WO2009014759A2 - Methods of inhibiting vzv replication and related compositions - Google Patents
Methods of inhibiting vzv replication and related compositions Download PDFInfo
- Publication number
- WO2009014759A2 WO2009014759A2 PCT/US2008/009097 US2008009097W WO2009014759A2 WO 2009014759 A2 WO2009014759 A2 WO 2009014759A2 US 2008009097 W US2008009097 W US 2008009097W WO 2009014759 A2 WO2009014759 A2 WO 2009014759A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell
- bag3
- activity
- inhibitor
- host
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
Definitions
- viruses replicate inside living cells using the metabolic machinery of the host. Because of their limited coding potential, viruses have evolved means to hijack the host cell machinery and exploit it to their advantage.
- VZV Varicella-zoster virus
- ORFs open reading frames
- LAPs latency associated proteins
- VZV can infect both epidermal and neuronal cells, the outcome of infection and the localisation of a subset of viral b proteins, the LAPs, depend on the mfected cell type. This suggests that cell specific pathways, in addition to the interactions between cellular and viral proteins, can determine whether virus replication is lytic or Latent.
- VZV ORF29 encodes a single-stranded DNA binding protein O [ORF29p] (SEQ ID NO: 16), which is assumed to function during viral DNA replication. Similar to the other LAPs, ORF29p is predominantly nuclear during lytic infection and reactivation, but is excluded from the nucleus during latency (39, 49). Nuclear import of ORF29p occurs in the absence of other VZV encoded 5 proteins via its non-classical nuclear localization signal [NLS]
- the ubiquitm-proteasome system In eukaryotic cells the ubiquitm-proteasome system it> tne mam pathway for recycling polypeptides and eliminating misfolded or mutated proteins (34) . It is well established that the native 5 state of newly synthesized and stress-denatured proteins is attained by the ATP hydrolysis-driven function of molecular chaperones or heat shock proteins (27). The same machinery is also used for the recognition of folding-incompetent proteins that should be poly-ubiquitmated and targeted for degradation. Thus, there is a functional link between the folding activity of molecular chaperones and proteasomal degradation.
- DnaK and DnaJ from E. coll were first identified as proteins that are necessary for bacteriophage DNA replication (80). They specifically associate with a multicomponent preinitiation replication complex and are required for the initiation of DNA replication (81) .
- eukaryotic heat shock protein 70 Hsp70 interacts with Orc4p of S. cerevisiae to prevent oligome ⁇ zation of its M-terminal domain ⁇ 29) .
- EBNA3A viral nuclear oncoprotein
- EBNA3A viral nuclear oncoprotein
- a method is provided of inhibiting Varicella zoster virus b replication or Epstein-Barr virus replication in a cell of a host comprising contacting the cell with an amount of a modulator of host chaperone protein activity effective to inhibit Varicella zoster virus replication or Epstem-Barr virus replication in the cell.
- a method is provided of enhancing exclusion of a Varicella zoster virus open reading frame 29 protein (ORF29p) from a nucleus of a cell comprising contacting the cell with an amount of an inhibitor of Hsp90 ATPase activity effective to enhance exclusion
- a pharmaceutical composition comprising an amount of an ansamycm antibiotic effective in enhancing exclusion of a Varicella zoster virus open reading frame 29 protein (ORF29p) 7 O from a nucleus of a host cell.
- an ansamycm antibiotic effective in enhancing exclusion of a Varicella zoster virus open reading frame 29 protein (ORF29p) 7 O from a nucleus of a host cell.
- a pharmaceutical composition comprising (i) an amount of an ansamycm antibiotic effective to inhibit replication of a Varicella zoster virus or Epstem-Barr virus in a cell of a host 25 and (ii) a pharmaceutically acceptable carrier.
- a pharmaceutical composition comprising (i) a short interfering nucleic acid directed to a nucleic acid encoding human BAG3 and (ii) a pharmaceutically acceptable carrier.
- a pharmaceutical composition comprising (i) a short interfering nucleic acid directed to a nucleic acid encoding human BAG3 effective in enhancing exclusion of a Varicella zoster virus open reading frame 29 protein (ORF29p) from a nucleus of a
- a pharmaceutical composition comprising (i) a short interfering nucleic acid directed to a nucleic acid encoding human BAG3 effective in inhibiting replication of a Varicella zoster virus or Epstem-Barr virus in a cell of a host and (11) a pharmaceutically acceptable carrier.
- a pharmaceutical composition comprising (i) a vector comprising a nucleic acid encoding a short interfering nucleic acid directed to a nucleic acid encoding human BAG3 a (11) pharmaceutically acceptable carrier.
- a method is provided of treating a subject suffering from a Varicella zoster virus infection or Epstem-Barr virus infection comprising administering a nucleic acid which inhibits expression of a numan BAG3 gene so as to thereby treat the subject.
- a method is provided of treating cold sore comprising administering to the cold sore treatment site a nucleic acid which inhibits expression of a human BAG3 gene so as to thereby treat the cold sore.
- a method is provided of identifying an agent as an inhibitor of Varicella zoster virus replication or Epstem-Barr virus replication in a host cell comprising: a. quantitating the activity of a chaperone protein of the host cell; b. contacting the chaperone protein with the agent; and c. quantitating the activity of the chaperone protein in the presence of the agent, wherein an increase or decrease in activity of the host chaperone protein activity as quantitated in step a) compared to host chapercne protein activity cts quantitated in step c) indicates that the agent is an inhibitor of Varicella zoster virus replication or Epstem-Barr virus replication in the host cell.
- a method is provided of treating a subject suffering from a Varicella zoster virus infection or Epstein-Barr virus infection comprising administering to the subject an amount of modulator of a chaperone protein activity effective to inhibit Varicella zoster virus replication or Epstein-Barr virus replications in the subject and thereby treat the subject.
- a method is provided of treating cold sore comprising administering to the cold sore treatment site with an amount of modulator of a chaperone protein activity effective to inhibit Varicella zoster virus replication or Epstein-Barr virus replications in the subject and thereby treat the cold sore.
- FIG. 1 ORF29p and BAG3 interact in vitro.
- a & B Schematic diagram of bcl2-associated anathogene-3 (BAG3) and open reading fcrame 29 protein (ORF29p) .
- BAG3 bcl2-associated anathogene-3
- ORF29p open reading fcrame 29 protein
- C Glutathione-S-transferease (GST) , GST-BAG3, GST- BAG3par, GST-BAG3ag and GST-heat shock protein 70 (Hsp70) were overexpressed in E. coli and purified using affinity chromatography. Four ⁇ g of each protein was analyzed by SDS-PAGE and stained with Coomassie Brilliant Blue R-250.
- ORF29p Plasmids encoding ORF29p, ORF29p[l-345] , ORF29p [ 346-1203 ] and open reading frame 63 (ORF63) were used in coupled transcription/translation reactions to prepare S-met- labeled proteins. Two ⁇ l of each reaction was analyzed by SDS-PAGE and autoradiography. [E-H] One ⁇ g of each purified protein was subjected to SDS-PAGE, transferred to nitrocellulose membranes, renatured in situ and blotted with [E] ORF29p, [F] ORF29p [ 1-345] ,
- ORF29p interacts with BAG3 and Hsp70/Hsc70 in vivo.
- 293T cells were transiently transfected with plasmids expressing ORF29p, flag-tagged BAG3 or both. Equal amounts of total protein were incubated with anti-flag M2 matrix and the bound material was analyzed by western blot with anti-ORF29p antibodies.
- Confluent MeWo cells were either mock infected or infected with cell-free VZV at an MOI of 0.01. Three days post infection cells were lysed and equal amounts of total protein were incubated with beads containing anti-BAG3 or anti-ORF29p antibodies. Western blotting of the bound materials was performed with anti-ORF29 ⁇ or anti-
- ORF29p levels were determined following immunoprecipitation and SDS-PAGE. Proteins were visualized by autoradiography and band intensity ⁇ fas quantified using ImageJ. Percent ORF29p was calculated relative to the amount present at the 0- h chase time point.
- FIG. 4 Localization of ORF29p and ORF63p in cells treated with ansamycin antibiotics. MeWo cells were infected with an adenovirus expressing ORF29p [A-C] or ORF63p [D-F] .
- ORF29p or ORF63p were detected by indirect immunofluorescence microscopy after reaction with specific antibodies. Images were viewed and captured using a 63x objective.
- FIG. 1 VZV plaque and spread assays in cells treated with ansamycin antibiotics.
- [A] Confluent MeWo monolayers were infected with cell-free VZV. After virus adsorption the medium was replaced with DMEM supplemented with the indicated concentrations of geldanamycin or 17DMAG. The cells were fixed, stained with crystal vioLet and pLaques were counted after 4 days.
- [B] Confluent MeWo cell cultures were infected with cell free VZV. After virus adsorption medium was replaced WLth DMEM supplemented with 1.5 ⁇ M qeldanamycin.
- ORF29p The cells were fixed at the indicated times post infection and the presence and intracellular localization of ORF29p and gE were determined by indirect immunofluorescence microscopy after reaction with specific antibodies.
- ORF29p is visualized after reaction with goat anti-rabbit antibody conjugated to Alexafluor 546 (gray) and gE with goat anti-mouse conjugated to Alexafluor 488 (white) . Images were viewed and captured using a 1Ox objective .
- FIG. 1 Localization of ORF29p, ORF62p, Hsp90, Hsp70/Hsc70 and BAG3 in cells infected with VZV.
- MeWo cells were infected with cell free VZV at an MOI of approximately 0.01. After 24 h cells were fixed and the localization of the indicated proteins was visualized after reaction with specific antibodies. Images were captured with a 10Ox objective and analyzed by volume deconvolution .
- AdBAG3 at an MOI of 20 were infected with cell free VZV [white] .
- Monolayers of empty, si737 and si2225 cells were infected with HSV-I [gray] .
- Three or two days post infection respectively cells were fixed and plaques were stained and counted.
- serial 10-fold dilutions of virus were titrated on the previously described monolayers.
- the plaque numbers in the different cell lines were then normalized to the number of plaques that formed in the empty cell line.
- the error bars represent the standard deviation of the mean for three representative analyses.
- FIG. 1 VZV spread assay in BAG3 siRNA MeWo cells.
- Confluent monolayers of empty, si737, si2235 and si2235 cells pre-mfected with AdBAG3 at an MOI of 20 were infected with cell free VZV.
- the cells were fixed at the indicated time points and the presence and localization of gE and ORF63p were determined. Images were viewed and captured using a 1Ox objective.
- Figure 9 HSV spread assays in BAG3 siRNA MeWo cells. Confluent monolayers of empty and si2235 cells were infected with 200 pfu of HSV. The cells were fixed at 48 hpi and the presence and localization of ICPO and gC were determined. Images were viewed and captured using a 1Ox objective.
- Varicella Zoster Virus shall mean the human alphaherpesvirus which causes varicella (chickenpox) and herpes zoster (shingles) .
- VSV Varicella Zoster Virus
- VSV is also known as Varicella virus, zoster virus and human herpes 3 (HHV-3) .
- Epstein-Barr Virus shall mean the human gammaherpesvirus of the genus Lymphocryptoviruses which causes infectious mononucleosis that can affect liver, lymph nodes and oral cavity. Epstein-Barr Virus (EBV) is also known Human herpesvirus 4 (HHV-4) .
- ORF29p is described in U.S. Patent No. 6,309,182, issued October 26, 2004, the contents of which are hereby incorporated by reference .
- a chaperone protein is a protein, for example a heat shock protein, which functions to assist a second protein in achieving proper folding in a cell.
- human chaperone proteins include heat shock protein 70/heat shock protein 70 cognate (Hsp70/Hsc70) complex, heat shock protein 90 (Hsp90) , heat shock protein 60 (Hsp ⁇ O) and heat shock protein 100 (HsplOO) .
- a co-chaperone is a protein which assists the chaperone protein in assisting the second protein to fold.
- human co-chaperone proteins include bcl-2 associated anthanogene-1 and bcl-2 associated anthanogene-3 (BAG3) .
- a host is a subject infected by a varicella zoster virus or Epstein-Barr Virus.
- a host includes a mammal, for example a human.
- a cell of the host may be a cell removed from the host and place, e.g. in vitro, or a cell which is in vivo in the host.
- the cell of the host may be L ⁇ situ.
- a modulator of chaperone protein activity as used herein, unless otherwise indicated, 10 a disruptor, attenuator, inhibitor or enhancer of the activity of the chaperone protein.
- the modulation may be direct, by interacting with the chaperone, or indirect, by interacting with a pathway that interacts with the chaperone, e.g. by affecting a co-chaperone of the chaperone.
- an amino-acid residue is the monomer entity of a polypeptide structure that lacks a hydrogen atom of an amino acid amino group (-NH-CHR-COOH), or the hydroxyl moiety of an amino icid carboxyl group (NH -CHR-CO-) , or both (-NH-CHR-CO-) .
- the monomer units of a peptide chain are ammo-acid residues .
- an “antibody” shall include, without limitation, an immunoglobulin molecule comprising two heavy chains and two light chains and which recognizes an antigen.
- the immunoglobulin molecule may derive from any of the commonly known classes, including but not limited to IgA, secretory IgA, IgG and IgM.
- IgG subclasses are also well known to those in the art and include but are not limited to human IgGl, IgG2, IgG3 and IgG4.
- “Antibody” includes, by way of example, both naturally occurring and non-naturally occurring antibodies; monoclonal and polyclonal antibodies; chimeric and humanized antibodies; human or nonhuman antibodies; wholly synthetic antibodies; and single chain antibodies.
- a nonhuman antibody may be humanized by recombinant methods to reduce its immunogenicity in man. Methods for humanizing antibodies are well known to those skilled in the art.
- Antibody also includes, without limitation, a fragment or portion of any of the afore-mentioned immunoglobulin molecules and includes a monovalent and a divalent fragment or portion. Antibody fragments include, for example, Fc fragments and antigen-binding fragments (Fab) .
- “Monoclonal antibodies,” also designated a mAbs are antibody molecules whose primary sequences are essentially identical and which exhibit the same antigenic specificity. Monoclonal b antibodies may be produced by hyb ⁇ doma, recombinant, transgenic or other techniques known to those skilled in the art.
- a “humanized” antibody refers to an antibody wherein some, most or all of the ammo acids outside the CDR regions are replaced
- ammo acids LO with corresponding ammo acids derived from human immunoglobulin molecules.
- some, most or all of the ammo acids outside the CDR regions have been replaced with ammo acids from human immunoglobulin molecules, whereas some, most or all ammo acids
- L5 within one or more CDR regions are unchanged. Small additions, deletions, insertions, substitutions or modifications of amino acids are permissible as long as they do not abrogate the ability of the antibody to bind a given antigen.
- Suitable human immunoglobulin molecules include IgGl, IgG2, IgG3, IgG4, IgA, IgE 0 and IgM molecules.
- a "humanized" antibody retains an antigenic specificity similar to that of the original antibody.
- United States Patent No. 5,225,539 describes another approach for the production of a humanized antibody.
- This patent describes the use of recombinant DNA technology to produce a humanized antibody 5 wherein the CDRs of a variable region of one immunoglobulin are replaced with the CDRs from an immunoglobulin with a different specificity such that the humanized antibody would recognize the desired target but would not be recognized in a bignificant way by the human subject's immune system.
- site directed mutagenesis is used to graft the CDRs onto the framework.
- the human melanoma (MeWo) fibroblast cell line is available from the American Type Culture Collection (ATCC) , P.O. Box 1549, Manassas, Virginia, 20108, as ATCC No. HTB-65.
- ATCC American Type Culture Collection
- the human 293T fibroblast cell line is available from the American Type Culture Collection (ATCC), P.O. Box 1549, Manassas, Virginia, 20108, as ATCC No. CPL-11268.
- nucleic acid sequence As used herein "complementary" with regard to a nucleic acid sequence shall mean from 75% matching to a fully matching a sequence by base-pairing, unless otherwise stated.
- administering an agent, for example a modulator
- the administering can be performed, for example, orally, parenterally, mtraperitoneally, intravenously, intraarterially, transdermally, sublmgually, intramuscularly, rectally, transbuccally, mtranasally, liposomally, via inhalation, vaginally, mtraoccularly, via local delivery, subcutaneously, intraadiposally, intraarticularly, intrathecally, into a cerebral ventricle, intraventicularly, intratumorally, into cerebral parenchyma or intraparenchchymally .
- compositions in accordance with the invention may be used but are only representative cf the many possible systems envisioned for administering compositions in accordance with the invention.
- Transmucosal delivery systems include patches, tablets, suppositories, pessaries, gels and creams, and can contain excipients such as solubilizers and enhancers (e.g., propylene glycol, bile salts and amino acids), and other vehicles (e.g., polyethylene glycol, fatty acid esters and derivatives, and hydrophilic polymers such as hydroxypropylmethylcellulose and hyaluronic acid) .
- solubilizers and enhancers e.g., propylene glycol, bile salts and amino acids
- other vehicles e.g., polyethylene glycol, fatty acid esters and derivatives, and hydrophilic polymers such as hydroxypropylmethylcellulose and hyaluronic acid
- Dermal delivery systems include, for example, aqueous and nonaqueous gels, creams, multiple emulsions, microemulsions, liposomes, ointments, aqueous and nonaqueous solutions, lotions, aerosols, hydrocarbon bases and powders, and can contain excipients such as solubilizers, permeation enhancers (e.g., fatty acids, fatty acid esters, fatty alcohols and ammo acids), and hydrophilic polymers (e.g., polycarbophil and polyvinylpyrolidone) .
- the pharmaceutically acceptable carrier is a liposome or a transdermal enhancer.
- Oral delivery systems include tablets and capsules. These can contain excipients such as binders (e.g., hydroxypropylmethylcellulose, polyvinyl pyrilodone, other cellulosic materials and starch), diluents (e.g., lactose and other sugars, starch, dicalcium phosphate and cellulosic materials), disintegrating agents (e.g., starch polymers and cellulosic materials) and lubricating agents (e.g., stearates and talc) .
- excipients such as binders (e.g., hydroxypropylmethylcellulose, polyvinyl pyrilodone, other cellulosic materials and starch), diluents (e.g., lactose and other sugars, starch, dicalcium phosphate and cellulosic materials), disintegrating agents (e.g., starch polymers and cellulosic materials) and lubricating agents (
- Injectable drug delivery systems include solutions, suspensions, gels, microspheres and polymeric injectables, and can comprise excipients such as solubility-altering agents (e.g., ethanol, propylene glycol and sucrose) and polymers (e.g., polycaprylactones and PLGA' s).
- solubility-altering agents e.g., ethanol, propylene glycol and sucrose
- polymers e.g., polycaprylactones and PLGA' s.
- Implantable systems include ro ⁇ s ana discs, and can contain excipients such as PLGA and polycaprylactone .
- Solutions, suspensions and powders for reconstitutable delivery systems include vehicles such as suspending agents (e.g., gums, zanthans, cellulosics and sugars), humectants (e.g., sorbitol), solubilizers (e.g., ethanol, water, PEG and propylene glycol), surfactants (e.g., sodium lauryl sulfate, Spans, Tweens, and cetyl pyridine), preservatives and antioxidants (e.g., parabens, vitamins E and C, and ascorbic acid) , anti-caking agents, coating agents, and chelating agents (e.g., EDTA).
- suspending agents e.g., gums, zanthans, cellulosics and sugars
- humectants e.g., sorbitol
- solubilizers e.g., ethanol, water, PEG and propylene glycol
- Pharmaceutically acceptable carriers suitable for topical administration and equivalent terms refer to pharmaceutically acceptable carriers, as described herein above, suitable for topical application.
- An inactive liquid or cream vehicle capable of suspending or dissolving the active agent (s), and having the properties of being nontoxic and non-inflammatory when applied to the skin is an example of a pharmaceutically-acceptable topical carrier. This term is specifically intended to encompass carrier materials approved for use in topical cosmetics as well.
- composition described herein may comprise a pharmaceutically acceptable additive.
- pharmaceutically acceptable additive refers to preservatives, antioxidants, fragrances, emulsifiers, dyes and excipients known or used in the field of drug formulation and that do not unduly interfere with the effectiveness of the biological activity of the active agent, and that is sufficiently non-toxic to the host or patient.
- Additives for topical formulations are well-known in the art, and may be added to the topical composition, as long as they are pharmaceutically acceptable and not deleterious to the epithelial cells or their function. Further, they should not cause deterioration in the stability of the composition.
- Topical, administration refers to the application of a pharmaceutical agent to the external surface of the skin, such that the agent crosses the external burface of the skin and enters the underlying tissues. Topical administration includes application of the composition to intact skin or to an broken, raw or open wound of skin. Topical administration of a pharmaceutical agent can result in a limited distribution of the agent to the skin and surrounding tissues or, when the agent is removed from the treatment area by the bloodstream, can result in systemic distribution of the agent.
- ocular delivery refers to intraocular injection, topical conjunctival application, topical corneal application or a mechanical delivery device for delivery to localized disease sites
- delivery systems useful in the method of the present invention may be employed m such sterile liquid forms such as solutions, suspensions or emulsions.
- Transdermal delivery refers to the diffusion of an agent across the barrier of the skin resulting from topical administration or other application of a composition.
- stratum corneum acts as a barrier and few pharmaceutical agents are able to penetrate intact skin.
- the epidermis and dermis are permeable to many solutes and absorption of drugs therefore occurs more readily through skin that is abraded or otherwise stripped of the stratum corneum to expose the epidermis.
- Transdermal delivery includes injection or other delivery through any portion of the skin or mucous membrane and absorption or permeation through the remaining portion. Absorption through intact skin can be enhanced by placing the active agent in an appropriate pharmaceutically acceptable vehicle before application to the skin.
- Passive topical administration may consist of applying the active agent directly to the treatment site in combination with emollients or penetration enhancers.
- transdermal delivery is intended to include delivery by permeation through or past the integument, i.e. skin.
- a method is provided of inhibiting Varicella zoster virus replication or Epstein-Barr virus replication in a cell of a host comprising contacting the cell with an amount of a modulator of 5 host chaperone protein activity effective to inhibit Varicella zoster virus replication or Epstein-Barr virus replication in the cell.
- the host chaperone protein is a heat shock LO protein.
- heat shock protein is Hsp90.
- modulator of host chaperone protein activity is an inhibitor of Hsp90 ATPase activity.
- the modulator of host chaperone protein activity is an inhibitor of Hsp90 ATPase activity.
- inhibitor of Hsp90 ATPase activity is an ansamycin antibiotic.
- the inhibitor of Hsp90 ATPase activity is geldanamycm.
- the inhibitor of Hsp90 ATPase activity is 17-dimethylaminoethylamino-17-demethoxy-geldanamycin (17DMAG) .
- the host chaperone protein is Hsp70/Hsc70.
- the modulator of host chaperone protein activity is an inhibitor of a co-chaperone protein activity.
- the modulator of host chaperone protein activity is an inhibitor of a co-chaperone protein expression.
- the inhibitor of a co-chaperone protein expression is an inhibitor of bcl2-associated anathogene 3 (BAG3) expression.
- BAG3 comprises consecutive amino acid residues
- This disclosure relates to compounds, compositions, and methods useful for modulating BAG3 gene expression using short interfering nucleic acid (siNA) molecules.
- This disclosure also 35 relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of BAG3 gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules.
- RNAi RNA interference
- the instant disclosure features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short
- siRNA interfering RNA
- dsRNA double-stranded RNA
- RNA short hairpin RNA
- shRNA short hairpin RNA
- the inhibitor of BAG3 expression is a nucleic acid
- the inhibitor of BAG3 expression is a nucleic acid which inhibits translation of a mRNA which encodes a BAG3.
- the inhibitor of BAG3 expression is a nucleic acid which inhibits the translation of a nucleic acid comprising consecutive nucleotides
- nucleic acid is, or upon transcription becomes, a short interfering ribonucleic acid.
- short interfering ribonucleic acid comprises two ribonucleic
- first strand which comprises about 15 to about 28 ribonucleotides the sequence of which is complementary to a sequence of consecutive nucleotides present within a gene encoding a BAG3, and a second strand which comprises about 15 to about 28 ribonucleotides, the sequence of which is complementary 5 to the first strand.
- the strands are fully complementary.
- the strands are complementary over 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 ribonucleotides of their length.
- first strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 0 ribonucleotides in length.
- second strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 ribonucleotides in length.
- the BAG3 gene is a human BAG3 gene. 5
- the two strands of the short interfering ribonucleic acid are base paired for 19 consecutive nucleotides and have a 2-nucleotide overhang at their respective 3' ends.
- one or more of the ribonucleotides is modified in a sugar or base present therein.
- at least one of the strands comprises an inter-ribonucleotide phosphorothioate bond.
- the nucleic acid is a shRNA. In an embodiment the nucleic acid is a siRNA.
- siRNA shall mean small interfering ribonucleic acid, i.e. a short (e.g. 21-23 nt) RNA duplex which can elicit an RNA interference (RNAi) response in a mammalian cell.
- siRNAs may be blunt ended or have mono, di or trinucleotide 3' overhangs.
- shPNA shall mean short hairpin interfering ribonucleic acid containing a double stranded base-paired segment, each strand of which is contiguous at one of its ends with a loop (or non-base- paired) segment and which can be processed in a cell into a siRNA.
- the base-paired segment can be 19 base- pairs in length.
- the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that down- regulates expression of a target gene or that directs cleavage of a target RNA, wherein said siNA molecule comprises about 15 to about 28 base pairs.
- siNA short interfering nucleic acid
- the disclosure features a double stranded short interfering nucleic acid (siNA) molecule that directs cleavage of a target RNA via RNA interference (RNAi), wherein the double stranded siNA molecule comprises a first and a second strand, each strand of the siNA molecule is about 18 to about 28 nucleotides in length, the first strand of the siNA molecule comprises nucleotide sequence having sufficient complementarity to the target RNA for the siNA molecule to direct cleavage of the target RNA via RNA interference, and the second strand of said siNA molecule comprises nucleotide sequence that is complementary to the first strand.
- siNA short interfering nucleic acid
- the disclosure features a double stranded short interfering nucleic acid (siNA) molecule that directs cleavage of a target RNA via RNA interference (RNAi) , wherein the double otranded biNA molecule comprises a first and a second strand, each strand of the siNA molecule is about 18 to about 23 nucleotides in length, the first strand of the siNA molecule comprises nucleotide sequence having sufficient complementarity to the target RNA for the siNA molecule to direct cleavage of the target RNA via RNA interference, and the second strand of said siNA molecule comprises nucleotide sequence that is complementary to the tirst strand.
- siNA short interfering nucleic acid
- the disclosure features a chemically synthesized ⁇ ouble stranded short interfering nucleic acid (SJ-NA) molecule that directs cleavage of a target PNA via PNA interference (RNAi) , wherein each strand of the siNA molecule is about 18 to about 28 nucleotides in length; and one strand of the siNA molecule comprises nucleotide sequence having sufficient complementarity to the target RNA for the siNA molecule to direct cleavage of the target RNA via RNA interference.
- SJ-NA chemically synthesized ⁇ ouble stranded short interfering nucleic acid
- RNAi PNA interference
- the disclosure features a chemically synthesized double stranded short interfering nucleic acid (siNA) molecule that directs cleavage of a target RNA via RNA interference (RNAi) , wherein each strand of the siNA molecule is about 18 to about 23 nucleotides in length; and one strand of the siNA molecule comprises nucleotide sequence having sufficient complementarity to the target RNA for the siNA molecule to direct cleavage of the target RNA via RNA interference.
- siNA double stranded short interfering nucleic acid
- the disclosure features a siNA molecule that down-regulates expression of a target gene or that directs cleavage of a target RNA, for example, wherein the gene comprises protein encoding sequence. In one embodiment, the disclosure features a siNA molecule that down-regulates expression of a target gene or that directs cleavage of a target RNA, for example, wherein the gene comprises non-coding sequence or (sncodes sequence ot regulatory elements involved in gene expression (e.g. non-coding RNA).
- the disclosure features a siNA molecule having RNAi activity against target RAD9 RNA (e.g., coding or non-codmg RNA) , wherein the siNA molecule comprises a sequence complementary to any RNA sequence encoding a RAD9 or portion thereof.
- the disclosure features a siNA molecule having RNAi activity against target RNA, wherein the siNA molecule comprises a sequence complementary to an RNA having variant encoding sequence
- a siNA molecule of the disclosure includes a nucleotide sequence that can interact with nucleotide sequence of a target gene and thereby mediate silencing of gene expression, for example, wherein the siNA mediates regulation of gene expression by cellular processes that modulate the chromatin structure or methylation patterns of the gene and prevent transcription of the gene.
- a siNA molecule comprises an antisense strand comprising a nucleotide sequence that is complementary to a target polynucleotide sequence or a portion thereof.
- the siNA further comprises a sense strand, wherein said sense strand comprises a nucleotide sequence of a target polynucleotide sequence or a portion thereof, (e.g., about 15 to about 25 or more, or about 15, 16, 17, 18, 19, 20, 21, 22, 23,
- the target polynucleotide sequence is a target DNA. In one embodiment, the target polynucleotide sequence is a target RNA.
- the disclosure features a siNA molecule comprising a first sequence, for example, the ant: sense sequence of the sxNA construct, complementary to a oequence or portion of sequence comprising sequence encoding R ⁇ D9, and a second sequence, for example a sense sequence, that is complementary to the antisense sequence.
- a siNA molecule comprises an antisense strand having about L5 to about 30 (e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, wherein the antisense strand is complementary to a target RNA sequence or a portion thereof, and wherein said siNA further comprises a sense strand having about 15 to about 30 (e.g. 15, 16, 17, 13, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, and wherein said sense strand and said antisense strand are distinct nucleotide sequences where at least about 15 nucleotides in each strand are complementary to the ether strand.
- a siNA molecule of the disclosure comprises an antisense region having about 15 to about 30 (e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, wherein the antisense region is complementary to a target DNA sequence, and wherein said siNA further comprises a sense region having about 15 to about 30 (e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, wherein said sense region and said antisense region are comprised in a linear molecule where the sense region comprises at least about 15 nucleotides that are complementary to the antisense region.
- the siNA molecule can be designed to target a sequence that is unique to a specific target RNA sequence (e.g., a single allele or single nucleotide polymorphism (SNP) ) due to the high degree of specificity that the siNA molecule requires to mediate RNAi activity.
- a specific target RNA sequence e.g., a single allele or single nucleotide polymorphism (SNP)
- SNP single nucleotide polymorphism
- nucleic acid molecules of the disclosure that act as mediators of the RNA interference gene silencing response are double-stranded nucleic acid molecules.
- the siNA molecules of the disclosure consist of duplex nucleic acid molecules containing about 15 to about 30 base pairs between oligonucleotides comprising about 15 to about 30 (e.g., -lbout 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides.
- siNA siNA
- LO molecules of the disclosure comprise duplex nucleic acid molecules with overhanging ends of about 1 to about 3 (e.g., about 1, 2, or 3) nucleotides, for example, about 21-nucleotide duplexes with about 19 base pairs and 3 '-terminal mononucleotide, dmucleotide, or trinucleotide overhangs.
- about 1 to about 3 e.g., about 1, 2, or 3
- nucleotides for example, about 21-nucleotide duplexes with about 19 base pairs and 3 '-terminal mononucleotide, dmucleotide, or trinucleotide overhangs.
- siNA molecules of the disclosure comprise duplex nucleic acid molecules with blunt ends, where both ends are blunt, or alternatively, where one of the ends is blunt.
- Non-limiting examples of encompassed chemical modifications 20 include, without limitation, phosphorothioate mternucleotide linkages, 2 ' -deoxy ⁇ bonucleotides, 2 ' -O-methyl ribonucleotides, 2 ' -deoxy-2 ' -fluoro ribonucleotides, "universal base” nucleotides, "acyclic" nucleotides, 5-C-methyl nucleotides, and terminal glyceryl and/or inverted deoxy abasic residue incorporation.
- a siNA molecule of the disclosure comprises modified nucleotides while maintaining the ability to mediate RNAi.
- the modified nucleotides can be used to improve m vitro or in vivo characteristics such as stability, activity, and/or bioavailability.
- a siNA molecule of the disclosure 5 can comprise modified nucleotides as a percentage of the total number of nucleotides present in the siNA molecule.
- a SiNA molecule ot the disclosure can generally comprise about 5o to about 100" modified nucleotides (e.g., about 5°, 10 ⁇ ⁇ , 151, 20?,, 25°n, 30°o, 353, 40°6, 45°o, 50°o, 55° O , 601, 65 Q o, 70°o, 75°o, 80% 35° ft , 901, 95°o or 100% modified nucleotides) .
- the actual percentage of modified nucleotides present in a given siNA molecule will depend on the total number of nucleotides present in the siNA.
- the percent modification can be based upon the total number of nucleotides present in the single stranded siNA molecules. Likewise, if the siNA molecule is double stranded, the percent modification can be based upon the total number of nucleotides present in the sense strand, antisense strand, or both the sense and antisense strands .
- a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression ot a target gene or that directs cleavage of a target PNA.
- the double stranded siNA molecule comprises one or more chemical modifications and each strand of the double-stranded siNA is about 21 nucleotides long.
- the double-stranded siNA molecule does not contain any ribonucleotides.
- the double-stranded siNA molecule comprises one or more ribonucleotides.
- each strand of the double-stranded siNA molecule independently comprises about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, wherein each strand comprises about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides that are complementary to the nucleotides of the other strand.
- one of the strands of the double-stranded siNA molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of the gene, and the second strand of the double-stranded siNA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence of the gene or a portion thereof.
- the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that down- regulates expression of a target gene or that directs cleavage of a target RNA, comprising an antisense region, wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence of the gene or a portion thereof, and a sense region, wherein the sense region comprises a nucleotide sequence substantially similar to the nucleotide sequence of the gene or a portion thereof.
- the antisense region and the sense region independently comprise about 15 to about 30 (e.g.
- the antisense region comprises about 15 to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides that are complementary to nucleotides of the sense region.
- the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that down- regulates expression of a target gene or that directs cleavage of a target RNA, comprising a sense region and an antisense region, wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence of RNA encoded by the gene or a portion thereof and the sense region comprises a nucleotide sequence that is complementary to the antisense region.
- siNA short interfering nucleic acid
- a siNA molecule of the disclosure comprises blunt ends, i.e., ends that do not include any overhanging nucleotides .
- any siNA molecule of the disclosure can comprise one or more blunt ends, i.e. where a blunt end does not have any overhanging nucleotides.
- the blunt ended siNA molecule has a number of base pairs equal to the number of nucleotides present in each strand of the siNA molecule.
- the siNA molecule comprises one blunt end, for example wherein the 5 ' -end of the antisense strand and the 3 '-end of the sense strand do not have any overhanging ⁇ nucleotides.
- the siNA molecule comprises one blunt end, for example wherein the 3 ' -end of the antisense strand and the 5 '-end of the sense strand do not have any overhanging nucleotides.
- a siNA molecule comprises two blunt ends, for example wherein the 3 '-end of the antisense
- a blunt ended siNA molecule can comprise, for example, from about 15 to about 30 nucleotides (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
- blunt ended siNA construct comprises terminal nucleotides that 5 are complementary between the sense and antisense regions of the siNA molecule.
- the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that down- 0 regulates expression of a target gene or that directs cleavage of a target RNA, wherein the siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule.
- the sense region can be connected to 5 the antisense region via a linker molecule, such as a polynucleotide linker or a non-nucleotide linker.
- the disclosure Leatures double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a target gene or that directs cLeavage of a target PNA, wherein the oiNA molecule comprises about 15 Lo about 30
- each strand of the siNA molecule comprises one or more chemical modifications.
- one of the strands of the double-stranded 3iNA molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence of a gene or a portion thereof
- the second strand of the double-stranded siMA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence or a portion thereof of the gene.
- one of the strands of the double-stranded siNA molecule comprises a nucleotide sequence that is complementary to a nucleotide .sequence of a gene or portion thereof, and the second strand of the double-stranded siNA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence or portion thereof of the gene.
- each strand of the siNA molecule comprises about 15 to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, and each strand comprises at least about 15 to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides that are complementary to the nucleotides of the other strand.
- a siNA molecule of the disclosure comprises no ribonucleotides. In another embodiment, a siNA molecule of the disclosure comprises ribonucleotides.
- a siNA molecule of the dicclccare comprises an antisense region comprising a nucleotide sequence that is complementary to a nucleotide sequence of a target gene or a portion thereof, and the siNA further comprises a sense region comprising a nucleotide sequence substantially similar to the nucleotide sequence of the target gene or a portion thereof.
- the antisense region and the sense region each comprise about 15 to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides and the antisense region comprises at least about 15 to about 30 (e.g.
- the siNA is a double stranded nucleic acid molecule, where each of the two strands of the siNA molecule independently comprise about 15 to about 40
- nucleic acid sequence of the gene or a portion thereof comprises at least about 15 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 or more) nucleotides that are complementary to the nucleic acid sequence of the gene or a portion thereof.
- a siNA molecule of the disclosure comprises a sense region and an antisense region, wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence of RNA encoded by a target gene, or a portion thereof, and the sense region comprises a nucleotide sequence that is complementary to the antisense region.
- the siNA molecule is assembled from two separate oligonucleotide fragments, wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule.
- the sense region is connected to the antisense region via a linker molecule.
- the sense region is connected to the antisense region via a linker molecule, such as a nucleotide or non-nucleotide linker .
- the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that down- regulates expression of a target gene or that directs cleavage of a target RNA comprising a sense region and an antisense region, wherein the antisense regxon comprises a nucleotide sequence that is complementary to a nucleotide sequence of RNA encoded by the target gene or a portion thereof and the sense region comprises a nucleotide oequence that is complementary to the antisense region, and wherein the siNA molecule has one or more modified pyrimidine and/or purine nucleotides.
- siNA double-stranded short interfering nucleic acid
- the pyrimidine nucleotides in the sense region are 2'-O- methylpyrimidme nucleotides or 2 ' -deo ⁇ y-2 ' -fluoro pyrimidine nucleotides and the purine nucleotides present in the sense region are 2 ' -deoxy purine nucleotides.
- the pyrimidine nucleotides in the sense region are 2 ' -deoxy-2 '- fluoro pyrimidine nucleotides and the purine nucleotides present in the sense region are 2'-O-methyl purine nucleotides.
- the pyrimidine nucleotides in the sense region are 2 ' -deoxy-2 ' -fluoro pyrimidine nucleotides and the purine nucleotides present m the sense region are 2 ' -deoxy purine nucleotides.
- the pyrimidine nucleotides m the antisense region are 2 ' -deoxy-2 ' -fluoro pyrimidine nucleotides and the purine nucleotides present in the antisense region are 2'-O-methyl or 2 ' -deoxy purine nucleotides.
- any nucleotides present in a non-complementary region of the sense strand are 2 '-deoxy nucleotides.
- the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that down- regulates expression of a target gene or that directs cleavage of a target RNA, wherein the siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule, and wherein the fragment comprising the sense re ⁇ ion includes a terminal cap moiety at the 5 '-end, the 3 '-end, or both of the 5' and 3' ends of the fragment.
- the terminal cap moiety is an inverted deoxy abasic moiety or glyceryl moiety.
- each of the two fragments of the siNA molecule independently comprise about 15 to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides.
- each of the two fragments of the siNA molecule independently comprise about 15 to about 40 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 23, 33, 34, 35, 36, 37, 38, 39, or 40) nucleotides.
- each of the two fragments of the siNA molecule comprise about 21 nucleotides.
- the disclosure features a siNA molecule comprising at least one modified nucleotide, wherein the modified nucleotide is a 2 ' -deoxy-2 ' -fluoro nucleotide.
- the siNA can be, for example, about 15 to about 40 nucleotides in length.
- all pyrimidine nucleotides present in the siNA are 2 ' -deoxy-2 ' -fluoro pyrimidine nucleotides.
- the modified nucleotides in the siNA include at least one 2 ' -deoxy- 2 ' -fluoro cytidine or 2 ' -deoxy-2 ' -fluoro uridine nucleotide.
- the modified nucleotides in the siNA include at least one 2 '-fluoro cytidine and at least one 2' -deoxy-2 '- fluoro uridine nucleotides.
- all uridine nucleotides present in the siNA are 2 ' -deoxy-2 ' -fluoro uridine nucleotides.
- all cytidine nucleotides present in the siNA are 2 ' -deoxy-2 ' -fluoro cytidine nucleotides.
- all adenosine nucleotides present in the siNA are 2'- deoxy-2 ' -fluoro adenosine nucleotides.
- all guanosine nucleotides present in the siNA are 2 ' -deoxy-2 ' -fluoro guanosme nucleotides.
- the siNA can further comprise at least one modified internucleotidic linkage, such as phosphorothioate linkage.
- the 2 ' -deoxy-2 ' -fluoronucleotides are present at specifically selected locations in the siNA that are sensitive to cleavage by ribonucleases, such as locations having pyrimidine nucleotides.
- the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that down- regulates expression of a target gene or that directs cleavage of a target RNA comprising a sense region and an antisense region, wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence of RNA encoded by the gene or a portion thereof and the sense region comprises a nucleotide sequence that is complementary to the antisense b region, and wherein the purine nucleotides present in the antisense region comprise 2 ' -deoxy-purine nucleotides.
- the purine nucleotides present in the antisense region comprise 2'-0-methyl purine nucleotides.
- the antisense region can
- the LO comprise a phosphorothioate mternucleotide linkage at the 3 1 end of the antisense region.
- the antisense region can comprise a glyceryl modification at the 3 1 end of the antisense region.
- L5 nucleotides present in a non-complementary region of the antisense strand are 2'- ⁇ eoxy nucleotides.
- the disclosure features a double-stranded short interfering nucleic acid fsiNA) molecule that down- 0 regulates expression of a target gene or that directs cleavage of a target PNA, wherein the siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule.
- fsiNA short interfering nucleic acid
- the siNA 5 molecule is a double stranded nucleic acid molecule, where each strand is about 21 nucleotides long and where about 19 nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule, wherein at least two 3' terminal nucleotides of 0 each fragment of the siNA molecule are not base-paired to the nucleotides of the other fragment of the siNA molecule.
- the siNA molecule is a double stranded nucleic acid molecule, where each strand is about 19 nucleotide long and where the nucleotides of each fragment of the siNA 5 molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule to form at least about 15 (e.g., 15, 16, 17, 18, or 19) base pairs, wherein one or both ends of the siNA molecule are blunt ends.
- each of the two 3' terminal nucleotides of each fragment of the siNA molecule is a 2 ' -deoxy-pyrimidine nucleotide, such as a 2 ' -deoxy- thymidine.
- all nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule.
- the siNA molecule is a double stranded nucleic acid molecule of about 19 to about 25 base pairs having a sense region and an antisense region, where about 19 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the target gene.
- about 21 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the target gene.
- the 5 ' -end of the fragment comprising said antisense region can optionally include a phosphate group.
- the disclosure features a chemically synthesized double stranded RNA molecule that directs cleavage of a target PNA via PNA interference, wherein each strand of said RNA molecule is about 15 to about 30 nucleotides in length; one strand of the RNA molecule comprises nucleotide sequence having sufficient complementarity to the target RNA for the RNA molecule to direct cleavage of the target RNA via RNA interference; and wherein at least one strand of the RNA molecule optionally comprises one or more chemically modified nucleotides described herein, such as without limitation deoxynucleotides, 2 ' -O-methyl nucleotides, 2 ' -deoxy-2 ' -fluoro nucleotides, 2 ' -O-methoxyethyl nucleotides etc.
- target RNA of the disclosure comprises non- coding RNA sequence (e.g., miRNA, snRNA siRNA etc.).
- the disclosure features a medicament comprising a siNA molecule of the disclosure.
- the disclosure features an active ingredient comprising a siNA molecule of the disclosure.
- the disclosure features the use of a double- stranded short interfering nucleic acid (siNA) molecule to inhibit, down-regulate, or reduce expression of a RAD9 gene or that directs cleavage of a target RAD9 RNA, wherein the siNA molecule comprises one or more chemical modifications and each strand of the double-stranded siMA is independently about 15 to about 30 or more (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 or more) nucleotides long.
- siNA short interfering nucleic acid
- the siNA molecule of the disclosure is a double stranded nucleic acid molecule comprising one or more chemical modifications, where each of the two fragments of the siNA molecule independently comprise about 15 to about 40 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 23, 33, 34, 35, 36, 37, 38, 39, or 40) nucleotides and where one of the strands comprises at least 15 nucleotides that are complementary to nucleotide sequence of target RNA or a portion thereof. In a non-limiting example, each of the two fragments of the siNA molecule comprise about 21 nucleotides.
- the siNA molecule is a double stranded nucleic acid molecule comprising one or more chemical modifications, where each strand is about 21 nucleotide long and where about 19 nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule, wherein at least two 3' terminal nucleotides of each fragment of the siNA molecule are not base-paired to the nucleotides of the other fragment of the siNA molecule.
- the siNA molecule is a double stranded nucleic acid molecule comprising one or more chemical modifications, where each strand is about 19 nucleotide long and where the nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule to form at least about 15 (e.g., 15, 16, 17, 18, or 19) base pairs, wherein one or both ends of the siNA molecule are blunt ends.
- each of the two 3' terminal nucleotides of each fragment of the siNA molecule is a 2 ' -deoxy-py ⁇ midine nucleotide, such as a 2 ' -deoxy- thymidine.
- all nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule.
- the siNA molecule is a double stranded nucleic acid molecule of about 19 to about 25 base pairs having a sense region and an antisense region and comprising one or more chemical modifications, where about 19 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the target gene.
- about 21 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the target gene.
- the 5 ' -end of the fragment comprising said antisense region can optionally include a phosphate group.
- the disclosure features the use of a double- stranded short interfering nucleic acid (siNA) molecule that inhibits, down-regulates, or reduces expression of a target gene or that directs cleavage of a target RNA, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of target RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the py ⁇ midine nucleotides present in the double-stranded siNA molecule comprises a sugar modification (e.g., 2 ' -deoxy-2 ' -fluoro, 2 ' -0- methyl, or 2 ' -deoxy modifications).
- a sugar modification e.g., 2 ' -deoxy-2 '
- the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits, down-regulates, or reduces expression of a target gene or that 5 directs cleavage of a target RNA, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of target PNA or a portion thereof, wherein the other strand is a sense strand which comprises nucleotide sequence that
- LO is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification
- the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits, down-regulates, or reduces expression of a gene or that directs cleavage of a target RNA, wherein one of the strands of the siNA.
- siNA short interfering nucleic acid
- 10 double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of target RNA that encodes a protein or portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the 5 antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification.
- each strand of the siNA molecule comprises about 15 to about 30 or more (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 0 or 30 or more) nucleotides, wherein each strand comprises at least about 15 nucleotides that are complementary to the nucleotides of the other strand.
- the uiNA molecule is assembled from two oligonucleotide fragments, wherein one fragment comprises the nucleotide sequence of the antisense 5 strand of the siNA molecule and a second fragment comprises nucleotide sequence of the sense region of the siNA molecule.
- the py ⁇ midine nucleotides present in the •strand are 2 ' -deoxy-2 ' fluoro 5 pyrimidme nucleotides and the purine nucleotides present in the ->ense region are 2 ' -deoxy purine nucleotides.
- the py ⁇ midme nucleotides present in the sense atrand are 2 ' -deoxy-2 ' fluoro pyrimidme nucleotides and the purine nucleotides present in the ⁇ ense region are 2'-0-methyl
- the antisense strand comprises one or more
- the pyrimidme nucleotides present in the antisense strand are 2 ' -deoxy-2 '- fluoro pyrimidme nucleotides and any purine nucleotides present in the antisense strand are 2 ' -O-methyl purine nucleotides.
- the sense strand comprises a 3 ' -end and a 5'- end, wherein a terminal cap moiety (e.g., an inverted deoxy abasic moiety or inverted deoxy nucleotide moiety such as inverted thymidine) is present at the 5' -end, the 3 ' -end, or both of the 5' and 3' ends of the sense strand.
- a terminal cap moiety e.g., an inverted deoxy abasic moiety or inverted deoxy nucleotide moiety such as inverted thymidine
- the antisense strand comprises a phosphorothioate mternucleotide linkage at the 3' end of the antisense strand.
- the antisense strand comprises a glyceryl modification at the 3' end.
- the 5 '-end of the antisense strand optionally includes a phosphate group.
- a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a target gene or that directs cleavage of a target RNA, wherein a majority of the pyrimidme nucleotides present in
- each of the two strands of the siNA molecule can comprise about 15 to about 30 or more (e.g., about 15, L6, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more) nucleotides.
- about 15 to about 30 or more (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more) nucleotides of each strand of the siNA molecule are base- paired to the complementary nucleotides of the other strand of the siNA molecule.
- nucleotides of each strand of the siNA molecule are base-paired to the complementary nucleotides of the other strand of the siNA molecule, wherein at least two 3' terminal nucleotides of each strand of the siNA molecule are not base-paired to the nucleotides of the other strand of the siNA molecule.
- each of the two 3' terminal nucleotides of each fragment of the siMA molecule is a 2'-deoxy- py ⁇ midme, such as 2 ' -deoxy-thymidine .
- eacn strand of the siNA molecule is base-paired to the complementary nucleotides of the other strand of the siNA molecule.
- about 15 to about 30 e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30
- nucleotides of the antisense strand are base-paired to the nucleotide sequence of the target RNA or a portion thereof.
- about 18 to about 25 e.g., about 18, 19, 20, 21, 22, 23, 24, or 25
- nucleotides of the antisense strand are base-paired to the nucleotide sequence of the target RNA or a portion thereof.
- the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a target gene or that directs cleavage of a target RNA, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of target RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the py ⁇ midine nucleotides present an the double- stranded siNA molecule comprises a sugar modification, and wherein the 5 ' -end of the antisense strand optionally includes a phosphate group.
- siNA short interfering nucleic acid
- the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a target gene or that directs cleavage of a target RNA, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of target RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidme nucleotides present in the double- stranded siNA molecule comprises a sugar modification, and wherein the nucleotide sequence or a portion thereof of the antisense strand is complementary to a nucleotide sequence of the untranslated region or a portion thereof of the target RNA.
- siNA short interfering nucleic acid
- the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a target gene or that directs cleavage of a target RNA, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of target RNA or a portion thereof, wherein the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand, wherein a majority of the pyrimidme nucleotides present in the double- stranded siNA molecule comprises a sugar modification, and wherein the nucleotide sequence of the antisense strand is complementary to a nucleotide sequence of the target RNA or a portion thereof that is present in the target RNA.
- siNA short interfering nucleic acid
- the disclosure features a composition comprising a siNA molecule of the disclosure in a pharmaceutically acceptable carrier or diluent.
- the introduction of chemically- modified nucleotides into nucleic acid molecules provides a powerful tool in overcoming potential limitations of in vivo stability and bioavailability inherent to native RNA molecules that are delivered exogenously.
- the use of chemically-modified nucleic acid molecules can enable a lower dose of a particular nucleic acid molecule for a given therapeutic effect since chemically-modified nucleic acid molecules tend to have a longer half-life in serum.
- certain chemical modifications can improve the bioavailability of nucleic acid molecules by targeting particular cells or tissues and/or improving cellular uptake of the nucleic acid molecule.
- the overall activity of the modified nucleic acid molecule can be greater than that of the native molecule due to improved stability and/or delivery of the molecule.
- chemically-modified siNA can also minimize the possibility of activating interferon activity in humans.
- the antisense region of a siNA molecule of the disclosure can comprise a phosphorothioate mternucleotide linkage at the 3 '-end of said antisense region.
- the antisense region can comprise about one to about five phosphorothioate mternucleotide linkages at the 5 ' -end of said antisense region.
- the 3 '-terminal nucleotide overhangs of a siNA molecule of the disclosure can comprise ribonucleotides or deoxyribonucleotides that are chemically- modified at a nucleic acid sugar, base, or backbone.
- the 3'- terminal nucleotide overhangs can comprise one or more universal base ribonucleotides.
- the 3 '-terminal nucleotide overhangs can comprise one or more acyclic nucleotides.
- One embodiment of the disclosure provides an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the disclosure in a manner that allows expression of the nucleic acid molecule.
- Another embodiment of the disclosure provides a mammalian cell comprising such an expression vector.
- the mammalian cell can be a human cell.
- the siNA molecule of the expression vector can comprise a sense region and an antisense region.
- the antisense region can comprise sequence complementary to a PNA or DNA sequence encoding the target and the sense region can comprise sequence complementary to the antisense region.
- the siNA molecule can comprise two distinct strands having complementary sense and antisense regions.
- the siNA molecule can comprise a single strand having complementary sense and antisense regions .
- the disclosure features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against a target polynucleotide
- siNA short interfering nucleic acid
- the disclosure features a chemically-modified short interfering nucleic acid (siNA) having about 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate mternucleotide linkages in one siNA strand.
- the disclosure features a chemically-modified short interfering nucleic acid (siNA) individually having about 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate mternucleotide linkages in both siNA strands.
- the phosphorothioate mternucleotide linkages can be present in one or both oligonucleotide strands of the siNA duplex, for example in the sense strand, the antisense strand, or both strands.
- the siNA molecules of the disclosure can comprise one or more phosphorothioate internucleotide linkages at the 3 '-end, the 5 '-end, or both of the 3'- and 5 '-ends of the sense strand, the antisense strand, or both strands.
- an exemplary siNA molecule of the disclosure can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) consecutive phosphorothioate internucleotide linkages at the 5 ' -end of the sense strand, the antisense strand, or both strands.
- an exemplary siNA molecule of the disclosure can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) py ⁇ midine phosphorothioate internucleotide linkages in the sense strand, the antisense strand, or both strands.
- an exemplary siNA molecule of the disclosure can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 3, 9, 10, or more) purine phosphorothioate internucleotide linkages in the sense strand, the antisense strand, or both strands.
- a siNA molecule of the disclosure is featured, wherein the sense strand comprises one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2 ' -deoxy- 2'-fluoro, and/or about one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3 '-end, the 5 '-end, or both of the 3'- and 5 ' -ends of the sense strand; and wherein the antisense strand comprises about 1 to about 10 or more, specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about
- one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, py ⁇ midine nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2'-deoxy, 2 ' -0-methyl and/or 2 ' -deoxy-2 ' -fluoro nucleotides, with or without one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, phosphorothioate mternucleotide linkages and/or a terminal cap molecule at the 3 '-end, the 5 '-end, or both of the 3'- and 5 '-ends, being present in the same or different strand.
- a siNA molecule of the disclosure is featured, wherein the sense strand comprises about 1 to about 5, specifically about 1, 2, 3, 4, or 5 phosphorothioate mternucleotide linkages, and/or one or more (e.g., about 1, 2,
- the antisense strand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5, or more phosphorothioate mternucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2 ' -deoxy, 2'- O-methyl, 2 ' -deoxy-2 ' -fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at
- one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, pyrimidme nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2 ' -deoxy, 2 ' -O-methyl and/or 2 ' -deoxy-2 ' -fluoro nucleotides, with or without about 1 to about 5 or more, for example about 1, 2, 3, 4, 5, or more phosphorothioate mternucleotide linkages and/or a terminal cap molecule at the 3 '-end, the 5 '-end, or both of the 3'- and 5 '-ends, being present in the same or different strand.
- a siNA molecule of the disclosure is featured, wherein the antisense strand comprises one or more, for example, about L, 2, 3, 4, 5, 6, 7, 8, 9, LO, or more phosphorothioate internucleotide linkages, and/or about one or more (e.g., about
- the antisense strand comprises about 1 to about 10 or more, specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'- O-methyl, 2 ' -deoxy-2 ' -fluoro, and/or one or more (e.g., about 1,
- one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more py ⁇ midme nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2 ' -deoxy, 2 ' -O-methyl and/or 2 ' -deoxy-2 ' -fluoro nucleotides, with or without one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotide linkages and/or a terminal cap molecule at the 3 '-end, the 5 ' -end, or both of the 3' and 5 '-ends, being present in the same or different strand.
- a siNA molecule of the disclosure is featured, wherein the antisense strand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'- O-methyl, 2 ' -deoxy-2 ' -fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 5, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3'- end, the 5 '-end, or both of the 3'- and 5 '-ends of the sense strand; and wherein the antisense strand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide linkages, and/or one or more (e.g., ibout 1, 2, 3, 4, 5,
- one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pyrimidine nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2'-deoxy, 2 ' -O-methyl and/or 2 ' -deoxy-2 ' -fluoro nucleotides, with or without about 1 to about 5, for example about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide linkages and/or a terminal cap molecule at the 3 '-end, the 5 '-end, or both of the 3'- and 5 '-ends, being present m the same or different strand.
- a chemically-modified short interfering nucleic acid (siNA) molecule of the disclosure comprises about 1 to about 5 or more (specifically about 1, 2, 3, 4, 5 or more) phosphorothioate internucleotide linkages in each strand of the siNA molecule.
- a siNA molecule of the disclosure comprises 2 '-5' internucleotide linkages.
- the 2 '-5' internucleotide linkage (s) can be at the 3 ' -end, the 5 ' -end, or both of the 3'- and 5 ' -ends of one or both siNA sequence strands.
- the 2 '-5' internucleotide linkage (s) can be present at various other positions within one or both siNA sequence strands, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more including every internucleotide linkage of a pyrimidine nucleotide in one or both strands of the siNA molecule can comprise a 2 '-5' internucleotide linkage, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more including every internucleotide linkage of a purine nucleotide in one or both strands of the siNA molecule can comprise a 2 '-5' internucleotide linkage.
- the nucleic acid is an siRNA duplex composed of 21-nt sense and 21-nt antisense strands, paired in a manner to have a 2-nt 3 1 overhang.
- the 2-nt 3' overhang comprises 2 ' -deo ⁇ ynucleotides .
- the nucleic acids can be delivered/administered via a transfection reagent such as Oligofectamine" '1 (product number: 12252011 from Invitrogen, CA).
- Oligofectamine has the advantage of being non-toxic to cells, siRNA transfection is also possible by using TransIT-TKO: small interfering RNA (siRNA) Transfection Reagent, which is provided by Mirus; jetSI'" made by Polyplus, France, silMPORTERTM, made by Upstate, MA.
- siRNA small interfering RNA
- Non-limiting examples of siRNA carriers include those set forth in Ge Q., Filip L., Bai A., Nguyen T., Eisen H. M and Chen J., PNAS 101: 8676-8681 (2004); Urban-Klein B., Werth S., Abuharbeid S., Czubayko F. and Aigner A. Gene Therapy 12 :461-466 (2005) and Hassani Z., Lemkine G. -F., Erbacher P., AIfama G., Giovannangeli C, Behr J. -P., and Demeneix B. -A, J. Gene Med., 7, 198-207 (2005) .
- Examples include linear polyethylenimine, with an ion chloride and water such as jetPEITM.
- the inhibitor of co-chaperone protein activity is an inhibitor of BAG3 activity.
- inhibitor of a BAG3 activity is an antibody or antibody fragment which binds to the BAG3.
- the antibody is a monoclonal antibody.
- antibody is a humanized antibody.
- the cell of the host is in vitro. In an embodiment the cell of the host is in vivo.
- the cell of the host is in vivo and contacting the cell of the host with the nucleic acid is effected by administering to the host a vector comprising the nucleic acid.
- the nucleic acid is transcribed in the cell of the host into a short interfering ribonucleic acid.
- the vector is a mammalian expression vector.
- the vector comprises a RNA III polymerase promoter.
- the RNA III polymerase promoter is a U6 promoter or a Hl promoter.
- the vector comprises a RNA III polymerase termination site.
- the termination site is a T5 sequence.
- the cell of the host is a dorsal root ganglion cell, a ganglion semilunare cell, or a trigeminal nerve cell.
- a nucleic acid of the disclosure may be delivered via a vector so as to effect transcription of the DNA inserted into the vector into a short hairpin RNA or transcription into a complementary sense and an antisense strand which subsequently hybridize to form a siRNA.
- the latter may be achieved by a vector insert which comprises a promoter sequence/sense strand encoding sequence/termination sequence/spacer sequence/promoter sequence/antisense strand encoding sequence/termination sequence or a promoter sequence/antisense strand encoding sequence/termination sequence/ spacer sequence/promoter sequence/sense strand encoding sequence/termination sequence (e.g. see Tuschl, Expanding small RNA interference, Nature Biotechnology, 20:446-448 (2002) hereby incorporated by reference).
- Promoters include RNA II polymerase promoters, e.g. U6 or Hl.
- a method is provided of treating a subject suffering from a Varicella zoster virus infection or Epstem-Barr virus infection comprising administering a nucleic acid which inhibits expression of a human BAG3 gene so as to thereby treat the subject.
- a method is provided of treating cold bore comprising administering to the cold sore treatment site a nucleic acid which inhibits expression of a human BAG3 gene so as to thereby treat the cold sore.
- Methods and compositions for gene silencing techniques are described in U.S. Patent Nos. 6,573,099; 6,506,599; 7,109,165; 7,022,828; 6,995,259; 6,617,438; 6,673,611; 6,849,726; and 6,818,447, which are hereby incorporated by reference.
- the host is human.
- a method is provided of enhancing exclusion of a Varicella zoster virus open reading frame 29 protein (ORF29p) from a nucleus of a cell comprising contacting the cell with an amount of an inhibitor of Hsp90 ATPase activity effective to enhance exclusion of the ORF29p protein from the nucleus of the cell.
- ORF29p Varicella zoster virus open reading frame 29 protein
- the ORF29p is encoded by a nucleic acid comprising consecutive ammo acids having the sequence set forth in SEQ ID NO: 16.
- the inhibitor of Hsp90 ATPase activity is an ansamycin antibiotic.
- the inhibitor of Hsp90 ATPase activity is geldanamycin.
- the inhibitor of Hsp90 ATPase activity is 17- dimethylaminoethylamino-17-demethoxy-geldanamycm (17DMAG).
- the cell is m vitro.
- the cell is in vivo.
- the cell is a dorsal root ganglion cell, a ganglion semilunare cell, or a trigeminal nerve cell.
- a pharmaceutical composition comprising an amount of an ansamycin antibiotic effective to inhibit replication of a Varicella zoster virus or Epstein-Barr virus in a cell of a host and a pharmaceutically acceptable carrier.
- ansamycin antibiotic is geldanamycin.
- ansamycin antibiotic is 17-dimethylaminoethylammo-17-demethoxy- geldanamycin (17DMAG).
- a pharmaceutical composition comprising an amount of an siRNA effective to inhibit replication of a Varicella zoster virus or Epstein-Barr virus in a cell of a host and a pharmaceutically acceptable carrier.
- the siRNA inhibits expression of BAG3.
- the BAG3 comprises consecutive amino acid residues having the sequence set forth in SEQ ID NO: 1.
- the composition is suitable for topical application to human skin or a human mucous membrane. In an embodiment of the instant compositions the composition is suitable for oral administration to a human. In an embodiment of the instant compositions the composition is suitable for ocular administration to a human.
- a method is provided of identifying an agent as an inhibitor of Varicella zoster virus replication or Epstein-Barr Virus replication in a host cell comprising: a) quantitating the activity of a chaperone protein of the host cell; b) contacting the chaperone protein with the agent; and c) quantitating the activity of the chaperone protein in the presence of the agent, wherein an increase or decrease in activity of the host chaperone protein activity as quantitated in step a) compared to host chaperone protein activity as quantitated in step c) indicates that the agent is an inhibitor of Varicella zoster virus replication or Epstein-Barr virus in the host cell.
- the host chaperone protein is a heat shock protein.
- the heat shock protein is Hsp90 or Hsp70/Hsc70.
- the activity of heat shock protein is ATPase activity.
- the agent increases the activity of the chaperone protein. In an embodiment the agent decreases the activity of the chaperone protein.
- a method is provided of treating a subject suffering from a
- Varicella zoster virus infection or Epstein-Barr Virus infection comprising administering to the subject an amount of modulator of a chaperone protein activity effective to inhibit Varicella zoster virus replication or Epstein-Barr Virus replication in the subject and thereby treat the subject.
- a method is provided of treating coJd sore comprising administering to the cold sore treatment site with an amount of modulator of a chaperone protein activity effective to inhibit Varicella ⁇ oster virus replication or Epstein-Barr virus replications in the subject and thereby treat the cold sore.
- the modulator of the chaperone protein activity is an inhibitor of Hsp90 ATPase activity.
- the inhibitor of Hsp90 ATPase activity is an ansamycin antibiotic.
- the inhibitor of Hsp90 ATPase activity is geldanamycm.
- the inhibitor of hsp90 ATPase activity is 17-dimethylaminoethylamino-17-demethoxy-geldanamycin (17DMAG) .
- the modulator of a chaperone protein activity is inhibitor of bcl2-associated anathogene 3 (BAG3) expression.
- the inhibitor is a nucleic acid which is, or upon transcription becomes, a short interfering ribonucleic acid.
- the term "effective amount” or an "amount .. effective” refers to the quantity of a component that is sufficient to yield a desired therapeutic response without undue adverse side effects (such as toxicity, irritation, or allergic response) commensurate with a reasonable benefit/risk ratio when used in the manner of this disclosure.
- an amount effective to inhibit or stop Varicella zoster virus or Epstein- Barr Virus replication or growth will vary with such factors as the particular condition being treated, the physical condition of the patient, the type of mammal being treated, the duration of the treatment, the nature of concurrent therapy (if any), and the specific formulations employed and the structure of the compounds or its derivatives.
- ORF29p open reading frame 29 protein
- VZV Varicella Zoster Virus
- Hsp90 is required for stabilization and nuclear localization of ORF29p and virus replication.
- This study shows that VZV redistributes BAG3 and its partners Hsp70 and Hsp90 into nuclear replication/transcription foci in infected cells, suggesting that the virus exploits the highly conserved functions of the host heat shock proteins to efficiently complete its life cycle.
- this report provides genetic evidence that BAG3 is required for efficient virus growth.
- herpes simplex virus [HSV] replication is also inhibited by ansamycins (7), its replication in human melanoma (MeWo) cells depleted of BAG3 is unaffected.
- This disclosure proposes that regulators of chaperone protein activity modulate VZV replication raising the possibility that this pathway is required for controlling replication of animal viruses.
- Mammalian cells Human melanoma [MeWo] and human 293T fibroblasts cells were maintained and infected as previously described ( "7 O, 71) .
- MeWo cells were infected with retroviruses and selected in growth medium containing lug/ml puromycin. Single cell colonies were selected, expanded and used for further analysis.
- Viruses [i] Varicella Zoster Virus. Jones VZV, a wild-type clinical isolate, was propagated as described (33) .
- Cell-free virus was obtained by infecting confluent monolayers of MeWo cells in 100 mm dishes. When cytopathic effect was present cells were washed three times with cold phosphate-buffered saline [PBS; ImM KH PO 4 , 1OmM Na-HPO 1 , 137mM NaCl, 2.7mM KCl, pH7.4] and incubated with 0.1° EDTA in PBS for five minutes. The cells were detached from the plate by pipetting and narvested by centrifugation at 500 x g for 5 mm at 4°C.
- the cell pellet was resuspended in 1 ml per 100 mm dish of fresh Phosphate Sucrose Glutamate Calf serum buffer [PSGC; 5° sucrose, 0.1° L[+] glutamic acid, 1Oo fetal calf serum in PBS] and sonicated for three 30 sec intervals.
- Cell debris was removed by centrifugation at 25 x g for 2 min at 4°C and the supernatant was filtered through a 5um filter as described (38) .
- Cell-free virus was stored at -150 0 C and the titer was determined by plaque assay on MeWo cells. [ii] Adenoviruses.
- Adenovirus AdBAG3 expressing flag-tagged BAG3 under the HSV-I tk promoter was constructed using the pCK-mFLAG- BAG3 and pBHGfrt ⁇ El, E3FLP system [Microbix Biosystems, Toronto, Ontario, Canada] (59).
- Adenovirus AdORF29 is described elsewhere (70) .
- Adenovirus AdORF63 expressing VZV ORF63p was constructed by M.S. Walters [Walters and Silverstem, unpublished data].
- Retroviruses were constructed by transient cotransfection of 293T cells with the proviral vectors pSuper. retro. puro (6), pCK-siBAG3-737 or pCK-siBAG3-2235 and pgag-polgpt (52) and pHCMV-G (79) .
- Herpes simplex virus was grcwn and titrated as previously described ( 60) .
- VZV nucleocapsids were prepared as described (72) .
- Virus DNA was isolated from nucleocapsids suspended in TE [1OmM TrisHCl pH8.0, ImM EDTA] and digested in ProteinaseK cocktail [10OmM NaCl, 1OmM EDTA, 5OmM TrisHCl pH 7.4, 200ug/ml ProteinaseK] at 50 0 C for 3 h.
- Virus DNA was extracted with phenol and precipitated with isopropanol.
- MeWo DNA was prepared using the DNAZOL reagent [Invitrogen, Carlsbad, CA], following the manufacturer's instructions.
- BAG3 plasmids [i] BAG3 plasmids .
- the 3' region of BAG3 cloned in the cDNA library was amplified with Pfu Turbo polymerase [Stratagene, La Jolla, CA] using the cDNA phagemid as template and the primers M13rev [5' - GAGCGGATAACAATTTCACACAGG - 3'] (SEQ ID NO: 3) and 3'Hind-BAG3 [5' GGAAGCTTTACAGGGCAGAGGCTACGGTG - 3'] (SEQ ID NO: 4).
- the PCR product was cLoned in ⁇ CR2.1 TOPO TA to yield pCK-BAG3par.
- BAG3 cDNA was amplified from MeWo total RNA with C. Therm. Polymerase One-Step RT-PCR System [Roche, Mannheim, 5 Germany] using the primers BAG3-5-F [5' - CAGACCCCAACCCAGCATGAG - 3'1(SEQ ID NO: 5 and BAG3-5-R [5' - CCGCTGCCACCTGTCCACAC - 3'J(SEQ ID NO: 6) and cloned in pCR2.1 TOPO TA to yield pCK-BAG3- 5.
- pCK-BAG3fl was constructed by digesting pCK-BAG3-5 with PpuMI and Xhol and ligating the released fragment to PpuMI and Xhol
- pCK-GST-BAG3par was digested with Sail/Xhol and self-ligated to create pCK-GST- BAG3ag.
- pCK-GST-BAG3 was prepared by cloning an EcoRI and HindIII digestion fragment from pCK-BAG3fl into EcoRI and HindIII digested pALEX .
- pCK-FLAG-BAG3 was constructed by cloning a
- 25 promoter of this plasmid was replaced by the 105bp of the HSV-I thymidine kinase promoter by ligating a BamHI/Bglll digested and Klenow filled-in fragment from pLS115/105 (24,55) into Xbal/Ncol digested and Klenow filled pCK-mFLAG-BAG3 to yield pCK-tkFLAG- BAG3.
- BAG3 siRNA plasm ⁇ ds The siRNA oligos targeting BAG3 mRNA were designed using SVM RNAi 3.6 [www.changbioscience.com/stat/sirna.html], which uses a collection of rules to predict functional siRNAs (30,36,64). To generate pCK-siBAG3-737 and pCK-siBAG3-2235 the annealed oligo 5 pairs 737-TS: 5'
- GATCCCCCCACTCAGCCAGATAAACATTCAAGAGATGTTTATCTGGCTGAGTGGTTTTTGGAAA 3' (SEQ ID NO: 8) and 737-BS: 5' AGCTTTTCCAAAAACCACTCAGCCAGATAAACATCTCTTGAATGTTTATCTGGCTGAGTGGGGG (SEQ ID NO: 9) or 2235-TS: 5' GATCCCCGAAGTTGCTTGTTGTTTGATTCAAGAGATCAAACAACAAGCAACTTCTTTTTGGAAA 3' (SEQ ID NO: 10) and 2235-BS: 5'
- ORF63p plasmids Full-length ORF63 was amplified by PCR using the oligonucleotides 5-Eco-63 [5' GGGAATTCATGTTTTGCACCTCACCGGCT - 3'] (SEQ ID NO: 12) and 3-Xho-63 [5' - GGCTCGAGTAAAGACTTCACGCCATGGGG - 3' ] (SEQ ID NO: 13), Pfu Turbo polymerase and VZV strain Jones DNA as template. The PCR product was cloned m pCR2.1 TOPO TA to create pCK-ORF63.
- HSP70 plasmids A full length Hsp70 gene [HSPAlA] was amplified from MeWo DNA using KOD DNA polymerase [Novagen, San Diego, CA] and 5-Hind-Hsp70 [5' - GGAAGCTTAGAGAGCAGCGAACCGGCAT - 3'] (SEQ ID NO: 14) and 3-Xho-Hsp70 [5'
- the protein was used to immunize rabbits and BAG3 opeci ⁇ ic antibodies were purified by affinity chromatography using BAG3 immobilized on cyanogen bromide-activated Sepharose JB, after removal of the GST tag [Amersham Biosciences, Uppsala, Sweden] .
- Mouse monoclonal antibodies to VZV gE and ORF62p were from ViroStat [Portland, Maine].
- Mouse monoclonal antibodies to HSP90 ⁇ / ⁇ and GAPDH were from Santa Cruz Biotechnology [Santa Cruz, CA] and to HSP70 from United States Biological [Swampscott, MA] .
- Alexa Fluor 483- conjugated anti-mouse and Alexa Fluor 546-con]ugated anti-rabbit were from Molecular Probes [Carlsbad, CA].
- Goat anti-rabbit and anti-mouse conjugated to horseradish peroxidase for iiranunoblotting were from KPL [Gaitherburg, MD] .
- HSV gC antibody was purchased from the Rumbaugh-Goodwm Institute [Plantation, FL]. Antibody to ICPO has been described (47).
- Infected or transfected cells were washed twice with cold PBS, scraped from tissue culture dishes, resuspended m radioimmunoprecipitatxon lysis buffer [5OmM TrisHCl pH8.0, 15OmM NaCl, l°c NP-40, 0.5°o DOCS, 0.1° o SDS, 5OmM NaF] plus Complete protease inhibitor cocktail [Roche, Mannheim, Germany] and incubated on ice for 30min. The lysate was clarified by centrifugation at 22,500 x g for 10 min in a Tomy MX-160 high- speed refrigerated microcentrifuge.
- Total protein concentration was measured using the Bio-Rad protein assay [Bio-Rad, Hercules, CA] (5).
- the appropriate amount of 5 x SDS sample buffer [25OmM TrisHCl pH 6.8, 50OmM DTT, 10°o SDS, 0.5°° bromophenol blue, 501 glycerol] was added to the samples before boiling for 10 min and SDS-PAGE analysis (41).
- the proteins were transferred to nitrocellulose membranes with a Bio-Rad Semi-Dry apparatus before western blotting.
- DMEM [GIBCO-BRL] for 30 min. Starvation medium was replaced with labeling medium [modified DMEM supplemented with Io dialyzed calf serum and 500uCi/ml Trans" r S-label (ICN, Irvine, CA)]. After a 1 h pulse cells were washed twice with chase media [normal DMEM supplemented with 1Oo fetal calf serum, 2mM Met and 4mM Cys] and chased for the indicated time periods. Cell lysates were prepared and ORF29p was immunoprecipitated. The bound material was subjected to SDS-PAGE. The gel was dried and exposed to X-ray film. ORF29p levels were quantified with ImageJ [NIH, at rsb. info. nih.gov/ij /] .
- RNA isolation and cDNA expression library construction RNA isolation and cDNA expression library construction. mRNA extracted from MeWo cells was used to construct an expression a cDNA library in the lambda ZAP vector (66) .Total RNA was isolated from MeWo cells using the TRIzol reagent [ Invitrogen] . Poly A + RNA was purified from total RNA using the Oligotex mRNA purification protocol [Qiagen, Valencia, CA] . Five ug of mRNA were used to construct a cDNA library using the ZAP Express cDNA cloning kit [Stratagene, La Jolla, CA] according to the manufacturer's instructions.
- the cDNAs were cloned in lambda ZAP (66) dnd phage DNA was packaged using the Gigapack III Gold packaging extract [Stratagenel .
- the library was titrated .and amplified once in Escherichia coli, strain XLl-Blue MRF' .
- the cDNA library was screened using a modification of methods previously described (50, 51, 67) . Approximately 10' ptu were used to infect E. coli, strain XLl-Blue MRF' and then plated on 20 NZY agar petri dishes [150mm] . The plates were incubated for 4 h at 42°C and then overlaid with nitrocellulose filters impregnated in 1OmM isopropyl- ⁇ -D-thiogalactopyranoside and incubated overnight at 37°C.
- the filters were then removed and washed for 15 min with TBST [1OmM TrisHCl pH8.0, 15OmM NaCl, 0.05°s Triton X-100], blocked ⁇ ith HBB buffer [2OmM Hepes pH7.4, SmM MgCl_, ImM KCl] with 5o nonfat milk tor 3 h at 4°C and then incubated with 0.8ng/ml of in vitro translated S-met-ORF29p in HBB with Ii nonfat milk overnight at 4°C. All membranes were washed three times with TBST for 10 mm at room temperature, dried and exposed to phosphorimager screens. Positives clones were picked and those phages demonstrating enrichment on subsequent screenings were plaque purified. The cDNA inserts were excised in vivo as a phagemids .
- BAG3 is a cell protein that interacts with ORF29p.
- Host proteins that interact with ORF29p were identified from a bacteriophage lambda cDNA expression library constructed using poly-adenylated
- RNA from actively growing human fibroblasts [MeWo cells].
- BAG3 is a predominantly cytoplasmic, 74kDa, member of an evolutiona ⁇ ly conserved family of proteins that contain at least one BAG domain that is responsible for binding to the ATPase domain of Hsp70/Hsc70 (76) and with Bcl-2 (42) . Via this interaction, these proteins can modulate the activity of the aforementioned chaperones, and are thus characterized as co- chaperones (23, 74, 76) .
- ORF29p interacts with BAG3 in vitro.
- ORF29p interacts with BAG3 in vitro and to exclude the possibility that the known BAG3 interaction partner Hsp70 [HSPAlA] bridged the interaction between the proteins.
- Hsp70 HSPAlA
- a far-western olot was performed.
- Purified GST, GST-BAG3, GST-BAG3par, GST-BAG3ag [Fig. IA] and GST-Hsp70 were subjected to SDS-PAGE, transferred to nitrocellulose membranes and renatured in situ [Fig. 1C] .
- ORF29p ORF29p[l- 345], ORF29p[346-1203] or ORF63p, which is another VZV LAP [Figs. IB & D] .
- Full length ORF29p but not the fragment of the protein that contains the N-termmal NLS interacted with full length BAG3 [Figs. IE & F].
- BAG3ag lacks the BAG domain and was not bound by either ORF29p or ORF29p [346-1203] [Figs. IE & G] .
- ORF29p did not interact with Hsp70 in this assay, demonstrating that HSPAlA does not bridge ORF29p and BAG3 [Fig. IE] .
- ORF63p did not interact with BAG3 or Hsp70, showing that association with BAG3 is not a general property of the LAPs [Fig. IH].
- ORF29p interacts with BA63 in vivo.
- 293T cells were transiently transfected with plasmid constructs expressing flag-tagged BAG3, ORF29p or both. Forty-eight hours post transfection the cells were lysed and equal amounts of total protein were incubated with anti-flag M2 affinity matrix and the bound material was subjected to SDS-PAGE.
- Western blotting with anti-ORF29p specific antibodies demonstrated that ORF29p was only immunoprecipitated from cells co-transfected with plasmids encoding for both tlag- tagged BAG3 and ORF29p [Fig. 2A] .
- ORF29p xs an Hsp90 client for proteasomal degradation.
- heat shock proteins can also control protein turnover (53, 54).
- Hsp90 is thought to be a key regulator of this balance between folding and polypeptide turnover, depending on its association with other chaperone and co-chaperone proteins (58, 62) .
- BAG3 can abrogate protein degradation mediated by Hsp70 - Hsp90 chaperone complexes (22) . Because ORF29p interacts with BAG3, it was determined if this pathway controls ORF29p levels.
- ORF29p localizes to the cytoplasm of geldanamycin and 17DMAG treated MeWo cells. It was previously shown that the intracellular localization of ORF29p correlated with its stability. The XM. of the protein is shorter in cell lines where it is localized in the cytoplasm, such as U373MG, compared to cell lines, such as MeWo cells, where it localized in the nucleus (70) . Therefore, this report investigated if the decreased half- life caused by geldanamycin treatment prevented nuclear localization of ORF29p in MeWo cells.
- MeWo cells were infected with adenovirus expressing ORF29p. After adsorption, the medium containing the virus was removed and replaced with medium containing DMSO, geldanamycin or 17DMAG [a water soluble analog] . The cells were fixed at 48 hpi and ORF29p localization was examined. Following DMSO treatment, ORF29p remained m the nuclei of MeWo cells [Fig. 4A] . However, in the presence of the drugs, the number of cells with detectable ORF29p was significantly decreased and the protein was excluded from the nucleus of the few cells where expression was detected [Figs 4B & C]. Similar results were obtained with shorter drug treatment.
- ORF29p localized predominantly in the nuclei of cells infected with VZV (39, 71). The protein was diffuse in the nucleus of some infected cells, whereas in others it was localized in discrete regions of the nucleus.
- the localization pattern of ORF29p was very similar to that of its HSV-I homolog, 0 ICP8, which exhibits diffuse nuclear staining at early times, but accumulates in sites of DNA replication later m infection (9, 63) .
- ORF62p a transcription regulator, localized in a manner similar to ORF29p and its HSV-I homolog ICP4 (40). Specifically, ORF62p was predominantly in the 5 nucleus of the infected cell, showing a diffuse staining early, but concentrating in globular structures later in infection. Furthermore, the merged images demonstrated that ORF29p and ORF62p CO- Localized, indicating that sites ot replication and transcription form in the nuclei of infected cells, similar to what was shown tor HSV-I (21) [Fig. 6A].
- BAG3 is essential for efficient VZV replication.
- cell lines stably expressing siRNAs targeting the BAG3 mRNA were constructed. Pseudotyped retroviruses were constructed and used to transduce MeWo cells [Fig. 7A] . After selection in puromycin and colony isolation, intracellular BAG3 levels were evaluated by western blot [Fig. 7B] .
- siPNA 737 had almost no effect on the level of endogenous BAG3, whereas cells transduced with siRNA 2235 had only 8% of the level present m cells transduced with an empty vector. The resulting cell lines were tested for the ability of VZV to replicate using plaque and spread assays.
- the defect in virus growth caused by the reduction of BAG3 levels was further characterized by IF microscopy to examine the presence and localization of ORF63p and gE, an immediate early and a late virus protein respectively.
- ORF63p and gE an immediate early and a late virus protein respectively.
- BAG3 is required for efficient VZV replication and plaque formation and that decreased levels of BAG3 expression can be complemented by exogenous expression from an adenovirus vector.
- BAG3 is not required for HSV replication.
- this study investigated if growth of another alphaherpesvirus, herpes simplex virus, was altered in the siRNA knock down cell lines using plaque and spread assays.
- HSV HSV in the knock down cell lines was further characterized using spread assays.
- Confluent empty and si2235 cells were infected with HSV and fixed at 48 hpi.
- the presence and localization of an immediate early protein, ICPO, and a late glycoprotein, gC, were examined by IF microscopy.
- virus spread, and the morphology of virus-induced syncytia were similar in control and knock down cell lines [Fig. 9].
- BAG3 The role of BAG3 is disclosed herein as a host protein that interacts with VZV ORF29p.
- a lambda cDNA expression library screen identified BAG3 as a host protein that interacts with ORF29p.
- Far western blotting showed that ORF29p associates in vitro with full-length BAG3 and fragments that contain the BAG domain.
- the region of ORF29p that is required to form the complex lacks the NLS, suggesting that the direct biological role of the interaction is not the association of ORF29p with the nuclear import machinery.
- the far western assay also demonstrated that ORF29p does not directly interact with Hsp70, a known BAG3 partner [Fig. IE].
- the interaction of the protein with BAG3 is either direct or bridged by other proteins present in the rabbit reticulocyte lysate.
- VZV Unlike other human alphaherpesviruses, VZV expresses a subset of its genome during latency. It is believed that that the LAPs may passively maintain the latent state because they fail to accumulate in the nucleus and thus render the virus unable to replicate. However, a more active role is also possible. Successful maintenance of latency requires the survival of infected neurons.
- B-cell lymphoma 2 (Bcl-2) a well described oncoprotein and potent inhibitor of apoptosis (11), heterodimerizes with members of the Bcl-2 protein family, including the proapoptotic factor Bax .
- BAG3 and other BAG family members interact with Bcl-2 and synergize with it to prevent Bax induced cell death (1, 42) .
- the interaction of ORF29p with BAG3 raises the possibility that expression of this LAP in latently infected neurons can regulate apoptosis.
- molecular chaperones recognize and associate with all nascent polypeptides as they exit the ribosome to prevent illegitimate interactions between exposed hydrophobic surfaces and to assist proteins in adopting their native conformation (25) .
- molecular chaperones can also direct protein turnover, unlike the folding of newly synthesized proteins, only a subset of the cellular polypeptides is degraded by this pathway.
- recognition mechanisms exist to differentially target proteins, such as ORF29p, to the proteasome, but spare others, such as ORF63p. It is likely that the interaction of co-chaperones, e.g. BAG3, with their clients alters the activity of the chaperones resulting in differential targeting.
- Bacterial chaperones are essential for lytic replication of bacteriophage lambda.
- DnaK the prokaryotic homolog of Hsp70
- the GroES/EL chaperone system is required for folding and multime ⁇ zation of the connector complex, which is similar to the portal structure of HSV-I (28) .
- the replication machinery of DNA animal viruses such as papillomaviruses and polyomaviruses, also interacts with eukaryotic chaperone proteins (10,46). However, the function of such interactions has not yet been determined.
- BAG3 interacts with ORF29p, a component of the VZV replication machinery, the results suggest that it facilitates virus genome replication.
- inefficient replication results in a temporal delay m the accumulation of viral progeny and drastically decreased levels of late glycoproteins that are required for cell-fusion (17), thus limiting the spread of VZV to adjacent cells.
- Hsp70 localizes adjacent to but not
- Hsps "7 O and 90 are uniformly distributed throughout replication sites formed m VZV infected cells [Fig. 6].
- Hsp70/Hsc70 25 and Hsp70/Hsc70.
- Virus infection of permissive cells results in commandeering the cell's chaperone machinery to sites of replication/transcription to promote virus growth and spread.
- drug inhibition of Hsp90 function or reduction of the levels of the Hsp70 activity regulator BAG3 result in greatly
- heat shock proteins serve as a component of a molecular switch that ' regulates the shift between lytic and latent infection.
- Herpes simplex virus type 1 DNA polymerase requires the mammalian chaperone hsp90 for proper localization to the nucleus. J Virol 79:10740-9.
- VZV VL ⁇ US
- VZV Varicella-zoster virus
- VZV Varicella-zoster virus
- VZV Varicella-zoster virus
- RNA polymerase II and facilitates its recruitment to herpes simplex virus 1 transcription sites, where it undergoes proteasomal degradation during infection. J Virol 80:3567- 81.
- L5 49 Lungu, O., C. A. Panagiotidis, P. W. Annunziato, A. A. Gershon, and S. J. Silverstem. 1998. Aberrant intracellular localization of Varicella-Zoster virus regulatory proteins during latency. Proc Natl Acad Sci U S A 95:7080-5. 0 50. Macgregor, P. F., C. Abate, and T. Curran. 1990. Direct cloning of leucine zipper proteins: Jun binds cooperatively to the CRE with CRE-BPl. Oncogene 5:451-8.
- Lambda ZAP a bacteriophage lambda expression vector with in vivo excision properties. Nucleic Acids Res 16: 7583-600.
- Epstem-Barr virus nuclear antigen (EBNA) 3A induces the expression of and interacts with a subset of chaperones and co- chapercnes. J Gen Virol. 89:866-77.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Methods are provided of inhibiting Varicella zoster virus replication or Epstein-Barr Virus replication in a cell of a host by contacting the cell with an amount of a modulator of host chaperone protein activity effective to inhibit Varicella zoster virus replication or Epstein-Barr Virus replication in the cell. Pharmaceutical compositions for inhibiting Varicella zoster virus or Epstein-Barr virus are provided. Methods of treating a subject infected with Varicella zoster virus or Epstein-Barr virus are provided.
Description
METHODS OF INHIBITING VZV REPLICATION AND RELATED COMPOSITIONS
This application claims the benefit of copending U.S. Provisional Application No. 60/962,104, filed July 25, 2007, the contents of which are hereby incorporated by reference.
The invention disclosed herein was made with government support under grant No. AI-024021 from the National Institutes of Health, Public Health Service. Accordingly, the U.S. Government has certain rights in this disclosure.
Throughout this application, various publications are referenced in parentheses by Arabic numeral. Full citation of these references can be found immediately preceding the claims section. The disclosures of these publications in their entireties are hereby incorporated by reference into this application to more fully describe the state of the art to which this invention pertains .
Background of Invention
As obligate intracellular parasites, viruses replicate inside living cells using the metabolic machinery of the host. Because of their limited coding potential, viruses have evolved means to hijack the host cell machinery and exploit it to their advantage.
Varicella-zoster virus [VZV] is an alphaherpesvirus that invades the dermis and epidermis during primary lytic infection and causes chicken pox [varicella] . After viral DNA replication and production of infectious progeny, the virus moves into the dorsal root ganglia to establish latency (2, 3, 12, 48) . Although DNA replication, late gene expression and virion production cease during latency, a limited repertoire of immediate early and early gene products, including the protein products of open reading frames [ORFs] 4, 21, 29, 62, 63 and 66 are still detected, and
these latency associated proteins [LAPs] are πberrantLy localized in the cytopLasm (L3-16, L9, 32, 37, 49, 56).
Although VZV can infect both epidermal and neuronal cells, the outcome of infection and the localisation of a subset of viral b proteins, the LAPs, depend on the mfected cell type. This suggests that cell specific pathways, in addition to the interactions between cellular and viral proteins, can determine whether virus replication is lytic or Latent.
LO Tt has been suggested that in response to certain stimuli, the LAPs translocate from the cytoplasm to the nucleus and the virus exits latency. This switch is likely regulated by a change in the host cell milieu. Therefore, elucidation of the molecular mechanisms governing nuclear targeting and exclusion of the LAPs
Lb and unraveling of their web of interactions with host cell proteins may shed light un the mechanisms controlling the replication and reactivation processes of the virus.
VZV ORF29 encodes a single-stranded DNA binding protein O [ORF29p] (SEQ ID NO: 16), which is assumed to function during viral DNA replication. Similar to the other LAPs, ORF29p is predominantly nuclear during lytic infection and reactivation, but is excluded from the nucleus during latency (39, 49). Nuclear import of ORF29p occurs in the absence of other VZV encoded 5 proteins via its non-classical nuclear localization signal [NLS]
(71), and the localization of the protein is cell-type specific and correlates with its stability (70) . These observations suggest that the host affects the rate of ORF29p degradation and alters its localization pattern. However, the molecular 0 mechanisms governing these processes are unknown.
In eukaryotic cells the ubiquitm-proteasome system it> tne mam pathway for recycling polypeptides and eliminating misfolded or mutated proteins (34) . It is well established that the native 5 state of newly synthesized and stress-denatured proteins is attained by the ATP hydrolysis-driven function of molecular
chaperones or heat shock proteins (27). The same machinery is also used for the recognition of folding-incompetent proteins that should be poly-ubiquitmated and targeted for degradation. Thus, there is a functional link between the folding activity of molecular chaperones and proteasomal degradation.
These evolutionaπly conserved activities of chaperones also augment DNA replication. DnaK and DnaJ from E. coll were first identified as proteins that are necessary for bacteriophage DNA replication (80). They specifically associate with a multicomponent preinitiation replication complex and are required for the initiation of DNA replication (81) . In addition, eukaryotic heat shock protein 70 (Hsp70) interacts with Orc4p of S. cerevisiae to prevent oligomeπzation of its M-terminal domain ^29) . Furthermore, the viral nuclear oncoprotein (EBNA3A) , which as been presumed to play an essential role in Epstem-Barr viral persistence in the human host, has been reported to induce the expression of cellular genes such as the chaperones risp70 and the the co-chaperone Bag3 (84) . Components of the replication machinery of animal DNA viruses, including the polyoma virus T antigen and papillomavirus helicase replication initiator protein El associate with mammalian chaperone proteins (10, 46) . However, unlike bacteria, in these cases the functional requirements for chaperone and co-chaperone proteins during host and virus replication remain unknown.
Several cell proteins are known to interact with the chaperone- client protein complexes and alter their function. Among these, members of the BAG family of proteins were shown to interact through their BAG domain with the N-termmal ATPase domain of Hsp70/Hsc70 (75), affecting the rate of ATP/ADP exchange and regulating their chaperone activity (4, 35).
Summary of Invention
A method is provided of inhibiting Varicella zoster virus b replication or Epstein-Barr virus replication in a cell of a host comprising contacting the cell with an amount of a modulator of host chaperone protein activity effective to inhibit Varicella zoster virus replication or Epstem-Barr virus replication in the cell.
10
A method is provided of enhancing exclusion of a Varicella zoster virus open reading frame 29 protein (ORF29p) from a nucleus of a cell comprising contacting the cell with an amount of an inhibitor of Hsp90 ATPase activity effective to enhance exclusion
J 5 of the ORF29p protein from the nucleus of the cell.
A pharmaceutical composition is provided comprising an amount of an ansamycm antibiotic effective in enhancing exclusion of a Varicella zoster virus open reading frame 29 protein (ORF29p) 7O from a nucleus of a host cell.
A pharmaceutical composition is provided comprising (i) an amount of an ansamycm antibiotic effective to inhibit replication of a Varicella zoster virus or Epstem-Barr virus in a cell of a host 25 and (ii) a pharmaceutically acceptable carrier.
A pharmaceutical composition is provided comprising (i) a short interfering nucleic acid directed to a nucleic acid encoding human BAG3 and (ii) a pharmaceutically acceptable carrier.
30
A pharmaceutical composition is provided comprising (i) a short interfering nucleic acid directed to a nucleic acid encoding human BAG3 effective in enhancing exclusion of a Varicella zoster virus open reading frame 29 protein (ORF29p) from a nucleus of a
35 host cell and (ii) a pharmaceutically acceptable carrier.
A pharmaceutical composition is provided comprising (i) a short interfering nucleic acid directed to a nucleic acid encoding human BAG3 effective in inhibiting replication of a Varicella zoster virus or Epstem-Barr virus in a cell of a host and (11) a pharmaceutically acceptable carrier.
A pharmaceutical composition comprising (i) a vector comprising a nucleic acid encoding a short interfering nucleic acid directed to a nucleic acid encoding human BAG3 a (11) pharmaceutically acceptable carrier.
A method is provided of treating a subject suffering from a Varicella zoster virus infection or Epstem-Barr virus infection comprising administering a nucleic acid which inhibits expression of a numan BAG3 gene so as to thereby treat the subject.
A method is provided of treating cold sore comprising administering to the cold sore treatment site a nucleic acid which inhibits expression of a human BAG3 gene so as to thereby treat the cold sore.
A method is provided of identifying an agent as an inhibitor of Varicella zoster virus replication or Epstem-Barr virus replication in a host cell comprising: a. quantitating the activity of a chaperone protein of the host cell; b. contacting the chaperone protein with the agent; and c. quantitating the activity of the chaperone protein in the presence of the agent, wherein an increase or decrease in activity of the host chaperone protein activity as quantitated in step a) compared to host chapercne protein activity cts quantitated in step c) indicates that the agent is an inhibitor of Varicella zoster virus replication or Epstem-Barr virus replication in the host cell.
A method is provided of treating a subject suffering from a Varicella zoster virus infection or Epstein-Barr virus infection comprising administering to the subject an amount of modulator of a chaperone protein activity effective to inhibit Varicella zoster virus replication or Epstein-Barr virus replications in the subject and thereby treat the subject.
A method is provided of treating cold sore comprising administering to the cold sore treatment site with an amount of modulator of a chaperone protein activity effective to inhibit Varicella zoster virus replication or Epstein-Barr virus replications in the subject and thereby treat the cold sore.
Brief Description of the Drawings
Figure 1. ORF29p and BAG3 interact in vitro. [A & B] Schematic diagram of bcl2-associated anathogene-3 (BAG3) and open reading fcrame 29 protein (ORF29p) . [C] Glutathione-S-transferease (GST) , GST-BAG3, GST- BAG3par, GST-BAG3ag and GST-heat shock protein 70 (Hsp70) were overexpressed in E. coli and purified using affinity chromatography. Four μg of each protein was analyzed by SDS-PAGE and stained with Coomassie Brilliant Blue R-250. [D] Plasmids encoding ORF29p, ORF29p[l-345] , ORF29p [ 346-1203 ] and open reading frame 63 (ORF63) were used in coupled transcription/translation reactions to prepare S-met- labeled proteins. Two μl of each reaction was analyzed by SDS-PAGE and autoradiography. [E-H] One μg of each purified protein was subjected to SDS-PAGE, transferred to nitrocellulose membranes, renatured in situ and blotted with [E] ORF29p, [F] ORF29p [ 1-345] ,
[G] ORF29p[346-1203] or [H] ORF63ρ. The membranes were dried and exposed to X-ray film.
Figure 2. ORF29p interacts with BAG3 and Hsp70/Hsc70 in vivo. [A] 293T cells were transiently transfected with plasmids expressing ORF29p, flag-tagged BAG3 or both. Equal amounts of total protein were incubated with anti-flag M2 matrix and the bound material was analyzed by western blot with anti-ORF29p antibodies. [B] Confluent MeWo cells were either mock infected or infected with cell-free VZV at an MOI of 0.01. Three days post infection cells were lysed and equal amounts of total protein were incubated with beads containing anti-BAG3 or anti-ORF29p antibodies. Western blotting of the bound materials was performed with anti-ORF29ρ or anti-
Hsp70/Hsc70 antibodies.
Figure 3. Half life of ORF29p. MeWo cells were infected with an adenovirus expressing ORF29p at an MOI of 10. At 24 hpi DMSO or 1.5μM geldanamycin was added to the medium. At 36 hpi, cells were labeled with 500uCi/ml Trans' S-label for 1 h in the presence of DMSO [lanes 2-5] or geldanamycin [lanes 6-9]. The labeling medium was replaced with DMEM supplemented with 10% fetal calf serum serum, 2mM methionine, 4mM cysteine and DMSO or 1.5μM geldanamycin for the indicated chase times. Cells were harvested and lysed and ORF29p levels were determined following immunoprecipitation and SDS-PAGE. Proteins were visualized by autoradiography and band intensity Λfas quantified using ImageJ. Percent ORF29p was calculated relative to the amount present at the 0- h chase time point.
Figure 4. Localization of ORF29p and ORF63p in cells treated with ansamycin antibiotics. MeWo cells were infected with an adenovirus expressing ORF29p [A-C] or ORF63p [D-F] .
After virus adsorption medium was replaced with DMEM supplemented with 20 fetal calf serum and DMSO [A and D], 1.5μM geldanamycin [B and E] or 0.5μM 17- dimethylaminoethylamino-17-demethoxy-geldanamycin (17DMAG) [C and F]. At 48 hpi cells were fixed and
ORF29p or ORF63p were detected by indirect immunofluorescence microscopy after reaction with specific antibodies. Images were viewed and captured using a 63x objective.
Figure 5. VZV plaque and spread assays in cells treated with ansamycin antibiotics. [A] Confluent MeWo monolayers were infected with cell-free VZV. After virus adsorption the medium was replaced with DMEM supplemented with the indicated concentrations of geldanamycin or 17DMAG. The cells were fixed, stained
with crystal vioLet and pLaques were counted after 4 days. [B] Confluent MeWo cell cultures were infected with cell free VZV. After virus adsorption medium was replaced WLth DMEM supplemented with 1.5μM qeldanamycin. The cells were fixed at the indicated times post infection and the presence and intracellular localization of ORF29p and gE were determined by indirect immunofluorescence microscopy after reaction with specific antibodies. ORF29p is visualized after reaction with goat anti-rabbit antibody conjugated to Alexafluor 546 (gray) and gE with goat anti-mouse conjugated to Alexafluor 488 (white) . Images were viewed and captured using a 1Ox objective .
Figure 6. Localization of ORF29p, ORF62p, Hsp90, Hsp70/Hsc70 and BAG3 in cells infected with VZV. MeWo cells were infected with cell free VZV at an MOI of approximately 0.01. After 24 h cells were fixed and the localization of the indicated proteins was visualized after reaction with specific antibodies. Images were captured with a 10Ox objective and analyzed by volume deconvolution .
Figure 7. VZV and HSV plaque assay in BAG3 siRNA MeWo cells. [A]
Schematic diagram of BAG3 mRNA, coding sequence and siRNA targeting constructs. [B] empty, si737, si2235 MeWo cells, and si2235 cells infected with AdBAG3 at an MOI of 20 were lysed in RIPA buffer and equal amounts of total protein were analyzed by western blot with anti-BAG3 and anti-GAPDH antibodies. The protein levels were quantified using ImageJ and the percent of remaining BAG3 was calculated after normalization to the GAPDH levels. [C] Confluent monolayers of empty, si737, si2235 and si2235 cells pre-mfected with
AdBAG3 at an MOI of 20 were infected with cell free
VZV [white] . Monolayers of empty, si737 and si2225 cells were infected with HSV-I [gray] . Three or two days post infection respectively, cells were fixed and plaques were stained and counted. In each experiment serial 10-fold dilutions of virus were titrated on the previously described monolayers. The plaque numbers in the different cell lines were then normalized to the number of plaques that formed in the empty cell line. The error bars represent the standard deviation of the mean for three representative analyses.
Figure 8. VZV spread assay in BAG3 siRNA MeWo cells. Confluent monolayers of empty, si737, si2235 and si2235 cells pre-mfected with AdBAG3 at an MOI of 20 were infected with cell free VZV. The cells were fixed at the indicated time points and the presence and localization of gE and ORF63p were determined. Images were viewed and captured using a 1Ox objective.
Figure 9: HSV spread assays in BAG3 siRNA MeWo cells. Confluent monolayers of empty and si2235 cells were infected with 200 pfu of HSV. The cells were fixed at 48 hpi and the presence and localization of ICPO and gC were determined. Images were viewed and captured using a 1Ox objective.
Detailed Description of Invention
Terms
As used herein, "Varicella Zoster Virus" shall mean the human alphaherpesvirus which causes varicella (chickenpox) and herpes zoster (shingles) . Varicella Zoster Virus (VSV) is also known as Varicella virus, zoster virus and human herpes 3 (HHV-3) .
As used herein, "Epstein-Barr Virus" shall mean the human gammaherpesvirus of the genus Lymphocryptoviruses which causes infectious mononucleosis that can affect liver, lymph nodes and oral cavity. Epstein-Barr Virus (EBV) is also known Human herpesvirus 4 (HHV-4) .
ORF29p is described in U.S. Patent No. 6,309,182, issued October 26, 2004, the contents of which are hereby incorporated by reference .
As used herein a chaperone protein is a protein, for example a heat shock protein, which functions to assist a second protein in achieving proper folding in a cell. By way of non-limiting example, human chaperone proteins include heat shock protein 70/heat shock protein 70 cognate (Hsp70/Hsc70) complex, heat shock protein 90 (Hsp90) , heat shock protein 60 (HspδO) and heat shock protein 100 (HsplOO) . A co-chaperone is a protein which assists the chaperone protein in assisting the second protein to fold. By way of non-limiting example, human co-chaperone proteins include bcl-2 associated anthanogene-1 and bcl-2 associated anthanogene-3 (BAG3) .
As used herein a host is a subject infected by a varicella zoster virus or Epstein-Barr Virus. By way of non-limiting example, a host includes a mammal, for example a human. A cell of the host may be a cell removed from the host and place, e.g. in vitro, or
a cell which is in vivo in the host. The cell of the host may be LΠ situ.
A modulator of chaperone protein activity as used herein, unless otherwise indicated, 10 a disruptor, attenuator, inhibitor or enhancer of the activity of the chaperone protein. The modulation may be direct, by interacting with the chaperone, or indirect, by interacting with a pathway that interacts with the chaperone, e.g. by affecting a co-chaperone of the chaperone.
As used herein an amino-acid residue is the monomer entity of a polypeptide structure that lacks a hydrogen atom of an amino acid amino group (-NH-CHR-COOH), or the hydroxyl moiety of an amino icid carboxyl group (NH -CHR-CO-) , or both (-NH-CHR-CO-) . By way of example, the monomer units of a peptide chain are ammo-acid residues .
An "antibody" shall include, without limitation, an immunoglobulin molecule comprising two heavy chains and two light chains and which recognizes an antigen. The immunoglobulin molecule may derive from any of the commonly known classes, including but not limited to IgA, secretory IgA, IgG and IgM. IgG subclasses are also well known to those in the art and include but are not limited to human IgGl, IgG2, IgG3 and IgG4. "Antibody" includes, by way of example, both naturally occurring and non-naturally occurring antibodies; monoclonal and polyclonal antibodies; chimeric and humanized antibodies; human or nonhuman antibodies; wholly synthetic antibodies; and single chain antibodies. A nonhuman antibody may be humanized by recombinant methods to reduce its immunogenicity in man. Methods for humanizing antibodies are well known to those skilled in the art. "Antibody" also includes, without limitation, a fragment or portion of any of the afore-mentioned immunoglobulin molecules and includes a monovalent and a divalent fragment or portion. Antibody fragments include, for example, Fc fragments and antigen-binding fragments (Fab) .
"Monoclonal antibodies," also designated a mAbs, are antibody molecules whose primary sequences are essentially identical and which exhibit the same antigenic specificity. Monoclonal b antibodies may be produced by hybπdoma, recombinant, transgenic or other techniques known to those skilled in the art.
A "humanized" antibody refers to an antibody wherein some, most or all of the ammo acids outside the CDR regions are replaced
LO with corresponding ammo acids derived from human immunoglobulin molecules. In one embodiment of the humanized forms of the antibodies, some, most or all of the ammo acids outside the CDR regions have been replaced with ammo acids from human immunoglobulin molecules, whereas some, most or all ammo acids
L5 within one or more CDR regions are unchanged. Small additions, deletions, insertions, substitutions or modifications of amino acids are permissible as long as they do not abrogate the ability of the antibody to bind a given antigen. Suitable human immunoglobulin molecules include IgGl, IgG2, IgG3, IgG4, IgA, IgE 0 and IgM molecules. A "humanized" antibody retains an antigenic specificity similar to that of the original antibody.
One skilled in the art would know how to make the humanized antibodies of the subject invention. Various publications, 5 several of which are hereby incorporated by reference into this application, also describe how to make humanized antibodies. For example, the methods described in United States Patent No. 4,816,567 comprise the production of chimeric antibodies having a variable region of one antibody and a constant region of another 0 antibody.
United States Patent No. 5,225,539 describes another approach for the production of a humanized antibody. This patent describes the use of recombinant DNA technology to produce a humanized antibody 5 wherein the CDRs of a variable region of one immunoglobulin are replaced with the CDRs from an immunoglobulin with a different
specificity such that the humanized antibody would recognize the desired target but would not be recognized in a bignificant way by the human subject's immune system. Specifically, site directed mutagenesis is used to graft the CDRs onto the framework.
The human melanoma (MeWo) fibroblast cell line is available from the American Type Culture Collection (ATCC) , P.O. Box 1549, Manassas, Virginia, 20108, as ATCC No. HTB-65.
The human 293T fibroblast cell line is available from the American Type Culture Collection (ATCC), P.O. Box 1549, Manassas, Virginia, 20108, as ATCC No. CPL-11268.
As used herein "complementary" with regard to a nucleic acid sequence shall mean from 75% matching to a fully matching a sequence by base-pairing, unless otherwise stated.
As used herein, "administering" an agent, for example a modulator, may be performed using any of the various methods or delivery systems well known to those skilled in the art. The administering can be performed, for example, orally, parenterally, mtraperitoneally, intravenously, intraarterially, transdermally, sublmgually, intramuscularly, rectally, transbuccally, mtranasally, liposomally, via inhalation, vaginally, mtraoccularly, via local delivery, subcutaneously, intraadiposally, intraarticularly, intrathecally, into a cerebral ventricle, intraventicularly, intratumorally, into cerebral parenchyma or intraparenchchymally .
The following delivery systems, which employ a number of routinely used pharmaceutical carriers, may be used but are only representative cf the many possible systems envisioned for administering compositions in accordance with the invention.
Transmucosal delivery systems include patches, tablets, suppositories, pessaries, gels and creams, and can contain
excipients such as solubilizers and enhancers (e.g., propylene glycol, bile salts and amino acids), and other vehicles (e.g., polyethylene glycol, fatty acid esters and derivatives, and hydrophilic polymers such as hydroxypropylmethylcellulose and hyaluronic acid) .
Dermal delivery systems include, for example, aqueous and nonaqueous gels, creams, multiple emulsions, microemulsions, liposomes, ointments, aqueous and nonaqueous solutions, lotions, aerosols, hydrocarbon bases and powders, and can contain excipients such as solubilizers, permeation enhancers (e.g., fatty acids, fatty acid esters, fatty alcohols and ammo acids), and hydrophilic polymers (e.g., polycarbophil and polyvinylpyrolidone) . In one embodiment, the pharmaceutically acceptable carrier is a liposome or a transdermal enhancer.
Oral delivery systems include tablets and capsules. These can contain excipients such as binders (e.g., hydroxypropylmethylcellulose, polyvinyl pyrilodone, other cellulosic materials and starch), diluents (e.g., lactose and other sugars, starch, dicalcium phosphate and cellulosic materials), disintegrating agents (e.g., starch polymers and cellulosic materials) and lubricating agents (e.g., stearates and talc) .
Injectable drug delivery systems include solutions, suspensions, gels, microspheres and polymeric injectables, and can comprise excipients such as solubility-altering agents (e.g., ethanol, propylene glycol and sucrose) and polymers (e.g., polycaprylactones and PLGA' s).
Implantable systems include roαs ana discs, and can contain excipients such as PLGA and polycaprylactone .
Solutions, suspensions and powders for reconstitutable delivery systems include vehicles such as suspending agents (e.g., gums,
zanthans, cellulosics and sugars), humectants (e.g., sorbitol), solubilizers (e.g., ethanol, water, PEG and propylene glycol), surfactants (e.g., sodium lauryl sulfate, Spans, Tweens, and cetyl pyridine), preservatives and antioxidants (e.g., parabens, vitamins E and C, and ascorbic acid) , anti-caking agents, coating agents, and chelating agents (e.g., EDTA).
Pharmaceutically acceptable carriers suitable for topical administration and equivalent terms refer to pharmaceutically acceptable carriers, as described herein above, suitable for topical application. An inactive liquid or cream vehicle capable of suspending or dissolving the active agent (s), and having the properties of being nontoxic and non-inflammatory when applied to the skin is an example of a pharmaceutically-acceptable topical carrier. This term is specifically intended to encompass carrier materials approved for use in topical cosmetics as well.
The composition described herein may comprise a pharmaceutically acceptable additive. The term "pharmaceutically acceptable additive" refers to preservatives, antioxidants, fragrances, emulsifiers, dyes and excipients known or used in the field of drug formulation and that do not unduly interfere with the effectiveness of the biological activity of the active agent, and that is sufficiently non-toxic to the host or patient. Additives for topical formulations are well-known in the art, and may be added to the topical composition, as long as they are pharmaceutically acceptable and not deleterious to the epithelial cells or their function. Further, they should not cause deterioration in the stability of the composition. For example, inert fillers, anti-irritants, tackifiers, excipients, fragrances, opacifiers, antioxidants, gelling agents, stabilizers, surfactant, emollients, coloring agents, preservatives, buffering agents, other permeation enhancers, and other conventional components of topical or transdermal delivery formulations as are known in the art.
The term "topical, administration" refers to the application of a pharmaceutical agent to the external surface of the skin, such that the agent crosses the external burface of the skin and enters the underlying tissues. Topical administration includes application of the composition to intact skin or to an broken, raw or open wound of skin. Topical administration of a pharmaceutical agent can result in a limited distribution of the agent to the skin and surrounding tissues or, when the agent is removed from the treatment area by the bloodstream, can result in systemic distribution of the agent.
The term, "ocular delivery" refers to intraocular injection, topical conjunctival application, topical corneal application or a mechanical delivery device for delivery to localized disease sites, delivery systems useful in the method of the present invention may be employed m such sterile liquid forms such as solutions, suspensions or emulsions.
The term "transdermal delivery" refers to the diffusion of an agent across the barrier of the skin resulting from topical administration or other application of a composition. The stratum corneum acts as a barrier and few pharmaceutical agents are able to penetrate intact skin. In contrast, the epidermis and dermis are permeable to many solutes and absorption of drugs therefore occurs more readily through skin that is abraded or otherwise stripped of the stratum corneum to expose the epidermis. Transdermal delivery includes injection or other delivery through any portion of the skin or mucous membrane and absorption or permeation through the remaining portion. Absorption through intact skin can be enhanced by placing the active agent in an appropriate pharmaceutically acceptable vehicle before application to the skin. Passive topical administration may consist of applying the active agent directly to the treatment site in combination with emollients or penetration enhancers. As used herein, transdermal delivery is intended to include delivery by permeation through or past the integument, i.e. skin.
A method is provided of inhibiting Varicella zoster virus replication or Epstein-Barr virus replication in a cell of a host comprising contacting the cell with an amount of a modulator of 5 host chaperone protein activity effective to inhibit Varicella zoster virus replication or Epstein-Barr virus replication in the cell.
In an embodiment the host chaperone protein is a heat shock LO protein.
In an embodiment the heat shock protein is Hsp90. In an embodiment the modulator of host chaperone protein activity is an inhibitor of Hsp90 ATPase activity. In an embodiment the
15 inhibitor of Hsp90 ATPase activity is an ansamycin antibiotic. In an embodiment the inhibitor of Hsp90 ATPase activity is geldanamycm. In an embodiment the inhibitor of Hsp90 ATPase activity is 17-dimethylaminoethylamino-17-demethoxy-geldanamycin (17DMAG) .
?0
In an embodiment the host chaperone protein is Hsp70/Hsc70.
In an embodiment the modulator of host chaperone protein activity is an inhibitor of a co-chaperone protein activity. In an
25 embodiment the modulator of host chaperone protein activity is an inhibitor of a co-chaperone protein expression. In an embodiment the inhibitor of a co-chaperone protein expression is an inhibitor of bcl2-associated anathogene 3 (BAG3) expression. In an embodiment the BAG3 comprises consecutive amino acid residues
30 having the sequence set forth in SEQ ID N0:l.
This disclosure relates to compounds, compositions, and methods useful for modulating BAG3 gene expression using short interfering nucleic acid (siNA) molecules. This disclosure also 35 relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in
pathways of BAG3 gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant disclosure features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short
5 interfering RNA (siRNA) , double-stranded RNA (dsRNA) , micro-RNA
(miRNA) , and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of BAG3 genes, including human BAG3.
In an embodiment the inhibitor of BAG3 expression is a nucleic
JO acid which inhibits expression of a BAG3 gene. In an embodiment the inhibitor of BAG3 expression is a nucleic acid which inhibits translation of a mRNA which encodes a BAG3. In an embodiment the inhibitor of BAG3 expression is a nucleic acid which inhibits the translation of a nucleic acid comprising consecutive nucleotides
L5 having the sequence set forth in SEQ ID NO: 2.
In an embodiment the nucleic acid is, or upon transcription becomes, a short interfering ribonucleic acid. In an embodiment the short interfering ribonucleic acid comprises two ribonucleic
"1O acid strands, a first strand which comprises about 15 to about 28 ribonucleotides the sequence of which is complementary to a sequence of consecutive nucleotides present within a gene encoding a BAG3, and a second strand which comprises about 15 to about 28 ribonucleotides, the sequence of which is complementary 5 to the first strand. I an embodiment the strands are fully complementary. In embodiments the strands are complementary over 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 ribonucleotides of their length. In embodiments the first strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 0 ribonucleotides in length. In embodiments the second strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 ribonucleotides in length.
In an embodiment the BAG3 gene is a human BAG3 gene. 5
In an embodiment the two strands of the short interfering ribonucleic acid are base paired for 19 consecutive nucleotides and have a 2-nucleotide overhang at their respective 3' ends. In an embodiment one or more of the ribonucleotides is modified in a sugar or base present therein. In an embodiment at least one of the strands comprises an inter-ribonucleotide phosphorothioate bond. In an embodiment the nucleic acid is a shRNA. In an embodiment the nucleic acid is a siRNA.
"siRNA" shall mean small interfering ribonucleic acid, i.e. a short (e.g. 21-23 nt) RNA duplex which can elicit an RNA interference (RNAi) response in a mammalian cell. siRNAs may be blunt ended or have mono, di or trinucleotide 3' overhangs.
"shPNA" shall mean short hairpin interfering ribonucleic acid containing a double stranded base-paired segment, each strand of which is contiguous at one of its ends with a loop (or non-base- paired) segment and which can be processed in a cell into a siRNA. By way of example, the base-paired segment can be 19 base- pairs in length.
In one embodiment, the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that down- regulates expression of a target gene or that directs cleavage of a target RNA, wherein said siNA molecule comprises about 15 to about 28 base pairs. In one embodiment, the disclosure features a double stranded short interfering nucleic acid (siNA) molecule that directs cleavage of a target RNA via RNA interference (RNAi), wherein the double stranded siNA molecule comprises a first and a second strand, each strand of the siNA molecule is about 18 to about 28 nucleotides in length, the first strand of the siNA molecule comprises nucleotide sequence having sufficient complementarity to the target RNA for the siNA molecule to direct cleavage of the target RNA via RNA interference, and the second strand of said siNA molecule comprises nucleotide sequence that is complementary to the first strand.
In one embodiment, the disclosure features a double stranded short interfering nucleic acid (siNA) molecule that directs cleavage of a target RNA via RNA interference (RNAi) , wherein the double otranded biNA molecule comprises a first and a second strand, each strand of the siNA molecule is about 18 to about 23 nucleotides in length, the first strand of the siNA molecule comprises nucleotide sequence having sufficient complementarity to the target RNA for the siNA molecule to direct cleavage of the target RNA via RNA interference, and the second strand of said siNA molecule comprises nucleotide sequence that is complementary to the tirst strand.
In one embodiment, the disclosure features a chemically synthesized αouble stranded short interfering nucleic acid (SJ-NA) molecule that directs cleavage of a target PNA via PNA interference (RNAi) , wherein each strand of the siNA molecule is about 18 to about 28 nucleotides in length; and one strand of the siNA molecule comprises nucleotide sequence having sufficient complementarity to the target RNA for the siNA molecule to direct cleavage of the target RNA via RNA interference.
In one embodiment, the disclosure features a chemically synthesized double stranded short interfering nucleic acid (siNA) molecule that directs cleavage of a target RNA via RNA interference (RNAi) , wherein each strand of the siNA molecule is about 18 to about 23 nucleotides in length; and one strand of the siNA molecule comprises nucleotide sequence having sufficient complementarity to the target RNA for the siNA molecule to direct cleavage of the target RNA via RNA interference.
In one embodiment, the disclosure features a siNA molecule that down-regulates expression of a target gene or that directs cleavage of a target RNA, for example, wherein the gene comprises protein encoding sequence. In one embodiment, the disclosure features a siNA molecule that down-regulates expression of a
target gene or that directs cleavage of a target RNA, for example, wherein the gene comprises non-coding sequence or (sncodes sequence ot regulatory elements involved in gene expression (e.g. non-coding RNA).
In one embodiment, the disclosure features a siNA molecule having RNAi activity against target RAD9 RNA (e.g., coding or non-codmg RNA) , wherein the siNA molecule comprises a sequence complementary to any RNA sequence encoding a RAD9 or portion thereof. In another embodiment, the disclosure features a siNA molecule having RNAi activity against target RNA, wherein the siNA molecule comprises a sequence complementary to an RNA having variant encoding sequence
Chemical modifications can be applied to any siNA construct of the disclosure. In another embodiment, a siNA molecule of the disclosure includes a nucleotide sequence that can interact with nucleotide sequence of a target gene and thereby mediate silencing of gene expression, for example, wherein the siNA mediates regulation of gene expression by cellular processes that modulate the chromatin structure or methylation patterns of the gene and prevent transcription of the gene.
In one embodiment of the disclosure a siNA molecule comprises an antisense strand comprising a nucleotide sequence that is complementary to a target polynucleotide sequence or a portion thereof. The siNA further comprises a sense strand, wherein said sense strand comprises a nucleotide sequence of a target polynucleotide sequence or a portion thereof, (e.g., about 15 to about 25 or more, or about 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, or 25 or more contiguous nucleotides in a target polynucleotide sequence) . In one embodiment, the target polynucleotide sequence is a target DNA. In one embodiment, the target polynucleotide sequence is a target RNA.
In one embodiment, the disclosure features a siNA molecule
comprising a first sequence, for example, the ant: sense sequence of the sxNA construct, complementary to a oequence or portion of sequence comprising sequence encoding RΛD9, and a second sequence, for example a sense sequence, that is complementary to the antisense sequence.
In one embodiment of the disclosure a siNA molecule comprises an antisense strand having about L5 to about 30 (e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, wherein the antisense strand is complementary to a target RNA sequence or a portion thereof, and wherein said siNA further comprises a sense strand having about 15 to about 30 (e.g. 15, 16, 17, 13, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, and wherein said sense strand and said antisense strand are distinct nucleotide sequences where at least about 15 nucleotides in each strand are complementary to the ether strand.
In another embodiment of the disclosure a siNA molecule of the disclosure comprises an antisense region having about 15 to about 30 (e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, wherein the antisense region is complementary to a target DNA sequence, and wherein said siNA further comprises a sense region having about 15 to about 30 (e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, wherein said sense region and said antisense region are comprised in a linear molecule where the sense region comprises at least about 15 nucleotides that are complementary to the antisense region.
In one embodiment, the siNA molecule can be designed to target a sequence that is unique to a specific target RNA sequence (e.g., a single allele or single nucleotide polymorphism (SNP) ) due to the high degree of specificity that the siNA molecule requires to mediate RNAi activity.
In one embodiment, nucleic acid molecules of the disclosure that act as mediators of the RNA interference gene silencing response are double-stranded nucleic acid molecules. In another '5 embodiment, the siNA molecules of the disclosure consist of duplex nucleic acid molecules containing about 15 to about 30 base pairs between oligonucleotides comprising about 15 to about 30 (e.g., -lbout 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides. In yet another embodiment, siNA
LO molecules of the disclosure comprise duplex nucleic acid molecules with overhanging ends of about 1 to about 3 (e.g., about 1, 2, or 3) nucleotides, for example, about 21-nucleotide duplexes with about 19 base pairs and 3 '-terminal mononucleotide, dmucleotide, or trinucleotide overhangs. In yet another
L5 embodiment, siNA molecules of the disclosure comprise duplex nucleic acid molecules with blunt ends, where both ends are blunt, or alternatively, where one of the ends is blunt.
Non-limiting examples of encompassed chemical modifications 20 include, without limitation, phosphorothioate mternucleotide linkages, 2 ' -deoxyπbonucleotides, 2 ' -O-methyl ribonucleotides, 2 ' -deoxy-2 ' -fluoro ribonucleotides, "universal base" nucleotides, "acyclic" nucleotides, 5-C-methyl nucleotides, and terminal glyceryl and/or inverted deoxy abasic residue incorporation. 5 These chemical modifications, when used in various siNA constructs, (e.g., RNA based siNA constructs), are shown to preserve RNAi activity in cells while at the same time, dramatically increasing the serum stability of these compounds. 0 In one embodiment, a siNA molecule of the disclosure comprises modified nucleotides while maintaining the ability to mediate RNAi. The modified nucleotides can be used to improve m vitro or in vivo characteristics such as stability, activity, and/or bioavailability. For example, a siNA molecule of the disclosure 5 can comprise modified nucleotides as a percentage of the total number of nucleotides present in the siNA molecule. As such, a
SiNA molecule ot the disclosure can generally comprise about 5o to about 100" modified nucleotides (e.g., about 5°, 10ιό, 151, 20?,, 25°n, 30°o, 353, 40°6, 45°o, 50°o, 55°O, 601, 65Qo, 70°o, 75°o, 80% 35°ft, 901, 95°o or 100% modified nucleotides) . The actual percentage of modified nucleotides present in a given siNA molecule will depend on the total number of nucleotides present in the siNA. If the siNA molecule is single stranded, the percent modification can be based upon the total number of nucleotides present in the single stranded siNA molecules. Likewise, if the siNA molecule is double stranded, the percent modification can be based upon the total number of nucleotides present in the sense strand, antisense strand, or both the sense and antisense strands .
One aspect of the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression ot a target gene or that directs cleavage of a target PNA. In one embodiment, the double stranded siNA molecule comprises one or more chemical modifications and each strand of the double-stranded siNA is about 21 nucleotides long. In one embodiment, the double-stranded siNA molecule does not contain any ribonucleotides. In another embodiment, the double-stranded siNA molecule comprises one or more ribonucleotides. In one embodiment, each strand of the double-stranded siNA molecule independently comprises about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, wherein each strand comprises about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides that are complementary to the nucleotides of the other strand. In one embodiment, one of the strands of the double-stranded siNA molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of the gene, and the second strand of the double-stranded siNA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence of the gene or a portion thereof.
In another embodiment, the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that down- regulates expression of a target gene or that directs cleavage of a target RNA, comprising an antisense region, wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence of the gene or a portion thereof, and a sense region, wherein the sense region comprises a nucleotide sequence substantially similar to the nucleotide sequence of the gene or a portion thereof. In one embodiment, the antisense region and the sense region independently comprise about 15 to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, wherein the antisense region comprises about 15 to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides that are complementary to nucleotides of the sense region.
In another embodiment, the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that down- regulates expression of a target gene or that directs cleavage of a target RNA, comprising a sense region and an antisense region, wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence of RNA encoded by the gene or a portion thereof and the sense region comprises a nucleotide sequence that is complementary to the antisense region.
In one embodiment, a siNA molecule of the disclosure comprises blunt ends, i.e., ends that do not include any overhanging nucleotides .
In one embodiment, any siNA molecule of the disclosure can comprise one or more blunt ends, i.e. where a blunt end does not have any overhanging nucleotides. In one embodiment, the blunt ended siNA molecule has a number of base pairs equal to the
number of nucleotides present in each strand of the siNA molecule. In another embodiment, the siNA molecule comprises one blunt end, for example wherein the 5 ' -end of the antisense strand and the 3 '-end of the sense strand do not have any overhanging ^ nucleotides. In another example, the siNA molecule comprises one blunt end, for example wherein the 3 ' -end of the antisense strand and the 5 '-end of the sense strand do not have any overhanging nucleotides. In another example, a siNA molecule comprises two blunt ends, for example wherein the 3 '-end of the antisense
10 strand and the 5 '-end of the sense strand as well as the 5 '-end of the antisense strand and 3 ' -end of the sense strand do not have any overhanging nucleotides. A blunt ended siNA molecule can comprise, for example, from about 15 to about 30 nucleotides (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
L5 28, 29, or 30 nucleotides) . Other nucleotides present in a blunt ended siNA molecule ran comprise, for example, mismatches, bulges, loops, or wobble base pairs to modulate the activity of the siNA molecule to mediate RNA interference. 0 By "blunt ends" is meant symmetric termini or termini of a double stranded siNA molecule having no overhanging nucleotides. The two strands of a double stranded siNA molecule align with each other without over-hanging nucleotides at the termini. For example, a blunt ended siNA construct comprises terminal nucleotides that 5 are complementary between the sense and antisense regions of the siNA molecule.
In one embodiment, the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that down- 0 regulates expression of a target gene or that directs cleavage of a target RNA, wherein the siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule. The sense region can be connected to 5 the antisense region via a linker molecule, such as a polynucleotide linker or a non-nucleotide linker.
Tn one embodiment, the disclosure Leatures double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a target gene or that directs cLeavage of a target PNA, wherein the oiNA molecule comprises about 15 Lo about 30
(e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, or 30) base pairs, and wherein each strand of the siNA molecule comprises one or more chemical modifications. In another embodiment, one of the strands of the double-stranded 3iNA molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence of a gene or a portion thereof, and the second strand of the double-stranded siMA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence or a portion thereof of the gene. In another embodiment, one of the strands of the double-stranded siNA molecule comprises a nucleotide sequence that is complementary to a nucleotide .sequence of a gene or portion thereof, and the second strand of the double-stranded siNA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence or portion thereof of the gene. In another embodiment, each strand of the siNA molecule comprises about 15 to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides, and each strand comprises at least about 15 to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides that are complementary to the nucleotides of the other strand.
In one embodiment, a siNA molecule of the disclosure comprises no ribonucleotides. In another embodiment, a siNA molecule of the disclosure comprises ribonucleotides.
In one embodiment, a siNA molecule of the dicclccare comprises an antisense region comprising a nucleotide sequence that is complementary to a nucleotide sequence of a target gene or a portion thereof, and the siNA further comprises a sense region comprising a nucleotide sequence substantially similar to the
nucleotide sequence of the target gene or a portion thereof. In another embodiment, the antisense region and the sense region each comprise about 15 to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides and the antisense region comprises at least about 15 to about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides that are complementary to nucleotides of the sense region. In another embodiment, the siNA is a double stranded nucleic acid molecule, where each of the two strands of the siNA molecule independently comprise about 15 to about 40
(e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 23, 33, 34, 35, 36, 37, 38, 39, or 40) nucleotides, and where one of the strands of the siNA molecule comprises at least about 15 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 or more) nucleotides that are complementary to the nucleic acid sequence of the gene or a portion thereof.
In one embodiment, a siNA molecule of the disclosure comprises a sense region and an antisense region, wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence of RNA encoded by a target gene, or a portion thereof, and the sense region comprises a nucleotide sequence that is complementary to the antisense region. In one embodiment, the siNA molecule is assembled from two separate oligonucleotide fragments, wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule. In another embodiment, the sense region is connected to the antisense region via a linker molecule. In another embodiment, the sense region is connected to the antisense region via a linker molecule, such as a nucleotide or non-nucleotide linker .
In one embodiment, the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that down- regulates expression of a target gene or that directs cleavage of a target RNA comprising a sense region and an antisense region,
wherein the antisense regxon comprises a nucleotide sequence that is complementary to a nucleotide sequence of RNA encoded by the target gene or a portion thereof and the sense region comprises a nucleotide oequence that is complementary to the antisense region, and wherein the siNA molecule has one or more modified pyrimidine and/or purine nucleotides. In one embodiment, the pyrimidine nucleotides in the sense region are 2'-O- methylpyrimidme nucleotides or 2 ' -deoκy-2 ' -fluoro pyrimidine nucleotides and the purine nucleotides present in the sense region are 2 ' -deoxy purine nucleotides. In another embodiment, the pyrimidine nucleotides in the sense region are 2 ' -deoxy-2 '- fluoro pyrimidine nucleotides and the purine nucleotides present in the sense region are 2'-O-methyl purine nucleotides. In another embodiment, the pyrimidine nucleotides in the sense region are 2 ' -deoxy-2 ' -fluoro pyrimidine nucleotides and the purine nucleotides present m the sense region are 2 ' -deoxy purine nucleotides. In one embodiment, the pyrimidine nucleotides m the antisense region are 2 ' -deoxy-2 ' -fluoro pyrimidine nucleotides and the purine nucleotides present in the antisense region are 2'-O-methyl or 2 ' -deoxy purine nucleotides. In another embodiment of any of the above-described siNA molecules, any nucleotides present in a non-complementary region of the sense strand (e.g. overhang region) are 2 '-deoxy nucleotides.
In one embodiment, the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that down- regulates expression of a target gene or that directs cleavage of a target RNA, wherein the siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule, and wherein the fragment comprising the sense reαion includes a terminal cap moiety at the 5 '-end, the 3 '-end, or both of the 5' and 3' ends of the fragment. In one embodiment, the terminal cap moiety is an inverted deoxy abasic moiety or glyceryl moiety. In one embodiment, each of the two fragments of the siNA molecule independently comprise about 15 to
about 30 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides. In another embodiment, each of the two fragments of the siNA molecule independently comprise about 15 to about 40 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 23, 33, 34, 35, 36, 37, 38, 39, or 40) nucleotides. In a non-limiting example, each of the two fragments of the siNA molecule comprise about 21 nucleotides.
In one embodiment, the disclosure features a siNA molecule comprising at least one modified nucleotide, wherein the modified nucleotide is a 2 ' -deoxy-2 ' -fluoro nucleotide. The siNA can be, for example, about 15 to about 40 nucleotides in length. In one embodiment, all pyrimidine nucleotides present in the siNA are 2 ' -deoxy-2 ' -fluoro pyrimidine nucleotides. In one embodiment, the modified nucleotides in the siNA include at least one 2 ' -deoxy- 2 ' -fluoro cytidine or 2 ' -deoxy-2 ' -fluoro uridine nucleotide. In another embodiment, the modified nucleotides in the siNA include at least one 2 '-fluoro cytidine and at least one 2' -deoxy-2 '- fluoro uridine nucleotides. In one embodiment, all uridine nucleotides present in the siNA are 2 ' -deoxy-2 ' -fluoro uridine nucleotides. In one embodiment, all cytidine nucleotides present in the siNA are 2 ' -deoxy-2 ' -fluoro cytidine nucleotides. In one embodiment, all adenosine nucleotides present in the siNA are 2'- deoxy-2 ' -fluoro adenosine nucleotides. In one embodiment, all guanosine nucleotides present in the siNA are 2 ' -deoxy-2 ' -fluoro guanosme nucleotides. The siNA can further comprise at least one modified internucleotidic linkage, such as phosphorothioate linkage. In one embodiment, the 2 ' -deoxy-2 ' -fluoronucleotides are present at specifically selected locations in the siNA that are sensitive to cleavage by ribonucleases, such as locations having pyrimidine nucleotides.
In one embodiment, the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that down- regulates expression of a target gene or that directs cleavage of a target RNA comprising a sense region and an antisense region,
wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence of RNA encoded by the gene or a portion thereof and the sense region comprises a nucleotide sequence that is complementary to the antisense b region, and wherein the purine nucleotides present in the antisense region comprise 2 ' -deoxy-purine nucleotides. In an alternative embodiment, the purine nucleotides present in the antisense region comprise 2'-0-methyl purine nucleotides. In either of the above embodiments, the antisense region can
LO comprise a phosphorothioate mternucleotide linkage at the 31 end of the antisense region. Alternatively, in either of the above embodiments, the antisense region can comprise a glyceryl modification at the 31 end of the antisense region. In another embodiment of any of the above-described siNA molecules, any
L5 nucleotides present in a non-complementary region of the antisense strand (e.g. overhang region) are 2'-αeoxy nucleotides.
In one embodiment, the disclosure features a double-stranded short interfering nucleic acid fsiNA) molecule that down- 0 regulates expression of a target gene or that directs cleavage of a target PNA, wherein the siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule. In another embodiment, the siNA 5 molecule is a double stranded nucleic acid molecule, where each strand is about 21 nucleotides long and where about 19 nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule, wherein at least two 3' terminal nucleotides of 0 each fragment of the siNA molecule are not base-paired to the nucleotides of the other fragment of the siNA molecule. In another embodiment, the siNA molecule is a double stranded nucleic acid molecule, where each strand is about 19 nucleotide long and where the nucleotides of each fragment of the siNA 5 molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule to form at least about 15
(e.g., 15, 16, 17, 18, or 19) base pairs, wherein one or both ends of the siNA molecule are blunt ends. In one embodiment, each of the two 3' terminal nucleotides of each fragment of the siNA molecule is a 2 ' -deoxy-pyrimidine nucleotide, such as a 2 ' -deoxy- thymidine. In another embodiment, all nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule. In another embodiment, the siNA molecule is a double stranded nucleic acid molecule of about 19 to about 25 base pairs having a sense region and an antisense region, where about 19 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the target gene. In another embodiment, about 21 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the target gene. In any of the above embodiments, the 5 ' -end of the fragment comprising said antisense region can optionally include a phosphate group.
In one embodiment, the disclosure features a chemically synthesized double stranded RNA molecule that directs cleavage of a target PNA via PNA interference, wherein each strand of said RNA molecule is about 15 to about 30 nucleotides in length; one strand of the RNA molecule comprises nucleotide sequence having sufficient complementarity to the target RNA for the RNA molecule to direct cleavage of the target RNA via RNA interference; and wherein at least one strand of the RNA molecule optionally comprises one or more chemically modified nucleotides described herein, such as without limitation deoxynucleotides, 2 ' -O-methyl nucleotides, 2 ' -deoxy-2 ' -fluoro nucleotides, 2 ' -O-methoxyethyl nucleotides etc.
In one embodiment, target RNA of the disclosure comprises non- coding RNA sequence (e.g., miRNA, snRNA siRNA etc.).
In one embodiment, the disclosure features a medicament comprising a siNA molecule of the disclosure.
In one embodiment, the disclosure features an active ingredient comprising a siNA molecule of the disclosure.
In one embodiment, the disclosure features the use of a double- stranded short interfering nucleic acid (siNA) molecule to inhibit, down-regulate, or reduce expression of a RAD9 gene or that directs cleavage of a target RAD9 RNA, wherein the siNA molecule comprises one or more chemical modifications and each strand of the double-stranded siMA is independently about 15 to about 30 or more (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 or more) nucleotides long. In one embodiment, the siNA molecule of the disclosure is a double stranded nucleic acid molecule comprising one or more chemical modifications, where each of the two fragments of the siNA molecule independently comprise about 15 to about 40 (e.g. about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 23, 33, 34, 35, 36, 37, 38, 39, or 40) nucleotides and where one of the strands comprises at least 15 nucleotides that are complementary to nucleotide sequence of target RNA or a portion thereof. In a non-limiting example, each of the two fragments of the siNA molecule comprise about 21 nucleotides. In another embodiment, the siNA molecule is a double stranded nucleic acid molecule comprising one or more chemical modifications, where each strand is about 21 nucleotide long and where about 19 nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule, wherein at least two 3' terminal nucleotides of each fragment of the siNA molecule are not base-paired to the nucleotides of the other fragment of the siNA molecule. In another embodiment, the siNA molecule is a double stranded nucleic acid molecule comprising one or more chemical modifications, where each strand is about 19 nucleotide long and
where the nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule to form at least about 15 (e.g., 15, 16, 17, 18, or 19) base pairs, wherein one or both ends of the siNA molecule are blunt ends. In one embodiment, each of the two 3' terminal nucleotides of each fragment of the siNA molecule is a 2 ' -deoxy-pyπmidine nucleotide, such as a 2 ' -deoxy- thymidine. In another embodiment, all nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule. In another embodiment, the siNA molecule is a double stranded nucleic acid molecule of about 19 to about 25 base pairs having a sense region and an antisense region and comprising one or more chemical modifications, where about 19 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the target gene. In another embodiment, about 21 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the target gene. In any of the above embodiments, the 5 ' -end of the fragment comprising said antisense region can optionally include a phosphate group.
In one embodiment, the disclosure features the use of a double- stranded short interfering nucleic acid (siNA) molecule that inhibits, down-regulates, or reduces expression of a target gene or that directs cleavage of a target RNA, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of target RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyπmidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification (e.g., 2 ' -deoxy-2 ' -fluoro, 2 ' -0- methyl, or 2 ' -deoxy modifications).
In one embodiment, the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits, down-regulates, or reduces expression of a target gene or that 5 directs cleavage of a target RNA, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of target PNA or a portion thereof, wherein the other strand is a sense strand which comprises nucleotide sequence that
LO is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification
(e.g., 2'-deoxy-2'-fluoro, 2 ' -O-methyl, or 2 ' -deoxy modifications) . i5
In one embodiment, the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits, down-regulates, or reduces expression of a gene or that directs cleavage of a target RNA, wherein one of the strands of the
10 double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of target RNA that encodes a protein or portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the 5 antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification. In one embodiment, each strand of the siNA molecule comprises about 15 to about 30 or more (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 0 or 30 or more) nucleotides, wherein each strand comprises at least about 15 nucleotides that are complementary to the nucleotides of the other strand. In cne embodiment, the uiNA molecule is assembled from two oligonucleotide fragments, wherein one fragment comprises the nucleotide sequence of the antisense 5 strand of the siNA molecule and a second fragment comprises nucleotide sequence of the sense region of the siNA molecule. In
one embodiment, the sense strand LS connected to the antisense ptrnnd via a Linker moLecuLe, inch as a po Lynuc Leotide hnker or a non-nυc Leot ide Imker. In a further embodiment, the pyπmidine nucleotides present in the
•strand are 2 ' -deoxy-2 ' fluoro 5 pyrimidme nucleotides and the purine nucleotides present in the ->ense region are 2 ' -deoxy purine nucleotides. Tn another embodiment, the pyπmidme nucleotides present in the sense atrand are 2 ' -deoxy-2 ' fluoro pyrimidme nucleotides and the purine nucleotides present in the ^ense region are 2'-0-methyl
10 purine nucleotides. In still another embodiment, the pyrimidme nucleotides present in the antisense strand are 2' -deoxy-2 '- t Luoro pyrimidme nucleotides and any purine nucleotides present in the antisense strand are 2 '-deoxy purine nucleotides. In another embodiment, the antisense strand comprises one or more
L5 2 ' -deoxy-2 ' -fluoro pyrimidme nucleotides and one or more 2 ' -O- inethyl purine nucleotides. In another embodiment, the pyrimidme nucleotides present in the antisense strand are 2 ' -deoxy-2 '- fluoro pyrimidme nucleotides and any purine nucleotides present in the antisense strand are 2 ' -O-methyl purine nucleotides. In a
20 further embodiment the sense strand comprises a 3 ' -end and a 5'- end, wherein a terminal cap moiety (e.g., an inverted deoxy abasic moiety or inverted deoxy nucleotide moiety such as inverted thymidine) is present at the 5' -end, the 3 ' -end, or both of the 5' and 3' ends of the sense strand. In another embodiment,
"25 the antisense strand comprises a phosphorothioate mternucleotide linkage at the 3' end of the antisense strand. In another embodiment, the antisense strand comprises a glyceryl modification at the 3' end. In another embodiment, the 5 '-end of the antisense strand optionally includes a phosphate group.
30
In any of the above-described embodiments of a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a target gene or that directs cleavage of a target RNA, wherein a majority of the pyrimidme nucleotides present in
35 the double-stranded siNA molecule comprises a sugar modification, each of the two strands of the siNA molecule can comprise about
15 to about 30 or more (e.g., about 15, L6, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more) nucleotides. In one embodiment, about 15 to about 30 or more (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more) nucleotides of each strand of the siNA molecule are base- paired to the complementary nucleotides of the other strand of the siNA molecule. In another embodiment, about 15 to about 30 or more (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more) nucleotides of each strand of the siNA molecule are base-paired to the complementary nucleotides of the other strand of the siNA molecule, wherein at least two 3' terminal nucleotides of each strand of the siNA molecule are not base-paired to the nucleotides of the other strand of the siNA molecule. In another embodiment, each of the two 3' terminal nucleotides of each fragment of the siMA molecule is a 2'-deoxy- pyπmidme, such as 2 ' -deoxy-thymidine . In one embodiment, eacn strand of the siNA molecule is base-paired to the complementary nucleotides of the other strand of the siNA molecule. In one embodiment, about 15 to about 30 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) nucleotides of the antisense strand are base-paired to the nucleotide sequence of the target RNA or a portion thereof. In one embodiment, about 18 to about 25 (e.g., about 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides of the antisense strand are base-paired to the nucleotide sequence of the target RNA or a portion thereof.
In one embodiment, the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a target gene or that directs cleavage of a target RNA, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of target RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyπmidine nucleotides present an the double-
stranded siNA molecule comprises a sugar modification, and wherein the 5 ' -end of the antisense strand optionally includes a phosphate group.
In one embodiment, the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a target gene or that directs cleavage of a target RNA, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of target RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidme nucleotides present in the double- stranded siNA molecule comprises a sugar modification, and wherein the nucleotide sequence or a portion thereof of the antisense strand is complementary to a nucleotide sequence of the untranslated region or a portion thereof of the target RNA.
In one embodiment, the disclosure features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a target gene or that directs cleavage of a target RNA, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of target RNA or a portion thereof, wherein the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand, wherein a majority of the pyrimidme nucleotides present in the double- stranded siNA molecule comprises a sugar modification, and wherein the nucleotide sequence of the antisense strand is complementary to a nucleotide sequence of the target RNA or a portion thereof that is present in the target RNA.
In one embodiment, the disclosure features a composition
comprising a siNA molecule of the disclosure in a pharmaceutically acceptable carrier or diluent.
In a non-limiting example, the introduction of chemically- modified nucleotides into nucleic acid molecules provides a powerful tool in overcoming potential limitations of in vivo stability and bioavailability inherent to native RNA molecules that are delivered exogenously. For example, the use of chemically-modified nucleic acid molecules can enable a lower dose of a particular nucleic acid molecule for a given therapeutic effect since chemically-modified nucleic acid molecules tend to have a longer half-life in serum. Furthermore, certain chemical modifications can improve the bioavailability of nucleic acid molecules by targeting particular cells or tissues and/or improving cellular uptake of the nucleic acid molecule. Therefore, even if the activity of a chemically-modified nucleic acid molecule is reduced as compared to a native nucleic acid molecule, for example, when compared to an all-RNA nucleic acid molecule, the overall activity of the modified nucleic acid molecule can be greater than that of the native molecule due to improved stability and/or delivery of the molecule. Unlike native unmodified siNA, chemically-modified siNA can also minimize the possibility of activating interferon activity in humans.
In any of the embodiments of siNA molecules described herein, the antisense region of a siNA molecule of the disclosure can comprise a phosphorothioate mternucleotide linkage at the 3 '-end of said antisense region. In any of the embodiments of siNA molecules described herein, the antisense region can comprise about one to about five phosphorothioate mternucleotide linkages at the 5 ' -end of said antisense region. In any of the embodiments of siNA molecules described herein, the 3 '-terminal nucleotide overhangs of a siNA molecule of the disclosure can comprise ribonucleotides or deoxyribonucleotides that are chemically- modified at a nucleic acid sugar, base, or backbone. In any of the embodiments of siNA molecules described herein, the 3'-
terminal nucleotide overhangs can comprise one or more universal base ribonucleotides. In any of the embodiments of siNA molecules described herein, the 3 '-terminal nucleotide overhangs can comprise one or more acyclic nucleotides.
One embodiment of the disclosure provides an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the disclosure in a manner that allows expression of the nucleic acid molecule. Another embodiment of the disclosure provides a mammalian cell comprising such an expression vector. The mammalian cell can be a human cell. The siNA molecule of the expression vector can comprise a sense region and an antisense region. The antisense region can comprise sequence complementary to a PNA or DNA sequence encoding the target and the sense region can comprise sequence complementary to the antisense region. The siNA molecule can comprise two distinct strands having complementary sense and antisense regions. The siNA molecule can comprise a single strand having complementary sense and antisense regions .
In one embodiment, the disclosure features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against a target polynucleotide
(e.g., DNA or RNA) inside a cell or reconstituted in vitro system, wherein the chemical modification comprises one or more phosphorothioate mternucleotide linkages. For example, in a non- limitmg example, the disclosure features a chemically-modified short interfering nucleic acid (siNA) having about 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate mternucleotide linkages in one siNA strand. In yet another embodiment, the disclosure features a chemically-modified short interfering nucleic acid (siNA) individually having about 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate mternucleotide linkages in both siNA strands. The phosphorothioate mternucleotide linkages can be present in one or both oligonucleotide strands of the siNA duplex, for example in the sense strand, the antisense strand, or both
strands. The siNA molecules of the disclosure can comprise one or more phosphorothioate internucleotide linkages at the 3 '-end, the 5 '-end, or both of the 3'- and 5 '-ends of the sense strand, the antisense strand, or both strands. For example, an exemplary siNA molecule of the disclosure can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) consecutive phosphorothioate internucleotide linkages at the 5 ' -end of the sense strand, the antisense strand, or both strands. In another non-limiting example, an exemplary siNA molecule of the disclosure can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) pyπmidine phosphorothioate internucleotide linkages in the sense strand, the antisense strand, or both strands. In yet another non-liraitmg example, an exemplary siNA molecule of the disclosure can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 3, 9, 10, or more) purine phosphorothioate internucleotide linkages in the sense strand, the antisense strand, or both strands.
In one embodiment, a siNA molecule of the disclosure is featured, wherein the sense strand comprises one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2 ' -deoxy- 2'-fluoro, and/or about one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3 '-end, the 5 '-end, or both of the 3'- and 5 ' -ends of the sense strand; and wherein the antisense strand comprises about 1 to about 10 or more, specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'- O-methyl, 2 ' -deoxy-2 ' -fluoro, and/or one ur more ^e. g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3'- end, the 5 ' -end, or both of the 3'- and 5 '-ends of the antisense strand. In another embodiment, one or more, for example about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, or more, pyπmidine nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2'-deoxy, 2 ' -0-methyl and/or 2 ' -deoxy-2 ' -fluoro nucleotides, with or without one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, phosphorothioate mternucleotide linkages and/or a terminal cap molecule at the 3 '-end, the 5 '-end, or both of the 3'- and 5 '-ends, being present in the same or different strand.
In another embodiment, a siNA molecule of the disclosure is featured, wherein the sense strand comprises about 1 to about 5, specifically about 1, 2, 3, 4, or 5 phosphorothioate mternucleotide linkages, and/or one or more (e.g., about 1, 2,
3, 4, 5, or more) 2'-deoxy, 2 '-O-methyl, 2 ' -deoxy-2 ' -fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3-end, the 5 '-end, or both of the 3'- and 5 ' -ends of the sense strand; and wherein the antisense strand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5, or more phosphorothioate mternucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2 ' -deoxy, 2'- O-methyl, 2 ' -deoxy-2 ' -fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3'- end, the 5 '-end, or both of the 3'- and 5 ' -ends of the antisense strand. In another embodiment, one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, pyrimidme nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2 ' -deoxy, 2 ' -O-methyl and/or 2 ' -deoxy-2 ' -fluoro nucleotides, with or without about 1 to about 5 or more, for example about 1, 2, 3, 4, 5, or more phosphorothioate mternucleotide linkages and/or a terminal cap molecule at the 3 '-end, the 5 '-end, or both of the 3'- and 5 '-ends, being present in the same or different strand.
In one embodiment, a siNA molecule of the disclosure is featured,
wherein the antisense strand comprises one or more, for example, about L, 2, 3, 4, 5, 6, 7, 8, 9, LO, or more phosphorothioate internucleotide linkages, and/or about one or more (e.g., about
1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2 ' -deoxy, 2 ' -O-methyl, 2'- deoκy-2 ' -fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5,
6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3 '-end, the 5 '-end, or both of the 3'- and 5 ' -ends of the sense strand; and wherein the antisense strand comprises about 1 to about 10 or more, specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'- O-methyl, 2 ' -deoxy-2 ' -fluoro, and/or one or more (e.g., about 1,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3'- end, the 5 ' -end, or both of the 3'- and 5 ' -ends cf the antisense strand. In another embodiment, one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pyπmidme nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2 ' -deoxy, 2 ' -O-methyl and/or 2 ' -deoxy-2 ' -fluoro nucleotides, with or without one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotide linkages and/or a terminal cap molecule at the 3 '-end, the 5 ' -end, or both of the 3' and 5 '-ends, being present in the same or different strand.
In another embodiment, a siNA molecule of the disclosure is featured, wherein the antisense strand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'- O-methyl, 2 ' -deoxy-2 ' -fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 5, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3'- end, the 5 '-end, or both of the 3'- and 5 '-ends of the sense strand; and wherein the antisense strand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5 or more
phosphorothioate internucleotide linkages, and/or one or more (e.g., ibout 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-dooxy, 2'- O-methyl, 2 ' -deoxy-2 ' -f luoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3'- end, the 5 '-end, or both of the 3'- and 5 ' -ends of the antisense strand. In another embodiment, one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pyrimidine nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2'-deoxy, 2 ' -O-methyl and/or 2 ' -deoxy-2 ' -fluoro nucleotides, with or without about 1 to about 5, for example about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide linkages and/or a terminal cap molecule at the 3 '-end, the 5 '-end, or both of the 3'- and 5 '-ends, being present m the same or different strand.
Tn one embodiment, a chemically-modified short interfering nucleic acid (siNA) molecule of the disclosure comprises about 1 to about 5 or more (specifically about 1, 2, 3, 4, 5 or more) phosphorothioate internucleotide linkages in each strand of the siNA molecule.
In another embodiment, a siNA molecule of the disclosure comprises 2 '-5' internucleotide linkages. The 2 '-5' internucleotide linkage (s) can be at the 3 ' -end, the 5 ' -end, or both of the 3'- and 5 ' -ends of one or both siNA sequence strands. In addition, the 2 '-5' internucleotide linkage (s) can be present at various other positions within one or both siNA sequence strands, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more including every internucleotide linkage of a pyrimidine nucleotide in one or both strands of the siNA molecule can comprise a 2 '-5' internucleotide linkage, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more including every internucleotide linkage of a purine nucleotide in one or both strands of the siNA molecule can comprise a 2 '-5' internucleotide linkage.
In one embodiment the nucleic acid is an siRNA duplex composed of 21-nt sense and 21-nt antisense strands, paired in a manner to have a 2-nt 31 overhang. In one embodiment, the 2-nt 3' overhang comprises 2 ' -deoκynucleotides .
The nucleic acids can be delivered/administered via a transfection reagent such as Oligofectamine"'1 (product number: 12252011 from Invitrogen, CA). Oligofectamine has the advantage of being non-toxic to cells, siRNA transfection is also possible by using TransIT-TKO: small interfering RNA (siRNA) Transfection Reagent, which is provided by Mirus; jetSI'" made by Polyplus, France, silMPORTER™, made by Upstate, MA. Other methods are described in the experimental results section below.
Non-limiting examples of siRNA carriers include those set forth in Ge Q., Filip L., Bai A., Nguyen T., Eisen H. M and Chen J., PNAS 101: 8676-8681 (2004); Urban-Klein B., Werth S., Abuharbeid S., Czubayko F. and Aigner A. Gene Therapy 12 :461-466 (2005) and Hassani Z., Lemkine G. -F., Erbacher P., AIfama G., Giovannangeli C, Behr J. -P., and Demeneix B. -A, J. Gene Med., 7, 198-207 (2005) . Examples include linear polyethylenimine, with an ion chloride and water such as jetPEI™.
In an embodiment the inhibitor of co-chaperone protein activity is an inhibitor of BAG3 activity. In an embodiment inhibitor of a BAG3 activity is an antibody or antibody fragment which binds to the BAG3. In an embodiment the antibody is a monoclonal antibody. In an embodiment antibody is a humanized antibody.
In an embodiment the cell of the host is in vitro. In an embodiment the cell of the host is in vivo.
In an embodiment the cell of the host is in vivo and contacting the cell of the host with the nucleic acid is effected by administering to the host a vector comprising the nucleic acid.
In an embodiment the nucleic acid is transcribed in the cell of
the host into a short interfering ribonucleic acid. In an embodiment the vector is a mammalian expression vector. In an embodiment the vector comprises a RNA III polymerase promoter. In an embodiment the RNA III polymerase promoter is a U6 promoter or a Hl promoter. In an embodiment the vector comprises a RNA III polymerase termination site. In an embodiment the termination site is a T5 sequence. In an embodiment the cell of the host is a dorsal root ganglion cell, a ganglion semilunare cell, or a trigeminal nerve cell.
A nucleic acid of the disclosure may be delivered via a vector so as to effect transcription of the DNA inserted into the vector into a short hairpin RNA or transcription into a complementary sense and an antisense strand which subsequently hybridize to form a siRNA. The latter may be achieved by a vector insert which comprises a promoter sequence/sense strand encoding sequence/termination sequence/spacer sequence/promoter sequence/antisense strand encoding sequence/termination sequence or a promoter sequence/antisense strand encoding sequence/termination sequence/ spacer sequence/promoter sequence/sense strand encoding sequence/termination sequence (e.g. see Tuschl, Expanding small RNA interference, Nature Biotechnology, 20:446-448 (2002) hereby incorporated by reference). Promoters include RNA II polymerase promoters, e.g. U6 or Hl.
A method is provided of treating a subject suffering from a Varicella zoster virus infection or Epstem-Barr virus infection comprising administering a nucleic acid which inhibits expression of a human BAG3 gene so as to thereby treat the subject.
A method is provided of treating cold bore comprising administering to the cold sore treatment site a nucleic acid which inhibits expression of a human BAG3 gene so as to thereby treat the cold sore.
Methods and compositions for gene silencing techniques are described in U.S. Patent Nos. 6,573,099; 6,506,599; 7,109,165; 7,022,828; 6,995,259; 6,617,438; 6,673,611; 6,849,726; and 6,818,447, which are hereby incorporated by reference.
In an embodiment the host is human.
A method is provided of enhancing exclusion of a Varicella zoster virus open reading frame 29 protein (ORF29p) from a nucleus of a cell comprising contacting the cell with an amount of an inhibitor of Hsp90 ATPase activity effective to enhance exclusion of the ORF29p protein from the nucleus of the cell.
In an embodiment the ORF29p is encoded by a nucleic acid comprising consecutive ammo acids having the sequence set forth in SEQ ID NO: 16. In an embodiment the inhibitor of Hsp90 ATPase activity is an ansamycin antibiotic. In an embodiment the inhibitor of Hsp90 ATPase activity is geldanamycin. In an embodiment the inhibitor of Hsp90 ATPase activity is 17- dimethylaminoethylamino-17-demethoxy-geldanamycm (17DMAG). In an embodiment the cell is m vitro. In an embodiment the cell is in vivo. In an embodiment the cell is a dorsal root ganglion cell, a ganglion semilunare cell, or a trigeminal nerve cell.
A pharmaceutical composition is provided comprising an amount of an ansamycin antibiotic effective to inhibit replication of a Varicella zoster virus or Epstein-Barr virus in a cell of a host and a pharmaceutically acceptable carrier. In an embodiment the ansamycin antibiotic is geldanamycin. In an embodiment the ansamycin antibiotic is 17-dimethylaminoethylammo-17-demethoxy- geldanamycin (17DMAG).
A pharmaceutical composition is provided comprising an amount of an siRNA effective to inhibit replication of a Varicella zoster virus or Epstein-Barr virus in a cell of a host and a pharmaceutically acceptable carrier. In an embodiment the siRNA
inhibits expression of BAG3. In an embodiment the BAG3 comprises consecutive amino acid residues having the sequence set forth in SEQ ID NO: 1.
In an embodiment of the instant compositions the composition is suitable for topical application to human skin or a human mucous membrane. In an embodiment of the instant compositions the composition is suitable for oral administration to a human. In an embodiment of the instant compositions the composition is suitable for ocular administration to a human.
A method is provided of identifying an agent as an inhibitor of Varicella zoster virus replication or Epstein-Barr Virus replication in a host cell comprising: a) quantitating the activity of a chaperone protein of the host cell; b) contacting the chaperone protein with the agent; and c) quantitating the activity of the chaperone protein in the presence of the agent, wherein an increase or decrease in activity of the host chaperone protein activity as quantitated in step a) compared to host chaperone protein activity as quantitated in step c) indicates that the agent is an inhibitor of Varicella zoster virus replication or Epstein-Barr virus in the host cell.
In an embodiment the host chaperone protein is a heat shock protein. In an embodiment the heat shock protein is Hsp90 or Hsp70/Hsc70. In an embodiment the activity of heat shock protein is ATPase activity. In an embodiment the agent increases the activity of the chaperone protein. In an embodiment the agent decreases the activity of the chaperone protein.
A method is provided of treating a subject suffering from a
Varicella zoster virus infection or Epstein-Barr Virus infection comprising administering to the subject an amount of modulator of a chaperone protein activity effective to inhibit Varicella
zoster virus replication or Epstein-Barr Virus replication in the subject and thereby treat the subject.
A method is provided of treating coJd sore comprising administering to the cold sore treatment site with an amount of modulator of a chaperone protein activity effective to inhibit Varicella ^oster virus replication or Epstein-Barr virus replications in the subject and thereby treat the cold sore.
In an embodiment the modulator of the chaperone protein activity is an inhibitor of Hsp90 ATPase activity. Tn an embodiment the inhibitor of Hsp90 ATPase activity is an ansamycin antibiotic. In an embodiment the inhibitor of Hsp90 ATPase activity is geldanamycm. In an embodiment the inhibitor of hsp90 ATPase activity is 17-dimethylaminoethylamino-17-demethoxy-geldanamycin (17DMAG) . In an embodiment the modulator of a chaperone protein activity is inhibitor of bcl2-associated anathogene 3 (BAG3) expression. In an embodiment the inhibitor is a nucleic acid which is, or upon transcription becomes, a short interfering ribonucleic acid.
As used herein, the term "effective amount" or an "amount .. effective" refers to the quantity of a component that is sufficient to yield a desired therapeutic response without undue adverse side effects (such as toxicity, irritation, or allergic response) commensurate with a reasonable benefit/risk ratio when used in the manner of this disclosure. For example, an amount effective to inhibit or stop Varicella zoster virus or Epstein- Barr Virus replication or growth. The specific effective amount will vary with such factors as the particular condition being treated, the physical condition of the patient, the type of mammal being treated, the duration of the treatment, the nature of concurrent therapy (if any), and the specific formulations employed and the structure of the compounds or its derivatives.
Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range, and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure .
25IlI combinations of the various elements described herein are within the scope of the invention.
The following Experimental Details are set forth to aid in an understanding of the subject matter of this disclosure, but are not intended to, and should not be construed to, limit in any way the claims which follow thereafter.
Experimental Results
In this report, novel interactions of open reading frame 29 protein (ORF29p) with host proteins are identified. The roles of these interactions in the degradation and localization of ORF29p and the ability of Varicella Zoster Virus (VZV) to grow in cultured cells are addressed. Biochemical evidence is provided indicating that ORF29p interacts with the co-chaperone blc2- associated anathogene-3 (BAG3) and forms a complex with at least
BAG3 and heat shock protein 70/heast shock protein 70 cognate
Ηsp70/Hsc70) in vivo in both transiently transfecteα and VZV infected cells. These results reveal that the ATPase activity of
Hsp90 is required for stabilization and nuclear localization of ORF29p and virus replication. This study shows that VZV redistributes BAG3 and its partners Hsp70 and Hsp90 into nuclear
replication/transcription foci in infected cells, suggesting that the virus exploits the highly conserved functions of the host heat shock proteins to efficiently complete its life cycle. Finally, this report provides genetic evidence that BAG3 is required for efficient virus growth. In contrast, while herpes simplex virus [HSV] replication is also inhibited by ansamycins (7), its replication in human melanoma (MeWo) cells depleted of BAG3 is unaffected. This disclosure proposes that regulators of chaperone protein activity modulate VZV replication raising the possibility that this pathway is required for controlling replication of animal viruses.
Materials And Methods
Mammalian cells. Human melanoma [MeWo] and human 293T fibroblasts cells were maintained and infected as previously described ("7O, 71) . To generate stable cell lines expressing siRNAs targeting BAG3 mRNA, MeWo cells were infected with retroviruses and selected in growth medium containing lug/ml puromycin. Single cell colonies were selected, expanded and used for further analysis.
Transfeetions . All transfections were performed using Lipofectamme PLUS in Opti-MEM media [Invitrogen, Carlsbad, CA].
Viruses. [i] Varicella Zoster Virus. Jones VZV, a wild-type clinical isolate, was propagated as described (33) . Cell-free virus was obtained by infecting confluent monolayers of MeWo cells in 100 mm dishes. When cytopathic effect was present cells were washed three times with cold phosphate-buffered saline [PBS; ImM KH PO4, 1OmM Na-HPO1, 137mM NaCl, 2.7mM KCl, pH7.4] and incubated with 0.1° EDTA in PBS for five minutes. The cells were detached from the plate by pipetting and narvested by centrifugation at 500 x g for 5 mm at 4°C. The cell pellet was resuspended in 1 ml per 100 mm dish of fresh Phosphate Sucrose Glutamate Calf serum buffer [PSGC; 5° sucrose, 0.1° L[+] glutamic acid, 1Oo fetal calf serum in PBS] and sonicated for three 30 sec
intervals. Cell debris was removed by centrifugation at 25 x g for 2 min at 4°C and the supernatant was filtered through a 5um filter as described (38) . Cell-free virus was stored at -1500C and the titer was determined by plaque assay on MeWo cells. [ii] Adenoviruses. Adenovirus AdBAG3 expressing flag-tagged BAG3 under the HSV-I tk promoter was constructed using the pCK-mFLAG- BAG3 and pBHGfrtΔEl, E3FLP system [Microbix Biosystems, Toronto, Ontario, Canada] (59). Adenovirus AdORF29 is described elsewhere (70) . Adenovirus AdORF63 expressing VZV ORF63p was constructed by M.S. Walters [Walters and Silverstem, unpublished data].
[in] Retroviruses. Retroviruses were constructed by transient cotransfection of 293T cells with the proviral vectors pSuper. retro. puro (6), pCK-siBAG3-737 or pCK-siBAG3-2235 and pgag-polgpt (52) and pHCMV-G (79) . [iv] Herpes simplex virus was grcwn and titrated as previously described ( 60) .
Preparation of VZV and cell DNA. VZV nucleocapsids were prepared as described (72) . Virus DNA was isolated from nucleocapsids suspended in TE [1OmM TrisHCl pH8.0, ImM EDTA] and digested in ProteinaseK cocktail [10OmM NaCl, 1OmM EDTA, 5OmM TrisHCl pH 7.4, 200ug/ml ProteinaseK] at 500C for 3 h. Virus DNA was extracted with phenol and precipitated with isopropanol. MeWo DNA was prepared using the DNAZOL reagent [Invitrogen, Carlsbad, CA], following the manufacturer's instructions.
Drug treatment. Cells were treated with geldanamycin or 17-NN- Dimethyl Ethylene Diamine-Geldanamycm [17DMAG] [InvivoGen, San Diego, CA] from lmg/ml stocks in DMSO and water respectively, at the concentrations and times indicated in the figure legends.
Plasmids construction, [i] BAG3 plasmids . The 3' region of BAG3 cloned in the cDNA library was amplified with Pfu Turbo polymerase [Stratagene, La Jolla, CA] using the cDNA phagemid as template and the primers M13rev [5' - GAGCGGATAACAATTTCACACAGG - 3'] (SEQ ID NO: 3) and 3'Hind-BAG3 [5'
GGAAGCTTTACAGGGCAGAGGCTACGGTG - 3'] (SEQ ID NO: 4). The PCR product was cLoned in ρCR2.1 TOPO TA to yield pCK-BAG3par. The 5' region of BAG3 cDNA was amplified from MeWo total RNA with C. Therm. Polymerase One-Step RT-PCR System [Roche, Mannheim, 5 Germany] using the primers BAG3-5-F [5' - CAGACCCCAACCCAGCATGAG - 3'1(SEQ ID NO: 5 and BAG3-5-R [5' - CCGCTGCCACCTGTCCACAC - 3'J(SEQ ID NO: 6) and cloned in pCR2.1 TOPO TA to yield pCK-BAG3- 5. pCK-BAG3fl was constructed by digesting pCK-BAG3-5 with PpuMI and Xhol and ligating the released fragment to PpuMI and Xhol
10 digested pCK-BAG3par. The full length BAG3 cDNA was amplified from pCK-BAG3fl using Pfu Turbo polymerase, 5-Bam-BAG3 [5' GGGGATCCAGCATGAGCGCCGCCACCCA - 3' ] (SEQ ID NO: 7) and 3-Hmd-BAG3 and cloned in pCP2.1 TOPO TA to yield pCK-BAG3. An EcoRI/HindiII digestion fragment from pCK-Bag3par was cloned into EcoRI/Hmdlll i5 digested pALEX (61) to yield pCK-GST-BAG3par . pCK-GST-BAG3par was digested with Sail/Xhol and self-ligated to create pCK-GST- BAG3ag. pCK-GST-BAG3 was prepared by cloning an EcoRI and HindIII digestion fragment from pCK-BAG3fl into EcoRI and HindIII digested pALEX . pCK-FLAG-BAG3 was constructed by cloning a
20 BamHI/Hindlll digestion fragment from pCK-BAG3 into BamHI/Hindlll digested pCMV-Tag2B [Stratagene] . A Notl digested, Klenow filled and HindiI digested fragment from pCK-FLAG-BAG3 was ligated to EcoRI digested, Klenow filled and HindIII digested pDC516 [Microbix Biosystems Inc.] to yield pCK-mFLAG-BAG3. The mCMV
25 promoter of this plasmid was replaced by the 105bp of the HSV-I thymidine kinase promoter by ligating a BamHI/Bglll digested and Klenow filled-in fragment from pLS115/105 (24,55) into Xbal/Ncol digested and Klenow filled pCK-mFLAG-BAG3 to yield pCK-tkFLAG- BAG3.
30 [ii] BAG3 siRNA plasm±ds . The siRNA oligos targeting BAG3 mRNA were designed using SVM RNAi 3.6 [www.changbioscience.com/stat/sirna.html], which uses a collection of rules to predict functional siRNAs (30,36,64). To generate pCK-siBAG3-737 and pCK-siBAG3-2235 the annealed oligo 5 pairs 737-TS: 5'
GATCCCCCCACTCAGCCAGATAAACATTCAAGAGATGTTTATCTGGCTGAGTGGTTTTTGGAAA
3' (SEQ ID NO: 8) and 737-BS: 5' AGCTTTTCCAAAAACCACTCAGCCAGATAAACATCTCTTGAATGTTTATCTGGCTGAGTGGGGG (SEQ ID NO: 9) or 2235-TS: 5' GATCCCCGAAGTTGCTTGTTGTTTGATTCAAGAGATCAAACAACAAGCAACTTCTTTTTGGAAA 3' (SEQ ID NO: 10) and 2235-BS: 5'
AGCTTTTCCAAAAAGAAGTTGCTTGTTGTTTGATCTCTTGAATCAAACAACAAGCAACTTCGGG - 3' (SEQ ID NO: 11) were Ligated into pSuper . retro .puro (6) . [iii] ORF29p plasmids. pZErO29, pET29 and pET29 [1-345] were described (71). pCK-X29 [346-1203] was constructed by releasing an EcoRV/Notl fragment from pZErO29 and ligating it into BamHI digested, Klenow polymerase filled and Notl digested pET-21c[+] [Novagen] .
[iv] ORF63p plasmids. Full-length ORF63 was amplified by PCR using the oligonucleotides 5-Eco-63 [5' GGGAATTCATGTTTTGCACCTCACCGGCT - 3'] (SEQ ID NO: 12) and 3-Xho-63 [5' - GGCTCGAGTAAAGACTTCACGCCATGGGG - 3' ] (SEQ ID NO: 13), Pfu Turbo polymerase and VZV strain Jones DNA as template. The PCR product was cloned m pCR2.1 TOPO TA to create pCK-ORF63. pCK-X- ORF63 expressing CRF63 with a 6His tag was constructed by digesting pCK-ORF63 with EcoRI and Xhol and cloning the resulting DMA fragment in EcoRI and Xhol digested pET-21a[+] [Novagen]. [v] HSP70 plasmids. A full length Hsp70 gene [HSPAlA] was amplified from MeWo DNA using KOD DNA polymerase [Novagen, San Diego, CA] and 5-Hind-Hsp70 [5' - GGAAGCTTAGAGAGCAGCGAACCGGCAT - 3'] (SEQ ID NO: 14) and 3-Xho-Hsp70 [5'
CGCTCGAGTTGGAAAGGCCCCTGATCTAC - 3'] (SEQ ID NO: 15). The PCR product was cloned in pCR2.1 TOPO TA to yield pCK-HSP70. Hsp70 was excised as a Hindlll/Xhol fragment and subcloned into Hindlll/Xhol digested pALEX to create pCK-GST-HSP70, which expresses Hsp70 as a GST fusion under the control of the T7 promoter. All primers used were manufactured by Proligo LLC [Boulder, CO] and all vector inserts were verified by DNA sequencing.
Antibodies. Rabbit polyclonal antibodies against ammo acids [aa] 1086 to 1201 of ORF29p and aa 1-265 of ORF63p were described
(49) . Λ portion ot the BAG3 cDNA [pCK-G5T-BAG3ag] encoding tor aa 134-°99 was cloned in the bacterial, expression vector pALEX (61). The GST fubion protein was over expressed in E. coll, strain BL21[DE3], and purified to apparent homogeneity by affinity chromatography on a glutathione oepharose column (68) . The protein was used to immunize rabbits and BAG3 opeci±ic antibodies were purified by affinity chromatography using BAG3 immobilized on cyanogen bromide-activated Sepharose JB, after removal of the GST tag [Amersham Biosciences, Uppsala, Sweden] . Mouse monoclonal antibodies to VZV gE and ORF62p were from ViroStat [Portland, Maine]. Mouse monoclonal antibodies to HSP90α/β and GAPDH were from Santa Cruz Biotechnology [Santa Cruz, CA] and to HSP70 from United States Biological [Swampscott, MA] . Alexa Fluor 483- conjugated anti-mouse and Alexa Fluor 546-con]ugated anti-rabbit were from Molecular Probes [Carlsbad, CA]. Goat anti-rabbit and anti-mouse conjugated to horseradish peroxidase for iiranunoblotting were from KPL [Gaitherburg, MD] . HSV gC antibody was purchased from the Rumbaugh-Goodwm Institute [Plantation, FL]. Antibody to ICPO has been described (47).
Indirect immunofluorescence microscopy. Cells on glass coverslips were fixed and stained with antibody and Hoechst as previously described (70, 71) . All samples were visualized with a Zeiss Axiovert 200M inverted microscope [Carl Zeiss Microimaging Inc, Thornwood, NY] and images were acquired with a Hamamatsu C4742- 80-12AG Digital CCD Camera [Hamamatsu Photonics, Hamamatsu-City, Japan] using Openlab 5 software [ Improvision, Lexington, MA]. Images were deconvolved when necessary using Openlab 5 and assembled in PhotoshopCS [Adobe Systems, San Jose, CA] . SDS-PAGE and western blotting. Infected or transfected cells were washed twice with cold PBS, scraped from tissue culture dishes, resuspended m radioimmunoprecipitatxon lysis buffer [5OmM TrisHCl pH8.0, 15OmM NaCl, l°c NP-40, 0.5°o DOCS, 0.1°o SDS, 5OmM NaF] plus Complete protease inhibitor cocktail [Roche, Mannheim, Germany] and incubated on ice for 30min. The lysate was clarified by centrifugation at 22,500 x g for 10 min in a Tomy MX-160 high-
speed refrigerated microcentrifuge. Total protein concentration was measured using the Bio-Rad protein assay [Bio-Rad, Hercules, CA] (5). The appropriate amount of 5 x SDS sample buffer [25OmM TrisHCl pH 6.8, 50OmM DTT, 10°o SDS, 0.5°° bromophenol blue, 501 glycerol] was added to the samples before boiling for 10 min and SDS-PAGE analysis (41). The proteins were transferred to nitrocellulose membranes with a Bio-Rad Semi-Dry apparatus before western blotting. After blocking the membrane in 5ό non-fat milk in PBST, immobilized proteins were reacted with ORF29p or BAG3 antibodies at a 1:1.000 diltution and HSP90, HSP70 or GAPDH antibody at a 1:2000 dilution in Io nonfat milk in PBST. The membrane was washed three times for 5 mm each with PBST, incubated with an anti-rabbit or anti-mouse antibody conjugated to horseradish peroxidase at a 1:5000 dilution, washed again three times for 5 mm with PBST, twice with PBS and antibodies were visualized by addition of the LumiGLO substrate [KPL] and exposure to X-ray film.
Far-western blottxng. GST, GST-BAG3, GST-BAG3par, GST-BAG3ag and GST-Hsp70 were over-expressed in E. coli, strain BL21[DE3], and purified by affinity chromatography on a glutathione sepharose column (68) . The concentration of the purified proteins was determined and the proteins were subjected to SDS-PAGE and transferred to nitrocellulose membranes using a Bio-Rad Semi-Dry apparatus. Proteins on the membrane were washed once for 10 min with TBST. The membranes were then blocked for 2 h at room temperature with HBB containing 5o nonfat milk, incubated for 2 h with HBB containing 1° nonfat milk and 20 ul of in vitro translated ORF29p, ORF29p [ 1-345] , OPF29p [ 346-1203 ] and ORF63p, washed three times with TBST for 10 min at room temperature, dried and exposed to a phosphorimager screen and X-ray film.
Immunoprecipitation. Infected, transfected or radioactively labeled cells were harvested and lysed as described above. Proteins were immunoprecipitated overnight at 4°C with 25 ul of
GammaBind Plus Sepharose beads [Amersham Biosciences, Piscataway,
NJ] conjugated with BAG3 or ORF29 antibody or 25 ul of anti-FLAG M2 agarose matrix [Sigma] . The beads were collected by centrifugation at 400 x g at 4°C in a Tomy MX-160 high-speed refrigerated microcentrifuge and washed five times for 5 min each with RIPA buffer at 4°C. Bound complexes were released from the beads by boiling for 10 mm in 50 ul 1.5 x SDS sample buffer. The released proteins were subjected to SDS-PAGE.
Pulse-chase labeling. Proteins were radiolabeled after washing the cell cultures three times with PBS and incubation in Met",
Cys" DMEM [GIBCO-BRL] for 30 min. Starvation medium was replaced with labeling medium [modified DMEM supplemented with Io dialyzed calf serum and 500uCi/ml Trans"rS-label (ICN, Irvine, CA)]. After a 1 h pulse cells were washed twice with chase media [normal DMEM supplemented with 1Oo fetal calf serum, 2mM Met and 4mM Cys] and chased for the indicated time periods. Cell lysates were prepared and ORF29p was immunoprecipitated. The bound material was subjected to SDS-PAGE. The gel was dried and exposed to X-ray film. ORF29p levels were quantified with ImageJ [NIH, at rsb. info. nih.gov/ij /] .
In vitro translation. [ S]Met-labeled ORF29p, ORF29p aal-345, ORF29p aa281-1203, ORF29p aa346-1203 and ORF63p were synthesized by coupled in vitro transcription and translation using the TNT coupled reticulocyte system [Promega, Madison, WI] with pET29, pET29[l-345] , pCK-X29 [346-1203] or pCK-X-ORF63.
RNA isolation and cDNA expression library construction. mRNA extracted from MeWo cells was used to construct an expression a cDNA library in the lambda ZAP vector (66) .Total RNA was isolated from MeWo cells using the TRIzol reagent [ Invitrogen] . Poly A+ RNA was purified from total RNA using the Oligotex mRNA purification protocol [Qiagen, Valencia, CA] . Five ug of mRNA were used to construct a cDNA library using the ZAP Express cDNA cloning kit [Stratagene, La Jolla, CA] according to the manufacturer's instructions. The cDNAs were cloned in lambda ZAP
(66) dnd phage DNA was packaged using the Gigapack III Gold packaging extract [Stratagenel . The library was titrated .and amplified once in Escherichia coli, strain XLl-Blue MRF' .
Screening of cDNA library and expression cloning. The cDNA library was screened using a modification of methods previously described (50, 51, 67) . Approximately 10' ptu were used to infect E. coli, strain XLl-Blue MRF' and then plated on 20 NZY agar petri dishes [150mm] . The plates were incubated for 4 h at 42°C and then overlaid with nitrocellulose filters impregnated in 1OmM isopropyl-β-D-thiogalactopyranoside and incubated overnight at 37°C. The filters were then removed and washed for 15 min with TBST [1OmM TrisHCl pH8.0, 15OmM NaCl, 0.05°s Triton X-100], blocked ^ith HBB buffer [2OmM Hepes pH7.4, SmM MgCl_, ImM KCl] with 5o nonfat milk tor 3 h at 4°C and then incubated with 0.8ng/ml of in vitro translated S-met-ORF29p in HBB with Ii nonfat milk overnight at 4°C. All membranes were washed three times with TBST for 10 mm at room temperature, dried and exposed to phosphorimager screens. Positives clones were picked and those phages demonstrating enrichment on subsequent screenings were plaque purified. The cDNA inserts were excised in vivo as a phagemids .
Pesults
BAG3 is a cell protein that interacts with ORF29p. Host proteins that interact with ORF29p were identified from a bacteriophage lambda cDNA expression library constructed using poly-adenylated
RNA from actively growing human fibroblasts [MeWo cells].
Screening of 1015 clones of the library for binding to in vitro translated 's-methionme labeled ORF29p, yielded three positive clones that were plaque purified and used to extract phagemids.
DNA sequencing of the phagemids revealed that all three clones encoded for aal34-575 of BAG3.
BAG3 is a predominantly cytoplasmic, 74kDa, member of an evolutionaπly conserved family of proteins that contain at least one BAG domain that is responsible for binding to the ATPase domain of Hsp70/Hsc70 (76) and with Bcl-2 (42) . Via this interaction, these proteins can modulate the activity of the aforementioned chaperones, and are thus characterized as co- chaperones (23, 74, 76) .
ORF29p interacts with BAG3 in vitro. To verify that ORF29p interacts with BAG3 in vitro and to exclude the possibility that the known BAG3 interaction partner Hsp70 [HSPAlA] bridged the interaction between the proteins, a far-western olot was performed. Purified GST, GST-BAG3, GST-BAG3par, GST-BAG3ag [Fig. IA] and GST-Hsp70 were subjected to SDS-PAGE, transferred to nitrocellulose membranes and renatured in situ [Fig. 1C] . The membranes were probed with in vitro translated ORF29p, ORF29p[l- 345], ORF29p[346-1203] or ORF63p, which is another VZV LAP [Figs. IB & D] . Full length ORF29p, but not the fragment of the protein that contains the N-termmal NLS interacted with full length BAG3 [Figs. IE & F]. In contrast, the C-terminal fragment that lacks the NLS was bound by BAG3 [Fig. IG]. BAG3ag lacks the BAG domain and was not bound by either ORF29p or ORF29p [346-1203] [Figs. IE & G] . However, ORF29p did not interact with Hsp70 in this assay, demonstrating that HSPAlA does not bridge ORF29p and BAG3 [Fig. IE] . Finally, ORF63p did not interact with BAG3 or Hsp70, showing that association with BAG3 is not a general property of the LAPs [Fig. IH].
ORF29p interacts with BA63 in vivo. Next it was determined if ORF29p and BAG3 interact in vivo. 293T cells were transiently transfected with plasmid constructs expressing flag-tagged BAG3, ORF29p or both. Forty-eight hours post transfection the cells were lysed and equal amounts of total protein were incubated with
anti-flag M2 affinity matrix and the bound material was subjected to SDS-PAGE. Western blotting with anti-ORF29p specific antibodies demonstrated that ORF29p was only immunoprecipitated from cells co-transfected with plasmids encoding for both tlag- tagged BAG3 and ORF29p [Fig. 2A] .
To provide evidence that endogenous BAG3 interacts with ORF29p expressed during virus infection, confluent MeWo monolayers were infected with cell-free VZV. Three days post infection the infected cells were lysed and equal amounts of total protein were incubated with antibodies specific for BAG3. Analysis of the bound complexes by western blot with an anti-ORF29p antibody revealed that ORF29p was only present in the bound material from infected cells [Fig. 2B]. Consistent with previous reports Hsp70/Hsc70 but not Hsp90 were present in the complexes precipitated with the anti-BAG3 antibody [Fig 2B and data not shown] (22) . Moreover, immunocapture with an anti-ORF29p antibody showed that Hsp70/Hsc70, the known binding partners of BAG3, are among the bound proteins in VZV infected cells [Fig. 2B]. These results suggest that, during VZV infection a complex composed of ORF29p, BAG3 and Hsp70/Hsc70 is formed.
ORF29p xs an Hsp90 client for proteasomal degradation. As discussed in the introduction, besides peptide folding, heat shock proteins can also control protein turnover (53, 54). Hsp90 is thought to be a key regulator of this balance between folding and polypeptide turnover, depending on its association with other chaperone and co-chaperone proteins (58, 62) . BAG3 can abrogate protein degradation mediated by Hsp70 - Hsp90 chaperone complexes (22) . Because ORF29p interacts with BAG3, it was determined if this pathway controls ORF29p levels. Geldanamycin and other ansamycin antibiotics interact with and inhibit the ATPase domain of Hsρ90, shifting the balance of Hsρ90 activity from protein folding to degradation of its clients (65, 78) . Therefore, it was tested if geldanamycin affected the stability of ORF29p. The t4 of ORF29p in MeWo cells infected with an adenovirus expressing
ORF29p was examined by pulse chase analysis in untreated and drug treated cells. Twenty-four hours post infection [hpi] DMSO or geldanamycin was added to the growth media. After 36h the infected cells were washed, starved for 30 mm in labeling medium containing DMSO or geldanamycin and then labeled with 'S for 1 h. The labeled proteins were chased for various times and cell extracts were prepared and normalized for total protein concentration before capture with antibody to ORF29ρ bound to agarose beads. Bound proteins were subjected to SDS-PAGE and visualized by autoradiography [Fig. 3]. Protein levels were determined relative to the 0 h chase point. In DMSO treated cells, the XM. of ORF29p exceeded the 6 h chase time point. However, the kinetics of protein degradation was faster and ORF29p was significantly less stable [th ≤ Ih] in geldanamycin treated cells. Thus, the ATPase activity of Hsp90 is required for stabilization of ORF29p.
ORF29p localizes to the cytoplasm of geldanamycin and 17DMAG treated MeWo cells. It was previously shown that the intracellular localization of ORF29p correlated with its stability. The XM. of the protein is shorter in cell lines where it is localized in the cytoplasm, such as U373MG, compared to cell lines, such as MeWo cells, where it localized in the nucleus (70) . Therefore, this report investigated if the decreased half- life caused by geldanamycin treatment prevented nuclear localization of ORF29p in MeWo cells.
MeWo cells were infected with adenovirus expressing ORF29p. After adsorption, the medium containing the virus was removed and replaced with medium containing DMSO, geldanamycin or 17DMAG [a water soluble analog] . The cells were fixed at 48 hpi and ORF29p localization was examined. Following DMSO treatment, ORF29p remained m the nuclei of MeWo cells [Fig. 4A] . However, in the presence of the drugs, the number of cells with detectable ORF29p was significantly decreased and the protein was excluded from the
nucleus of the few cells where expression was detected [Figs 4B & C]. Similar results were obtained with shorter drug treatment.
To demonstrate that nuclear exclusion resulting from drug-induced 5 inhibition of Hsp90 ATPase activity was specific for ORF29p and not from a non-specific blockade of the cell's nuclear import machinery, the localization of ORF63p was examined. MeWo cells were infected with an adenovirus expressing ORF63p, treated as described above, fixed and the protein localization was examined
10 [Fig. 4D-F] . Unlike ORF29p, geldanamycin or 17DMAG did not affect the number of cells expressing ORF63p or its localization. This experiment demonstrates that steady state levels and nuclear localization of ORF29p are modulated by the ATPase activity of Hsp90.
Inhibition of Hsp90 abolishes VZV plaque formation. OPF29p is indispensable for viral growth (11). Therefore one would predict that pharmacologically induced nuclear exclusion of ORF29ρ would inhibit VZV replication. Two experiments were done to investigate
?0 the ability of VZV to grow m the presence of Hsp90 ATPase inhibitors .
Confluent MeWo cells were infected with cell-free VZV. After adsorption, varying concentrations of geldanamycin or 17DMAG were
25 added to the infected cell monolayers. At 96 hpi the cells were fixed, stained with crystal violet and plaques were counted [Fig. 5A] . The number of plaques in each well treated with drugs was compared to the number arising in untreated controls This analysis revealed that drug induced inhibition of Hsp90 ATPase
30 activity blocked plaque formation. In the range of concentrations used for these experiments, 17DMAG was a more potent inhibitor of plaque formation than geldanamycin [Fig. 5A].
To ascertain the effect on virus spread, confluent MeWo cells
35 were infected with cell-free VZV. After adsorption the cells were overlaid with medium containing DMSO or drugs. The cells were
fixed at 24, 48 or 72 hpi and the expression and intracellular localization of ORF29p and gE, a late glycoprotein, were determined. We show that in cells treated with DMSO, the virus has started to spread to neighboring cells at 24 hpi . By 48 hpi 5 the cells started to fuse and gE was expressed at high levels. By 72h large plaques were apparent [Fig. 5B] . At all time points, in cells treated with geldanamycin, a limited number of cells expressed viral early and late proteins but the infection did not spread to neighboring cells [Fig. 5B]. Similar findings were LO obtained with 17DMAG [data not shown] . Although the nuclear import of ORF29p is inhibited by ansamycms, we cannot exclude the possibility that cellular clients of Hsp90 are also required for VZV replication and are affected by drug treatment.
L 5 Hsp90, Hsp70/Hsc70 and BAG3 are redistributed during VZV infection and are localized in nuclear replication-transcription foci. This report established that ORF29p forms complexes with BAG3 and Hsp70/Hsc"?0 in vivo, and its degradation is dependent on Hsp90. Next, the intracellular localization of these proteins 0 during VZV infection was determined.
MeWo cells infected with VZV were fixed 24 hpi and the intracellular localization of ORF29p, ORF62p, Hsp90, Hsp70/Hsc70 and BAG3 was monitored by indirect IF microscopy. As previously 5 shown, ORF29p localized predominantly in the nuclei of cells infected with VZV (39, 71). The protein was diffuse in the nucleus of some infected cells, whereas in others it was localized in discrete regions of the nucleus. The localization pattern of ORF29p was very similar to that of its HSV-I homolog, 0 ICP8, which exhibits diffuse nuclear staining at early times, but accumulates in sites of DNA replication later m infection (9, 63) . Moreover, it has been shown that ORF62p, a transcription regulator, localized in a manner similar to ORF29p and its HSV-I homolog ICP4 (40). Specifically, ORF62p was predominantly in the 5 nucleus of the infected cell, showing a diffuse staining early, but concentrating in globular structures later in infection.
Furthermore, the merged images demonstrated that ORF29p and ORF62p CO- Localized, indicating that sites ot replication and transcription form in the nuclei of infected cells, similar to what was shown tor HSV-I (21) [Fig. 6A].
The intracellular localization of the ORF29p associated chaperone proteins Hsp90 and Hsp70/Hsc70 was then investigated. Both proteins were predominantly localized in the cytoplasm in uninfected cells. However, during VZV infection, a fraction of these proteins was redistributed and colocalized with ORF29p in the nucleus [Fig. 6B and C].
Finally, this report determined that the co-chaperone protein BAG3 also redistributed during virus infection. BAG3 was diffusely localized predominantly in the cytoplasm of uninfected cells, but in infected cells a fraction of the protein co- localized with ORF62p, concentrating in discrete nuclear structures [Fig. 6D] .
These data demonstrate that in infected cells the host chaperone and co-chaperone machinery redistribute and localize to intranuclear structures that contain ORFs 29p and 62p.
BAG3 is essential for efficient VZV replication. To evaluate the functional requirement of BAG3 for the replication of VZV, cell lines stably expressing siRNAs targeting the BAG3 mRNA were constructed. Pseudotyped retroviruses were constructed and used to transduce MeWo cells [Fig. 7A] . After selection in puromycin and colony isolation, intracellular BAG3 levels were evaluated by western blot [Fig. 7B] . siPNA 737 had almost no effect on the level of endogenous BAG3, whereas cells transduced with siRNA 2235 had only 8% of the level present m cells transduced with an empty vector. The resulting cell lines were tested for the ability of VZV to replicate using plaque and spread assays.
Monolayers of confluent empty, si737 and si2235 cells were infected with cell-free VZV. At 72 hpi the cells were fcixed, stained and then plaques were counted. The number of plaques in the siRNA cell lines was normalized to the number formed in the 5 empty cell line. Reduction of BAG3 levels resulted in a 60-fold decrease in virus titer when compared to the cell lines containing either the empty vector or the nonfunctional targeting sequence. Thus, BAG3 levels dramatically and specifically affect the efficiency of VZV plaque formation.
LO
The defect in virus growth caused by the reduction of BAG3 levels was further characterized by IF microscopy to examine the presence and localization of ORF63p and gE, an immediate early and a late virus protein respectively. At 48 hpi the virus
L5 replicated and spread to neighboring cells in the empty [Fig. 8 rows 1 S 2] and si737 control cell lines. The nuclei of the infected cells formed ring-shaped structures within the polykaryocytes and the virus proteins stained as a continuous layer, which is indicative of VZV-directed syncytia formation
20 (77) . By 96 hpi almost all cells in the monolayer expressed virus proteins and large plaques adjacent to the condensed nuclei were seen. Although virus proteins were expressed in the cell line with decreased BAG3 levels, the virus spread to neighboring cells was slow and inefficient [Fig. 8 rows 3 & 4] . At 48 hpi, the
°5 average size of the infected foci was strikingly reduced and protein staining was detected only in individual cells, demonstrating that cell fusion and virus spread had not occurred. At 96 hpi, although the virus was able to spread, the ring-shaped nuclear structures did not form. Thus, in the absence of BAG3,
30 virus replication and spread were both delayed and defective.
To confirm that the altered plaque phenotype, decreased plαquing efficiency and lower yield of VZV resulted from decreased levels of BAG3, an adenovirus vector expressing a siRNA-resistant form 35 of BAG3 that lacked the si2235 target sequence was used to complement si2235 cells. Western blot analysis revealed that BAG3
levels were increased to 56ri of that found in the empty cell line [Fig. 7B] . Pre-mfection of si2235 cells with AdBAG3 significantly restored the defective phenotype as measured by VZV plaque formation. The number of plaques formed increased by 16- fold [Fig. 7C]. Moreover, IF microscopy of infected cells revealed ring-shaped nuclear structures and enhanced virus spread when compared to si2235 cells [Fig. 8 rows 5 & 6] .
From these data one can conclude that BAG3 is required for efficient VZV replication and plaque formation and that decreased levels of BAG3 expression can be complemented by exogenous expression from an adenovirus vector.
BAG3 is not required for HSV replication. To evaluate BAG3's specificity for VZV replication, this study investigated if growth of another alphaherpesvirus, herpes simplex virus, was altered in the siRNA knock down cell lines using plaque and spread assays.
Monolayers of confluent empty, si737 and si2235 cells were infected with HSV. At 48 hpi cells were fixed, stained and plaques were counted. In contrast to VZV, plaqumg efficiency of herpes simplex virus was unaffected by decreased BAG3 levels [Fig. 7C] .
The growth of HSV in the knock down cell lines was further characterized using spread assays. Confluent empty and si2235 cells were infected with HSV and fixed at 48 hpi. The presence and localization of an immediate early protein, ICPO, and a late glycoprotein, gC, were examined by IF microscopy. Unlike VZV, virus spread, and the morphology of virus-induced syncytia were similar in control and knock down cell lines [Fig. 9].
Thus, this data indicate that BAG3 is a host protein that is specifically required for efficient replication of VZV and not HSV.
Discussion
The role of BAG3 is disclosed herein as a host protein that interacts with VZV ORF29p. A lambda cDNA expression library screen identified BAG3 as a host protein that interacts with ORF29p. Far western blotting showed that ORF29p associates in vitro with full-length BAG3 and fragments that contain the BAG domain. The region of ORF29p that is required to form the complex lacks the NLS, suggesting that the direct biological role of the interaction is not the association of ORF29p with the nuclear import machinery. The far western assay also demonstrated that ORF29p does not directly interact with Hsp70, a known BAG3 partner [Fig. IE]. Thus, the interaction of the protein with BAG3 is either direct or bridged by other proteins present in the rabbit reticulocyte lysate.
Unlike other human alphaherpesviruses, VZV expresses a subset of its genome during latency. It is believed that that the LAPs may passively maintain the latent state because they fail to accumulate in the nucleus and thus render the virus unable to replicate. However, a more active role is also possible. Successful maintenance of latency requires the survival of infected neurons. B-cell lymphoma 2 (Bcl-2) , a well described oncoprotein and potent inhibitor of apoptosis (11), heterodimerizes with members of the Bcl-2 protein family, including the proapoptotic factor Bax . BAG3 and other BAG family members interact with Bcl-2 and synergize with it to prevent Bax induced cell death (1, 42) . The interaction of ORF29p with BAG3 raises the possibility that expression of this LAP in latently infected neurons can regulate apoptosis.
Since BAG3 abrogates protein degradation mediated by heat shock proteins (22), it was hypothesized that its interaction partner ORF29p is a client for Hsp90 directed proteasomal degradation. This report shows that inhibition of Hsp90 activity with drugs that associate with the ATP binding domain of Hsp90 and "lock"
the protein in its ADP bound conformation (31,73)) results in the rapid degradation of the protein [Fig. 3], It has previously been reported that restriction of ORF29p to the cytoplasm results in its rapid degradation. However, the protein is stabilized when proteasome inhibitors are added and it can then accumulate in the nucleus (70). Here it : s shown that the converse is also true. Pharmacological intervention of Hsp90 activity destabilizes ORF29p and causes it to accumulate in the cytoplasm of cells where it is normally localized to the nucleus [Fig. 4]. Interestingly, the localization of ORF63p is not affected by the same treatment. Although both ORF29p and ORF63p are expressed during latency m infected dorsal root ganglia and accumulate in the nucleus during reactivation, this study demonstrates that the mechanisms governing the degradation and the nuclear/cytoplasmic bwitch for the two proteins are distinct. This result suggests that the nuclear import of the individual LAPs during the reactivation process may involve unique cellular pathways that are triggered in response to certain stimuli.
It is well known that molecular chaperones recognize and associate with all nascent polypeptides as they exit the ribosome to prevent illegitimate interactions between exposed hydrophobic surfaces and to assist proteins in adopting their native conformation (25) . Although molecular chaperones can also direct protein turnover, unlike the folding of newly synthesized proteins, only a subset of the cellular polypeptides is degraded by this pathway. Here it is suggested that recognition mechanisms exist to differentially target proteins, such as ORF29p, to the proteasome, but spare others, such as ORF63p. It is likely that the interaction of co-chaperones, e.g. BAG3, with their clients alters the activity of the chaperones resulting in differential targeting.
Drug attenuation of Hsp90' s ATPase activity efficiently inhibits VZV plaque formation [Fig. 5] . Geldanamycin treatment also inhibits replication of HSV-I (43), by inhibiting nuclear
transport off the virus DNA polymerase (7) . It is likely that inhibition of VZV replication is a result of interfering with both cell and virus targets. As far as VZV targets are concerned, this study demonstrates that the drug affects at least ORF29p localization and stability. Ansamycin antibiotics are currently in clinical trials for their anti-tumor activities (57). This report proposes that the same compounds can be used as antiviral drugs targeting the replication and spread of alphaherpesviruses .
This disclosure shows that protein complexes containing ORF29p, Hsp90, Hsp70/Hsc70 and BAG3 assemble at distinct intranuclear sites in VZV mtected cells. Furthermore, these results demonstrate that ORF62p colocalizes with these proteins in virus replication compartments. This indicates that replication and transcription coincide in discrete compartments inside the nuclei of VZV infected cells. The redistribution of heat shock proteins to the nucleus of infected cells is a conserved characteristic of human alphaherpesviruses, and was described for HSV-I (7,8). However, the function of cnaperone and co-chaperone proteins during virus infection is not yet understood.
Bacterial chaperones are essential for lytic replication of bacteriophage lambda. DnaK, the prokaryotic homolog of Hsp70, is required for release of the P protein from the preprimosomal complex and generation of the large multienzyme complex on the origin of DNA replication (44) . Furthermore, the GroES/EL chaperone system is required for folding and multimeπzation of the connector complex, which is similar to the portal structure of HSV-I (28) . The replication machinery of DNA animal viruses, such as papillomaviruses and polyomaviruses, also interacts with eukaryotic chaperone proteins (10,46). However, the function of such interactions has not yet been determined. It is lively that the evolutionarily conserved activities of mammalian chaperones are required for efficient replication of animal viruses, such as alphaherpesviruses. The greatly increased macromolecular crowding in the nuclei of cells infected with herpesviruses and the
efficient and rapid assembly of the replication and transcription complexes are likely to require heat shock proteins. Furthermore, proteolytic activity is also associated with these proteins. Given that a number of host proteins are degraded in the nucleus during alphaherpesvirus infection, molecular chaperones are candidates to provide the driving force for virus-directed protein degradation (20,26).
To provide evidence for the functional significance of the virus- induced redistribution of the chaperone and co-chaperone proteins in the nuclei of infected cells, this investigation evaluated virus replication and spread in cell lines with reduced levels of BAG3. VZV is able to infect these cells and express immediate early and late proteins. However, the infection inefficiently spreads when intracellular EAG3 levels are decreased. Nevertheless, in BAG3 depleted cells OPF29p accumulates in the nucleus when autonomously expressed, and following VZV infection heat shock proteins localize to the nucleus ana virus transcription/replication sites form. This suggests that localization of the chaperone proteins in the nucleus is not sufficient for successful replication of the viral genome. Regulation of heat shock protein activity by BAG3 and/or other co-chaperone proteins is also required.
Because BAG3 interacts with ORF29p, a component of the VZV replication machinery, the results suggest that it facilitates virus genome replication. In the absence of BAG3, inefficient replication results in a temporal delay m the accumulation of viral progeny and drastically decreased levels of late glycoproteins that are required for cell-fusion (17), thus limiting the spread of VZV to adjacent cells.
Although the functional dependence of the Hsp70/Hsc70 complexes on BAG3 is unknown, structural data suggest that members of the BAG family function as nucleotide exchange factors (69). Thus they may promote the release of Hsp70/Hsc70 substrates and
exchange bound ADP for ATP, similar to the prokaryotic protein GrpE (45) . Based on this hypothesis, only small amounts of BAG3 would be required for certain cellular processes. This is consistent with the results reported herein, as knock down of b BAG3 does not block nuclear accumulation of virus and host proteins, allowing for formation of transcription/replication bodies but at the cost of a dramatically slowed and defective VZV infection cycle.
10 Interestingly, HSV-I growth is not inhibited in cell lines with reduced BAG3 levels [Fig. 7C & 9] . This may reflect the differences in distribution of chaperones and co-chaperones in the nuclei of cells infected with HSV vs. those infected with VZV. During HSV infection Hsp70 localizes adjacent to but not
Lb within the globular replication factories where virus-specified proteins and Hsp90 reside (1 ) . In contrast, Hsps "7O and 90 are uniformly distributed throughout replication sites formed m VZV infected cells [Fig. 6]. Thus, although these closely related viruses redistribute the host chaperone machinery inside the
?0 nuclei of infected cells, the functional requirements of their replication/transcription machinery for co-chaperones differ.
The disclosed results demonstrate that VZV replication depends on regulation of the activity of chaperone proteins, including Hsp90
25 and Hsp70/Hsc70. Virus infection of permissive cells results in commandeering the cell's chaperone machinery to sites of replication/transcription to promote virus growth and spread. In contrast, drug inhibition of Hsp90 function or reduction of the levels of the Hsp70 activity regulator BAG3 result in greatly
30 diminished virus replication. These findings suggest that VZV, and probably other herpesviruses, exploit the heat shock protein machinery to cense the cellular environment and regulate their life cycle. Because the levels and activity of chaperone proteins are altered in response to different stimuli and intracellular
35 conditions, and alphaherpesviruses exit from latency in response to various stress conditions, it is tempting to speculate that
heat shock proteins serve as a component of a molecular switch that' regulates the shift between lytic and latent infection.
References
L. Antoku, K., R. S. Maser, W. J. Scully, Jr., S. M. Delach, and D. E. Johnson. 2001. Isolation of Bcl-2 binding proteins that exhibit homology with BAG-L and suppressor of
'ieath domains protein. Biochem Biophys Res Commun 286:1003-
10.
2. Arvm, A. M. 1996. Varicella-zoster virus. Clin Microbiol
Rev 9:361-81. 3. Arvm, A. M. 1996. Varicella-zoster virus: overview and clinical manifestations. Semin Dermatol 15:4-7.
4. Bimston, D., J. Song, D. Winchester, S. Takayama, J. C. Reed, and R. I. Moπmoto. 1998. BAG-I, a negative regulator of Hsp70 chaperone activity, uncouples nucleotide hydrolysis from substrate release. Embo J 17:6871-8.
5. Bradford, M. M. 1976. A rapid _ind sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protem-dye binding. Anal Biochem 72:248- 54. 6. Brummelkamp, T. R., R. Bernards, and R. Agami . 2002. Stable suppression of tumorigenicity by virus-mediated RNA interference. Cancer Cell 2:243-7.
7. Burch, A. D., and S. K. Weller. 2005. Herpes simplex virus type 1 DNA polymerase requires the mammalian chaperone hsp90 for proper localization to the nucleus. J Virol 79:10740-9.
8. Burch, A. D., and S. K. Weller. 2004. Nuclear sequestration of cellular chaperone and proteasomal machinery during herpes simplex virus type 1 infection. J Virol 78:7175-85. 9. Burkham, J., D. M. Coen, and S. K. Weller. 1998. NDlO protein PML is recruited to herpes simplex virus type 1 prereplicative sites and replication compartments in the presence of viral DNA polymerase. J Virol 72:10100-7.
10. Campbell, K. S., K. P. Mullane, I. A. Aksoy, H. Stubdal, J. Zalvide, J. M. Pipas, P. A. Silver, T. M. Roberts, B. S. Schaffhausen, and J. A. DeCaprio. 1997. DnaJ/hsp40
chaperone domain of SV40 large T antigen promotes efficient viral DNA replication. Genes Dev 11:1.098-110.
11. Cohen, J. T., r . Krogmann, L. Pesnicak, and M. A. All. 2007. Absence or Overexpression of the Varicella-Zoster
5 VLΓUS (VZV) ORF29 Latency-Associated Protein Impairs Late Gene Expression and Reduces VZV Latency in a Rodent Model. J Virol 81:1586-91.
12. Cohen, J. I., and S. E. Straus. 1996. Varicella-Zoster Virus and Its Replication, p. 2525-2545. In B. N. Fields,
10 D. M. Knipe, and P. M. Howley (ed.), Fields Virology. Lippincott - Raven Publushers, Philadelphia.
13. Cohrs, R. J., M. Barbour, and D. H. Gilden. 1996. Varicella-zoster virus (VZV) transcription during latency in human ganglia: detection of transcripts mapping to genes
J 5 21, 29, 62, and 63 in a cDMA library enriched for VZV RNA. J Virol 70:2789-96.
14. Cohrs, R. J., M. B. Barbour, R. Mahaiingam, M. Wellish, and D. H. Gilden. 1995. Varicella-zoster virus (VZV) transcription during latency in human ganglia: prevalence 0 of VZV gene 21 transcripts in latently infected human ganglia. J Virol 69:2674-8.
15. Cohrs, R. J., D. H. Gilden, P. R. Kinchington, E. Gnnfeld, and P. G. Kennedy. 2003. Varicella-zoster virus gene 66 transcription and translation in latently infected human
25 Ganglia. J Virol 77:6660-5.
16. Cohrs, R. J., K. Srock, M. B. Barbour, G. Owens, R. Mahaiingam, M. E. Devlin, M. Wellish, and D. H. Gilden. 1994. Varicella-zoster virus (VZV) transcription during latency in human ganglia: construction of a cDNA library
30 from latently infected human trigeminal ganglia and detection of a VZV transcript. J Virol 68:7900-8.
17. Cole, M. L., and C. Grose. 2003. Membrane fusion mediated by herpesvirus glycoproteins: the paradigm of varicella- zoster virus. Rev Med Virol 13:207-22.
18. Cory, S., D. C. Huang, and J. M. Adams. 2003. The Bcl-2 family: roles in cell survival and oncogenesis. Oncogene 22:8590-607.
19. Croen, K. D., J. M. Ostrove, L. J. Dragovic, and S. E. b Straus. 1988. Patterns of gene expression and sites of latency in human nerve ganglia are different for varicella- zoster and herpes simplex viruses. Proc Natl Acad Sci U S A 85:9773-7.
20. Dai-Ju, J. Q., L. Li, L. A. Johnson, and R. M. Sandri- 10 Goldm. 2006. ICP27 interacts with the C-terminal domain of
RNA polymerase II and facilitates its recruitment to herpes simplex virus 1 transcription sites, where it undergoes proteasomal degradation during infection. J Virol 80:3567- 81.
L5 21. de Bruyn Kops, A., and D. M. Knipe . 1994. Preexisting nuclear architecture defines the intranuclear location of herpesvirus DNA replication structures. J Virol 68:3512-26.
22. Doong, H., K. Rizzo, S. Fang, V. Kulpa, A. M. Weissman, and E. C. Kohn. 2003. CAIR-l/BAG-3 abrogates heat shock 0 protem-70 chaperone complex-mediated protein degradation: accumulation of poly-ubiquitmated Hsp90 client proteins. J Biol Chem 278:28490-500.
23. Doong, H., A. Vrailas, and E. C. Kohn. 2002. What's in the 'BAG'?--A functional domain analysis of the BAG-family b proteins. Cancer Lett 188:25-32.
24. ElKareh, A., A. J. Murphy, T. Fichter, A. Efstratiadis, and S. Silverstem. 1985. "Transactivation" control signals in the promoter of the herpesvirus thymidine kinase gene. Proc Natl Acad Sci U S A 82:1002-6. 0 25. Ellis, R. J., and F. U. Hartl . 1996. Protein folding in the cell: competing models of chaperonin function. Faseb J 10:20-6.
26. Everett, R. D., and G. G. Maul. 1994. HSV-I IE protein VmwllO causes redistribution of PML. Embo J 13:5062-9.
27. Foldman, D. E., and J. Frydman. 2000. Protein folding LΠ VLVO: the importance of molecuLar chaperones. Curr Opin Struct Biol 10:26-33.
28. Georgopoulos, C. P., R. W. ilendrix, S. R. Casηens, and A. D. KdLber. 1973. Host participation _n bacteriophage lambda head assembly. J MoI Biol 76:45-60.
29. Giraldo, R., and R. Diaz-Orejas . 2001. Similarities between the DNA replication initiators of Gram-negative bacteria plasmids (RepA) and ^ukaryotes (Orc4p) /archaea (Cdc6p) . Proc Natl Acad Sci U S A 98:4938-43.
30. Gong, D., and J. E. Ferrell, Jr. 2004. Picking a winner: new mechanistic insights into the design of effective 3iRNAs. Trends Biotechnol 22:451-4.
31. Grenert, J. P., W. P. Sullivan, P. Fadden, T. A. Haystead, J. Clark, E. Mimnaugh, H. Krutzsch, H. J. Ochel, T. W. ochulte, E. oausville, L. M. Neckers, and D. O. Toft. 1997. The amino-termmal domain of heat shock protein 90 fhsp90) that binds geldanamycin is an ATP/ADP switch domain that regulates hsp90 conformation. J Biol Chem 272:23843-50. 32. Gπnfeld, E., and P. G. Kennedy. 2004. Translation of varicella-zoster virus genes during human ganglionic latency. Virus Genes 29:317-9.
33. Grose, C, and P. A. Brunei. 1978. Varicella-zoster virus: isolation and propagation in human melanoma cells at 36 and 32 degrees C. Infect Immun 19:199-203.
34. Hershko, A., and A. Ciechanover. 1998. The ubiquitin system. Annu Rev Biochem 67:425-79.
35. Hohfeld, J., and S. Jentsch. 1997. GrpE-like regulation of the hsc70 chaperone by the anti-apoptotic protein BAG-I. Embo J 16:6209-16.
36. Jagla, B., N. Aulner, P. D. Kelly, D. Song, A. Volchuk, A. Zatorski, D. Shum, T. Mayer, D. A. De Angelis, 0. Ouerfelli, U. Rutishauser, and J. E. Rothman. 2005. Sequence characteristics of functional siRNAs. Rna 11:864- 72.
37. Kennedy, P. G., E. Grinfeld, and J. E. Bell. 2000. Varicella-zoster virus gene expression in latently infected and explanted human ganglia. J Virol 74:11393-8.
38. Kmchmgton, P. R., K. Fite, and S. E. Turse. 2000. Nuclear 5 accumulation of IE62, the varicella-zoster virus (VZV) major transcriptional regulatory protein, is inhibited by phosphorylation mediated by the VZV open reading frame 66 protein kinase. J Virol 74:2265-77.
39. Kinchington, P. R., G. Inchauspe, J. H. Subak-Sharpe, F. 10 Robey, J. Hay, and W. T. Ruyechan. 1988. Identification and characterization of a varicella-zoster virus DNA-bindmg protein by using antisera directed against a predicted synthetic oligopeptide. J Virol 62:802-9.
40. Knipe, D. M., D. Senechek, S. A. Rice, and J. L. Smith. L5 1987. Stages in the nuclear association of the herpes simplex virus transcriptional activator protein ICP4. J Virol 61:276-84.
41. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 0 227:630-5.
42. Lee, J. H., T. Takahashi, N. Yasuhara, J. Inazawa, S. Kamada, and Y. Tsu]imoto. 1999. Bis, a Bcl-2-bindmg protein that synergizes with Bcl-2 in preventing cell death. Oncogene 18:6183-90. 5 43. Li, Y. H., P. Z. Tao, Y. Z. Liu, and J. D. Jiang. 2004. Geldanamycm, a ligand of heat shock protein 90, inhibits the replication of herpes simplex virus type 1 in vitro. Antimicrob Agents Chemother 48:867-72.
44. Liberek, K., C. Georgopoulos, and M. Zylicz . 1988. Role of 0 the Escherichia coll DnaK and DnaJ heat shock proteins in the initiation of bacteriophage lambda DNA replication. Prcc Natl Acad Sci U S A 35:6632-6.
45. Liberek, K., J. Marszalek, D. Ang, C. Georgopoulos, and M. Zylicz. 1991. Escherichia coll DnaJ and GrpE heat shock 5 proteins jointly stimulate ATPase activity of DnaK. Proc Natl Acad Sci U S A 88:2874-8.
46. Liu, J. S., S. R. Kuo, A. M. Makhov, D. M. Cyr, J. D. Griffith, T. R. Broker, and L. T. Chow. 1998. Human Hsp70 and Hsp40 chaperone proteins facilitate human ρapillomavirus-11 El protein binding to the origin and
5 stimulate cell-free DNA replication. J Biol Chem 273:30704- 12.
47. Lium, E. K., C. A. Panagiotidis, X. Wen, and S. oilverstem. 1996. Repression of the alphaO gene by ICP4 during a productive herpes simplex virus infection. J Virol
10 70:3488-96.
48. Lungu, O., P. W. Annunziato, A. Gershon, S. M. Staugaitis, D. Josefson, P. LaRussa, and S. J. Silverstem. 1995. Reactivated and latent varicella-zoster virus in human dorsal root ganglia. Proc Natl Acad 3ci U S A 92:10980-4.
L5 49. Lungu, O., C. A. Panagiotidis, P. W. Annunziato, A. A. Gershon, and S. J. Silverstem. 1998. Aberrant intracellular localization of Varicella-Zoster virus regulatory proteins during latency. Proc Natl Acad Sci U S A 95:7080-5. 0 50. Macgregor, P. F., C. Abate, and T. Curran. 1990. Direct cloning of leucine zipper proteins: Jun binds cooperatively to the CRE with CRE-BPl. Oncogene 5:451-8.
51. Margolis, B., and R. Young. 1994. Screening lambda expression libraries with antibody and protein probed, p. 4 5 v. In D. M. Glover and B. D. Hames (ed.), DNA cloning : a practical approach, 2nd ed. IRL Press at Oxford University Press, Oxford ; New York.
52. Markowitz, D., S. Goff, and A. Bank. 1988. A safe packaging line for gene transfer: separating viral genes on two 0 different plasmids. J Virol 62:1120-4.
53. McClellan, A. J., and J. Frydman. 2001. Molecular chapercnes and the art of recognizing a lost cause. Nat Cell Biol 3:E51-3.
54. McClellan, A. J., S. Tarn, D. Kaganovich, and J. Frydman. 5 2005. Protein quality control: chaperones culling corrupt conformations. Nat Cell Biol 7:736-41.
55. McKnight, 3. L., and R. Kingsbury. 1982. Transcriptional control. signals off a eukaryotic protein-coding gene. Science 217:316-24.
56. Meier, J. L., R. P. Holman, K. D. Croen, J. E. Smialek, and S. E. Straus. 1993. Varicella-Foster virus transcription in human trigeminal ganglia. Virology 193:193-200.
57. Neckers, L., and K. Neckers. 2005. Heat-shock protein 90 inhibitors as novel cancer chemotherapeutics - an update. Expert Opm Emerg Drugs 10:137-49. 58. Neckers, L., T. W. Schulte, and E. Mimnaugh. 1999. Geldanarnycm as a potential anti-cancer agent: its molecular target and biochemical activity. Invest New Drugs 17:361-73.
59. Ng, P., D. T. Cummings, C. M. Evelegh, and F. L. Graham. 2000. Yeast recombinase FLP functions effectively in human cells for construction of adenovirus vectors. Biotechmques 29:524-6, 528.
60. Nishioka, Y., and S. Silverstem. 1977. Degradation of cellular mRNA during infection by herpes simplex virus. Proc Natl Acad Sci U S A 74:2370-4.
61. Panagiotidis, C. A., and S. J. Silverstem. 1995. pALEX, a dual-tag prokaryotic expression vector for the purification of full-length proteins. Gene 164:45-7.
62. Prodromou, C, S. M. Roe, R. O'Brien, J. E. Ladbury, P. W. Piper, and L. H. Pearl. 1997. Identification and structural characterization of the ATP/ADP-bmding site in the Hsp90 molecular chaperone. Cell 90:65-75.
63. Qumlan, M. P., L. B. Chen, and D. M. Knipe . 1984. The intranuclear location of a herpes simplex virus DNA-binding protein is determined by the status of viral DNA replication. Cell 36:857-68.
64. Peynolds, A., D. Leake, Q. Boese, S. Scannge, W. S. Marshall, and A. Khvorova. 2004. Rational siRNA design for RNA interference. Nat Biotechnol 22:326-30. 65. Schneider, C, L. Sepp-Lorenzino, E. Nimmesgern, 0. Ouerfelli, S. Damshefsky, N. Rosen, and F. U. Hartl. 1996.
Pharmacologic shifting of a balance between protein retoldinq and degradation mediated by Hsp90. Proc Natl Acad Sci U S A 93: 14536-41.
66. Short, J. M., J. M. Fernandez, J. A. Sorge, and W. D. Huse. 5 1988. Lambda ZAP: a bacteriophage lambda expression vector with in vivo excision properties. Nucleic Acids Res 16: 7583-600.
67. Skolnik, E. Y., B. Margolis, M. Mohammadi, E. Lowenstein, R. Fischer, A. Drepps, A. Ullrich, and J. Schlessinger . 0 1991. Cloning of PI3 kinase-associated p85 utilizing a novel method for expression/cloning of target proteins for receptor tyrosine kinases. Cell 65:83-90.
68. Smith, D. B., and K. S. Johnson. 1988. Single-step purification of polypeptides expressed in Escherichia coll
L5 .is fusions with glutathione S-transferase . Gene 67:31-40.
69. Sondermann, H., C. Scheufler, C. Schneider, J. Hohfeld, F. U. Hartl, and I. Moarefi. 2001. Structure of a Bag/Hsc70 complex: convergent functional evolution of Hsp70 nucleotide exchange factors. Science 291:1553-7. 0 70. Stallmgs, C. L., G. J. Duigou, A. A. Gershon, M. D. Gershon, and S. J. Silverstein. 2006. The cellular localization pattern of Varicella-Zoster virus ORF29p is influenced by proteasome-mediated degradation. J Virol 80:1497-512. 5 71. Stallmgs, C. L., and S. Silverstein. 2005. Dissection of a novel nuclear localization signal in open reading frame 29 of varicella-zoster virus. J Virol 79:13070-81.
72. Straus, S. E., H. S. Aulakh, W. T. Ruyechan, J. Hay, T. A. Casey, G. F. Vande Woude, J. Owens, and H. A. Smith. 1981. 0 Structure of varicella-zoster virus DNA. J Virol 40:516-25.
73. Sullivan, W., B. Stensgard, G. Caucutt, B. Bartha, N. McMahon, E. S. Alnemπ, G. Litwack, and D. Toft. 1997. Nucleotides and two functional states of hsp90. J Biol Chem 272:8007-12. 5 74. Takayama, S., D. N. Bimston, S. Matsuzawa, B. C. Freeman, C. Aime-Sempe, Z. Xie, R. I. Moπmoto, and J. C. Reed.
1997. BAG-L moduLates the chape rone activity of Hsp7O/Hsc7O. Embo J L6 : 4887-96.
75. Takayama, S., and J. C. Reed. 2001. MoLecular chaperone targeting and regulation by BAG fami.Ly proteins. Nat Cell Biol 3:E237-4L.
76. Takayama, 5., Z. Xie, and J. C. Reed. L999. An evo Lutionanly conserved family of Hsp70/Hsc70 molecular chaperone regulators. J Biol Chem 274:781-6.
77. Tzanck, A. 1947. Le cy todiagnostic immediat en dermatolσgie . Bull Soc Fr Dermatol Syph 7:68.
78. Whitesell, L., E. G. Mimnaugh, B. De Costa, C. E. Myers, and L. M. Meckers . L994. Inhibition of heat shock protein HSP90-pp60v-src heteroprotein complex formation by benzoquinone ansamycins: essential role for stress proteins in oncogenic transformation. Proc Natl Acad Sci U S A 91:8324-8.
79. Yee, J. K., A. Miyanohara, P. LaPorte, K. Bouic, J. C. Burns, and T. Friedmann. 1994. A general method for the generation of high-titer, pantropic retroviral vectors: highly efficient infection of primary hepatocytes . Proc Natl Acad Sci U S A 91:9564-8.
80. Yochem, J., H. Uchida, M. Sunshine, H. Saito, C. P. Georgopoulos, and M. Feiss. 1978. Genetic analysis of two genes, dnaJ and dnaK, necessary for Escherichia coll and bacteriophage lambda DNA replication. MoI Gen Genet 164:9- 14.
81. Zylicz, M., D. Ang, K. Liberek, and C. Georgopoulos. 1989. Initiation of lambda DNA replication with purified host- and bacteriophage-encoded proteins: the role of the dnaK, dnaJ and grpE heat shock proteins. Embo J 8:1601-8.
82. U.S. Patent No. 6,809,182, issued October 26, 2004.
83. U.S. Patent No. 5,225,539, issued July 6, 1993.
84. /oung P, Anderton E, Paschos K, White R, and Allday MJ. 2008. Epstem-Barr virus nuclear antigen (EBNA) 3A induces the expression of and interacts with a subset of chaperones and co- chapercnes. J Gen Virol. 89:866-77.
Claims
1. A method of inhibiting Varicella zoster virus replication or Epstein-Barr Virus in a cell of a host comprising contacting the cell with an amount of a modulator of host chaperone protein activity effective to inhibit Varicella zoster virus replication or Epstein-Barr virus replication in the cell.
2. The method of claim 1, wherein the host chaperone protein is a heat shock protein.
3. The method of claim 2, wherein the heat shock protein is Hsp90.
4. The method of claim 3, wherein the modulator of host chaperone protein activity is an inhibitor of Hsp90 ATPase activity .
5. The method of claim 4, wherein the inhibitor of Hsp90 ATPase activity is an ansamycin antibiotic.
6. The method of claim 4, wherein the inhibitor of Hsp90 ATPase activity is geldanamycin.
7. The method of claim 4, wherein the inhibitor of Hsp90 ATPase activity is 17-dimethylaminoethylamino-17-demethoxy- geldanamycin (17DMAG).
8. The method of claim 2, wherein the host chaperone protein is Hsp70/Hsc70.
9. The method of claim 8, wherein the mocluLator ot host <_hnperone protein activity LS an inhibitor of a co- chaperone protein activity.
LO. The method ot claim 8, wherein Lhe modulator of host thnperone protein activity is an inhibitor of a co- chaperone protein expression.
11. The method of claim 10, wherein the inhibitor of a co- thaperone protein expression is an inhibitor of bcl2- associated anathogene 3 (BAG3) expression.
12. The method of claim 11, wherein the BAG3 comprises consecutive ammo acid residues having the sequence set forth in SEQ ID NO:1.
13. The method of claim 11, wherein the inhibitor of BAG3 expression is a nucleic acid which inhibits expression of a BAG3 gene .
14. The method of claim 11, wherein the inhibitor of BAG3 expression is a nucleic acid which inhibits translation of a mRNA which encodes a BAG3.
15. The method of claim 11, wherein the inhibitor of BAG3 expression is a nucleic acid which inhibits the translation of a nucleic acid comprising consecutive nucleotides having the sequence set forth in SEQ ID NO: 2.
16. The method of claim 11, wherein the nucleic acid is, or upon transcription becomes, a short interfering ribonucleic acid .
17. The method of claim 16, wherein the short interfering ribonucleic acid comprises two ribonucleic acid strands, a first strand which comprises about 15 to about 28 ribonucleotides the sequence of which is complementary to a sequence of consecutive nucleotides present within a gene encoding a BAG3, and a second strand which comprises about 15 to about 28 ribonucleotides, the sequence of which is complementary to the sequence of the first strand.
18. The method of claim 17, wherein the BAG3 gene is a human BAG3 gene.
19. The method of claim 17, wherein the two strands of the short interfering ribonucleic acid are base paired for 19 consecutive nucleotides and have a 2-nucleotide overhang at their respective 3' ends.
20. The method of claim 17, wherein one or more of the ribonucleotides is modified in a sugar or base present therein.
21. The method of claim 17, wherein at least one of the strands comprises an mter-ribonucleotide phosphorothioate bond.
22. The method of claim 9, wherein the inhibitor of co- chaperone protein activity is an inhibitor of BAG3 activity.
23. The method of claim 22, wherein the inhibitor of a BAG3 activity is an antibody or antibody fragment which binds to the BAG3.
24. The method of claim 23, wherein the antibody is a monoclonal antibody.
?5. The method of claim 23, wherein the antibody is a humanized antibody.
26. The method of claim 1, wherein the cell of the host is in vitro .
27. The method of claim L, wherein the cell of the host is in vivo .
28. The method of claim 13, wherein the cell of the host is in vivo and contacting the cell of the host with the nucleic acid is effected by administering to the host a vector comprising the nucleic acid.
29. The method of claim 28, wherein the nucleic acid is transcribed in the cell of the host into a short interfering ribonucleic acid.
30. The method of claim 28, wherein the vector is a mammalian expression vector.
31. The method of claim 28, wherein the vector comprises a RNA III polymerase promoter.
32. The method of claim 28, wherein the RNA III polymerase promoter is a U6 promoter or a Hl promoter.
33. The method of claim 28, wherein the vector comprises a RNA III polymerase termination site.
34. The method of claim 33, wherein the termination site is a T5 sequence.
35. The method of claim 1, wherein the cell of the host is a dorsal root ganglion cell, a ganglion semilunare cell, or a trigeminal nerve cell.
36. The method of claim 1, wherein the host is human.
37. A method of enhancing exclusion of a Varicella zoster virus open reading frame 29 protein (ORF29p) from a nucleus of a cell comprising contacting the cell with an amount of an inhibitor of Hsp90 ATPase activity effective to enhance exclusion of the ORF29p protein from the nucleus of the cell.
38. The method of claim 37, wherein the ORF29p is encoded by a nucleic acid comprising consecutive amino acids having the sequence set forth m SEQ ID NO: 16.
39. The method of claim 37, wherein the inhibitor of Hsp90 ATPase activity is an ansamycin antibiotic.
40. The method of claim 37, wherein the inhibitor of Hsp90 ATPase activity is geldanamycin.
41. The method of claim 37, wherein the inhibitor of Hsp90 ATPase activity is i7-dimethylaminoethylammo-17-demethoxy- geldanamycin (17DMAG).
42. The method of claim 37, wherein the cell is in vitro.
43. The method of claim 37, wherein the cell is in vivo.
44. The method of claim 37, wherein the cell is a dorsal root ganglion cell, a ganglion semilunare cell, or a trigeminal nerve cell.
45. A pharmaceutical composition comprising an amount of an ansamycin antibiotic effective to inhibit replication of a Varicella zoster virus or Epstein-Barr Virus in a cell of a host and a pharmaceutically acceptable carrier.
46. The pharmaceutical composition of claim 45, wherein the ansamycin antibiotic is geldanamycin.
47. The pharmaceutical composition of claim 45, wherein the ansamycin antibiotic is 17-dimethylaminoethylamino-17- demethoxy-geldanamycin (17DMAG).
48. A pharmaceutical composition comprising an amount of an siRNA effective to inhibit replication of a Varicella zoster virus or Epstein-Barr Virus in a cell of a host and a pharmaceutically acceptable carrier.
49. The pharmaceutical composition of claim 48, wherein the siRNA inhibits expression of BAG3.
50. The pharmaceutical composition of claim 49, wherein the BAG3 comprises consecutive amino acid residues having the sequence set forth in SEQ ID NO:1.
51. The pharmaceutical composition of claim 45 or 49, wherein the composition is suitable for topical application to human skin or a human mucous membrane.
52. The pharmaceutical composition of claim 45 or 49, wherein the composition is suitable for oral administration to a human .
53. A method of identifying an agent as an inhibitor of Varicella zoster virus replication in a host cell comprising: a) quantitatmg the activity of a chaperone protein of the host cell; b) contacting the chaperone protein with the agent; and c) quantitatmg the activity of the chaperone protein in the presence cf the agent, wherein an increase or decrease in activity of the host chaperone protein activity as quantitated in step a) compared to host chaperone protein activity as quantitated in step c) indicates that the agent is an inhibitor of Varicella zoster virus replication or Epstein-Barr virus replication in the host cell.
54. The method of claim 53, wherein the host chaperone protein is a heat shock protein.
55. The method of claim 54, wherein the heat shock protein is Hsp90 or Hsp70/Hsc70.
56. The method of claim 54, wherein the activity of heat shock protein is ATPase activity.
57. The method of claim 53, wherein the agent increases the activity of the chaperone protein.
58. The method of claim 53, wherein the agent decreases the activity of the chaperone protein.
59. A method of treating a subject suffering from a Varicella zoster virus infection or Epstein-Barr virus infection comprising administering to the subject an amount of modulator of a chaperone protein activity effective to inhibit Varicella zoster virus replication or Epstein-Barr virus replication in the subject and thereby treat the subject .
60. The method of claim 59, wherein the modulator of the chaperone protein activity is an inhibitor of Hsp90 ATPase activity.
61. The method of claim 60, wherein the inhibitor of Hsp90 A.TPase activity is an ansamycin antibiotic.
62. The method of claim 61, wherein the inhibitor of Hsp90 ATPase activity is geldanamycin.
63. The method of claim 61, wherein the inhibitor of Hsp90 ATPase activity is 17-dimethylαminoethylamino-17-demethoxy- geldanamycm (17DMAG).
64. The method of claim 61, wherein the modulator of a chaperone protein activity is inhibitor of bcl2-associated anathogene 3 (BAG3) expression.
65. The method of claim 64, wherein the inhibitor is a nucleic acid which is, or upon transcription becomes, a short interfering ribonucleic acid.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US96210407P | 2007-07-25 | 2007-07-25 | |
| US60/962,104 | 2007-07-25 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2009014759A2 true WO2009014759A2 (en) | 2009-01-29 |
| WO2009014759A3 WO2009014759A3 (en) | 2009-06-11 |
Family
ID=40282048
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2008/009097 Ceased WO2009014759A2 (en) | 2007-07-25 | 2008-07-24 | Methods of inhibiting vzv replication and related compositions |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2009014759A2 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2016516078A (en) * | 2013-03-18 | 2016-06-02 | ビオウニヴェルサ ソシエタ ア レスポンサビリタ リミタータ | Anti-BAG3 antibody for therapeutic use |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050176025A1 (en) * | 2001-05-18 | 2005-08-11 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of B-cell CLL/Lymphoma-2 (BCL-2) gene expression using short interfering nucleic acid (siNA) |
| US20060159681A1 (en) * | 2004-12-14 | 2006-07-20 | Functional Neuroscience Inc. | Compositions and methods to inhibit cell loss by using inhibitors of BAG |
-
2008
- 2008-07-24 WO PCT/US2008/009097 patent/WO2009014759A2/en not_active Ceased
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11117957B2 (en) | 2012-03-18 | 2021-09-14 | Biouniversa S.R.L. | Anti-BAG3 antibodies for therapeutic use |
| JP2016516078A (en) * | 2013-03-18 | 2016-06-02 | ビオウニヴェルサ ソシエタ ア レスポンサビリタ リミタータ | Anti-BAG3 antibody for therapeutic use |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2009014759A3 (en) | 2009-06-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230149319A1 (en) | Cell-receptor targeted exosomes | |
| KR20090010234A (en) | RNA-mediated inhibition of tumor necrosis factor α-related symptoms | |
| AU2013207601B2 (en) | RNAi-mediated inhibition of spleen tyrosine kinase-related inflammatory conditions | |
| JP5750787B2 (en) | Pharmaceutical composition for treatment or prevention of herpes virus infection | |
| JP2010538244A (en) | Molecular targets and compounds useful for the treatment of bone and joint degenerative diseases and methods for identification thereof | |
| JP2007530029A (en) | Annexin II and uses thereof | |
| US20100183707A1 (en) | Methods and compositions for treating hiv infection | |
| RU2664466C1 (en) | Composition for treating cancer associated with hpv infection | |
| WO2009014759A2 (en) | Methods of inhibiting vzv replication and related compositions | |
| CN119909178A (en) | Annexin A2 (ANXA2) and its inhibitors in the diagnosis, treatment and/or prevention of pulmonary arterial hypertension | |
| US20100285002A1 (en) | Treatment or prevention of inflammation by targeting cyclin d1 | |
| KR20200133575A (en) | Novel viral complex comprising shRNA and anti-EpCAM andtobody and uses thereof | |
| Chen et al. | S100A10 downregulation inhibits the phagocytosis of Cryptococcus neoformans by murine brain microvascular endothelial cells | |
| US20240167037A1 (en) | Cancer therapy | |
| KR101121987B1 (en) | Anti-osteoclast mediated bone resorption siRNA vector for gene therapy | |
| EP4686477A1 (en) | Compounds and compositions for treating pns injury and degenerative diseases | |
| CN115505593B (en) | Oligonucleotides, viral vectors and their applications and RNAi drug preparations | |
| US8367633B2 (en) | Methods of treating B-cell cancers | |
| WO2025114453A1 (en) | Method of prevention and/or treatment of nairoviridae family infections | |
| WO2005047504A1 (en) | Induction of cellular senescence by cdk4 disruption for tumor suppression and regression | |
| Pieterse | Investigating Alphavirus Host-Protein Interactions as Determinants of Neurovirulence | |
| WO2025068418A1 (en) | Inhibitor of the transcription factor ap-1 for use in the treatment of age-related diseases | |
| US20130295115A1 (en) | Compositions and methods for treating alphavirus infection | |
| Lewis | The role of host heterochromatin during egress of lytic Herpes Simplex Virus 1 | |
| KR20230019756A (en) | Use of STING as a nuclear-import facilitating factor of DNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08794790 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 08794790 Country of ref document: EP Kind code of ref document: A2 |