WO2009006429A1 - Host cells and methods for producing 3-methyl-2-buten-1-ol, 3-methyl-3-buten-1-ol, and 3-methyl-butan-1-ol - Google Patents

Host cells and methods for producing 3-methyl-2-buten-1-ol, 3-methyl-3-buten-1-ol, and 3-methyl-butan-1-ol Download PDF

Info

Publication number
WO2009006429A1
WO2009006429A1 PCT/US2008/068831 US2008068831W WO2009006429A1 WO 2009006429 A1 WO2009006429 A1 WO 2009006429A1 US 2008068831 W US2008068831 W US 2008068831W WO 2009006429 A1 WO2009006429 A1 WO 2009006429A1
Authority
WO
WIPO (PCT)
Prior art keywords
methyl
buten
host cell
enzyme
carbon alcohol
Prior art date
Application number
PCT/US2008/068831
Other languages
French (fr)
Inventor
Howard H. Chou
Jay D. Keasling
Original Assignee
Regents Of The University Of California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Regents Of The University Of California filed Critical Regents Of The University Of California
Publication of WO2009006429A1 publication Critical patent/WO2009006429A1/en
Priority to US12/646,189 priority Critical patent/US7985567B2/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • CCHEMISTRY; METALLURGY
    • C10PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10LFUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
    • C10L1/00Liquid carbonaceous fuels
    • C10L1/02Liquid carbonaceous fuels essentially based on components consisting of carbon, hydrogen, and oxygen only
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0012Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0036Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/16Butanols
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02EREDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00Technologies for the production of fuel of non-fossil origin
    • Y02E50/10Biofuels, e.g. bio-diesel

Definitions

  • the present invention is in the field of production of 5-carbon alcohol compounds, and in particular host cells that are genetically modified to produce 5-carbon alcohol compounds.
  • Petroleum derived fuels have been the primary source of energy for over a hundred years. Petroleum is formed over millions of years in nature and is a non-renewable source of energy. A significant amount of research in biofuels has been ongoing for decades. Within this field, ethanol has been studied intensively as a gasoline substitute. However, the efficiency of ethanol as a fuel remains debatable. (Pimentel, Natural Resources Research (2005) 14:65; Farrell et al., Science (2006), 311 :506).
  • the present invention provides methods for the biosynthesis of branched 5-carbon alcohols (branched-C5 alcohols) from the isoprenoid precursors isopentyl pyrophosphate (IPP) or dimethylallyl diphosphate (DMAPP).
  • IPP isopentyl pyrophosphate
  • DMAPP dimethylallyl diphosphate
  • Isoprenoids are compounds derived from the five-carbon molecule, IPP. Investigators have identified over 29,000 individual isoprenoid compounds, with new ones continuously being discovered. Isoprenoids are often isolated from natural products, such as plants and microorganisms, which use isopentenyl pyrophosphate as a basic building block to form relatively complex structures. Vital to living organisms, isoprenoids serve to maintain cellular fluidity and electron transport, as well as function as natural pesticides, to name just a few of their roles in vivo. Furthermore, the pharmaceutical and chemical communities use isoprenoids as pharmaceuticals, nutriceuticals, flavoring agents, and agricultural pest control agents. Given their importance in biological systems and usefulness in a broad range of applications, isoprenoids have been the focus of much attention by scientists.
  • 6,190,895 describes nucleic acid sequences that code for the expression of l-deoxyxylulose-5-phosphate synthase, an enzyme used in one biological pathway for the synthesis of isopentenyl pyrophosphate.
  • U.S. Pat. No. 7,172,886 describes the cloning of genes for a mevalonate- isoprenoid pathway and synthesizing an isoprenoid or an isoprenoid precursor via the mevalonate pathway in a host cell.
  • HMG-CoA hydroxymethylglutaryl-CoA
  • the present invention provides for a method of producing a 5-carbon alcohol in a genetically modified host cell.
  • the method comprises culturing the genetically modified host cell under a suitable condition such that the culturing results in the genetically modified host cell producing a 5-carbon alcohol.
  • the host cell comprises an enzyme capable of catalyzing the dephosphorylation of an isopentenyl disphosphate (IPP) or dimethylallyl diphosphate (DMAPP), and optionally a second enzyme capable of reducing a 3-methyl-2-buten-l-ol into 3-methyl-butan-l-ol.
  • the 5-carbon alcohol is 3-methyl-2-buten-l-ol, 3-methyl-3-buten-l-ol, or 3-methyl-butan-l-ol, or any combination thereof.
  • the present invention also provides for a genetically modified host cell useful for the methods of the present invention.
  • the present invention further provides for an isolated 3-methyl-2-buten- 1 -ol, 3-methyl-3-buten-l-ol or 3-methyl-butan-l-ol produced from the method of the present invention.
  • Figure 1 shows the enzymatic pathway for producing 3-methyl-2-buten-l-ol, 3-methyl-3-buten-l-ol and 3-methyl-butan-l-ol.
  • Figure 2 shows the sequence alignment of Bacillus stearothermophilus NGBlOl YhfR with sequences of YhfR. homologs in other Bacillus strains and species. conserveed amino acid residues are in bold and triangles mark amino acid residues lining the active site cleft of YhfR; filled triangles denote the conserved amino acid residues that form the catalytic core; and open triangles denote other positions.
  • Figure 3 shows the relative transformation of 3-methyl-2-butenol and 3-methyl-3- butenol to isopentanol by Saccharomyces cerevisiae.
  • the y-axis is milligrams of isopentanol/L/O.D..
  • Dark shaded bars represent the production of isopentanol by S. cerevisiae in the absence of added alcohol substrate.
  • Light shaded bars represent transformation of substrate alcohol by S. cerevisiae into isopentanol.
  • Figure 4 shows the relative transformation of 3-methyl-2-butenol to isopentanol by Saccharomyces cerevisiae with or without over-expressing oye2.
  • the y-axis is milligrams of isopentanol/L/O.D.. Dark shaded bars represent the production of isopentanol by S. cerevisiae in the absence of added alcohol substrate. Light shaded bars represent transformation of substrate alcohol by S. cerevisiae into isopentanol.
  • Figure 5 shows the relative transformation of 3-methyl-2-butenol to isopentanol by Saccharomyces cerevisiae with or without over-expressing oye3 (YPL171c).shows a hypothetical mechanism for the reduction of 3-methyl-2-butenol to isopentanol by OYE2.
  • Figure 6 shows a hypothetical mechanism for the reduction of 3-methyl-2-butenol to isopentanol by OYE.
  • an "expression vector” includes a single expression vector as well as a plurality of expression vectors, either the same (e.g., the same operon) or different; reference to "cell” includes a single cell as well as a plurality of cells; and the like.
  • a host cell and "host microorganism” are used interchangeably herein to refer to a living biological cell that can be transformed via insertion of an expression vector.
  • a host organism or cell as described herein may be a prokaryotic organism (e.g., an organism of the kingdom Eubacteria) or a eukaryotic cell.
  • a prokaryotic cell lacks a membrane-bound nucleus, while a eukaryotic cell has a membrane-bound nucleus.
  • heterologous DNA refers to a polymer of nucleic acids wherein at least one of the following is true: (a) the sequence of nucleic acids is foreign to (i.e., not naturally found in) a given host microorganism; (b) the sequence may be naturally found in a given host microorganism, but in an unnatural (e.g., greater than expected) amount; or (c) the sequence of nucleic acids comprises two or more subsequences that are not found in the same relationship to each other in nature.
  • a heterologous nucleic acid sequence that is recombinantly produced will have two or more sequences from unrelated genes arranged to make a new functional nucleic acid.
  • the present invention describes the introduction of an expression vector into a host microorganism, wherein the expression vector contains a nucleic acid sequence coding for an enzyme that is not normally found in a host microorganism. With reference to the host microorganism's genome, then, the nucleic acid sequence that codes for the enzyme is heterologous.
  • mevalonate pathway is used herein to refer to the pathway that converts acetyl-CoA to isopentenyl pyrophosphate through a mevalonate intermediate.
  • expression vector refers to a compound and/or composition that transduces, transforms, or infects a host microorganism, thereby causing the cell to express nucleic acids and/or proteins other than those native to the cell, or in a manner not native to the cell.
  • An "expression vector” contains a sequence of nucleic acids (ordinarily RNA or DNA) to be expressed by the host microorganism.
  • the expression vector also comprises materials to aid in achieving entry of the nucleic acid into the host microorganism, such as a virus, liposome, protein coating, or the like.
  • the expression vectors contemplated for use in the present invention include those into which a nucleic acid sequence can be inserted, along with any preferred or required operational elements. Further, the expression vector must be one that can be transferred into a host microorganism and replicated therein.
  • Preferred expression vectors are plasmids, particularly those with restriction sites that have been well documented and that contain the operational elements preferred or required for transcription of the nucleic acid sequence. Such plasmids, as well as other expression vectors, are well known to those of ordinary skill in the art.
  • transduce refers to the transfer of a sequence of nucleic acids into a host microorganism or cell. Only when the sequence of nucleic acids becomes stably replicated by the cell does the host microorganism or cell become “transformed.” As will be appreciated by those of ordinary skill in the art, “transformation” may take place either by incorporation of the sequence of nucleic acids into the cellular genome, i.e., chromosomal integration, or by extrachromosomal integration.
  • an expression vector e.g., a virus
  • an expression vector is "infective" when it transduces a host microorganism, replicates, and (without the benefit of any complementary virus or vector) spreads progeny expression vectors, e.g., viruses, of the same type as the original transducing expression vector to other microorganisms, wherein the progeny expression vectors possess the same ability to reproduce.
  • isolated or “biologically pure” refer to material that is substantially or essentially free of components that normally accompany it in its native state.
  • nucleic acid sequence As used herein, the terms “nucleic acid sequence,” “sequence of nucleic acids,” and variations thereof shall be generic to polydeoxyribonucleotides (containing 2-deoxy-
  • D-ribose D-ribose
  • polyribonucleotides containing D-ribose
  • any other type of polynucleotide that is an N-glycoside of a purine or pyrimidine base and to other polymers containing nonnucleotidic backbones, provided that the polymers contain nucleobases in a configuration that allows for base pairing and base stacking, as found in DNA and RNA.
  • nucleic acid sequence modifications for example, substitution of one or more of the naturally occurring nucleotides with an analog; intemucleotide modifications, such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), with negatively charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), and with positively charged linkages (e.g., arninoalklyphosphoramidates, aminoalkylphosphotriesters); those containing pendant moieties, such as, for example, proteins (including nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.); those with intercalators (e.g., acridine, psoralen, etc.); and those containing chelators (e.g., metals, radioactive metals, boron, oxidative metals, etc
  • operably linked refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter) and a second nucleic acid sequence, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence.
  • Alga algal
  • microalgae or the like, refere to plants belonging to the subphylum Algae of the phylum Thallophyta.
  • the algae are unicellular, photosynthetic, oxygenic algae and are non-parasitis plants without roots, stems, or leaves; they contain chlorophyll and have a great variety in size, from microscopic to large seaweeds.
  • Green algae belonging to Eukaryota ⁇ Viridiplantae ⁇ Chlorophyta ⁇ Chlorophyceae, can be used in the invention. However, algae useful in the invention may also be blue-green, red, or brown.
  • the present invention provides methods for constructing a de novo synthetic pathway, in a genetically modified host cell, for the production of C5-isoprenyl alcohols and isopentanol using isopentenyl disphosphate (IPP) and dimethylallyl diphosphate (DMAPP) as substrates. These substrates can be derived from the non-mevalonate as well as mevalonate pathways.
  • IPP isopentenyl disphosphate
  • DMAPP dimethylallyl diphosphate
  • the method comprises: culturing a genetically modified host cell under a suitable condition, wherein the genetically modified host cell comprises a first enzyme capable of catalyzing the dephosphorylation of an isopentenyl disphosphate (IPP) or dimethylallyl diphosphate (DMAPP) to 3-methyl-3-buten-l-ol or 3-methyl-2-buten-l-ol, respectively, and optionally a second enzyme capable of reducing 3-methyl-2-buten-l-ol to 3-methyl-butan-l-ol.
  • IPP isopentenyl disphosphate
  • DMAPP dimethylallyl diphosphate
  • the method comprises: culturing a genetically modified host cell under a suitable condition, wherein the genetically modified host cell comprises an enzyme capable of catalyzing the dephosphorylation of an isopentenyl disphosphate (IPP) or dimethylallyl diphosphate (DMAPP) to 3-methyl-2-buten-l-ol or 3-methyl-3 -buten- 1 -ol.
  • IPP isopentenyl disphosphate
  • DMAPP dimethylallyl diphosphate
  • the method comprises: culturing a genetically modified host cell under a suitable condition, wherein the genetically modified host cell comprises a first enzyme capable of catalyzing the dephosphorylation of a dimethylallyl diphosphate (DMAPP) to 3-methyl-2-buten-l-ol, and a second enzyme capable of reducing 3-methyl-2-buten-l-ol to 3-methyl-butan-l-ol.
  • DMAPP dimethylallyl diphosphate
  • the second enzyme capable of reducing 3-methyl-2-buten- l-ol to 3-methyl-butan-l-ol is a member of, or homologous to, the OYE family of reductases.
  • the OYE family member is 0YE2 or a homolog.
  • the OYE family member is OYE3 or a homolog.
  • the method comprises: culturing a genetically modified host cell under a suitable condition, wherein the genetically modified host cell comprises a nucleic acid construct encoding an enzyme capable of catalyzing the dephosphorylation of an isopentenyl disphosphate (IPP) and/or dimethylallyl diphosphate (DMAPP) to 3 -methyl-3 -buten- l-ol and/or 3-methyl-2-buten-l-ol, respectively, and the culturing results in the expression of the enzyme, such that the culturing results in the genetically modified host cell producing 3-methyl-3-buten-l-ol and/or 3-methyl-2-buten-l-ol.
  • IPP isopentenyl disphosphate
  • DMAPP dimethylallyl diphosphate
  • the method comprises: (a) introducing a nucleic acid construct encoding an enzyme capable of catalyzing the dephosphorylation of an isopentenyl disphosphate (IPP) and/or dimethylallyl diphosphate (DMAPP) to 3-methyl- 3-buten-l-ol and/or 3-methyl-2-buten-l-ol, respectively, into a genetically modified host cell; and (b) culturing the genetically modified host cell under a suitable condition such that the enzyme is expressed in the host cell; such that the culturing results in the genetically modified host cell producing 3-methyl-3-buten-l-ol and/or 3-methyl-2-buten-l-ol.
  • IPP isopentenyl disphosphate
  • DMAPP dimethylallyl diphosphate
  • the method further comprises the step of recovering the produced 5-carbon alcohol, wherein the recovering step is concurrent or subsequent to the culturing step.
  • the host cells are capable of biosynthesis of the 5-carbon alcohol compounds by the coexpression of the appropriate mevalonate or non-mevalonate biosynthetic pathway enzymes to produce IPP and/or DMAPP and the phosphatase, and optionally the reductase, in E. coli or yeast.
  • Mevalonate or non-mevalonate biosynthetic pathway enzymes have been thoroughly studied for the production of many medicinally important isoprenoid natural products, and metabolic engineering of the biosynthetic pathway has also been intensively done to improve the production (Ro et al., Nature 2006, 440:940; Reiling et al., Biotechnol. Bioeng. 2004, 87:200; Martin et al., Nat. Biotechnol. 2003, 21:796; which are incorporated in their entireties by reference).
  • the enzymes capable of catalyzing the dephosphorylation of IPP and/or DMAPP include, but are not limited to, a phosphatase, or a homologous enzyme thereof.
  • a homologous enzyme is an enzyme that has a polypeptide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95% or 99% identical to any one of the enzymes described in this specification or in an incorporated reference.
  • the homologous enzyme retains amino acids residues that are recognized as conserved for the enzyme.
  • the homologous enzyme may have non-conserved amino acid residues replaced or found to be of a different amino acid, or amino acid(s) inserted or deleted, but which does not affect or has insignificant effect on the enzymatic activity of the homologous enzyme.
  • the homologous enzyme has an enzymatic activity that is identical or essentially identical to the enzymatic activity any one of the enzymes described in this specification or in an incorporated reference.
  • the homologous enzyme may be found in nature or be an engineered mutant thereof. a) Phosphatases
  • a first reaction in the de novo pathway catalyzes the dephosphorylation of IPP to 3- methyl-3-butenol and DMAPP to 3-methyl-2-butenol.
  • a suitable phosphatase enzyme has an enzymatic activity for cleaving a pyrophosphate from EPP and/or DMAPP, or cleaving a single phosphate multiple times from IPP and/or DMAPP.
  • a suitable phosphatase enzyme is a broad specificity phosphatase PhoE (YhfR) of a Bacillus sp., such as PhoE (YhfR) of Bacillus stearothermophilus (such as strains NGBlOl and 10; Ridgen et al., Protein ScL 2001, 10:1835-1846, which is incorporated in its entirety by reference), Bacillus halodurans (Takami et al., Nucleic Acids Res. (2000) 28:4317-4331, which is incorporated in its entirety by reference) or Bacillus subtilus (Kunst et al., Nature (1997), 390:249-256; Pearson et al., J. Bacteriol.
  • the amino acid sequences are disclosed in Rigden et al. ⁇ Protein ScL (2001) 10:1835-1846), which are incorporated in their entireties by reference.
  • the suitable phosphatase is about 190 to 210, or about 192 to 209, amino acids in length.
  • a homologous enzyme comprises the conserved amino acid residues and sequences are identified in Fig. 2 and in Rigden et al. (Protein ScL (2001) 10:1835-1846).
  • a conserved amino acid sequence is RHG; RHGE; RHGE(T or S); RHGE(T or S)(W or G)N; or RHGX 4 N (where X is any amino acid).
  • a conserved amino acid sequence is RHGEX 3 NX 42 RX 23 EX 56 . 67 H (where X is any amino acid).
  • a conserved amino acid sequence is RHGEX 3 NX 5 QG (where X is any amino acid).
  • a conserved amino acid sequence is RHGX 4 NXy-QDX 2 LXsG (where X is any amino acid). Further conserved amino acid sequences of the phosphatase are shown in Fig. 1 of Rigden et al. (Protein ScL (2001) 10:1835-1846).
  • suitable phosphatases are members of the Nudix hydrolase superfamily from, but not limited to, Escherichia sp., Bacillus sp., Pseudomonas sp., Lactococcus sp., Caulobacter sp., Agrobacterium sp., Synechocytis sp., Streptomyces sp., Saccharomyces sp., human, and mouse.
  • An exemplar nucleic acid sequence of Nudix hydrolase family is found at GenBank accession No. NP_009669.
  • the Nudix superfamily recognizes the general substrate motif nucleoside diphosphate linked to another moiety.
  • the Nudix enzymes have a conserved 23 -amino acid catalytic motif (Nudix box), consisting of the consensus sequence
  • GXsEX 5 [UA] XREX 2 EEXGU where U is an aliphatic, hydrophobic residue and X is any amino acid (McLennan, A.G., Cell MoI. Life Sd. (2006) 63:123). There also exist individuals in the superfamily with slightly altered consensus residues. Examples of Nudix hydrolases from E. coli are listed in Table 1, but are not meant to limit the scope of the present invention.
  • suitable phosphatases are members of the halocid dehalogenase (HAD) superfamily from, but not limited to, Escherichia sp., Bacillus sp., Pseudomonas sp., Lactococcus sp., Caulobacter sp., Agrobacterium sp., Synechocytis sp., Streptomyces sp., Saccharomyces sp., human, and mouse.
  • HAD halocid dehalogenase
  • HADs have 10-30% sequence similarity can be identified from three short conserved sequence motifs that include a conserved aspartic acid, a serine/threonine, a lysine, and a nucleophile, such as an aspartic acid or serine.
  • the consensus sequence for the amino acid sequence motifs are disclosed in figure 2 of Koonin and Tatusov, J. MoI. Biol. (1994) 244:125; which are incorporated in their entireties by reference) and Supplementary Figure 1 of Kuznetsova, et al., (J Biol. Chem.
  • a second reaction optionally, in the pathway catalyzes the reduction of the a, ⁇ - unsaturated bond in 3 ⁇ methyl-2-butenol, converting it to isopentanol (3-methyl-butanol).
  • a reductase capable of reducing a, /S-unsaturated alcohols had not been identified.
  • the enzymes capable of catalyzing the reduction of 3-methyl-2-butenol to 3- methyl-butantol include, but are not limited to, a reductase, or a homologous enzyme thereof.
  • a homologous enzyme is an enzyme that has a polypeptide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95% or 99% identical to any one of the enzymes described in this specification or in an incorporated reference.
  • the homologous enzyme retains amino acids residues that are recognized as conserved for the enzyme.
  • the homologous enzyme may have non-conserved amino acid residues replaced or found to be of a different amino acid, or amino acid(s) inserted or deleted, but which does not affect or has insignificant effect on the enzymatic activity of the homologous enzyme.
  • the homologous enzyme has an enzymatic activity that is identical or essentially identical to the enzymatic activity any one of the enzymes described in this specification or in an incorporated reference.
  • the homologous enzyme may be found in nature or be an engineered mutant thereof.
  • Suitable reductases are described in Ward et al. (Enzyme Microb. Technol. 1990, 12:482-493) and Rodriguez et al. (JAm. Chem. Soc, 2001, 123:1547-1555), which are incorporated in their entireties by reference.
  • a suitable reductase is any enzyme capable of hydrogenating the double bond of 3-methyl-2-buten-l-ol to form 3-methyl-butan-l-ol.
  • a particular suitable reductase is an enzyme that has enoyl reductase activity.
  • Suitable enzymes which may be used to hydrogenate the double bond of 3-methyl-2-buten-l-ol include, but is not limited to, a yeast oxidoreductase (Ward et al., Enzyme Microb. Technol. 1990, 12:482- 493). Such an enzyme is the fatty acid synthase of Saccharomyces cerevisiae, which contains a functional domain with enoyl reductase activity.
  • Suitable reductases are a Torulaspora delbrueckii fatty acid synthase and Kluyveromyces lactis fatty acid synthase (King et al., Yeast 16:499-506 (2000), which is incorporated in its entirety by reference), and E. coli fatty acid synthase.
  • a reductase suitable for use in this invention is an enzyme that has enoyl reductase activity.
  • Such an enzyme is the fatty acid synthase of Saccharomyces cerevisiae., which contains a functional domain with enoyl reductase activity.
  • Suitable enzymes are the fatty acid synthase of Torulaspora delbrueckii and Kluyveromyces lactis (King et al., Yeast (2000) 16:499-506, which is incorporated in its entirety by reference).
  • the reductases are members of the Old Yellow Enzyme (OYE) family of flavoproteins from, but not limited to, Saccharomyces sp., Escherchia sp., Eubacterium sp., Pseudomonas sp., Kluyveromyces sp., Candida sp., Gluconobacter sp., Bacillus sp., and Zymomonas sp..
  • OYE family use flavin mononucleotide (FMN) as a co-factor and share a conserved region of residues with the consensus sequence SNXRTDEYGG(S OR T) where X is any amino acid residue.
  • FMN flavin mononucleotide
  • OYEs are characterized as single-domain proteins with an approximate size of 45 kDa with an a/ ⁇ barrel fold. Structures and descriptions of OYEs are described in Williams and Bruce, Microbiology (2002) 148:1607; which is incorporated by reference in its entirety). An exemplar nucleic acid sequence for oye family members is located at Gene Bank accession No. NP O 12049.
  • enzymes capable of catalyzing the interconversion of branched-C5 alcohols to branched-C5 aldehydes include, but are not limited to, a dehydrogenase, or a homologous enzyme thereof are employed.
  • a homologous enzyme is an enzyme that has a polypeptide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95% or 99% identical to any one of the enzymes described in this specification or in an incorporated reference. The homologous enzyme retains amino acids residues that are recognized as conserved for the enzyme.
  • the homologous enzyme may have non-conserved amino acid residues replaced or found to be of a different amino acid, or amino acid(s) inserted or deleted, but which does not affect or has insignificant effect on the enzymatic activity of the homologous enzyme.
  • the homologous enzyme has an enzymatic activity that is identical or essentially identical to the enzymatic activity any one of the enzymes described in this specification or in an incorporated reference.
  • the homologous enzyme may be found in nature or be an engineered mutant thereof.
  • Suitable alcohol dehydrogenases that can interconvert branched-C5 alcohols to branched-C5 aldehydes are members of the zinc-dependent medium-chain dehydrogenase/reductase (MDR) family.
  • the zinc-dependent ADHs have the consensus sequence: GHEX 2 GX 5 (G 5 A)X 2 (I 5 V 5 A 5 CS) (Larry, et al. 5 Eur. J. Biochem.
  • (2002) 269:5738 which is incorporated by reference in its entirety), and include, but are not limited to, ADHl, ADH2, ADH3, ADH5, SFAl, SORl, YDL246c, XYL2, BDHl, YAL061w, and YCR105w.
  • ADH6 and ADH7 are members of the cinnamyl alcohol dehydrogenase family.
  • the alcohol dehydrogenase are members of the cinnamyl alcohol dehydrogenase family.
  • the alocohol dehydrogenase is ADH6 and ADH7.
  • the nucleic acid constructs of the present invention comprise nucleic acid sequences encoding one or more of the subject enzymes.
  • the nucleic acid of the subject enzymes are operably linked to promoters and optionally control sequences such that the subject enzymes are expressed in a host cell cultured under suitable conditions.
  • the promoters and control sequences are specific for each host cell species.
  • expression vectors comprise the nucleic acid constructs. Methods for designing and making nucleic acid constructs and expression vectors are well known to those skilled in the art.
  • Sequences of nucleic acids encoding the subject enzymes are prepared by any suitable method known to those of ordinary skill in the art, including, for example, direct chemical synthesis or cloning.
  • formation of a polymer of nucleic acids typically involves sequential addition of 3'-blocked and 5'-blocked nucleotide monomers to the terminal 5'-hydroxyl group of a growing nucleotide chain, wherein each addition is effected by nucleophilic attack of the terminal 5'-hydroxyl group of the growing chain on the 3 '-position of the added monomer, which is typically a phosphorus derivative, such as a phosphotriester, phosphoramidite, or the like.
  • the desired sequences may be isolated from natural sources by splitting DNA using appropriate restriction enzymes, separating the fragments using gel electrophoresis, and thereafter, recovering the desired nucleic acid sequence from the gel via techniques known to those of ordinary skill in the art, such as utilization of polymerase chain reactions (PCR; e.g., U.S. Pat. No. 4,683,195).
  • PCR polymerase chain reactions
  • Each nucleic acid sequence encoding the desired subject enzyme can be incorporated into an expression vector. Incorporation of the individual nucleic acid sequences may be accomplished through known methods that include, for example, the use of restriction enzymes (such as BamHI, EcoRI, Hhal, Xhol, Xmal, and so forth) to cleave specific sites in the expression vector, e.g., plasmid.
  • restriction enzymes such as BamHI, EcoRI, Hhal, Xhol, Xmal, and so forth
  • the restriction enzyme produces single stranded ends that may be annealed to a nucleic acid sequence having, or synthesized to have, a terminus with a sequence complementary to the ends of the cleaved expression vector. Annealing is performed using an appropriate enzyme, e.g., DNA ligase.
  • both the expression vector and the desired nucleic acid sequence are often cleaved with the same restriction enzyme, thereby assuring that the ends of the expression vector and the ends of the nucleic acid sequence are complementary to each other.
  • DNA linkers may be used to facilitate linking of nucleic acids sequences into an expression vector.
  • a series of individual nucleic acid sequences can also be combined by utilizing methods that are known to those having ordinary skill in the art (e.g., U.S. Pat. No. 4,683,195).
  • each of the desired nucleic acid sequences can be initially generated in a separate PCR. Thereafter, specific primers are designed such that the ends of the PCR products contain complementary sequences. When the PCR products are mixed, denatured, and reannealed, the strands having the matching sequences at their 3' ends overlap and can act as primers for each other Extension of this overlap by DNA polymerase produces a molecule in which the original sequences are "spliced" together. In this way, a series of individual nucleic acid sequences may be "spliced” together and subsequently transduced into a host cell simultaneously. Thus, expression of each of the plurality of nucleic acid sequences is effected.
  • nucleic acid sequences are then incorporated into an expression vector.
  • the invention is not limited with respect to the process by which the nucleic acid sequence is incorporated into the expression vector.
  • Those of ordinary skill in the art are familiar with the necessary steps for incorporating a nucleic acid sequence into an expression vector.
  • a typical expression vector contains the desired nucleic acid sequence preceded by one or more regulatory regions, along with a ribosome binding site, e.g., a nucleotide sequence that is 3-9 nucleotides in length and located 3-11 nucleotides upstream of the initiation codon in E. coli . See Shine et al. (1975) Nature 254:34 and Steitz, in Biological Regulation and Development: Gene Expression (ed. R. F. Goldberger), vol. 1, p. 349, 1979, Plenum Publishing, N. Y.
  • Regulatory regions include, for example, those regions that contain a promoter and an operator.
  • a promoter is operably linked to the desired nucleic acid sequence, thereby initiating transcription of the nucleic acid sequence via an RNA polymerase enzyme.
  • An operator is a sequence of nucleic acids adjacent to the promoter, which contains a protein- binding domain where a repressor protein can bind. In the absence of a repressor protein, transcription initiates through the promoter. When present, the repressor protein specific to the protein-binding domain of the operator binds to the operator, thereby inhibiting transcription. In this way, control of transcription is accomplished, based upon the particular regulatory regions used and the presence or absence of the corresponding repressor protein.
  • lactose promoters Lad repressor protein changes conformation when contacted with lactose, thereby preventing the Lad repressor protein from binding to the operator
  • tryptophan promoters when complexed with tryptophan, TrpR repressor protein has a conformation that binds the operator; in the absence of tryptophan, the TrpR repressor protein has a conformation that does not bind to the operator.
  • tac promoter See deBoer et al. (1983) Proc. Natl. Acad. ScL USA, 80:21-25.
  • these and other expression vectors may be used in the present invention, and the invention is not limited in this respect.
  • any suitable expression vector may be used to incorporate the desired sequences
  • readily available expression vectors include, without limitation: plasmids, such as pSClOl, pBR322, pBBRlMCS-3, pUR, pEX, pMRlOO, pCR4, pBAD24, pUC19; bacteriophages, such as Ml 3 phage and ⁇ phage.
  • plasmids such as pSClOl, pBR322, pBBRlMCS-3, pUR, pEX, pMRlOO, pCR4, pBAD24, pUC19
  • bacteriophages such as Ml 3 phage and ⁇ phage.
  • the expression vector can be introduced into the host cell, which is then monitored for viability and expression of the sequences contained in the vector.
  • the expression vectors of the invention must be introduced or transferred into the host cell.
  • Such methods for transferring the expression vectors into host cells are well known to those of ordinary skill in the art.
  • one method for transforming E. coli with an expression vector involves a calcium chloride treatment wherein the expression vector is introduced via a calcium precipitate.
  • Other salts e.g., calcium phosphate, may also be used following a similar procedure.
  • electroporation i.e., the application of current to increase the permeability of cells to nucleic acid sequences
  • microinjection of the nucleic acid sequencers provides the ability to transfect host microorganisms.
  • Other means, such as lipid complexes, liposomes, and dendrimers may also be employed. Those of ordinary skill in the art can transfect a host cell with a desired sequence using these or other methods.
  • a culture of potentially transfected host cells may be separated, using a suitable dilution, into individual cells and thereafter individually grown and tested for expression of the desired nucleic acid sequence.
  • plasmids an often-used practice involves the selection of cells based upon antimicrobial resistance that has been conferred by genes intentionally contained within the expression vector, such as the amp, gpt, neo, and hyg genes.
  • the host cell is transformed with at least one expression vector.
  • the vector will contain all of the nucleic acid sequences necessary.
  • the host cell is allowed to grow.
  • this process entails culturing the cells in a suitable medium. It is important that the culture medium contain an excess carbon source, such as a sugar (e.g., glucose) when an intermediate is not introduced. In this way, cellular production of acetyl-CoA, a starting material for IPP and DMAPP synthesis is ensured. When added, the intermediate is present in an excess amount in the culture medium.
  • an excess carbon source such as a sugar (e.g., glucose)
  • the enzymes catalyze the steps necessary for carrying out the steps of IPP and/or DMAPP acid production and the 5-carbon alcohol production, i.e., converting IPP and/or DMAPP into 5-carbon alcohol is 3-methyl- 2-buten-l-ol, 3-methyl-3-buten-l-ol and/or 3-methyl-butan-l-ol.
  • the expressed enzymes catalyze those steps necessary to convert the intermediate into the respective IPP and/or DMAPP.
  • Any means for recovering the 5-carbon alcohol from the host cell may be used. For example, the host cell may be harvested and subjected to hypotonic conditions, thereby lysing the cells. The lysate may then be centrifuged and the supernatant subjected to high performance liquid chromatography (HPLC) or gas chromatography (GC).
  • HPLC high performance liquid chromatography
  • GC gas chromatography
  • the host cells of the present invention are genetically modified in that heterologous nucleic acid have been introduced into the host cells, and as such the genetically modified host cells do not occur in nature.
  • the suitable host cell is one capable of expressing a nucleic acid construct encoding an enzyme capable of catalyzing the dephosphorylation of IPP and/or DMAPP, and optionally an enzyme capable of reducing 3-methyl-2-buten-l-ol into 3-methyl- butan-1-ol. Such enzymes are described herein.
  • the host cell naturally produces EPP and/or DMAPP, and optionally may comprises heterologous nucleic acid constructs capable of expressing one or more genes for producing EPP and/or DMAPP.
  • the gene may be heterogous to the host cell or the gene may be native to the host cell but is operatively linked to a heterologous promoter and one or more control regions which result in a higher expression of the gene in the host cell.
  • the host cell does not naturally produce EPP and/or DMAPP, and comprises heterologous nucleic acid constructs capable of expressing one or more genes for producing EPP and/or DMAPP.
  • the enzyme capable of catalyzing the dephosphorylation of EPP and/or DMAPP can be native or heterologous to the host cell.
  • the enzyme capable of catalyzing the reduction of 3-methyl-2-buten-l-ol into 3-methyl-butan-l-ol can be native or heterologous to the host cell.
  • the host cell is genetically modified to modulate expression of the enzyme. This modification can involve the modification of the chromosomal gene encoding the enzyme in the host cell or a nucleic acid construct encoding the gene of the enzyme is introduced into the host cell.
  • One of the effects of the modification is the expression of the enzyme is modulated in the host cell, such as the increased expression of the enzyme in the host cell as compared to the expression of the enzyme in an unmodified host cell.
  • the host cells produce the EPP and/or DMAPP that is dephosphorylated into
  • the host cell comprises the genes encoding enzymes in the pathway from which the EPP and/or DMAPP are synthesized from acetyl-CoA.
  • the host cell may comprise a gene encoding the enzyme that reduces 3-methyl-2-buten-l-ol into 3-methyl-butan-l-ol.
  • These genes can either be native to the host cell or are heterologous to the host cell and introduced all or in part into the host cell either by integration into the host cell chromosome(s) or an expression vector, or both.
  • the host cells may comprise systems for synthesizing IPP and/or DMAPP.
  • Such systems are taught in U.S. Pat. Nos. 7,172,886 and 7,183,089, and U.S. Pat. Application Pub. No. 2003/0148479, 2006/0079476, 2007/0077616, 2007/0092931, and 2007/0099261, which are incorporated in their entireties by reference.
  • Such methods include producing an IPP and/or DMAPP in a genetically modified host cell, such as E. coli.
  • the host cells may express pyrophosphases which hydrolyze the isoprenyl diphosphate intermediates to the corresponding primary alcohols (Song, Appl. Biochem. Biotechnol. 2006, 128:149, which is incorporated in its entirety by reference).
  • the host cells maybe knocked out for or lack expression of any terpene cyclases which catalyze the formation of terpenes from diphosphate intermediates.
  • IPP and DMAPP are generated in vivo via either the mevalonate pathway or the non-mevalonate pathway (also known as the DXP pathway), which is described in Reiling et al., Biotechnol. Bioeng. 87(2):200-212 (2004), which is incorporated in its entirety by reference.
  • a host cell may naturally be capable of hydrogenating the double bond of 3-methyl-2-buten-l-ol. Such a host cell may not be modified in order to be able to produce 3-methyl-butan-l-ol from 3-methyl-2-buten-l-ol, or the gene encoding the enzyme for catalyzing this reaction can be modified so that expression of the enzyme is increased.
  • a host cell that may not require modification is Saccharomyces cerevisiae.
  • Gramatica et al. ⁇ Expe ⁇ entia 38, 1982 have shown that S. cerevisiae is capable of reducing geraniol to R-(+)-citronellol.
  • Gramatica et al. J Org. Chem. 50, 1985
  • S. cerevisiae is capable of hydrogenating the double bonds in a- or /3-methyl- ⁇ ,/3-unsaturated aldehydes (including alcohols and acetals).
  • yeast can catalyze the conversion of 3- methyl-2-butenol to isopentanol (see Figure 3).
  • any prokaryotic or eukaryotic host cell may be used in the present method so long as it remains viable after being transformed with a sequence of nucleic acids.
  • the host microorganism is bacterial.
  • bacterial host cells include, without limitation, those species assigned to the Escherichia, Enterobacter, Azotobacter, Erwinia, Bacillus, Pseudomonas, Klebsiella, Proteus, Salmonella, Serratia, Shigella, Rhizobia, Vitreoscilla, Synechococcus, and Paracoccus taxonomical classes.
  • the microorganism is a cyanobacteria.
  • the bacterial host is Synechocystis sp..
  • the host cell is not adversely affected by the transduction of the necessary nucleic acid sequences, the subsequent expression of the proteins (i.e., enzymes), or the resulting intermediates required for carrying out the steps associated with the mevalonate pathway.
  • minimal "cross- talk" i.e., interference
  • Suitable eukaryotic cells include, but are not limited to, algal, fungal, insect or mammalian cells, hi some embodiments, suitable fungal cells are yeast cells, such as yeast cells of the Saccharomyces genus. In some embodiments the eukaryotic cell is a green algae. In some embodiments the eukaryotic cell is Chlamydomonas reinhardtii, Scenedesmus obliquus, Chlorella vulgaris or Dunaliella salina.
  • the host cell can further be modified to comprise endogenous solvent efflux system such as AcrAB-TolC (Ramos et al, Annu Rev Microbiol 2002, 56:743, which is incorporated in its entirety by reference) to pump the 5-carbon alcohol produced by the host cell out of the cell.
  • endogenous solvent efflux system such as AcrAB-TolC (Ramos et al, Annu Rev Microbiol 2002, 56:743, which is incorporated in its entirety by reference) to pump the 5-carbon alcohol produced by the host cell out of the cell.
  • the host cell is capable of pumping the produced 5-carbon alcohol out of the cell, the 5-carbon alcohol can be recovered by removal of the supernatant in which the host cell is being cultured.
  • the toxicity of the branched-C5 alcohols will not be problematic for the viability of host cells during fermentation.
  • the minimum inhibitory concentration (MIC) of the alcohols is approximately 1% (w/v) for E. coli.
  • the branched-C5 alcohols begin to phase separate at this concentration from the growth medium.
  • the present invention provides for an isolated 5-carbon alcohol produced from the method of the present invention.
  • Isolating the 5-carbon alcohol involves the separating at least part or all of the host cells, and parts thereof, from which the 5-carbon alcohol was produced, from the isolated 5-carbon alcohol.
  • the isolated 5-carbon alcohol may be free or essentially free of impurities formed from at least part or all of the host cells, and parts thereof.
  • the isolated 5-carbon alcohol is essentially free of these impurities when the amount and properties of the impurities do not interfere in the use of the 5-carbon alcohol as a fuel, such as a fuel in a combustion reaction.
  • These host cells are specifically cells that do not in nature produce the 5-carbon alcohol.
  • the impurities are no more than 5%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% by weight of a composition comprising one or more of the 5-carbon alcohols.
  • the present invention also provides for a combustible composition
  • a combustible composition comprising an isolated 5-carbon alcohol and cellular components, wherein the cellular components do not substantially interfere in the combustion of the composition.
  • the cellular components include whole cells or parts thereof.
  • the cellular components are derived from host cells which produced the 5-carbon alcohol was derived.
  • the 5-carbon alcohol of the present invention are useful as fuels as chemical source of energy that can be used as an alternative to petroleum derived fuels, ethanol and the like.
  • the pMevT plasmid (containing the genes for synthesizing mevalonate from acetyl- CoA) and pMBI (containing the genes for synthesizing IPP and DMAPP from mevalonate) are introduced into E. coli DHlOB, which then is capable of expressing PP and DMAPP.
  • the method for constructing the pMevT plasmid, and nucleotide sequence, are taught in U.S. Pat. No. 7,183,089, which is incorporated in its entirety by reference.
  • the method for constructing the pMBI plasmid is taught in Martin et al. ⁇ Nature Biotechnol.
  • Primers can be designed to PCR Bacillus subtilus phosphatase PhoE (YhfR) from Bacillus subtilus genomic DNA and cloned into a suitable E. coli expression vector.
  • the resultant plasmid is introduced into an E. coli host cell also containing the pMevT and pMBI plasmids.
  • the resulting transformant is cultured in a suitable medium, such as Luria broth (LB) medium at 37°C with the appropriate antibiotics to maintain the plasmids.
  • LB Luria broth
  • the enzymes are induced using the appropriate inducers, such as IPTG or propionate, and incubated at 30 0 C for 3-7 days.
  • the induction of the enzymes results in the production of 3-methyl- 2-buten-l-ol and/or 3-methyl-3-buten-l-ol from DMAPP and/or IPP, respectively.
  • the 3-methyl-2-buten- 1 -ol and/or 3-methyl-3-buten- 1 -ol can be purified and analyzed using a gas chromatography-mass spectrometer (GC-MS).
  • GC-MS gas chromatography-mass spectrometer
  • Primers can be designed to PCR Saccharomyces cerevisiae fatty acid synthase from Saccharomyces cerevisiae genomic DNA and cloned into a suitable E. coli expression vector.
  • the resultant plasmid is introduced into an E. coli host cell also containing the pMevT and pMBI plasmids, and a plasmid expressing Bacillus subtilus phosphatase YhfR.
  • the resulting transformant is cultured in a suitable medium, such as Luria broth (LB) medium at 37 0 C with the appropriate antibiotics to maintain the plasmids.
  • LB Luria broth
  • the enzymes are induced using the appropriate inducers, such as IPTG or propionate, and incubated at 30 0 C for 3-7 days.
  • the induction of the enzymes results in the production of 3-methyl-butan-l-ol.
  • the 3-methyl- butan-1-ol can be purified and analyzed using a GC-MS.
  • the GC-MS data were collected in full-scan mode (m/z 50-300) using a Tr- Wax column (0.25 mm x 30 m, 0.25 ⁇ m film thickness; Thermo Electron) on a PolarisQ GC-MS with TriPlusautosampler (Thermo Electron).
  • the carrier flow was 1.2 ml min "1 , and the inlet temperature was set to 200 0 C.
  • the oven program was as follows: 4O 0 C (1.20 min hold), 40- 130 0 C (25°C min "1 ), 130-220°C(35°C min "1 ).
  • the solvent delay was set at 3.40 min. Samples were normalized using the butanol internal standard and quantified using authentic standards.
  • yeast reductase genes were amplified from a S. cerevisiae BY4742 cDNA library and inserted into pESC-leu with the appropriate restriction enzymes using standard protocols.
  • the cDNA library was made following Invitrogen's suggested method for Superscript III Reverse Transcriptase, the incubation was extended from 1 hour to 3 hours in Step 5 of the manufacturer's protocol.
  • the primers used to amplify YHRl 79w were 5'-AAC CGT CGA CAT GCC ATT TGT TAA GGA CTT TAA G-3' and 5'-TAA CGC TAG CTT AAT TTT TGT CCC AAC CGA GTT TTA GAG C-3 ', and the gene was inserted into the Nhel-Sall sites of pESC- leu.
  • the primers used to amplify YPL171c were 5'- AACCGTCGACATGCCATTTGTAAAAGGTTTTGAGC-3' and 5'- TAACGCTAGCTCAGTTCTTGTTCCAACCTAAATCTAC-S', and the gene was inserted into the Nhel-Sall sites of pESC-leu.
  • the primers used to amplify YOR120w were 5'- AACCGGATCC ATGCCTGCTACTTTACATGATTC-3 ' and 5 ' -
  • TAACCTCGAGTTACTTGAATACTTCGAAAGGAG-S' and the gene was inserted into the BamHI-XhoI sites of pESC-leu.
  • the primers used to amplify YDR368w were 5'- AACCGTCGACATGCCTGCTACGTTAAAGAA-3' and 5'- TAACCTCGAGTCATTGGAAAATTGGGAAG-3', and the gene was inserted into the SaII- Xhol sites of pESC-leu.
  • the primers used to amplify YBRl 49w were 5'- AACCGGATCCATGTCTTCTTCAGTAGCCTC-3' and 5'-
  • the primers used to amplify YIR036c were 5'- AACCGGATCCATGGGC AAGGTTATTTTGATTA-3' and 5'- TAACGCTAGCCTAGCCCTGCACCGGCCCCAGTC-3', and the gene was inserted into the BamHI-Nhel sites of pESC-leu.
  • the primers used to amplify YMR226c were 5 '- AACCGGATCCATGTCCCAAGGTAGAAAAGCTG-S' and 5'- TAACGCTAGCTTATCCACGGAAGATATGATGAGGT-3', and the gene was inserted into the BamHI-Nhel sites of pESC-leu.
  • the primers used to amplify Y0L151w were 5'- AACCGGATCCATGTCAGTTTTCGTTTCAGGTG-
  • TAACCTCGAGTTATATTCTGCCCTCAAATTTTAAAA-S' and the gene was inserted into the BamHI-XhoI sites of pESC-leu.
  • the primers used to amplify YGL157w were 5'- AACCGGATCCATGACTACTGATACCACTGTTTTC-3' and 5'- TAACCTCGAGTTAGGCTTCATTTTGAAC-S', and the gene was inserted into the BamHI- XhoI sites of pESC-leu.
  • the primers used to amplify YDR541c were 5'- AACCGGATCCATGTCTAATACAGTTCTAG-3' and 5'-
  • AACCGGATCCTCAT AATCTGTTCTCCTTCTTC-3' was inserted into the BamHI-XhoI sites of pESC-leu.
  • the primers used to amplify YGL039w were 5'- AACCGTCGAC ATGACTACTGAAAAAACCGTTG-S ' and 5 '-
  • the primers used to amplify YGLl 85c were 5'- AACCGGATCCATGTGCGATTCTCCTGCA-3' and 5'- TAACCTCGAGTCAAACTACACGGGAGAAATGCT-S', and the gene was inserted into the BamHI-XhoI sites of pESC-leu.
  • the primers used to amplify YNL274c were 5'- AACCGGATCCATGAGTAAGAAACCAATTGTTTTG-3' and 5'- TAACCTCGAGTCAAACTAATGGCTTAGATTC-3', and the gene was inserted into the BamHI-XhoI sites of pESC-leu.
  • the primers used to amplify YPLl 13c were 5'- AACCGGATCCATGATTACTTCAATTGACATAGCAG-3 ' and
  • TAACGCTAGCTCAGTTGAGCACATACTTACCATCAC-S' and the gene was inserted into the BamHI-NheI sites of pESC-leu.
  • the primers used to amplify YCRl 07w were 5'- AACCGGATCCATGATTGGGTCCGCGTCCGA-3' and 5'- TAACCTCGAGCTAAACATTATTCGTACC-3', and the gene was inserted into the BamHI-XhoI sites of pESC-leu.
  • the primers used to amplify YNL331 c were 5 '- AACCGGATCCATGACTGACTTGTTTAAACCTC-S' and 5'-
  • TAACCTCGAGCTAATTGTCAAAAGCTATCCTG-3' and the gene was inserted into the BamHI-XhoI sites of pESC-leu.
  • the primers used to amplify YPL275w were 5'- AACCGGATCCATGGTGGTCATCAAT AAGCAATTA-3' and 5'- TAACCTCGAGTTATTTCTTCTGTCCATAAGCTCTGG-S', and the gene was inserted into the BamHI-XhoI sites of pESC-leu.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention provides for a method for producing a 5-carbon alcohol in a genetically modified host cell. In one embodiment, the method comprises culturing a genetically modified host cell which expresses a first enzyme capable of catalyzing the dephosphorylation of an isopentenyl disphosphate (EPP) or dimethylallyl diphosphate (DMAPP), such as a Bacillus subtilis phosphatase (YhfR), under a suitable condition so that 5-carbon alcohol is 3-methyl-2-buten-1-ol and/or 3-methyl-3-buten-1-ol is produced. Optionally, the host cell may further comprise a second enzyme capable of reducing a 3-methyl-2-buten-1-ol to 3-methyl-butan-1-ol, such as a reductase.

Description

HOST CELLS AND METHODS FOR PRODUCING 3-METHYL-2-BUTEN-1-OL, 3-METHYL-3-BUTEN-1-OL, AND
3-METHYL-BUTAN-l-OL
RELATED PATENT APPLICATIONS
[0001] This application claims priority to U.S. provisional application No. 60/947,285, filed June 29, 2007, the contents of which are hereby incorporated by reference in the entirety.
STATEMENT OFGOVERNMENT SUPPORT [0002] The invention described and claimed herein was made utilizing funds supplied by the U.S. Department of Energy under Contract No. DE-AC02-05CH11231. The government has certain rights in this invention.
FIELD OF THE INVENTION [0003] The present invention is in the field of production of 5-carbon alcohol compounds, and in particular host cells that are genetically modified to produce 5-carbon alcohol compounds.
BACKGROUND OF THE INVENTION [0004] Petroleum derived fuels have been the primary source of energy for over a hundred years. Petroleum is formed over millions of years in nature and is a non-renewable source of energy. A significant amount of research in biofuels has been ongoing for decades. Within this field, ethanol has been studied intensively as a gasoline substitute. However, the efficiency of ethanol as a fuel remains debatable. (Pimentel, Natural Resources Research (2005) 14:65; Farrell et al., Science (2006), 311 :506).
[0005] The present invention provides methods for the biosynthesis of branched 5-carbon alcohols (branched-C5 alcohols) from the isoprenoid precursors isopentyl pyrophosphate (IPP) or dimethylallyl diphosphate (DMAPP).
[0006] Isoprenoids are compounds derived from the five-carbon molecule, IPP. Investigators have identified over 29,000 individual isoprenoid compounds, with new ones continuously being discovered. Isoprenoids are often isolated from natural products, such as plants and microorganisms, which use isopentenyl pyrophosphate as a basic building block to form relatively complex structures. Vital to living organisms, isoprenoids serve to maintain cellular fluidity and electron transport, as well as function as natural pesticides, to name just a few of their roles in vivo. Furthermore, the pharmaceutical and chemical communities use isoprenoids as pharmaceuticals, nutriceuticals, flavoring agents, and agricultural pest control agents. Given their importance in biological systems and usefulness in a broad range of applications, isoprenoids have been the focus of much attention by scientists.
[0007] Conventional means for producing isoprenoids include extraction from biological materials (e.g., plants, microbes, and animals) and partial or total organic synthesis in the laboratory. Such means, however, have generally been unsatisfactory as they involve the use of toxic solvents and provide a low yield of the desired isoprenoid. Recently, researchers have looked to the biosynthetic production of isoprenoids. U.S. Pat. No. 6,291,745 describes the production of limonene and other metabolites in plants. U.S. Pat. No. 6,190,895 describes nucleic acid sequences that code for the expression of l-deoxyxylulose-5-phosphate synthase, an enzyme used in one biological pathway for the synthesis of isopentenyl pyrophosphate. U.S. Pat. No. 7,172,886 describes the cloning of genes for a mevalonate- isoprenoid pathway and synthesizing an isoprenoid or an isoprenoid precursor via the mevalonate pathway in a host cell. U.S. Pat. No. 7,183,089 describes a method for enhancing production of isoprenoid compounds in a host cell by modulating the level of hydroxymethylglutaryl-CoA (HMG-CoA) in the cell, such that the level of HMG-CoA is not toxic to the cell and does not substantially inhibit cell growth.
[0008] U.S. Pat. Nos. 5,460,949; 6,531,303; and 6,689,593; U.S. Pat. Pub. Nos. 2003/
0148479; 2004/0029239; 2004/005678; 2004/0063182; 2004/0072323; 2004/0077039; 2004/0110259; and 2004/0194162; Martin et al. (2003) Nat. Biotech. 21(7):796-802;
Polakowski et al. (1998) Appl. Microbiol. Biotechnol. 49:67-71; Wilding et al. (2000)
J. Bacteriol. 182(15):4319-27; Donald et al. (1997) Appl. Env. Microbiol. 63:3341-3344;
Jackson et al. (2003) Organ. Lett. 5: 1629-1632; Hamano et al. (2001) Biosci. Biotechnol.
Biochem. 65:1627-1635; Kuzuyama (2004) Biosci. Biotechnol. Biochem. 68(4):931-934; Kazuhiko (2004) Biotechnol. Lett. 26 : 1487- 1491 ; Brock et al. (2004) Eur. J. Biochem .
271:3227-3241; Choi et al. (1999) Appl. Environ. Microbiol. 65:4363-4368; Parke et al.
(2004) Appl. Environ. Microbiol. 70:2974-2983; Subrahmanyam et al. (1998) J Bacteriol. 180:4596-4602; Murli et al. (2003) J. Ind. Microbiol. Biotechnol. 30:560-509. These references are hereby incorporated in their entireties by reference.
SUMMARY OF THE INVENTION [0009] The present invention provides for a method of producing a 5-carbon alcohol in a genetically modified host cell. The method comprises culturing the genetically modified host cell under a suitable condition such that the culturing results in the genetically modified host cell producing a 5-carbon alcohol. The host cell comprises an enzyme capable of catalyzing the dephosphorylation of an isopentenyl disphosphate (IPP) or dimethylallyl diphosphate (DMAPP), and optionally a second enzyme capable of reducing a 3-methyl-2-buten-l-ol into 3-methyl-butan-l-ol. The 5-carbon alcohol is 3-methyl-2-buten-l-ol, 3-methyl-3-buten-l-ol, or 3-methyl-butan-l-ol, or any combination thereof.
[0010] The present invention also provides for a genetically modified host cell useful for the methods of the present invention. [0011 ] The present invention further provides for an isolated 3-methyl-2-buten- 1 -ol, 3-methyl-3-buten-l-ol or 3-methyl-butan-l-ol produced from the method of the present invention.
BRIEF DESCRIPTION OF THE DRAWINGS [0012] The foregoing aspects and others will be readily appreciated by the skilled artisan from the following description of illustrative embodiments when read in conjunction with the accompanying drawings.
[0013] Figure 1 shows the enzymatic pathway for producing 3-methyl-2-buten-l-ol, 3-methyl-3-buten-l-ol and 3-methyl-butan-l-ol. [0014] Figure 2 shows the sequence alignment of Bacillus stearothermophilus NGBlOl YhfR with sequences of YhfR. homologs in other Bacillus strains and species. Conserved amino acid residues are in bold and triangles mark amino acid residues lining the active site cleft of YhfR; filled triangles denote the conserved amino acid residues that form the catalytic core; and open triangles denote other positions. [0015] Figure 3 shows the relative transformation of 3-methyl-2-butenol and 3-methyl-3- butenol to isopentanol by Saccharomyces cerevisiae. The y-axis is milligrams of isopentanol/L/O.D.. Dark shaded bars represent the production of isopentanol by S. cerevisiae in the absence of added alcohol substrate. Light shaded bars represent transformation of substrate alcohol by S. cerevisiae into isopentanol.
[0016] Figure 4 shows the relative transformation of 3-methyl-2-butenol to isopentanol by Saccharomyces cerevisiae with or without over-expressing oye2. The y-axis is milligrams of isopentanol/L/O.D.. Dark shaded bars represent the production of isopentanol by S. cerevisiae in the absence of added alcohol substrate. Light shaded bars represent transformation of substrate alcohol by S. cerevisiae into isopentanol.
[0017] Figure 5 shows the relative transformation of 3-methyl-2-butenol to isopentanol by Saccharomyces cerevisiae with or without over-expressing oye3 (YPL171c).shows a hypothetical mechanism for the reduction of 3-methyl-2-butenol to isopentanol by OYE2.
[0018] Figure 6 shows a hypothetical mechanism for the reduction of 3-methyl-2-butenol to isopentanol by OYE.
DETAILED DESCRIPTION OF THE INVENTION [0019] Before the invention is described in detail, it is to be understood that, unless otherwise indicated, this invention is not limited to particular sequences, expression vectors, enzymes, host microorganisms, or processes, as such may vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and is not intended to be limiting. [0020] In order to more fully appreciate the invention the following definitions are provided.
[0021] As used in the specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to an "expression vector" includes a single expression vector as well as a plurality of expression vectors, either the same (e.g., the same operon) or different; reference to "cell" includes a single cell as well as a plurality of cells; and the like.
[0022] The terms "optional" or "optionally" as used herein mean that the subsequently described feature or structure may or may not be present, or that the subsequently described event or circumstance may or may not occur, and that the description includes instances where a particular feature or structure is present and instances where the feature or structure is absent, or instances where the event or circumstance occurs and instances where it does not.
[0023] The terms "host cell" and "host microorganism" are used interchangeably herein to refer to a living biological cell that can be transformed via insertion of an expression vector. Thus, a host organism or cell as described herein may be a prokaryotic organism (e.g., an organism of the kingdom Eubacteria) or a eukaryotic cell. As will be appreciated by one of ordinary skill in the art, a prokaryotic cell lacks a membrane-bound nucleus, while a eukaryotic cell has a membrane-bound nucleus.
[0024] The term "heterologous DNA" as used herein refers to a polymer of nucleic acids wherein at least one of the following is true: (a) the sequence of nucleic acids is foreign to (i.e., not naturally found in) a given host microorganism; (b) the sequence may be naturally found in a given host microorganism, but in an unnatural (e.g., greater than expected) amount; or (c) the sequence of nucleic acids comprises two or more subsequences that are not found in the same relationship to each other in nature. For example, regarding instance (c), a heterologous nucleic acid sequence that is recombinantly produced will have two or more sequences from unrelated genes arranged to make a new functional nucleic acid. Specifically, the present invention describes the introduction of an expression vector into a host microorganism, wherein the expression vector contains a nucleic acid sequence coding for an enzyme that is not normally found in a host microorganism. With reference to the host microorganism's genome, then, the nucleic acid sequence that codes for the enzyme is heterologous.
[0025] The term "mevalonate pathway" is used herein to refer to the pathway that converts acetyl-CoA to isopentenyl pyrophosphate through a mevalonate intermediate.
[0026] The terms "expression vector" or "vector" refer to a compound and/or composition that transduces, transforms, or infects a host microorganism, thereby causing the cell to express nucleic acids and/or proteins other than those native to the cell, or in a manner not native to the cell. An "expression vector" contains a sequence of nucleic acids (ordinarily RNA or DNA) to be expressed by the host microorganism. Optionally, the expression vector also comprises materials to aid in achieving entry of the nucleic acid into the host microorganism, such as a virus, liposome, protein coating, or the like. The expression vectors contemplated for use in the present invention include those into which a nucleic acid sequence can be inserted, along with any preferred or required operational elements. Further, the expression vector must be one that can be transferred into a host microorganism and replicated therein. Preferred expression vectors are plasmids, particularly those with restriction sites that have been well documented and that contain the operational elements preferred or required for transcription of the nucleic acid sequence. Such plasmids, as well as other expression vectors, are well known to those of ordinary skill in the art.
[0027] The term "transduce" as used herein refers to the transfer of a sequence of nucleic acids into a host microorganism or cell. Only when the sequence of nucleic acids becomes stably replicated by the cell does the host microorganism or cell become "transformed." As will be appreciated by those of ordinary skill in the art, "transformation" may take place either by incorporation of the sequence of nucleic acids into the cellular genome, i.e., chromosomal integration, or by extrachromosomal integration. In contrast, an expression vector, e.g., a virus, is "infective" when it transduces a host microorganism, replicates, and (without the benefit of any complementary virus or vector) spreads progeny expression vectors, e.g., viruses, of the same type as the original transducing expression vector to other microorganisms, wherein the progeny expression vectors possess the same ability to reproduce.
[0028] The terms "isolated" or "biologically pure" refer to material that is substantially or essentially free of components that normally accompany it in its native state.
[0029] As used herein, the terms "nucleic acid sequence," "sequence of nucleic acids," and variations thereof shall be generic to polydeoxyribonucleotides (containing 2-deoxy-
D-ribose), to polyribonucleotides (containing D-ribose), to any other type of polynucleotide that is an N-glycoside of a purine or pyrimidine base, and to other polymers containing nonnucleotidic backbones, provided that the polymers contain nucleobases in a configuration that allows for base pairing and base stacking, as found in DNA and RNA. Thus, these terms include known types of nucleic acid sequence modifications, for example, substitution of one or more of the naturally occurring nucleotides with an analog; intemucleotide modifications, such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), with negatively charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), and with positively charged linkages (e.g., arninoalklyphosphoramidates, aminoalkylphosphotriesters); those containing pendant moieties, such as, for example, proteins (including nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.); those with intercalators (e.g., acridine, psoralen, etc.); and those containing chelators (e.g., metals, radioactive metals, boron, oxidative metals, etc.). As used herein, the symbols for nucleotides and polynucleotides are those recommended by the IUPAC-IUB Commission of Biochemical Nomenclature (Biochem. 9:4022, 1970).
[0030] The term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter) and a second nucleic acid sequence, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence.
[0031] "Alga," "algal," and "microalgae" or the like, refere to plants belonging to the subphylum Algae of the phylum Thallophyta. The algae are unicellular, photosynthetic, oxygenic algae and are non-parasitis plants without roots, stems, or leaves; they contain chlorophyll and have a great variety in size, from microscopic to large seaweeds. Green algae, belonging to Eukaryota~Viridiplantae~Chlorophyta~Chlorophyceae, can be used in the invention. However, algae useful in the invention may also be blue-green, red, or brown.
Introduction [0032] The present invention provides methods for constructing a de novo synthetic pathway, in a genetically modified host cell, for the production of C5-isoprenyl alcohols and isopentanol using isopentenyl disphosphate (IPP) and dimethylallyl diphosphate (DMAPP) as substrates. These substrates can be derived from the non-mevalonate as well as mevalonate pathways. [0033] In some embodiments of the invention, for the method for producing a 5-carbon alcohol in a genetically modified host cell, the method comprises: culturing a genetically modified host cell under a suitable condition, wherein the genetically modified host cell comprises a first enzyme capable of catalyzing the dephosphorylation of an isopentenyl disphosphate (IPP) or dimethylallyl diphosphate (DMAPP) to 3-methyl-3-buten-l-ol or 3-methyl-2-buten-l-ol, respectively, and optionally a second enzyme capable of reducing 3-methyl-2-buten-l-ol to 3-methyl-butan-l-ol.
[0034] In some embodiments of the invention, for the method for producing a 5-carbon alcohol in a genetically modified host cell, the method comprises: culturing a genetically modified host cell under a suitable condition, wherein the genetically modified host cell comprises an enzyme capable of catalyzing the dephosphorylation of an isopentenyl disphosphate (IPP) or dimethylallyl diphosphate (DMAPP) to 3-methyl-2-buten-l-ol or 3-methyl-3 -buten- 1 -ol.
[0035] In some embodiments of the invention, for the method for producing a 5-carbon alcohol in a genetically modified host cell, the method comprises: culturing a genetically modified host cell under a suitable condition, wherein the genetically modified host cell comprises a first enzyme capable of catalyzing the dephosphorylation of a dimethylallyl diphosphate (DMAPP) to 3-methyl-2-buten-l-ol, and a second enzyme capable of reducing 3-methyl-2-buten-l-ol to 3-methyl-butan-l-ol.
[0036] In some embodiments the second enzyme capable of reducing 3-methyl-2-buten- l-ol to 3-methyl-butan-l-ol is a member of, or homologous to, the OYE family of reductases. In some embodiments the OYE family member is 0YE2 or a homolog. In some embodiments the OYE family member is OYE3 or a homolog.
[0037] In some embodiments of the invention, for the method for producing a 5-carbon alcohol in a genetically modified host cell, the method comprises: culturing a genetically modified host cell under a suitable condition, wherein the genetically modified host cell comprises a nucleic acid construct encoding an enzyme capable of catalyzing the dephosphorylation of an isopentenyl disphosphate (IPP) and/or dimethylallyl diphosphate (DMAPP) to 3 -methyl-3 -buten- l-ol and/or 3-methyl-2-buten-l-ol, respectively, and the culturing results in the expression of the enzyme, such that the culturing results in the genetically modified host cell producing 3-methyl-3-buten-l-ol and/or 3-methyl-2-buten-l-ol.
[0038] In some embodiments of the invention, for the method for producing a 5-carbon alcohol in a genetically modified host cell, the method comprises: (a) introducing a nucleic acid construct encoding an enzyme capable of catalyzing the dephosphorylation of an isopentenyl disphosphate (IPP) and/or dimethylallyl diphosphate (DMAPP) to 3-methyl- 3-buten-l-ol and/or 3-methyl-2-buten-l-ol, respectively, into a genetically modified host cell; and (b) culturing the genetically modified host cell under a suitable condition such that the enzyme is expressed in the host cell; such that the culturing results in the genetically modified host cell producing 3-methyl-3-buten-l-ol and/or 3-methyl-2-buten-l-ol.
[0039] In some embodiments of the invention, the method further comprises the step of recovering the produced 5-carbon alcohol, wherein the recovering step is concurrent or subsequent to the culturing step. [0040] In some embodiments, the host cells are capable of biosynthesis of the 5-carbon alcohol compounds by the coexpression of the appropriate mevalonate or non-mevalonate biosynthetic pathway enzymes to produce IPP and/or DMAPP and the phosphatase, and optionally the reductase, in E. coli or yeast. Mevalonate or non-mevalonate biosynthetic pathway enzymes have been thoroughly studied for the production of many medicinally important isoprenoid natural products, and metabolic engineering of the biosynthetic pathway has also been intensively done to improve the production (Ro et al., Nature 2006, 440:940; Reiling et al., Biotechnol. Bioeng. 2004, 87:200; Martin et al., Nat. Biotechnol. 2003, 21:796; which are incorporated in their entireties by reference). Both mevalonate pathway and non- mevalonate pathway have been engineered to produce high titer of isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) (Martin et al., Nat. Biotechnol. 2003, 21:796). Instead of terpene cyclases which catalyze the formation of terpenes from diphosphate intermediates, pyrophosphatases are expressed for the production of terpenol and they hydrolyze diphosphate intermediates to the corresponding primary alcohols (Song, Appl. Biochem. Biotechnol. 2006, 128:149, which is incorporated in its entirety by reference).
I. Further Description of the Invention
A. Enzymes, and constructs encoding thereof
1. Enzymes
[0041] The enzymes capable of catalyzing the dephosphorylation of IPP and/or DMAPP include, but are not limited to, a phosphatase, or a homologous enzyme thereof. A homologous enzyme is an enzyme that has a polypeptide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95% or 99% identical to any one of the enzymes described in this specification or in an incorporated reference. The homologous enzyme retains amino acids residues that are recognized as conserved for the enzyme. The homologous enzyme may have non-conserved amino acid residues replaced or found to be of a different amino acid, or amino acid(s) inserted or deleted, but which does not affect or has insignificant effect on the enzymatic activity of the homologous enzyme. The homologous enzyme has an enzymatic activity that is identical or essentially identical to the enzymatic activity any one of the enzymes described in this specification or in an incorporated reference. The homologous enzyme may be found in nature or be an engineered mutant thereof. a) Phosphatases
[0042] A first reaction in the de novo pathway catalyzes the dephosphorylation of IPP to 3- methyl-3-butenol and DMAPP to 3-methyl-2-butenol. A suitable phosphatase enzyme has an enzymatic activity for cleaving a pyrophosphate from EPP and/or DMAPP, or cleaving a single phosphate multiple times from IPP and/or DMAPP. A suitable phosphatase enzyme is a broad specificity phosphatase PhoE (YhfR) of a Bacillus sp., such as PhoE (YhfR) of Bacillus stearothermophilus (such as strains NGBlOl and 10; Ridgen et al., Protein ScL 2001, 10:1835-1846, which is incorporated in its entirety by reference), Bacillus halodurans (Takami et al., Nucleic Acids Res. (2000) 28:4317-4331, which is incorporated in its entirety by reference) or Bacillus subtilus (Kunst et al., Nature (1997), 390:249-256; Pearson et al., J. Bacteriol. (2000) 182:4121^-123; which are incorporated in their entireties by reference). The amino acid sequences are disclosed in Rigden et al. {Protein ScL (2001) 10:1835-1846), which are incorporated in their entireties by reference. In some embodiments, the suitable phosphatase is about 190 to 210, or about 192 to 209, amino acids in length. A homologous enzyme comprises the conserved amino acid residues and sequences are identified in Fig. 2 and in Rigden et al. (Protein ScL (2001) 10:1835-1846). In some embodiments, a conserved amino acid sequence is RHG; RHGE; RHGE(T or S); RHGE(T or S)(W or G)N; or RHGX4N (where X is any amino acid). In some embodiments, a conserved amino acid sequence is RHGEX3NX42RX23EX56.67H (where X is any amino acid). In some embodiments, a conserved amino acid sequence is RHGEX3NX5QG (where X is any amino acid). In some embodiments, a conserved amino acid sequence is RHGX4NXy-QDX2LXsG (where X is any amino acid). Further conserved amino acid sequences of the phosphatase are shown in Fig. 1 of Rigden et al. (Protein ScL (2001) 10:1835-1846).
[0043] Two exemplary enzyme superfamilies with members able to catalyze the hydrolysis of phosphoester bonds are Nudix (Mildvan et al, Arch. Biochem. Biophysics (2005) 433 : 129) and haloacid dehalogenase (HAD) (Allen and Dunaway-Mariano, Trends Biochem. ScL (2004) 29:495). (see Table 1). Another superfamily able to hydrolyze phosphoester bonds is the cofactor-dependent phosphoglycerate mutase (Rigden et al., J. MoI. Biol. (2003) 324:411). Other protein families able to dephosphorylate IPP and DMAPP can be used with the current invention.
[0044] In some embodiments suitable phosphatases are members of the Nudix hydrolase superfamily from, but not limited to, Escherichia sp., Bacillus sp., Pseudomonas sp., Lactococcus sp., Caulobacter sp., Agrobacterium sp., Synechocytis sp., Streptomyces sp., Saccharomyces sp., human, and mouse. An exemplar nucleic acid sequence of Nudix hydrolase family is found at GenBank accession No. NP_009669. hi some embodiments the Nudix superfamily recognizes the general substrate motif nucleoside diphosphate linked to another moiety. In some embodiments the Nudix enzymes have a conserved 23 -amino acid catalytic motif (Nudix box), consisting of the consensus sequence
GXsEX5[UA] XREX2EEXGU, where U is an aliphatic, hydrophobic residue and X is any amino acid (McLennan, A.G., Cell MoI. Life Sd. (2006) 63:123). There also exist individuals in the superfamily with slightly altered consensus residues. Examples of Nudix hydrolases from E. coli are listed in Table 1, but are not meant to limit the scope of the present invention.
[0045] In some embodiments suitable phosphatases are members of the halocid dehalogenase (HAD) superfamily from, but not limited to, Escherichia sp., Bacillus sp., Pseudomonas sp., Lactococcus sp., Caulobacter sp., Agrobacterium sp., Synechocytis sp., Streptomyces sp., Saccharomyces sp., human, and mouse. HADs have 10-30% sequence similarity can be identified from three short conserved sequence motifs that include a conserved aspartic acid, a serine/threonine, a lysine, and a nucleophile, such as an aspartic acid or serine. The consensus sequence for the amino acid sequence motifs are disclosed in figure 2 of Koonin and Tatusov, J. MoI. Biol. (1994) 244:125; which are incorporated in their entireties by reference) and Supplementary Figure 1 of Kuznetsova, et al., (J Biol. Chem.
(2006) 281 :36149; which is incorporated in their entireties by reference). Examples of HADs from E. coli are listed in Table 1, but are not meant to limit the scope of the present invention. b) Reductases
[0046] A second reaction, optionally, in the pathway catalyzes the reduction of the a, β- unsaturated bond in 3~methyl-2-butenol, converting it to isopentanol (3-methyl-butanol). Prior to the present invention a reductase capable of reducing a, /S-unsaturated alcohols had not been identified.
[0047] The enzymes capable of catalyzing the reduction of 3-methyl-2-butenol to 3- methyl-butantol include, but are not limited to, a reductase, or a homologous enzyme thereof. A homologous enzyme is an enzyme that has a polypeptide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95% or 99% identical to any one of the enzymes described in this specification or in an incorporated reference. The homologous enzyme retains amino acids residues that are recognized as conserved for the enzyme. The homologous enzyme may have non-conserved amino acid residues replaced or found to be of a different amino acid, or amino acid(s) inserted or deleted, but which does not affect or has insignificant effect on the enzymatic activity of the homologous enzyme. The homologous enzyme has an enzymatic activity that is identical or essentially identical to the enzymatic activity any one of the enzymes described in this specification or in an incorporated reference. The homologous enzyme may be found in nature or be an engineered mutant thereof.
[0048] Suitable reductases are described in Ward et al. (Enzyme Microb. Technol. 1990, 12:482-493) and Rodriguez et al. (JAm. Chem. Soc, 2001, 123:1547-1555), which are incorporated in their entireties by reference. A suitable reductase is any enzyme capable of hydrogenating the double bond of 3-methyl-2-buten-l-ol to form 3-methyl-butan-l-ol. A particular suitable reductase is an enzyme that has enoyl reductase activity. Suitable enzymes which may be used to hydrogenate the double bond of 3-methyl-2-buten-l-ol include, but is not limited to, a yeast oxidoreductase (Ward et al., Enzyme Microb. Technol. 1990, 12:482- 493). Such an enzyme is the fatty acid synthase of Saccharomyces cerevisiae, which contains a functional domain with enoyl reductase activity. Other suitable reductases are a Torulaspora delbrueckii fatty acid synthase and Kluyveromyces lactis fatty acid synthase (King et al., Yeast 16:499-506 (2000), which is incorporated in its entirety by reference), and E. coli fatty acid synthase. [0049] In some embodiments a reductase suitable for use in this invention is an enzyme that has enoyl reductase activity. Such an enzyme is the fatty acid synthase of Saccharomyces cerevisiae., which contains a functional domain with enoyl reductase activity. Other suitable enzymes are the fatty acid synthase of Torulaspora delbrueckii and Kluyveromyces lactis (King et al., Yeast (2000) 16:499-506, which is incorporated in its entirety by reference).
[0050] In some embodiments the reductases are members of the Old Yellow Enzyme (OYE) family of flavoproteins from, but not limited to, Saccharomyces sp., Escherchia sp., Eubacterium sp., Pseudomonas sp., Kluyveromyces sp., Candida sp., Gluconobacter sp., Bacillus sp., and Zymomonas sp.. Members of the OYE family use flavin mononucleotide (FMN) as a co-factor and share a conserved region of residues with the consensus sequence SNXRTDEYGG(S OR T) where X is any amino acid residue. OYEs are characterized as single-domain proteins with an approximate size of 45 kDa with an a/β barrel fold. Structures and descriptions of OYEs are described in Williams and Bruce, Microbiology (2002) 148:1607; which is incorporated by reference in its entirety). An exemplar nucleic acid sequence for oye family members is located at Gene Bank accession No. NP O 12049.
[0051] Without limitation to a particular theory or mode of action a hypothetical mechanism by which OYE proteins might be involved in the reduction of 3-methyl-2-butenol is provided (Figure 6). We propose that yeast alcohol dehydrogenase (ADH) first converts the alkenol to 3-methyl-2-butenal before the carbon-carbon double bond is reduced by OYE2. The aldehyde intermediate is then reduced to isopentanol. c) Alcohol Dehydrogenases
[0052] In some embodiments enzymes capable of catalyzing the interconversion of branched-C5 alcohols to branched-C5 aldehydes include, but are not limited to, a dehydrogenase, or a homologous enzyme thereof are employed. A homologous enzyme is an enzyme that has a polypeptide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95% or 99% identical to any one of the enzymes described in this specification or in an incorporated reference. The homologous enzyme retains amino acids residues that are recognized as conserved for the enzyme. The homologous enzyme may have non-conserved amino acid residues replaced or found to be of a different amino acid, or amino acid(s) inserted or deleted, but which does not affect or has insignificant effect on the enzymatic activity of the homologous enzyme. The homologous enzyme has an enzymatic activity that is identical or essentially identical to the enzymatic activity any one of the enzymes described in this specification or in an incorporated reference. The homologous enzyme may be found in nature or be an engineered mutant thereof.
[0053] Suitable alcohol dehydrogenases (ADHs) that can interconvert branched-C5 alcohols to branched-C5 aldehydes are members of the zinc-dependent medium-chain dehydrogenase/reductase (MDR) family. The zinc-dependent ADHs have the consensus sequence: GHEX2GX5(G5A)X2(I5V5A5CS) (Larry, et al.5 Eur. J. Biochem. (2002) 269:5738, which is incorporated by reference in its entirety), and include, but are not limited to, ADHl, ADH2, ADH3, ADH5, SFAl, SORl, YDL246c, XYL2, BDHl, YAL061w, and YCR105w.
[0054] Yeast ADHs demonstrate promiscuous oxidase and reductase activities toward a wide variety of substrates (Dickinson and Dack, Chem-Biol. Inter. (2001) 130-132:417). ADH6 and ADH7 are members of the cinnamyl alcohol dehydrogenase family. In some embodiments the alcohol dehydrogenase are members of the cinnamyl alcohol dehydrogenase family. In some embodiments the alocohol dehydrogenase is ADH6 and ADH7.
2. Constructs
[0055] The nucleic acid constructs of the present invention comprise nucleic acid sequences encoding one or more of the subject enzymes. The nucleic acid of the subject enzymes are operably linked to promoters and optionally control sequences such that the subject enzymes are expressed in a host cell cultured under suitable conditions. The promoters and control sequences are specific for each host cell species. In some embodiments, expression vectors comprise the nucleic acid constructs. Methods for designing and making nucleic acid constructs and expression vectors are well known to those skilled in the art.
[0056] Sequences of nucleic acids encoding the subject enzymes are prepared by any suitable method known to those of ordinary skill in the art, including, for example, direct chemical synthesis or cloning. For direct chemical synthesis, formation of a polymer of nucleic acids typically involves sequential addition of 3'-blocked and 5'-blocked nucleotide monomers to the terminal 5'-hydroxyl group of a growing nucleotide chain, wherein each addition is effected by nucleophilic attack of the terminal 5'-hydroxyl group of the growing chain on the 3 '-position of the added monomer, which is typically a phosphorus derivative, such as a phosphotriester, phosphoramidite, or the like. Such methodology is known to those of ordinary skill in the art and is described in the pertinent texts and literature (e.g., in Matteuci et al. (1980) TeL Lett. 521:719; U.S. Pat. Nos. 4,500,707; 5,436,327; and 5,700,637). In addition, the desired sequences may be isolated from natural sources by splitting DNA using appropriate restriction enzymes, separating the fragments using gel electrophoresis, and thereafter, recovering the desired nucleic acid sequence from the gel via techniques known to those of ordinary skill in the art, such as utilization of polymerase chain reactions (PCR; e.g., U.S. Pat. No. 4,683,195).
[0057] Each nucleic acid sequence encoding the desired subject enzyme can be incorporated into an expression vector. Incorporation of the individual nucleic acid sequences may be accomplished through known methods that include, for example, the use of restriction enzymes (such as BamHI, EcoRI, Hhal, Xhol, Xmal, and so forth) to cleave specific sites in the expression vector, e.g., plasmid. The restriction enzyme produces single stranded ends that may be annealed to a nucleic acid sequence having, or synthesized to have, a terminus with a sequence complementary to the ends of the cleaved expression vector. Annealing is performed using an appropriate enzyme, e.g., DNA ligase. As will be appreciated by those of ordinary skill in the art, both the expression vector and the desired nucleic acid sequence are often cleaved with the same restriction enzyme, thereby assuring that the ends of the expression vector and the ends of the nucleic acid sequence are complementary to each other. In addition, DNA linkers may be used to facilitate linking of nucleic acids sequences into an expression vector.
[0058] A series of individual nucleic acid sequences can also be combined by utilizing methods that are known to those having ordinary skill in the art (e.g., U.S. Pat. No. 4,683,195).
[0059] For example, each of the desired nucleic acid sequences can be initially generated in a separate PCR. Thereafter, specific primers are designed such that the ends of the PCR products contain complementary sequences. When the PCR products are mixed, denatured, and reannealed, the strands having the matching sequences at their 3' ends overlap and can act as primers for each other Extension of this overlap by DNA polymerase produces a molecule in which the original sequences are "spliced" together. In this way, a series of individual nucleic acid sequences may be "spliced" together and subsequently transduced into a host cell simultaneously. Thus, expression of each of the plurality of nucleic acid sequences is effected.
[0060] Individual nucleic acid sequences, or "spliced" nucleic acid sequences, are then incorporated into an expression vector. The invention is not limited with respect to the process by which the nucleic acid sequence is incorporated into the expression vector. Those of ordinary skill in the art are familiar with the necessary steps for incorporating a nucleic acid sequence into an expression vector. A typical expression vector contains the desired nucleic acid sequence preceded by one or more regulatory regions, along with a ribosome binding site, e.g., a nucleotide sequence that is 3-9 nucleotides in length and located 3-11 nucleotides upstream of the initiation codon in E. coli . See Shine et al. (1975) Nature 254:34 and Steitz, in Biological Regulation and Development: Gene Expression (ed. R. F. Goldberger), vol. 1, p. 349, 1979, Plenum Publishing, N. Y.
[0061] Regulatory regions include, for example, those regions that contain a promoter and an operator. A promoter is operably linked to the desired nucleic acid sequence, thereby initiating transcription of the nucleic acid sequence via an RNA polymerase enzyme. An operator is a sequence of nucleic acids adjacent to the promoter, which contains a protein- binding domain where a repressor protein can bind. In the absence of a repressor protein, transcription initiates through the promoter. When present, the repressor protein specific to the protein-binding domain of the operator binds to the operator, thereby inhibiting transcription. In this way, control of transcription is accomplished, based upon the particular regulatory regions used and the presence or absence of the corresponding repressor protein. Examples include lactose promoters (Lad repressor protein changes conformation when contacted with lactose, thereby preventing the Lad repressor protein from binding to the operator) and tryptophan promoters (when complexed with tryptophan, TrpR repressor protein has a conformation that binds the operator; in the absence of tryptophan, the TrpR repressor protein has a conformation that does not bind to the operator). Another example is the tac promoter. (See deBoer et al. (1983) Proc. Natl. Acad. ScL USA, 80:21-25.) As will be appreciated by those of ordinary skill in the art, these and other expression vectors may be used in the present invention, and the invention is not limited in this respect.
[0062] Although any suitable expression vector may be used to incorporate the desired sequences, readily available expression vectors include, without limitation: plasmids, such as pSClOl, pBR322, pBBRlMCS-3, pUR, pEX, pMRlOO, pCR4, pBAD24, pUC19; bacteriophages, such as Ml 3 phage and λ phage. Of course, such expression vectors may only be suitable for particular host cells. One of ordinary skill in the art, however, can readily determine through routine experimentation whether any particular expression vector is suited for any given host cell. For example, the expression vector can be introduced into the host cell, which is then monitored for viability and expression of the sequences contained in the vector. In addition, reference may be made to the relevant texts and literature, which describe expression vectors and their suitability to any particular host cell.
[0063] The expression vectors of the invention must be introduced or transferred into the host cell. Such methods for transferring the expression vectors into host cells are well known to those of ordinary skill in the art. For example, one method for transforming E. coli with an expression vector involves a calcium chloride treatment wherein the expression vector is introduced via a calcium precipitate. Other salts, e.g., calcium phosphate, may also be used following a similar procedure. In addition, electroporation (i.e., the application of current to increase the permeability of cells to nucleic acid sequences) may be used to transfect the host microorganism. Also, microinjection of the nucleic acid sequencers) provides the ability to transfect host microorganisms. Other means, such as lipid complexes, liposomes, and dendrimers, may also be employed. Those of ordinary skill in the art can transfect a host cell with a desired sequence using these or other methods.
[0064] For identifying a transfected host cell, a variety of methods are available. For example, a culture of potentially transfected host cells may be separated, using a suitable dilution, into individual cells and thereafter individually grown and tested for expression of the desired nucleic acid sequence. In addition, when plasmids are used, an often-used practice involves the selection of cells based upon antimicrobial resistance that has been conferred by genes intentionally contained within the expression vector, such as the amp, gpt, neo, and hyg genes.
[0065] The host cell is transformed with at least one expression vector. When only a single expression vector is used (without the addition of an intermediate), the vector will contain all of the nucleic acid sequences necessary.
[0066] Once the host cell has been transformed with the expression vector, the host cell is allowed to grow. For microbial hosts, this process entails culturing the cells in a suitable medium. It is important that the culture medium contain an excess carbon source, such as a sugar (e.g., glucose) when an intermediate is not introduced. In this way, cellular production of acetyl-CoA, a starting material for IPP and DMAPP synthesis is ensured. When added, the intermediate is present in an excess amount in the culture medium. [0067] As the host cell grows and/or multiplies, expression of the enzymes necessary for producing the 5-carbon alcohol is effected. Once expressed, the enzymes catalyze the steps necessary for carrying out the steps of IPP and/or DMAPP acid production and the 5-carbon alcohol production, i.e., converting IPP and/or DMAPP into 5-carbon alcohol is 3-methyl- 2-buten-l-ol, 3-methyl-3-buten-l-ol and/or 3-methyl-butan-l-ol. If an intermediate has been introduced, the expressed enzymes catalyze those steps necessary to convert the intermediate into the respective IPP and/or DMAPP. Any means for recovering the 5-carbon alcohol from the host cell may be used. For example, the host cell may be harvested and subjected to hypotonic conditions, thereby lysing the cells. The lysate may then be centrifuged and the supernatant subjected to high performance liquid chromatography (HPLC) or gas chromatography (GC). B. Host cells
[0068] The host cells of the present invention are genetically modified in that heterologous nucleic acid have been introduced into the host cells, and as such the genetically modified host cells do not occur in nature. The suitable host cell is one capable of expressing a nucleic acid construct encoding an enzyme capable of catalyzing the dephosphorylation of IPP and/or DMAPP, and optionally an enzyme capable of reducing 3-methyl-2-buten-l-ol into 3-methyl- butan-1-ol. Such enzymes are described herein. In some embodiments, the host cell naturally produces EPP and/or DMAPP, and optionally may comprises heterologous nucleic acid constructs capable of expressing one or more genes for producing EPP and/or DMAPP. The gene may be heterogous to the host cell or the gene may be native to the host cell but is operatively linked to a heterologous promoter and one or more control regions which result in a higher expression of the gene in the host cell. In other embodiments, the host cell does not naturally produce EPP and/or DMAPP, and comprises heterologous nucleic acid constructs capable of expressing one or more genes for producing EPP and/or DMAPP. [0069] The enzyme capable of catalyzing the dephosphorylation of EPP and/or DMAPP can be native or heterologous to the host cell. Similarly, the enzyme capable of catalyzing the reduction of 3-methyl-2-buten-l-ol into 3-methyl-butan-l-ol can be native or heterologous to the host cell. Where the enzyme is native to the host cell, the host cell is genetically modified to modulate expression of the enzyme. This modification can involve the modification of the chromosomal gene encoding the enzyme in the host cell or a nucleic acid construct encoding the gene of the enzyme is introduced into the host cell. One of the effects of the modification is the expression of the enzyme is modulated in the host cell, such as the increased expression of the enzyme in the host cell as compared to the expression of the enzyme in an unmodified host cell. [0070] The host cells produce the EPP and/or DMAPP that is dephosphorylated into
3-methyl-3-buten-l-ol and/or 3-methyl-2-buten-l-ol, respectively. The host cell comprises the genes encoding enzymes in the pathway from which the EPP and/or DMAPP are synthesized from acetyl-CoA. Optionally, the host cell may comprise a gene encoding the enzyme that reduces 3-methyl-2-buten-l-ol into 3-methyl-butan-l-ol. These genes can either be native to the host cell or are heterologous to the host cell and introduced all or in part into the host cell either by integration into the host cell chromosome(s) or an expression vector, or both. [0071] The host cells may comprise systems for synthesizing IPP and/or DMAPP. Such systems are taught in U.S. Pat. Nos. 7,172,886 and 7,183,089, and U.S. Pat. Application Pub. No. 2003/0148479, 2006/0079476, 2007/0077616, 2007/0092931, and 2007/0099261, which are incorporated in their entireties by reference. Such methods include producing an IPP and/or DMAPP in a genetically modified host cell, such as E. coli.
[0072] The host cells may express pyrophosphases which hydrolyze the isoprenyl diphosphate intermediates to the corresponding primary alcohols (Song, Appl. Biochem. Biotechnol. 2006, 128:149, which is incorporated in its entirety by reference). The host cells maybe knocked out for or lack expression of any terpene cyclases which catalyze the formation of terpenes from diphosphate intermediates.
[0073] IPP and DMAPP are generated in vivo via either the mevalonate pathway or the non-mevalonate pathway (also known as the DXP pathway), which is described in Reiling et al., Biotechnol. Bioeng. 87(2):200-212 (2004), which is incorporated in its entirety by reference. [0074] In some embodiments, a host cell may naturally be capable of hydrogenating the double bond of 3-methyl-2-buten-l-ol. Such a host cell may not be modified in order to be able to produce 3-methyl-butan-l-ol from 3-methyl-2-buten-l-ol, or the gene encoding the enzyme for catalyzing this reaction can be modified so that expression of the enzyme is increased. A host cell that may not require modification is Saccharomyces cerevisiae. Gramatica et al. {Expeήentia 38, 1982) have shown that S. cerevisiae is capable of reducing geraniol to R-(+)-citronellol. Gramatica et al. (J Org. Chem. 50, 1985) have shown that S. cerevisiae is capable of hydrogenating the double bonds in a- or /3-methyl- α,/3-unsaturated aldehydes (including alcohols and acetals).
[0075] It is now shown in the present invention that yeast can catalyze the conversion of 3- methyl-2-butenol to isopentanol (see Figure 3).
[0076] Any prokaryotic or eukaryotic host cell may be used in the present method so long as it remains viable after being transformed with a sequence of nucleic acids. Generally, although not necessarily, the host microorganism is bacterial. Examples of bacterial host cells include, without limitation, those species assigned to the Escherichia, Enterobacter, Azotobacter, Erwinia, Bacillus, Pseudomonas, Klebsiella, Proteus, Salmonella, Serratia, Shigella, Rhizobia, Vitreoscilla, Synechococcus, and Paracoccus taxonomical classes. In some embodiments, the microorganism is a cyanobacteria. In some embodiments the bacterial host is Synechocystis sp.. Preferably, the host cell is not adversely affected by the transduction of the necessary nucleic acid sequences, the subsequent expression of the proteins (i.e., enzymes), or the resulting intermediates required for carrying out the steps associated with the mevalonate pathway. For example, it is preferred that minimal "cross- talk" (i.e., interference) occur between the host cell's own metabolic processes and those processes involved with the mevalonate pathway.
[0077] Suitable eukaryotic cells include, but are not limited to, algal, fungal, insect or mammalian cells, hi some embodiments, suitable fungal cells are yeast cells, such as yeast cells of the Saccharomyces genus. In some embodiments the eukaryotic cell is a green algae. In some embodiments the eukaryotic cell is Chlamydomonas reinhardtii, Scenedesmus obliquus, Chlorella vulgaris or Dunaliella salina.
[0078] The host cell can further be modified to comprise endogenous solvent efflux system such as AcrAB-TolC (Ramos et al, Annu Rev Microbiol 2002, 56:743, which is incorporated in its entirety by reference) to pump the 5-carbon alcohol produced by the host cell out of the cell. When the host cell is capable of pumping the produced 5-carbon alcohol out of the cell, the 5-carbon alcohol can be recovered by removal of the supernatant in which the host cell is being cultured.
[0079] The toxicity of the branched-C5 alcohols will not be problematic for the viability of host cells during fermentation. The minimum inhibitory concentration (MIC) of the alcohols is approximately 1% (w/v) for E. coli. The branched-C5 alcohols begin to phase separate at this concentration from the growth medium.
C. Isolation of 5-carbon alcohols produced
[0080] The present invention provides for an isolated 5-carbon alcohol produced from the method of the present invention. Isolating the 5-carbon alcohol involves the separating at least part or all of the host cells, and parts thereof, from which the 5-carbon alcohol was produced, from the isolated 5-carbon alcohol. The isolated 5-carbon alcohol may be free or essentially free of impurities formed from at least part or all of the host cells, and parts thereof. The isolated 5-carbon alcohol is essentially free of these impurities when the amount and properties of the impurities do not interfere in the use of the 5-carbon alcohol as a fuel, such as a fuel in a combustion reaction. These host cells are specifically cells that do not in nature produce the 5-carbon alcohol. The impurities are no more than 5%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% by weight of a composition comprising one or more of the 5-carbon alcohols.
[0081] The present invention also provides for a combustible composition comprising an isolated 5-carbon alcohol and cellular components, wherein the cellular components do not substantially interfere in the combustion of the composition. The cellular components include whole cells or parts thereof. The cellular components are derived from host cells which produced the 5-carbon alcohol was derived.
[0082] The 5-carbon alcohol of the present invention are useful as fuels as chemical source of energy that can be used as an alternative to petroleum derived fuels, ethanol and the like. [0083] It is to be understood that, while the invention has been described in conjunction with the preferred specific embodiments thereof, the foregoing description is intended to illustrate and not limit the scope of the invention. Other aspects, advantages, and modifications within the scope of the invention will be apparent to those skilled in the art to which the invention pertains. [0084] All patents, patent applications, and publications mentioned herein are hereby incorporated by reference in their entireties.
[0085] The invention having been described, the following examples are offered to illustrate the subject invention by way of illustration, not by way of limitation.
II. Examples
[0086] The following examples are provided by way of illustration only and not by way of limitation. Those of skill in the art will readily recognize a variety of non-critical parameters that could be changed or modified to yield essentially similar results.
[0087] All solvents, standards, and antibiotics (e.g. tetracycline, chloramphenicol, kanamycin, carbenicillin)were purchased from Sigma- Aldrich (St. Louis, MO) unless otherwise indicated. 3-methyl-2-butenol and 3-methyl-butanol were purchased from Tokyo Chemical Industry (Portland, OR). Phusion polymerase and all restriction enzymes were purchased from New England Biolabs (Ipswich, MA).SuperScriptIII Reverse Transcriptase was purchased from Invitrogen (Carlsbad, CA). IPTG was obtained from EM Sciences (Gibbstown, NJ). EXAMPLE 1 Production of 3-methyI-2-buten-l-ol and 3-methyl-3-buten-l-ol in a host cell
[0088] The pMevT plasmid (containing the genes for synthesizing mevalonate from acetyl- CoA) and pMBI (containing the genes for synthesizing IPP and DMAPP from mevalonate) are introduced into E. coli DHlOB, which then is capable of expressing PP and DMAPP. The method for constructing the pMevT plasmid, and nucleotide sequence, are taught in U.S. Pat. No. 7,183,089, which is incorporated in its entirety by reference. The method for constructing the pMBI plasmid is taught in Martin et al. {Nature Biotechnol. 21:796 - 802 (2003)), which is incorporated in its entirety by reference. [0089] Primers can be designed to PCR Bacillus subtilus phosphatase PhoE (YhfR) from Bacillus subtilus genomic DNA and cloned into a suitable E. coli expression vector. The resultant plasmid is introduced into an E. coli host cell also containing the pMevT and pMBI plasmids. The resulting transformant is cultured in a suitable medium, such as Luria broth (LB) medium at 37°C with the appropriate antibiotics to maintain the plasmids. The enzymes are induced using the appropriate inducers, such as IPTG or propionate, and incubated at 300C for 3-7 days. The induction of the enzymes results in the production of 3-methyl- 2-buten-l-ol and/or 3-methyl-3-buten-l-ol from DMAPP and/or IPP, respectively.
[0090] The 3-methyl-2-buten- 1 -ol and/or 3-methyl-3-buten- 1 -ol can be purified and analyzed using a gas chromatography-mass spectrometer (GC-MS). EXAMPLE 2
Production of 3-methyl-butan-l-ol in a host cell
[0091] Primers can be designed to PCR Saccharomyces cerevisiae fatty acid synthase from Saccharomyces cerevisiae genomic DNA and cloned into a suitable E. coli expression vector. The resultant plasmid is introduced into an E. coli host cell also containing the pMevT and pMBI plasmids, and a plasmid expressing Bacillus subtilus phosphatase YhfR. The resulting transformant is cultured in a suitable medium, such as Luria broth (LB) medium at 370C with the appropriate antibiotics to maintain the plasmids. The enzymes are induced using the appropriate inducers, such as IPTG or propionate, and incubated at 300C for 3-7 days. The induction of the enzymes results in the production of 3-methyl-butan-l-ol. The 3-methyl- butan-1-ol can be purified and analyzed using a GC-MS. EXAMPLE 3
In vivo reduction of 3-methyϊ-2-butenol or 3-methyI-3-butenoI to 3-methyl- butanol
[0092] To test the capability of yeast to catalyze the conversion of 3-methyl-2-butenol to isopentanol, 5 ml. of YPD medium with 2% glycerol, in a 100ml culture tube, was inoculated with an overnight culture of freshly plated S. cerevisiae BY4741 cells to achieve a final absorbance of 0.5 at 600 nm (A6oo). The cultures were grown at 300C at 200 r.p.m. After 48 hours, either 3-methyl-2-butenol or 3-methyl-3-butenol (lg/1) was added to the culture.
[0093] Cultures were sampled after addition of 3-methyl-2-butenol or 3-methyl-3-butenol and grown for an additional 2 days. The samples were collected by pelleting 1 ml of culture, and adding 150 μl of the supernatant to 750 μl of the extraction solvent (80:20 chloroform: methanol spiked with 50 mg I"1 of butanol internal standard).The samples were vortexed for 15 minutes and centrifuged for 2 minutes at 5000 r.c.f. 450 μl of the organic layer was removed from each sample and transferred to a clean GC vial for analysis. The GC-MS data were collected in full-scan mode (m/z 50-300) using a Tr- Wax column (0.25 mm x 30 m, 0.25μm film thickness; Thermo Electron) on a PolarisQ GC-MS with TriPlusautosampler (Thermo Electron). The carrier flow was 1.2 ml min"1, and the inlet temperature was set to 2000C. The oven program was as follows: 4O0C (1.20 min hold), 40- 1300C (25°C min"1), 130-220°C(35°C min"1). The solvent delay was set at 3.40 min. Samples were normalized using the butanol internal standard and quantified using authentic standards.
[0094] Yeast grown in the presence of 3-methyl-2-butenol produced significantly more isopentanol than yeast grown in the absence of 3-methyl-2-butenol (Figure 3, left hand column, light bar compared to dark bar) or those grown in the presence of 3-methyl-3-butenol (Figure 3, left hand column relative to right hand column). EXAMPLE 4
Construction of Yeast Reductase Library
[0095] The yeast reductase genes were amplified from a S. cerevisiae BY4742 cDNA library and inserted into pESC-leu with the appropriate restriction enzymes using standard protocols. The cDNA library was made following Invitrogen's suggested method for Superscript III Reverse Transcriptase, the incubation was extended from 1 hour to 3 hours in Step 5 of the manufacturer's protocol.
[0096] The primers used to amplify YHRl 79w were 5'-AAC CGT CGA CAT GCC ATT TGT TAA GGA CTT TAA G-3' and 5'-TAA CGC TAG CTT AAT TTT TGT CCC AAC CGA GTT TTA GAG C-3 ', and the gene was inserted into the Nhel-Sall sites of pESC- leu.The primers used to amplify YPL171c were 5'- AACCGTCGACATGCCATTTGTAAAAGGTTTTGAGC-3' and 5'- TAACGCTAGCTCAGTTCTTGTTCCAACCTAAATCTAC-S', and the gene was inserted into the Nhel-Sall sites of pESC-leu.The primers used to amplify YOR120w were 5'- AACCGGATCC ATGCCTGCTACTTTACATGATTC-3 ' and 5 ' -
TAACCTCGAGTTACTTGAATACTTCGAAAGGAG-S', and the gene was inserted into the BamHI-XhoI sites of pESC-leu.The primers used to amplify YDR368w were 5'- AACCGTCGACATGCCTGCTACGTTAAAGAA-3' and 5'- TAACCTCGAGTCATTGGAAAATTGGGAAG-3', and the gene was inserted into the SaII- Xhol sites of pESC-leu.The primers used to amplify YBRl 49w were 5'- AACCGGATCCATGTCTTCTTCAGTAGCCTC-3' and 5'-
TAACGCTAGCTTAATACTTTAAATTGTCCAAG-3', and the gene was inserted into the BamHI-Nhel sites of pESC-leu.The primers used to amplify YHRl 04w were 5'- AACCGGATCCATGTCTTCACTGGTTACTCTTA-3' and 5'- TAACCTCGAGTCAGGCAAAAGTGGGGAAT-3 ', and the gene was inserted into the BamHI-XhoI sites of pESC-leu.The primers used to amplify YDL124w were 5'- AACCGGATCCATGTCATTTCACCAACAGTTC-3' and 5'- TAACCTCGAGTTATACTTTTTGAGCAGCG-3', and the gene was inserted into the BamHI-XhoI sites of pESC-leu.The primers used to amplify YJR096w were 5'- AACCGGATCCATGGTTCCTAAGTTTTACAAAC-3 ' and 5 '-
TAACCTCGAGTTATGGCGCGTCTGTGCATTC-S', and the gene was inserted into the BamHI-XhoI sites of pESC-leu.The primers used to amplify YIR036c were 5'- AACCGGATCCATGGGC AAGGTTATTTTGATTA-3' and 5'- TAACGCTAGCCTAGCCCTGCACCGGCCCCAGTC-3', and the gene was inserted into the BamHI-Nhel sites of pESC-leu.The primers used to amplify YMR226c were 5 '- AACCGGATCCATGTCCCAAGGTAGAAAAGCTG-S' and 5'- TAACGCTAGCTTATCCACGGAAGATATGATGAGGT-3', and the gene was inserted into the BamHI-Nhel sites of pESC-leu.The primers used to amplify Y0L151w were 5'- AACCGGATCCATGTCAGTTTTCGTTTCAGGTG-S' and 5'-
TAACCTCGAGTTATATTCTGCCCTCAAATTTTAAAA-S', and the gene was inserted into the BamHI-XhoI sites of pESC-leu.The primers used to amplify YGL157w were 5'- AACCGGATCCATGACTACTGATACCACTGTTTTC-3' and 5'- TAACCTCGAGTTAGGCTTCATTTTGAAC-S', and the gene was inserted into the BamHI- XhoI sites of pESC-leu. The primers used to amplify YDR541c were 5'- AACCGGATCCATGTCTAATACAGTTCTAG-3' and 5'-
AACCGGATCCTCAT AATCTGTTCTCCTTCTTC-3', and the gene was inserted into the BamHI-XhoI sites of pESC-leu.The primers used to amplify YGL039w were 5'- AACCGTCGAC ATGACTACTGAAAAAACCGTTG-S ' and 5 '-
TAACGCTAGCTTAGCTTTTACTTTGAACTTCTAGTAATTGCG-S ', and the gene was inserted into the Nhel-Sall sites of pESC-leu.The primers used to amplify YAL060w were 5'- AACCGGATCCATGAGAGCTTTGGCATATTTC-3' and 5'- TAACCTCGAGTTACTTCATTTCACCGTGA-3', and the gene was inserted into the BamHI-XhoI sites of pESC-leu.The primers used to amplify YLR070c were 5'- AACCGGATCCATGACTGACTTAACTACACA-3' and 5'-
TAACCTCGAGTCATTCCGGGCCCTCAATGATC-3', and the gene was inserted into the BamHI-XhoI sites of pESC-leu.The primers used to amplify YGLl 85c were 5'- AACCGGATCCATGTGCGATTCTCCTGCA-3' and 5'- TAACCTCGAGTCAAACTACACGGGAGAAATGCT-S', and the gene was inserted into the BamHI-XhoI sites of pESC-leu.The primers used to amplify YNL274c were 5'- AACCGGATCCATGAGTAAGAAACCAATTGTTTTG-3' and 5'- TAACCTCGAGTCAAACTAATGGCTTAGATTC-3', and the gene was inserted into the BamHI-XhoI sites of pESC-leu. The primers used to amplify YPLl 13c were 5'- AACCGGATCCATGATTACTTCAATTGACATAGCAG-3 ' and 5 '-
TAACGCTAGCTCAGTTGAGCACATACTTACCATCAC-S', and the gene was inserted into the BamHI-NheI sites of pESC-leu.The primers used to amplify YCRl 07w were 5'- AACCGGATCCATGATTGGGTCCGCGTCCGA-3' and 5'- TAACCTCGAGCTAAACATTATTCGTACC-3', and the gene was inserted into the BamHI-XhoI sites of pESC-leu.The primers used to amplify YNL331 c were 5 '- AACCGGATCCATGACTGACTTGTTTAAACCTC-S' and 5'-
TAACCTCGAGCTAATTGTCAAAAGCTATCCTG-3', and the gene was inserted into the BamHI-XhoI sites of pESC-leu.The primers used to amplify YPL275w were 5'- AACCGGATCCATGGTGGTCATCAAT AAGCAATTA-3' and 5'- TAACCTCGAGTTATTTCTTCTGTCCATAAGCTCTGG-S', and the gene was inserted into the BamHI-XhoI sites of pESC-leu.
EXAMPLE 5
Screening of candidates for reduction of 3-methyl-2-butenoI to 3-methyl- butanol
[0097] To identify enzymes with the capability to catalyze the reduction 3-methyl-2- butenol to 3-methyl-butanol the following assay system was employed. 5 ml of synthetic defined medium lacking leucine with 1.8% galactose and 0.2% glucose was inoculated with an overnight culture of S. cerevisiae BY4741 freshly transformed with a vector (pESC) expressing a reductase candidate gene to achieve a final absorbance of 0.5 at 600 nm (A6oo). The cultures were grown at 300C at 200 r.p.m. After 48 hours, 3-methyl-2-butenol (1 g/1) was added to the culture.
[0098] Cultures were sampled for isopentanol production after addition of 3-methyl-2- butenol as described in Example 3. [0099] Yeast genetically modified to over-express either OYE2 or OYE3 showed a significant increase in isopentanol production relative to controls (Figures 4 and 5).
[0100] While the present invention has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present invention. All such modifications are intended to be within the scope of the claims appended hereto. TABLEl
Figure imgf000028_0001
TABLE 2
Figure imgf000029_0001

Claims

WHAT IS CLAIMED IS:
L A method for producing a 5-carbon alcohol in a genetically modified host cell, the method comprising: (a) culturing a genetically modified host cell under a suitable condition, wherein the genetically modified host cell comprises a first enzyme capable of catalyzing the dephosphorylation of an isopentenyl disphosphate (IPP) or dimethylallyl diphosphate (DMAPP), and optionally a second enzyme capable of reducing a 3-methyl-2-buten-l-ol, such that the culturing results in the genetically modified host cell producing a 5-carbon alcohol, wherein the 5-carbon alcohol is 3-methyl-2-buten-l-ol, 3-methyl-3-buten- 1-ol or 3-methyl-butan-l-ol.
2. The method of claim 1 , wherein the genetically modified host cell comprises a first nucleic acid construct encoding the first enzyme capable of catalyzing the dephosphorylation of an IPP or DMAPP, and optionally a second nucleic acid construct encoding the second enzyme capable of reducing a 3-methyl-2-buten-l-ol, and the culturing results in the expression of the first enzyme, and optionally the second enzyme.
3. The method of claim 2, further comprising the step of: introducing the first nucleic acid construct, and optionally a second nucleic acid construct, into the genetically modified host cell, wherein the introducing step is prior the culturing step.
4. The method of claim 1, further comprising the step of: (b) recovering the produced 5-carbon alcohol, wherein the recovering step is concurrent or subsequent to the culturing step.
5. The method of claim 1, wherein the first enzyme is a phosphatase, or a homologous enzyme thereof.
6. The method of claim 1, wherein the phosphatase is Bacillus sp. YhfR.
7. The method of claim 1, wherein the second enzyme is a reductase, or a homologous enzyme thereof.
8. The method of claim 1, wherein the reductase is Escherichia coli, Saccharomyces cerevisiae, Torulaspora delbrueckii, or Kluyveromyces lactis fatty acid synthase.
9. The method of claim 7, wherein the reductase is an OYE family member.
10 The method of claim 9, wherein the reductase is a Saccharomyces sp. OYE family member.
11 The method of claim 9, wherein the OYE family member is OYE2.
12 The method of claim 9, wherein the OYE family member is OYE3.
13The method of claim 1 , wherein the 5-carbon alcohol is 5-carbon alcohol is 3-methyl-2-buten-l-ol.
14. The method of claim 1, wherein the 5-carbon alcohol is 5-carbon alcohol is 3 -methyl-3 -buten- 1 -ol.
15. The method of claim 1, wherein the 5-carbon alcohol is 5-carbon alcohol is 3-methyl-butan- 1 -ol.
16. The method of claim 1, wherein the host cell is a eubacteria.
17. The method of claim 15, wherein the host cell is one selected from the Escherichia, Enterobacter, Azotobacter, Erwinia, Bacillus, Pseudomonas, Klebsiella, Proteus, Salmonella, Serratia, Shigella, Rhizobia, Vitreoscilla, Synechococcus, Synechocystis, and Paracoccus taxonomical classes.
18. The method of claim 16, wherein the host cell is Escherichia coli.
19. The method of claim 1, wherein the host cell is an algal, fungal, insect or mammalian cell line.
20. The method of claim 18, wherein the host cell is a yeast.
21. The method of claim 19, wherein the host cell is Saccharomyces cerevisae.
22. A genetically modified host cell comprising a first nucleic acid construct encoding a first enzyme capable of catalyzing the dephosphorylation of an isopentenyl disphosphate (IPP) or dimethylallyl diphosphate (DMAPP), and optionally a second nucleic acid construct encoding a second enzyme capable of reducing a 3-methyl- 2-buten-l-ol, which under a suitable condition produces 3-methyl-2-buten-l-ol, 3-methyl- 3-buten-l-ol or 3-methyl-butan-l-ol.
23. The host cell of claim 21, wherein host cell prior to genetic modification does not produce 3-methyl-2-buten-l-ol, 3-methyl-3-buten-l-ol and 3-methyl- butan-1-ol.
24. A combustible composition comprising an isolated 3-methyl-2-buten- l-ol, 3-methyl-3-buten-l-ol or 3-methyl-butan-l-ol and cellular components, wherein the cellular components do not substantially interfere in the combustion of the composition.
25. The composition of claim 23, wherein the cellular components are of cells which do not naturally produce the 3-methyl-2-buten-l-ol, 3-methyl-3-buten-l-ol or 3-methyl-butan-l-ol.
PCT/US2008/068831 2007-06-29 2008-06-30 Host cells and methods for producing 3-methyl-2-buten-1-ol, 3-methyl-3-buten-1-ol, and 3-methyl-butan-1-ol WO2009006429A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US12/646,189 US7985567B2 (en) 2007-06-29 2009-12-23 Host cells and methods for producing 3-methyl-2-buten-1-ol, 3-methyl-3-buten-1-ol, and 3-methyl-butan-1-ol

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US94728507P 2007-06-29 2007-06-29
US60/947,285 2007-06-29

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/646,189 Continuation US7985567B2 (en) 2007-06-29 2009-12-23 Host cells and methods for producing 3-methyl-2-buten-1-ol, 3-methyl-3-buten-1-ol, and 3-methyl-butan-1-ol

Publications (1)

Publication Number Publication Date
WO2009006429A1 true WO2009006429A1 (en) 2009-01-08

Family

ID=40226512

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/068831 WO2009006429A1 (en) 2007-06-29 2008-06-30 Host cells and methods for producing 3-methyl-2-buten-1-ol, 3-methyl-3-buten-1-ol, and 3-methyl-butan-1-ol

Country Status (2)

Country Link
US (1) US7985567B2 (en)
WO (1) WO2009006429A1 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8114641B2 (en) 2007-12-10 2012-02-14 Synthetic Genomics, Inc. Methylbutanol as an advanced biofuel
US8124400B2 (en) 2008-12-10 2012-02-28 Synthetic Genomics, Inc. Production of branched-chain alcohols by photosynthetic microorganisms
WO2013053824A1 (en) 2011-10-11 2013-04-18 Metabolic Explorer New biosynthesis pathway for prenol in a recombinant microorganism
US20130309742A1 (en) * 2012-05-16 2013-11-21 Glycos Biotechnologies, Inc. Microorganisms and processes for the production of isoprene
US20130309743A1 (en) * 2008-09-15 2013-11-21 The Goodyear Tire & Rubber Company Conversion of prenyl derivatives to isoprene
WO2018206262A1 (en) 2017-05-10 2018-11-15 Global Bioenergies Improved methods for producing isobutene from 3-methylcrotonic acid
CN116162605A (en) * 2022-08-18 2023-05-26 安徽农业大学 Tea tree cinnamyl alcohol dehydrogenase for synthesizing geraniol and application thereof
US11884620B2 (en) 2020-12-11 2024-01-30 The Regents Of The University Of California Use of polyamines in the pretreatment of biomass

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2012138943A (en) * 2010-02-12 2014-03-20 Джево, Инк. THE YEAST MICRO-ORGANISMS WITH THE REDUCED ACCUMULATION OF BY-PRODUCTS FOR THE IMPROVED PRODUCTION OF FUELS, CHEMICALS AND AMINO ACIDS
US9096859B2 (en) 2011-01-26 2015-08-04 The Regents Of The University Of California Microbial conversion of plant biomass to advanced biofuels
WO2013040210A2 (en) * 2011-09-14 2013-03-21 The Regents Of The University Of California Methods for increasing production of 3-methyl-2-butenol using fusion proteins
FR2987369A1 (en) * 2012-02-27 2013-08-30 Total Raffinage Marketing HIGH POWER LIQUID FUEL COMPOSITION FOR IGNITION ENGINES
WO2014018982A1 (en) 2012-07-27 2014-01-30 The Regents Of The University Of California Systems and methods for enhancing gene expression
US10597665B1 (en) 2012-11-27 2020-03-24 University Of Kentucky Research Foundation Method and System for diterpene production platforms in yeast
EP3559208A4 (en) 2016-12-21 2020-08-12 Creatus Biosciences Inc. Method and organism expressing metschnikowia xylose transporters for increased xylose uptake
US20210062178A1 (en) 2019-06-21 2021-03-04 The Regents Of The University Of California Novel xylose isomerase gene and polypeptide and uses thereof
EP4165063A1 (en) 2020-06-15 2023-04-19 Melio Peptide Systems Inc. Microorganisms and methods for reducing bacterial contamination
US20240052133A1 (en) 2022-08-05 2024-02-15 The Regents Of The University Of California Chemical recyling of plastics using ionic liquids or deep eutectic solvents

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4609624A (en) * 1984-02-03 1986-09-02 Les Services De Consultation D.B. Plus Limitee Process for producing isopropyl alcohol from cellulosic substrates
US6515202B1 (en) * 1999-05-19 2003-02-04 Pioneer Hi-Bred International, Inc. Polynucleotides encoding monocot 12-oxo-phytodienoate reductases and methods of use
US20030219798A1 (en) * 2000-09-29 2003-11-27 Gokarn Ravi R. Isoprenoid production
US20070087425A1 (en) * 2000-12-28 2007-04-19 Chikara Ohto Methods of producing prenyl alcohols

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US224007A (en) * 1880-02-03 Petehs
US5460949A (en) * 1990-11-15 1995-10-24 Amoco Corporation Method and composition for increasing the accumulation of squalene and specific sterols in yeast
US6291745B1 (en) * 1993-04-02 2001-09-18 Pioneer Hi-Bred International, Inc. Limonene and other downstream metabolites of geranyl pyrophosphate for insect control in plants
AU746684B2 (en) * 1997-09-02 2002-05-02 Washington State University Research Foundation Nucleic and amino acid sequences for a novel transketolase from $i (Mentha Piperita)
US6531303B1 (en) * 1998-07-06 2003-03-11 Arkion Life Sciences Llc Method of producing geranylgeraniol
EP1360300A2 (en) * 2000-07-31 2003-11-12 Frederick M. Hahn Manipulation of genes of the mevalonate and isoprenoid pathways to create novel traits in transgenic organisms
WO2002024865A2 (en) * 2000-09-19 2002-03-28 Microbia, Inc. Modulation of secondary metabolite production by zinc binuclear cluster proteins
JP3838033B2 (en) * 2000-12-28 2006-10-25 トヨタ自動車株式会社 Method for producing prenyl alcohol
US20040063182A1 (en) * 2000-12-28 2004-04-01 Chikara Ohto Process for producing prenyl alcohol
US20040110259A1 (en) * 2001-08-03 2004-06-10 Baugh Mariah R Drug metabolizing enzymes
US7172886B2 (en) * 2001-12-06 2007-02-06 The Regents Of The University Of California Biosynthesis of isopentenyl pyrophosphate
US7192751B2 (en) * 2001-12-06 2007-03-20 The Regents Of The University Of California Biosynthesis of amorpha-4,11-diene

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4609624A (en) * 1984-02-03 1986-09-02 Les Services De Consultation D.B. Plus Limitee Process for producing isopropyl alcohol from cellulosic substrates
US6515202B1 (en) * 1999-05-19 2003-02-04 Pioneer Hi-Bred International, Inc. Polynucleotides encoding monocot 12-oxo-phytodienoate reductases and methods of use
US20030219798A1 (en) * 2000-09-29 2003-11-27 Gokarn Ravi R. Isoprenoid production
US20070087425A1 (en) * 2000-12-28 2007-04-19 Chikara Ohto Methods of producing prenyl alcohols

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
RIGDEN ET AL.: "A cofactor-dependent phosphoglycerate mutase homolog from Bacillus stearothermophilus is actually a broad specificity phosphatase", PROTEIN SCIENCE, vol. 10, 2001, pages 1835 - 1846 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9080188B2 (en) 2007-12-10 2015-07-14 Synthetic Genomics, Inc. Methylbutanol as an advanced biofuel
US8114641B2 (en) 2007-12-10 2012-02-14 Synthetic Genomics, Inc. Methylbutanol as an advanced biofuel
US20130309743A1 (en) * 2008-09-15 2013-11-21 The Goodyear Tire & Rubber Company Conversion of prenyl derivatives to isoprene
US8945893B2 (en) * 2008-09-15 2015-02-03 Danisco Us Inc. Conversion of prenyl derivatives to isoprene
US8445257B2 (en) 2008-12-10 2013-05-21 Synthetic Genomics, Inc. Production of branched-chain alcohols by photosynthetic microorganisms
US8124400B2 (en) 2008-12-10 2012-02-28 Synthetic Genomics, Inc. Production of branched-chain alcohols by photosynthetic microorganisms
US9181558B2 (en) 2008-12-10 2015-11-10 Synthetic Genomics, Inc. Production of branched-chain alcohols by photosynthetic microorganisms
WO2013053824A1 (en) 2011-10-11 2013-04-18 Metabolic Explorer New biosynthesis pathway for prenol in a recombinant microorganism
US9410164B2 (en) 2011-10-11 2016-08-09 Metabolic Explorer Biosynthesis pathway for prenol in a recombinant microorganism
US20130309742A1 (en) * 2012-05-16 2013-11-21 Glycos Biotechnologies, Inc. Microorganisms and processes for the production of isoprene
US8741613B2 (en) * 2012-05-16 2014-06-03 Glycos Biotechnologies, Inc. Microorganisms and processes for the production of isoprene
US8741612B2 (en) 2012-05-16 2014-06-03 Glycos Biotechnologies, Inc. Microorganisms and processes for the production of isoprene
WO2018206262A1 (en) 2017-05-10 2018-11-15 Global Bioenergies Improved methods for producing isobutene from 3-methylcrotonic acid
US11884620B2 (en) 2020-12-11 2024-01-30 The Regents Of The University Of California Use of polyamines in the pretreatment of biomass
CN116162605A (en) * 2022-08-18 2023-05-26 安徽农业大学 Tea tree cinnamyl alcohol dehydrogenase for synthesizing geraniol and application thereof

Also Published As

Publication number Publication date
US20100205855A1 (en) 2010-08-19
US7985567B2 (en) 2011-07-26

Similar Documents

Publication Publication Date Title
US7985567B2 (en) Host cells and methods for producing 3-methyl-2-buten-1-ol, 3-methyl-3-buten-1-ol, and 3-methyl-butan-1-ol
CA3059650C (en) Improved methods for producing isobutene from 3-methylcrotonic acid
Kang et al. Isopentenyl diphosphate (IPP)-bypass mevalonate pathways for isopentenol production
US10597685B2 (en) Host cells and methods for oxidizing aromatic amino acids
DK2872641T3 (en) BIORAFFINADERY SYSTEM, PROCEDURES AND COMPOSITIONS THEREOF
US9200298B2 (en) Host cells and methods for producing isoprenyl alkanoates
US11660961B2 (en) Host cells and methods for producing isopentenol from mevalonate
US9631210B2 (en) Methods for increasing production of 3-methyl-2-butenol using fusion proteins
Caforio et al. Formation of the ether lipids archaetidylglycerol and archaetidylethanolamine in Escherichia coli
US11932896B2 (en) Host cells and methods for producing hydroxytyrosol
US20200239796A1 (en) Host cells and methods for producing tricyclic sesquiterpenes, aviation and missile fuel precursors
US9096859B2 (en) Microbial conversion of plant biomass to advanced biofuels
DK2403953T3 (en) Method for stereoselective enzymatic reduction of keto compounds
Helalat et al. Metabolic engineering of Deinococcus radiodurans for pinene production from glycerol
US9441248B2 (en) Engineered photosynthetic bacteria, method of manufacture of biofuels
US20230174922A1 (en) Modified yeast host cells useful for producing isoprenol
US20240102057A1 (en) Methods and compositions useful for the production of 4-vinylphenol
Shobana et al. Microbial production of hydrocarbon and its derivatives using different kinds of microorganisms
EP4144838A1 (en) Organisms producing less crotonic acid
US20200255841A1 (en) Host cells and methods for reducing isoprenoid precursors and isoprenoids by geranylgeranyl reductase
Qin et al. Using Unnatural Protein Fusions to Engineer a Coenzyme Self-Sufficiency System for D-Phenyllactic Acid
WO2023077017A1 (en) Methods and compositions useful for the production of olefinic ester

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08781200

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08781200

Country of ref document: EP

Kind code of ref document: A1