA directed to TLR4 that "consists essentially of sequences represented by a segment of about 15 to about 30 bases (or any sequence of intermediate length) of SEQ ID NO:1, preferably of SEQ ID NO: 5, or complements of these sequence. Another embodiment of the invention is an siRNA directed to TLR2 that "consists essentially of sequences represented by a segment of about 15 to about 30 bases (or any sequence of intermediate length) of SEQ ID NO:3, preferably of SEQ ID NO:6,or complements of these sequence. The term "consists essentially of is an intermediate transitional phrase, and in this case excludes, for example, sequences that are long enough to induce a significant interferon (anti-viral type) response. An siRNA of the invention may consist essentially of between about 15 and about 30 bp in length, preferably between about 15 and 29 bp, inclusive, more preferably between about 20 and about 25 bp. As for sequence variants, it is generally preferred that an inhibitory nucleic acid, whether an siRNA, an antisense molecule, or a ribozyme (the recognition sequences), comprise a strand that is complementary (100% identical in sequence) to a sequence of a gene that it is designed to inhibit. However, 100% sequence identity is not required to practice the present invention. Thus, the invention has the advantage of being able to tolerate naturally occurring sequence variations in human TLR4 (or TLR2) that might be expected due to genetic mutation, polymorphism, or evolutionary divergence. Alternatively, the variant sequences may be artificially generated. Nucleic acid sequences with small insertions, deletions, or single point mutations relative to the target sequence can be effective inhibitors. The degree of sequence identity may be optimized by sequence comparison and alignment algorithms well-known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991, and references cited therein) and calculating the percent difference between the nucleotide sequences by, for example, the Smith- Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group). At least about 90% sequence identity is preferred (e.g., at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%), or even 100% sequence identity, between the inhibitory nucleic acid and the targeted sequence of targeted gene.

Alternatively, an active variant of an inhibitory nucleic acid of the invention is one that hybridizes to the sequence it is intended to inhibit under conditions of high stringency. For example, the duplex region of an siRNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the target gene transcript under high stringency conditions (e.g., 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 5O⁰C or 7O⁰C, hybridization for 12-16 hours), followed generally by washing.

Human TLR4-expresssing cells, and particularly NPCs, when not infected with the viral vector or other of this invention, cannot generate neurons due to the inhibition effected by the TLR4. In contrast, the same cells infected or transduced with a vector comprising the present siRNA sequences do not respond, or respond more weakly, to stimulation of TLR4 by an endogenous ligand. As noted below, although the identities of endogenous ligands for TLRs in the context of neurogenesis have yet to be fully understood, the practice of preferred embodiments of the present invention (i.e., RNAi or antisense- mediated inhibition of TLR4 expression) does not require advance knowledge of these ligands. However, it is believed that potential candidate ligands are molecules associated with the extracellular matrix (ECM) and their degradation products (Johnson, GB et al. (2003); Taylor, KR & Gallo, RL (2006)). ECM molecules are found in the neurogenic niche and play roles in the regulation of NPC proliferation and differentiation (Garcion, E et al. (2004)). TLR specificity is important since TLR2 and TLR4 have distinct and opposite effects when tested in the context of hippocampal neurogenesis (as exemplified herein), so that selective inhibition of TLR4 is a means for stimulating or promoting neurogenesis.

Delivery and expression of the siRNA compositions of the present invention will stimulate neurogenesis and is thus useful in the treatment of any disease or condition for with neurogenesis is beneficial. Such disease or condition includes acute trauma, neurodegenerative diseases and mental dysfunctions. Thus the constructs of the present invention are useful for "nucleic acid therapy" of TLR4-expressing cells of the CNS, and particularly NPCs, in vivo. Therapeutic Compositions and Methods

The preferred animal subject of the present invention is a mammal. The invention is particularly useful in the treatment of human subjects. Because of the conservation of sequence in TLRs, inhibitory nucleic acids such as siRNAs can be targeted to human sequences yet be used successfully in other mammalian (and even non-mammalian) species.

By the term "treating" is intended the administration to a subject of an effective dose of a pharmaceutical composition comprising an TLR4 siRNA or other TLR4 specific siNA, preferably in the form of a viral vector that comprises (a) an expression construct of the siRNA operatively linked to a promoter, and (b) a pharmaceutically acceptable excipient or carrier. Also included is the administration of a biologic, pharmacologic (including small organic molecule) agonist of the TLR2 receptor that stimulates the receptor and postbinding cellular activity or antagonist of the TLR4 receptor that inhibits the binding of endogenous ligands for the receptor. Preferred doses of agonists, antagonists, and nucleic acids are between about 1 ng and 100 mg/kg body weight and may be administered once or repeatedly. The composition, whether nucleic acid, viral vector or pharmacologic agent, may be administered by any acceptable route, e.g., orally or by systemic injection or infusion (preferably intravenously or intramuscularly), injected or instilled regionally, (e.g. subcutaneously, intrabronchially, intrathecally, intracerebroventricularly) or more locally (e.g., intradermally). In the case of subjects with tumors, a preferred route is direct intratumoral administration.

The invention further relates to use of the TLR4 siRNA, other TLR4-specific siNA, TLR4-specifϊc siNA expression constructs, viral vectors comprising such expression constructs, or agonistic or antagonistic pharmacological agents acting at TLR4, for the manufacture of medicaments for use in therapeutic methods as herein described.

Having now generally described the invention, the same will be more readily understood through reference to the following examples which are provided by way of illustration, and are not intended to be limiting of the present invention, unless specified. EXAMPLE I MATERIALS AND METHODS:

Animals. C57B1/6J, C57B1/10 and 129Sv/J mice were supplied by the Animal Breeding Center of the Weizmann Institute of Science. TLR2-defϊcient and MyD88- deficient inbred strains of mice were a gift from Prof. Shizuo Akira (Osaka University,

Japan). To generate these transgenic mice, heterozygous ES cell lines containing a mutant TLR2 or Myd88 disrupted alleles were microinjected into C57BL/6 blastocysts. Successful chimeric mice were backcrossed to C57BL/6 (>10 generations) to produce TLR2-defϊcient (TRL2D) or MyD88-deficient mice. TLR4-deficient (TLR4D) inbred mice on the C57BL/1 OScNJ background are homozygous for a spontaneous mutation resulting in a deletion allele Tlr41ps-del. These mice, their wild-type controls, and C57BL/10 mice were a gift of Prof. Irun Cohen (Weizmann Institute).

Mice of each deficient strain were compared throughout these studies to their relevant wild-type controls: TLR2D and MyD 88 -deficient mice were compared to C57BL/6, and TLR4D mice were compared to C57BL/10. Male mice aged 8-12 weeks were used. All were handled according to regulations of the Institutional Animal Care and Use Committee (IACUC). Detailed veterinary and pathological inspection of these mice revealed no signs of inflammation. Administration of BrdU and tissue preparation. Mice were injected i.p. with BrdU (Sigma- Aldrich; 50 mg per kg body weight), every 8 hours for 1 day. One day or a week after the injections, the mice were killed and perfused transcardially, first with PBS and then with 2.5% paraformaldehyde. Their brains were removed, postfixed overnight and equilibrated in phosphate buffered 30% sucrose. Free-floating, 30 μm thick coronal hippocampal sections were collected on a freezing microtome (Leica SM2000R) and stored at 4°C before immunohistochemistry.

Immunohistochemistry and quantification were performed basically as previously described (Ziv, Y et al. (2006)). All measurements were performed by an observer blinded to the identity of the examined tissues. A. Antibodies and reagents for immunohistochemistry. Primary antibodies included: rat antibody to BrdU (1 :200; Oxford Biotechnology), goat antibody to DCX (1 :400; Santa Cruz Biotechnology), mouse antibody to GFAP (1 :200; BD Bioscience), rabbit antibody to βlll-tubulin (1 :2000; Covance), rabbit antibody to PCNA (1 :200; Santa Cruz Biotechnology); mouse anti RIP(1 : 10,000; Chemicon), mouse anti P65-subunit of NF- KB (F-6) (1 :50; Santa Cruz); rabbit anti P50-subunit of NF-κB (1 :50; Santa Cruz). Secondary antibodies used were Cy-3- or Cy-5 -conjugated donkey anti-rat antibody, Cy-2- or Cy-3- conjugated donkey anti-goat antibody, Cy-2- or Cy-3 -conjugated donkey anti-rabbit antibody and Cy-2- conjugated donkey anti-mouse antibody (1 :200; all from Jackson ImmunoResearch).

B. Quantification. Microscopic analysis was done using Nikon E800 microscope. Proliferation was assessed by counting (bilaterally) BrdU⁺ or PCNA⁺ cells in the subgranular zone (SGZ) of the DG. Neurogenesis in the DG was evaluated by counting cells that were double-labeled with BrdU and DCX (and shown as a percentage of total BrdU⁺ cells). The number of astrocytes was assessed by counting the BrdU GFAP⁺ cells in the DG or GFAP⁺ cells in the hilus. The number of labeled cells were counted in six coronal sections (180μm apart) per mouse brain that were stained and mounted on coated slides. To estimate the total number of labeled cells per DG, the total number of cells counted in the selected coronal sections from each brain was multiplied by the "volume index" (the ratio between the volume of the DG and the total volume of the selected sections).

Mixed glial cultures: Glia cells were extracted from brains of neonatal (PO- Pl) mice. The brains were first stripped of the meninges and minced with scissors under a dissecting microscope (Zeiss, Stemi DV4, Germany) in Leibovitz-15 medium (Biological Industries, Beit Ha-Emek, Israel). After trypsinization (0.5% trypsin, 10 min, 37°C/5% CO₂), the cells were incubated with a trypsin inhibitor (Sigma) and washed in glial cell culture medium (DMEM supplemented with 10% fetal calf serum (FCS) (Sigma- Aldrich, Rehovot), 1-glutamine (1 mM), sodium pyruvate (1 mM), penicillin (100 U/ml), and streptomycin (100 mg/ml)]. Cells were cultured at 37°C in a 5% CO₂ atmosphere on and Matrigel-pre-coated 24 well culture plates in the presence of poly-D-lysine (PDL) (10 mg/ml; Sigma-Aldrich, Rehovot) for 5 days before addition of NPCs.

Neural progenitor cell culture. Adult NPCs were obtained as described (Pluchino, S et al. (2003)) either from wild-type or TLR-deficient mice and were cultured in growth medium enriched with epidermal growth factor (EGF; 20 ng/ml) and fibroblast growth factor (FGF-II; 10 ng/ml both from PeproTech). For activation assays, NPCs were cultured in differentiation medium (supplemented DMEM/F12, without FGF and EGF) and were cultured at 37°C/5% CO₂ in the presence of the synthetic TLR2 ligands, the lipopeptide, Pam3CysSK4 (P3C; EMC microcollections, Tubingen, Germany), a peptidoglycan (PG; Fluka) and ultra-purified LPS (InvivoGen). This LPS preparation activates only TLR4, in contrast to other LPS preparations, which activate both TLR2 and TLR4. The medium was supplemented with 2% fetal calf serum (FCS; Sigma- Aldrich, Rehovot), 1-glutamine (1 mM), sodium pyruvate (1 mM), penicillin (100 U/ml), and streptomycin (100 mg/ml); 9.6 mg/ml putrescine, 6.3 ng/ml progesterone, 5.2 ng/ml sodium selenide, 0.025 mg/ml insulin, 0.1 mg/ml transferrin, and 2 μg/ml heparin.

Inhibitors were added 30 min prior to the addition of the activators. The following inhibitors were used:

(a) NF-κB inhibitor: Calbiochem cat. No. 481406 (2μM))

(b) PKC inhibitor: GF109203X from LC Laboratories. (c) MyD 88 inhibitor: homodimerization inhibitory peptide from Imgenex

(d) neutralizing antibodies: rat anti-TLR4, 2 μg/ml, Santa Cruz Biotechnology; mouse anti-TLR2, 2 μg/ml; Biolegen)

The medium for proliferation assays lacked FCS, but was enriched with EGF and FGF as above Transfection with siRNA. A pool of three target- specific siRNAs was used to suppress TLR4 (a kit from Santa Cruz Biotechnology; 10 nM siRNA) and CodeBreaker™ siRNA transfection reagent (Promega). All procedures were performed in 6-well plates, using heparin- free growth medium for the first 24 h after transfection, according to the manufacturer's instructions. Silencing was confirmed by real-time PCR. Functional effects were observed when inhibition of TLR4 expression was approximately 40% and higher.

Western blot analysis. Cells (3-5 χlθ⁶ per sample) were cultured in growth medium for the indicated intervals in the presence of the activators. Neutralizing antibodies were added 30 min prior to the addition of the activators. Cells were lysed and their proteins were extracted (for NF-κB analysis, nuclear and cytoplasmic fractions were separated), quantified, run on SDS-PAGE gel, and blotted with the relevant antibodies.

Co-culturing of glia and NPCs. NPCs were cultured for 2 h with BrdU (7.8 μg/ml; Sigma) and washed. Following this procedure approximately 30% of the NPCs were labeled with BrdU. Glial cells were extracted from brains of neonatal mice, lysed, and resuspended in glial cell-culture medium. (Butovsky, O et al. (2006)). The cells were cultured at 37°C/5% CO₂ in Matrigel-precoated 24-well tissue-culture plates containing poly-D-lysine (10 mg/ml, Sigma-Aldrich) and incubated for 5 days. The NPCs were then added to the culture of glial cells and incubated for a further 3-5 days in differentiation-inducing medium (no FGF or EGF). BrdU pre-labeling enabled monitoring of the cells' further development in co-culture. The cells were fixed with 2.5% paraformaldehyde and analyzed by immunohistochemistry.

RNA purification, cDNA synthesis, and reverse-transcription PCR analysis (RT-PCR) These procedures were performed essentially as previously described (Butovsky, O et al. (2006)). Primers and detailed protocols are described below. The following primers were used for RNA purification, cDNA synthesis, and RT- PCR analysis:

Primers pairs β-actin 5' TAAAACGCAGCTCAGTAACAGTCCG SEQ ID NO: 7 5' TGGAATCCTGTGGCATCCATGAAAC SEQ ID NO: 8

TLRl ^"T^" ATGATTCTGCCTGGGTGAAG SEQ ID NO: 9 5' TCTGGATGAAGTGGGGAGAC SEQ ID NO: 10

TLR2 ^"T^" CTCCCACTTCAGGCTCTTTG SEQ ID NO: 11 5' AGGAACTGGGTGGAGAACCT SEQ ID NO: 12

TLR3 ^"T^" AGCTTTGCTGGGAACTTTCA SEQ ID NO: 13 5' GAAAGATCGAGCTGGGTGAG SEQ ID NO: 14

TLR4 ^"T^" CAGCAAAGTCCCTGATGACA SEQ ID NO:15 5' AGAGGTGGTGTAAGCCATGC SEQ ID NO: 16

TLR5 ^"T^" ATTCTCATCGTGGTGGTGGT SEQ ID NO: 17 5' GCTATGGTTCGCAACTGGAT SEQ ID NO: 18

TLR6 5' ACACAATCGGTTGCAAAACA SEQ ID NO: 19 5' GGAAAGTCAGCTTCGTCAGG SEQ ID NO:20

TLR7 ^"T^" CCACAGGCTCACCCATACTTV SEQ ID NO:21 5' CAAGGCATGTCCTAGGTGGT SEQ ID NO:22

TLR8 ^"T^" GGCACAACTCCCTTGTGATT SEQ ID NO: 23 5' CATTTGGGTGCTGTTGTTTG SEQ ID NO:24

TLR9 ^"T^" GCTTTGGCCTTTCACTCTTG SEQ ID NO: 25 5' AACTGCGCTCTGTGCCTTAT SEQ ID NO:26 RT-PCR reactions were carried out using 1 μg of cDNA, 5 nmol of each primer, and ReadyMix PCR Master Mix (ABgene, Epsom, UK) in 30-μl reactions. PCR reactions were carried out in an Eppendorf PCR system with cycles (usually 25-30) of 95°C for 30 s, 60⁰C for 1 min, 72°C for 1 min, and additional 72°C for 5 min in the end of the reaction. As an internal standard for the amount of cDNA synthesized, β-actin mRNA was used. PCR products were subjected to agarose gel analysis and visualized by ethidium bromide staining. In all cases one product was observed with each primer set, and the observed product had an amplicon size that matched the size predicted from published cDNA sequences.

Morris Water Maze (MWM) Behavioral Test. Spatial learning/memory was assessed by performance in a hippocampus-dependent visuo-spatial task using the

MWM. Mice were given four trials per day, for 4 consecutive days, to find a hidden platform located 1.5 cm below the water surface in a pool of 1.4 m diameter. Within the testing room, only distal visuo-spatial cues were available to the mice for location of the submerged platform. The escape latency, i.e., time required to find, and climb onto, the platform, was recorded for up to 60 s (acquisition stage). Each mouse was allowed to remain on the platform for 30 s, and was then manually moved by an investigator from the maze to the home cage. If the mouse did not find the platform within 120 s, it was manually placed on the platform, left there for 30 s and then returned to its home cage. The inter-trial interval was 30 s. On day 5, the platform was removed from the pool, and each mouse was tested by a "probe trial" for 60 s. On days 6-7 the platform was placed at the opposite location ("reversal stage"), and the mouse was retrained in four sessions. Results were recorded using an Etho Vision automated tracking system (Noldus Information Technology, Wageningen, The Netherlands).

Statistical analysis. A two-tailed unpaired Student's t-test or factorial ANOVA were used, followed by Fisher exact tests to evaluate statistical significance of differences.. Behavioral results were analyzed using ANOVA followed by the Scheffe test.

RESULTS

Generation of new neurons in the adult brain is mostly associated with two regions, the subventricular zone of the lateral ventricles (SVZ) and the subgranular zone of the hippocampal dentate gyrus (SGZ) (Emsley, JG et al. (2005)). TLR2 is one of the most prevalent Toll-like receptors in the central nervous system (CNS) (Kielian, T (2006); Rivest, S (2003); Bsibsi, M et al. (2002); Olson, JK & Miller, SD (2004); Nguyen, MD et al. (2002). Examination of TLR2 immunoreactivity in these two adult brain neurogenic niches revealed its expression on cells in both the SGZ (Fig. la,b) and the SVZ (Fig. lc-e). TLR2 expression was detected on cells that co-express the early neuronal marker, doublecortin (DCX) (Fig.ld,e), or glial fibrillary acid protein (GFAP) (Fig. If). TLR2 expression was also detected on myeloid cells (Fig. Ig). The finding that TLR2 is expressed in the adult neurogenic niches prompted the inventors to investigate whether it plays a role in hippocampal neurogenesis using TLR2-deficient (TLR2D) mice. Proliferating cell numbers were compared in slices obtained from the dentate gyrus of TLR2-deficient (TLR2D) mice and wild-type C57BL/6 (control) mice; Figs. Ij and k). Mice were examined 1 day, 7 days, or 28 days after the first of three injections (50 mg/kg; given every 8 hours) of the cell-proliferation marker 5-bromodeoxyuridine (BrdU). No differences were observed, suggesting that neither cell proliferation nor cell survival (the number of remaining BrdU+ cells on day 28) was affected by TLR2 deficiency (Fig. Ih).

Similar results were obtained when we injected BrdU (200 mg/kg) every 2 hours for 16 h and excised the brains immediately after the last injection (Hayes, NL & Nowakowski, RS (2002; Cameron, HA & McKay, RD (2001)) (Fig. 6).

The next study examined whether TLR2 deficiency affects differentiation of NPCs into neurons (Fig. li,j). A significantly smaller percentage of BrdU+ cells co- expressing DCX was found in TLR2D mice (52 ± 5.5%) than in wild type (71 ± 1.7%; Fig. Ii). A similar reduction in new neurons was observed by staining for the neuronal marker, β- III tubulin (βHIT) (Fig. Ii). By examining the same sections for DCX and GFAP, it was possible to estimate the relative proportions of these two cell lineages into which the newly dividing BrdU+ cells differentiated. In line with the observed decrease in differentiation of NPCs into neurons in TLR2D mice compared to controls, differentiation of these NPCs into astrocytes was increased (Fig. Ii). GFAP labeling in the brains of TLR2D mice also showed a marked increase in the hilus (Fig. Ik). The use of an additional astrocytic marker, SlOOβ, confirmed the increase in differentiation of BrdU+ cells into astrocytes (4.3 ± 0.7% in wild- type compared to 13.1 ± 3.1% in TLR2D mice). Staining for NG2, an early marker of oligodendrocytes, revealed no differences between wild-type and TLR2D mice (Fig. Ii). These results demonstrated that TLR2 contributes to determination of the fate of adult hippocampal NPCs without affecting their self-renewal.

Adult hippocampal neurogenesis is dependent both on intrinsic (NPC-derived) and extrinsic cues (surrounding endothelial cells, astrocytes, and microglia) (Rivest, S. (2003); Song, H et al. (2002); Palmer, TD et al.(2000)). Studies were therefore done to determine whether the observed impairment of neuronal differentiation in vivo could be attributed to a deficiency of TLR2 on the NPCs or the glia. To address this, NPCs were isolated from the brains of wild-type mice. In line with the in vivo findings, TLR2 was shown to be expressed on these NPCs (Fig. 2a). Moreover, NPCs isolated from TLR2D mice did not differ from wild-type NPCs in their capacity for primary (PO; Fig. 2b) or secondary sphere formation (P15; Fig. 2c) and survival (Fig. 2d).

To distinguish the role of NPC TLR2 from that of glial TLR2 in the cell-fate decision of the NPCs, a co-culture experiment was done in which TLR2D or wild-type NPCs were co-cultured with mixed glial cells isolated from wild-type or TLR2D mice. Prior to co- cultivation, the NPCs were labeled with BrdU so that they could be distinguished from primary mixed glial cells. TLR2 deficient NPCs showed impaired neuronal differentiation but were induced to differentiate into astrocytes (Fig. 2e, f). TLR2-deficiency in glial cells had only a minor effect on NPC differentiation. NPCs derived from the TLR2-deficient mice, when grown on glia derived from either wild-type or TLR2D mice, demonstrated a marked reduction in DCX labeling (Fig. 2e) and an increase in GFAP-expressing cells (Fig. 2f). Thus, TLR2 expressed by the NPCs is directly involved in their neuronal differentiation.

Pharmacological activators of TLR2 were employed to examine how the TLR2 expressed on NPCs affect the neuronal differentiation. The two activators tested were tthe lipopeptide Pam3CysSK4 [P3C] and a peptidoglycan [PG, a cell-wall component of Gram-positive organisms]), as were TLR2 -neutralizing antibodies. Addition of the TLR2 activators to wild-type NPCs significantly enhanced their differentiation, manifest as a dose- dependent increase in the percentage of cells expressing the neuronal marker βHIT and a change in their morphology (Fig. 2g,h and Fig. 7). Differentiating cells in these cultures demonstrated a well-developed neuronal morphology, characterized by extensive branching of the newly-formed neurons (Fig. 7). In contrast, a significantly lower precentage of cells expressing βHIT was observed in NPCs from TLR2D mice; also noted was a significant decrease in the number of neurites and their length (Fig. 2g and Fig. 7). These TLR2 activators also caused a reduction in the percentage of cells expressing the astrocytic marker GFAP, but did not affect NG2 expression and did not affect NPCs derived from TLR2D. TLR2 -neutralizing antibodies diminished the effect induced by the activators (Fig. 2g). Importantly, neither activator affected self-renewal capacity of NPCs derived from wild type mice (Fig. 7).

TLR2 activation is generally mediated by an intracellular adaptor, myeloid differentiation primary response protein 88 (MyD88) (McGettrick, AF & O'Neill, LA (2004)). Inhibition of MyD88 dimerization, using a MyD 88 -inhibitory peptide, reduced the effect of the TLR2 activator on differentiation (Fig. 3a), showing that MyD88 is involved in the TLR2 effect on neuronal differentiation of NPCs

TLR2 activity usually leads to the activation of nuclear factor (NF) KB (Uematsu, S & Akira, S (2006b)). NF-κB exists in several dimeric forms, predominantly the p50/p65 heterodimer. Translocation of NF-κB to the nucleus (Zhang, G & Ghosh, S (2001)) is regulated by the phosphorylation of IKB kinase (IKK). Western blot analysis demonstrated increased IKK phosphorylation within 15 min of P3C activation (Fig. 3b) and an increase in NF -KB in the nuclear fraction of the NPCs within 30 min. TLR2 -neutralizing antibodies reduced this NF-κB translocation (Fig. 3c). Immunocytochemical analysis revealed that in nonactivated cells p50 was located within the nucleus, whereas p65 was found mostly in the cytoplasm (Fig. 3d). Within 30 min of TLR2 activation, p65 translocated to the nucleus, resulting in an increase of 3.2-fold (p<0.05, Student's t-test). The p50 subunit was not noticeably affected (Fig. 3d). Presence of a specific NF -KB inhibitor with or without the TLR2 activators resulted in markedly decreased neuronal differentiation (Fig. 3e).

Regulation of NF-κB translocation to the nucleus is commonly mediated by protein kinase C (PKC) via degradation of IκB-α (Asehnoune, K et al. (2005)). Neuronal differentiation of NPCs was monitored in the presence or absence of TLR2 activators after adding the PKCα/β inhibitor GF109203X. Inhibition of PKC, like NF-κB inhibition, significantly decreased neuronal differentiation. Thus, TLR2-induced neuronal differentiation is mediated, at least in part, by activation of PKC-dependent NF -KB (Fig. 3e). Note that inhibition of NF-κB caused a decrease in neuronal differentiation of NPC in the presence and absence of TLR2 activators (Fig. 3e), indicating that the activity of NF-κB does not depend exclusively on its TLR2 -mediated activation, and is essentia51 for NPC survival (Fig- 7). TLR4

The effect of NPC TLR2 on fate decisions of adult stem/progenitor cells prompted the inventors to address the specificity of the effects. Undifferentiated wild-type NPCs expressed mRNA encoding additional members of the TLR family (TLRl -9; Fig. 4a). Therefore another member of this family, TLR4, was examined for its involvement in neurogenesis. Like TLR2, this receptor, is widely expressed in the adult CNS. Staining with TLR4-specifϊc antibodies verified that wild-type NPCs express TLR4 (Fig. 4b).

Activation of TLR4 on wild-type NPCs by ultra-purified lipopolysaccharide (upLPS), resulted in decreased sphere formation (Fig. 4c). This effect was the opposite of that observed with TLR2 activators,.

Suppression of TLR4 expression was performed using TLR4-targeted small interfering RNA (siRNA). A dramatic increase in sphere formation was observed (Fig. 4c,d). Efficiency of suppression of TLR4 expression was verified by PCR (Fig. 8). None of these treatments affected NPC survival (Fig. 4e). In line with these findings, NPCs isolated from TLR4-deficient (TLR4D) mice showed increased primary clonal efficiency (PO; Fig. 4f). Studies using markers of all neural cell lineages demonstrated that upLPS inhibited neuronal differentiation and this was overcome by neutralizing TLR4 antibodies (Fig. 4g,h). As a corollary, suppression of TLR4 expression by siRNA enhanced neuronal differentiation (Fig. 4g,h). Taken together, these results show that TLR4 is an important player in both proliferation and in differentiation of NPCs.

TLR2 is known to act exclusively via the MyD88-dependent pathway In contrast, TLR4 can act via both MyD88-dependent and MyD88-independent pathways (Akira, S & Takeda, K (2004)). Because these pathways differ in the timing of NF-κB activation (activation via the MyD88-independent pathway is relatively delayed), the inventors examined IKK phosphorylation and NF-κB nuclear translocation in NPCs following TLR4 activation using upLPS. Increased IKK phosphorylation and translocation of NF-κB to the nuclear fraction were evident within 15 and 30 min, respectively of upLPS exposure (Fig. 4i,j). IRF-3, known to be activated via the MyD88-independent pathway (Akira, S & Takeda, K (2004)) were further examined. Phosphorylation of IRF-3 (Fig. 4k) supports the participation of MyD88-independent pathway, leading to a conclusion that both MyD88-dependent and -independent pathways are involved in NPC activation by TLR4. To determine the role of TLR4 in vivo, TLR4 expression adult in wild-type brains was first evaluated. TLR4 is expressed both in the hippocampus (Fig. 4 l~m) and in the SVZ (Fig. 4 n-o). BrdU-immunoreactivity in TLR4D mice was compared to that of their matched wild-type (C57BL/10) controls. A marked increase in NPC proliferation in the SGZ of TLR4D was observed using 8-hourly injections of BrdU (1810 ± 142 and 3010 ± 249 cells per dentate gyrus in wild-type and TLR4D mice, respectively (mean ± SEM; Fig. 5a)), and 1392 ± 34 and 2434 ± 147 cells per dentate gyrus in wild-type and TLR4D mice, respectively (means ± SEM) with the 2-hourly protocol (Fig. 8). Notably, by day 28 after BrdU injection, the differences between wild type and TLR4D mice had diminished, indicating that the survival of newly formed neurons in these TLR4D mice was lower than in controls. This finding, together with the evidence from our -vitro experiments that neither activation nor suppression of TLR4 expression affected NPC survival (Fig. 4e), led to a conclusion that survival of newly- formed cells is distinctly regulated by additional cells or other factors. Proliferation in the SVZ of the TLR4D mice was increased relative to their matched control showed, similar to observations in the animals' SGZ (Fig. 8). In TLR2D mice, NPC proliferation in the SVZ did not differ from controls (as in the SGZ) (Fig. Ih; Fig. 8).

In addition to increased proliferation (Fig. 5a) deficiency of TLR4 led to increase in neuronal differentiation (78.9 ± 1.4% of cells expressing DCX and 31.4 ± 1.6% expressing βHIT in TLR4D mice compared to 63.5 ± 1.5% and 15.3 ± 1.5%, respectively, in the wild type; Fig. 5b, c). This contrasts with TLR2 deficiency. Assessment of BrdU+ cells co-expressing markers of other cell lineages in the SGZ of these mice revealed only slight changes compared to wild type (Fig. 5b). These results indicate that higher percentages of the BrdU+ cells differentiated in TLR4D mice compared to wild-type controls. Combined Impact of Antibodies to TLR2 and TLR4

The distinctive effects of TLR2 and TLR4 on neurogenesis prompted examination of their combined effects on NPCs.

Application of a mixture of specific neutralizing antibodies against both TLR2 and TLR4 resulted in an increase in both self-renewal and neuronal differentiation of adult wild-type NPCs Fig. 8). These results suggest that TLR4 has a predominant effect over TLR2 in NPCs and that these two pathways interact; a possibility that is consistent with the reported inhibitory effects between TLRs (Spitzer, JH et al. (2002); Ekdahl, CT et al. (2003)).

The distinct effects of TLR2 and TLR4 on neurogenesis prompted examination of the combined effects of these receptors on NPCs. Application of a mixture of specific neutralizing antibodies against both TLR2 and TLR4 resulted in an increase in both self-renewal and neuronal differentiation of adult wild-type NPCs (Fig. 8). These results suggest a dominant effect of TLR4 over TLR2 in NPCs and interaction between these two pathways. The latter is consistent with the reported inhibitory effects between TLRs (Spitzer, JH et al. (2002)). Because MyD88 is involved in both TLR2 and TLR4 activation in NPCs, neurogenesis in MyD88-deficient mice was studied. Proliferation and neuronal differentiation were significantly greater in the SGZ of MyD88-deficient mice 7 days after BrdU injections (three injections given i.p. every 8 h) (Fig. 5d-f), similarly to TLR4 deficient mice. Interestingly, although TLR2 activity is MyD88-dependent, a deficiency in MyD88 mimicked TLR4 deficiency rather than TLR2 deficiency. Together with the in vitro findings, the latter results demonstrate that the TLR4 effect dominates when both TLR2 and TLR4 are inhibited, suggesting that TLR4, acting via a MyD88-dependent pathway, inhibits proliferation and neuronal differentiation; TLR2 attenuates the TLR4-inhibitory effect on differentiation. In the absence of MyD88 (like in similarly the absence of TLR4) there is no negative regulation of proliferation and differentiation levels. Behavioral Impact of TLR2 Deficiency

The specific function of newly formed adult neurons and their ability to integrate into a pre-existing neuronal network have not yet been fully elucidated. However, it appears increasingly that hippocampal neurogenesis contributes to learning and memory (Bsibsi, M et al. (2002); Iosif, RE et al. (2006); Johnson, GB e al. (2003)). Therefore, a study was conducted to compare the spatial learning and memory of TLR2-deficient mice compared to WT controls in a hippocampus-dependent visuo-spatial learning/memory task, the Morris Water Maze (MWM). TLR2-deficient mice in which hippocampal neurogenesis was shown to be defective (see above), manifested significant impairment in the acquisition and reversal phases of the spatial learning/memory task compared with their WT counterparts (Fig 10a and 10b). No differences were observed between these groups in the extinction phase. It was concluded that that TLR2 plays an important role in cognitive abilities that are believed to depend upon this receptor's effects on adult hippocampal neurogenesis. Summary and Discussion of Examples

The present inventors have identified a novel family of pattern-recognition receptors, Toll-like receptors, as players in hippocampal neurogenesis. TLRs were found here to be expressed on NPCs and were identified as players in neural stem cell self-renewal and fate determination. While, TLR2 affected mostly cell-fate decision of the adult neural stem cells, TLR4 affected both proliferation and differentiation of the NPCs.

In the neurogenic niches of adult brain, TLRs are expressed on other cell types, such as immune cells and astrocytes which can also contribute to neurogenesis (Song, H et al (2002); Ziv, Y et al. (2006); Monje, ML et al. (2003); Ekdahl, CT et al. (2003); and Josif, RE et al. (2006)). The relative contributions of the TLR-expressing cells might differ under physiological and pathological conditions, consistent with recent reports that hippocampal neurogenesis is affected by immune activity. Some endogenous ligands of TLRs are listed hereinabove and others have not yet been identified. However, studies of immune cells suggest that these receptors can respond rapidly to alterations in their immediate microenvironment by recognizing matrix components and their degradation products (Johnson, GB et al. (2003)). The finding that the two TLRs analyzed here, TLR2 and TLR4, showed distinctive and opposite effects on hippocampal neurogenesis argues in favor of TLR specificity, and emphasizes the involvement of this diverse receptor family in the regulation of hippocampal neurogenesis via recognition of a wide range of common patterns to which the cells are exposed in vivo as they regenerated, grow, develop, mature.

EXAMPLE II

MATERIALS AND METHODS:

Animals. TLR4-defϊceint mice (TLR4D) (C57BL/1 OScNJ; The Jackson Laboratory) and their wild-type C57BL/10 counterparts (a generous gift of Prof. Irun Cohen, The Weizmann Institute), MyD88-deficient mice (a generous gift of Prof. Shizuo Akira, Research Institute for Microbial Diseases, Osaka University, Osaka, Japan), TICAMl- deficient (C57BL/6J-AW046014Lps2/J, The Jackson Laboratory) and wild-type C57BL/6 mice (supplied by the Animal Breeding Center of The Weizmann Institute of Science) were maintained at the Weizmann Institute Animal Facility. All animals were handled according to the regulations formulated by the Institutional Animal Care and Use Committee (IACUC).

Administration of BrdU. Animals were given intraperitoneal injections of 0.125 mg/gram body weight BrdU (Sigma Aldrich). For proliferation assays, mice were killed 6 hours following injection, and their eyes were removed and prepared for histology as described below. For differentiation assays, injected mice were maintained for 7 days and then killed.

Growth factor administration. TLR4D and C57BL/10 PN15 mice were anesthetized and growth factors (20ng/μl FGF-2, lμg/μl insulin) together with BrdU (lμg/μl) were delivered into left eyes by intravitreal injection using a glass micropipette attached to a lOμl Hamilton syringe (total volume lμl/eye). Mice were injected on four consecutive days and killed 24 hours after the last injection. Eyes were removed and prepared for histology, as described below. Immunohistochemistry. Mice were anesthetized and killed at different postnatal time points; their eyes were removed and prepared for histology. The eyes were placed in 2.5% paraformaldehyde (PFA) for 48 hours at room temperature (RT) and then moved to 70% EtOH, also at RT. The tissue was dehydrated in a gradient of 70%, 95%, 100% EtOH, xylene and paraffin. The tissues were then embedded in paraffin, cut into 6-μm sections, and then deparaffϊnized in xylene, 100%, 95%, 70%, 50% EtOH and PBS, for 15 min each. Treatment to enhance antigen exposure included incubation in 10 mM sodium citrate (pH=6.0) for TLR4, nestin, Pax6, CKl 8, CK AE1/AE3, CD34, cleaved Caspase3, Ki67 and BrdU, or with 0.1M TRIS (pH=9.0) for βlll-tubulin and ChxlO while heating in a microwave oven to the boiling point, and then for a further 10 min at 20% microwave power. To enhance exposure of the antigenic sites on BrdU, slides were incubated in 2M HCl at 37°C for 30 minutes. To elevate pH and ensure successful staining of additional markers, HCl treatment was followed by a 10 minute incubation of slides in 0.1 M Borate buffer (pH=8.5). The slides were washed and then blocked for 60 minutes. When staining included nestin, RIP, CKl 8 and CK AE1/AE3 blocking was performed using the MOM kit (Vector Laboratories, Peterborough, UK); in all other cases, blocking was performed with 20% horse serum, 0.2% Triton X-100 (Sigma-Aldrich) in PBS. Antibody binding was allowed to proceed for 24 h at room temperature, followed by an additional 48 h at 4⁰C. Slides were stained with the following antibodies: rabbit anti TLR4 (1 :50; Abeam), rat anti CD34 (1 : 100; Cedarlane), mouse anti cytokeratinl8 (1 :100; Abeam), mouse anti cytokeratin AE1/AE3 (1 :75; Zymed), rabbit anti GFAP (1 :100; Dako), rabbit anti SlOOβ (1 :1000; Swant), rabbit anti NG-2 (1 :100; Chemicon), mouse anti RIP (1 :10,000; Chemicon), rabbit anti cleaved- caspase3 (1 :50; Cell signaling), sheep anti ChxlO (1 :200; Abeam), rat anti BrdU (1 :100; AbD Serotec), mouse anti nestin (1 :100; Chemicon), goat anti DCX (1 :100; Santa Cruz Biotechnology), rabbit anti Pax6 (1 :500; Chemicon), rabbit anti βlll-tubulin (1 :500; Covance) and rat anti Ki67 (1 :50; Dako). Antibody was prepared in 2% horse serum and 0.2% Triton X-100. Secondary antibodies used included: Cy2-conjugated donkey anti-rat antibody, Cy2-conjugated donkey anti-rabbit antibody, Cy3 conjugated donkey anti-mouse antibody, Cy3 -conjugated donkey anti-sheep, Cy3 -conjugated donkey anti-goat and Cy3- conjugated donkey anti-rabbit (1 :200; all from Jackson ImmunoResearch).

RNA purification, cDNA synthesis, and reverse-transcription PCR analysis. The same primers were used in the present Example II as were used in Example I (SEQ ID NOS:7-26). RNA procedures were performed as described previously (Butovsky et al., 2006); RNA was prepared by homogenation of eyes using a PRO250 homogenator in TRI reagent (Sigma Aldrich) on ice or by treating retinal progenitor cells with TRI reagent (Sigma Aldrich) on ice. RT-PCR reactions were carried out using 1 μg of cDNA, 10 pmol of each primer, and ReadyMix PCR Master Mix (ABgene) in 30-μl reactions. PCR reactions were carried out in an Eppendorf PCR system with cycles (usually 25 - 36) of 95°C for 30 s, 60⁰C for lmin, 72°C for 1 min, and 72°C for an additional 5 min at the end of the reaction. As an internal standard for the amount of cDNA synthesized, we used primers for β-actin mRNA. PCR products were subjected to agarose gel analysis and visualized by ethidium bromide staining. In all cases, a single product was observed with each primer set, and the observed product had an amplicon size that matched the size predicted from published cDNA sequences.

Retinal progenitor cell (RPC) culture. RPCs were grown, as previously described (Neeley et al., 2008), in growth medium (Neurobasal; Invitrogen-Gibco) supplemented with 2mM glutamine (Biological Industries, Israel), 100 μg/ml penicillin- streptomycin (Biological Industries, Israel), 20 ng/ml epidermal growth factor (EGF; Peprotech Rocky Hill, NJ), 20U/ml nystatin (Gibco-invitrogen), 2% B27 neural supplement (Gibco-Invitrogen) and 1% N-2 neural supplement (Gibco-invitrogen). Cultures were grown in TC flasks as suspended neurospheres, fed every 2 days, and split 1 :3 every 5-7 days.

Proliferation assays. To examine RPC proliferation, spheres were dissociated by rigorous pipetting and single cells were seeded onto round bottom 96 well plates at a density of 5000 cells/ml. Ultra pure Lipopolysacharride (upLPS; Invivogen) was added to the desired final concentration. After 3 days, proliferation was measured by XTT (TOX2; Sigma), a spectrophotometric measurement of cell viability based on mitochodrial dehydrogenase activity. Sphere diameter (n=39-62) was calculated using Image Pro software.

Differentiation assays. To examine the differentiation of RPCs in vitro, cells were seeded in 24-well plates containing glass cover slips pre-coated with Poly-D-Lysine (10mg/ml Sigma- Aldrich) and Matrigel. To induce differentiation of RPCs, cells were seeded as single cells, grown for 1 week in differentiation medium [no EGF, containing 10% foetal bovine serum (FBS; Biological Industries, Israel)]. The cells were fixed in 2.5% paraformaldehyde for 20 minutes, washed in PBS and analyzed by immunohistochemistry.

Survival assays. RPCs were plated in growth medium in 96 well plates at a density of 10⁴ cells/well. Aphidicolin (10 μg/ml; Sigma) was added to inhibit proliferation. After 3 days, survival was measured using XTT (TOX2; Sigma). RPC transfection with siRNA. Single cells were plated onto 24 well plates at a density of 15*10⁴ cells/well. Cells were transfected with 25nM of siTLR4 or siControl (Santa-Cruz) in growth medium containing 20μg/ml codebreaker (Promega), as transfection reagent, according to manufacturer's protocol. After 5 days, following sphere formation, spheres were photographed and their diameter was measured using Image Pro software.

Quantification. For microscopic analysis, a Nikon fluorescence microscope (Nikon E800) or Zeiss LSM 510 confocal laser scanning microscope was used. The number of cells in the peripheral retina and immunoreactivity in the ciliary epithelium was determined automatically with Image-Pro Plus 4.5 software (Media Cybernetics). All measurements were performed by an observer blinded as to the identity of the examined tissues.

Statistical analysis. The results were analyzed by Student's t-test or factorial ANOVA, followed by Fisher's exact test, and are expressed as means±S.E.M.

RESULTS AND DISCUSSION

TLR4 deficiency results in increased proliferation and neuronal differentiation in the post natal mammalian retina.

To assess the effect of TLR4 on RPC proliferation, retinas were analyzed from postnatal day 6 mice (PN6), the latest time point at which intense proliferation in the mammalian retina has been described (Blanks and Bok, 1977; Young, 1985). It was found by PCR that TLR4 is the dominant TLR family member expressed in the eye of 6-day-old mice (Fig. HA). In agreement with previous reports (Brito et al., 2004), immunohistochemical analysis revealed that TLR4 is expressed in the retina and the ciliary epithelium (CE) (Fig. HB), a location that has been shown to harbor a retinal progenitor population (Ahmad et al., 2000; Tropepe et al., 2000). In an attempt to identify the specific population of cells that express TLR4 in the ciliary body, we performed immunohistochemical analysis to determine expression of various molecular markers. TLR4 positive cells hardly expressed markers characteristic of endothelial (CD34; Fig. HC) or epithelial (cytokeratin 18 and AE1/AE3; Fig. HD) cells, but expressed molecular markers characteristic of RPCs such as nestin, a neural progenitor marker (Fig. HE), and ChxlO, a retinal progenitor marker (Fig. HF). To further strengthen our hypothesis that the TLR4 positive cells are proliferating RPCs, the 6- day old mice were injected with the cell-proliferation marker, 5-bromodeoxyuridine (BrdU). BrdU positive cells that co-expressed TLR4 were detected 6 hrs after BrdU injection (Fig. HG).

Next examined was whether cell proliferation in the mammalian eye is affected by the absence of TLR4. To that end, proliferation was compared between wild-type and TLR4D PN6 mice, assessed by BrdU incorporation and staining for the proliferation marker, Ki67, a nuclear protein expressed in all phases of cell cycle except the resting phase. The number of proliferating cells was higher in the TLR4D mice relative to the matched wild-type controls, both in the ciliary epithelium and the peripheral retina (Fig. llH-FigllJ). Next, double-immunohistochemical analysis confirmed that the observed increase in proliferation occurred in cells expressing the neural progenitor marker, nestin, and the retinal progenitor markers, Pax6 and ChxlO (Fig. HK- Fig. UN). These results suggest that deficiency in TLR4 enhances proliferation of cells expressing markers characteristic of retinal progenitors.

To determine the fate of the proliferating cells, 6-day old mice were injected with BrdU, killed 7 days later, and tested by immunohistochemistry for the presence of different lineage markers (the neuronal marker, βlll-tubulin; markers for astrocytes, GFAP and SlOOβ; the oligodendrocyte markers, RIP and NG2) and apoptosis (cleaved caspase3) (Fig. 12A). Quantitative analyses revealed an increased number of BrdU positive cells expressing the neuronal marker, βlll-tubulin, in the TLR4D peripheral retina compared to the wild-type (16,590±1872 versus 8,480±2687, respectively, student's t-test; *P=0.05). Since the increased number of newly formed neurons could result from increased proliferation, or in addition, from preferential differentiation into neurons, the percentage of newly formed neurons (BrdU+/βIII-tubulin+) from the total population of BrdU+ cells was determined. In the TLR4D mice, not only was greater proliferation noticed, but also increased differentiation into neuronal cells expressing βlll-tubulin (Fig. 12B, Fig. 12C). No differences were evident in the percentage of differentiation into astrocytes and oligodendrocytes, or of apoptosis assessed by cleaved caspase 3 (Fig. 12B). These results suggest that absence of TLR4 leads to enhanced proliferation and neuronal differentiation in 6-day postnatal retina.

TLR4 activation has a direct effect on RPC fate decision.

We next sought to determine whether the observed increased proliferation in vivo could be attributed to a direct effect of TLR4 on RPCs. To address this issue, we first tested whether TLRs are expressed by RPCs isolated from wild-type mice. In vitro studies revealed that undifferentiated wild-type RPCs express mRNA that encodes for members of the TLR family (TLRl -9), with pronounced expression of TLR4 (Fig. 13A). Using TLR4- specific antibodies, we verified that RPCs indeed express this receptor (Fig. 13B- Fig. 13D). To examine whether the TLR4 expressed on the RPCs affects their proliferation, we used an activator of TLR4, ultra-purified lipopolysaccharide (upLPS)(Akira and Takeda, 2004).

Reduction of sphere diameter and proliferation were observed in the presence of upLPS (Fig. 13E- Fig. 13G). Treatment with upLPS did not affect RPC viability (Fig. 13H). To further demonstrate that TLR4 expressed on RPCs has a role in their fate decision, we used TLR4- targeted small interfering RNA (siRNA). Suppression of TLR4 expression increased the sphere diameter by 19.5±3.9% (n=46-56; student's t-test; P=0.0004) (Fig. 131). Next, we examined the ability of TLR4 expressed on RPCs to direct their differentiation into neurons. Using markers of all neural cell lineages, we showed that activation of TLR4 expressed on RPCs with upLPS inhibited neuronal differentiation assessed by βlll-tubulin (βHIT) and doublecortin (DCX) (Fig. 13 J, Fig. 13K), and had no effect on differentiation to the other lineages. Taken together, these results suggest that TLR4 is an intrinsic regulator, restricting both proliferation and neuronal differentiation of RPCs.

Deficiency in the common adaptors of TLR signaling, MyD88 and TICAMl, results in increased proliferation in the post natal mammalian retina.

In the classical immune response, TLR signaling in general and TLR4 in particular, leads to the activation of the transcription factor NF-κB, which acts as a master switch, regulating the transcription of many genes (Akira and Takeda, 2004; Krishnan et al., 2007). TLR signaling, which relies on cytoplasmic adapter molecules that can associate with the intracellular region of the TLR molecule, exerts its effect via two main signaling pathways; MyD88 (myeloid differentiation primary response protein 88) dependent and MyD88-independent cascades. The former involves the activation of the intracellular adaptor MyD88, and the latter, entails the participation of another adaptor, TICAMl (TIR domain- containing adaptor protein inducing INF-β, also known as TRIF) (Akira and Takeda, 2004; Krishnan et al., 2007).

Previous studies indicated that in developing neurons, TLR activation does not activate NF-κB (Cameron et al., 2007; Ma et al., 2006), demonstrating that a different signaling pathway is induced in these cells. In contrast, TLR4 activation in adult neural progenitor cells results in the activation of both MyD88 dependent and MyD88 independent pathways (Rolls et al., 2007), similar to the pathways activated in the immune system. As proliferation of retinal progenitor cells can be considered a recapitulation of both neurogenesis and developmental processes, we wished to identify the signaling pathways used in this process. We therefore tested whether MyD88 and TICAMl participate in regulation of cell proliferation in the eye. Thus, we examined proliferation in MyD88- deficient (MyD88D) and TICAM 1-deficeint (TICAMlD) PN6 mice. We found increased numbers of BrdU+ cells in the peripheral retina and the ciliary epithelium of both MyD88 and TICAMl deficient mice, relative to wild-type (Fig. 14A- Fig. 14C). We further confirmed that the proliferating cells expressed markers characteristic of RPCs, including nestin, Pax6 and ChxlO (Fig. 14D). Our results therefore suggest that cell proliferation in the early postnatal eye is inhibited by both MyD88-dependent and independent pathways, similar to the mechanism activated by TLRs in immune cells.

Deficiency in TLR4 promotes proliferation obtained by growth factor administration.

Although adult retinal stem/progenitor cells exhibit self-renewal capacity in culture (Tropepe et al., 2000), their proliferation in the mature eye is not evident after the second postnatal week in rodents (Blanks and Bok, 1977; Young, 1985). The inhibitory role of TLR4 on cell proliferation at PN6, identified here, along with the known progressive time dependent decrease of proliferating progenitors, prompted us to test whether TLR4 determines the time period at which proliferation occurs. We therefore explored whether TLR4 levels become elevated as animals enter adulthood, and whether such an increase in

TLR4 expression might explain the limited proliferation in the adult eye. We found elevated TLR4 levels in the CE from day 12 and onwards, relative to day 6 (Fig. 15A- Fig. 15C). The observed correlation between the elevated levels of TLR4 expression and the cessation of cell proliferation, prompted us to test whether deficiency in the TLR4 receptor might enable extension of the time period in which proliferation is observed, beyond PN6. As long as proliferation was detectable in the peripheral retina, deficiency in TLR4 resulted in increased proliferation relative to wild-type (Fig. 15D, Fig. 15E). Since the absence of TLR4 had no effect on proliferation at later time points (Fig. 15E), we suggest that TLR4 signaling represents a secondary mechanism restricting proliferation of these cells in the adult eye. The absence of proliferating RPCs in the adult eye can be either attributed to the lack of proliferation promoting factors or to the presence of inhibitory molecules. The former was recently demonstrated, as growth factor administration results in in vivo proliferation of cells expressing markers characteristic of RPCs (Fischer and Reh, 2003; Zhao et al., 2005). Therefore, we tested whether TLR4 participates in restricting proliferation when growth factors are provided (Fischer and Reh, 2003; Zhao et al., 2005). We intra vitreally injected fibroblast growth factor 2 (F GF -2) and insulin, as previously described (Zhao et al, 2005), to wild-type and TLR4D mice at PN15 (Fig. 15F). Incorporation of BrdU, injected together with the growth factors, revealed, as expected (Fischer and Reh, 2003; Zhao et al., 2005), an extension of the proliferation period in the ciliary body and the adjacent peripheral retina. As in the early post natal stage, providing the eye with growth factors resulted in significantly higher proliferation in the TLR4D mice compared to the wild- type animals (Fig. 15G-15I), indicating that TLR4 had a negative impact on proliferation when conditions permissive for RPC proliferation were restored. To confirm these results and to demonstrate the effect of growth factors on cell proliferation, we analyzed retinas from both strains, with or without growth-factor treatment, for the expression of Ki67. A higher number of proliferating cells was seen in the growth- factor treated retinas relative to controls in both strains (Fig. 15J); however, the effect was far more pronounced in the TLR4D mice (4 fold increase) than in their matched controls (2.5 fold increase) (Fig. 15J). We further confirmed that the observed increased proliferation involved cells expressing markers distinguishing RPCs, such as Pax6 and ChxlO (Fig. 15K, 15L). These results suggest that under permissive conditions, TLR4 down-regulates proliferation. Importantly, deficiency in TLR4 had a more pronounced effect on proliferation in the PN 15 eyes supplied with growth factors relative to PN6 eyes (Fig. 15M). This pronounced effect is expected in light of the enhanced expression of TLR4 at PN15 relative to PN6 (Fig. 15A- Fig. 15C). Thus, our findings suggest that even though it cannot be considered the primary limiting factor of RPC proliferation in adulthood, enhanced TLR4 expression in the eye contributes to the restriction of RPC proliferation.

In this study, we identified TLR4 as a novel player in the regulation of retinal progenitor cell proliferation in the mammalian eye. We found that TLR4 inhibits proliferation of retinal cells expressing progenitor markers in the early postnatal period and contributes to their lack of proliferation in the subsequent time period. In vitro studies confirmed that TLR4 is expressed on the retinal progenitor cells, and directly affects their cell fate decision. Notably, TLR4 does not belong to any of the previously known classes of cell- cell signaling pathways employed to determine the fate of retinal progenitor cells (Yang, 2004). Interestingly, the major classes of known cell-cell signaling pathways share a common property with the TLR orthologue, as they all participate in dorsal-ventral patterning in Drosophila (Anderson et al., 1985a; Biemar et al., 2006). Moreover, since similar effects of TLR4 on neural progenitor cell proliferation are also evident in the adult dentate gyrus of the hippocampus (see Example I and Rolls et al., 2007), our results further emphasize the importance of this receptor family in neurogenic processes in general.

TLR4 is a member of a larger receptor family. Thus, our results suggest that additional members of this family may participate in retinogenesis and retinal progenitor cell fate regulation. The unique features of the TLR family, including pattern recognition rather than identification of a single specific ligand, and their ability to recognize stress-related compounds (Asea et al., 2002; Johnson et al., 2003; Ohashi et al., 2000; Quintana and Cohen, 2005) or pathogens, provide retinal progenitor cells with the capacity to rapidly respond to various deviations from homeostasis, such as acute injury. Our finding that TLR4 restricts RPC proliferation provides, at least in part, an explanation for the limited neurogenesis in response to injury (Nickerson et al., 2007), a condition which releases a variety of ligands that can ultimately be recognized by the TLR family (Johnson et al., 2003; Vabulas et al., 2002).

Documents Cited

Ahmad, L, et al., "Identification of neural progenitors in the adult mammalian eye" Biochem Biophys Res Commun. 270:517-521 (2000)

Akira S et al., "Pathogen recognition and innate immunity" Cell, 124:783-801 (2006) Akira, S & Takeda, K, "Toll-like receptor signalling" Nat Rev Immunol, 4:499-511 (2004) Allshire, R, "Molecular biology. RNAi and heterochromatin— a hushed-up affair" Science, 297:1818-1819 (2002)

Anderson, KV et al., "Establishment of dorsal-ventral polarity in the Drosophila embryo: the induction of polarity by the Toll gene product" Cell 42:791-798 (1985a)

Anderson, KV et al., "Establishment of dorsal-ventral polarity in the Drosophila embryo: genetic studies on the role of the Toll gene product" Cell, 42:779-789 (1985b)

Andrews P et al., "Stem cell differentiation" WO02/ 16620 (2002)

Arndt G and Raponi M, "Methods for mediating gene suppression by using factors that enhance RNAi" WO01/92513 (2001)

Arts, GJ et al., "Adenoviral vectors expressing siRNAs for discovery and validation of gene function" Genome Res, 13:2325-2332 (2003) Asea, A et al., "Novel signal transduction pathway utilized by extracellular HSP70: role of toll-like receptor (TLR) 2 and TLR4" J Biol Chem. 277:15028-15034 (2002)

Asehnoune, K et al., "Involvement of PKCalpha/beta in TLR4 and TLR2 dependent activation of NF-kappaB" Cell Signal, 17:385-394 (2005) Banin, E et al., "Retinal incorporation and differentiation of neural precursors derived from human embryonic stem cells. Stem Cells. 24:246-257 (2006)

Bantounas I et al., "Assessing adenoviral hammerhead ribozyme and small hairpin RNA cassettes in neurons: inhibition of endogenous caspase-3 activity and protection from apoptotic cell death" J Neurosci Res, 79:661-669 (2005) Barton, GM et al., "Retroviral delivery of small interfering RNA into primary cells" Proc NαtlAcαdSci USA, 99:14943-14945 (2002)

Bass, BL, "RNA interference. The short answer" Nature, 411 :428-429 (2001)

Behrstock, SP et al., ,,Conditionally-immortalized astrocytic cell line expresses GAD and secretes GABA under tetracycline regulation" JNeurosci Res, 60:302-310 (2000) Bernstein, E et al., "Role for a bidentate ribonuclease in the initiation step of RNA interference" Nature, 409:363-366 (2001)

Biemar, F et al., "Comprehensive identification of Drosophila dorsal- ventral patterning genes using a whole-genome tiling array" Proc Natl Acad Sd USA. 103:12763-12768 (2006) Blanks, JC and Bok D, "An autoradiographic analysis of postnatal cell proliferation in the normal and degenerative mouse retina" J Comp Neurol. 174:317-327 (1977)

Blumenthal, A. et al., "The Wingless homo log WNT5A and its receptor Frizzled-5 regulate inflammatory responses of human mononuclear cells induced by microbial stimulation" Bloo d, 108:965-973 (2006) Brito, BE et al., "Toll-like receptor 4 and CD 14 expression in human ciliary body and TLR-4 in human iris endothelial cells" Exp Eye Res. 79:203-208 (2004)

Bruel-Jungerman, E et al., "New neurons in the dentate gyrus are involved in the expression of enhanced long-term memory following environmental enrichment" Eur JNeurosci, 21 :513-521 (2005) Brummelkamp, TR et al., "A system for stable expression of short interfering RNAs in mammalian cells" Science, 296:550-553 (2002)

Bsibsi, M et al., "Broad expression of Toll-like receptors in the human central nervous system" J Neuropathol Exp Neurol, 61 :1013-1021 (2002) Butovsky, O et al., "Microglia activated by IL-4 or IFN-gamma differentially induce neurogenesis and oligodendrogenesis from adult stem/progenitor cells" MoI Cell Neurosci, 31 :149-160 (2006)

Cameron, HA & McKay, RD, "Adult neurogenesis produces a large pool of new granule cells in the dentate gyrus" JComp Neurol 435:406-417 (2001)

Cameron, JS et al., "Toll-like receptor 3 is a potent negative regulator of axonal growth in mammals" J Neurosci 27:13033-13041 (2007)

Chang, JH et al., "Toll-like receptors in ocular immunity and the immunopathogenesis of inflammatory eye disease" Br J Ophthalmol 90:103-108 (2006) Cohen N et al., "Clonal expansion and not cell interconversion is the basis for the neuroblast and nonneuronal types of the SK-N-SH neuroblastoma cell line" Cancer Genet Cytogenet, 143:80-84 (2004)

Deschamps De Paillette E, "Product comprising at least a double stranded RNA combined with at least an antiviral agent" WO99/07409 (1999) Devroe E, Silver PA, "Therapeutic potential of retroviral RNAi vectors" Expert Opin Biol Ther 4:319-327 (2004)

Dykxhoorn, DM et al. "Killing the messenger: short RNAs that silence gene expression" Nature Rev MoI Cell Bio, 4:457-467 (2003)

Ebihara, N et al. "Expression and function of toll-like receptor-3 and -9 in human corneal myofibroblasts" Invest Ophthalmol Vis Sci 48 :3069-3076 (2007)

Ekdahl, CT et al., "Inflammation is detrimental for neurogenesis in adult brain" Proc Natl Acad Sci USA, 100:13632-13637 (2003)

Elbashir, SM et al., "Duplexes of 21 -nucleotide RNAs mediate RNA interference in cultured mammalian cells" Nature, 411 :494-498 (2001a) Elbashir, SM et al., "RNA interference is mediated by 21- and 22-nucleotide RNAs" Genes Dev. 15:188-200 (2001b)

Elner, SG et al., "TLR4 mediates human retinal pigment epithelial endotoxin binding and cytokine expression" Trans Am Ophthalmol Soc. 103:126-137 (2005)

Emsley, J.G., et al., "Adult neurogenesis and repair of the adult CNS with neural progenitors, precursors, and stem cells" Prog Neurobiol 75:321-341 (2005)

Federici T et al., "Ribonucleic acid interference for neurological disorders: candidate diseases, potential targets, and current approaches". Neurosurgery 60:3-16 (2007)

Federoff H and Bowers W, "Method of producing herpes simplex virus amplicons, resulting amplicons, and their use" WOO 1/89304 (2001) Fire, A et al, "Genetic inhibition by double-stranded RNA" US Pat. 6,506,559 (2003) Fire, A et al., "Genetic inhibition by double-stranded RNA" WO99/32619 (2003)

Fire, A et al., "Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans" Nature 391 :806-811 (1998) Fischer, AJ and Reh,TA, "Growth factors induce neurogenesis in the ciliary body" Dev Biol. 259:225-240 (2003)

Fuchs, E et al., "Stress, glucocorticoids and structural plasticity of the hippocampus" Neurosci Biobehav Rev 23:295-300 (1998)

Garcion, E et al., "Generation of an environmental niche for neural stem cell development by the extracellular matrix molecule tenascin C" Development 131 :3423-3432 (2004)

Gould, E et al., "Neurogenesis in adult mammals: some progress and problems" J Neurosci 22:619-623 (2002)

Gribskov and Devereux, "Sequence Analysis Primer", Stockton Press (1991)

Halfon, MS et al., "The Drosophila toll gene functions zygotically and is necessary for proper motoneuron and muscle development" Dev Biol. 169:151-167 (1995)

Hall, IM et al., "Establishment and maintenance of a heterochromatin domain" Science 297:2232-2237 (2002)

Hargreaves, DC, Medzhitov, R, "Innate sensors of microbial infection" J Clin Immunol 25:503-510 (2005) Hayes, NL & Nowakowski, RS, "Dynamics of cell proliferation in the adult dentate gyrus of two inbred strains of mice" Brain Res Dev Brain Res 134:77-85 (2002)

Hutvagner, G et al., "A microRNA in a multiple-turnover RNAi enzyme complex" Science 297:2056-2060 (2002)

Iosif, RE et al., "Tumor necrosis factor receptor 1 is a negative regulator of progenitor proliferation in adult hippocampal neurogenesis" J Neurosci 26:9703-9712 (2006)

Janeway, CA, Jr. & Medzhitov, R, "Innate immune recognition" Annu Rev Immunol 20:197- 216 (2002)

Jenuwein, T, "Molecular biology. An RNA-guided pathway for the epigenome" Science 297:2215-2218 (2002) Johnson, GB et al., "Activation of mammalian Toll-like receptors by endogenous agonists" CritRev Immunol 23:15-44 (2003) Kawasaki, H et al, "Short hairpin type of dsRNAs that are controlled by tRNA(Val) promoter significantly induce RNAi-mediated gene silencing in the cytoplasm of human cells" Nucleic Acids Res 31 :700-707 (2003)

Kempermann, G et al., "Experience-induced neurogenesis in the senescent dentate gyrus" J Neurosci 18:3206-3212 (1998)

Kempermann, G et al., "Genetic influence on neurogenesis in the dentate gyrus of adult mice" Proc Natl Acad Sci USA, 94:10409-10414 (1997)

Kempermann, G & Gage FH, "Neurogenesis in the adult hippocampus" Novartis Found Symp 231 :220-241, 302-306 (2000) Khvorova, A et al. , "Functional siRNAs and miRNAs exhibit strand bias" Cell 115 :209-216 (2003)

Kielian, T, "Toll-like receptors in central nervous system glial inflammation and homeostasis" J Neurosci Res 83:711-730 (2006)

Kretschmer-Kazemi Far, R et al. "The activity of siRNA in mammalian cells is related to structural target accessibility: a comparison with antisense oligonucleotides" Nucleic

Acids Res. 31 :4417-4424 (2003)

Rreutzer R and Limmer S, "Method and medicament for inhibiting the expression of a defined gene" WO00/44895 (2000)

Krishnan, J et al., "Toll-like receptor signal transduction" Exp MoI Med. 39:421-438 (2007) Kruse CA et al., "Characterization of a continuous human glioma cell line DBTRG-05MG: growth kinetics, karyotype, receptor expression, and tumor suppressor gene analyses" In Vitro Cell Dev Biol. 28A:609-614 (1992)

Kumar A et al., "Toll-like receptor 3 agonist poly(I:C)-induced antiviral response in human corneal epithelial cells" Immunology. 117:11-21 (2006) Kumar, MV et al., "Innate immunity in the retina: Toll-like receptor (TLR) signaling in human retinal pigment epithelial cells" J Neuroimmunol. 153:7-15 (2004)

Lau, NC et al., "Censors of the genome" SciAmer 289:34-41 (2003)

Lee, KS et al., "Yeast strains to identify specific inhibitors of polo kinases" WOOl /90401 (2001) Lee, NS et al., "Expression of small interfering RNAs targeted against HIV-I rev transcripts in human cells" Nat Biotechnol 20:500-505 (2002)

Lehnardt, S et al., "Activation of innate immunity in the CNS triggers neurodegeneration through a Toll-like receptor 4-dependent pathway" Proc Natl Acad Sci USA 100:8514-8519 (2003) Leuner, B et al., "Is there a link between adult neurogenesis and learning?" Hippocampus 16:216-224 (2006)

Lie, DC et al., "Wnt signalling regulates adult hippocampal neurogenesis" Nature 437:1370- 1375 (2005) Li, Y et al., "Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA" WO 00/44914 (2000)

Lin, SL et al., "D-RNAi (messenger RNA-antisense DNA interference) as a novel defense system against cancer and viral infections" Curr Cancer Drug Targets 1 :241-247 (2001) Ma, Y et al., "Toll-like receptor 8 functions as a negative regulator of neurite outgrowth and inducer of neuronal apoptosis" J Cell Biol. 175:209-215 (2006)

MacLaren, RE et al., "Retinal repair by transplantation of photoreceptor precursors" Nature. 444:203-207 (2006)

Martinez, J et al. "Single-stranded antisense siRNAs guide target RNA cleavage in RNAi" Cell 110:563-74 (2002)

McCaffrey, AP et al., "RNA interference in adult mice" Nature 418:38-39 (2002)

McGettrick, AF & O'Neill, LA, "The expanding family of MyD88-like adaptors in Toll-like receptor signal transduction" MoI Immunol 41 :577-582 (2004).

McManus, MT et al., "Gene silencing in mammals by small interfering RNAs" Nature Rev Genetics 3, 737-747 (2002b)

McManus, MT et al., "Gene silencing using micro-RNA designed hairpins" RNA 8:842-850 (2002a)

Mello CC et al., "RNA interference pathway genes as tools for targeted genetic interference" WOOl /29058 (2001) Miyagishi, M et al., "Development and application of siRNA expression vector" Nuc Acids Res Suppl 2:113-114 (2002a)

Miyagishi, M et al., "U6 promoter-driven siRNAs with four uridine 3' overhangs efficiently suppress targeted gene expression in mammalian cells" Nature Biotechnol 20:497-500 (2002b) Monje, ML et al., "Inflammatory blockade restores adult hippocampal neurogenesis" Science 302:1760-1765 (2003).

Morrissey et al., "RNA interference mediated inhibition of hepatitis b virus (HBV) using short interfering nucleic acid (SINA)" US Pat App. 20030206887 (2003)

Moss, EG, "RNA interference: it's a small RNA world" Curr Biol 11 :R772-775 (2001) Neeley, WL et al., "A micro fabricated scaffold for retinal progenitor cell grafting" Biomaterials. 29:418-426 (2008)

Nguyen, MD et al., "Innate immunity: the missing link in neuroprotection and neurodegeneration?" Nαti?ev Λfewrascz 3:216-227 (2002). Nickerson, PE et al., "Proliferation and expression of progenitor and mature retinal phenotypes in the adult mammalian ciliary body after retinal ganglion cell injury" Invest Ophthalmol Vis Sci. 48:5266-5275 (2007)

Nunes et al., "Identification and isolation of multipotential neural progenitor cells from the subcortical white matter of the adult human brain" Nat Med 9:439-47 (2003) Nykanen A et al., "ATP requirements and small interfering RNA structure in the RNA interference pathway" Cell 107:309-321 (2001)

Odelstad L et al., "Neuron-specific enolase in relation to differentiation in human neuroblastoma" Brain Res. 224:69-82 (1981)

Ohashi, K et al., "Cutting edge: heat shock protein 60 is a putative endogenous ligand of the toll-like receptor-4 complex" J Immunol. 164:558-61 (2000)

Okamura, Y et al., "The extra domain A of fibronectin activates Toll-like receptor 4" J Biol Chem. 276:10229-10233 (2001)

Olson, AK et al., "Environmental enrichment and voluntary exercise massively increase neurogenesis in the adult hippocampus via dissociable pathways" Hippocampus 16:250-260 (2006)

Olson, JK & Miller, SD, "Microglia initiate central nervous system innate and adaptive immune responses through multiple TLRs" J Immunol 173:3916-3924 (2004)

Paddison, PJ et al., "RNA interference: the new somatic cell genetics?" Cancer Cell 2:17-23 (2002c) Paddison, PJ et al., "Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells" Gene Dev 16:948-958 (2002a)

Paddison, PJ et al., "Stable suppression of gene expression by RNAi in mammalian cells" Proc Natl Acad Sci USA 99:1443-1448 (2002b)

Pahlman S et al., "Phenotypic changes of human neuroblastoma cells in culture induced by 12-O-tetradecanoyl-phorbol- 13 -acetate" Int J Cancer. 28:583-589 (1981)

Palmer, TD et al., "Vascular niche for adult hippocampal neurogenesis" J Comp Neurol 425:479-494 (2000)

Paul, CP et al., "Effective expression of small interfering RNA in human cells" Nature Biotechnol 20:505-508 (2002) Pellegrini, G et al., "Towards therapeutic application of ocular stem cells" Semin Cell Dev Biol. 18:805-818 (2007)

Plaetinick G et al., "Characteristics of gene function using double stranded RNA inhibition" WO 00/01846 (2000) Pluchino, S. et al., "Injection of adult neurospheres induces recovery in a chronic model of multiple sclerosis" Nature 422:688-694 (2003)

Prickaerts, J et al., "Learning and adult neurogenesis: survival with or without proliferation?" Neurobiol Learn Mem 81 :1-11 (2004)

Qin XF et al., "Inhibiting HIV-I infection in human T cells by lentiviral-mediated delivery of small interfering RNA against CCR5" Proc Natl Acad Sci USA 100:183-188 (2003)

Quintana, FJ and Cohen IR, "Heat shock proteins as endogenous adjuvants in sterile and septic inflammation" J Immunol 175:2777-2782 (2005)

Ranade RM and Mathad GS, "Deep Trench method to reduce/eliminate formation of black silicon" WO02/29858 (2002) Reh, TAand Fischer, AJ, "Retinal stem cells" Methods Enzymol 419:52-73 (2006) Reinhart, BJ et al., "MicroRNAs in plants" Genes Dev. 16:1616-1626 (2002a)

Reinhart, BJ et al., "Small RNAs correspond to centromere heterochromatic repeats" Science 297:1831 (2002b)

Reome, J.B. et al., "The effects of prolonged administration of 5-bromodeoxyuridine on cells of the immune system" J Immunol 165:4226-4230 (2000)

Reynolds, A et al., "Rational siRNA design for RNA interference" Nature Biotechnology 22:326-330 (2004)

Rivest, S, "Molecular insights on the cerebral innate immune system" Brain Behav Immun 17:13-19 (2003). Rolls, A et al., "Toll-like receptors modulate adult hippocampal neurogenesis" Nat Cell Biol. 9:1081-1088 (2007)

Rose, D et al., "Toll, a muscle cell surface molecule, locally inhibits synaptic initiation of the RP3 motoneuron growth cone in Drosophila" Development. 124:1561-1571 (1997)

Rubinson, DA et al., "A lentivirus-based system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference" Nat Genet

33:401-406 (2003)

Sabbioni S et al., "Anticancer activity of an adenoviral vector expressing short hairpin RNA against BK virus T-ag" Cancer Gene Ther. 14:297-305 (2007) Scherr M et al., "Modulation of gene expression by lentiviral -mediated delivery of small interfering RNA" Cell Cycle 2:251-257 (2003)

Schwarz, DS et al., "Asymmetry in the assembly of the RNAi enzyme complex" Cell 115:199-208 (2003) Schwarz, DS et al., "Evidence that siRNAs function as guides, not primers, in the Drosophila and human RNAi pathways" MoI Cell 10:537-568 (2002)

Seki, T, "Microenvironmental elements supporting adult hippocampal neurogenesis" Anat Sci Int 78:69-78 (2003)

Sharp, PA, "RNA interference— 2001" Genes Dev. 15:485-490 (2001) Shen C et al., "Gene silencing by adenovirus-delivered siRNA" FEBS Lett. 539:111-114 (2003)

Shinomiya N et al., "c-met siRNA adenovirus vectors inhibit cancer cell growth, invasion and tumorigenicity" WO05/095622 (2005)

Shinomiya N et al., "RNA interference reveals that ligand-independent met activity is required for tumor cell signaling and survival" Cancer Res. 64:7962-7970 (2004)

Song, H et al., "Astroglia induce neurogenesis from adult neural stem cells" Nature 417:39- 44 (2002)

Song, PI et al., "The expression of functional LPS receptor proteins CD 14 and toll-like receptor 4 in human corneal cells" Invest Ophthalmol Vis Sci. 42:2867-7287 (2001) Spitzer, JH et al., "Toll-like receptor 1 inhibits Toll-like receptor 4 signaling in endothelial cells" Eur J Immunol 32: 1182-1187 (2002)

Sui, G et al., "A DNA vector-based RNAi technology to suppress gene expression in mammalian cells" Proc Natl Acad Sci USA 99:5515-5520 (2002)

Takeda, K and Akira S, "Toll-like receptors in innate immunity" Int Immunol 17:1-14 (2005) Takeuchi, O. et al., "Differential roles of TLR2 and TLR4 in recognition of gram-negative and gram-positive bacterial cell wall components" Immunity 11 :443-451 (1999)

Tanapat, P et al., "Stress inhibits the proliferation of granule cell precursors in the developing dentate gyrus" Int J Dev Neurosci 16:235-239 (1998)

Taylor, KR & Gallo RL, "Glycosaminoglycans and their proteoglycans: host-associated molecular patterns for initiation and modulation of inflammation" FASEB J 20:9-22

(2006)

Tiscornia, G et al., "A general method for gene knockdown in mice by using lentiviral vectors expressing small interfering RNA" Proc Natl Acad Sci USA 100:1844- 1848 (2003) Tiscornia G et al., "CRE recombinase-inducible RNA interference mediated by lentiviral vectors" Proc Natl Acad Sci USA 101 :7347-7351 (2004)

Tropepe, V et al., "Retinal stem cells in the adult mammalian eye" Science 287:2032-2036 (2000) Tseng JC et al., "Using sindbis viral vectors for specific detection and suppression of advanced ovarian cancer in animal models" Cancer Res. 64:6684-6692 (2004)

Tuschl, T et al., "RNA sequence specific mediators of RNA interference" WO01/75164 (2001)

Tuschl, T et al., "Targeted mRNA degradation by double-stranded RNA in vitro" Genes Dev 13:3191-3197 (1999)

Uematsu S, Akira, S, "The role of Toll-like receptors in immune disorders" Expert Opin Biol Ther 6:203-214 (2006a)

Uematsu, S, Akira S, "Toll-like receptors and innate immunity" J MoI Med 84:712-25 (2006b) Vabulas, RM et al., "Heat shock proteins as ligands of toll-like receptors" Curr Top Microbiol Immunol 270:169-184 (2002)

Vickers, TA et al., "Efficient reduction of target RNAs by small interfering RNA and RNase H-dependent antisense agents. A comparative analysis" J Biol Chem 278:7108-7118 (2003) Volpe, TA et al., "Regulation of heterochromatic silencing and histone H3 lysine-9 methylation by RNAi" Science 297:1833-1837 (2002)

Wadachi, R and Hargreaves KM, "Trigeminal nociceptors express TLR-4 and CD 14: a mechanism for pain due to infection" J Dent Res. 85:49-53 (2006)

Wu, PH et al., "Net production of gamma-aminobutyric acid in astrocytes in primary cultures determined by a sensitive mass spectrometric method" J Neurochem 32:379-390

(1979)

Yang, D et al., "Short RNA duplexes produced by hydrolysis with Escherichia coli RNase III mediate effective RNA interference in mammalian cells" Proc Natl Acad Sci USA 99:9942-9947 (2002) Yang, XJ, "Roles of cell-extrinsic growth factors in vertebrate eye pattern formation and retinogenesis" Semin Cell Dev Biol. 15:91-103 (2004)

Young, MJ, "Stem cells in the mammalian eye: a tool for retinal repair" Apmis. 113:845-857 (2005)

Young, RW, "Cell differentiation in the retina of the mouse" Anat Rec. 212: 199-205 (1985) Yu, JYet al., "RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells" Proc Natl Acad Sci USA 99:6047-6052 (2002)

Zernicka-Goetz M et al., "Inhibiting gene expression with DSRNA" WOO 1/36646 (2001)

Zhang, G & Ghosh S, "Toll-like receptor-mediated NF-kappaB activation: a phylogenetically conserved paradigm in innate immunity" J Clin Invest 107: 13-19 (2001)

Zhao, X et al., "Growth factor-responsive progenitors in the postnatal mammalian retina" Dev Dyn. 232:349-538 (2005)

All references cited above are all incorporated by reference herein, whether specifically incorporated or not.

Having now fully described this invention, it will be appreciated by those skilled in the art that the same can be performed within a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation.

Claims

WHAT IS CLAIMED IS:

1. A method for promoting neurogenesis in the CNS of a subject in need thereof comprising causing the downregulation of TLR4 and/or the upregulation of TLR2 on TLR-expressing cells in the CNS of the subject.

2. A method in accordance with claim 1, comprising causing the downregulation of TLR4 on TLR4-expressing cells in the CNS of the subject.

3. A method in accordance with claim 2, wherein said causing step comprises administering to the TLR4-expressing cells a TLR4 specific siNA or an antagonist of TLR4 that inhibits the binding of endogenous ligands for TLR4.

4. A method in accordance with claim 1, comprising causing the upregulation of TLR2 on TLR2-expressing cell in the CNS of the subject.

5. A method in accordance with claim 4, wherein said causing step comprises administering to the TLR2-expressing cells a TLR2-specific agonist that stimulates TLR2 and postbinding cellular activity.

6. A method in accordance with claim 1 , wherein the neurogenesis that is being promoted is retinogenesis and the TLR-expressing cells are in the vicinity of the retinal nerve.

7. A method in accordance with claim 1 , wherein the subject in need is one suffering from acute trauma to the CNS, a neurodegenerative disease or a mental dysfunction.

8. A method for inhibiting neurogenesis in the CNS of a subject in need thereof comprising causing the upregulation of TLR4 and/or the downregulation of TLR2 on TLR-expressing cells in the CNS of the subject.

9. A method in accordance with claim 8, comprising causing the downregulation of TLR2 on TLR2-expressing cells in the CNS of the subject.

10. A method in accordance with claim 9, wherein said causing step comprises administering to the TLR2-expressing cells a TLR2-specific siNA or an antagonist of TLR2 that inhibits the binding of endogenous ligands for TLR2.

11. A method in accordance with claim 8, comprising causing the upregulation of TLR4 on TLR4-expressing cell in the CNS of the subject.

12. A method in accordance with claim 11, wherein said causing step comprises administering to the TLR4-expressing cells a TLR4-specific agonist that stimulates TLR2 and postbinding cellular activity.

13. A method in accordance with claim 8, wherein the subject in need is one suffering from brain cancer.

14. The method of claim 13, wherein said brain cancer is selected from the group consisting of neuroblastoma, glioblastoma; glioblastoma multiformae; anaplastic astrocytoma, pilocytic astrocytoma, pleomorphic xanthoastrocytoma, subependymal giant cell astrocytoma, fibrillary astrocytoma, gemistocytic astrocytoma, protoplasmic astrocytoma; mixed oligoastrocytoma and malignant oligoastrocytoma; oligodendroglioma and anaplastic oligodendroglioma; anaplastic ependymoma, myxopapillary ependymoma, and subependymoma.

15. An interfering or inhibitory nucleic acid (NAi) having a sequence that is sufficiently complementary to the sequence of mRNA corresponding to the DNA sequence encoding human TLR4 (SEQ ID NO:5) or TLR4 of another mammalian source, so that expression of said NAi molecule in a cell that normally expresses TLR4 results in diminution or loss of expression of TLR4.

16. The NAi of claim 15 that is an interfering RNA (RNAi) molecule.

17. The RNAi molecule of claim 15 that is a single stranded siRNA that forms a hairpin structure.

18. The RNAi molecule of claim 15 that is a double stranded siRNA.

19. The RNAi molecule of any of claims 15-18 that (i) consists of between about 6 and about 50 nucleotides, or (ii) hybridizes to, a TLR4 target subsequence of between about 6 and 50 nucleotides, such that binding of said RNAi molecule to said target inhibits expression of TLR4 in said cellresults in ibhibition

20. A DNA molecule encoding the NAi or RNAi molecule of any of claims 15-19.

21. An expression construct comprising DNA molecule of claim 20, operatively linked to a promoter that drives the expression of said NAi or RNAi in TLA4- expressing cells.

22. A viral vector comprising the expression construct of claim 21.

23. Use of an NAi or RNAi molecule as defined in any of claims 15- 19, a DNA molecule as defined in claim 20, an expression construct as defined in claim 20, or a viral vector as defined in claim 22, for the preparation of a medicament for therapeutic inhibition of TLR4 expression in a TLR4-expressing cell.

24. Use of a pharmacological inhibitor or antagonist that blocks binding of a TLR4 ligand to TLR4 or postbinding activation of TLR4 for the preparation of a medicament for therapeutic inhibition of TLR4 expression in a TLR4- expressing cell.

25. A use according to any of claims 24, wherein said inhibition reduces the ability of said cell to bind and respond to stimulation by an agonist ligand of TLR4.

26. The method of claim 5, wherein said TLR2-specific agonist is lipopeptide Pam3CysSK4 (P3C) or peptidoglycan PG.

27. A method for promoting neuronal differentiation of neural progenitor cells (NPCs) comprising exposing NPCs to an effective amount of an agent that increases expression of TLR2, binding of a TLR2 ligand to TLR2, or postbinding activation of TLR2.

28. A method of claim 27 wherein the agent is lipopeptide Pam3CysSK4 (P3C) or peptidoglycan PG.