WO2009011885A1 - Modulators of hematopoiesis - Google Patents

Modulators of hematopoiesis Download PDF

Info

Publication number
WO2009011885A1
WO2009011885A1 PCT/US2008/008734 US2008008734W WO2009011885A1 WO 2009011885 A1 WO2009011885 A1 WO 2009011885A1 US 2008008734 W US2008008734 W US 2008008734W WO 2009011885 A1 WO2009011885 A1 WO 2009011885A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
gpr91
hematopoiesis
functionality
stimulates
Prior art date
Application number
PCT/US2008/008734
Other languages
French (fr)
Inventor
Yaron Hakak
Ling Liu
Karin Bruinsma
Original Assignee
Arena Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Arena Pharmaceuticals, Inc. filed Critical Arena Pharmaceuticals, Inc.
Publication of WO2009011885A1 publication Critical patent/WO2009011885A1/en

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/566—Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/72—Assays involving receptors, cell surface antigens or cell surface determinants for hormones
    • G01N2333/726—G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)

Definitions

  • the present invention relates to methods for identifying a compound that regulates hematopoiesis, by determining whether the compound modulates GPR91 functionality. Accordingly, a compound identified using a method of the present invention can be useful in the prophylaxis or treatment of blood disorders such as anemia and thrombocytopenia.
  • red blood cells and white blood cells are derived from the same primitive hematopoietic stem cell. There are many intermediate stages between the starting cell, the hemopoietic stem cell, and the finished cell, the mature blood cell.
  • the hematopoietic stem cell becomes either a lymphoid stem cell or a myeloid stem cell.
  • the lymphoid stem cell divides to eventually give rise to a lymphoblast which becomes the B and T cell lymphocytes.
  • the myeloid stem cell eventually gives rise to: an erythroblast, which becomes erythrocytes (red blood cells), a megakaryoblast, which becomes platelets (also called thrombocytes), and a myeloblast, which becomes granulocytes and monocytes.
  • erythropoiesis The name given to the production of red blood cells is erythropoiesis.
  • Platelet production is given the name thrombopoiesis, derived from thrombocyte, the other name for platelet.
  • Another name describing platelet production is megakaryopoiesis. This term comes from the name megakaryoblast, an early precursor of platelet production.
  • Hematological disorders include diseases of the blood and all its constituents as well as diseases of organs and tissues involved in the generation or degradation of blood constituents.
  • Common hematological disorders include, for example, anemia, thrombocytopenia, leukemia, lymphoma and myeloma.
  • Anemia is a deficiency in the oxygen-carrying component of the blood, measured in unit volume concentrations of hemoglobin, red blood cell volume, or red blood cell number.
  • Anemia can have many causes including dietary deficiencies, kidney failure, cancer, and chemotherapy.
  • Thrombocytopenia is the term for a reduced platelet (thrombocyte) count. It occurs when platelets are lost from the circulation faster than they can be replaced from the bone marrow where they are made. Thrombocytopenia may either result from a failure of platelet production and/or an increased rate of removal from blood. Thrombocytopenias can occur when the bone marrow does not produce enough platelets, as happens in leukemia and some anemias. Viral infections and chemotherapy can also lead to thrombocytopenia. In addition, the body may use or destroy too many platelets, as occurs in many disorders including idiopathic thrombocytopenic purpura, thrombotic thrombocytopenic purpura, and hemolytic-uremic syndrome.
  • EPO drug epogen
  • EPO is a genetically engineered form of the naturally occurring protein erythropoietin.
  • EPO is usually injected three times per week and the treatment is costly.
  • EPO can induce hypertension and an immunological response in some patients.
  • thrombocytopenia one needs to stimulate the megakaryocyte precursor cell.
  • thrombocytopenia Current treatments for thrombocytopenia include platelet transfusions and IL-11. Platelet transfusions are expensive and not readily available. Also there is a risk of transfusion reactions and disease transmission when using platelet transfusions. Some of the problems with the use of IL-11 are the inconvenience of using a drug that must be injected, the modest efficacy of the drug, and high incidence of side effects.
  • GPCR G-protein coupled receptor
  • the invention features a method for identifying a compound that stimulates hematopoiesis, comprising contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased, wherein an increase in GPR91 functionality is indicative of the candidate compound being a compound that stimulates hematopoiesis.
  • said GPR91 is human.
  • said determining comprises a second messenger assay.
  • the invention also features a method of the first aspect further comprising preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier.
  • the invention features a method for identifying a compound that stimulates erythropoiesis, comprising contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased, wherein an increase in GPR91 functionality is indicative of the candidate compound being a compound that stimulates erythropoiesis.
  • said GPR91 is human, hi some embodiments, said determining comprises a second messenger assay.
  • the invention also features a method of the second aspect further comprising preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier.
  • the invention features a method for identifying a compound that stimulates thrombopoiesis, comprising contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased, wherein an increase in GPR91 functionality is indicative of the candidate compound being a compound that stimulates thrombopoiesis.
  • said GPR91 is human, hi some embodiments, said determining comprises a second messenger assay.
  • the invention also features a method of the third aspect further comprising preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier. hi a.
  • the invention features a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition of the first, second or third aspects.
  • said hematopoietic disorder is anemia, thrombocytopenia, neutropenia, leukopenia, cytopenia, or idiopathic thrombocytopenic purpura, hi one embodiment, said hematopoietic disorder is anemia, hi another embodiment, said hematopoietic disorder is thrombocytopenia.
  • the invention also features a method of the fourth aspect further comprising administering to said individual an effective amount of an agent used to stimulate hematopoiesis in combination with an effective amount of the pharmaceutical composition of the first, second or third aspects.
  • said individual is a mammal. In one embodiment, said individual is a human.
  • the invention features a compound that stimulates hematopoiesis identified according to a method of the first aspect.
  • the invention also features a pharmaceutical composition comprising the compound of the fifth aspect.
  • the invention features a compound that stimulates erythropoiesis identified according to a method of the second aspect.
  • the invention also features a pharmaceutical composition comprising the compound of the sixth aspect.
  • the invention features a compound that stimulates thrombopoiesis identified according to a method of the third aspect.
  • the invention also features a pharmaceutical composition comprising the compound of the seventh aspect.
  • the invention features a method for identifying a compound that reduces hematopoiesis, comprising contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased, wherein a decrease in GPR91 functionality is indicative of the candidate compound being a compound that reduces hematopoiesis.
  • said GPR91 is human.
  • said determining comprises a second messenger assay.
  • the invention also features a method of the eighth aspect further comprising preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier.
  • the invention features a method for identifying a compound that reduces erythropoiesis, comprising contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased, wherein a decrease in GPR91 functionality is indicative of the candidate compound being a compound that reduces erythropoiesis.
  • said GPR91 is human.
  • said determining comprises a second messenger assay.
  • the invention also features a method of the ninth aspect further comprising preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier.
  • the invention features a method for identifying a compound that reduces thrombopoiesis, comprising contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased, wherein a decrease in GPR91 functionality is indicative of the candidate compound being a compound that reduces thrombopoiesis.
  • said GPR91 is human.
  • said determining comprises a second messenger assay.
  • the invention also features a method of the tenth aspect further comprising preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier.
  • the invention features a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition of the eighth, ninth, or tenth aspects.
  • said hematopoietic disorder is erythrocytosis, a myeloproliferative disorder, essential thrombocythemia, post-transplant erythrocytosis, or polycythemia vera.
  • said hematopoietic disorder is erythrocytosis.
  • said hematopoietic disorder is a myeloproliferative disorder.
  • the invention also features a method of the eleventh aspect further comprising administering to said individual an effective amount of an agent used for decreasing hematopoiesis in combination with an effective amount of the pharmaceutical composition of the eighth, ninth, or tenth aspects.
  • said individual is a mammal. In one embodiment, said individual is a human.
  • the invention features a compound that reduces hematopoiesis identified according to a method of the eighth aspect.
  • the invention also features a pharmaceutical composition comprising the compound of the twelfth aspect.
  • the invention features a compound that reduces erythropoiesis identified according to a method of the ninth aspect.
  • the invention also features a pharmaceutical composition comprising the compound of the thirteenth aspect.
  • the invention features a compound that stimulates thrombopoiesis identified according to a method of the tenth aspect.
  • the invention also features a pharmaceutical composition comprising the compound of the fourteenth aspect.
  • the invention features a method for the manufacture of a medicament comprising a compound of the fifth, sixth or seventh aspects for use as a hematopoietic agent.
  • the invention further features a method for the manufacture of a medicament comprising a compound of the fifth, sixth or seventh aspects, for use in the treatment of a blood disorder.
  • the invention features the use of a compound of the fifth, sixth or seventh aspects for the manufacture of a medicament for treating or preventing a blood disorder in an individual.
  • said blood disorder is anemia.
  • said blood disorder is thrombocytopenia.
  • said compound is used in combination with an agent used to stimulate hematopoiesis.
  • the invention features a method for the manufacture of a medicament comprising a compound of the twelfth, thirteenth or fourteenth aspects for use as a hematopoietic agent.
  • the invention further features a method for the manufacture of a medicament comprising a compound of the twelfth, thirteenth or fourteenth aspects, for use in the treatment of a blood disorder.
  • the invention features the use of a compound of the twelfth, thirteenth or fourteenth aspects for the manufacture of a medicament for treating or preventing a blood disorder in an individual.
  • said blood disorder is erythrocytosis.
  • said blood disorder is a myeloproliferative disorder.
  • said compound is used in combination with an agent used for decreasing hematopoiesis.
  • Figure 1 shows Affymetrix gene chip analysis of human GPR91 expression in human cell types and tissues.
  • the cell or tissues from left to right are: Table I.
  • Adipocyte cultured visceral fat
  • Adipocyte primary amine
  • Preadipocyte cultured adipocytes, cultured visceral fat
  • Figure 2 shows succinate-stimulated proliferation of TF-I cells is sensitive to pertussis toxin (PTX).
  • PTX pertussis toxin
  • FIG. 3 shows succinate-stimulated inositol 1,4,5-triphosphate (IP3) signaling in TF-I cells is sensitive to PTX.
  • FIG. 4 shows succinate-stimulated mitogen-activated protein kinase (MAPK) activation in TF-I cells is sensitive to PTX.
  • MAPK mitogen-activated protein kinase
  • FIG. 5 shows MAPK and phosphatidylinositol 3 -kinase (PI3-K) are required for succinate-induced proliferation in TF-I cells.
  • Figure 6 shows fluorescence activated cell sorting (FACS) analysis of succinate- induced CD41 expression in TF-I cells.
  • Figure 7 shows succinate inhibits serum starvation-induced apoptosis of cultured TF-I cells.
  • FIG. 8 shows GPR91 -specific small-interfering RNA (siRNA) inhibits succinate stimulated TF-I cell proliferation.
  • siRNA small-interfering RNA
  • Figure 9 shows succinate stimulates platelet and red blood cell recovery in myelosuppressed mice.
  • Applicants have disclosed herein that human GPR91 is expressed prominently in immune system cells and tissues (such as macrophage samples), kidney, and hematopoietic progenitor cell samples as well as the AXM-35 cell line (see Figure 1).
  • succinate-stimulated proliferation of TF-I cells is PTX sensitive (see Figure 2).
  • succinate-stimulated IP3 signaling ( Figure 3) and MAPK activation ( Figure 4) in TF-I cells is PTX sensitive.
  • Applicants disclose MAPK and PI3-K are required for succinate-induced proliferation in TF-I cells ( Figure 5).
  • succinate increases the percentage of CD41 expressing TF-I cells and this increase is PTX sensitive ( Figure 6). Applicants further disclose that succinate inhibits serum starvation-induced apoptosis of cultured TF-I cells (see Figure 7). In addition, Applicants disclose GPR91 -specific siRNA inhibits succinate stimulated TF-I cell proliferation ( Figure 8). Applicants show that IL-11 increases platelet number and hemoglobin concentration in busulfan challenged mice ( Figure 10) and disclose that succinate stimulates platelet and red blood cell recovery in myelosuppressed mice comparable to IL-11 (see Figure 11). Further, Applicants disclose that succinate does not regulate human platelet activity in a platelet aggregation assay (Figure 12).
  • GPCR G protein-coupled receptor
  • GPCRs share a common structural motif, having seven sequences of between 22 to 24 hydrophobic amino acids that form seven alpha helices, each of which spans the membrane (each span is identified by number, i.e., transmembrane- 1 (TM-I), transmembrane-2 (TM-2), etc.).
  • the transmembrane helices are joined by strands of amino acids between transmembrane-2 and transmembrane-3, transmembrane-4 and transmembrane-5, and transmembrane-6 and transmembrane-7 on the exterior, or "extracellular" side, of the cell membrane (these are referred to as "extracellular" regions 1, 2 and 3 (EC-I, EC-2 and EC-3), respectively).
  • transmembrane helices are also joined by strands of amino acids between transmembrane- 1 and transmembrane-2, transmembrane-3 and transmembrane-4, and transmembrane-5 and transmembrane-6 on the interior, or "intracellular” side, of the cell membrane (these are referred to as "intracellular” regions 1, 2 and 3 (IC-I, IC-2 and IC-3), respectively).
  • the "carboxy" (“C”) terminus of the receptor lies in the intracellular space within the cell, and the "amino" (“N”) terminus of the receptor lies in the extracellular space outside of the cell.
  • C carboxy
  • activation of the receptor there is a change in the conformation of the receptor that facilitates coupling between the intracellular region and an intracellular "G-protein.”
  • GPCRs are "promiscuous" with respect to G proteins, i.e., that a GPCR can interact with more than one G protein. See, Kenakin, T., 43 Life Sciences 1095 (1988). Although other G proteins exist, currently, Gq, Gs, Gi, Gz and Go are G proteins that have been identified.
  • Ligand-activated GPCR coupling with the G-protein initiates a signaling cascade process (referred to as "signal transduction”). Under normal conditions, signal transduction ultimately results in cellular activation or cellular inhibition.
  • signal transduction a signaling cascade process
  • G proteins which appear to couple several classes of GPCRs to the phospho lipase C pathway, such as G ⁇ l5 or G ⁇ l6 (Offermanns & Simon, J Biol Chem 270:15175-80 (1995)), or chimeric G proteins designed to couple a large number of different GPCRs to the same pathway, e.g. phospholipase C (Milligan & Rees, Trends in Pharmaceutical Sciences 20:118-24 (1999)).
  • G ⁇ l5 or G ⁇ l6 Offermanns & Simon, J Biol Chem 270:15175-80 (1995)
  • chimeric G proteins designed to couple a large number of different GPCRs to the same pathway, e.g. phospholipase C (Milligan & Rees, Trends in Pharmaceutical Sciences 20:118-24 (1999)).
  • Gi-coupled GPCRs lower intracellular cAMP levels.
  • the melanophore technology (see infra) is useful for identifying Gi-coupled GPCRs and also for identifying modulators of said Gi-coupled GPCRs.
  • GPCRs exist in the cell membrane in equilibrium between two different conformations: an "inactive" state and an “active” state.
  • a receptor in an inactive state is unable to link to the intracellular signaling transduction pathway to initiate signal transduction leading to a biological response.
  • Changing the receptor conformation to the active state allows linkage to the transduction pathway (via the G-protein) and produces a biological response.
  • a receptor can be stabilized in an active state by a ligand or a compound such as a drug.
  • Recent discoveries, including but not exclusively limited to modifications to the amino acid sequence of the receptor provide means other than ligands or drugs to promote and stabilize the receptor in the active state conformation. These means effectively stabilize the receptor in an active state by simulating the effect of a ligand binding to the receptor. Stabilization by such ligand-independent means is termed "constitutive receptor activation.”
  • GPR91 was first cloned by Wittenberger et al. using batch EST database searching (Wittenberger et al., J. Molec. Biol. 307: 799-813, 2001). The gene contains a single intron and was mapped by electronic PCR to 3q24-q25.1. The deduced 330- amino acid protein is 68% identical to the mouse protein.
  • Northern blot analysis revealed expression of a 4.8-kb GPR91 transcript specifically in kidney.
  • GPR91 was designated as an orphan receptor until He et al. demonstrated that GPR91 functions as a receptor for the citric acid cycle intermediate succinate (He, W. et al., Nature 429: 188- 193, 2004). They demonstrated that succinate increases blood pressure in animals. The succinate-induced hypertensive effect appears to involve the renin- angiotensin system and is abolished in GPR91 -deficient mice.
  • mice deficient in GPR91 by homologous recombination. Mice homozygous for the targeted allele of GPR91 were viable and had no discernable abnormal phenotype. Baseline blood pressure was similar in wildtype and knockout mice; however, succinate could no longer induce hypertension in GPR91- deficient mice, hi contrast, angiotensin-2 increased blood pressure similarly in wildtype and GPR91 -deficient mice, indicating that the hypertensive effects of succinate might be mediated by GPR91.
  • AGONIST shall mean material, for example, a ligand or candidate compound, that activates an intracellular response when it binds to the receptor.
  • An intracellular response can be, for example, enhancement of GTP binding to membranes or modulation of the level of a second messenger such as cAMP or IP3.
  • an AGONIST is material not previously known to activate the intracellular response when it binds to the receptor (for example, to enhance GTP ⁇ S binding to membranes or to lower intracellular cAMP level), hi some embodiments, an AGONIST is material not previously known to effect hematopoiesis.
  • AGONIST also includes PARTIAL AGONISTS which are materials, for example, ligands or candidate compounds, which activate the intracellular response when they bind to the receptor to a lesser degree or extent than do full agonists.
  • ANTAGONIST shall mean material, for example, ligands or candidate compounds that competitively bind to the receptor at the same site as an agonist but which does not activate an intracellular response, and can thereby inhibit an intracellular response elicited by the agonist.
  • An ANTAGONIST does not diminish the baseline intracellular response in the absence of an agonist.
  • an ANTAGONIST is material not previously known to compete with an agonist to inhibit a cellular response when it binds to the receptor (for example, wherein the cellular response is GTP7S binding to membranes or to the lowering of intracellular cAMP level).
  • CANDIDATE COMPOUND shall mean a molecule (for example, a chemical compound) that is amenable to a screening technique.
  • candidate compound excludes any compound publicly known to bind to or interact with GPR91.
  • Applicants are not aware of any compound (other than succinate) being publicly known to bind to or interact with GPR91, however if any such compound is known, the phrase "candidate compound” would specifically exclude such a compound.
  • COMPOSITION shall mean a material comprising at least two compounds or two components; for example, a "Pharmaceutical Composition" is a Composition.
  • COMPOUND EFFICACY shall mean a measurement of the ability of a compound to inhibit or stimulate receptor functionality, as opposed to receptor binding affinity.
  • CONTACT or CONTACTING shall mean bringing at least two moieties together, whether in an in vitro system or an in vivo system.
  • EFFECTIVE AMOUNT means an amount of active compound or pharmaceutical composition that elicits the desired biological or medicinal response in a tissue, system, or individual that is being sought by the researcher or medical doctor or other clinician.
  • an effective dose can be an amount that can treat a hematopoietic disorder.
  • an effective dose can be an amount that can prevent a hematopoietic disorder.
  • HEMATOPOIESIS means the process of formation, development, and/or differentiation of the formed elements of whole blood. This can occur in myeloid tissue, which is found in the bone marrow, and lymphatic tissue, such as lymph nodes or the spleen. All of the cellular components of the blood are derived from hematopoietic stem cells. There are many intermediate stages between the starting cell, the hemopoietic stem cell, and the finished mature blood cell. In the first step, the hematopoietic stem cell becomes either a lymphoid stem cell or a myeloid stem cell. The lymphoid stem cell divides to eventually give rise to a lymphoblast which becomes the B and T cell lymphocytes.
  • the myeloid stem cell eventually gives rise to: an erythroblast, which becomes erythrocytes (red blood cells), a megakaryoblast, which becomes platelets (also called thrombocytes), and a myeloblast, which becomes granuloctytes and monocytes.
  • red blood cells erythropoiesis
  • megakaryoblast which becomes platelets
  • myeloblast which becomes granuloctytes and monocytes.
  • the name given to the production of red blood cells is erythropoiesis.
  • Platelet production is given the name thrombopoiesis, derived from thrombocyte, the other name for platelet.
  • HEMATOPOIETIC DISORDER means a blood disorder. Hematological disorders include diseases of the blood and all its constituents as well as diseases of organs and tissues involved in the generation or degradation of blood constituents.
  • hematopoietic disorders include situations where there is no hematopoietic deficit per se, but it would be advantageous to increase hematopoiesis, for example, in surgery patients to decrease the need for transfusions in patients at risk for perioperative transfusions, and for blood donors, for example, to increase platelet counts.
  • a hematopoietic disorder can affect any blood cell component, for example, erythrocytes, platelets, lymphocytes, as well as any blood progenitor cell.
  • hematopoietic disorders include, for example, anemia, neutropenia, leucopenia, cytopenia, and thrombocytopenias, such as idiopathic thrombocytopenic purpura, thrombotic thrombocytopenic purpura, and hemolytic-uremic syndrome.
  • hematopoietic disorders include leukemia, lymphoma, myeloma, as well as disorders such as erythrocytosis and myeloproliferative disorders.
  • INHIBIT or INHIBITING in relationship to the term "response” shall mean that a response is decreased or prevented in the presence of a compound as opposed to in the absence of the compound.
  • IN NEED OF PREVENTION OR TREATMENT refers to a judgment made by a caregiver (e.g. physician, nurse, nurse practitioner, etc. in the case of humans; veterinarian in the case of animals, including non-human mammals) that an individual or animal requires or will benefit from treatment. This judgment is made based on a variety of factors that are in the realm of a caregiver's expertise, but include the knowledge that the individual or animal is ill, or will be ill, as the result of a condition that is treatable by a compound of the invention.
  • a caregiver e.g. physician, nurse, nurse practitioner, etc. in the case of humans; veterinarian in the case of animals, including non-human mammals
  • INDIVIDUAL refers to any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, swine, cattle, sheep, horses, or primates, and most preferably humans.
  • MODULATE or MODULATING shall mean to refer to an increase or decrease in the amount, quality, response or effect of a particular activity, function or molecule.
  • a GPR91 MODULATOR is an agent that modulates the GPR91 receptor.
  • PHARMACEUTICAL COMPOSITION shall mean a composition comprising at least one compound and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition can comprise at least one active ingredient, whereby the composition is amenable to investigation for a specified, efficacious outcome in an animal (for example, a mammal such as a human).
  • RECEPTOR FUNCTIONALITY shall refer to the normal operation of a receptor to receive a stimulus and moderate an effect in the cell, including, but not limited to regulating gene transcription, regulating the influx or efflux of ions, effecting a catalytic reaction, and/or modulating activity through G-proteins.
  • a GPR91 functionality can be, for example, binding a G-protein such as Gi or Gq, signaling through a second messenger such as IP3 or MAPK, binding to a GPR91 antibody, binding to succinate, or regulating blood cell levels in vivo.
  • SECOND MESSENGER shall mean an intracellular response produced as a result of receptor activation.
  • a second messenger can include, for example, inositol triphosphate (IP3), diacylglycerol (DAG), cyclic AMP (cAMP), cyclic GMP (cGMP), and Ca 2+ .
  • IP3 inositol triphosphate
  • DAG diacylglycerol
  • cAMP cyclic AMP
  • cGMP cyclic GMP
  • Ca 2+ Ca 2+ .
  • Second messenger response can be measured for a determination of receptor activation.
  • second messenger response can be measured for the direct identification of candidate compounds, including for example, inverse agonists, partial agonists, agonists, and antagonists.
  • the invention relates to a method for identifying a compound that regulates hematopoiesis, comprising:a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is modified, wherein a modification in GPR91 functionality is indicative of the candidate compound being a compound that stimulates hematopoiesis.
  • the invention relates to a method for identifying a compound that regulates erythropoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is modified, wherein a modification in GPR91 functionality is indicative of the candidate compound being a compound that stimulates erythropoiesis.
  • the invention further relates to a method for identifying a compound that regulates thrombopoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is modified, wherein a modification in GPR91 functionality is indicative of the candidate compound being a compound that stimulates thrombopoiesis.
  • GPR91 refers to a polypeptide with the amino acid sequence as encoded by GenBank Accession No. NP l 49039, or an isoform, variant or ortholog of this sequence that retains at least one function of the wild-type polypeptide.
  • GPR91 is intended to include other GPR91 polypeptides, for example, mammalian species orthologs of the human GPR91 polypeptide.
  • the sequences of species orthologs of human GPR91 are present in the database, for example, a mouse ortholog of GPR91 can be found in GenBank at Accession No. NP_115776 and a rat ortholog of GPR91 can be found in GenBank at Accession No. NP 001001518.
  • GPR91 includes variants such as allelic variants, splice variants and conservative amino acid substitution variants of GPR91.
  • GPR91 includes variants that retain substantially a GPR91 function of the entire GPR91 polypeptide such as, for example, binding a G-protein, signaling through a second messenger such as IP3, binding to a GPR91 antibody, binding to succinate, or increasing erythrocyte or platelet levels in vivo.
  • Conservative and non-conservative amino acid changes, gaps, and insertions to an amino acid sequence can be compared to a reference sequence using available algorithms and programs such as the Basic Local Alignment Search Tool ("BLAST") using default settings [See, e.g., Karlin and Altschul, Proc Natl Acad Sci USA (1990) 87:2264-8; Altschul et al., J MoI Biol (1990) 215:403-410; Altschul et al., Nature Genetics (1993) 3:266-72; and Altschul et al., Nucleic Acids Res (1997) 25:3389-3402]. It is understood that a fragment of GPR91 which retains substantially a function of the entire polypeptide is included in the definition.
  • BLAST Basic Local Alignment Search Tool
  • a signal generating domain of GPR91 or a compound binding domain of GPR91 can be used in lieu of the entire polypeptide.
  • GPR91 can contain heterologous sequences such as an epitiope tag or other fused polypeptide.
  • GPR91 can contain a label, for example, a radiolabel, fluorescent label or enzymatic label.
  • the methods of the invention can be applied using a polypeptide comprising 99%, 98%, 95%, 92%, 90%, 85%, 80%, 75%, or 70% sequence identity to the human GPR91 sequence.
  • said variant of GPR91 is a non-endogenous, constitutively activated mutant of GPR91.
  • said GPR91 is derived from a mammal. In another embodiment, said GPR91 is human.
  • said GPR91 is recombinant.
  • said contacting comprises contacting with a host cell or with membrane of a host cell that expresses the GPCR, wherein the host cell comprises an expression vector comprising a polynucleotide encoding the receptor.
  • said contacting is carried out in the presence of a known agonist of the GPCR such as succinate.
  • the invention provides a method for identifying a compound that stimulates hematopoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is increased, wherein an increase in GPR91 functionality is indicative of the candidate compound being a compound that stimulates hematopoiesis.
  • the GPR91 is human.
  • said compound that stimulates hematopoiesis is a GPR91 agonist.
  • an agonist can also include, for example, a partial agonist.
  • the compound that stimulates hematopoiesis is a GPR91 agonist.
  • said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 10 ⁇ M, of less than 1 ⁇ M, of less than 100 nM, or of less than 10 nM. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than a value selected from the interval of 1 nM to 10 ⁇ M. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than a value selected from the interval of 1 nM to 1 ⁇ M.
  • said compound that stimulates hematopoiesis is an agonist with an EC50 of less than a value selected from the interval of 1 nM to 100 nM.
  • said compound that stimulates hematopoiesis is an agonist with an EC50 of less than a value selected from the interval of 1 nM to 10 nM.
  • said EC50 is determined using an IP3 assay on a cell line that endogenously expresses GPR91.
  • said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 10 ⁇ M, of less than 1 ⁇ M, of less than 100 nM, or of less than 10 nM in said assay, hi some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 10 ⁇ M in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 9 ⁇ M in said assay.
  • said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 8 ⁇ M in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 7 ⁇ M in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 6 ⁇ M in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 5 ⁇ M in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 4 ⁇ M in said assay.
  • said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 3 ⁇ M in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 2 ⁇ M in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 1 ⁇ M in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 900 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 800 nM in said assay.
  • said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 700 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 600 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 500 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 400 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 300 nM in said assay.
  • said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 200 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 100 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 90 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 80 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 70 nM in said assay.
  • said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 60 nM in said assay, hi some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 50 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 40 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 30 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 20 nM in said assay.
  • said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 10 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 in said assay of less than a value selected from the interval of 1 nM to 10 ⁇ M. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 in said assay of less than a value selected from the interval of 1 nM to 1 ⁇ M. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 in said assay of less than a value selected from the interval of 1 nM to 100 nM.
  • said compound that stimulates hematopoiesis is an agonist with an EC50 in said assay of less than a value selected from the interval of 1 nM to 10 nM. In some embodiments, said compound that stimulates hematopoiesis is selective for the GPCR. In some embodiments, said compound that stimulates hematopoiesis is orally bioavailable. In some embodiments, said oral bioavailability is at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, or at least 45% relative to intraperitoneal administration.
  • said oral bioavailablity is at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, or at least 45% relative to intraperitoneal administration, hi some embodiments, said orally bioavailable compound that stimulates hematopoiesis is further able to cross the blood-brain barrier.
  • screening methods can be performed using any of several techniques known in the art. For example, one skilled in the art can find a cell or cell line that endogenously expresses a receptor of interest and use that cell in a screening protocol.
  • One type of screening assay involves finding compounds that bind to the receptor of interest. Often binding assays use displacement of a known binding compound, such as a radio-labeled ligand for the receptor, as an assay for screening for candidate compounds that bind to the receptor.
  • Other assays look for changes in the level of second messengers as an indication that a candidate compound modulates a receptor.
  • Several screening assays are known in the art and examples of screening assays are provided herein (see Examples 10-17).
  • said determining comprises a second messenger assay.
  • the initiation of an intracellular signal can be determined, for example, through the measurement of the level of a second messenger such as cyclic AMP (cAMP), cyclic GMP (cGMP), inositol triphosphate (IP3), diacylglycerol (DAG), MAP kinase, or calcium.
  • a second messenger such as cyclic AMP (cAMP), cyclic GMP (cGMP), inositol triphosphate (IP3), diacylglycerol (DAG), MAP kinase, or calcium.
  • receptor functionality refers to the normal operation of a receptor to receive a stimulus and moderate an effect in the cell, including, but not limited to regulating gene transcription, regulating the influx or efflux of ions, effecting a catalytic reaction, and/or modulating activity through G-proteins.
  • a GPR91 functionality can be, for example, binding a G-protein such as Gi or Gq, signaling through a second messenger such as IP3 or MAPK, specifically binding to a GPR91 antibody, or regulating blood cell levels in vivo.
  • said candidate compound is not a polypeptide or peptide. In all the methods of the invention, in certain embodiments, said candidate compound is not an antibody or antigen-binding derivative thereof.
  • the invention also provides methods that further comprise preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier. For example, the invention provides a method for preparing a pharmaceutical composition by combining a pharmaceutically acceptable carrier with a compound that stimulates hematopoiesis where the compound that stimulates hematopoiesis is identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased.
  • a compound identified by a method of the present invention can be formulated into a pharmaceutical composition using techniques well known to those in the art. Suitable pharmaceutically-acceptable carriers, outside those mentioned herein, are available to those in the art; for example, see Remington's Pharmaceutical Sciences, 16 l Edition, 1980, Mack Publishing Co., (Oslo et al., eds.).
  • a compound of the invention can in an alternative use be administered as a raw or pure chemical, it can be useful to present the compound or active ingredient as a pharmaceutical formulation or composition further comprising a pharmaceutically acceptable carrier.
  • the invention thus further provides pharmaceutical formulations comprising a compound identified by a method of the invention or a pharmaceutically acceptable salt or derivative thereof together with one or more pharmaceutically acceptable carriers thereof and/or prophylactic ingredients.
  • the carrier(s) must be "acceptable” in the sense of being compatible with the other ingredients of the formulation and not overly deleterious to the recipient thereof.
  • compositions include those suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), vaginal or parenteral (including intramuscular, subcutaneous and intravenous) administration or in a form suitable for administration by inhalation or insufflation.
  • a compound identified by a method of the invention, together with a conventional adjuvant, carrier, or diluent, can thus be placed into the form of pharmaceutical formulations and unit dosages thereof, and in such form can be employed as solids, such as tablets or filled capsules, or liquids such as solutions, suspensions, emulsions, elixirs, gels or capsules filled with the same, all for oral use, in the form of suppositories for rectal administration; or in the form of sterile injectable solutions for parenteral (including subcutaneous) use.
  • Such pharmaceutical compositions and unit dosage forms thereof can comprise conventional ingredients in conventional proportions, with or without additional active compounds or principles, and such unit dosage forms can contain any suitable effective amount of the active ingredient commensurate with the intended daily dosage range to be employed.
  • the pharmaceutical composition can be in the form of, for example, a tablet, capsule, suspension or liquid.
  • the pharmaceutical composition can be made in the form of a dosage unit containing a particular amount of the active ingredient.
  • dosage units are capsules, tablets, powders, granules or a suspension, with conventional additives such as lactose, mannitol, corn starch or potato starch; with binders such as crystalline cellulose, cellulose derivatives, acacia, corn starch or gelatins; with disintegrators such as corn starch, potato starch or sodium carboxymethyl-cellulose; and with lubricants such as talc or magnesium stearate.
  • the active ingredient can also be administered by injection as a composition wherein, for example, saline, dextrose or water can be used as a suitable pharmaceutically acceptable carrier.
  • the dose when using the compounds identified by the methods of the invention can vary within wide limits, and as is customary and is known to the physician, it is to be tailored to the individual conditions in each individual case. It depends, for example, on the nature and severity of the illness to be treated, on the condition of the patient, on the compound employed or on whether an acute or chronic disease state is treated or prophylaxis is conducted or on whether further active compounds are administered in addition to the compounds identified by the methods of the invention.
  • Representative doses of the present invention include, about 0.01 mg to about 1000 mg, about 0.01 to about 750 mg, about 0.01 to about 500 mg, 0.01 to about 250 mg, 0.01 mg to about 200 mg, about 0.01 mg to 150 mg, about 0.01 mg to about 100 mg, and about 0.01 mg to about 75 mg.
  • Multiple doses can be administered during the day, especially when relatively large amounts are deemed to be needed, for example 2, 3 or 4, doses. If appropriate, depending on individual behavior and as appropriate from the patients physician or care-giver it can be necessary to deviate upward or downward from the daily dose.
  • the amount of active ingredient, or an active salt or derivative thereof, required for use in treatment will vary not only with the particular salt selected but also with the route of administration, the nature of the condition being treated and the age and condition of the patient and will ultimately be at the discretion of the attendant physician or clinician.
  • animal models include, but are not limited to, the busulfan mouse model of myelosuppression as described in Example 9.
  • these extrapolations can merely be based on the weight of the animal model in comparison to another, such as a mammal, for example, a human, however, more often, these extrapolations are not simply based on weights, but rather incorporate a variety of factors. Representative factors include the type, age, weight, sex, diet and medical condition of the patient, the severity of the disease, the route of administration, pharmacological considerations such as the activity, efficacy, pharmacokinetic and toxicology profiles of the particular compound employed, whether a drug delivery system is utilized, on whether an acute or chronic disease state is being treated or prophylaxis is conducted or on whether further active compounds are administered in addition to the compounds identified by the methods of the invention and as part of a drug combination.
  • the dosage regimen for treating a disease condition with the compounds and/or compositions of this invention is selected in accordance with a variety factors as cited above.
  • the actual dosage regimen employed can vary widely and therefore can deviate from a preferred dosage regimen and one skilled in the art will recognize that dosage and dosage regimen outside these typical ranges can be tested and, where appropriate, can be used in the methods of this invention.
  • the desired dose can conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example, as two, three, four or more sub- doses per day.
  • the sub-dose itself can be further divided, e.g., into a number of discrete loosely spaced administrations.
  • the daily dose can be divided, especially when relatively large amounts are administered as deemed appropriate, into several, for example 2, 3 or 4, part administrations. If appropriate, depending on individual behavior, it can be necessary to deviate upward or downward from the daily dose indicated.
  • the invention provides a compound that stimulates hematopoiesis identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased.
  • the invention also provides a pharmaceutical composition comprising, consisting essentially of, or consisting of said compound.
  • the invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that stimulates hematopoiesis identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased.
  • a hematopoietic disorder can also include situations where there is no hematopoietic deficit per se, but it would be advantageous to increase hematopoiesis, for example, in surgery patients to decrease the need for transfusions in patients at risk for perioperative transfusions, and for blood donors, for example, to increase platelet counts.
  • said hematopoietic disorder is anemia, thrombocytopenia, neutropenia, leukopenia, cytopenia, or idiopathic thrombocytopenic purpura. In one embodiment, said hematopoietic disorder is anemia. In another embodiment, said hematopoietic disorder is thrombocytopenia
  • the invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of an agent used to stimulate hematopoiesis in combination with an effective amount of the pharmaceutical composition comprising a compound that stimulates hematopoiesis identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased.
  • Agents used to stimulate hematopoiesis include, for example, erythropoietin (epo) and colony stimulating factors such as granulocyte colony stimulating factor (G-CSF).
  • the invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of an agent used for the treatment of cancer in combination with an effective amount of the pharmaceutical composition comprising a compound that stimulates hematopoiesis identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased.
  • the individual is a mammal. In another embodiment, the individual is a human.
  • treating in reference to a disorder means a reduction in severity of one or more symptoms associated with a particular disorder. Therefore, treating a disorder does not necessarily mean a reduction in severity of all symptoms associated with a disorder and does not necessarily mean a complete reduction in the severity of one or more symptoms associated with a disorder.
  • preventing means prevention of the occurrence or onset of one or more symptoms associated with a particular disorder and does not necessarily mean the complete prevention of a disorder.
  • the methods of the invention can be used to treat a hematopoietic disorder including, for example, anemia, thrombocytopenia, erythrocytosis or a myeloproliferative disorder.
  • the invention provides a method for identifying a compound that stimulates erythropoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is increased, wherein an increase in
  • GPR91 functionality is indicative of the candidate compound being a compound that stimulates erythropoiesis.
  • the compound that stimulates erythropoiesis is a GPR91 agonist.
  • the compound that stimulates erythropoiesis is a GPR91 partial agonist.
  • the GPR91 is human.
  • determining comprises a second messenger assay.
  • the invention also provides a method for identifying a compound that stimulates thrombopoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is increased, wherein an increase in
  • GPR91 functionality is indicative of the candidate compound being a compound that stimulates thrombopoiesis.
  • the compound that stimulates thrombopoiesis is a GPR91 agonist.
  • the compound that stimulates thrombopoiesis is a GPR91 partial agonist.
  • the GPR91 is human.
  • determining comprises a second messenger assay.
  • the invention also includes, for example, a method for identifying a compound that stimulates erythropoiesis and thrombopoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is increased, wherein an increase in GPR91 functionality is indicative of the candidate compound being a compound that stimulates erythropoiesis and thrombopoiesis.
  • the compound that stimulates erythropoiesis and thrombopoiesis is a GPR91 agonist.
  • the compound that stimulates erythropoiesis and thrombopoiesis is a GPR91 partial agonist.
  • the GPR91 is human.
  • determining comprises a second messenger assay.
  • pharmaceutical compositions can be prepared by combining at least one pharmaceutically acceptable carrier with a compound that stimulates erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased.
  • the invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that stimulates erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased.
  • said hematopoietic disorder is anemia, thrombocytopenia, neutropenia, leukopenia, cytopenia, or idiopathic thrombocytopenic purpura.
  • said hematopoietic disorder is anemia.
  • said hematopoietic disorder is thrombocytopenia.
  • the invention provides a method for increasing red blood cell levels in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that stimulates hematopoiesis or erythropoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased.
  • the invention provides a method for increasing platelet levels in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that stimulates hematopoiesis or thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased.
  • the invention provides a method for increasing hematopoietic progenitor cell levels in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that stimulates hematopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased.
  • the invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of an agent used to stimulate hematopoiesis in combination with an effective amount of the pharmaceutical composition comprising a compound that stimulates erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased.
  • the invention further provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of an agent used for the treatment of cancer in combination with an effective amount of the pharmaceutical composition comprising a compound that stimulates erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased.
  • the individual is a mammal. In another embodiment, the individual is a human.
  • the invention provides a compound that stimulates erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased.
  • the invention also provides a pharmaceutical composition comprising, consisting essentially of, or consisting of said compound.
  • the invention also provides a method for the manufacture of a medicament comprising a compound that stimulates hematopoiesis, erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased, for use as a hematopoietic agent, hi addition, the invention provides a method for the manufacture of a medicament comprising a compound that stimulates hematopoiesis, erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased, for use in the treatment of a blood disorder.
  • the invention provides use of a compound that stimulates hematopoiesis, erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased, for the manufacture of a medicament for treating or preventing a blood disorder in an individual.
  • the invention also provides the use of said compound with an agent used to stimulate hematopoiesis.
  • the invention further provides the use of said compound with an agent used for the treatment of cancer, hi one embodiment, said blood disorder is anemia. In another embodiment, said blood disorder is thrombocytopenia.
  • the invention provides a method for identifying a compound that reduces hematopoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is decreased, wherein a decrease in GPR91 functionality is indicative of the candidate compound being a compound that reduces hematopoiesis.
  • the GPR91 is human.
  • said compound that reduces hematopoiesis is a GPR91 antagonist.
  • the compound that reduces hematopoiesis is a GPR91 inverse agonist.
  • said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 10 ⁇ M, of less than 1 ⁇ M, of less than 100 nM, or of less than 10 nM.
  • said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than a value selected from the interval of 1 nM to 10 ⁇ M.
  • said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than a value selected from the interval of 1 nM to 1 ⁇ M.
  • said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than a value selected from the interval of 1 nM to 100 nM. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than a value selected from the interval of 1 nM to 10 nM.
  • said IC50 is determined using an IP3 assay on a cell line that endogenously expresses GPR91.
  • said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 10 ⁇ M, of less than 1 ⁇ M, of less than 100 nM, or of less than 10 nM in said assay.
  • said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 10 ⁇ M in said assay.
  • said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 9 ⁇ M in said assay.
  • said compound that reduces hematopoiesis is an inverse antagonist or inverse agonist or an antagonist or inverse agonist with an IC50 of less than 8 ⁇ M in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 7 ⁇ M in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 6 ⁇ M in said assay, In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 5 ⁇ M in said assay.
  • said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 4 ⁇ M in said assay, hi some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 3 ⁇ M in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 2 ⁇ M in said assay.
  • said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 1 ⁇ M in said assay, hi some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 900 nM in said assay, hi some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 800 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 700 nM in said assay.
  • said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 600 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 500 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 400 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 300 nM in said assay.
  • said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 200 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 100 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 90 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 80 nM in said assay.
  • said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 70 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 60 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 50 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 40 nM in said assay.
  • said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 30 nM in said assay, hi some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 20 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 10 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 in said assay of less than a value selected from the interval of 1 nM to 10 ⁇ M.
  • said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 in said assay of less than a value selected from the interval of 1 nM to 1 ⁇ M.
  • said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 in said assay of less than a value selected from the interval of 1 nM to 100 nM.
  • said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 in said assay of less than a value selected from the interval of 1 nM to 10 nM.
  • said compound that reduces hematopoiesis is selective for the GPCR.
  • said compound that reduces hematopoiesis is orally bioavailable.
  • said oral bioavailability is at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, or at least 45% relative to intraperitoneal administration.
  • said oral bioavailablity is at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, or at least 45% relative to intraperitoneal administration.
  • said orally bioavailable compound that reduces hematopoiesis is further able to cross the blood-brain barrier.
  • said determining comprises a second messenger assay.
  • said second messenger IP3.
  • said second messenger is MAPK.
  • said candidate compound is not a polypeptide or peptide, hi all the methods of the invention, in certain embodiments, said candidate compound is not an antibody or antigen-binding derivative thereof.
  • the invention also provides methods that further comprise preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier.
  • the invention provides a method for preparing a pharmaceutical composition by combining a pharmaceutically acceptable carrier with a compound that reduces hematopoiesis where the compound that reduces hematopoiesis is identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased.
  • a compound identified by a method of the present invention can be formulated into a pharmaceutical composition using techniques well known to those in the art.
  • a compound of the invention can in an alternative use be administered as a raw or pure chemical, it can be useful to present the compound or active ingredient as a pharmaceutical formulation or composition further comprising a pharmaceutically acceptable carrier.
  • the invention thus further provides pharmaceutical formulations comprising a compound identified by a method of the invention or a pharmaceutically acceptable salt or derivative thereof together with one or more pharmaceutically acceptable carriers thereof and/or prophylactic ingredients.
  • the invention provides a compound that reduces hematopoiesis identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased.
  • the invention also provides a pharmaceutical composition comprising, consisting essentially of, or consisting of said compound.
  • the invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that reduces hematopoiesis identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased.
  • said hematopoietic disorder is erythrocytosis, a myeloproliferative disorder, essential thrombocythemia, post-transplant erythrocytosis, or polycythemia vera .
  • said hematopoietic disorder is erythrocytosis.
  • said hematopoietic disorder is a myeloproliferative disorder.
  • the invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of an agent used for decreasing hematopoiesis in combination with an effective amount of the pharmaceutical composition comprising a compound that reduces hematopoiesis identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased.
  • AB agent used for decreasing hematopoiesis can include, for example, a chemotherapeutic agent, radiation, or a compound such as anagrelide.
  • the individual is a mammal. In another embodiment, the individual is a human.
  • the invention provides a method for identifying a compound that reduces erythropoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is decreased, wherein a decrease in GPR91 functionality is indicative of the candidate compound being a compound that reduces erythropoiesis.
  • the compound that reduces erythropoiesis is a GPR91 antagonist, hi some embodiments, the compound that reduces erythropoiesis is a GPR91 inverse agonist.
  • the GPR91 is human, hi some embodiments, determining comprises a second messenger assay.
  • the invention also provides a method for identifying a compound that reduces thrombopoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is decreased, wherein a decrease in GPR91 functionality is indicative of the candidate compound being a compound that reduces thrombopoiesis.
  • the compound that reduces thrombopoiesis is a GPR91 antagonist.
  • the compound that reduces thrombopoiesis is a GPR91 inversel agonist.
  • the GPR91 is human.
  • determining comprises a second messenger assay.
  • the invention also includes, for example, a method for identifying a compound that reduces erythropoiesis and thrombopoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is decreased, wherein a decrease in GPR91 functionality is indicative of the candidate compound being a compound that reduces erythropoiesis and thrombopoiesis.
  • the compound that reduces erythropoiesis and thrombopoiesis is a GPR91 antagonist.
  • the compound that reduces erythropoiesis and thrombopoiesis is a GPR91 inverse agonist.
  • the GPR91 is human.
  • determining comprises a second messenger assay.
  • compositions can be prepared by combining at least one pharmaceutically acceptable carrier with a compound that reduces erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased.
  • the invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that reduces erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91 , and determining whether GPR91 functionality is decreased.
  • said hematopoietic disorder is erythrocytosis, a myeloproliferative disorder, essential thrombocythemia, post-transplant erythrocytosis, or polycythemia vera .
  • said hematopoietic disorder is erythrocytosis.
  • said hematopoietic disorder is a myeloproliferative disorder.
  • the invention provides a method for decreasing red blood cell levels in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that reduces hematopoiesis or erythropoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased.
  • the invention provides a method for decreasing platelet levels in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that reduces hematopoiesis or thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased.
  • the invention provides a method for decreasing hematopoietic progenitor cell levels in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that reduces hematopoiesis, identified by contacting a candidate compound with GPR91 , and determining whether GPR91 functionality is decreased.
  • the invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of an agent used for decreasing hematopoiesis in combination with an effective amount of the pharmaceutical composition comprising a compound that reduces erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased.
  • the individual is a mammal. In another embodiment, the individual is a human.
  • the invention provides a compound that reduces erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased.
  • the invention also provides a pharmaceutical composition comprising, consisting essentially of, or consisting of said compound.
  • the invention also provides a method for the manufacture of a medicament comprising a compound that reduces hematopoiesis, erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased, for use as a hematopoietic agent.
  • the invention provides a method for the manufacture of a medicament comprising a compound that reduces hematopoiesis, erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased, for use in the treatment of a blood disorder.
  • the invention provides use of a compound that reduces hematopoiesis, erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased, for the manufacture of a medicament for treating or preventing a blood disorder in an individual.
  • the invention further provides the use of said compound with an agent used for decreasing hematopoiesis.
  • said blood disorder is erythrocytosis.
  • said blood disorder is a myeloproliferative disorder.
  • the invention also relates to a method for increasing GPR91 function in a cell, comprising contacting a cell expressing GPR91 with an effective amount of a compound identified according to the method of: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is increased, wherein an increase in GPR91 functionality is indicative of the candidate compound being a compound that increases GPR91 function in a cell
  • One object of the invention relates to a method of a) performing a method of the invention to identify a compound that stimulates hematopoiesis and (b) optionally, determining the structure of the compound, and (c) providing the compound or the name or structure of the compound.
  • the invention relates to a method of a) performing a method of the invention to identify a compound that stimulates hematopoiesis and (b) optionally, determining the structure of the compound, (c) optionally, providing the name or structure of the compound, and (d) producing or synthesizing the compound.
  • the invention further relates to a process for modulating the functionality of a GPCR comprising performing a method of the invention to identify a compound that stimulates hematopoiesis and then contacting the GPCR with the compound that stimulates hematopoiesis or administering compound that stimulates hematopoiesis to an individual under conditions sufficient to modulate the functionality of the GPCR
  • Another object of the invention relates to a method of a) performing a method of the invention to identify a compound that reduces hematopoiesis and (b) optionally, determining the structure of the compound, and (c) providing the compound or the name or structure of the compound.
  • the invention relates to a method of a) performing a method of the invention to identify a compound that reduces hematopoiesis and (b) optionally, determining the structure of the compound, (c) optionally, providing the name or structure of the compound, and (d) producing or synthesizing the compound.
  • the invention further relates to a process for modulating the functionality of a GPCR comprising performing a method of the invention to identify a compound that reduces hematopoiesis and then contacting the GPCR with the compound that reduces hematopoiesis or administering compound that reduces hematopoiesis to an individual under conditions sufficient to modulate the functionality of the GPCR.
  • Another object of the present invention relates to radio-labeled compounds identified by a method of the invention that would be useful not only in radio-imaging but also in assays, both in vitro and in vivo, for localizing and quantitating GPR91 in tissue samples, including human, and for identifying GPR91 ligands by inhibition binding of a radiolabeled compound. It is a further object of this invention to develop novel GPR91 assays of which comprise such radiolabeled compounds.
  • Suitable radionuclides that can be incorporated in compounds of the present invention include but are not limited to 3 H (also written as T), 11 C, 14 C, 18 F, 125 I, 82 Br, 123 1, 124 1, 125 1, 131 1, 75 Br, 76 Br, 15 0, 13 N, 35 S and 77 Br.
  • the radionuclide that is incorporated in the instant radiolabeled compounds will depend on the specific application of that radiolabeled compound. Thus, for in vitro GPR91 labeling and competition assays, compounds that incorporate 3 H, 14 C, 125 1 , 131 1, 35 S or 82 Br will generally be most useful. For radio-imaging applications 11 C, 18 F, 125 1, 123 I, 124 1, 131 I,. 75 Br, 76 Br or 77 Br will generally be most useful.
  • a “radio-labeled " or “labeled compound” is a compound identified by a method of the invention that has incorporated at least one radionuclide; in some embodiments the radionuclide is selected from the group consisting of 3 H, 14 C, 125 1 , 35 S and 82 Br; in some embodiments the radionuclide 3 H or 14 C. Moreover, it should be understood that all of the atoms represented in the compounds of the invention can be either the most commonly occurring isotope of such atoms or the more scarce radio-isotope or nonradio-active isotope.
  • Synthetic methods for incorporating radio-isotopes into organic compounds including those applicable to those compounds of the invention are well known in the art and include incorporating activity levels of tritium into target molecules include:
  • Synthetic methods for incorporating activity levels of 125 I into target molecules include: A. Sandmeyer and like reactions - This procedure transforms an aryl or heteroaryl amine into a diazonium salt, such as a tetrafluoroborate salt, and subsequently to 125 I labelled compound using Na 125 I. A represented procedure was reported by Zhu, D.-G. and co-workers in J. Ore. Chem. 67:943-948 (2002)).
  • B. Ortho 125 Iodination of phenols This procedure allows for the incorporation of 125 I at the ortho position of a phenol as reported by Collier, T. L. and co-workers in J. Labelled Compd Radiopharm.
  • Aryl and heteroaryl bromide exchange with 125 I - This method is generally a two step process.
  • the first step is the conversion of the aryl or heteroaryl bromide to the corresponding tri-alkyltin intermediate using for example, a Pd catalyzed reaction [i.e. Pd(Ph 3 P) 4 ] or through an aryl or heteroaryl lithium, in the presence of a tri-alkyltinhalide or hexaalkylditin [e.g., (CH 3 ) 3 SnSn(CH 3 ) 3 ].
  • Pd catalyzed reaction i.e. Pd(Ph 3 P) 4
  • a tri-alkyltinhalide or hexaalkylditin e.g., (CH 3 ) 3 SnSn(CH 3 ) 3 ].
  • a radiolabeled GPR91 compound identified by a method of the invention can be used in a screening assay to identify/evaluate compounds.
  • a newly synthesized or identified compound i.e., candidate compound
  • the ability of a candidate compound to compete with the "radio-labeled compound identified by a method of the invention" for the binding to the GPR91 receptor directly correlates to its binding affinity.
  • One object of the invention relates to a method of identifying whether a candidate compound binds to a GPR91 receptor comprising the steps of: (a) contacting the receptor with a detectably labeled known ligand of the receptor (i.e. succinate) in the presence or absence of the candidate compound; and (b) determining whether the binding of said labeled known ligand to the receptor is inhibited in the presence of the candidate compound; wherein said inhibition is indicative of the candidate compound binding to the GPR91 receptor, hi one embodiment, said contacting comprises contacting with a host cell or with membrane of a host cell that expresses the GPCR, wherein said host cell comprises an expression vector comprising a polynucleotide encoding the receptor.
  • Another object of the invention relates to a method for detecting a ligand that binds to a GPR91 receptor, comprising the steps of: (a) contacting a test ligand with a host cell or with membrane of a host cell that expresses said receptor, under conditions which permit interaction between said receptor and said test ligand; and (b) detecting a ligand bound to said receptor, hi one embodiment, said contacting comprises contacting with a host cell or with membrane of a host cell that expresses the GPCR, wherein said host cell comprises an expression vector comprising a polynucleotide encoding the receptor.
  • Applicants reserve the right to exclude any one or more candidate compounds from any of the embodiments of the invention. Applicants also reserve the right to exclude any one or more modulators from any of the embodiments of the invention. Applicants additionally reserve the right to exclude any hematopoietic disorder from any of the embodiments of the invention.
  • Example 1 The examples are provided to further define the invention without, however, limiting the invention to the specifics of these examples.
  • Example 1
  • the expression level of human GPR91 was determined in several human cell types and tissues using an Affymetrix GeneChip®.
  • GPCRs G protein-coupled receptors
  • Affymetrix designed and manufactured an oligonucleotide microarray for the purpose of measuring mRNA expression levels of these receptors in various tissues via its GeneChip® Technology.
  • GPR91 has high levels of expression in macrophage samples, kidney, hematopoietic progenitor cells and a cell line called AXM-35 (see Figure 1).
  • TF-I cells were plated at 30,000 cells per a well in RPMI 1640/2% fetal bovine serum (FBS) and incubated overnight at 37°C/5% CO 2 .
  • FBS fetal bovine serum
  • cells were treated with lOOng/ml of pertussis toxin (PTX) (Sigma) at the time of plating. After 14 hours, cells were then treated with the compounds indicated in Figure 2 and incubated for 48 hours.
  • PTX pertussis toxin
  • MTS colorimetric tetrazolium salt
  • IP3 accumulation in succinate-stimulated TF-I cells was investigated.
  • TF-I cells were plated at 50,000 cells/well in inositol free media (Invitrogen) containing 0.4 ⁇ Ci of 3 H-myoinositol/well in a total of 100 ⁇ l per well using a round bottom 96-well plate.
  • Pertussis toxin treatment at 100ng/ml was included where indicated in Figure 3. Cells were cultured overnight at 37°C/5% CO 2 .
  • MAP kinase activation in succinate-stimulated TF-I cells was investigated.
  • TF-I cells were serum starved overnight in OptiMEM medium. Cells were then treated with the compounds indicated in Figure 4 and incubated for 10 minutes at 37°C. Cells were then washed with ice-cold PBS, scraped with 1 ml of ice-cold PBS and then spun at 3,000 rpm for 5 minutes. Supernatents were then analyzed using the Phospho ERK1/2 pTl 85 pTl 87 ELISA kit (Biosource) by following the manufacturer's protocol.
  • TF-I cells were serum starved overnight in OptiMEM medium. Cells were pretreated with the pharmacological inhibitors indicated in Figure 5 for 30 minutes. Cells were then treated with compounds (EPO, succinated or vehicle) and incubated for
  • FACS Analysis of Succinate-induced Expression in TF-I Cells In this example, the expression of CD41 on succinate-induced TF-I cells was analyzed by fluorescence activated cell sorting (FACS).
  • Cells were cultured and treated as indicated in the proliferation assay in Example 2. After 48 hours of treatment with the compounds indicated in Figure 7 in the presence of low serum conditions (2% FBS), cell death was analyzed by FACS analysis. The percentage of cells undergoing apoptosis was assessed by staining with the nucleic acid dye 7-Amino-Actinomycin D (7- AAD, BD Biosciences) and analysis by FACS. Data shown in Figure 7 are representative of three independent experiments.
  • succinate inhibits serum starvation-induced apoptosis of cultured TF-I cells.
  • GPR91 Specific siRNA Inhibits Succinate Stimulated TF-I Cell Proliferation hi this example, the effect of GPR91 specific siRNA on proliferation in succinate-stimulated TF-I cells was investigated.
  • TF-I cells were plated at 150,000 cells/well into a 6 well plate in RPMI 1640 media with 10% FBS. Cells were transfected with a pool of four siRNA sequences selective for GPR91 (Dharmacon, Chicago,IL) overnight. The sequence of the four siRNAs were as follows:
  • a GPR91 -specific siRNA inhibited succinate-stimulated TF-I cell proliferation.
  • Example 9 Succinate Stimulates Platelet and Red Blood Cell Recovery in Myelosuppressed Mice
  • succinate the effect of succinate on platelet and red blood cell recovery in myelosuppressed mice was investigated.
  • mice Male Balb/C mice were administered the myelosuppresive chemotherapy agent busulfan (15mg/kg) on days 0 and 3. Thereafter, IL-11 (500ug/kg) reconstituted in saline with 0.25% BSA, or sodium succinate (lOmg/kg) reconstituted in saline, were injected daily for eight days. On day 17 complete blood cell analysis was performed.
  • Melanophores are skin cells found in lower vertebrates. They contain pigmented organelles termed melanosomes. Melanophores are able to redistribute these melanosomes along a microtubule network upon G-protein coupled receptor (GPCR) activation. The result of this pigment movement is an apparent lightening or darkening of the cells.
  • GPCR G-protein coupled receptor
  • melanophores the decreased levels of intracellular cAMP that result from activation of a Gi-coupled receptor cause melanosomes to migrate to the center of the cell, resulting in a dramatic lightening in color. If cAMP levels are then raised, following activation of a Gs-coupled receptor, the melanosomes are re-dispersed and the cells appear dark again.
  • the increased levels of diacylglycerol that result from activation of Gq-coupled receptors can also induce this re-dispersion.
  • the technology is also suited to the study of certain receptor tyrosine kinases.
  • the response of the melanophores takes place within minutes of receptor activation and results in a simple, robust color change. The response can be easily detected using a conventional absorbance microplate reader or a modest video imaging system. Unlike other skin cells, the melanophores derive from the neural crest and appear to express a full complement of signaling proteins, hi particular, the cells express an extremely wide range of G-proteins and so are able to functionally express almost all GPCRs.
  • Melanophores can be utilized to identify compounds, including natural ligands, which bind to and/or activate GPCRs.
  • This method can be conducted by introducing test cells of a pigment cell line capable of dispersing or aggregating their pigment in response to a specific stimulus and expressing an exogenous clone coding for the GPCR.
  • An initial state of pigment disposition can be set using, for example, using melatonin, MSH or light.
  • the test cells are then contacted with chemical compounds, and it is determined whether the pigment disposition in the cells changed from the initial state of pigment disposition. Dispersion of pigments cells due to the candidate compound, including but not limited to a ligand, coupling to the GPCR will appear dark on a petri dish, while aggregation of pigments cells will appear light.
  • Melanophores are transfected by electroporation with a plasmid which contains the coding sequence of mouse GPR91.
  • the cells are plated in 96-well plates. 48 hours post-transfection, half of the cells on each plate are treated with 1OnM melatonin.
  • Melatonin activates an endogenous Gi-coupled receptor in the melanophores and causes them to aggregate their pigment.
  • the remaining half of the cells are transferred to serum-free medium 0.7X L- 15 (Gibco). After one hour, the cells in serum-free media remain in a pigment-dispersed state while the melatonin-treated cells are in a pigment- aggregated state.
  • the cells are treated with different compounds from a proprietary compound library containing 140,000-150,000 organic small molecule compounds. If GPR91 bound to the compound, the melanophores would be expected to undergo a color change in response to the compound. Since the receptor can couple to Gi, the pigment-dispersed cells would be expected to undergo a dose-dependent pigment aggregation.
  • GPCRs The following are illustrative; those of ordinary skill in the art are credited with the ability to determine those techniques that are preferentially beneficial for the needs of the artisan.
  • [ 35 S]GTPyS Assay When a G protein-coupled receptor is in its active state, either as a result of ligand binding or constitutive activation, the receptor couples to a G protein and stimulates the release of GDP and subsequent binding of GTP to the G protein.
  • the alpha subunit of the G protein-receptor complex acts as a GTPase and slowly hydrolyzes the GTP to GDP, at which point the receptor normally is deactivated. Activated receptors continue to exchange GDP for GTP.
  • the non-hydrolyzable GTP analog, [ 35 S]GTPyS can be utilized to demonstrate enhanced binding of [ 35 S]GTPyS to membranes expressing activated receptors.
  • the assay utilizes the ability of G protein coupled receptors to stimulate [ 35 S]GTPyS binding to membranes expressing the relevant receptors.
  • the assay can, therefore, be used in the direct identification method to screen candidate compounds to endogenous GPCRs and non-endogenous, constitutively activated GPCRs.
  • the assay is generic and has application to drug discovery at all G protein-coupled receptors.
  • the [ 35 S]GTPyS assay is incubated in 20 mM HEPES and between 1 and about 2OmM MgCl 2 (this amount can be adjusted for optimization of results, although 2OmM is preferred) pH 7.4, binding buffer with between about 0.3 and about 1.2 nM [ 35 S]GTPyS (this amount can be adjusted for optimization of results, although 1.2 is preferred) and 12.5 to 75 ⁇ g membrane protein (e.g, 293 cells expressing the GPR91; this amount can be adjusted for optimization) and 10 ⁇ M GDP (this amount can be changed for optimization) for 1 hour. Wheatgerm agglutinin beads (25 ⁇ l; Amersham) are then added and the mixture incubated for another 30 minutes at room temperature. The tubes are then centrifuged at 1500 x g for 5 minutes at room temperature and then counted in a scintillation counter.
  • a Flash PlateTM Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) designed for cell-based assays can be modified for use with crude plasma membranes.
  • the Flash Plate wells can contain a scintillant coating which also contains a specific antibody recognizing cAMP.
  • the cAMP generated in the wells can be quantitated by a direct competition for binding of radioactive cAMP tracer to the cAMP antibody.
  • the following serves as a brief protocol for the measurement of changes in cAMP levels in whole cells that express a receptor. Transfected cells are harvested approximately twenty four hours after transient transfection. Media is carefully aspirated off and discarded. 10ml of PBS is gently added to each dish of cells followed by careful aspiration.
  • Assay Buffer (50 ⁇ l) to 1 ImI Detection Buffer) is prepared and maintained in accordance with the manufacturer's instructions.
  • Assay Buffer is prepared fresh for screening and contains 50 ⁇ l of Stimulation Buffer, 3 ⁇ l of candidate compound (12 ⁇ M final assay concentration) and 50 ⁇ l cells.
  • Assay Buffer is stored on ice until utilized.
  • the assay preferably carried out, for example, in a 96-well plate, is initiated by addition of 50 ⁇ l of cAMP standards to appropriate wells followed by addition of 50 ⁇ l of PBSA to wells Hl 1 and H12. 50 ⁇ l of Stimulation Buffer is added to all wells.
  • DMSO (or selected candidate compounds) is added to appropriate wells using a pin tool capable of dispensing 3 ⁇ l of compound solution, with a final assay concentration of 12 ⁇ M candidate compound and lOO ⁇ l total assay volume.
  • the cells are then added to the wells and incubated for 60 minutes at room temperature.
  • lOO ⁇ l of Detection Mix containing tracer cAMP is then added to the wells. Plates are then incubated additional 2 hours followed by counting in a Wallac MicroBeta scintillation counter. Values of cAMP/well are then extrapolated from a standard cAMP curve which is contained within each assay plate.
  • TSHR is a Gs coupled GPCR that causes the accumulation of cAMP upon activation.
  • TSHR can be constitutively activated by mutating amino acid residue 623 (i.e., changing an alanine residue to an isoleucine residue).
  • a Gi coupled receptor is expected to inhibit adenylyl cyclase, and, therefore, decrease the level of cAMP production, which can make assessment of cAMP levels challenging.
  • An effective technique for measuring the decrease in production of cAMP as an indication of activation of a Gi coupled receptor can be accomplished by co-transfecting, non- endogenous, constitutively activated TSHR (TSHR-A623I) (or an endogenous, constitutively active Gs coupled receptor) as a "signal enhancer" with a Gi linked target GPCR to establish a baseline level of cAMP.
  • TSHR-A623I non- endogenous, constitutively activated TSHR
  • Gs coupled receptor an endogenous, constitutively active Gs coupled receptor
  • the target GPCR is then co-transfected with the signal enhancer, and it is this material that can be used for screening.
  • this approach is preferably used in the direct identification of candidate compounds against Gi coupled receptors. It is noted that for a Gi coupled GPCR, when this approach is used, an inverse agonist of the target GPCR will increase the cAMP signal and an agonist will decrease the cAMP signal.
  • tube A is prepared by mixing 2 ⁇ g DNA of each receptor transfected into the mammalian cells, for a total of 4 ⁇ g DNA (e.g., pCMV vector; pCMV vector with mutated THSR (TSHR-A623I); TSHR- A623I and GPCR, etc.) in 1.2ml serum free DMEM (Irvine Scientific, Irvine, CA); tube B is prepared by mixing 120 ⁇ l lipofectamine (Gibco BRL) in 1.2ml serum free DMEM.
  • Tubes A and B are then admixed by inversions (several times), followed by incubation at room temperature for 30-45minutes.
  • the admixture is referred to as the "transfection mixture”.
  • Plated 293 cells are washed with IXPBS, followed by addition of 10ml serum free DMEM.
  • 2.4ml of the transfection mixture is then added to the cells, followed by incubation for 4 hours at 37°C/5% CO 2 .
  • the transfection mixture is then removed by aspiration, followed by the addition of 25ml of DMEM/10% Fetal Bovine Serum. Cells are then incubated at 37°C/5% CO 2 . After 24 hours incubation, cells are harvested and utilized for analysis.
  • a Flash PlateTM Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) is designed for cell-based assays, but can be modified for use with crude plasma membranes depending on the need of the skilled artisan.
  • the Flash Plate wells contain a scintillant coating which also contains a specific antibody recognizing cAMP.
  • the cAMP generated in the wells can be quantitated by a direct competition for binding of radioactive cAMP tracer to the cAMP antibody. The following serves as a brief protocol for the measurement of changes in cAMP levels in whole cells that express a receptor of interest.
  • Transfected cells are harvested approximately twenty four hours after transient transfection. Media is carefully aspirated off and discarded. 10ml of PBS is gently added to each dish of cells followed by careful aspiration. ImI of Sigma cell dissociation buffer and 3ml of PBS is added to each plate. Cells are pipetted off the plate and the cell suspension is collected into a 50ml conical centrifuge tube. Cells are then centrifuged at room temperature at 1,100 rpm for 5 minutes. The cell pellet is carefully re-suspended into an appropriate volume of PBS (about 3ml/plate). The cells are then counted using a hemocytometer and additional PBS is added to give the appropriate number of cells (with a final volume of about 50 ⁇ l/well).
  • cAMP standards and Detection Buffer comprising l ⁇ Ci of tracer [ 125 I] cAMP (50 ⁇ l) to 1 ImI Detection Buffer
  • Assay Buffer should be prepared fresh for screening and contain 50 ⁇ l of Stimulation Buffer, 3 ⁇ l of candidate compound (12 ⁇ M final assay concentration) and 50 ⁇ l cells.
  • Assay Buffer can be stored on ice until utilized.
  • the assay can be initiated by addition of 50 ⁇ l of cAMP standards to appropriate wells followed by addition of 50 ⁇ l of PBSA to wells H-11 and H12. Fifty ⁇ l of Stimulation Buffer is added to all wells.
  • Selected compounds e.g., TSH
  • TSH Selected compounds
  • the cells are then added to the wells and incubated for 60 minutes at room temperature.
  • lOO ⁇ l of Detection Mix containing tracer cAMP is then added to the wells. Plates are then incubated additional 2 hours followed by counting in a Wallac MicroBeta scintillation counter. Values of cAMP/well are extrapolated from a standard cAMP curve which is contained within each assay plate. 4. Reporter-Based Assays a.
  • CRE-LUC Reporter Assay 293 or 293T cells are plated-out on 96 well plates at a density of 2 x 10 4 cells per well and are transfected using Lipofectamine Reagent (BRL) the following day according to manufacturer instructions.
  • a DNA/lipid mixture is prepared for each 6- well transfection as follows: 260ng of plasmid DNA in lOO ⁇ l of DMEM is gently mixed with 2 ⁇ l of lipid in lOO ⁇ l of DMEM (the 260ng of plasmid DNA consists of 200ng of a 8xCRE-Luc reporter plasmid, 50ng of pCMV comprising endogenous receptor or non- endogenous receptor or pCMV alone, and IOng of a GPRS expression plasmid (GPRS in pcDNA3 (Invitrogen)).
  • the 8XCRE-Luc reporter plasmid is prepared as follows: vector SRIF- ⁇ -gal is obtained by cloning the rat somatostatin promoter (-71 /+51) at BglV-Hindlll site in the p ⁇ gal-Basic Vector (Clontech). Eight (8) copies of cAMP response element are obtained by PCR from an adenovirus template AdpCF126CCRE8 (see, Suzuki et al., Hum Gene Ther 7:1883-1893 (1996); the disclosure of which is hereby incorporated by reference in its entirety) and cloned into the SRIF- ⁇ -gal vector at the Kpn-BglV site, resulting in the 8xCRE- ⁇ -gal reporter vector.
  • the 8xCRE-Luc reporter plasmid is generated by replacing the beta-galactosidase gene in the 8xCRE- ⁇ - gal reporter vector with the luciferase gene obtained from the pGL3 -basic vector (Promega) at the Hindlll-BamHI site. Following 30 minutes incubation at room temperature, the DNA/lipid mixture is diluted with 400 ⁇ l of DMEM and lOO ⁇ l of the diluted mixture is added to each well. 100 ⁇ l of DMEM with 10% FCS are added to each well after a four hour incubation in a cell culture incubator. The following day the transfected cells are changed with 200 ⁇ l/well of DMEM with 10% FCS.
  • Gq-associated receptors A method to detect Gq stimulation depends on the known property of Gq- dependent phospholipase C to cause the activation of genes containing API elements in their promoter.
  • a PathdetectTM AP-I cis-Reporting System (Stratagene, Catalogue No.
  • Gq-dependent phospholipase C One method to detect Gq stimulation depends on the known property of Gq- dependent phospholipase C to cause the activation of genes containing serum response factors in their promoter.
  • a PathdetectTM SRF-Luc-Reporting System (Stratagene) can be utilized to assay for Gq coupled activity in, for example, COS7 cells. Cells are transfected with the plasmid components of the system and the indicated expression plasmid encoding endogenous or non-endogenous GPCR using a Mammalian TransfectionTM Kit (Stratagene, Catalogue #200285) according to the manufacturer's instructions.
  • 410 ng SRF-Luc, 80 ng pCMV-receptor expression plasmid and 20 ng CMV-SEAP secreted alkaline phosphatase expression plasmid; alkaline phosphatase activity is measured in the media of transfected cells to control for variations in transfection efficiency between samples
  • CMV-SEAP secreted alkaline phosphatase expression plasmid; alkaline phosphatase activity is measured in the media of transfected cells to control for variations in transfection efficiency between samples
  • DMEM/well DMEM/well. The solutions are gently mixed and incubated for 15-30 minutes at room temperature. Cells are washed with 0.5 ml PBS and 400 ⁇ l of serum free media is mixed with the transfection media and added to the cells. The cells are then incubated for 3-4 hours at 37°C/5%CO 2 and then the transfection media is removed and replaced with 1 ml/well of regular growth media. On day 3 the cells are labeled with ⁇ -myoinositol. Briefly, the media is removed and the cells are washed with 0.5 ml PBS.
  • inositol-free/serum free media GEBCO BRL
  • 0.5 ml inositol-free/serum free media GEBCO BRL
  • 0.25 ⁇ Ci of 3 H- myo-inositol/ well the cells are incubated for 16-18 hours overnight at 37°C/5%CO 2 .
  • the cells are washed with 0.5 ml PBS and 0.45 ml of assay medium is added containing inositol-free/serum free media, 10 ⁇ M pargyline, 10 mM lithium chloride or 0.4 ml of assay medium and 50 ⁇ l of 1Ox ketanserin (ket) to final concentration of lO ⁇ M, if using a control construct containing a serotonin receptor.
  • the cells are then incubated for 30 minutes at 37 0 C.
  • the cells are then washed with 0.5 ml PBS and 200 ⁇ l of fresh/ice cold stop solution (IM KOH; 18 mM Na-borate; 3.8 mM EDTA) is added/well.
  • IM KOH fresh/ice cold stop solution
  • the solution is kept on ice for 5-10 minutes or until cells were lysed and then neutralized by 200 ⁇ l of fresh/ice cold neutralization sol. (7.5 % HCL).
  • the lysate is then transferred into 1.5 ml eppendorf tubes and 1 ml of chloroform/methanol (1:2) is added/tube.
  • the solution is vortexed for 15 seconds and the upper phase is applied to a Biorad AGl -X8TM anion exchange resin (100-200 mesh).
  • the resin is washed with water at 1 : 1.25 W/V and 0.9 ml of upper phase is loaded onto the column.
  • the column is washed with 10 mis of 5 mM myo-inositol and 10 ml of 5 mM Na- borate/60mM Na- formate.
  • the inositol tris phosphates are eluted into scintillation vials containing 10 ml of scintillation cocktail with 2 ml of 0.1 M formic acid/ 1 M ammonium formate.
  • the columns are regenerated by washing with 10 ml of 0.1 M formic acid/3M ammonium formate and rinsed twice with dd H 2 O and stored at 4 0 C in water.
  • the design of the GPCR-G protein fusion construct can be accomplished as follows: both the 5' and 3' ends of the rat G protein Gs ⁇ (long form; Itoh, H. et al., Proc. Natl. Acad. Sci. 83:3776 (1986)) are engineered to include a HindIII sequence thereon. Following confirmation of the correct sequence (including the flanking HindIII sequences), the entire sequence is shuttled into pcDNA3.1(-) (Invitrogen, cat. no. V795- 20) by subcloning using the HindIII restriction site of that vector. The correct orientation for the Gs ⁇ sequence is determined after subcloning into pcDNA3.1(-).
  • the modified pcDNA3.1(-) containing the rat Gs ⁇ gene at HindIII sequence is then verified; this vector is now available as a "universal" Gs ⁇ protein vector.
  • the pcDNA3.1 (-) vector contains a variety of well-known restriction sites upstream of the HindIII site, thus beneficially providing the ability to insert, upstream of the Gs protein, the coding sequence of a receptor of interest.
  • This same approach can be utilized to create other "universal" G protein vectors, and, of course, other commercially available or proprietary vectors known to the artisan can be utilized— the important criteria is that the sequence for the GPCR be upstream and in- frame with that of the G protein.
  • the design of a Gq(del)/Gi fusion construct can be accomplished as follows: the N-terminal six (6) amino acids (amino acids 2 through 7, having the sequence of
  • TLESIM (SEQ ID NO: 5)) of G ⁇ q-subunit is deleted and the C-terminal five (5) amino acids having the sequence EYNLV (SEQ ID NO: 6) is replaced with the corresponding amino acids of the G ⁇ i Protein, having the sequence DCGLF (SEQ ID NO: 7).
  • This fusion construct can be obtained by PCR using the following primers: 5'-gatcAAGCTTCCATGGCGTGCTGCCTGAGCGAGGAG-3' (SEQ ID NO: 8) and
  • Plasmid 63313 which contains the mouse G ⁇ q-wild type version with a hemagglutinin tag as template. Nucleotides in lower caps are included as spacers.
  • TaqPlus Precision DNA polymerase (Stratagene) can be utilized for the amplification by the following cycles, with steps 2 through 4 repeated 35 times: 95 0 C for 2 min; 95 0 C for 20 sec; 56 0 C for 20 sec; 72 0 C for 2 min; and 72 0 C for 7 min.
  • the PCR product can be cloned into a pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator kit (P.E. Biosystems). Inserts from a TOPO clone containing the sequence of the fusion construct can be shuttled into the expression vector pcDNA3.1(+) at the Hindlll/BamHI site by a 2 step cloning process.
  • PCT Application Number PCT/US02/05625 published as WO02068600 on 6 September 2002, the disclosure of which is hereby incorporated by reference in its entirety.
  • membranes comprising the Target GPCR of interest for use in the identification of candidate compounds as, e.g.,. agonists, inverse agonists or antagonists are prepared as follows: a. Materials “Membrane Scrape Buffer” is comprised of 2OmM HEPES and 1 OmM EDTA, pH 7.4; “Membrane Wash Buffer” is comprised of 2OmM HEPES and 0.ImM EDTA, pH 7.4; “Binding Buffer” is comprised of 2OmM HEPES, 100 mM NaCl, and 10 mM MgCl 2 , pH 7.4. b. Procedure All materials are kept on ice throughout the procedure.
  • the media is aspirated from a confluent monolayer of cells, followed by rinsing with 10ml cold PBS, followed by aspiration. Thereafter, 5ml of Membrane Scrape Buffer is added to scrape cells; this is followed by transfer of cellular extract into 50ml centrifuge tubes (centrifuged at 20,000 rpm for 17 minutes at 4 0 C). Thereafter, the supernatant is aspirated and the pellet is resuspended in 30ml Membrane Wash Buffer followed by centrifuge at 20,000 rpm for 17 minutes at 4 0 C. The supernatant is then aspirated and the pellet resuspended in Binding Buffer. This is then homogenized using a Brinkman PolytronTM homogenizer (15-20 second bursts until the all material is in suspension). This is referred to herein as "Membrane Protein”.
  • protein concentration of the membranes is determined using the Bradford Protein Assay (protein can be diluted to about 1.5mg/ml, aliquoted and frozen (-8O 0 C) for later use; when frozen, protocol for use will be as follows: on the day of the assay, frozen Membrane Protein is thawed at room temperature, followed by vortex and then homogenized with a Polytron at about 12 x 1,000 rpm for about 5-10 seconds; it is noted that for multiple preparations, the homogenizer should be thoroughly cleaned between homogenization of different preparations).
  • Binding Buffer (as per above); Bradford Dye Reagent; Bradford Protein Standard is utilized, following manufacturer instructions (Biorad, cat. no. 500-0006).
  • Duplicate tubes are prepared, one including the membrane, and one as a control "blank". Each tube contains 800 ⁇ l Binding Buffer. Thereafter, lO ⁇ l of Bradford
  • GDP Buffer consists of 37.5ml Binding Buffer and 2mg GDP (Sigma, cat. no. G-7127), followed by a series of dilutions in Binding Buffer to obtain 0.2 ⁇ M GDP (final concentration of GDP in each well is 0.1 ⁇ M GDP); each well comprising a candidate compound has a final volume of 200 ⁇ l consisting of lOO ⁇ l GDP Buffer (final concentration, 0.1 ⁇ M GDP), 50 ⁇ l Membrane Protein in Binding Buffer, and 50 ⁇ l [ 35 S]GTPyS (0.6 nM) in Binding Buffer (2.5 ⁇ l [ 35 S]GTPyS per 10ml Binding Buffer).
  • Candidate compounds can be screened using a 96-well plate format (these can be frozen at -8O 0 C).
  • Membrane Protein or membranes with expression vector excluding the Target GPCR, as control), are homogenized briefly until in suspension. Protein concentration is be determined using the Bradford Protein Assay set forth above.
  • Membrane Protein (and control) is diluted to 0.25mg/ml in Binding Buffer (final assay concentration, 12.5 ⁇ g/well). Thereafter, lOO ⁇ l GDP Buffer is added to each well of a Wallac ScintistripTM (Wallac).
  • a 5 ⁇ l pin-tool is used to transfer 5 ⁇ l of a candidate compound into such well (i.e., 5 ⁇ l in total assay volume of 200 ⁇ l is a 1:40 ratio such that the final screening concentration of the candidate compound is lO ⁇ M).
  • the pin tool should be rinsed in three reservoirs comprising water (IX), ethanol (IX) and water (2X) - excess liquid should be shaken from the tool after each rinse and dried with paper and kimwipes.
  • 50 ⁇ l of Membrane Protein is added to each well (a control well comprising membranes without the Target GPCR is also utilized), and pre-incubated for 5-10 minutes at room temperature.
  • Another assay approach for identifying candidate compounds as, e.g., agonists, inverse agonist, or antagonists can accomplished by utilizing a cyclase-based assay.
  • this assay approach can be utilized as an independent approach to provide confirmation of the results from the [ 35 S]GTPyS approach as set forth in the above example.
  • a modified Flash PlateTM Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) can be utilized for direct identification of candidate compounds as inverse agonists and agonists to a receptor of interest in accordance with the following protocol.
  • Transfected cells are harvested approximately three days after transfection.
  • Membranes are prepared by homogenization of suspended cells in buffer containing 2OmM HEPES, pH 7.4 and 1OmM MgCl 2 . Homogenization is performed on ice using a Brinkman PolytronTM for approximately 10 seconds. The resulting homogenate is centrifuged at 49,000 X g for 15 minutes at 4°C. The resulting pellet is then resuspended in buffer containing 2OmM HEPES, pH 7.4 and 0.1 mM EDTA, homogenized for 10 seconds, followed by centrifugation at 49,000 x g for 15 minutes at 4°C. The resulting pellet is then stored at -80°C until utilized.
  • the membrane pellet On the day of direct identification screening, the membrane pellet is slowly thawed at room temperature, resuspended in buffer containing 2OmM HEPES, pH 7.4 and 1OmM MgCl 2 , to yield a final protein concentration of 0.60mg/ml (the resuspended membranes are placed on ice until use).
  • cAMP standards and Detection Buffer comprising 2 ⁇ Ci of tracer [ 125 I]cAMP
  • Assay Buffer is prepared fresh for screening and contains 2OmM HEPES, pH 7.4, 1OmM MgCl 2 , 2OmM phospocreatine (Sigma), 0.1 units/ml creatine phosphokinase (Sigma), 50 ⁇ M GTP (Sigma), and 0.2 mM ATP (Sigma); Assay Buffer is then stored on ice until utilized.
  • Candidate compounds are added to, for example, 96-well plate wells (3 ⁇ l/well; 12 ⁇ M final assay concentration), together with 40 ⁇ l Membrane Protein (30 ⁇ g/well) and 50 ⁇ l of Assay Buffer. This admixture is then incubated for 30 minutes at room temperature, with gentle shaking. Following the incubation, lOO ⁇ l of Detection Buffer is added to each well, followed by incubation for 2-24 hours. Plates are then counted in a Wallac MicroBetaTM plate reader using "Prot. #31" (as per manufacturer's instructions).
  • Target Receptor (experimental) and pCMV (negative control) stably transfected cells from respective clonal lines are seeded into poly-D-lysine pretreated 96-well plates (Becton-Dickinson, #356640) at 5.5xlO 4 cells/well with complete culture medium (DMEM with 10% FBS, 2mM L-glutamine, ImM sodium pyruvate) for assay the next day. Because GPR91 is Gi coupled, the cells comprising GPR91 can further comprise G ⁇ l5, G ⁇ l6, or the chimeric Gq/Gi alpha subunit.
  • GPR91 is also coupled to G ⁇ l2/13 (see Example 3 and Figure 3), a promiscuous G protein such as G ⁇ l5, G ⁇ l6, or the chimeric Gq/Gi alpha subunit may not be required in order to cause a detectable calcium flux.
  • Fluo4-AM Molecular Probe, #F14202
  • 467 ⁇ l DMSO and 467 ⁇ l Pluoronic acid Molecular Probe, #P3000
  • Fluo4-AM is a fluorescent calcium indicator dye.
  • Candidate compounds are prepared in wash buffer (IX HBSS/2.5mM Probenicid/20mM HEPES at pH 7.4).
  • culture medium is removed from the wells and the cells are loaded with lOO ⁇ l of 4 ⁇ M Fluo4- AM/2.5 mM Probenicid (Sigma, #P8761)/20mM HEPES/complete medium at pH 7.4. Incubation at 37°C/5% CO 2 is allowed to proceed for 60 minutes.
  • Fluo4-AM incubation buffer is removed and the cells are washed 2X with 100 ⁇ l wash buffer. In each well is left 100 ⁇ l wash buffer. The plate is returned to the incubator at 37°C/5% CO 2 for 60 minutes.
  • FLEPR Fluorometric Imaging Plate Reader; Molecular Device
  • FLEPR Fluorometric Imaging Plate Reader; Molecular Device
  • Total fluorescence change counts are used to determine agonist activity using the FLIPR software.
  • the instrument software normalizes the fluorescent reading to give equivalent initial readings at zero.
  • MAP kinase mitogen activated kinase
  • MAP kinase can be monitored to evaluate receptor activation.
  • MAP kinase can be detected by several approaches.
  • One approach is based on an evaluation of the phosphorylation state, either unphosphorylated (inactive) or phosphorylated (active).
  • the phosphorylated protein has a slower mobility in SDS- PAGE and can therefore be compared with the unstimulated protein using Western blotting.
  • antibodies specific for the phosphorylated protein are available (New England Biolabs) which can be used to detect an increase in the phosphorylated kinase, hi either method, cells are stimulated with the candidate compound and then extracted with Laemmli buffer.
  • the soluble fraction is applied to an SDS-PAGE gel and proteins are transferred electrophoretically to nitrocellulose or Immobilin. Immunoreactive bands are detected by standard Western blotting technique. Visible or chemiluminescent signals are recorded on film and can be quantified by densitometry.
  • Another approach is based on evalulation of the MAP kinase activity via a phosphorylation assay.
  • Cells are stimulated with the candidate compound and a soluble extract is prepared.
  • the extract is incubated at 30°C for 10 minutes with gamma- 32 P- ATP, an ATP regenerating system, and a specific substrate for MAP kinase such as phosphorylated heat and acid stable protein regulated by insulin, or PHAS-I.
  • the reaction is terminated by the addition OfH 3 PO 4 and samples are transferred to ice.
  • An aliquot is spotted onto Whatman P81 chromatography paper, which retains the phosphorylated protein.
  • the chromatography paper is washed and counted for 32 P is a liquid scintillation counter.
  • the cell extract is incubated with gamma- 32 P- ATP, an ATP regenerating system, and biotinylated myelin basic proein bound by streptavidin to a filter support.
  • the myelin basic protein is a substrate for activated MAP kinase.
  • the phosphorylation reaction is carried out for 10 minutes at 30°C.
  • the extract can then be aspirated through the filter, which retains, the phosphorylated myelin basic protein.
  • the filter is washed and counted for 32 P by liquid scintillation counting.
  • Another means for evaluating a candidate compound is by determining binding affinities to the GPR91 receptor.
  • This type of assay generally requires a radiolabeled ligand to the GPR91 receptor. Absent the use of known ligands for the GPR91 receptor and radiolabels thereof, compounds identified by a method of the invention can be labelled with a radioisotope and used in an assay for evaluating the affinity of a candidate compound to the GPR91 receptor.
  • a radiolabeled GPR91 compound can be used in a screening assay to identify/evaluate compounds.
  • a newly synthesized or identified compound i.e., candidate compound
  • the ability to compete with the radiolabeled GPR91 compound for the binding to the GPR91 receptor directly correlates to the binding affinity of the candidate compound to the GPR91 receptor.
  • ASSAY PROTOCOL FOR DETERMINING RECEPTOR BINDING FOR GPR91 A.
  • HEK293 cells human kidney, ATCC
  • 293 cells can be transiently or stably transfected with GPR91 as described herein.
  • 293 cells can be transiently transfected with 10 ⁇ g human GPR91 receptor and 60 ⁇ l Lipofectamine (per 15-cm dish), and grown in the dish for 24 hours (75% confluency) with a media change.
  • Cells are removed with lOml/dish of Hepes-EDTA buffer ( 2OmM Hepes + 10 mM EDTA, pH 7.4).
  • the cells are then centrifuged in a Beckman Coulter centrifuge for 20 minutes, 17,000 rpm (JA-25.50 rotor).
  • the pellet is resuspended in 2OmM Hepes + 1 mM EDTA, pH 7.4 and homogenized with a 50- ml Dounce homogenizer and again centrifuged. After removing the supernatant, the pellets are stored at -8O 0 C, until used in binding assay.
  • membranes are thawed on ice for 20 minutes and then 1OmL of incubation buffer (2OmM Hepes, ImM MgCl 25 IOOmM NaCl, pH 7.4) is added. The membranes are then vortexed to resuspend the crude membrane pellet and homogenized with a Brinkmann PT-3100 Polytron homogenizer for 15 seconds at setting 6. The concentration of membrane protein is determined using the BRL Bradford protein assay.
  • a total volume of 50 ⁇ l of appropriately diluted membranes (diluted in assay buffer containing 5OmM Tris HCl (pH 7.4), 1OmM MgCl 2 , and ImM EDTA; 5-50 ⁇ g protein) is added to 96-well polyproylene microtiter plates followed by addition of lOO ⁇ l of assay buffer and 50 ⁇ l of radiolabeled GPR91 compound.
  • 50 ⁇ l of assay buffer is added instead of lOO ⁇ l and an additional 50 ⁇ l of lO ⁇ M cold GPR91 is added before 50 ⁇ l of radiolabeled GPR91 compound is added. Plates are then incubated at room temperature for 60-120 minutes.
  • the binding reaction is terminated by filtering assay plates through a Microplate Devices GF/C Unifilter filtration plate with a Brandell 96-well plate harvestor followed by washing with cold 50 mM Tris HCl, pH 7.4 containing 0.9% NaCl. Then, the bottom of the filtration plates are sealed, 50 ⁇ l of Optiphase Supermix is added to each well, the top of the plates are sealed, and plates are counted in a Trilux MicroBeta scintillation counter. For compound competition studies, instead of adding lOO ⁇ l of assay buffer, lOO ⁇ l of appropriately diluted candidate compound is added to appropriate wells followed by addition of 50 ⁇ l of radiolabeled GPR91 compound.
  • the candidate compounds are initially assayed at 1 and O.l ⁇ M and then at a range of concentrations chosen such that the middle dose would cause about 50% inhibition of a radiolabeled GPR91 compound binding (i.e., IC 50 ).
  • IC 50 Specific binding in the absence of candidate compound (Bo) is the difference of total binding (BT) minus non-specific binding (NSB) and similarly specific binding (in the presence of candidate compound) (B) is the difference of displacement binding (B D ) minus non-specific binding (NSB).
  • IC 50 is determined from an inhibition response curve, logit-log plot of % B/Bo vs concentration of candidate compound.
  • Kj is calculated by the Cheng and Prustoff transformation: where [L] is the concentration of a radiolabeled GPR91 compound used in the assay and K D is the dissociation constant of a radiolabeled GPR91 compound determined independently under the same binding conditions.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to a method for identifying a compound that stimulates hematopoiesis by: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is increased, where an increase in GPR91 functionality is indicative of the candidate compound being a compound that stimulates hematopoiesis. The invention further relates to a method for identifying a compound that stimulates erythropoiesis or thrombopoiesis by: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is increased, where an increase in GPR91 functionality is indicative of the candidate compound being a compound that stimulates erythropoiesis or thrombopoiesis.

Description

MODULATORS OF HEMATOPOIESIS
FIELD OF THE INVENTION
The present invention relates to methods for identifying a compound that regulates hematopoiesis, by determining whether the compound modulates GPR91 functionality. Accordingly, a compound identified using a method of the present invention can be useful in the prophylaxis or treatment of blood disorders such as anemia and thrombocytopenia.
BACKGROUND OF THE INVENTION
Both red blood cells and white blood cells are derived from the same primitive hematopoietic stem cell. There are many intermediate stages between the starting cell, the hemopoietic stem cell, and the finished cell, the mature blood cell. In the first step, the hematopoietic stem cell becomes either a lymphoid stem cell or a myeloid stem cell. The lymphoid stem cell divides to eventually give rise to a lymphoblast which becomes the B and T cell lymphocytes. The myeloid stem cell eventually gives rise to: an erythroblast, which becomes erythrocytes (red blood cells), a megakaryoblast, which becomes platelets (also called thrombocytes), and a myeloblast, which becomes granulocytes and monocytes. The name given to the production of red blood cells is erythropoiesis. Platelet production is given the name thrombopoiesis, derived from thrombocyte, the other name for platelet. Another name describing platelet production is megakaryopoiesis. This term comes from the name megakaryoblast, an early precursor of platelet production.
Hematological disorders include diseases of the blood and all its constituents as well as diseases of organs and tissues involved in the generation or degradation of blood constituents. Common hematological disorders include, for example, anemia, thrombocytopenia, leukemia, lymphoma and myeloma. Anemia is a deficiency in the oxygen-carrying component of the blood, measured in unit volume concentrations of hemoglobin, red blood cell volume, or red blood cell number. Anemia can have many causes including dietary deficiencies, kidney failure, cancer, and chemotherapy.
Thrombocytopenia is the term for a reduced platelet (thrombocyte) count. It occurs when platelets are lost from the circulation faster than they can be replaced from the bone marrow where they are made. Thrombocytopenia may either result from a failure of platelet production and/or an increased rate of removal from blood. Thrombocytopenias can occur when the bone marrow does not produce enough platelets, as happens in leukemia and some anemias. Viral infections and chemotherapy can also lead to thrombocytopenia. In addition, the body may use or destroy too many platelets, as occurs in many disorders including idiopathic thrombocytopenic purpura, thrombotic thrombocytopenic purpura, and hemolytic-uremic syndrome.
In order to treat anemia, one needs to stimulate the erythroid precursor cell. A treatment currently used for the treatment of anemia, particularly anemia caused by chemotherapy or chronic kidney failure, is the drug epogen (EPO). EPO is a genetically engineered form of the naturally occurring protein erythropoietin. EPO is usually injected three times per week and the treatment is costly. In addition, about 30% of patients fail to mount an adequate response to EPO and only 75% of the responders maintain hemoglobin levels long term. Recently the effectiveness of EPO for prolonging survival in cancer patients has been questioned. Moreover, EPO can induce hypertension and an immunological response in some patients. In order to treat thrombocytopenia, one needs to stimulate the megakaryocyte precursor cell. Current treatments for thrombocytopenia include platelet transfusions and IL-11. Platelet transfusions are expensive and not readily available. Also there is a risk of transfusion reactions and disease transmission when using platelet transfusions. Some of the problems with the use of IL-11 are the inconvenience of using a drug that must be injected, the modest efficacy of the drug, and high incidence of side effects.
Thus, there exists a need for the identification of an agent which safely and effectively regulates hematopoiesis for the treatment of blood disorders such as anemia and thrombocytopenia. The present invention satisfies this need and provides related advantages as well.
SUMMARY OF THE INVENTION
Applicants have determined that an agonist of the G-protein coupled receptor (GPCR) GPR91 stimulates hematopoiesis. Further, Applicants disclose herein that an agonist of GPR91 stimulates erythropoiesis and thrombopoiesis.
In a first aspect, the invention features a method for identifying a compound that stimulates hematopoiesis, comprising contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased, wherein an increase in GPR91 functionality is indicative of the candidate compound being a compound that stimulates hematopoiesis. In some embodiments said GPR91 is human. In some embodiments, said determining comprises a second messenger assay. The invention also features a method of the first aspect further comprising preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier.
In a second aspect, the invention features a method for identifying a compound that stimulates erythropoiesis, comprising contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased, wherein an increase in GPR91 functionality is indicative of the candidate compound being a compound that stimulates erythropoiesis. hi some embodiments said GPR91 is human, hi some embodiments, said determining comprises a second messenger assay. The invention also features a method of the second aspect further comprising preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier. In a third aspect, the invention features a method for identifying a compound that stimulates thrombopoiesis, comprising contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased, wherein an increase in GPR91 functionality is indicative of the candidate compound being a compound that stimulates thrombopoiesis. hi some embodiments said GPR91 is human, hi some embodiments, said determining comprises a second messenger assay. The invention also features a method of the third aspect further comprising preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier. hi a. fourth aspect, the invention features a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition of the first, second or third aspects. In some embodiments, said hematopoietic disorder is anemia, thrombocytopenia, neutropenia, leukopenia, cytopenia, or idiopathic thrombocytopenic purpura, hi one embodiment, said hematopoietic disorder is anemia, hi another embodiment, said hematopoietic disorder is thrombocytopenia. The invention also features a method of the fourth aspect further comprising administering to said individual an effective amount of an agent used to stimulate hematopoiesis in combination with an effective amount of the pharmaceutical composition of the first, second or third aspects. In one embodiment, said individual is a mammal. In one embodiment, said individual is a human.
In a fifth aspect, the invention features a compound that stimulates hematopoiesis identified according to a method of the first aspect. The invention also features a pharmaceutical composition comprising the compound of the fifth aspect.
In a sixth aspect, the invention features a compound that stimulates erythropoiesis identified according to a method of the second aspect. The invention also features a pharmaceutical composition comprising the compound of the sixth aspect. In a seventh aspect, the invention features a compound that stimulates thrombopoiesis identified according to a method of the third aspect. The invention also features a pharmaceutical composition comprising the compound of the seventh aspect.
In an eighth aspect, the invention features a method for identifying a compound that reduces hematopoiesis, comprising contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased, wherein a decrease in GPR91 functionality is indicative of the candidate compound being a compound that reduces hematopoiesis. In some embodiments said GPR91 is human. In some embodiments, said determining comprises a second messenger assay. The invention also features a method of the eighth aspect further comprising preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier.
In a ninth aspect, the invention features a method for identifying a compound that reduces erythropoiesis, comprising contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased, wherein a decrease in GPR91 functionality is indicative of the candidate compound being a compound that reduces erythropoiesis. In some embodiments said GPR91 is human. In some embodiments, said determining comprises a second messenger assay. The invention also features a method of the ninth aspect further comprising preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier. In a tenth aspect, the invention features a method for identifying a compound that reduces thrombopoiesis, comprising contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased, wherein a decrease in GPR91 functionality is indicative of the candidate compound being a compound that reduces thrombopoiesis. In some embodiments said GPR91 is human. In some embodiments, said determining comprises a second messenger assay. The invention also features a method of the tenth aspect further comprising preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier. In a eleventh aspect, the invention features a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition of the eighth, ninth, or tenth aspects. In some embodiments, said hematopoietic disorder is erythrocytosis, a myeloproliferative disorder, essential thrombocythemia, post-transplant erythrocytosis, or polycythemia vera. In one embodiment, said hematopoietic disorder is erythrocytosis. In another embodiment, said hematopoietic disorder is a myeloproliferative disorder. The invention also features a method of the eleventh aspect further comprising administering to said individual an effective amount of an agent used for decreasing hematopoiesis in combination with an effective amount of the pharmaceutical composition of the eighth, ninth, or tenth aspects. In one embodiment, said individual is a mammal. In one embodiment, said individual is a human.
In a twelfth aspect, the invention features a compound that reduces hematopoiesis identified according to a method of the eighth aspect. The invention also features a pharmaceutical composition comprising the compound of the twelfth aspect. In a thirteenth aspect, the invention features a compound that reduces erythropoiesis identified according to a method of the ninth aspect. The invention also features a pharmaceutical composition comprising the compound of the thirteenth aspect. hi a fourteenth aspect, the invention features a compound that stimulates thrombopoiesis identified according to a method of the tenth aspect. The invention also features a pharmaceutical composition comprising the compound of the fourteenth aspect.
In a. fifteenth aspect, the invention features a method for the manufacture of a medicament comprising a compound of the fifth, sixth or seventh aspects for use as a hematopoietic agent. The invention further features a method for the manufacture of a medicament comprising a compound of the fifth, sixth or seventh aspects, for use in the treatment of a blood disorder. In addition, the invention features the use of a compound of the fifth, sixth or seventh aspects for the manufacture of a medicament for treating or preventing a blood disorder in an individual. In one embodiment, said blood disorder is anemia. In another embodiment, said blood disorder is thrombocytopenia. In some embodiments, said compound is used in combination with an agent used to stimulate hematopoiesis.
In a sixteenth aspect, the invention features a method for the manufacture of a medicament comprising a compound of the twelfth, thirteenth or fourteenth aspects for use as a hematopoietic agent. The invention further features a method for the manufacture of a medicament comprising a compound of the twelfth, thirteenth or fourteenth aspects, for use in the treatment of a blood disorder. In addition, the invention features the use of a compound of the twelfth, thirteenth or fourteenth aspects for the manufacture of a medicament for treating or preventing a blood disorder in an individual. In one embodiment, said blood disorder is erythrocytosis. In another embodiment, said blood disorder is a myeloproliferative disorder. In some embodiments, said compound is used in combination with an agent used for decreasing hematopoiesis.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows Affymetrix gene chip analysis of human GPR91 expression in human cell types and tissues. The cell or tissues from left to right are: Table I.
1 Anterior Hippocampus
2 Globus pallidus
3 Pons, lower
4 CAP
5 Sciatic Nerve Wallerian degeneration
6 Frontal Cortex, Superior BM9
7 Cerebellum
8 Substantia Nigra
9 Cingulate gyrus
10 Amygdala
11 Spinal Cord
12 Hippocampus
13 Medulla Oblongata
14 VTA
15 Pituitary gland, female
16 Whole brain
17 Retina
18 Dorsal Root Ganglion
19 Thalamus
20 Fetal Brain
21 Pituitary gland, male
22 Astrocytes, resting Olfactory bulb
Corpus Callosum
Hypothalamus, anterior
Astrocytes, activated
Neural progenitor
Pons, upper
Sciatic Nerve
Sciatic Nerve fiber
HepG2
HL-60 +DMSO macrophage BC2
THP-I +PMA macrophage D2 +LPS macrophage BC2 +oxLDL
THP-I +PMA +oxLDL
THP-I activated
Neutrophils
T-cells, CD4+ resting
Natural Killer Cells
T-cells, CD4+ activated
HL-60
Thymus
T-cells, CD8+ resting
Lymph Node
T-cells, CD8+ activated
B-cells, CD 19+ monocytes, adherent
Spleen
Jurkat
Eosinophils
THP-I macrophage D2
Monocytes, CD 14+ macrophage Dl
Langerhan cells + IFNgamma
Langerhan cells
Neutrophils, BM (n=l) macrophage Dl +LPS
Ventricle, Left
Cartilage
Adipocyte, cultured visceral fat
Adipocyte, primary
Preadipocyte, cultured adipocytes, cultured visceral fat
Adipose
Aortic Smooth Muscle Cells, proliferative
Aortic Smooth Muscle Cells, contractile
Pericardium
Aortic Endothelial Cells
HUVEC 74 cultured interstitial cells
75 Aorta
76 aortic valve
77 Heart
78 Colon
79 Rectum
80 Small Intestine
81 Stomach
82 Fetal Liver
83 Liver
84 Keratinocyte
85 Lung
86 smooth muscle
87 Skin
88 Esophagus
89 Melanocytes
90 gall bladder
91 Trachea
92 Duodenum
93 fibroblast, dermal
94 Kidney
95 Pancreas
96 Adrenal Gland
97 pancreatic islets
98 Salivary Gland
99 Mesenchymal stem cell
100 Bladder
101 Bone
102 Skeletal Muscle
103 CD34+ progenitor cells
104 Bone Marrow
105 Megakaryocyte, cultured
106 Megakaryocyte, CB
107 Megakaryocyte, MPB
108 myeloid prog. MPB
109 TF-I alpha
110 TF-I
111 K562
112 Erythroid progenitors Neg SeI.
113 erythroid progenitors
114 CD34+ MPB
115 BM CD71+
116 CD34+ CB
117 Hel92.1
118 dendritic precursors
119 Bone Marrow Stromal Cells
120 AC133+
121 myeloid prog. BM
122 Uterus
123 Prostate
124 Testis 125 Ovary
126 Placenta
127 Cervix
128 Breast
129 Prostate epithelial
130 AXC-0034 Kidney Embryonic
131 A-431
132 AXC-OO 15 Pancreas Adenocarcinoma
133 AXC-0002 Epidermis Carcinoma
134 HeLa
135 AXC-0038 Leucocyte Promyeloblast
136 AXC-0058 Lung Carcinoma
137 AXC-0082 Leucocyte Monocytoma
138 NB69
139 AXC-0148 Breast Carcinoma
140 AXC-0052 Uterus Sarcoma
141 AXC-0086 Leucocyte Lymphoma
142 AXC-0056 Lung Mesothelioma
143 AXC-0055 Leucocyte Lymphoblastoma
144 AXC-0003 Lung Carcinoma
145 AXC-0080 Breast Carcinoma
146 RAJI cells
147 AXC-0050 Breast Adenocarcinoma
148 U87
149 AXC-0046 Leucocyte Lymphoblastoma
150 HT1080
151 AXC-0043 Lymph Lymphoblast
152 AXC-0059 Stomach Carcinoma
153 AXC-0029 Lymph Lymphoma
154 AXC-0009 Pancreas Adenocarcinoma
155 AXC-OO 12 Large Intestine Normal Fibroblast
156 AXC-0074 LungCarcinoma
157 AXC-0025 Small Intestine Normal Epithelial
158 AXC-0028 Lung Carcinoma
159 AXC-0049 Breast Adenocarcinoma
160 Y79 retinoblastoma
161 AXC-0146 Breast Adenocarcinoma
162 PC-3
163 AXC-0031 Breast Epithelial
164 MCF7
165 AXC-0081 Neuronal Medulloblastoma
166 SHSY5Y + BDNF
167 AXC-0077 Neuronal Neuroepithelioma
168 SHSY5Y
169 AXC-0017 Large Intestine Adenocarcinoma
170 Caco-2
171 AXC-0011 Large Intestine Adenocarcinoma
172 AXC-0036 Liver Carcinoma
173 293 cells
174 AXC-0084 Bone Sarcoma
175 AXC-0073 Bone Osteosarcoma 176 AXC-0054 Bone Osteosarcoma
177 AXC-0041 Bladder Carcinoma
178 AXC-0040 Bladder Carcinoma
179 AXC-0075 Neuronal Neuroblastoma
180 AXC-0078 Pancreas Carcinoma
181 AXC-OO 13 Neuroglia Astrocytoma
182 AXC-0062 Pancreas Carcinoma
183 AXC-0039 Pancreas Adenocarcinoma
184 AXC-0085 Neuroglia Astrocytoma
185 AXC-0168 Testis Carcinoma
186 AXC-0147 Ovary Carcinoma
187 AXC-0076 Blood Vessels Adenocarcinoma
188 AXC-0065 Prostrate Adenocarcinoma
189 AXC-0023 Large Intestine Adenocarcinoma
190 AXC-0035 Hemopoietic Lymphoblastoma
191 AXC-0042 Lymp Lymphoma
Figure 2 shows succinate-stimulated proliferation of TF-I cells is sensitive to pertussis toxin (PTX).
Figure 3 shows succinate-stimulated inositol 1,4,5-triphosphate (IP3) signaling in TF-I cells is sensitive to PTX.
Figure 4 shows succinate-stimulated mitogen-activated protein kinase (MAPK) activation in TF-I cells is sensitive to PTX.
Figure 5 shows MAPK and phosphatidylinositol 3 -kinase (PI3-K) are required for succinate-induced proliferation in TF-I cells. Figure 6 shows fluorescence activated cell sorting (FACS) analysis of succinate- induced CD41 expression in TF-I cells.
Figure 7 shows succinate inhibits serum starvation-induced apoptosis of cultured TF-I cells.
Figure 8 shows GPR91 -specific small-interfering RNA (siRNA) inhibits succinate stimulated TF-I cell proliferation.
Figure 9 shows succinate stimulates platelet and red blood cell recovery in myelosuppressed mice.
DETAILED DESCRIPTION
Applicants have disclosed herein that human GPR91 is expressed prominently in immune system cells and tissues (such as macrophage samples), kidney, and hematopoietic progenitor cell samples as well as the AXM-35 cell line (see Figure 1). In addition, Applicants have disclosed herein that succinate-stimulated proliferation of TF-I cells is PTX sensitive (see Figure 2). Further, Applicants disclose herein that succinate-stimulated IP3 signaling (Figure 3) and MAPK activation (Figure 4) in TF-I cells is PTX sensitive. In addition, Applicants disclose MAPK and PI3-K are required for succinate-induced proliferation in TF-I cells (Figure 5). Using FACS analysis, Applicants disclose that succinate increases the percentage of CD41 expressing TF-I cells and this increase is PTX sensitive (Figure 6). Applicants further disclose that succinate inhibits serum starvation-induced apoptosis of cultured TF-I cells (see Figure 7). In addition, Applicants disclose GPR91 -specific siRNA inhibits succinate stimulated TF-I cell proliferation (Figure 8). Applicants show that IL-11 increases platelet number and hemoglobin concentration in busulfan challenged mice (Figure 10) and disclose that succinate stimulates platelet and red blood cell recovery in myelosuppressed mice comparable to IL-11 (see Figure 11). Further, Applicants disclose that succinate does not regulate human platelet activity in a platelet aggregation assay (Figure 12).
Although a number of receptor classes exist in humans, by far the most abundant and therapeutically relevant is represented by the G protein-coupled receptor (GPCR) class. It is estimated that there are some 30,000-40,000 genes within the human genome, and of these, approximately 2% are estimated to code for GPCRs. GPCRs represent an important area for the development of pharmaceutical products: from approximately 20 of the 100 known GPCRs, approximately 60% of all prescription pharmaceuticals have been developed.
GPCRs share a common structural motif, having seven sequences of between 22 to 24 hydrophobic amino acids that form seven alpha helices, each of which spans the membrane (each span is identified by number, i.e., transmembrane- 1 (TM-I), transmembrane-2 (TM-2), etc.). The transmembrane helices are joined by strands of amino acids between transmembrane-2 and transmembrane-3, transmembrane-4 and transmembrane-5, and transmembrane-6 and transmembrane-7 on the exterior, or "extracellular" side, of the cell membrane (these are referred to as "extracellular" regions 1, 2 and 3 (EC-I, EC-2 and EC-3), respectively). The transmembrane helices are also joined by strands of amino acids between transmembrane- 1 and transmembrane-2, transmembrane-3 and transmembrane-4, and transmembrane-5 and transmembrane-6 on the interior, or "intracellular" side, of the cell membrane (these are referred to as "intracellular" regions 1, 2 and 3 (IC-I, IC-2 and IC-3), respectively). The "carboxy" ("C") terminus of the receptor lies in the intracellular space within the cell, and the "amino" ("N") terminus of the receptor lies in the extracellular space outside of the cell. Generally, when a ligand binds with the receptor (often referred to as
"activation" of the receptor); there is a change in the conformation of the receptor that facilitates coupling between the intracellular region and an intracellular "G-protein." It has been reported that GPCRs are "promiscuous" with respect to G proteins, i.e., that a GPCR can interact with more than one G protein. See, Kenakin, T., 43 Life Sciences 1095 (1988). Although other G proteins exist, currently, Gq, Gs, Gi, Gz and Go are G proteins that have been identified. Ligand-activated GPCR coupling with the G-protein initiates a signaling cascade process (referred to as "signal transduction"). Under normal conditions, signal transduction ultimately results in cellular activation or cellular inhibition. Although not wishing to be bound to theory, it is thought that the IC-3 loop as well as the carboxy terminus of the receptor interact with the G protein.
There are also promiscuous G proteins, which appear to couple several classes of GPCRs to the phospho lipase C pathway, such as Gαl5 or Gαl6 (Offermanns & Simon, J Biol Chem 270:15175-80 (1995)), or chimeric G proteins designed to couple a large number of different GPCRs to the same pathway, e.g. phospholipase C (Milligan & Rees, Trends in Pharmaceutical Sciences 20:118-24 (1999)).
Gi-coupled GPCRs lower intracellular cAMP levels. The melanophore technology (see infra) is useful for identifying Gi-coupled GPCRs and also for identifying modulators of said Gi-coupled GPCRs.
Under physiological conditions, GPCRs exist in the cell membrane in equilibrium between two different conformations: an "inactive" state and an "active" state. A receptor in an inactive state is unable to link to the intracellular signaling transduction pathway to initiate signal transduction leading to a biological response. Changing the receptor conformation to the active state allows linkage to the transduction pathway (via the G-protein) and produces a biological response. A receptor can be stabilized in an active state by a ligand or a compound such as a drug. Recent discoveries, including but not exclusively limited to modifications to the amino acid sequence of the receptor, provide means other than ligands or drugs to promote and stabilize the receptor in the active state conformation. These means effectively stabilize the receptor in an active state by simulating the effect of a ligand binding to the receptor. Stabilization by such ligand-independent means is termed "constitutive receptor activation."
GPR91 was first cloned by Wittenberger et al. using batch EST database searching (Wittenberger et al., J. Molec. Biol. 307: 799-813, 2001). The gene contains a single intron and was mapped by electronic PCR to 3q24-q25.1. The deduced 330- amino acid protein is 68% identical to the mouse protein. Northern blot analysis revealed expression of a 4.8-kb GPR91 transcript specifically in kidney. GPR91 was designated as an orphan receptor until He et al. demonstrated that GPR91 functions as a receptor for the citric acid cycle intermediate succinate (He, W. et al., Nature 429: 188- 193, 2004). They demonstrated that succinate increases blood pressure in animals. The succinate-induced hypertensive effect appears to involve the renin- angiotensin system and is abolished in GPR91 -deficient mice.
He et al. (2004) generated mice deficient in GPR91 by homologous recombination. Mice homozygous for the targeted allele of GPR91 were viable and had no discernable abnormal phenotype. Baseline blood pressure was similar in wildtype and knockout mice; however, succinate could no longer induce hypertension in GPR91- deficient mice, hi contrast, angiotensin-2 increased blood pressure similarly in wildtype and GPR91 -deficient mice, indicating that the hypertensive effects of succinate might be mediated by GPR91.
DEFINITIONS
AGONIST shall mean material, for example, a ligand or candidate compound, that activates an intracellular response when it binds to the receptor. An intracellular response can be, for example, enhancement of GTP binding to membranes or modulation of the level of a second messenger such as cAMP or IP3. hi some embodiments, an AGONIST is material not previously known to activate the intracellular response when it binds to the receptor (for example, to enhance GTP^S binding to membranes or to lower intracellular cAMP level), hi some embodiments, an AGONIST is material not previously known to effect hematopoiesis. The term AGONIST also includes PARTIAL AGONISTS which are materials, for example, ligands or candidate compounds, which activate the intracellular response when they bind to the receptor to a lesser degree or extent than do full agonists. ANTAGONIST shall mean material, for example, ligands or candidate compounds that competitively bind to the receptor at the same site as an agonist but which does not activate an intracellular response, and can thereby inhibit an intracellular response elicited by the agonist. An ANTAGONIST does not diminish the baseline intracellular response in the absence of an agonist. In some embodiments, an ANTAGONIST is material not previously known to compete with an agonist to inhibit a cellular response when it binds to the receptor (for example, wherein the cellular response is GTP7S binding to membranes or to the lowering of intracellular cAMP level).
CANDIDATE COMPOUND shall mean a molecule (for example, a chemical compound) that is amenable to a screening technique. The term candidate compound excludes any compound publicly known to bind to or interact with GPR91. Applicants are not aware of any compound (other than succinate) being publicly known to bind to or interact with GPR91, however if any such compound is known, the phrase "candidate compound" would specifically exclude such a compound. COMPOSITION shall mean a material comprising at least two compounds or two components; for example, a "Pharmaceutical Composition" is a Composition.
COMPOUND EFFICACY shall mean a measurement of the ability of a compound to inhibit or stimulate receptor functionality, as opposed to receptor binding affinity.
CONTACT or CONTACTING shall mean bringing at least two moieties together, whether in an in vitro system or an in vivo system.
EFFECTIVE AMOUNT means an amount of active compound or pharmaceutical composition that elicits the desired biological or medicinal response in a tissue, system, or individual that is being sought by the researcher or medical doctor or other clinician. For example, an effective dose can be an amount that can treat a hematopoietic disorder. Also, for example, an effective dose can be an amount that can prevent a hematopoietic disorder.
HEMATOPOIESIS means the process of formation, development, and/or differentiation of the formed elements of whole blood. This can occur in myeloid tissue, which is found in the bone marrow, and lymphatic tissue, such as lymph nodes or the spleen. All of the cellular components of the blood are derived from hematopoietic stem cells. There are many intermediate stages between the starting cell, the hemopoietic stem cell, and the finished mature blood cell. In the first step, the hematopoietic stem cell becomes either a lymphoid stem cell or a myeloid stem cell. The lymphoid stem cell divides to eventually give rise to a lymphoblast which becomes the B and T cell lymphocytes. The myeloid stem cell eventually gives rise to: an erythroblast, which becomes erythrocytes (red blood cells), a megakaryoblast, which becomes platelets (also called thrombocytes), and a myeloblast, which becomes granuloctytes and monocytes. The name given to the production of red blood cells is erythropoiesis. Platelet production is given the name thrombopoiesis, derived from thrombocyte, the other name for platelet. HEMATOPOIETIC DISORDER means a blood disorder. Hematological disorders include diseases of the blood and all its constituents as well as diseases of organs and tissues involved in the generation or degradation of blood constituents. In addition, hematopoietic disorders include situations where there is no hematopoietic deficit per se, but it would be advantageous to increase hematopoiesis, for example, in surgery patients to decrease the need for transfusions in patients at risk for perioperative transfusions, and for blood donors, for example, to increase platelet counts. A hematopoietic disorder can affect any blood cell component, for example, erythrocytes, platelets, lymphocytes, as well as any blood progenitor cell. Common hematopoietic disorders include, for example, anemia, neutropenia, leucopenia, cytopenia, and thrombocytopenias, such as idiopathic thrombocytopenic purpura, thrombotic thrombocytopenic purpura, and hemolytic-uremic syndrome. In addition, hematopoietic disorders include leukemia, lymphoma, myeloma, as well as disorders such as erythrocytosis and myeloproliferative disorders.
INHIBIT or INHIBITING, in relationship to the term "response" shall mean that a response is decreased or prevented in the presence of a compound as opposed to in the absence of the compound.
IN NEED OF PREVENTION OR TREATMENT as used herein refers to a judgment made by a caregiver (e.g. physician, nurse, nurse practitioner, etc. in the case of humans; veterinarian in the case of animals, including non-human mammals) that an individual or animal requires or will benefit from treatment. This judgment is made based on a variety of factors that are in the realm of a caregiver's expertise, but include the knowledge that the individual or animal is ill, or will be ill, as the result of a condition that is treatable by a compound of the invention.
INDIVIDUAL as used herein refers to any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, swine, cattle, sheep, horses, or primates, and most preferably humans.
MODULATE or MODULATING shall mean to refer to an increase or decrease in the amount, quality, response or effect of a particular activity, function or molecule. A GPR91 MODULATOR is an agent that modulates the GPR91 receptor. PHARMACEUTICAL COMPOSITION shall mean a composition comprising at least one compound and a pharmaceutically acceptable carrier. For example, a pharmaceutical composition can comprise at least one active ingredient, whereby the composition is amenable to investigation for a specified, efficacious outcome in an animal (for example, a mammal such as a human). Those of ordinary skill in the art will understand and appreciate the techniques appropriate for determining whether an active ingredient has a desired efficacious outcome based upon the needs of the artisan.
RECEPTOR FUNCTIONALITY shall refer to the normal operation of a receptor to receive a stimulus and moderate an effect in the cell, including, but not limited to regulating gene transcription, regulating the influx or efflux of ions, effecting a catalytic reaction, and/or modulating activity through G-proteins. A GPR91 functionality can be, for example, binding a G-protein such as Gi or Gq, signaling through a second messenger such as IP3 or MAPK, binding to a GPR91 antibody, binding to succinate, or regulating blood cell levels in vivo. SECOND MESSENGER shall mean an intracellular response produced as a result of receptor activation. A second messenger can include, for example, inositol triphosphate (IP3), diacylglycerol (DAG), cyclic AMP (cAMP), cyclic GMP (cGMP), and Ca2+. Second messenger response can be measured for a determination of receptor activation. In addition, second messenger response can be measured for the direct identification of candidate compounds, including for example, inverse agonists, partial agonists, agonists, and antagonists.
The invention relates to a method for identifying a compound that regulates hematopoiesis, comprising:a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is modified, wherein a modification in GPR91 functionality is indicative of the candidate compound being a compound that stimulates hematopoiesis. In addition, the invention relates to a method for identifying a compound that regulates erythropoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is modified, wherein a modification in GPR91 functionality is indicative of the candidate compound being a compound that stimulates erythropoiesis. The invention further relates to a method for identifying a compound that regulates thrombopoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is modified, wherein a modification in GPR91 functionality is indicative of the candidate compound being a compound that stimulates thrombopoiesis.
As used herein, "GPR91" refers to a polypeptide with the amino acid sequence as encoded by GenBank Accession No. NP l 49039, or an isoform, variant or ortholog of this sequence that retains at least one function of the wild-type polypeptide.
It is understood that limited variations or modifications to GPR91 can be made without destroying its function. For example, GPR91 is intended to include other GPR91 polypeptides, for example, mammalian species orthologs of the human GPR91 polypeptide. The sequences of species orthologs of human GPR91 are present in the database, for example, a mouse ortholog of GPR91 can be found in GenBank at Accession No. NP_115776 and a rat ortholog of GPR91 can be found in GenBank at Accession No. NP 001001518. In addition, GPR91 includes variants such as allelic variants, splice variants and conservative amino acid substitution variants of GPR91. For example, GPR91 includes variants that retain substantially a GPR91 function of the entire GPR91 polypeptide such as, for example, binding a G-protein, signaling through a second messenger such as IP3, binding to a GPR91 antibody, binding to succinate, or increasing erythrocyte or platelet levels in vivo.
Conservative and non-conservative amino acid changes, gaps, and insertions to an amino acid sequence can be compared to a reference sequence using available algorithms and programs such as the Basic Local Alignment Search Tool ("BLAST") using default settings [See, e.g., Karlin and Altschul, Proc Natl Acad Sci USA (1990) 87:2264-8; Altschul et al., J MoI Biol (1990) 215:403-410; Altschul et al., Nature Genetics (1993) 3:266-72; and Altschul et al., Nucleic Acids Res (1997) 25:3389-3402]. It is understood that a fragment of GPR91 which retains substantially a function of the entire polypeptide is included in the definition. For example, a signal generating domain of GPR91 or a compound binding domain of GPR91 can be used in lieu of the entire polypeptide. In addition, GPR91 can contain heterologous sequences such as an epitiope tag or other fused polypeptide. Further, GPR91 can contain a label, for example, a radiolabel, fluorescent label or enzymatic label.
In one embodiment, the methods of the invention can be applied using a polypeptide comprising 99%, 98%, 95%, 92%, 90%, 85%, 80%, 75%, or 70% sequence identity to the human GPR91 sequence. In some embodiments, said variant of GPR91 is a non-endogenous, constitutively activated mutant of GPR91. In one embodiment, said GPR91 is derived from a mammal. In another embodiment, said GPR91 is human.
In certain embodiments, said GPR91 is recombinant. In certain embodiments, said contacting comprises contacting with a host cell or with membrane of a host cell that expresses the GPCR, wherein the host cell comprises an expression vector comprising a polynucleotide encoding the receptor. In some embodiments, said contacting is carried out in the presence of a known agonist of the GPCR such as succinate.
The invention provides a method for identifying a compound that stimulates hematopoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is increased, wherein an increase in GPR91 functionality is indicative of the candidate compound being a compound that stimulates hematopoiesis. In some embodiments, the GPR91 is human. In one embodiment, said compound that stimulates hematopoiesis is a GPR91 agonist. As described above, an agonist can also include, for example, a partial agonist. In some embodiments, the compound that stimulates hematopoiesis is a GPR91 agonist. hi some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 10 μM, of less than 1 μM, of less than 100 nM, or of less than 10 nM. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than a value selected from the interval of 1 nM to 10 μM. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than a value selected from the interval of 1 nM to 1 μM. hi some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than a value selected from the interval of 1 nM to 100 nM. hi some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than a value selected from the interval of 1 nM to 10 nM.
In certain embodiments, said EC50 is determined using an IP3 assay on a cell line that endogenously expresses GPR91. hi some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 10 μM, of less than 1 μM, of less than 100 nM, or of less than 10 nM in said assay, hi some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 10 μM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 9 μM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 8 μM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 7 μM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 6 μM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 5 μM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 4 μM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 3 μM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 2 μM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 1 μM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 900 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 800 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 700 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 600 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 500 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 400 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 300 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 200 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 100 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 90 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 80 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 70 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 60 nM in said assay, hi some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 50 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 40 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 30 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 20 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 of less than 10 nM in said assay. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 in said assay of less than a value selected from the interval of 1 nM to 10 μM. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 in said assay of less than a value selected from the interval of 1 nM to 1 μM. In some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 in said assay of less than a value selected from the interval of 1 nM to 100 nM. hi some embodiments, said compound that stimulates hematopoiesis is an agonist with an EC50 in said assay of less than a value selected from the interval of 1 nM to 10 nM. In some embodiments, said compound that stimulates hematopoiesis is selective for the GPCR. In some embodiments, said compound that stimulates hematopoiesis is orally bioavailable. In some embodiments, said oral bioavailability is at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, or at least 45% relative to intraperitoneal administration. In some embodiments, said oral bioavailablity is at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, or at least 45% relative to intraperitoneal administration, hi some embodiments, said orally bioavailable compound that stimulates hematopoiesis is further able to cross the blood-brain barrier.
The methods of the invention for identifying compounds (called screening methods in the art) can be performed using any of several techniques known in the art. For example, one skilled in the art can find a cell or cell line that endogenously expresses a receptor of interest and use that cell in a screening protocol. One type of screening assay involves finding compounds that bind to the receptor of interest. Often binding assays use displacement of a known binding compound, such as a radio-labeled ligand for the receptor, as an assay for screening for candidate compounds that bind to the receptor. Other assays look for changes in the level of second messengers as an indication that a candidate compound modulates a receptor. Several screening assays are known in the art and examples of screening assays are provided herein (see Examples 10-17). In one embodiment, said determining comprises a second messenger assay. The initiation of an intracellular signal can be determined, for example, through the measurement of the level of a second messenger such as cyclic AMP (cAMP), cyclic GMP (cGMP), inositol triphosphate (IP3), diacylglycerol (DAG), MAP kinase, or calcium. Several assays are well known in the art and disclosed herein for measuring these second messengers, for example, cAMP assays, EP3 assays, the FLIPR assay, the melanophore assay, or CRE-reporter assay. In certain embodiments, said second messenger IP3. In other embodiments, said second messenger is MAPK.
As stated above, receptor functionality refers to the normal operation of a receptor to receive a stimulus and moderate an effect in the cell, including, but not limited to regulating gene transcription, regulating the influx or efflux of ions, effecting a catalytic reaction, and/or modulating activity through G-proteins. A GPR91 functionality can be, for example, binding a G-protein such as Gi or Gq, signaling through a second messenger such as IP3 or MAPK, specifically binding to a GPR91 antibody, or regulating blood cell levels in vivo.
In all the methods of the invention, in certain embodiments, said candidate compound is not a polypeptide or peptide. In all the methods of the invention, in certain embodiments, said candidate compound is not an antibody or antigen-binding derivative thereof. The invention also provides methods that further comprise preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier. For example, the invention provides a method for preparing a pharmaceutical composition by combining a pharmaceutically acceptable carrier with a compound that stimulates hematopoiesis where the compound that stimulates hematopoiesis is identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased.
A compound identified by a method of the present invention can be formulated into a pharmaceutical composition using techniques well known to those in the art. Suitable pharmaceutically-acceptable carriers, outside those mentioned herein, are available to those in the art; for example, see Remington's Pharmaceutical Sciences, 16l Edition, 1980, Mack Publishing Co., (Oslo et al., eds.).
While it is possible that, for use in the prophylaxis or treatment, a compound of the invention can in an alternative use be administered as a raw or pure chemical, it can be useful to present the compound or active ingredient as a pharmaceutical formulation or composition further comprising a pharmaceutically acceptable carrier.
The invention thus further provides pharmaceutical formulations comprising a compound identified by a method of the invention or a pharmaceutically acceptable salt or derivative thereof together with one or more pharmaceutically acceptable carriers thereof and/or prophylactic ingredients. The carrier(s) must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not overly deleterious to the recipient thereof.
Pharmaceutical formulations include those suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), vaginal or parenteral (including intramuscular, subcutaneous and intravenous) administration or in a form suitable for administration by inhalation or insufflation.
A compound identified by a method of the invention, together with a conventional adjuvant, carrier, or diluent, can thus be placed into the form of pharmaceutical formulations and unit dosages thereof, and in such form can be employed as solids, such as tablets or filled capsules, or liquids such as solutions, suspensions, emulsions, elixirs, gels or capsules filled with the same, all for oral use, in the form of suppositories for rectal administration; or in the form of sterile injectable solutions for parenteral (including subcutaneous) use. Such pharmaceutical compositions and unit dosage forms thereof can comprise conventional ingredients in conventional proportions, with or without additional active compounds or principles, and such unit dosage forms can contain any suitable effective amount of the active ingredient commensurate with the intended daily dosage range to be employed.
For oral administration, the pharmaceutical composition can be in the form of, for example, a tablet, capsule, suspension or liquid. The pharmaceutical composition can be made in the form of a dosage unit containing a particular amount of the active ingredient. Examples of such dosage units are capsules, tablets, powders, granules or a suspension, with conventional additives such as lactose, mannitol, corn starch or potato starch; with binders such as crystalline cellulose, cellulose derivatives, acacia, corn starch or gelatins; with disintegrators such as corn starch, potato starch or sodium carboxymethyl-cellulose; and with lubricants such as talc or magnesium stearate. The active ingredient can also be administered by injection as a composition wherein, for example, saline, dextrose or water can be used as a suitable pharmaceutically acceptable carrier. The dose when using the compounds identified by the methods of the invention can vary within wide limits, and as is customary and is known to the physician, it is to be tailored to the individual conditions in each individual case. It depends, for example, on the nature and severity of the illness to be treated, on the condition of the patient, on the compound employed or on whether an acute or chronic disease state is treated or prophylaxis is conducted or on whether further active compounds are administered in addition to the compounds identified by the methods of the invention. Representative doses of the present invention include, about 0.01 mg to about 1000 mg, about 0.01 to about 750 mg, about 0.01 to about 500 mg, 0.01 to about 250 mg, 0.01 mg to about 200 mg, about 0.01 mg to 150 mg, about 0.01 mg to about 100 mg, and about 0.01 mg to about 75 mg. Multiple doses can be administered during the day, especially when relatively large amounts are deemed to be needed, for example 2, 3 or 4, doses. If appropriate, depending on individual behavior and as appropriate from the patients physician or care-giver it can be necessary to deviate upward or downward from the daily dose.
The amount of active ingredient, or an active salt or derivative thereof, required for use in treatment will vary not only with the particular salt selected but also with the route of administration, the nature of the condition being treated and the age and condition of the patient and will ultimately be at the discretion of the attendant physician or clinician. In general, one skilled in the art understands how to extrapolate in vivo data obtained in a model system, typically an animal model, to another, such as a human. Typically, animal models include, but are not limited to, the busulfan mouse model of myelosuppression as described in Example 9. In some circumstances, these extrapolations can merely be based on the weight of the animal model in comparison to another, such as a mammal, for example, a human, however, more often, these extrapolations are not simply based on weights, but rather incorporate a variety of factors. Representative factors include the type, age, weight, sex, diet and medical condition of the patient, the severity of the disease, the route of administration, pharmacological considerations such as the activity, efficacy, pharmacokinetic and toxicology profiles of the particular compound employed, whether a drug delivery system is utilized, on whether an acute or chronic disease state is being treated or prophylaxis is conducted or on whether further active compounds are administered in addition to the compounds identified by the methods of the invention and as part of a drug combination. The dosage regimen for treating a disease condition with the compounds and/or compositions of this invention is selected in accordance with a variety factors as cited above. Thus, the actual dosage regimen employed can vary widely and therefore can deviate from a preferred dosage regimen and one skilled in the art will recognize that dosage and dosage regimen outside these typical ranges can be tested and, where appropriate, can be used in the methods of this invention.
The desired dose can conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example, as two, three, four or more sub- doses per day. The sub-dose itself can be further divided, e.g., into a number of discrete loosely spaced administrations. The daily dose can be divided, especially when relatively large amounts are administered as deemed appropriate, into several, for example 2, 3 or 4, part administrations. If appropriate, depending on individual behavior, it can be necessary to deviate upward or downward from the daily dose indicated. The invention provides a compound that stimulates hematopoiesis identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased. The invention also provides a pharmaceutical composition comprising, consisting essentially of, or consisting of said compound.
The invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that stimulates hematopoiesis identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased. A hematopoietic disorder can also include situations where there is no hematopoietic deficit per se, but it would be advantageous to increase hematopoiesis, for example, in surgery patients to decrease the need for transfusions in patients at risk for perioperative transfusions, and for blood donors, for example, to increase platelet counts. In some embodiments, said hematopoietic disorder is anemia, thrombocytopenia, neutropenia, leukopenia, cytopenia, or idiopathic thrombocytopenic purpura. In one embodiment, said hematopoietic disorder is anemia. In another embodiment, said hematopoietic disorder is thrombocytopenia
The invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of an agent used to stimulate hematopoiesis in combination with an effective amount of the pharmaceutical composition comprising a compound that stimulates hematopoiesis identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased. Agents used to stimulate hematopoiesis include, for example, erythropoietin (epo) and colony stimulating factors such as granulocyte colony stimulating factor (G-CSF).
Cancer treatment often results in chemotherapy-induced anemia. Epo is currently in use for the treatment of chemotherapy-induced anemia; however, epo can be ineffective for some patients or have undesirable side-effects for certain patients. The invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of an agent used for the treatment of cancer in combination with an effective amount of the pharmaceutical composition comprising a compound that stimulates hematopoiesis identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased. In one embodiment, the individual is a mammal. In another embodiment, the individual is a human.
As used herein the term "treating" in reference to a disorder means a reduction in severity of one or more symptoms associated with a particular disorder. Therefore, treating a disorder does not necessarily mean a reduction in severity of all symptoms associated with a disorder and does not necessarily mean a complete reduction in the severity of one or more symptoms associated with a disorder. Similarly, the term "preventing" means prevention of the occurrence or onset of one or more symptoms associated with a particular disorder and does not necessarily mean the complete prevention of a disorder. The methods of the invention can be used to treat a hematopoietic disorder including, for example, anemia, thrombocytopenia, erythrocytosis or a myeloproliferative disorder.
The invention provides a method for identifying a compound that stimulates erythropoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is increased, wherein an increase in
GPR91 functionality is indicative of the candidate compound being a compound that stimulates erythropoiesis. In some embodiments, the compound that stimulates erythropoiesis is a GPR91 agonist. In some embodiments, the compound that stimulates erythropoiesis is a GPR91 partial agonist. In some embodiments, the GPR91 is human. In some embodiments, determining comprises a second messenger assay.
The invention also provides a method for identifying a compound that stimulates thrombopoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is increased, wherein an increase in
GPR91 functionality is indicative of the candidate compound being a compound that stimulates thrombopoiesis. In some embodiments, the compound that stimulates thrombopoiesis is a GPR91 agonist. In some embodiments, the compound that stimulates thrombopoiesis is a GPR91 partial agonist. In some embodiments, the GPR91 is human. In some embodiments, determining comprises a second messenger assay.
The invention also includes, for example, a method for identifying a compound that stimulates erythropoiesis and thrombopoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is increased, wherein an increase in GPR91 functionality is indicative of the candidate compound being a compound that stimulates erythropoiesis and thrombopoiesis. In some embodiments, the compound that stimulates erythropoiesis and thrombopoiesis is a GPR91 agonist. In some embodiments, the compound that stimulates erythropoiesis and thrombopoiesis is a GPR91 partial agonist. In some embodiments, the GPR91 is human. In some embodiments, determining comprises a second messenger assay. In addition, pharmaceutical compositions can be prepared by combining at least one pharmaceutically acceptable carrier with a compound that stimulates erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased. The invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that stimulates erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased. In some embodiments, said hematopoietic disorder is anemia, thrombocytopenia, neutropenia, leukopenia, cytopenia, or idiopathic thrombocytopenic purpura. In one embodiment, said hematopoietic disorder is anemia. In another embodiment, said hematopoietic disorder is thrombocytopenia. For example, the invention provides a method for increasing red blood cell levels in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that stimulates hematopoiesis or erythropoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased. In addition, for example, the invention provides a method for increasing platelet levels in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that stimulates hematopoiesis or thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased. Further, for example, the invention provides a method for increasing hematopoietic progenitor cell levels in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that stimulates hematopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased.
The invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of an agent used to stimulate hematopoiesis in combination with an effective amount of the pharmaceutical composition comprising a compound that stimulates erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased.
The invention further provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of an agent used for the treatment of cancer in combination with an effective amount of the pharmaceutical composition comprising a compound that stimulates erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased. In one embodiment, the individual is a mammal. In another embodiment, the individual is a human.
The invention provides a compound that stimulates erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased. The invention also provides a pharmaceutical composition comprising, consisting essentially of, or consisting of said compound.
The invention also provides a method for the manufacture of a medicament comprising a compound that stimulates hematopoiesis, erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased, for use as a hematopoietic agent, hi addition, the invention provides a method for the manufacture of a medicament comprising a compound that stimulates hematopoiesis, erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased, for use in the treatment of a blood disorder. Further, the invention provides use of a compound that stimulates hematopoiesis, erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is increased, for the manufacture of a medicament for treating or preventing a blood disorder in an individual. The invention also provides the use of said compound with an agent used to stimulate hematopoiesis. The invention further provides the use of said compound with an agent used for the treatment of cancer, hi one embodiment, said blood disorder is anemia. In another embodiment, said blood disorder is thrombocytopenia.
The invention provides a method for identifying a compound that reduces hematopoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is decreased, wherein a decrease in GPR91 functionality is indicative of the candidate compound being a compound that reduces hematopoiesis. In some embodiments, the GPR91 is human.
In one embodiment, said compound that reduces hematopoiesis is a GPR91 antagonist.
In another embodiment, the compound that reduces hematopoiesis is a GPR91 inverse agonist. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 10 μM, of less than 1 μM, of less than 100 nM, or of less than 10 nM. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than a value selected from the interval of 1 nM to 10 μM. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than a value selected from the interval of 1 nM to 1 μM. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than a value selected from the interval of 1 nM to 100 nM. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than a value selected from the interval of 1 nM to 10 nM.
In certain embodiments, said IC50 is determined using an IP3 assay on a cell line that endogenously expresses GPR91. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 10 μM, of less than 1 μM, of less than 100 nM, or of less than 10 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 10 μM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 9 μM in said assay. In some embodiments, said compound that reduces hematopoiesis is an inverse antagonist or inverse agonist or an antagonist or inverse agonist with an IC50 of less than 8 μM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 7 μM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 6 μM in said assay, In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 5 μM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 4 μM in said assay, hi some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 3 μM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 2 μM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 1 μM in said assay, hi some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 900 nM in said assay, hi some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 800 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 700 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 600 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 500 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 400 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 300 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 200 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 100 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 90 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 80 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 70 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 60 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 50 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 40 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 30 nM in said assay, hi some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 20 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 of less than 10 nM in said assay. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 in said assay of less than a value selected from the interval of 1 nM to 10 μM. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 in said assay of less than a value selected from the interval of 1 nM to 1 μM. hi some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 in said assay of less than a value selected from the interval of 1 nM to 100 nM. In some embodiments, said compound that reduces hematopoiesis is an antagonist or inverse agonist with an IC50 in said assay of less than a value selected from the interval of 1 nM to 10 nM. In some embodiments, said compound that reduces hematopoiesis is selective for the GPCR.
In some embodiments, said compound that reduces hematopoiesis is orally bioavailable. In some embodiments, said oral bioavailability is at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, or at least 45% relative to intraperitoneal administration. In some embodiments, said oral bioavailablity is at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, or at least 45% relative to intraperitoneal administration. In some embodiments, said orally bioavailable compound that reduces hematopoiesis is further able to cross the blood-brain barrier.
In one embodiment, said determining comprises a second messenger assay. In certain embodiments, said second messenger IP3. hi other embodiments, said second messenger is MAPK.
In all the methods of the invention, in certain embodiments, said candidate compound is not a polypeptide or peptide, hi all the methods of the invention, in certain embodiments, said candidate compound is not an antibody or antigen-binding derivative thereof.
The invention also provides methods that further comprise preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier. For example, the invention provides a method for preparing a pharmaceutical composition by combining a pharmaceutically acceptable carrier with a compound that reduces hematopoiesis where the compound that reduces hematopoiesis is identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased. A compound identified by a method of the present invention can be formulated into a pharmaceutical composition using techniques well known to those in the art. While it is possible that, for use in the prophylaxis or treatment, a compound of the invention can in an alternative use be administered as a raw or pure chemical, it can be useful to present the compound or active ingredient as a pharmaceutical formulation or composition further comprising a pharmaceutically acceptable carrier.
The invention thus further provides pharmaceutical formulations comprising a compound identified by a method of the invention or a pharmaceutically acceptable salt or derivative thereof together with one or more pharmaceutically acceptable carriers thereof and/or prophylactic ingredients. The invention provides a compound that reduces hematopoiesis identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased. The invention also provides a pharmaceutical composition comprising, consisting essentially of, or consisting of said compound. The invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that reduces hematopoiesis identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased. In one embodiment, said hematopoietic disorder is erythrocytosis, a myeloproliferative disorder, essential thrombocythemia, post-transplant erythrocytosis, or polycythemia vera . In one embodiment, said hematopoietic disorder is erythrocytosis. In another embodiment, said hematopoietic disorder is a myeloproliferative disorder.
The invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of an agent used for decreasing hematopoiesis in combination with an effective amount of the pharmaceutical composition comprising a compound that reduces hematopoiesis identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased. AB agent used for decreasing hematopoiesis can include, for example, a chemotherapeutic agent, radiation, or a compound such as anagrelide.
In one embodiment, the individual is a mammal. In another embodiment, the individual is a human.
The invention provides a method for identifying a compound that reduces erythropoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is decreased, wherein a decrease in GPR91 functionality is indicative of the candidate compound being a compound that reduces erythropoiesis. hi some embodiments, the compound that reduces erythropoiesis is a GPR91 antagonist, hi some embodiments, the compound that reduces erythropoiesis is a GPR91 inverse agonist. In some embodiments, the GPR91 is human, hi some embodiments, determining comprises a second messenger assay.
The invention also provides a method for identifying a compound that reduces thrombopoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is decreased, wherein a decrease in GPR91 functionality is indicative of the candidate compound being a compound that reduces thrombopoiesis. In some embodiments, the compound that reduces thrombopoiesis is a GPR91 antagonist. In some embodiments, the compound that reduces thrombopoiesis is a GPR91 inversel agonist. In some embodiments, the GPR91 is human. In some embodiments, determining comprises a second messenger assay.
The invention also includes, for example, a method for identifying a compound that reduces erythropoiesis and thrombopoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is decreased, wherein a decrease in GPR91 functionality is indicative of the candidate compound being a compound that reduces erythropoiesis and thrombopoiesis. In some embodiments, the compound that reduces erythropoiesis and thrombopoiesis is a GPR91 antagonist. In some embodiments, the compound that reduces erythropoiesis and thrombopoiesis is a GPR91 inverse agonist. In some embodiments, the GPR91 is human. In some embodiments, determining comprises a second messenger assay.
In addition, pharmaceutical compositions can be prepared by combining at least one pharmaceutically acceptable carrier with a compound that reduces erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased.
The invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that reduces erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91 , and determining whether GPR91 functionality is decreased. In one embodiment, said hematopoietic disorder is erythrocytosis, a myeloproliferative disorder, essential thrombocythemia, post-transplant erythrocytosis, or polycythemia vera . In one embodiment, said hematopoietic disorder is erythrocytosis. In another embodiment, said hematopoietic disorder is a myeloproliferative disorder.
For example, the invention provides a method for decreasing red blood cell levels in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that reduces hematopoiesis or erythropoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased. In addition, for example, the invention provides a method for decreasing platelet levels in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that reduces hematopoiesis or thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased. Further, for example, the invention provides a method for decreasing hematopoietic progenitor cell levels in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition comprising a compound that reduces hematopoiesis, identified by contacting a candidate compound with GPR91 , and determining whether GPR91 functionality is decreased.
The invention also provides a method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of an agent used for decreasing hematopoiesis in combination with an effective amount of the pharmaceutical composition comprising a compound that reduces erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased.
In one embodiment, the individual is a mammal. In another embodiment, the individual is a human.
The invention provides a compound that reduces erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased. The invention also provides a pharmaceutical composition comprising, consisting essentially of, or consisting of said compound.
The invention also provides a method for the manufacture of a medicament comprising a compound that reduces hematopoiesis, erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased, for use as a hematopoietic agent. In addition, the invention provides a method for the manufacture of a medicament comprising a compound that reduces hematopoiesis, erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased, for use in the treatment of a blood disorder. Further, the invention provides use of a compound that reduces hematopoiesis, erythropoiesis, thrombopoiesis, or erythropoiesis and thrombopoiesis, identified by contacting a candidate compound with GPR91, and determining whether GPR91 functionality is decreased, for the manufacture of a medicament for treating or preventing a blood disorder in an individual. The invention further provides the use of said compound with an agent used for decreasing hematopoiesis. In one embodiment, said blood disorder is erythrocytosis. In another embodiment, said blood disorder is a myeloproliferative disorder.
The invention also relates to a method for increasing GPR91 function in a cell, comprising contacting a cell expressing GPR91 with an effective amount of a compound identified according to the method of: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is increased, wherein an increase in GPR91 functionality is indicative of the candidate compound being a compound that increases GPR91 function in a cell One object of the invention relates to a method of a) performing a method of the invention to identify a compound that stimulates hematopoiesis and (b) optionally, determining the structure of the compound, and (c) providing the compound or the name or structure of the compound. In addition, the invention relates to a method of a) performing a method of the invention to identify a compound that stimulates hematopoiesis and (b) optionally, determining the structure of the compound, (c) optionally, providing the name or structure of the compound, and (d) producing or synthesizing the compound. The invention further relates to a process for modulating the functionality of a GPCR comprising performing a method of the invention to identify a compound that stimulates hematopoiesis and then contacting the GPCR with the compound that stimulates hematopoiesis or administering compound that stimulates hematopoiesis to an individual under conditions sufficient to modulate the functionality of the GPCR
.Another object of the invention relates to a method of a) performing a method of the invention to identify a compound that reduces hematopoiesis and (b) optionally, determining the structure of the compound, and (c) providing the compound or the name or structure of the compound. In addition, the invention relates to a method of a) performing a method of the invention to identify a compound that reduces hematopoiesis and (b) optionally, determining the structure of the compound, (c) optionally, providing the name or structure of the compound, and (d) producing or synthesizing the compound. The invention further relates to a process for modulating the functionality of a GPCR comprising performing a method of the invention to identify a compound that reduces hematopoiesis and then contacting the GPCR with the compound that reduces hematopoiesis or administering compound that reduces hematopoiesis to an individual under conditions sufficient to modulate the functionality of the GPCR.
Another object of the present invention relates to radio-labeled compounds identified by a method of the invention that would be useful not only in radio-imaging but also in assays, both in vitro and in vivo, for localizing and quantitating GPR91 in tissue samples, including human, and for identifying GPR91 ligands by inhibition binding of a radiolabeled compound. It is a further object of this invention to develop novel GPR91 assays of which comprise such radiolabeled compounds.
Suitable radionuclides that can be incorporated in compounds of the present invention include but are not limited to 3H (also written as T), 11C, 14C, 18F, 125I, 82Br, 1231, 1241, 1251, 1311, 75Br, 76Br, 150, 13N, 35S and 77Br. The radionuclide that is incorporated in the instant radiolabeled compounds will depend on the specific application of that radiolabeled compound. Thus, for in vitro GPR91 labeling and competition assays, compounds that incorporate 3H, 14C, 1251 , 1311, 35S or 82Br will generally be most useful. For radio-imaging applications 11C, 18F, 1251, 123I, 1241, 131I,. 75Br, 76Br or 77Br will generally be most useful.
It is understood that a "radio-labeled " or "labeled compound" is a compound identified by a method of the invention that has incorporated at least one radionuclide; in some embodiments the radionuclide is selected from the group consisting of 3H, 14C, 1251 , 35S and 82Br; in some embodiments the radionuclide 3H or 14C. Moreover, it should be understood that all of the atoms represented in the compounds of the invention can be either the most commonly occurring isotope of such atoms or the more scarce radio-isotope or nonradio-active isotope.
Synthetic methods for incorporating radio-isotopes into organic compounds including those applicable to those compounds of the invention are well known in the art and include incorporating activity levels of tritium into target molecules include:
A. Catalytic Reduction with Tritium Gas - This procedure normally yields high specific activity products and requires halogenated or unsaturated precursors.
B. Reduction with Sodium Borohydride [3H] - This procedure is rather inexpensive and requires precursors containing reducible functional groups such as aldehydes, ketones, lactones, esters, and the like. C. Reduction with Lithium Aluminum Hydride [3H ] - This procedure offers products at almost theoretical specific activities. It also requires precursors containing reducible functional groups such as aldehydes, ketones, lactones, esters, and the like. D. Tritium Gas Exposure Labeling - This procedure involves exposing precursors containing exchangeable protons to tritium gas in the presence of a suitable catalyst. E. N-Methylation using Methyl Iodide [3H] - This procedure is usually employed to prepare O-methyl or N-methyl (3H) products by treating appropriate precursors with high specific activity methyl iodide (3H). This method in general allows for high specific activity, such as about 80-87 Ci/mmol.
Synthetic methods for incorporating activity levels of 125I into target molecules include: A. Sandmeyer and like reactions - This procedure transforms an aryl or heteroaryl amine into a diazonium salt, such as a tetrafluoroborate salt, and subsequently to 125I labelled compound using Na125I. A represented procedure was reported by Zhu, D.-G. and co-workers in J. Ore. Chem. 67:943-948 (2002)). B. Ortho 125Iodination of phenols - This procedure allows for the incorporation of 125I at the ortho position of a phenol as reported by Collier, T. L. and co-workers in J. Labelled Compd Radiopharm. , 42: S264-S266 (1999)). C. Aryl and heteroaryl bromide exchange with 125I - This method is generally a two step process. The first step is the conversion of the aryl or heteroaryl bromide to the corresponding tri-alkyltin intermediate using for example, a Pd catalyzed reaction [i.e. Pd(Ph3P)4] or through an aryl or heteroaryl lithium, in the presence of a tri-alkyltinhalide or hexaalkylditin [e.g., (CH3)3SnSn(CH3)3]. A represented procedure was reported by Bas, M.-D. and co-workers in J. Labelled Compd Radiopharm.. 44:S280-S282 (2001)). A radiolabeled GPR91 compound identified by a method of the invention can be used in a screening assay to identify/evaluate compounds. In general terms, a newly synthesized or identified compound (i.e., candidate compound) can be evaluated for its ability to reduce binding of the "radio-labeled compound identified by a method of the invention" to the GPR91 receptor. Accordingly, the ability of a candidate compound to compete with the "radio-labeled compound identified by a method of the invention" for the binding to the GPR91 receptor directly correlates to its binding affinity.
One object of the invention relates to a method of identifying whether a candidate compound binds to a GPR91 receptor comprising the steps of: (a) contacting the receptor with a detectably labeled known ligand of the receptor (i.e. succinate) in the presence or absence of the candidate compound; and (b) determining whether the binding of said labeled known ligand to the receptor is inhibited in the presence of the candidate compound; wherein said inhibition is indicative of the candidate compound binding to the GPR91 receptor, hi one embodiment, said contacting comprises contacting with a host cell or with membrane of a host cell that expresses the GPCR, wherein said host cell comprises an expression vector comprising a polynucleotide encoding the receptor.
Another object of the invention relates to a method for detecting a ligand that binds to a GPR91 receptor, comprising the steps of: (a) contacting a test ligand with a host cell or with membrane of a host cell that expresses said receptor, under conditions which permit interaction between said receptor and said test ligand; and (b) detecting a ligand bound to said receptor, hi one embodiment, said contacting comprises contacting with a host cell or with membrane of a host cell that expresses the GPCR, wherein said host cell comprises an expression vector comprising a polynucleotide encoding the receptor.
Applicants reserve the right to exclude any one or more candidate compounds from any of the embodiments of the invention. Applicants also reserve the right to exclude any one or more modulators from any of the embodiments of the invention. Applicants additionally reserve the right to exclude any hematopoietic disorder from any of the embodiments of the invention.
Other uses of the disclosed receptors and methods will become apparent to those in the art based upon, inter alia, a review of this patent document.
The following examples are given to illustrate the invention and are not intended to be inclusive in any manner:
EXAMPLES
The examples are provided to further define the invention without, however, limiting the invention to the specifics of these examples. Example 1
Affymetrix chip expression of human GPR91
In this example, the expression level of human GPR91 was determined in several human cell types and tissues using an Affymetrix GeneChip®.
1. AFFYMETRIX GENECHIP® TECHNOLOGY
Nucleotide sequences corresponding to several G protein-coupled receptors (GPCRs) were submitted to Affymetrix. Affymetrix designed and manufactured an oligonucleotide microarray for the purpose of measuring mRNA expression levels of these receptors in various tissues via its GeneChip® Technology. RNA samples from a large number of tissue and cell types, including human brain sub-regions (Harvard Brain Bank), human cell lines (Axiom) and peripheral tissues, were amplified, labeled, hybridized to the microarray, and data analyzed according to manufacturer's instructions. GPCRs were determined to be expressed if the expression index was greater than
50 (based upon and according to manufacturer's instructions). The data was analyzed and had indicated that classification of GPCRs with an expression index greater than 50 was reasonable because a number of known GPCRs had previously been reported to be expressed in neuronal tissues with an expression index greater than 50. Using the GeneChip®, Applicant has discovered GPR91 has high levels of expression in macrophage samples, kidney, hematopoietic progenitor cells and a cell line called AXM-35 (see Figure 1).
Example 2 Succinate-stimulated Proliferation of TF-I Cells is PTX Sensitive
In this example, the proliferation of TF-I cells in response to succinate was investigated.
TF-I cells were plated at 30,000 cells per a well in RPMI 1640/2% fetal bovine serum (FBS) and incubated overnight at 37°C/5% CO2. Where indicated in Figure 2, cells were treated with lOOng/ml of pertussis toxin (PTX) (Sigma) at the time of plating. After 14 hours, cells were then treated with the compounds indicated in Figure 2 and incubated for 48 hours. Using a colorimetric tetrazolium salt (MTS) proliferation assay (Celltiter 96, Promega), 40μl of MTS/PMS solution per 200 μl of cell suspension was added and incubated for 4 hours. Absorbance was read at 490nm using an ELISA plate reader.
As shown in Figure 2, succinate-stimulated proliferation of TF-I cells was sensitive to pertussis toxin.
Example 3
Succinate-stimulated IP3 Signaling in TF-I Cells is PTX Sensitive
In this example, IP3 accumulation in succinate-stimulated TF-I cells was investigated. TF-I cells were plated at 50,000 cells/well in inositol free media (Invitrogen) containing 0.4 μCi of 3H-myoinositol/well in a total of 100 μl per well using a round bottom 96-well plate. Pertussis toxin treatment at 100ng/ml was included where indicated in Figure 3. Cells were cultured overnight at 37°C/5% CO2.
The next day, the 3H-myoinositol containing media was removed and compounds of choice were diluted in inositol-free media containing 10μM pargyline and 1OmM LiCl and added to the cells. Cells were then incubated for 3 hours. The media was then removed and 200 μl of ice-cold 0.1 M formic acid was added. Cells were then lysed by putting the plate on dry ice until the media was completely frozen, then thawing the plate at 370C. While the plate was thawing, a total of 400 μl of formate was added to form a resin slurry/well (BioRad) and transferred to a MultiScreen plate
(Millipore). After the first 200 μl was added, drain using a vacuum manifold. Once a total of 400 μl of resin was added and drained, the resin was washed 3 times with 200 μl distilled water. The last wash was completely drained then the cell lysate was added to the resin and washed 5 times with distilled water. The sample was eluted to a 96-well collection plate with 200 μl of IM ammonium formate/0. IM formic acid. Then the eluate was transfered to vials containing 4 mis Optiphase Supermix (Perkin Elmer) and counted on a liquid scintillation counter.
As shown in Figure 3, succcinate-stimulated IP3 signaling in TF-I cells was sensitive to pertussis toxin
Example 4
Succinate-stimulated MAPK Activation in TF-I Cells is PTX Sensitive
In this example, MAP kinase activation in succinate-stimulated TF-I cells was investigated. TF-I cells were serum starved overnight in OptiMEM medium. Cells were then treated with the compounds indicated in Figure 4 and incubated for 10 minutes at 37°C. Cells were then washed with ice-cold PBS, scraped with 1 ml of ice-cold PBS and then spun at 3,000 rpm for 5 minutes. Supernatents were then analyzed using the Phospho ERK1/2 pTl 85 pTl 87 ELISA kit (Biosource) by following the manufacturer's protocol.
As shown in Figure 4, succinate-stimulated MAP kinase activation in TF-I cells was sensitive to pertussis toxin.
Example 5 MAPK and PI3-K are Required for Succinate-induced Proliferation of TF-I Cells
In this example, the role of MAP kinase and PI3 kinase in succinate-induced proliferation in TF-I cells was investigated.
TF-I cells were serum starved overnight in OptiMEM medium. Cells were pretreated with the pharmacological inhibitors indicated in Figure 5 for 30 minutes. Cells were then treated with compounds (EPO, succinated or vehicle) and incubated for
10 minutes at 37°C. Cells were then washed with ice-cold PBS, scraped with 1 ml of ice-cold PBS and then spun at 3,000 rpm for 5 minutes. Supernatants were then analyzed using the Phospho ERKl/2 pT185 pT187 ELISA kit (Biosource) by following the manufacturer's protocol. As shown in Figure 5, PD98059 (a MAP kinase inhibitor) and LY294002 (a PI3 kinase inhibitor) both inhibited succinate-induced proliferation in TF-I cells.
Example 6
FACS Analysis of Succinate-induced Expression in TF-I Cells In this example, the expression of CD41 on succinate-induced TF-I cells was analyzed by fluorescence activated cell sorting (FACS).
Cells were cultured and treated as indicated in the proliferation assay in Example
2. After 24 hours of treatment with the compounds indicated in Figure 6, cells were analyzed for expression of the megakaryocyte marker CD41 by FACS analysis. Cells were stained with PE-conjugated CD41 antibody and analyzed on an LSRII FACS analyzer (BD Biosciences). Data shown in Figure 6 are representative of three independent experiments.
As shown in Figure 6, CD41 expression in succinate-induced TF-I cells is sensitive to pertussis toxin. Example 7
Succinate Inhibits Serum Starvation-induced Apoptosis of Cultured TF-I Cells
In this example, the effect of succinate on serum starvation-induced apoptosis in TF-I cells was investigated.
Cells were cultured and treated as indicated in the proliferation assay in Example 2. After 48 hours of treatment with the compounds indicated in Figure 7 in the presence of low serum conditions (2% FBS), cell death was analyzed by FACS analysis. The percentage of cells undergoing apoptosis was assessed by staining with the nucleic acid dye 7-Amino-Actinomycin D (7- AAD, BD Biosciences) and analysis by FACS. Data shown in Figure 7 are representative of three independent experiments.
As shown in Figure 7, succinate inhibits serum starvation-induced apoptosis of cultured TF-I cells.
Example 8
GPR91 Specific siRNA Inhibits Succinate Stimulated TF-I Cell Proliferation hi this example, the effect of GPR91 specific siRNA on proliferation in succinate-stimulated TF-I cells was investigated.
TF-I cells were plated at 150,000 cells/well into a 6 well plate in RPMI 1640 media with 10% FBS. Cells were transfected with a pool of four siRNA sequences selective for GPR91 (Dharmacon, Chicago,IL) overnight. The sequence of the four siRNAs were as follows:
5 '-pCAAGUAUCGAUCUAUGCUGUU (SEQ ID NO: 1 ) 5 '-pAAAC AAC AAUGGUAUUUCCUU (SEQ ID NO: 2)
5'-PUUGAUGACGACCUGAGUGCUU (SEQ ED NO: 3) 5-pAAGGAUGUAAGGGAUUUGAUU (SEQ ID NO: 4)
Cells were then spun, resuspended in RPMI 1640 media with 2% FBS, and plated at 30,000 cell /well in a 96 well plate. After overnight incubation at 37°C/5% CO2, cell proliferation was assayed as described in Example 2.
As shown in Figure 8, a GPR91 -specific siRNA inhibited succinate-stimulated TF-I cell proliferation.
Example 9 Succinate Stimulates Platelet and Red Blood Cell Recovery in Myelosuppressed Mice In this example, the effect of succinate on platelet and red blood cell recovery in myelosuppressed mice was investigated.
Male Balb/C mice were administered the myelosuppresive chemotherapy agent busulfan (15mg/kg) on days 0 and 3. Thereafter, IL-11 (500ug/kg) reconstituted in saline with 0.25% BSA, or sodium succinate (lOmg/kg) reconstituted in saline, were injected daily for eight days. On day 17 complete blood cell analysis was performed.
Blood cell counts shown in Figure 9 are the mean +/- S.D. of 8 mice/group (* p<0.05).
As shown in Figure 9, succinate stimulats platelet and red blood cell recovery in myelosuppressed mice.
Example 10
Melanophore Screening Technology
In this example, a screening method for identifying compounds that stimulate or reduce hematopoiesis is described
1. Melanophore Technology
Melanophores are skin cells found in lower vertebrates. They contain pigmented organelles termed melanosomes. Melanophores are able to redistribute these melanosomes along a microtubule network upon G-protein coupled receptor (GPCR) activation. The result of this pigment movement is an apparent lightening or darkening of the cells. In melanophores, the decreased levels of intracellular cAMP that result from activation of a Gi-coupled receptor cause melanosomes to migrate to the center of the cell, resulting in a dramatic lightening in color. If cAMP levels are then raised, following activation of a Gs-coupled receptor, the melanosomes are re-dispersed and the cells appear dark again. The increased levels of diacylglycerol that result from activation of Gq-coupled receptors can also induce this re-dispersion. In addition, the technology is also suited to the study of certain receptor tyrosine kinases. The response of the melanophores takes place within minutes of receptor activation and results in a simple, robust color change. The response can be easily detected using a conventional absorbance microplate reader or a modest video imaging system. Unlike other skin cells, the melanophores derive from the neural crest and appear to express a full complement of signaling proteins, hi particular, the cells express an extremely wide range of G-proteins and so are able to functionally express almost all GPCRs. Melanophores can be utilized to identify compounds, including natural ligands, which bind to and/or activate GPCRs. This method can be conducted by introducing test cells of a pigment cell line capable of dispersing or aggregating their pigment in response to a specific stimulus and expressing an exogenous clone coding for the GPCR. An initial state of pigment disposition can be set using, for example, using melatonin, MSH or light. The test cells are then contacted with chemical compounds, and it is determined whether the pigment disposition in the cells changed from the initial state of pigment disposition. Dispersion of pigments cells due to the candidate compound, including but not limited to a ligand, coupling to the GPCR will appear dark on a petri dish, while aggregation of pigments cells will appear light.
Materials and methods were followed according to the disclosure of U.S. Patent Number 5,462,856 and U.S. Patent Number 6,051,386. These patent disclosures are hereby incorporated by reference in their entirety.
Melanophores are transfected by electroporation with a plasmid which contains the coding sequence of mouse GPR91. The cells are plated in 96-well plates. 48 hours post-transfection, half of the cells on each plate are treated with 1OnM melatonin. Melatonin activates an endogenous Gi-coupled receptor in the melanophores and causes them to aggregate their pigment. The remaining half of the cells are transferred to serum-free medium 0.7X L- 15 (Gibco). After one hour, the cells in serum-free media remain in a pigment-dispersed state while the melatonin-treated cells are in a pigment- aggregated state. At this point, the cells are treated with different compounds from a proprietary compound library containing 140,000-150,000 organic small molecule compounds. If GPR91 bound to the compound, the melanophores would be expected to undergo a color change in response to the compound. Since the receptor can couple to Gi, the pigment-dispersed cells would be expected to undergo a dose-dependent pigment aggregation.
Example 11
Assays for Determination of GPCR Activation A variety of approaches are available for assessment of activation of human
GPCRs. The following are illustrative; those of ordinary skill in the art are credited with the ability to determine those techniques that are preferentially beneficial for the needs of the artisan.
1. Membrane Binding Assays: [35S]GTPyS Assay When a G protein-coupled receptor is in its active state, either as a result of ligand binding or constitutive activation, the receptor couples to a G protein and stimulates the release of GDP and subsequent binding of GTP to the G protein. The alpha subunit of the G protein-receptor complex acts as a GTPase and slowly hydrolyzes the GTP to GDP, at which point the receptor normally is deactivated. Activated receptors continue to exchange GDP for GTP. The non-hydrolyzable GTP analog, [35S]GTPyS, can be utilized to demonstrate enhanced binding of [35S]GTPyS to membranes expressing activated receptors. The advantage of using [35S]GTPyS binding to measure activation is that: (a) it is generically applicable to all G protein-coupled receptors; (b) it is proximal at the membrane surface making it less likely to pick-up molecules which affect the intracellular cascade.
The assay utilizes the ability of G protein coupled receptors to stimulate [35S]GTPyS binding to membranes expressing the relevant receptors. The assay can, therefore, be used in the direct identification method to screen candidate compounds to endogenous GPCRs and non-endogenous, constitutively activated GPCRs. The assay is generic and has application to drug discovery at all G protein-coupled receptors.
The [35S]GTPyS assay is incubated in 20 mM HEPES and between 1 and about 2OmM MgCl2 (this amount can be adjusted for optimization of results, although 2OmM is preferred) pH 7.4, binding buffer with between about 0.3 and about 1.2 nM [35S]GTPyS (this amount can be adjusted for optimization of results, although 1.2 is preferred) and 12.5 to 75 μg membrane protein (e.g, 293 cells expressing the GPR91; this amount can be adjusted for optimization) and 10 μM GDP (this amount can be changed for optimization) for 1 hour. Wheatgerm agglutinin beads (25 μl; Amersham) are then added and the mixture incubated for another 30 minutes at room temperature. The tubes are then centrifuged at 1500 x g for 5 minutes at room temperature and then counted in a scintillation counter.
2. Adenylyl Cyclase
A Flash Plate™ Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) designed for cell-based assays can be modified for use with crude plasma membranes. The Flash Plate wells can contain a scintillant coating which also contains a specific antibody recognizing cAMP. The cAMP generated in the wells can be quantitated by a direct competition for binding of radioactive cAMP tracer to the cAMP antibody. The following serves as a brief protocol for the measurement of changes in cAMP levels in whole cells that express a receptor. Transfected cells are harvested approximately twenty four hours after transient transfection. Media is carefully aspirated off and discarded. 10ml of PBS is gently added to each dish of cells followed by careful aspiration. ImI of Sigma cell dissociation buffer and 3ml of PBS are added to each plate. Cells are pipetted off the plate and the cell suspension is collected into a 50ml conical centrifuge tube. Cells are then centrifuged at room temperature at 1,100 rpm for 5 minutes. The cell pellet is carefully re-suspended into an appropriate volume of PBS (about 3ml/plate). The cells are then counted using a hemocytometer and additional PBS is added to give the appropriate number of cells (with a final volume of about 50μl/well). cAMP standards and Detection Buffer (comprising lμCi of tracer [125I] cAMP
(50μl) to 1 ImI Detection Buffer) is prepared and maintained in accordance with the manufacturer's instructions. Assay Buffer is prepared fresh for screening and contains 50μl of Stimulation Buffer, 3μl of candidate compound (12μM final assay concentration) and 50μl cells. Assay Buffer is stored on ice until utilized. The assay, preferably carried out, for example, in a 96-well plate, is initiated by addition of 50μl of cAMP standards to appropriate wells followed by addition of 50μl of PBSA to wells Hl 1 and H12. 50μl of Stimulation Buffer is added to all wells. DMSO (or selected candidate compounds) is added to appropriate wells using a pin tool capable of dispensing 3μl of compound solution, with a final assay concentration of 12μM candidate compound and lOOμl total assay volume. The cells are then added to the wells and incubated for 60 minutes at room temperature. lOOμl of Detection Mix containing tracer cAMP is then added to the wells. Plates are then incubated additional 2 hours followed by counting in a Wallac MicroBeta scintillation counter. Values of cAMP/well are then extrapolated from a standard cAMP curve which is contained within each assay plate.
3. Cell-Based cAMP for Gi Coupled Target GPCRs TSHR is a Gs coupled GPCR that causes the accumulation of cAMP upon activation. TSHR can be constitutively activated by mutating amino acid residue 623 (i.e., changing an alanine residue to an isoleucine residue). A Gi coupled receptor is expected to inhibit adenylyl cyclase, and, therefore, decrease the level of cAMP production, which can make assessment of cAMP levels challenging. An effective technique for measuring the decrease in production of cAMP as an indication of activation of a Gi coupled receptor can be accomplished by co-transfecting, non- endogenous, constitutively activated TSHR (TSHR-A623I) (or an endogenous, constitutively active Gs coupled receptor) as a "signal enhancer" with a Gi linked target GPCR to establish a baseline level of cAMP. Upon creating an endogenous or non- endogenous version of the Gi coupled receptor, the target GPCR is then co-transfected with the signal enhancer, and it is this material that can be used for screening. In some embodiments, this approach is preferably used in the direct identification of candidate compounds against Gi coupled receptors. It is noted that for a Gi coupled GPCR, when this approach is used, an inverse agonist of the target GPCR will increase the cAMP signal and an agonist will decrease the cAMP signal.
On day one, 2x104 293 cells/well are plated out. On day two, two reaction tubes are prepared (the proportions to follow for each tube are per plate): tube A is prepared by mixing 2μg DNA of each receptor transfected into the mammalian cells, for a total of 4μg DNA (e.g., pCMV vector; pCMV vector with mutated THSR (TSHR-A623I); TSHR- A623I and GPCR, etc.) in 1.2ml serum free DMEM (Irvine Scientific, Irvine, CA); tube B is prepared by mixing 120μl lipofectamine (Gibco BRL) in 1.2ml serum free DMEM. Tubes A and B are then admixed by inversions (several times), followed by incubation at room temperature for 30-45minutes. The admixture is referred to as the "transfection mixture". Plated 293 cells are washed with IXPBS, followed by addition of 10ml serum free DMEM. 2.4ml of the transfection mixture is then added to the cells, followed by incubation for 4 hours at 37°C/5% CO2. The transfection mixture is then removed by aspiration, followed by the addition of 25ml of DMEM/10% Fetal Bovine Serum. Cells are then incubated at 37°C/5% CO2. After 24 hours incubation, cells are harvested and utilized for analysis.
A Flash Plate™ Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) is designed for cell-based assays, but can be modified for use with crude plasma membranes depending on the need of the skilled artisan. The Flash Plate wells contain a scintillant coating which also contains a specific antibody recognizing cAMP. The cAMP generated in the wells can be quantitated by a direct competition for binding of radioactive cAMP tracer to the cAMP antibody. The following serves as a brief protocol for the measurement of changes in cAMP levels in whole cells that express a receptor of interest.
Transfected cells are harvested approximately twenty four hours after transient transfection. Media is carefully aspirated off and discarded. 10ml of PBS is gently added to each dish of cells followed by careful aspiration. ImI of Sigma cell dissociation buffer and 3ml of PBS is added to each plate. Cells are pipetted off the plate and the cell suspension is collected into a 50ml conical centrifuge tube. Cells are then centrifuged at room temperature at 1,100 rpm for 5 minutes. The cell pellet is carefully re-suspended into an appropriate volume of PBS (about 3ml/plate). The cells are then counted using a hemocytometer and additional PBS is added to give the appropriate number of cells (with a final volume of about 50μl/well). cAMP standards and Detection Buffer (comprising lμCi of tracer [125I] cAMP (50μl) to 1 ImI Detection Buffer) is prepared and maintained in accordance with the manufacturer's instructions. Assay Buffer should be prepared fresh for screening and contain 50μl of Stimulation Buffer, 3μl of candidate compound (12μM final assay concentration) and 50μl cells. Assay Buffer can be stored on ice until utilized. The assay can be initiated by addition of 50μl of cAMP standards to appropriate wells followed by addition of 50μl of PBSA to wells H-11 and H12. Fifty μl of Stimulation Buffer is added to all wells. Selected compounds (e.g., TSH) are added to appropriate wells using a pin tool capable of dispensing 3μl of compound solution, with a final assay concentration of 12μM candidate compound and lOOμl total assay volume. The cells are then added to the wells and incubated for 60 minutes at room temperature. lOOμl of Detection Mix containing tracer cAMP is then added to the wells. Plates are then incubated additional 2 hours followed by counting in a Wallac MicroBeta scintillation counter. Values of cAMP/well are extrapolated from a standard cAMP curve which is contained within each assay plate. 4. Reporter-Based Assays a. CRE-LUC Reporter Assay (Gs-associated receptors) 293 or 293T cells are plated-out on 96 well plates at a density of 2 x 104 cells per well and are transfected using Lipofectamine Reagent (BRL) the following day according to manufacturer instructions. A DNA/lipid mixture is prepared for each 6- well transfection as follows: 260ng of plasmid DNA in lOOμl of DMEM is gently mixed with 2μl of lipid in lOOμl of DMEM (the 260ng of plasmid DNA consists of 200ng of a 8xCRE-Luc reporter plasmid, 50ng of pCMV comprising endogenous receptor or non- endogenous receptor or pCMV alone, and IOng of a GPRS expression plasmid (GPRS in pcDNA3 (Invitrogen)). The 8XCRE-Luc reporter plasmid is prepared as follows: vector SRIF-β-gal is obtained by cloning the rat somatostatin promoter (-71 /+51) at BglV-Hindlll site in the pβgal-Basic Vector (Clontech). Eight (8) copies of cAMP response element are obtained by PCR from an adenovirus template AdpCF126CCRE8 (see, Suzuki et al., Hum Gene Ther 7:1883-1893 (1996); the disclosure of which is hereby incorporated by reference in its entirety) and cloned into the SRIF-β-gal vector at the Kpn-BglV site, resulting in the 8xCRE-β-gal reporter vector. The 8xCRE-Luc reporter plasmid is generated by replacing the beta-galactosidase gene in the 8xCRE-β- gal reporter vector with the luciferase gene obtained from the pGL3 -basic vector (Promega) at the Hindlll-BamHI site. Following 30 minutes incubation at room temperature, the DNA/lipid mixture is diluted with 400 μl of DMEM and lOOμl of the diluted mixture is added to each well. 100 μl of DMEM with 10% FCS are added to each well after a four hour incubation in a cell culture incubator. The following day the transfected cells are changed with 200 μl/well of DMEM with 10% FCS. Eight (8) hours later, the wells are changed to 100 μl /well of DMEM without phenol red, after one wash with PBS. Luciferase activity is measured the next day using the LucLite™ reporter gene assay kit (Packard) following manufacturer instructions and read on a 1450 MicroBeta™ scintillation and luminescence counter (Wallac). b. API reporter assay (Gq-associated receptors) A method to detect Gq stimulation depends on the known property of Gq- dependent phospholipase C to cause the activation of genes containing API elements in their promoter. A Pathdetect™ AP-I cis-Reporting System (Stratagene, Catalogue No. 219073) can be utilized following the protocol set forth above with respect to the CREB reporter assay, except that the components of the calcium phosphate precipitate are 410 ng pAPl-Luc, 80 ng pCMV-receptor expression plasmid, and 20 ng CMV-SEAP. c. SRF-LUC Reporter Assay (Gq- associated receptors)
One method to detect Gq stimulation depends on the known property of Gq- dependent phospholipase C to cause the activation of genes containing serum response factors in their promoter. A Pathdetect™ SRF-Luc-Reporting System (Stratagene) can be utilized to assay for Gq coupled activity in, for example, COS7 cells. Cells are transfected with the plasmid components of the system and the indicated expression plasmid encoding endogenous or non-endogenous GPCR using a Mammalian Transfection™ Kit (Stratagene, Catalogue #200285) according to the manufacturer's instructions. Briefly, 410 ng SRF-Luc, 80 ng pCMV-receptor expression plasmid and 20 ng CMV-SEAP (secreted alkaline phosphatase expression plasmid; alkaline phosphatase activity is measured in the media of transfected cells to control for variations in transfection efficiency between samples) are combined in a calcium phosphate precipitate as per the manufacturer's instructions. Half of the precipitate is equally distributed over 3 wells in a 96-well plate and kept on the cells in a serum free media for 24 hours. The last 5 hours the cells are incubated with, for example, 1 μM, candidate compound. Cells are then lysed and assayed for luciferase activity using a Luclite™ Kit (Packard, Cat. No. 6016911) and "Trilux 1450 Microbeta" liquid scintillation and luminescence counter (Wallac) as per the manufacturer's instructions. The data can be analyzed using GraphPad Prism™ 2.0a (GraphPad Software Inc.). d. Intracellular IP3 Accumulation Assay (Gq-associated receptors) On day 1, cells comprising the receptor of interest (endogenous or non- endogenous) can be plated onto 24 well plates, usually 1x105 cells/well (although his number can be optimized). On day 2 cells can be transfected by first mixing 0.25μg DNA in 50 μl serum free DMEM/well and 2 μl lipofectamine in 50 μl serum free
DMEM/well. The solutions are gently mixed and incubated for 15-30 minutes at room temperature. Cells are washed with 0.5 ml PBS and 400 μl of serum free media is mixed with the transfection media and added to the cells. The cells are then incubated for 3-4 hours at 37°C/5%CO2 and then the transfection media is removed and replaced with 1 ml/well of regular growth media. On day 3 the cells are labeled with ^-myoinositol. Briefly, the media is removed and the cells are washed with 0.5 ml PBS. Then 0.5 ml inositol-free/serum free media (GIBCO BRL) is added/well with 0.25 μCi of 3H- myo-inositol/ well and the cells are incubated for 16-18 hours overnight at 37°C/5%CO2 . On Day 4 the cells are washed with 0.5 ml PBS and 0.45 ml of assay medium is added containing inositol-free/serum free media, 10 μM pargyline, 10 mM lithium chloride or 0.4 ml of assay medium and 50μl of 1Ox ketanserin (ket) to final concentration of lOμM, if using a control construct containing a serotonin receptor. The cells are then incubated for 30 minutes at 370C. The cells are then washed with 0.5 ml PBS and 200μl of fresh/ice cold stop solution (IM KOH; 18 mM Na-borate; 3.8 mM EDTA) is added/well. The solution is kept on ice for 5-10 minutes or until cells were lysed and then neutralized by 200 μl of fresh/ice cold neutralization sol. (7.5 % HCL). The lysate is then transferred into 1.5 ml eppendorf tubes and 1 ml of chloroform/methanol (1:2) is added/tube. The solution is vortexed for 15 seconds and the upper phase is applied to a Biorad AGl -X8™ anion exchange resin (100-200 mesh). Firstly, the resin is washed with water at 1 : 1.25 W/V and 0.9 ml of upper phase is loaded onto the column. The column is washed with 10 mis of 5 mM myo-inositol and 10 ml of 5 mM Na- borate/60mM Na- formate. The inositol tris phosphates are eluted into scintillation vials containing 10 ml of scintillation cocktail with 2 ml of 0.1 M formic acid/ 1 M ammonium formate. The columns are regenerated by washing with 10 ml of 0.1 M formic acid/3M ammonium formate and rinsed twice with dd H2O and stored at 40C in water.
Example 12 Fusion Protein Preparation a. GPCR:Gs Fusion Constuct
The design of the GPCR-G protein fusion construct can be accomplished as follows: both the 5' and 3' ends of the rat G protein Gsα (long form; Itoh, H. et al., Proc. Natl. Acad. Sci. 83:3776 (1986)) are engineered to include a HindIII sequence thereon. Following confirmation of the correct sequence (including the flanking HindIII sequences), the entire sequence is shuttled into pcDNA3.1(-) (Invitrogen, cat. no. V795- 20) by subcloning using the HindIII restriction site of that vector. The correct orientation for the Gsα sequence is determined after subcloning into pcDNA3.1(-). The modified pcDNA3.1(-) containing the rat Gsα gene at HindIII sequence is then verified; this vector is now available as a "universal" Gsα protein vector. The pcDNA3.1 (-) vector contains a variety of well-known restriction sites upstream of the HindIII site, thus beneficially providing the ability to insert, upstream of the Gs protein, the coding sequence of a receptor of interest. This same approach can be utilized to create other "universal" G protein vectors, and, of course, other commercially available or proprietary vectors known to the artisan can be utilized— the important criteria is that the sequence for the GPCR be upstream and in- frame with that of the G protein.
b. Gq(6 amino acid deletion)/Gi Fusion Construct
The design of a Gq(del)/Gi fusion construct can be accomplished as follows: the N-terminal six (6) amino acids (amino acids 2 through 7, having the sequence of
TLESIM (SEQ ID NO: 5)) of Gαq-subunit is deleted and the C-terminal five (5) amino acids having the sequence EYNLV (SEQ ID NO: 6) is replaced with the corresponding amino acids of the Gαi Protein, having the sequence DCGLF (SEQ ID NO: 7). This fusion construct can be obtained by PCR using the following primers: 5'-gatcAAGCTTCCATGGCGTGCTGCCTGAGCGAGGAG-3' (SEQ ID NO: 8) and
5'- gatcGGATCCTTAGAACAGGCCGCAGTCCTTCAGGTTCAGCTGCAGGATGGTG-
3' (SEQ ED NO: 9) and Plasmid 63313 which contains the mouse Gαq-wild type version with a hemagglutinin tag as template. Nucleotides in lower caps are included as spacers.
TaqPlus Precision DNA polymerase (Stratagene) can be utilized for the amplification by the following cycles, with steps 2 through 4 repeated 35 times: 950C for 2 min; 950C for 20 sec; 560C for 20 sec; 720C for 2 min; and 720C for 7 min. The PCR product can be cloned into a pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator kit (P.E. Biosystems). Inserts from a TOPO clone containing the sequence of the fusion construct can be shuttled into the expression vector pcDNA3.1(+) at the Hindlll/BamHI site by a 2 step cloning process. Also see, PCT Application Number PCT/US02/05625 published as WO02068600 on 6 September 2002, the disclosure of which is hereby incorporated by reference in its entirety.
Example 13 [35S]GTPyS Assay A. Membrane Preparation
In some embodiments membranes comprising the Target GPCR of interest for use in the identification of candidate compounds as, e.g.,. agonists, inverse agonists or antagonists, are prepared as follows: a. Materials "Membrane Scrape Buffer" is comprised of 2OmM HEPES and 1 OmM EDTA, pH 7.4; "Membrane Wash Buffer" is comprised of 2OmM HEPES and 0.ImM EDTA, pH 7.4; "Binding Buffer" is comprised of 2OmM HEPES, 100 mM NaCl, and 10 mM MgCl2, pH 7.4. b. Procedure All materials are kept on ice throughout the procedure. Firstly, the media is aspirated from a confluent monolayer of cells, followed by rinsing with 10ml cold PBS, followed by aspiration. Thereafter, 5ml of Membrane Scrape Buffer is added to scrape cells; this is followed by transfer of cellular extract into 50ml centrifuge tubes (centrifuged at 20,000 rpm for 17 minutes at 40C). Thereafter, the supernatant is aspirated and the pellet is resuspended in 30ml Membrane Wash Buffer followed by centrifuge at 20,000 rpm for 17 minutes at 40C. The supernatant is then aspirated and the pellet resuspended in Binding Buffer. This is then homogenized using a Brinkman Polytron™ homogenizer (15-20 second bursts until the all material is in suspension). This is referred to herein as "Membrane Protein". Bradford Protein Assay
Following the homogenization, protein concentration of the membranes is determined using the Bradford Protein Assay (protein can be diluted to about 1.5mg/ml, aliquoted and frozen (-8O0C) for later use; when frozen, protocol for use will be as follows: on the day of the assay, frozen Membrane Protein is thawed at room temperature, followed by vortex and then homogenized with a Polytron at about 12 x 1,000 rpm for about 5-10 seconds; it is noted that for multiple preparations, the homogenizer should be thoroughly cleaned between homogenization of different preparations). a. Materials
Binding Buffer (as per above); Bradford Dye Reagent; Bradford Protein Standard is utilized, following manufacturer instructions (Biorad, cat. no. 500-0006). b. Procedure
Duplicate tubes are prepared, one including the membrane, and one as a control "blank". Each tube contains 800μl Binding Buffer. Thereafter, lOμl of Bradford
Protein Standard (lmg/ml) is added to each tube, and lOμl of membrane Protein is then added to just one tube (not the blank). Thereafter, 200μl of Bradford Dye Reagent is added to each tube, followed by vortexing of each tube. After five (5) minutes, the tubes are re-vortexed and the material therein is transferred to cuvettes. The cuvettes are read using a CECIL 3041 spectrophotometer, at wavelength 595.
Identification Assay a. Materials
GDP Buffer consists of 37.5ml Binding Buffer and 2mg GDP (Sigma, cat. no. G-7127), followed by a series of dilutions in Binding Buffer to obtain 0.2 μM GDP (final concentration of GDP in each well is 0.1 μM GDP); each well comprising a candidate compound has a final volume of 200μl consisting of lOOμl GDP Buffer (final concentration, 0.1 μM GDP), 50μl Membrane Protein in Binding Buffer, and 50μl [35S]GTPyS (0.6 nM) in Binding Buffer (2.5 μl [35S]GTPyS per 10ml Binding Buffer). b. Procedure Candidate compounds can be screened using a 96-well plate format (these can be frozen at -8O0C). Membrane Protein (or membranes with expression vector excluding the Target GPCR, as control), are homogenized briefly until in suspension. Protein concentration is be determined using the Bradford Protein Assay set forth above. Membrane Protein (and control) is diluted to 0.25mg/ml in Binding Buffer (final assay concentration, 12.5μg/well). Thereafter, lOOμl GDP Buffer is added to each well of a Wallac Scintistrip™ (Wallac). A 5μl pin-tool is used to transfer 5 μl of a candidate compound into such well (i.e., 5μl in total assay volume of 200 μl is a 1:40 ratio such that the final screening concentration of the candidate compound is lOμM). Again, to avoid contamination, after each transfer step the pin tool should be rinsed in three reservoirs comprising water (IX), ethanol (IX) and water (2X) - excess liquid should be shaken from the tool after each rinse and dried with paper and kimwipes. Thereafter, 50μl of Membrane Protein is added to each well (a control well comprising membranes without the Target GPCR is also utilized), and pre-incubated for 5-10 minutes at room temperature. Thereafter, 50μl of [35S]GTPyS (0.6 nM) in Binding Buffer is added to each well, followed by incubation on a shaker for 60 minutes at room temperature (plates are covered with foil). The assay is then stopped by spinning of the plates at 4000 RPM for 15 minutes at 220C. The plates are aspirated with an 8 channel manifold and sealed with plate covers. The plates are read on a Wallac 1450 using setting "Prot. #37" (as per manufacturer's instructions).
Example 14 Cyclic AMP Assay
Another assay approach for identifying candidate compounds as, e.g., agonists, inverse agonist, or antagonists, can accomplished by utilizing a cyclase-based assay. In addition to direct identification, this assay approach can be utilized as an independent approach to provide confirmation of the results from the [35S]GTPyS approach as set forth in the above example.
A modified Flash Plate™ Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) can be utilized for direct identification of candidate compounds as inverse agonists and agonists to a receptor of interest in accordance with the following protocol.
Transfected cells are harvested approximately three days after transfection. Membranes are prepared by homogenization of suspended cells in buffer containing 2OmM HEPES, pH 7.4 and 1OmM MgCl2. Homogenization is performed on ice using a Brinkman Polytron™ for approximately 10 seconds. The resulting homogenate is centrifuged at 49,000 X g for 15 minutes at 4°C. The resulting pellet is then resuspended in buffer containing 2OmM HEPES, pH 7.4 and 0.1 mM EDTA, homogenized for 10 seconds, followed by centrifugation at 49,000 x g for 15 minutes at 4°C. The resulting pellet is then stored at -80°C until utilized. On the day of direct identification screening, the membrane pellet is slowly thawed at room temperature, resuspended in buffer containing 2OmM HEPES, pH 7.4 and 1OmM MgCl2, to yield a final protein concentration of 0.60mg/ml (the resuspended membranes are placed on ice until use). cAMP standards and Detection Buffer (comprising 2μCi of tracer [125I]cAMP
(lOOμl) to 1 ImI Detection Buffer] are prepared and maintained in accordance with the manufacturer's instructions. Assay Buffer is prepared fresh for screening and contains 2OmM HEPES, pH 7.4, 1OmM MgCl2, 2OmM phospocreatine (Sigma), 0.1 units/ml creatine phosphokinase (Sigma), 50 μM GTP (Sigma), and 0.2 mM ATP (Sigma); Assay Buffer is then stored on ice until utilized.
Candidate compounds are added to, for example, 96-well plate wells (3μl/well; 12μM final assay concentration), together with 40 μl Membrane Protein (30μg/well) and 50μl of Assay Buffer. This admixture is then incubated for 30 minutes at room temperature, with gentle shaking. Following the incubation, lOOμl of Detection Buffer is added to each well, followed by incubation for 2-24 hours. Plates are then counted in a Wallac MicroBeta™ plate reader using "Prot. #31" (as per manufacturer's instructions).
Example 15 Fluorometric Imaging Plate Reader (FLIPR) Assay for the Measurement of Intracellular Calcium Concentration
Target Receptor (experimental) and pCMV (negative control) stably transfected cells from respective clonal lines are seeded into poly-D-lysine pretreated 96-well plates (Becton-Dickinson, #356640) at 5.5xlO4 cells/well with complete culture medium (DMEM with 10% FBS, 2mM L-glutamine, ImM sodium pyruvate) for assay the next day. Because GPR91 is Gi coupled, the cells comprising GPR91 can further comprise Gαl5, Gαl6, or the chimeric Gq/Gi alpha subunit. However, since GPR91 is also coupled to Gαl2/13 (see Example 3 and Figure 3), a promiscuous G protein such as Gαl5, Gαl6, or the chimeric Gq/Gi alpha subunit may not be required in order to cause a detectable calcium flux. To prepare Fluo4-AM (Molecular Probe, #F14202) incubation buffer stock, 1 mg Fluo4-AM is dissolved in 467μl DMSO and 467μl Pluoronic acid (Molecular Probe, #P3000) to give a ImM stock solution that can be stored at -20°C for a month. Fluo4-AM is a fluorescent calcium indicator dye. Candidate compounds are prepared in wash buffer (IX HBSS/2.5mM Probenicid/20mM HEPES at pH 7.4).
At the time of assay, culture medium is removed from the wells and the cells are loaded with lOOμl of 4μM Fluo4- AM/2.5 mM Probenicid (Sigma, #P8761)/20mM HEPES/complete medium at pH 7.4. Incubation at 37°C/5% CO2 is allowed to proceed for 60 minutes.
After the 1 hour incubation, the Fluo4-AM incubation buffer is removed and the cells are washed 2X with 100 μl wash buffer. In each well is left 100 μl wash buffer. The plate is returned to the incubator at 37°C/5% CO2 for 60 minutes. FLEPR (Fluorometric Imaging Plate Reader; Molecular Device) is programmed to add 50 μl candidate compound on the 30th second and to record transient changes in intracellular calcium concentration ([Ca2+]) evoked by the candidate compound for another 150 seconds. Total fluorescence change counts are used to determine agonist activity using the FLIPR software. The instrument software normalizes the fluorescent reading to give equivalent initial readings at zero.
Although the foregoing provides a FLIPR assay for agonist activity using stably transfected cells, a person of ordinary skill in the art would readily be able to modify the assay in order to characterize antagonist activity. Said person of ordinary skill in the art would also readily appreciate that, alternatively, transiently transfected cells could be used.
Example 16
MAP Kinase Assay
MAP kinase (mitogen activated kinase) can be monitored to evaluate receptor activation. MAP kinase can be detected by several approaches. One approach is based on an evaluation of the phosphorylation state, either unphosphorylated (inactive) or phosphorylated (active). The phosphorylated protein has a slower mobility in SDS- PAGE and can therefore be compared with the unstimulated protein using Western blotting. Alternatively, antibodies specific for the phosphorylated protein are available (New England Biolabs) which can be used to detect an increase in the phosphorylated kinase, hi either method, cells are stimulated with the candidate compound and then extracted with Laemmli buffer. The soluble fraction is applied to an SDS-PAGE gel and proteins are transferred electrophoretically to nitrocellulose or Immobilin. Immunoreactive bands are detected by standard Western blotting technique. Visible or chemiluminescent signals are recorded on film and can be quantified by densitometry.
Another approach is based on evalulation of the MAP kinase activity via a phosphorylation assay. Cells are stimulated with the candidate compound and a soluble extract is prepared. The extract is incubated at 30°C for 10 minutes with gamma-32P- ATP, an ATP regenerating system, and a specific substrate for MAP kinase such as phosphorylated heat and acid stable protein regulated by insulin, or PHAS-I. The reaction is terminated by the addition OfH3PO4 and samples are transferred to ice. An aliquot is spotted onto Whatman P81 chromatography paper, which retains the phosphorylated protein. The chromatography paper is washed and counted for 32P is a liquid scintillation counter. Alternatively, the cell extract is incubated with gamma-32P- ATP, an ATP regenerating system, and biotinylated myelin basic proein bound by streptavidin to a filter support. The myelin basic protein is a substrate for activated MAP kinase. The phosphorylation reaction is carried out for 10 minutes at 30°C. The extract can then be aspirated through the filter, which retains, the phosphorylated myelin basic protein. The filter is washed and counted for 32P by liquid scintillation counting.
Example 17 Receptor Binding Assay
In addition to the methods described herein, another means for evaluating a candidate compound is by determining binding affinities to the GPR91 receptor. This type of assay generally requires a radiolabeled ligand to the GPR91 receptor. Absent the use of known ligands for the GPR91 receptor and radiolabels thereof, compounds identified by a method of the invention can be labelled with a radioisotope and used in an assay for evaluating the affinity of a candidate compound to the GPR91 receptor.
A radiolabeled GPR91 compound can be used in a screening assay to identify/evaluate compounds. In general terms, a newly synthesized or identified compound (i.e., candidate compound) can be evaluated for its ability to reduce binding of the radiolabeled GPR91 compound to the GPR91 receptor. Accordingly, the ability to compete with the radiolabeled GPR91 compound for the binding to the GPR91 receptor directly correlates to the binding affinity of the candidate compound to the GPR91 receptor. ASSAY PROTOCOL FOR DETERMINING RECEPTOR BINDING FOR GPR91 : A. GPR91 RECEPTOR PREPARATION
For example, HEK293 cells (human kidney, ATCC) can be transiently or stably transfected with GPR91 as described herein. For example, 293 cells can be transiently transfected with 10 μg human GPR91 receptor and 60 μl Lipofectamine (per 15-cm dish), and grown in the dish for 24 hours (75% confluency) with a media change. Cells are removed with lOml/dish of Hepes-EDTA buffer ( 2OmM Hepes + 10 mM EDTA, pH 7.4). The cells are then centrifuged in a Beckman Coulter centrifuge for 20 minutes, 17,000 rpm (JA-25.50 rotor). Subsequently, the pellet is resuspended in 2OmM Hepes + 1 mM EDTA, pH 7.4 and homogenized with a 50- ml Dounce homogenizer and again centrifuged. After removing the supernatant, the pellets are stored at -8O0C, until used in binding assay. When used in the assay, membranes are thawed on ice for 20 minutes and then 1OmL of incubation buffer (2OmM Hepes, ImM MgCl25IOOmM NaCl, pH 7.4) is added. The membranes are then vortexed to resuspend the crude membrane pellet and homogenized with a Brinkmann PT-3100 Polytron homogenizer for 15 seconds at setting 6. The concentration of membrane protein is determined using the BRL Bradford protein assay.
B. BINDING ASSAY
For total binding, a total volume of 50μl of appropriately diluted membranes (diluted in assay buffer containing 5OmM Tris HCl (pH 7.4), 1OmM MgCl2, and ImM EDTA; 5-50μg protein) is added to 96-well polyproylene microtiter plates followed by addition of lOOμl of assay buffer and 50μl of radiolabeled GPR91 compound. For nonspecific binding, 50μl of assay buffer is added instead of lOOμl and an additional 50μl of lOμM cold GPR91 is added before 50μl of radiolabeled GPR91 compound is added. Plates are then incubated at room temperature for 60-120 minutes. The binding reaction is terminated by filtering assay plates through a Microplate Devices GF/C Unifilter filtration plate with a Brandell 96-well plate harvestor followed by washing with cold 50 mM Tris HCl, pH 7.4 containing 0.9% NaCl. Then, the bottom of the filtration plates are sealed, 50μl of Optiphase Supermix is added to each well, the top of the plates are sealed, and plates are counted in a Trilux MicroBeta scintillation counter. For compound competition studies, instead of adding lOOμl of assay buffer, lOOμl of appropriately diluted candidate compound is added to appropriate wells followed by addition of 50μl of radiolabeled GPR91 compound.
C. CALCULATIONS The candidate compounds are initially assayed at 1 and O.lμM and then at a range of concentrations chosen such that the middle dose would cause about 50% inhibition of a radiolabeled GPR91 compound binding (i.e., IC50). Specific binding in the absence of candidate compound (Bo) is the difference of total binding (BT) minus non-specific binding (NSB) and similarly specific binding (in the presence of candidate compound) (B) is the difference of displacement binding (BD) minus non-specific binding (NSB). IC50 is determined from an inhibition response curve, logit-log plot of % B/Bo vs concentration of candidate compound.
Kj is calculated by the Cheng and Prustoff transformation:
Figure imgf000061_0001
where [L] is the concentration of a radiolabeled GPR91 compound used in the assay and KD is the dissociation constant of a radiolabeled GPR91 compound determined independently under the same binding conditions.
Those skilled in the art will recognize that various modifications, additions, substitutions, and variations to the illustrative examples set forth herein can be made without departing from the spirit of the invention and are, therefore, considered within the scope of the invention. All documents referenced above, including, but not limited to, printed publications, and provisional and regular patent applications, are incorporated herein by reference in their entirety.

Claims

CLAIMSWe claim:
1. A method for identifying a compound that stimulates hematopoiesis, comprising: a) contacting a candidate compound with GPR91 , and b) determining whether GPR91 functionality is increased, wherein an increase in GPR91 functionality is indicative of the candidate compound being a compound that stimulates hematopoiesis.
2. A method for identifying a compound that stimulates erythropoiesis, comprising: a) contacting a candidate compound with GPR91 , and b) determining whether GPR91 functionality is increased, wherein an increase in GPR91 functionality is indicative of the candidate compound being a compound that stimulates erythropoiesis.
3. A method for identifying a compound that stimulates thrombopoiesis, comprising: a) contacting a candidate compound with GPR91 , and b) determining whether GPR91 functionality is increased, wherein an increase in GPR91 functionality is indicative of the candidate compound being a compound that stimulates thrombopoiesis.
4. The method of any one of claims 1 to 3, wherein said GPR91 is human.
5. The method of any one of claims 1 to 3, wherein said determining comprises a second messenger assay.
6. The method of any one of claims 1 to 3, further comprising preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier.
7. A method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition of claim 6.
8. The method of claim 7, wherein said hematopoietic disorder is anemia, thrombocytopenia, neutropenia, leukopenia, cytopenia, or idiopathic thrombocytopenic purpura.
9. The method of claim 7, wherein said hematopoietic disorder is anemia.
10. The method of claim 7, wherein said hematopoietic disorder is thrombocytopenia.
11. The method of claim 7, further comprising administering to said individual an effective amount of an agent used to stimulate hematopoiesis in combination with an effective amount of the pharmaceutical composition of claim 6.
12. The method of any one of claims 7 to 11, wherein the individual is a mammal.
13. The method of any one of claims 7 to 11, wherein the individual is a human.
14. A compound that stimulates hematopoiesis identified according to the method of claim 1.
15. A pharmaceutical composition comprising the compound of claim 14.
16. A compound that stimulates erythropoiesis identified according to the method of claim 2.
17. A pharmaceutical composition comprising the compound of claim 16.
18. A compound that stimulates thrombopoiesis identified according to the method of claim 3.
19. A pharmaceutical composition comprising the compound of claim 19.
20. A method for identifying a compound that reduces hematopoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is decreased, wherein a decrease in GPR91 functionality is indicative of the candidate compound being a compound that reduces hematopoiesis.
21. A method for identifying a compound that reduces erythropoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is decreased, wherein a decrease in GPR91 functionality is indicative of the candidate compound being a compound that reduces erythropoiesis.
22. A method for identifying a compound that reduces thrombopoiesis, comprising: a) contacting a candidate compound with GPR91, and b) determining whether GPR91 functionality is decreased, wherein a decrease in GPR91 functionality is indicative of the candidate compound being a compound that reduces thrombopoiesis.
23. The method of any one of claims 20 to 22, wherein said GPR91 is human.
24. The method of any one of claims 20 to 22, wherein said determining comprises a second messenger assay.
25. The method of any one of claims 20 to 22, further comprising preparing a pharmaceutical composition by combining the identified compound with at least one pharmaceutically acceptable carrier.
26. A method for treating or preventing a hematopoietic disorder in an individual in need thereof, comprising administering to said individual an effective amount of the pharmaceutical composition of claim 25.
27. The method of claim 26, wherein said hematopoietic is erythrocytosis, a myeloproliferative disorder, essential thrombocythemia, post-transplant erythrocytosis, or polycythemia vera.
28. The method of claim 26, wherein said hematopoietic disorder is erythrocytosis.
29. The method of claim 26, wherein said hematopoietic disorder is a myeloproliferative disorder.
30. The method of claim 26, further comprising administering to said individual an effective amount of an agent used for decreasing hematopoiesis in combination with an effective amount of the pharmaceutical composition of claim 25.
31. The method of any one of claims 26 to 30, wherein the individual is a mammal.
32. The method of any one of claims 26 to 30, wherein the individual is a human.
33. A compound that stimulates hematopoiesis identified according to the method of claim 20.
34. A pharmaceutical composition comprising the compound of claim 33.
35. A compound that stimulates erythropoiesis identified according to the method of claim 21.
36. A pharmaceutical composition comprising the compound of claim 35.
37. A compound that stimulates thrombopoiesis identified according to the method of claim 22.
38. A pharmaceutical composition comprising the compound of claim 37.
39. A method for the manufacture of a medicament comprising a compound of any one of claims 14, 16, or 18 for use as a hematopoietic agent.
40. A method for the manufacture of a medicament comprising a compound of any one of claims 14, 16, or 18, for use in the treatment of a blood disorder.
41. Use of a compound of any one of claims 14, 16, or 18, for the manufacture of a medicament for treating or preventing a blood disorder in an individual.
42. The use of claim 41 , wherein said blood disorder is anemia.
43. The use of claim 41, wherein said blood disorder is thrombocytopenia.
44. The use of claim 41, wherein said compound is used in combination with an agent used to stimulate hematopoiesis.
45. A method for the manufacture of a medicament comprising a compound of any one of claims 33, 35 or 37 for use as a hematopoietic agent.
46. A method for the manufacture of a medicament comprising a compound of any one of claims 33, 35 or 37, for use in the treatment of a blood disorder.
47. Use of a compound of any one of claims 33, 35 or 37 for the manufacture of a medicament for treating or preventing a blood disorder in an individual.
48. The use of claim 47, wherein said blood disorder is erythrocytosis.
49. The use of claim 47, wherein said blood disorder is a myeloproliferative disorder.
50. The use of claim 47, wherein said compound is used in combination with an agent used for decreasing hematopoiesis.
PCT/US2008/008734 2007-07-18 2008-07-17 Modulators of hematopoiesis WO2009011885A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US96105207P 2007-07-18 2007-07-18
US60/961,052 2007-07-18

Publications (1)

Publication Number Publication Date
WO2009011885A1 true WO2009011885A1 (en) 2009-01-22

Family

ID=40032392

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/008734 WO2009011885A1 (en) 2007-07-18 2008-07-17 Modulators of hematopoiesis

Country Status (1)

Country Link
WO (1) WO2009011885A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005010152A2 (en) * 2003-06-27 2005-02-03 Tanox, Inc. Human mast cell-expressed membrane protein
WO2005050220A1 (en) * 2003-10-31 2005-06-02 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with g protein-coupled receptor 91 (gpr91)
WO2006117193A2 (en) * 2005-05-03 2006-11-09 Novartis Ag Receptor in dendritic cells

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005010152A2 (en) * 2003-06-27 2005-02-03 Tanox, Inc. Human mast cell-expressed membrane protein
WO2005050220A1 (en) * 2003-10-31 2005-06-02 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with g protein-coupled receptor 91 (gpr91)
WO2006117193A2 (en) * 2005-05-03 2006-11-09 Novartis Ag Receptor in dendritic cells

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
WITTENBERGER T ET AL: "An expressed sequence tag (EST) data mining strategy succeeding in the discovery of new G-protein coupled receptors", JOURNAL OF MOLECULAR BIOLOGY, LONDON, GB, vol. 307, no. 3, 30 March 2001 (2001-03-30), pages 799 - 813, XP004464166, ISSN: 0022-2836 *

Similar Documents

Publication Publication Date Title
JP5769361B2 (en) Human G protein coupled receptor and modulators thereof for the treatment of hyperglycemia and related disorders
EP1812080B1 (en) Gpr41 and modulators thereof for the treatment of insulin-related disorders
US20040142377A1 (en) Human G protein-coupled receptors and modulators thereof for the treatment of metabolic-related disorders
AU2006284926A1 (en) Human G protein-coupled receptor and modulators thereof for the treatment of atherosclerosis and atherosclerotic disease and for the treatment of conditions related to MCP-1 expression
US20110038850A1 (en) G Protein-Coupled Receptor and Modulators Thereof For The Treatment of Gaba-Related Neurological Disorders Including Sleep-Related Disorders
Haas et al. Mutations that silence constitutive signaling activity in the allosteric ligand-binding site of the thyrotropin receptor
US20120208843A1 (en) Method of Using GPR35 to Identify Metabolic-Stabilizing Compounds
US9068983B2 (en) Methods of identifying candidate compounds of the human G protein-coupled receptor, GPR50, as modulators of body mass or adiposity
WO2006036688A9 (en) Gpr43 and modulators thereof for the treatment of metabolic-related disorders
WO2009011885A1 (en) Modulators of hematopoiesis
US20030139588A9 (en) Endogenous and non-endogenous versions of human G protein-coupled receptors
WO2007047520A1 (en) Gpr22 and methods relating thereto
US20070231263A1 (en) Human G protein-coupled receptor and modulators thereof for the treatment of hyperglycemia and related disorders
Perrin et al. Characterization of a Pachymedusa dacnicolor–Sauvagine Analog as a New High-Affinity Radioligand for Corticotropin-Releasing Factor Receptor Studies
Rawadi 18 Wnt/Frizzled receptor signaling in osteoporosis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08794546

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08794546

Country of ref document: EP

Kind code of ref document: A1