WO2008157728A1

WO2008157728A1 - An anti-inflammatory, cytoprotective factor derivable from a probiotic organism

Info

Publication number: WO2008157728A1
Application number: PCT/US2008/067552
Authority: WO
Inventors: Eugene B. Chang; Elaine O. Petrof
Original assignee: The University Of Chicago
Priority date: 2007-06-19
Filing date: 2008-06-19
Publication date: 2008-12-24

Abstract

The invention provides an isolated, anti-inflammatory, cytoprotective compound that is soluble in aqueous fluid, is derivable from the conditioned medium of Lactobacillus plantarum culture, induces heat shock protein expression, and has shown the capacity to inhibit NF-ϰB activation and to inhibit a proteasome activity. The compound is amenable to formulation in a pharmaceutical composition and to packaging in a kit form with instructions for use in methods according to the invention, which include methods of preventing, treating, or ameliorating a symptom of an inflammatory disorder, such as an inflammatory epithelial disease, e.g., inflammatory bowel disease such as enterocolitis, characterized by inflammation.

Description

PATENT

AN ANTI-INFLAMMATORY, CYTOPROTECTIVE FACTOR DERIVABLE FROM A PROBIOTIC ORGANISM

[0001] The government owns rights in the invention pursuant to grant numbers DK47722, DK42086, T32 GM07019, and K08 DK064840-01 from the National Institutes of Health.

FIELD OF THE INVENTION

[0002] The invention relates generally to the field of inflammatory disorders. More particularly, it concerns inflammatory bowel diseases, such as ulcerative colitis and Crohn's disease.

BACKGROUND OF THE INVENTION

[0003] Inflammatory bowel disease (IBD) is a group of chronic disorders, such as necrotizing enterocolitis, ulcerative colitis and Crohn's disease, that cause inflammation or ulceration of the digestive tract. The unfortunate combination of genetic background, exposure to environmental factors, or colonization by certain inciting commensal bacteria, can result in the development of IBD in susceptible individuals.

[0004] Necrotizing enteric colitis is a condition primarily seen in premature infants, and involves necrosis or tissue death of portions of the bowel. Onset of the disease is generally inversely proportional to the developmental level of the infant at birth, i.e., more premature infants typically show signs of necrotizing enterocolitis, the later signs of the disease become apparent relative to premature infants born closer to full term. Initial symptoms include feeding intolerance, increased gastric residuals, abdominal distension and bloody stools, and progress to abdominal discoloration with intestinal perforation and peritonitis as well as systemic hypotension. Current treatment consists primarily of supportive care, including the following: bowel rest by stopping enteral feeds; gastric decompression with intermittent suction; fluid replenishment to correct electrolyte abnormalities; parenteral nutrition; and antibiotic therapy. Where the disease is not halted through medical treatment alone, or when the bowel perforates, immediate emergency surgery to resect the dead bowel is required. This may require a colostomy, which may be able to be reversed at a later time. Some children may suffer later as a result of short bowel syndrome if extensive portions of the bowel have been removed.

[0005] Ulcerative colitis causes inflammation and ulceration of the inner lining of the colon and rectum. It rarely affects the small intestine except for the end that connects to the colon, called the terminal ileum. Ulcerative colitis may also be called colitis or proctitis. Ulcerative colitis may occur in people of any age, but most often it starts between ages 15 and 30. Ulcerative colitis affects men and women equally and appears to run in some families. Theories about what causes ulcerative colitis abound, but none have been proven. A popular theory is that the body's immune system reacts to a virus or a bacterium by causing ongoing inflammation in the intestinal wall.

[0006] The most common symptoms of ulcerative colitis are abdominal pain and bloody diarrhea. Patients may also experience fatigue, weight loss, loss of appetite, rectal bleeding, and loss of body fluids and nutrients. About half of patients have mild symptoms. Others suffer frequent fever, bloody diarrhea, nausea, and severe abdominal cramps. Ulcerative colitis may also cause problems such as arthritis, inflammation of the eye, liver disease (hepatitis, cirrhosis, and primary sclerosing cholangitis), osteoporosis, skin rashes, and anemia. No one knows for sure why problems occur outside the colon. Scientists think these complications may occur when the immune system triggers inflammation in other parts of the body. Some of these problems go away when the colitis is treated.

[0007] The extent and severity of mucosal injury in inflammatory bowel diseases are determined by the disequilibrium between two opposing processes, reparative and cytoprotective mechanisms versus inflammation-induced injury.

[0008] Treatment for ulcerative colitis depends on the seriousness of the disease. Most people are treated with medication. In severe cases, a patient may need surgery to remove the diseased colon. Patients whose symptoms are triggered by certain foods are able to control the symptoms by avoiding foods that upset their intestines, like highly seasoned foods, raw fruits and vegetables, or milk sugar (lactose). Some people have remissions that last for months or even years; however, most patients' symptoms eventually return.

[0009] The goal of therapy is to induce and maintain remission, and to improve the quality of life for people with ulcerative colitis. Several types of drugs are currently available. [0010] Aminosalicylate drugs, such as those that contain 5-aminosalicylic acid (5-ASA), help control inflammation. Sulfasalazine is a combination of sulfapyridine and 5-ASA and is used to induce and maintain remission. The sulfapyridine component carries the antiinflammatory 5-ASA to the intestine. However, sulfapyridine may lead to side effects such as nausea, vomiting, heartburn, diarrhea, and headache. Other 5-ASA agents such as olsalazine, mesalamine, and balsalazide, have a different carrier, offer fewer side effects, and may be used by people who cannot take sulfasalazine. 5-ASAs are given orally, through an enema, or in a suppository, depending on the location of the inflammation in the colon. Most people with mild or moderate ulcerative colitis are treated with this group of drugs first.

[0011] Corticosteroids, such as prednisone and hydrocortisone, also reduce inflammation. They may be used by patients with moderate to severe ulcerative colitis, or by those who do not respond to 5-ASA drugs. Corticosteroids can be given orally, intravenously, through an enema, or in a suppository. These drugs can cause side effects such as weight gain, acne, facial hair, hypertension, mood swings, and an increased risk of infection. For this reason, they are not recommended for long-term use.

[0012] Immunomodulators, such as azathioprine and 6-mercapto-purine (6-MP), reduce inflammation by affecting the immune system. They are used by patients who have not responded to 5-ASAs or corticosteroids, or by those who are dependent on corticosteroids. However, immunomodulators are slow-acting and it may take up to 6 months before the full benefit is seen. Patients taking these drugs are monitored for complications including pancreatitis and hepatitis, a reduced white blood cell count, and an increased risk of infection. Cyclosporine A may be used with 6-MP or azathioprine to treat active, severe ulcerative colitis in patients who do not respond to intravenous corticosteroids.

[0013] In addition to the above, other drugs may be given to relax the patient or to relieve pain, diarrhea, or infection.

[0014] About 25-40% of ulcerative colitis patients must eventually have their colons removed because of massive bleeding, severe illness, rupture of the colon, or risk of cancer. Sometimes the doctor will recommend removing the colon if medical treatment fails or if the side effects of corticosteroids or other drugs threaten the patient's health.

[0015] Crohn's disease differs from ulcerative colitis in that it may affect any part of the digestive tract. It causes inflammation and ulcers that may affect the deepest layers of lining of the digestive tract. Anti-inflammatory drugs, such as 5-aminosalicylates (e.g., mesalamine) or corticosteroids, are typically prescribed, but are not always effective. Immunosuppression with cyclosporine is sometimes beneficial for patients resistant to or intolerant of corticosteroids.

[0016] Nevertheless, surgical correction is eventually required in 90% of patients with Crohn's disease; 50% undergo colonic resection. (Leiper et al, 1998; Makowiec et al, 1998). The recurrence rate after surgery is high, with 50% requiring further surgery within 5 years. (Leiper et al, 1998; Besnard et al, 1998).

[0017] Current concepts regarding the etiopathogenesis of IBD suggest that there is a disequilibrium between the processes of cytoprotection and wound healing and the proinflammatory pathways, the net result of which culminates in a state of proinflammatory overactivity and resultant damage to the intestinal mucosa (Chang, 1999; Podolsky, 2002). Central to preserving mucosal integrity is maintenance of epithelial barrier function, as evidenced by the fact that altered tight junction structure resulting in impaired barrier function is thought to contribute to the clinical sequelae of ulcerative colitis (Schmitz et al, 1999).

[0018] Through the use of sense and antisense transfection experiments, it has been shown that heat shock proteins play a central role in providing cytoprotection to epithelial cells, as illustrated by their ability to protect epithelial barrier function under conditions of oxidative stress (Ropeleski et al, 2003; Urayama et al, 1998). Inducible heat shock proteins (Hsp) belong to a family of highly conserved proteins that play an important role in protecting cells against physiologic and pathogenic stressors in the environment. Under conditions of stress such as heat, exposure to heavy metals, and toxins, ischemia/reperfusion injury, or oxidative stress from inflammation, Hsp induction is both rapid and robust. Induction of heat shock proteins by a mild "stress" confers protection against subsequent insult or injury, which would otherwise lead to cell death. This well-described phenomenon is known as "stress tolerance" (Parsell and Lindquist, 1993).

[0019] In intestinal epithelial cells, inducible heat shock proteins convey a degree of cytoprotection against stressors such as inflammatory cell-derived oxidants and preserve the integrity of intestinal epithelial cell barrier function under hostile conditions (Chang, 1999; Musch et al, 1996; Musch et al, 1999). The induction of heat shock proteins in intestinal epithelial cells prolongs viability under conditions of stress (Musch et al, 1996) and preserves tight junctions as measured by transepithelial resistance (Musch et al, 1999). [0020] Activation of the pro-inflammatory NF-κB pathway is thought to be a key molecular event involved in the pathogenesis of IBD (Neurath et al,, 1998; Jobin and Sartor, 2000; Schmid and Adler, 2000; Boone et al, 2002). Administration of antisense oligonucleotides targeting the NF-κB subunit p65 was more effective than steroid treatment in reducing inflammation in two different murine models of colitis (Neurath et al, 1996). Immunohistochemical studies have shown that colonic biopsies from Crohn's patients display increased levels of expression of the NF-κB subunit p65 in areas of active inflammation (Neurath et al, 1998). In the non-inflammatory state, NF-κB is held in its inactive, cytosolic form complexed to the inhibitory protein IKB. Once a signal is received to activate NF-κB, its inhibitor IKB is phosphorylated and targeted for degradation by the ubiquitin proteasome pathway. The release of NF-κB from inhibition and its translocation to the nucleus, results in the transcriptional activation of a broad spectrum of cytokine and chemokine genes, cell adhesion molecules, and immunoreceptors, all important mediators of the inflammatory response (Neurath et al,, 1998; Jobin and Sartor, 2000; Schmid and Adler, 2000; Boone et al, 2002).

[0021] There is growing interest in the use of probiotics, which are defined as ingestible microorganisms having health benefit beyond their intrinsic nutritive value, in the treatment of a variety of gastrointestinal ailments including inflammatory bowel diseases (Gionchetti et al, 2000a), irritable bowel syndrome (Niedzielin et al, 2001), pouchitis (Gionchetti et al, 2000b; Gionchetti et al, 2003), as well as rotavirus and antibiotic-associated diarrhea (Isolauri et al, 1991; Majamaa et al, 1995; Arvola et al, 1999). Although little is known about their mechanisms of action, probiotics appear to have protective, trophic, and antiinflammatory effects on bowel mucosa.

[0022] Proposed mechanisms by which probiotics may act include the production of ammonia, hydrogen peroxide (Kullisaar et al, 2002; Annuk et al, 2003; Ocana et al, 1999), and bacteriocins (Cleveland et al, 2001; Paraje et al, 2000; Braude and Siemienski, 1968), which inhibit the growth of pathogenic bacteria, the competition for adhesion sites on intestinal epithelia (Lee et al, 2000; Lee et al, 2003), and an adjuvant- like stimulation of the immune system against pathogenic organisms (Maassen et al, 2000). However, the exact mechanisms by which probiotics act to protect against intestinal inflammation have yet to be fully elucidated.

[0023] Changing the gut flora of IBD patients with probiotic agents is being intensely studied as a therapeutic strategy. However, the mechanisms of probiotic action remain unclear. Moreover, the clinical efficacy of probiotics is highly dependent on the ability to establish and maintain bacterial colonization, and is limited by unregulated composition of formulations and homeopathic delivery of active agents. Thus, there is a need to elucidate the mechanisms of probiotic activity and develop more effective therapies for inflammatory bowel diseases, including enterocolitis, e.g., necrotizing enterocolitis.

SUMMARY OF THE INVENTION

[0024] The invention disclosed herein satisfies at least one of the aforementioned needs in the art by providing at least one isolated factor from Lactobacillus plantarum, wherein the isolated factor(s) is useful in treating, preventing, or ameliorating a symptom of an inflammatory epithelial cell disorder, such as inflammatory bowel disease. More particularly, the invention provides a relatively small, heat stable, pepsin-resistant, nuclease-sensitive component of the conditioned medium of L. plantarum useful in combating inflammatory diseases and disorders, such as enterocolitis, e.g., necrotizing enterocolitis.

[0025] The invention provides bioactive compounds or agents secreted by L. plantarum that attenuate the TNF-α-mediated induction of NF-κB activation in intestinal epithelial cells, thus affecting inflammatory bowel disease. The compounds of the invention provide the basis for therapies for the treatment of IBD that are superior to those currently available in the art.

[0026] In one aspect of the invention, a composition is provided that comprises an isolated, soluble, anti-inflammatory, cytoprotective compound derived from Lactobacillus plantarum. In some embodiments, the compound is present in a conditioned medium resulting from contact between L. plantarum and the medium. In certain embodiments, the composition is less than 10 kilodaltons, is refractory to pepsin cleavage, i.e., is not apparently cleaved by pepsin, as assessed by gel electrophoretogram, and is sensitive to nuclease degradation, i.e., at least one cleavage by a nuclease. In some embodiments, the compound is a nucleic acid. In some embodiments, the compound is present in an ether-extracted fraction of the conditioned medium. The composition according to the invention is capable of inducing the expression of at least one heat shock protein, such as Hsp70 of a human epithelial cell or Hsp25/27 of a mouse epithelial cell. In some embodiments, the composition is capable of acting as an inhibitor of NF-KB activation, for example compounds capable of inhibiting NF- KB by stabilizing IKB, for example stabilizing phosphorylated IKBOC, a form of IKB. In some embodiments, the compound is a proteasome inhibitor, such as a compound that selectively inhibits the chymotrypsin-like activity of the proteasome. In certain embodiments, the composition is a proteasome inhibitor that selectively inhibits the proteasome in an epithelial cell, such as an intestinal epithelial cell.

[0027] Another aspect of the invention is drawn to a pharmaceutical composition comprising an isolated, anti-inflammatory, cytoprotective compound derived from an L. plantarum-condiύoned medium and at least one pharmaceutically acceptable excipient. An exemplary pharmaceutical composition comprises an isolated, anti-inflammatory, cytoprotective compound of less than 10 kilodaltons. In some embodiments, the compound is a nucleic acid. In certain embodiments, the compound has the capacity to induce the expression of at least one heat shock protein, such as Hsp70 or Hsp25/27. In an illustrative embodiment, the compound is an inhibitor of NF-κB activation, such as by stabilizing IKB, whether phosphorylated IKB or not. In some embodiments, the compound is a proteasome inhibitor, such as a compound that selectively inhibits the chymotrypsin-like activity of the proteasome. An exemplary proteasome is an epithelial cell proteasome, such as an intestinal epithelial cell proteasome.

[0028] Yet another aspect of the invention is a method for treating a patient with an inflammatory disorder comprising administering to the patient an effective amount of an isolated, anti-inflammatory, cytoprotective compound derived from an L. plantarum- conditioned medium. Typically, the compound is administered in an amount effective to slow, halt or reverse the progress of an inflammatory disorder, such as an inflammatory disease or condition, e.g., an inflammatory bowel disease; however, also contemplated is the administration of a compound as described herein in an amount effective to ameliorate a symptom associated with an inflammatory disorder. Symptoms associated with inflammatory disorders, such as redness, swelling, heat and pain, are known in the art, as are methods for measuring or assessing such a symptom to determine whether that symptom has been ameliorated. The inflammatory disorder may be an autoimmune disorder. Examples of autoimmune disorders that may be treated according to the invention include rheumatoid arthritis, juvenile rheumatoid arthritis, osteoarthritis, psoriatic arthritis, atopic dermatitis, eczematous dermatitis, psoriasis, Sjogren's Syndrome, Crohn's disease, aphthous ulcer, iritis, conjunctivitis, keratoconjunctivitis, ulcerative colitis, asthma, allergic asthma, cutaneous lupus erythematosus, scleroderma, vaginitis, leprosy reversal reactions, erythema nodosum leprosum, autoimmune uveitis, polychondritis, Stevens-Johnson syndrome, lichen planus, sarcoidosis, primary biliary cirrhosis, uveitis posterior, or interstitial lung fibrosis. [0029] In a preferred embodiment of this aspect of the invention, the inflammatory disorder is an inflammatory bowel disease. In one aspect of the invention the inflammatory bowel disease is enterocolitis, e.g., necrotizing enterocolitis, including neonatal necrotizing enterocolitis. In some embodiments, the inflammatory bowel disease is ulcerative colitis or Crohn's disease. It is contemplated that compounds useful in the practice of the method will include a nucleic acid and/or be less than 10 kilodaltons and/or be refractory to pepsin cleavage and/or be sensitive to at least one nuclease. The compound may inhibit NF-κB activation (e.g., by stabilizing IKB in a phosphorylated or unphosphorylated form). In some embodiments, the compound used in the method is an inhibitor of a protease activity, such as a protease activity of a proteasome, e.g., an epithelial cell proteasome, including an intestinal epithelial cell. In certain embodiments, the compound selectively inhibits the chymotrypsin- like activity of the proteasome. In some embodiments, the anti-inflammatory, cytoprotective compound does not alter the ubiquitination level of at least one protein amenable to ubiquitination in an epithelial cell exposed to the compound. In some embodiments, the compound being administered is capable of inducing the expression of at least one heat shock protein, such as Hsp70 or Hsp25/27. In other embodiments of the method, the compound being administered is an inhibitor of NF- KB activation, such as a compound that inhibits NF- KB activation by stabilizing IKB.

[0030] A related aspect of the invention is directed to a method of preventing an inflammatory disorder comprising administering an effective amount of an antiinflammatory, cytoprotective compound derived from an L. plantarum-conditioned medium. This aspect of the invention includes embodiments analogous to the above-described embodiments of treatment methods, with apparent modification of those embodiments to suit the prophylactic use of a compound according to the invention to prevent, rather than to treat, a patient with an inflammatory disorder.

[0031] Yet another aspect of the invention is drawn to a kit for treating (including ameliorating a symptom thereof) or preventing an inflammatory disorder comprising a pharmaceutical composition as described above and instructions for administration of the composition to treat or prevent the disorder.

[0032] Another aspect of the invention provides a method of producing an isolated, antiinflammatory cytoprotective compound comprising obtaining an L. plantarum-condiύoned medium and isolating an anti-inflammatory, cytoprotective compound from the L. plantarum- conditioned medium, thereby producing an isolated, anti-inflammatory, cytoprotective compound. In some embodiments, the method further comprises characterizing the antiinflammatory, cytoprotective compound. More preferably, the method further comprises identifying the anti-inflammatory, cytoprotective compound.

[0033] In an aspect related to the pharmaceutical composition described above, the invention provides a method for administering the pharmaceutical composition to a therapeutically effective amount of an anti-inflammatory cytoprotective compound derived from an L. plantarum conditioned medium to a subject. Preferably the subject is a human. Also preferably, the subject has an inflammatory disorder. More preferably, the inflammatory disorder is an inflammatory bowel disease. In some embodiments the inflammatory bowel disease is enterocolitis, such as necrotizing enterocolitis. In other embodiments the inflammatory bowel disease is ulcerative colitis or Crohn's disease.

[0034] Another aspect of the invention is drawn to a method of screening for a modulator of monocyte chemoattractant protein - 1 (MCP-I) release, comprising: (a) combining a candidate modulator, an L. plantarum -conditioned medium, and an epithelial cell; (b) measuring MCP-I release by the cell; and (c) comparing the MCP-I release in the presence, and absence, of the candidate modulator, wherein a difference in the MCP-I release identifies the candidate modulator as a modulator of MCP-I release.

[0035] In a related aspect, the invention provides a method of screening for a modulator of heat shock protein expression, comprising (a) combining a candidate modulator, an L. plantarum-condiύoned medium, and an epithelial cell; (b) measuring heat shock protein expression in the cell; and (c) comparing the heat shock protein expression in the presence, and absence, of the candidate modulator, wherein a difference in the heat shock protein expression identifies the candidate modulator as a modulator of heat shock protein expression. In some embodiments, the heat shock protein is selected from the group consisting of Hsp25/27 and Hsp70. In some embodiments, the modulator alters the activity of Heat Shock Transcription Factor- 1 (HSF-I).

[0036] Another aspect of the invention is drawn to a kit for treating or preventing an inflammatory disorder comprising a pharmaceutical composition as described herein and instructions for administration of the composition to treat or prevent the disorder.

[0037] Yet another aspect of the invention is a method for treating a patient with an autoimmune disorder comprising administering to the patient an effective amount of an isolated anti-inflammatory, cytoprotective compound derived from an L. plantarum- conditioned medium. Any autoimmune disorder known in the art is expected to benefit from the method of treatment disclosed herein, including but not limited to rheumatoid arthritis, systemic lupus erythematosus, Sjogren's syndrome, multiple sclerosis, myasthenia gravis, psoriasis, Graves' disease and Hashimoto's disease.

[0038] A related aspect of the invention is drawn to a method of preventing an autoimmune disorder comprising administering an effective amount of an isolated, antiinflammatory, cytoprotective compound derived from an L. plantarum-conditioned medium. Any autoimmune disorder known in the art is expected to be susceptible to prevention using the method disclosed herein. Such disorders include the expressly identified autoimmune disorders of the preceding paragraph.

[0039] Another aspect of the invention is drawn to a kit for treating or preventing an autoimmune disorder comprising a pharmaceutical composition as described herein and instructions for administration of the composition to treat or prevent the disorder.

[0040] Numerous additional aspects and advantages of the invention will become apparent to those skilled in the art upon consideration of the following detailed description of the invention, which describes presently preferred embodiments thereof.

BRIEF DESCRIPTION OF THE DRAWING

[0041] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0042] Figure 1. A. Lp-CM inhibited NF-κB binding in intestinal epithelial cells. Nuclear extracts from YAMC cells treated with TNF were run on electrophoretic mobility shift assay. Pretreatment with Lp-CM blocked binding of NF-κB normally induced by TNFα (arrow#3). Binding inhibition of this classic NF-κB isoform by L. plantarum is as strong as MG132, a potent NF-κB inhibitor which blocks degradation of IKB through inhibition of the proteasome. In all cases except one (indicated in red), Lp-CM was given prior to (last three lanes), or at approximately the same time as, the TNF (indicated in blue), i.e., samples were timed to be harvested together. If Lp-CM was given after TNF (red), no inhibition was observed. Establishing that Lp-CM was unable to inhibit NF-κB binding once the inflammatory cascade was initiated. Maximal inhibition occurred if Lp-CM was given prior to TNF, indicating that optimal inhibition resulted from pre-treatment (i.e., given before TNF stimulation). Nonspecific binding (NS) indicated free probe at bottom of gel. B. YAMC cells were pretreated with conditioned media from Lactobacillus plantarum (Lp-CM) for the times indicated to establish a time course, cells were stimulated with TNF for 30 minutes and then a commercially available NF-κB ELISA (Active Motif) was used to test nuclear extracts and determine degree of NF-κB binding. It is seen that NF-κB inhibition only occurred if Lp- CM was given prior to TNF treatment. Lp-CM was unable to inhibit NF-κB binding once the inflammatory cascade was initiated.

[0043] Figure 2. Unlike Lp-CM, E. coli and L. paracasei CMs do not inhibit NF-κB. Cells were pre-treated with conditioned media from the indicated bacteria, stimulated with TNF as described in the brief description of Figure IA, and then a commercially available NF-kB ELISA (Active Motif) was used to test nuclear extracts and determine the degree of NF-κB binding. Unlike Lp-CM, conditioned media from the other two bacteria (E. coli, L. paracasei) were unable to inhibit NF-κB binding, demonstrating that the effect is specific for Lp-CM. References to "P. para" on the X-axis are references to L. paracasei.

[0044] Figure 3. A. Lp-CM inhibits TNF-mediated MCP-I release. YAMC cells were treated with Lp-CM for one hour, then with TNF-alpha (50 ng/ml) 6 hours prior to harvest and compared to untreated control (No Treatment, column 1), or TNF-alpha treatment alone (column 2), then assayed for release of chemokine MCP-I by ELISA. YAMC cells pretreated with Lp-CM showed a reduction in the amount of MCP-I released (column 4) in response to TNF-alpha stimulation, whereas the same effect was not seen for L. paracasei- CM (column 6) or E. coli-CM (last column) controls (mean + SE for three separate experiments, in each experiment, assay performed in triplicate). B. RAW 264.7 murine macrophage cells were treated with one of Lp-CM, L. paracasei-CM or E. coli-CM for one hour, then with TNF-alpha (50ng/ml) for 6 hours and then assayed for MCP-I release using a commercially available ELISA. Cells pretreated with Lp-CM showed a reduction in the amount of MCP-I released compared to TNF and L. paracasei-CM or E. coli-CM controls, indicating the effect is specific for Lp-CM.

[0045] Figure 4. A. Lp-CM inhibits IL-6 release and MCP-I release in primary dendritic cells. B. Provides a histogram showing the results of NF-KB assays of RAW cell lysates exposed to TNF, poly LC, Lp-CM, LP-CM and TNF, Lp-CM and LC, L. paracasei, L. paracasei and poly LC as well as positive and negative (no TX) controls. [0046] Figure 5. Presents a histogram showing that pretreatment with Lp-CM inhibited NF-κB activation by TLR (Toll-Like Receptor) ligands and TNF. Lp-CM was used to treat RAW cells, a macrophage cell line, activated by different NF-κB activators (TNF, LPS(TLR4), CpG DNA(TLR9)) and NF-κB activity was tested using an NF-κB ELISA kit (Active Motif). In all cases tested, NF-κB activation was inhibited by Lp-CM treatment (n=3).

[0047] Figure 6. A histogram showing that pretreatment with Lp-CM inhibited NF-κB activation by TLR (Toll-Like Receptor) ligands and TNF in RAW cells.

[0048] Figure 7. Provides histograms showing the results of NF-KB assays of YAMC (A), IEC-18 (B), and RAW (C) cell lysates exposed to Lp-CM, TNF, Lp-CM and TNF, Flagellin, and Flagellin and Lp-CM as well as a negative (no TX) control.

[0049] Figure 8. A-C. Provides histograms showing results of cell death ELISAs of various cell types exposed to the compounds indicated along the X-axis of the relevant panel. Panel A: IEC-18 cells; panel B: RAW cells; panel C: YAMC cells.

[0050] Figure 9. Shows Western blots of IKB, demonstrating that IKB degradation is inhibited by Lp-CM. YAMC cells were pretreated with either HBS Saline control (HBSS) or with Lp-CM for 30 minutes, then stimulated with TNFα (30ng/mL) and harvested at the time points (min) indicated. Samples were then subjected to Western blot analysis for the presence of IKB. Beta-actin was used as a loading control.

[0051] Figure 10. A. Provides a histogram showing results of treating YAMC cells with Lp-CM for one hour, then harvesting for proteasome assay using SLLVY-AMC substrate. Results are expressed as proteasome activity in fluorescence units/min. Activity was determined by measuring fluorescence (excitation 380 nm, emission 460 nm) for the first 5 minutes, then every 15 minutes thereafter in a Hitachi F-2000 fluorometer. Normal proteasome activity (column 1) is inhibited by Lp-CM (column 2), but not by E. coli-CM (column 3) or L. paracasei-CM (column 4). The synthetic inhibitor MG132 (Sigma, 25 μM, column 5) is also shown. B. Discloses a histogram showing results demonstrating that Lp- CM had a direct inhibitory effect on proteasome activity. Proteasomes were purified from mouse liver. Lp-CM was then added directly to the proteasome preparation, SLLVY-AMC substrate was added and the samples were assayed for proteasome activity as described below, except that a Bio-Tek fluorometer was used and slopes were calculated using KC4 software. MG132 was used as an inhibitor control. Proteasome preparations treated with L. paracasei-CM or E. coli-CM are also shown, indicating that the inhibitory effect is specific for Lp-CM. Results are presented as the mean + SE for three separate experiments, in each experiment each group was performed in triplicate, * p< 0.05 compared to controls.

DETAILED DESCRIPTION

[0052] Inflammatory bowel diseases (IBDs) are a group of chronic disorders that affect the digestive tract of susceptible individuals. The extent and severity of mucosal injury in IBD is determined by the disequilibrium between inflammation-induced injury versus reparative and cytoprotective mechanisms. In recent in vitro and in vivo studies, various probiotics have been shown to be effective in either preventing or mitigating intestinal mucosal inflammation associated with experimental colitis (Madsen et al., 2001; Gionchetti et al., 2000b; Campierei et al., 2000). Furthermore, probiotics appear to reduce the rate of malignant transformation of colonic mucosa in the setting of chronic inflammation (Wollowski et al., 2001). A number of preliminary clinical trials have shown that probiotics are effective in the treatment of pouchitis and IBD. Several multicenter clinical trials are also under way to determine the effectiveness of these agents and to optimize dosage in IBD patients. The mechanism(s) of probiotic action, however, remains unclear. It follows that there is no appreciation in the art that the beneficial effects of crude probiotic materials, such as unrefined probiotic - conditioned media, can be ascribed to, and hence achieved, with one or more discrete compounds. Moreover, the therapeutic use of crude conditioned media of uncharacterized content presents significant health concerns.

[0053] There are also a fairly large number of autoimmune disorders or diseases, including autoimmune thyroid diseases like Graves' disease and Hashimoto's thyroiditis. Autoimmune thyroid disease results from the production of autoantibodies that either stimulate the thyroid to cause hyperthyroidism (Graves' disease) or destroy the thyroid to cause hypothyroidism (Hashimoto's thyroiditis). RA is caused by a combination of events including an initial infection or injury, an abnormal immune response, and genetic factors. While autoreactive T cells and B cells are present in RA, the detection of high levels of autoantibodies that collect in the joints, called rheumatoid factor, is used in the diagnosis of RA. Systemic Lupus Erythematosus (SLE) is caused by recurrent injuries to blood vessels in multiple organs, including the kidney, skin, and joints. In patients with SLE, a faulty interaction between T cells and B cells results in the production of autoantibodies that attack the cell nucleus. Immune thrombocytopenic purpura (ITP) is caused by autoantibodies that bind to blood platelets and cause their destruction. Some cases of ITP are caused by autoimmune disease such as SLE. Sjogren's syndrome is an autoimmune disease characterized by destruction of the body's moisture -producing glands. Autoantibodies, including anti-nuclear antibodies, rheumatoid factor, anti-fodrin, and anti-muscarinic receptor are often present in patients with Sjogren's syndrome. Multiple sclerosis (MS) is characterized by inflammation of the central nervous system and destruction of myelin, which insulates nerve cell fibers in the brain, spinal cord, and body. Myasthenia Gravis (MG) is a chronic autoimmune neuromuscular disorder that is characterized by weakness of the voluntary muscle groups. MG is caused by autoantibodies that bind to acetylcholine receptors expressed at neuromuscular junctions. The autoantibodies reduce or block acetylcholine receptors, preventing the transmission of signals from nerves to muscles. Psoriasis is characterized by autoimmune inflammation in the skin. Scleroderma is a chronic autoimmune disease of the connective tissue that is also known as systemic sclerosis.

[0054] The probiotic Lactobacillus plantarum is disclosed herein as producing factor(s) with anti-inflammatory and cytoprotective properties. More particularly, soluble factors secreted by the specific probiotic agent Lactobacillus plantarum decrease the incidence and severity of NEC by improving intestinal host defense mechanisms, including (1) cytoprotection via enhancement of intestinal barrier function, (2) induction of cytoprotective heat shock proteins/protection against oxidant injury, and (3) modulation of the intestinal inflammatory response through inhibition of NF-KB activation/proteasome function. Moreover, these effects could be mediated through the common unifying mechanism of proteasome inhibition, although the invention is not contemplated as being limited by such explanatory theorizing. To facilitate a more thorough understanding of the invention, the following term definitions are provided. Similarly, the L. plantarum conditioned medium provides at least one factor suitable for use in treating, preventing or ameliorating a symptom of an autoimmune disorder or disease.

[0055] "Isolated" in the context of describing the invention disclosed herein means that a given substance is separated from at least one other substance with which it is typically found in nature. By way of example, a bioactive agent "isolated" from a conditioned medium is separated from at least one other component of the relevant crude conditioned medium.

[0056] "Selective inhibition," in the context of the selective inhibition of protease functions of the proteasome, means that less than all, and preferably one, protease function of a proteasome is reduced to a level comparable to the level of that protease measured in the presence of up to 10 μM lactocystin. For example, reduction of a chymotrypsin-like activity of a proteasome to a level found in the presence of no more than 10 μM lactocystin, without the concomitant reduction in the activity of at least one of the trypsin-like or the caspase-like proteasome activities, is illustrative of selective inhibition.

[0057] "Anti-inflammatory" has a plain meaning well known in the art as a substance or process that reduces inflammation, a physiological process generally characterized by heat, redness, swelling and pain. "Anti-inflammatory" is given its plain meaning herein.

[0058] "Inflammatory disorder" means any disease, malady, or condition known in the art to be characterized by involvement of inflammation. The term includes diseases, maladies and conditions of epithelial cells and, by way of particular example, of intestinal (i.e., gut) epithelial cells.

[0059] "Cytoprotective" has a plain meaning well known in the art as a substance or process that protects at least one cell or cell type, and it is this plain meaning that is given the term throughout this application.

[0060] "Probiotic-conditioned media" means a cell culture medium that has been exposed to viable cells. Suitable culture media include all media known in the art to be suitable for the growth, and/or maintenance, of a cell amenable to maintenance or growth in vitro and includes numerous media useful for maintaining or growing a variety of prokaryotic or eukaryotic cells.

[0061] "Media," and "medium," are given their plain meanings of compositions containing compounds required for the maintenance and/or growth of at least one cell type. For example, a medium may contain an energy source, nutrients, growth factors, and the like, as would be known in the art. These terms are used throughout this application without strict adherence to number and, accordingly, may be used as synonyms, as would be apparent to one of skill from the context of a particular recitation.

[0062] "Stabilizing IKB" means the act of preserving an IKB protein for a physiologically significant period of time, without regard to whether the protein being stabilized is unmodified or modified, for example by phosphorylation.

[0063] "NF-κB activation" means that intracellular NF-κB exhibits an increased level of at least one activity characteristic of this protein, as would be known in the art. Such activation may result from a decreased rate of destruction of NF-κB, an increased rate of production (e.g., expression) of NF-κB, or a combination thereof. [0064] "Pharmaceutically acceptable excipient," is a phrase given its plain meaning of a substantially inert substance admixable with a pharmaceutical or bioactive agent as a vehicle to provide a consistency or form suitable for pharmaceutical administration. Such vehicles typically do not produce an allergic or similar untoward reaction when administered to a human.

[0065] "MCP-I release" refers to the separation of Monocyte Chemoattractant Protein- 1 from a cell that had produced or harbored it, such as by secretion, as would be known in the art.

[0066] "Modulator" means a substance that affects a detectable activity (e.g., of a protein) or process (e.g., a physiological process such as MCP-I release), regardless of whether the effect is one of promotion (e.g., enhancement) or inhibition.

[0067] In view of these definitions, it will be appreciated that the compounds of the invention provide therapies for the treatment of inflammatory disorders, such as IBD, that are superior to those currently available in the art. In one embodiment, the invention provides a composition comprising an isolated, anti-inflammatory, cytoprotective compound derivable from an L. plantarum-conditioned medium. In addition, the invention provides methods for treating a patient with an inflammatory disorder comprising administering to the patient an isolated, anti-inflammatory, cytoprotective compound derivable from an L. plantarum- conditioned medium. In other aspects, the invention provides methods for isolating and characterizing at least one compound from an L. plantarum-condiύoned medium that has anti-inflammatory and/or cytoprotective properties, and preferably both types of properties.

[0068] The invention provides methods of identifying and characterizing compounds derivable from cell cultures, such as bacterial cultures, that have anti-inflammatory and cytoprotective properties. The invention provides isolated, anti-inflammatory, cytoprotective compounds derivable from Lactobacillus plantarum. The invention also provides compositions and methods useful in treating, and/or preventing, inflammatory diseases, particularly inflammatory disease of an epithelium.

I. Isolation of Anti-Inflammatory and Cytoprotective Compounds

[0069] Methods of bacterial cell culture are well known to those of skill in the art. In a preferred method, L. plantarum is cultured in mammalian tissue culture medium. L. plantarum grows in mammalian tissue culture medium (e.g., RPMI 1640 or DMEM) under aerobic conditions. Growth in tissue culture medium makes the isolation of secreted factors much more straightforward than if a complex broth is used. Also suitable are any number of bacterial culture media known in the art, such as MRS medium.

[0070] The anti-inflammatory, cytoprotective compounds of the invention are factors derivable from a cell-conditioned medium such as an L. plantarum-condiύoned medium (Lp- CM). To facilitate the identification and characterization of this/these compound(s), it is preferable to remove the bacterial cells from the medium. One of skill in the art would be familiar with methods of separating cells from the soluble factors in the medium. For example, the cells may be removed by centrifugation, filtration or a combination of both. In one embodiment, overnight cultures grown at 37⁰C in tissue culture medium (e.g., RPMI 1640) are prepared and then centrifuged at 10,000g for 5 minutes at 4⁰C. The medium is then removed and filtered through a 0.2 μm cellulose acetate filter to exclude all live and intact bacteria. This "conditioned medium" is then used as the source from which antiinflammatory and cytoprotective compounds are identified.

A. Organic Extraction

[0071] The anti-inflammatory and cytoprotective compounds can be further isolated from the conditioned medium by extraction with organic solvents. Organic extraction separates organic from aqueous compounds. Methods of extraction and suitable organic solvents are well known to those of skill in the art. In a preferred embodiment, the organic extraction is performed with ether. The ether extraction process generally removes organic acids and their derivatives, as well as lipid and phospholipid molecules, whereas inorganic salts, hydrophilic peptides, hydrophilic proteins, carbohydrates and polysaccharides tend to remain in the aqueous phase.

B. Thin Layer Chromatography

[0072] Methods for the purification of organic acids are well known to those of skill in the art. For example, the compounds of the invention may be purified from the ether-extracted fraction of the conditioned medium using thin layer chromatography (TLC), which is a chromatographic technique that is useful for separating organic compounds such as organic acids and their derivatives.

[0073] In an embodiment, ether extracts of L. plantarum-conditioned medium are subjected to thin layer chromatography (TLC) on a silica gel G TLC plate that has been activated at 15O⁰C for 6 hours. The plate is developed using ethanol/ammonia/water in a ratio of 50:8:6 by volume for the first dimension, and benzene/methanol/acetic acid in a ratio of 45:8:4 for the second dimension. Because of differences in their partitioning behaviors between the mobile liquid phase and the stationary phase, the different components in the ether-extracted mixture will migrate at different rates, allowing for their separation. The chromatogram is then developed reversibly under iodine vapor, which binds to carbon double bonds and allows visualization of the individual components of the ether-extracted mixture. The separated components are individually isolated by scraping the visualized spots off with a spatula, allowing the iodine vapor to evaporate, and then back extracting again with ether. Each fraction is then tested for activity. To ensure that the ether extraction process itself is not exerting an effect on bioactivity, conditioned medium from the DH5α laboratory strain of E. coli is treated in the same manner as above and used as a negative control for the ether extraction process.

C. Other Separation Techniques

[0074] Other separation techniques known to those of skill in the art may also be employed in the invention to fractionate the conditioned medium. High Performance Liquid Chromatography (HPLC) is characterized by a very rapid separation with extraordinary resolution of peaks. This is achieved by the use of very fine particles and high pressure to maintain an adequate flow rate. Separation can be accomplished in a matter of minutes, or at most an hour. Moreover, only a very small volume of the sample is needed because the particles are so small and close-packed that the void volume is a very small fraction of the bed volume. Also, the concentration of the sample need not be very great because the bands are so narrow that there is very little dilution of the sample.

[0075] Gel chromatography, or molecular sieve chromatography, is a special type of partition chromatography that is based on molecular size. The theory behind gel chromatography is that the column, which is prepared with tiny particles of an inert substance that contain small pores, separates larger molecules from smaller molecules as they pass through or around the pores, depending on their size. As long as the material of which the particles are made does not adsorb the molecules, the sole factor determining rate of flow is the size. Hence, molecules are eluted from the column in decreasing size, so long as the shape is relatively constant. Gel chromatography is unsurpassed for separating molecules of different size because separation is independent of all other factors such as pH, ionic strength, temperature, and the like. There also is virtually no adsorption, less zone spreading and the elution volume is related in a simple matter to molecular weight. [0076] Separation techniques based on charge may also be used. One such technique is ion exchange chromatography. With ion exchange chromatography, the sample is reversibly bound to a charged matrix. Matrices containing diethyl aminoethyl (DEAE) and carboxymethyl (CM) celluloses are commonly used. Desorption is then brought about by increasing the salt concentration or by altering the pH of the mobile phase. Another technique known to those skilled in the art for separating compounds based on charge is IEF (isoelectric focusing).

[0077] Additionally, the conditioned medium may be passed through filters with specific molecular weight cutoffs. For example, some fractions of the invention were parsed by passage through Centricon filters with a 10 kDa molecular weight cutoff.

[0078] During the course of purification or isolation, it may be desirable to assay the fractions in order to follow those fractions that retain anti-inflammatory and cytoprotective activity. For example, the medium or fraction may be screened for the ability to inhibit NF- KB activity in intestinal epithelial cultured cells. These assays are described in more detail below. Preparations that have biological activity may be frozen in aliquots to be used later for identification, purification, and future production of anti-inflammatory and cytoprotective compounds.

D. Chemical Synthesis

[0079] In addition to isolating the anti-inflammatory, cytoprotective compounds of the invention from L. plantarum-conditioned medium, it is also envisioned that these compounds may be created by chemical synthesis. Methods of chemical synthesis are well known to those of skill in the art.

II. Identification of Anti-Inflammatory and Cytoprotective Compounds

[0080] The anti-inflammatory and cytoprotective compounds of the invention may be identified by methods known to those of skill in the art. Two preferred methods of identifying the compounds of the invention are preparative TLC (similar to analytical TLC described above but on a larger scale) and HPLC (high performance liquid chromatography).

[0081] In one embodiment, HPLC is run using a C8 reversed-phase (RP) column with potassium phosphate buffer (pH2.8)/methanol (95:5) to isolate each compound. Separation of components occurs through hydrophobic interactions with the stationary phase (C8 column), and the mobile phase consisting of an aqueous acidic solution followed by an organic solvent then allows for elution of individual compounds in the mixture. Each compound is retained on the column until the appropriate concentration of organic solvent displaces it from the C8 stationary phase. Each separated peak is then collected, and the identification of the eluted compounds is carried out by using suitable techniques known in the art, such as nuclear magnetic resonance imaging (NMR) and infrared spectroscopy (IR).

[0082] In some embodiments, the compounds of the invention may be identified using mass spectrometry. Mass spectrometry provides a means of "weighing" individual molecules by ionizing the molecules in vacuo and making them "fly" by volatilization. Under the influence of combinations of electric and magnetic fields, the ions follow trajectories depending on their individual mass (m) and charge (z). Mass spectrometric methods are well-known to those of skill in the art, and are routinely used for the analysis and characterization of a variety of molecules.

III. Characterization of Anti-inflammatory and Cytoprotective Compounds

[0083] Compounds derivable from probiotic-conditioned medium, such as compounds actually derived therefrom, can be assayed for the ability to inhibit NF-κB activity and, separately, to inhibit the proteasomal function of cells such as intestinal epithelial cells.

A. The NF-κB Pathway

[0084] A number of approaches are known to those of skill in the art to assess the inhibition of NF-κB activation, such as inhibition of the NF-κB pathway. For example, electrophoretic mobility shift assays (EMSA or gel shifts) using an oligonucleotide labeled, e.g., with ³²P, is performed to determine activation of NF-κB. Activation of NF-κB and release from the inhibitor IKB results in binding to this mimic, which is easily detected on polyacrylamide gels. At least two additional measures are available to be used to corroborate NF-κB activation. First, activated NF-κB translocates into the nucleus of the cell and therefore detection of NF-κB in the nucleus by immunofluorescence or immunoblotting of nuclear fractions strongly supports NF-κB activation. Second, transient transfections with a NF-κB-sensitive reporter construct, such as a construct having five copies of the NF-κB responsive promoter element cloned in front of a firefly luciferase reporter, can be performed. Moreover, data from the three assays (EMSA, nuclear NF-κB translocation, and NF-κB reporter) may help identify unique steps at which the compounds of the invention modulate, e.g., inhibit, NF-κB activity. [0085] ELISA-based assays for the detection of NF-κB activation are also known in the art. For example, an NF-κB ELISA-based assay kit is commercially available from Vinci- Biochem (Vinci, Italy).

[0086] NF-κB regulates a wide variety of genes encoding, for example, cytokines, cytokine receptors, cell adhesion molecules, proteins involved in coagulation, and proteins involved in cell growth. Thus, another approach to the study of the NF-κB pathway is through the analysis of the expression of genes known to be regulated by NF-κB. Those of skill in the art will be familiar with a variety of techniques for the analysis of gene expression. For example, changes in mRNA and/or protein levels may be measured. Changes in mRNA levels can be detected by numerous methods including, but not limited to, real-time PCR and genomic microarrays. Changes in protein levels may be analyzed by a variety of immunodetection methods known in the art.

[0087] It is also worthwhile to monitor changes in the NF-κB regulator, IKB. AS the compounds of the invention are expected to affect the activity of IKB in more than one form, antibodies to both the native as well as the phosphorylated form of IKB are useful and may be used for Western blotting and immunohistochemical localization.

B. The Proteasome

[0088] The compounds of the invention may be screened by assessing their effects on cellular proteasomal function. The proteasome is a large complex, which contains several protease activities with different specificities. It exists in two forms, a 2OS complex and a 26S complex. Cellular proteasomes play an important role in degrading cellular proteins as well as in providing viral and endogenous peptide fragments for loading of MHC I molecules for antigen presentation.

[0089] Inhibitors of the proteasome block the degradation of many cellular proteins. Proteasome inhibitors are broadly categorized into two groups: synthetic analogs and natural products. Synthetic inhibitors are peptide-based compounds with diverse pharmacophores. These include peptide benzamides, peptide α-ketoamides, peptide aldehydes, peptide α - ketoaldehydes, peptide vinyl sulfones, and peptide boronic acids. Known natural product proteasome inhibitors include linear peptide epoxyketones, peptide macrocycles, γ-lactam thiol ester, and epipolythiodioxopiperazine toxin. Some specific examples of proteasome inhibitors include MG132, ALLN, E64d, LLM, quinacrine, chloroquine, clioquinol, (R)-(-)- 3-hydroxybutyrate, dopamine, L-DOPA, PR39, gliotoxin, and green tea (EGCG). Additional examples of proteasome inhibitors are disclosed in Kisselev and Goldberg (2001) and Myung et al. (2001), both of which are incorporated herein by reference in their entireties.

[0090] Inhibition of proteasomal function by L. plantarum-condiύoned medium provides a potential unifying mechanism for the inhibition of NF-κB and induction of cytoprotective heat shock proteins. Such an action is consistent with the accumulation of phospho- and ubiquitinated-IκB disclosed herein. Furthermore, it has been shown that inhibition of proteasomal function is an extremely potent stimulus of the heat shock protein response, likely due to the accumulation of undegraded proteins (Lee and Goldberg, 1998). Although not wishing to be bound by theory, the data disclosed herein indicate that the primary mechanism of action through which L. plantarum-conditioned medium inhibits the NF-κB pathway and induces Hsp expression appears to be direct inhibition of proteasomal function. This represents a novel mechanism of probiotic action differing from that reported by Neish, et al, who had reported inhibition of activated NF-κB by non-pathogenic Salmonella organisms through a type III secretion system, which requires intact bacteria and bacterial adherence.

[0091] Those of skill in the art are familiar with methods for assaying proteasome function. In a preferred method, proteasome assays are performed using a fluorometric assay by preparing crude cell lysates from YAMC cells treated with L. plantarum-condiύoned medium, then adding the proteasome substrate SLLVY-AMC and measuring hydrolysis of this product over time. The substrate is a five amino acid peptide attached to a fluor (4- amino-7-methylcoumarin) which, upon cleavage by the chymotrypsin-like activity of the proteasome, results in a fluorescent signal that can be measured and plotted over time. The activity of the proteasome is reflected by the rate, or slope of the line. In this assay, the inhibition of proteasome activity by a candidate molecule may be compared to that of a known proteasome inhibitor, such as MG132.

[0092] Another method for assaying proteasome function is immunofluorescence using antibodies that recognize active proteasomes. For example, LMP2 antibodies specifically recognize the proteasome beta subunit. In addition, proteasome assay kits are commercially available from Biomol International LP.

C. Animal Models

[0093] The characterization of the compound(s) of the invention may involve the use of various animal models, including transgenic animals that have been engineered to have specific defects, or to carry markers that can be used to measure the ability of a candidate substance to reach and affect different cells within the organism. Due to their size, ease of handling, and information on their physiology and genetic make-up, mice are a preferred animal model, especially for transgenics. However, other animals are suitable as well, including rats, rabbits, hamsters, guinea pigs, gerbils, woodchucks, cats, dogs, sheep, goats, pigs, cows, horses, and monkeys (including chimps, gibbons and baboons). Assays may be conducted using an animal model derived from any of these species.

[0094] Some examples of mouse models for colitis include the DSS-induced colitis model (for which there is also a corresponding rat model), IL-10 knockout mouse, A20 knockout mouse, TNBS-induced colitis model, IL-2 knockout mouse, TCRalpha receptor knockout mouse, and the E-cadherin knockout mouse.

[0095] Treatment of animals with test compounds will involve the administration of the compound, in an appropriate form, to the animal. Any animal model of inflammatory disease known to those of skill in the art can be used in the practice of a method according to the invention. Administration will be by any route that could be utilized for clinical or nonclinical purposes. For example, the compound may be delivered by gavage or by rectal administration. In addition, the protective effects of a compound may be assayed by administering a compound before inducing colitis in the animal model. Alternatively, the therapeutic effect of a compound may be assayed by administering the compound after inducing colitis in the animal model.

[0096] Determining the effectiveness of a compound in vivo may involve consideration of a variety of different criteria. One of ordinary skill in the art would be familiar with the wide range of techniques available for assaying for inflammation in a subject, whether that subject is an animal or a human subject. For example, inflammation can be measured by histological assessment and grading of the severity of the inflammation, e.g., colitis. Other methods for assaying inflammation in a subject include, for example, measuring myeloperoxidase (MPO) activity, transport activity, villin expression, and transcutaneous electrical resistance (TER) or transepithelial electrical resistance (TEER).

[0097] The effectiveness of a compound can also be assayed using tests that assess cell proliferation. For example, cell proliferation may be assayed by measuring 5-bromo-2'- deoxyuridine (BrdU) uptake. Yet another approach to determining the effectiveness of a compound would be to assess the degree of apoptosis. Methods for studying apoptosis are well known in the art and include, for example, the TUNEL assay.

[0098] In addition, measuring toxicity and dose response can be performed in animals rather than in in vitro or in cyto assays.

IV. Pharmaceutical Compositions

[0099] Composition(s) of the invention comprise an effective amount of an antiinflammatory, cytoprotective compound, which may be dissolved and/or dispersed in a pharmaceutically acceptable excipient, such as a carrier and/or aqueous medium.

[0100] The anti-inflammatory, cytoprotective compounds of the invention may be delivered by any method known to those of skill in the art (see for example, "Remington's Pharmaceutical Sciences" 15th Edition). For example, the pharmaceutical compositions may be delivered orally, rectally, parenterally, or topically.

[0101] Solutions comprising the compounds of the invention may be prepared in water suitably mixed with a surfactant, such as polyethylene glycol (PEG) of low (less than 8 kDa) or high (greater than 8, and preferably greater than 15, kDa) average molecular weight, or hydroxypropylcellulose. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The form should usually be sterile and must be fluid to the extent that effective syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.

[0102] For parenteral administration in an aqueous solution, for example, the solution may be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, intratumoral, and intraperitoneal administration. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure.

[0103] A suppository may also be used. Suppositories are solid dosage forms of various weights and/or shapes for insertion into the rectum, vagina and/or the urethra. After insertion, suppositories soften, melt and/or dissolve in the cavity fluids. In general, for suppositories, traditional binders and/or carriers may include, for example, polyalkylene glycols and/or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably l%-2%. The pharmaceutical compositions of the invention may also be delivered by enema.

[0104] Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and/or the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained-release formulations and/or powders. In certain defined embodiments, oral pharmaceutical compositions will comprise an inert diluent and/or assimilable edible carrier, and/or they may be enclosed in hard- and/or soft- shell gelatin capsule, and/or they may be compressed into tablets, and/or they may be incorporated directly with the food of the diet. For oral therapeutic administration, the active compound(s) may be incorporated with excipients and/or used in the form of ingestible tablets, buccal tables, troches, capsules, elixirs, suspensions, syrups, wafers, and/or the like. Such compositions and/or preparations should contain at least 0.1% of active compound. The percentage of the compositions and/or preparations may, of course, be varied and/or may conveniently be between about 2 to about 75% of the weight of the unit, and/or preferably between 25-60%. The amount of active compounds in such therapeutically useful compositions is such that a suitable dosage will be obtained.

[0105] The tablets, troches, pills, capsules and/or the like may also contain the following: a binder, such as gum tragacanth, acacia, cornstarch, and/or gelatin; excipients, such as dicalcium phosphate; a disintegrating agent, such as corn starch, potato starch, alginic acid and/or the like; a lubricant, such as magnesium stearate; and/or a sweetening agent, such as sucrose, lactose and/or saccharin may be added and/or a flavoring agent, such as peppermint, oil of wintergreen, and/or cherry flavoring. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings and/or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, and/or capsules may be coated with shellac, sugar and/or both. A syrup of elixir may contain the active compounds sucrose, as a sweetening agent, methyl and/or propylparabens as preservatives, and a dye and/or flavoring, such as cherry and/or orange flavor.

[0106] Topical formulations include, creams, ointments, jellies, gels, epidermal solutions or suspensions, and the like, containing the active compound. [0107] For human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by the FDA Office of Biologies standards.

[0108] The dosage of the anti-inflammatory, cytoprotective compounds and dosage schedule may be varied on a subject-by-subject basis, taking into account, for example, factors such as the weight and age of the subject, the type of disease being treated, the severity of the disease condition, previous or concurrent therapeutic interventions, the manner of administration, and the like, which can be readily determined by one of ordinary skill in the art.

[0109] Administration is in any manner compatible with the dosage formulation, and in such amount as will be therapeutically effective. The quantity to be administered depends on the subject to be treated. Precise amounts of an active ingredient required to be administered depend on the judgment of the practitioner and such judgments may involve routine procedures to determine an effective amount on a case-by-case basis.

[0110] The following examples are included to demonstrate preferred embodiments of the invention. It will be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques disclosed herein as functioning well in the practice of the invention. However, those of skill in the art will, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

Example 1

General Methodologies

L. plantarum Culture and Generation of Conditioned Medium

[00100] Lactobacillus plantarum was grown to 2xlO⁹ cfu/ml in MRS (Mann Ragusa Sharp) broth at 37°C, 5% CO₂ under non-agitating conditions. The bacteria were then centrifuged for 20 minutes at 5400 rpm and the bacterial pellet was resuspended in HBSS (Hanks Buffered Saline) and propagated for 16 hours at 37°C, 5% CO₂, non-agitating conditions. The culture was centrifuged (20 minutes, 5400 rpm) and the supernatant (conditioned media) was aseptically filtered using a 0.22 micron low protein binding cellulose acetate filter to yield conditioned media (CM) that was free of contaminating bacteria. An aliquot of each new batch was streaked on MRS-agar plates to ensure there was no growth of bacteria. For each new batch of CM, bioactivity was compared to a known CM batch containing established activity, which serves as the relative standard to ensure quality control. Readout for bioactivity was NF-κB inhibition in YAMC epithelial cells after TNF stimulation, as measured by ELISA (commercially available kits from Active Motif). Only CM with activity equivalent to at least 80% of the standard was used. Conditioned media was produced in large batches, then aliquotted and stored at 4°C until use. Conditioned media from E. coli (Fl 8 strain) and L. paracasei was prepared in the same manner, except that for E. coli, Luria-Bertani (LB) agar plates and LB broth were used instead of MRS. As disclosed herein and as would be recognized by one of skill in the art, further purification of any such factor(s) is feasible using any of a number of well-known techniques.

Tissue Culture YAMC cells

[0111] YAMC (young adult mouse colon) cells are a conditionally immortalized mouse colonic intestinal epithelial cell line derived from the Immortimouse that express a transgene of a temperature- sensitive SV40 large T antigen (tsA58) under control of an interferon- gamma-sensitive portion of the MHC class II promoter (Whitehead et al, 1993). YAMC cells were maintained under permissive conditions (33⁰C) in RPMI 1640 medium with 5% (vol/vol) fetal bovine serum, 5 U/ml murine IFN-γ (GibcoBRL, Grand Island, NY), 50 μg/ml streptomycin, 50 U/ml penicillin, supplemented with ITS+ Premix (BD Biosciences, Bedford, MA). Under non-permissive (non-transformed) conditions at 37⁰C in the absence of IFN-γ, these cells undergo differentiation and develop mature epithelial cell functions and properties including tight junction formation, polarity, microvillar apical membranes, and transport functions.

[0112] Cells were plated at a density of 2 x 10⁵ per 60 mm tissue culture dish (e.g., for Western blot analysis and proteasome assays), or at 1 x 10⁵ per well in 6-well plates (for NF- KB luciferase transfection experiments). After 24 hours of growth at 33⁰C to allow for cell attachment, the medium was replaced with IFN-free medium and cells were moved to 37⁰C (non-permissive conditions) for 24 hours to allow the development of the differentiated colonocyte phenotype for all experiments. Cells were treated with L. plantarum-conditioned medium (Lp-CM) (1:10 dilution) overnight, and then used the following day in various experiments. For NF-κB luciferase reporter assays, murine TNF-α (Peprotech, Rocky Hill, NJ), at a concentration of 50 ng/ml, was added directly to the cells at this time and left for 6 hours before harvest. Heat shock controls were exposed to 42⁰C for 23 minutes and allowed to recover at 37⁰C for 2 hours before harvest. MG132-treated control cells were treated for 2 hours with 25 μM MG132 (Biomol, Plymouth Mtg, PA) at 37⁰C prior to harvest unless otherwise specified.

IEC-18 cells

[0113] The rat small intestinal cell line IEC-18 (ATCC #CRL-1589) was grown in Dulbecco's modified Eagle's medium (DMEM, high glucose, 4.5g/L) with 5% (vol/vol) fetal bovine serum, 0.1 U/ml insulin, 50 μg/ml streptomycin, and 50 U/ml penicillin. Cells were used at confluence between passages 10 and 20.

RAW cells

[0114] Murine RAW 264.7 macrophage cells were maintained in Dulbecco's modified Eagle's medium (DMEM) with 4 mM L-glutamine and 10% fetal bovine serum. Cells were grown at 37°C and passaged every 2 to 3 days at a ratio of 1:6, for up to 30 passages. For the experiments, cells were plated in 60 mm culture dishes at IxIO⁵ cells/ml and were grown overnight at 37⁰C.

Preparation of Cell Lysates

[0115] Cells were washed twice and then scraped in ice-cold HBS (150 mM NaCl, 5 mM KCl, 10 mM HEPES, pH 7.4). Cells were pelleted (14,000 x g for 20 seconds at room temperature), then resuspended in ice-cold lysis buffer (10 mM Tris, pH 7.4, 5 mM MgCl₂, 50 U/ml DNAse and RNAse, plus complete protease inhibitor cocktail (Roche Molecular Biochemicals, Indianapolis, IN)). Protein concentrations were determined using the bicinchoninic acid procedure (Smith, 1985). For proteasome assays, samples were stored immediately at -8O⁰C until use. For Western blots, samples were heated to 75⁰C for 5 minutes after addition of 3X Laemmli Stop buffer, then stored at -8O⁰C until use.

Preparation of Nuclear Extracts

[0116] Nuclear extracts were obtained utilizing a method modified from Inan et al (Inan, MS, et al., Gastroenterology 2000; 118:724-734). Briefly, young adult mouse colon (YAMC) cells were cultured as described above. The cells were washed and harvested in Tris buffered saline, and then incubated for 15 minutes in extract lysis buffer (10 mM Hepes, pH 7.4, 10 mM KCl, 0.1 mM EDTA, 2 mM MgCl₂, 0.5 mM sucrose, 0.05% Nonidet P-40 (NP40), 0.5 mM PMSF, 1 mM DTT, and Ix Complete protease inhibitor [Roche]). The cytosolic fraction was then removed and discarded. Nucleus-containing pellets were rinsed with extract lysis buffer without NP40 and incubated 40 minutes in 25 μl high- salt buffer (20 niM Hepes pH 7.4, 1.5 niM MgCl₂, 420 niM NaCl, 0.2 niM EDTA, 5% glycerol, 1 niM DTT, 0.5 rnM PMSF, and Ix Complete protease inhibitor [Roche]). The nuclear extract was removed and combined with 38 μl low-salt buffer (20 mM Hepes pH 7.4, 50 mM KCl, 0.2 mM EDTA, 20% glycerol, 1 mM DTT, 0.5 mM PMSF, and Ix Complete protease inhibitor [Roche]). Protein concentrations were determined by Bio-Rad protein assay (Bio-Rad, Hercules, CA). The DNA binding activity of NF-kB in nuclear extracts was assessed using either electrophoretic mobility shift assay (EMSA) or ELISA.

Western Blot Analysis

[0117] Twenty micrograms of protein per lane were resolved on 12.5% SDS-PAGE and transferred in IX Towbin buffer (composition 25 mM Tris, 192 mM glycine, pH 8.8, 15% vol/vol methanol) onto PVDF membranes (Polyscreen, Perkin-Elmer NEN, Boston, MA) as previously described (Kojima, 2003), incorporated herein by reference. Alternatively, Westerns were initiated by fractionating 20 μg protein on 11% SDS-PAGE and using a semi- dry transfer system (Bio-Rad) in transfer buffer (200 ml methanol, 3.03 g Tris and 14.4 g glycine/1), per manufacturer's instructions. Membranes were blocked in 5% (wt/vol) non-fat milk in TBS-Tween (Tris-buffered saline (150 mM NaCl, 5 mM KCl, 10 mM Tris, pH 7.4) with 0.05% (vol/vol) Tween 20) for one hour at room temperature. For anti-ubiquitin blots, membranes were blocked in 3% bovine serum albumin (Fisher, Pittsburgh, PA). Primary antibody was added to TBS-Tween and incubated overnight at 4⁰C with a specific anti- Hsp25/27 antibody (SPA 801, Stressgen, Victoria, BC, Canada), anti-Hsp70 antibody (SPA 810, Stressgen), anti-Hsc 73 antibody (SPA 815, Stressgen), anti-IκB-α antibody (sc-1643, Santa Cruz Biotechnology, Santa Cruz, CA), anti-phospho IκB-α antibody (sc-8404, Santa Cruz), or anti-ubiquitin antibody (PW 8810, Affiniti Research Products Ltd, Exeter, U.K.). Blots were then washed in TBS-Tween five times for 10 minutes each at room temperature before incubation with peroxidase-conjugated secondary antibodies (Jackson Immunoresearch Labs, Inc., Fort Washington, PA) for 1 hour at room temperature. Membranes were then washed (five times, 10 minutes each) in TBS-Tween followed by a final wash in TBS (no Tween). Blots were visualized with an enhanced chemiluminescence system ECL reagent (Supersignal, Pierce, Rockford, IL) and developed as per the manufacturer's instructions. Cell Death Assay

[0118] Sample preparation and Cell Death ELISA assay was performed according to the manufacturer's instructions (Roche Applied Science). Briefly, cells were washed twice with phosphate buffered saline (PBS) and harvested in 1 ml of PBS. The concentration of the cells was determined using a Hemacytometer and IxIO⁵ cells were spun down and resuspended in Incubation buffer supplied by the manufacturer. After incubation at room temperature for 30 minutes, cytoplasmic fractions were diluted with Incubation buffer at a ratio of 1:10 and stored at -2O⁰C overnight until use. Positive controls were prepared according to the manufacturer's instructions by incubating cells for 2 hours in hypertonic buffer (10 mM Tris, 400 mM NaCl, 5 mM CaCl₂ and 10 mM MgCl₂), followed by diluting the supernatant 1:5 with Incubation buffer. The ELISA procedure was performed at room temperature and all samples analyzed in duplicate. The wells of the MP-module were precoated with Coating solution for one hour followed by washing and incubation with Incubation buffer for 30 min. Wells were washed again and incubated with samples for 90 minutes. Samples were removed by washing and the Conjugate solution was added to all wells and incubated for 90 min. After the final washing the Substrate solution was added to every well, incubated for 10 minutes and read on a Versamax tunable microplate reader (Molecular Devices).

Statistical Analysis

[0119] The luciferase assays were performed in triplicate and the proteasome assays were performed in duplicate for each experiment. All experiments were repeated a minimum of three to six times each. All numerical values are expressed as mean +/- standard error of the mean unless otherwise indicated. Where multiple comparisons were made, ANOVA analysis using a Bonferroni's correction was used to assess significance of differences between groups. P<0.05 was considered statistically significant.

Example 2

Characteristics of isolated L. plantarum factor! s) A. Heat stability

[0120] Conditioned medium from L. plantarum was boiled at 95°C in sand blocks for 10 minutes. The results showed that the anti- inflammatory factor(s) in L. plantarum- conditioned medium are heat-stable. Similar results were obtained when conditioned medium was exposed to pepsin in that the anti-inflammatory factors were resistant to cleavage by the protease.

B. Acid stability and pH optima

[0121] L. plantarum-conditioned medium was treated with pepsin (from porcine gastric mucosa Sigma P7012) 50 μg/ml (high end of working concentration range) by digesting for 1-2 hours 37 degrees in a water- filled heat block (bring samples to incubation temperature and then initiate incubation by placing microfuge tubes in water- filled heat block well). Pepsin cleaves bands involving aromatic amino acids including phenylalanine, tryptophan, and tyrosine, with a preference for cleaving C-terminal to F, L, and E. Pepsin does not cleave V, A, or G. No loss of inhibitory activity indicates either the factor is not a protein or is a protein not cleaved by pepsin. Pepsin was chosen because of its stability in acidic environments relative to other available proteases. Contacting L. plantarum-conditioned medium with pepsin did not result in significant loss of the anti-inflammatory activity. Thus, the isolated anti-inflammatory factor(s) of L. plantarum-conditioned medium is/are resistant to pepsin digestion.

C. DNase stability

[0122] L. plantarum-condiύoned medium was treated with 5 μg/ml DNAse I plus 1 mM MgCl₂ (DNAse I: stock =4 μg/μl) and incubated at room temperature for 2 hours (untreated conditioned medium was also stored at room temperature for 2 hours). YAMC cells were then treated with untreated L. plantarum-conditioned medium, DNAse-treated conditioned medium (containing MgCl₂), or MgCl₂-treated conditioned medium for 30 minutes with or without TNF. Cells were then harvested to obtain nuclear extracts and NF-κB ELISAs were performed as described herein. The results show partial inhibition of NF-kB after DNase treatment, which may suggest that bacterial DNA plays a role in the effect of L. plantarum- conditioned medium on NF-κB inhibition. Notably, however, the same inhibition was also seen in the samples containing only magnesium chloride, making meaningful results difficult to discern. (MgCl₂ is required for DNase I enzymatic activity.)

D. Partitioning behavior

[0123] L. Plantarum-condiύonεd medium was subjected to ether extraction to determine the partitioning behavior of the bioactive factor(s). Conditioned medium was extracted with ether using standard procedures and the phases were assayed to determine whether the bioactive factors would partition into the ether or the aqueous phase. Each of the phases was tested and NF-κB ELISAs were performed as previously described. The ether phase lost its bioactivity, indicating that the bioactive factor(s) are found only in the aqueous phase. MRS broth alone (i.e., unconditioned MRS broth) was subjected to the same extraction procedure and no inhibition was seen, demonstrating that the inhibition seen in the aqueous phase is not a non-specific effect due to the extraction process itself.

[0124] The experiment demonstrated that the bioactive factor(s) partitioned into the aqueous phase, indicating that the factor(s) are unlikely to be non-polar organic compounds, such as small molecule effectors that are non-polar.

E. Bacterial life cycle and production

[0125] Lactobacillus plantarum bacteria were incubated at 37^QC in MRS broth for varying times and then assayed for bioactivity. The batches incubated for longer periods of time generally possessed more bioactivity than those incubated for shorter periods of time, indicating that the bioactive factor(s) either were synthesized late in the course of the bacterial growth phase or accumulated to effective levels slowly, such that it took time to accumulate bioactive factor(s) in sufficient quantity to observe a physiologic effect. Cells were treated and harvested, and NF-κB ELISAs were performed.

3. NF-KB Inhibition

[0126] YAMC cells were treated with L. plantarum conditioned medium for various times and then treated with TNF-alpha at 30 ng/ml for 30 minutes, unless otherwise indicated. Cells were then harvested for EMSA analyses. Samples were timed to be harvested together (e.g., if treated for 6 hours with L. plantarum, TNF would be added for the last 30 minutes of the L. plantarum 6-hour incubation). NF-κB electrophoretic mobility shift assay (EMSA) was performed.

[0127] Using supershift analysis with antibodies specific to different NF- KB subunits, the identities of the various NF-κB isoforms affected by L. plantarum treatment were determined. Major bands 1-4 were identified, including the classic (p50/p65) NF-κB isoform.

[0128] Treatment with L. plantarum-condiύoned medium (CM) blocked binding of NF-κB normally induced by stimulation with TNF-α. Binding inhibition of this classic NF-κB isoform by L. plantarum CM is as strong as MGl 32, a potent NF-κB inhibitor which acts by blocking degradation of IKB through inhibition of proteasome function. In all cases except one, L. plantarum CM was given prior to or at approximately the same time as, the TNF-α, i.e., samples were timed to be harvested together. If L. plantarum CM were given after TNF- α, no inhibition was observed, indicating that L. plantarum CM was unable to inhibit NF-κB binding once the inflammatory cascade was initiated. If L. plantarum CM were given at approximately the same time, some inhibition was observed, but maximal inhibition was seen when L. plantarum CM was provided prior to TNF-α exposure, indicating that optimal inhibition resulted from pre-treatment (i.e., CM given before TNF stimulation).

[0129] In addition, based on supershift analyses, L. plantarum CM treatment was shown to inhibit the binding of two additional isoforms of NF-κB. These isoforms are present at baseline levels in YAMC cells unstimulated by TNF-α and their binding does not change with TNF-α stimulation.

[0130] NF-κB luciferase assays were also performed on YAMC extracts. For the luciferase assays, the Promega Dual Luciferase Reporter 1000 Assay System (Promega, Madison, WI) and plasmids were transfected using TransIT LT-I transfection reagent (Mirus, Madison WI) according to the manufacturer's instructions. YAMC cells were pretreated with L. plantarum-CM at a dilution of 1:10 for 30 or 60 minutes, then murine TNF-α was added at 50 ng/ml and cells were harvested 6 hours later. Luminescence was measured in a Berthold Lumat 9047 Luminometer (Oakridge, TN). YAMC cells transiently transfected with an NF- KB luciferase reporter gene expressed a low level of baseline NF-κB activity which increased upon stimulation with TNF-α, as reflected by an increase in luciferase activity. Pretreatment with L. plantarum-CM for as little as 30 minutes resulted in a marked attenuation of TNF-α- induced NF-kB activity in epithelial cells compared to TNF-α treatment alone. Interestingly, L. plantarum-CM treatment alone also decreased even the basal level of NF-κB activation normally seen in YAMC cells.

A. Isoforms in YAMC

[0131] Supershift EMSA analyses were performed to identify the particular NF-κB isoforms present in intestinal epithelial cells. The supershift assays were conducted using antibodies specific to the different subunits which comprise the different isoforms of NF-κB to discriminate among the various isoforms. Antibodies and supershift assays are described herein. Binding of a specific antibody to a subunit increases the effective size of the "subunit," which retards its migration through the gel, resulting in a shift to a higher apparent molecular weight. In addition to the classic p50/p56 isoform of NF-κB, other isoforms containing ReIB and p52 were identified. These isoforms appear to be present even without NF-κB induction (e.g., by TNF-α. Cells were treated for 30 minutes with murine TNF-α at 30 ng/ml.

B. Binding Sites

[0132] In order to determine which bands on EMSA were due to non-specific binding, YAMC cells were stimulated with TNF-α and then subjected to EMSA analysis as previously described. Competition experiments with increasing concentrations of non-specific poly dl- dC DNA were performed. Competition experiments using cold (non-radioactive) NF-κB oligonucleotide completely obliterated the p50/p65 band and were unable to obliterate a lower molecular weight band even at very high concentrations, indicating that the lower molecular weight band results from non-specific binding.

C. Inhibition

1. ELISA

[0133] At room temperature, nuclear extracts (5-10 μg) were incubated for 15 minutes with 5 mM Tris pH 7.5, 0.5 mM EDTA, 2% ficoll, 0.5 mM DTT, 37.5 mM KCl, 1 μg poly (dl-dC) (Roche), and 50,000 cpm of a γ-³²P-labeled probe encoding the NF-KB consensus sequence (5'— AGTTGAGGGGACTTTCCCAGG C— 3') (Promega, Madison, WI). To determine oligonucleotide specificity, a 100-fold excess cold oligonucleotide was added to the reaction mixture prior to the 15 minute incubation. In supershift reactions, either rabbit preimmune serum or antibodies to NF-κB p50, NF-κB p65, NF-κB p52, NF-κB cRel, or NF-κB ReIB (Santa Cruz) were pre-incubated with the nuclear extract and reaction buffer in the absence of probe for 30 minutes. The probe was then added and samples were incubated for an additional 15 minutes prior to loading onto the gel. Samples were electrophoresed on a native 5% polyacrylamide gel. The gel was then dried and exposed to film.

[0134] For IL-6 ELISA assays, mouse dendritic cells were pre-treated with Lp-CM for 30 minutes and then exposed to LPS for 30 minutes to stimulate IL-6 release. After 6 hours, supernatants were collected and tested for the presence of IL-6 using a commercial mouse ELISA kit according to manufacturer's instructions.

2. EMSA

[0135] For EMSA assays, 2.5 μg aliquots of nuclear extracts were assessed using the Trans-AM NF-κB p65 transcription factor assay kit according to the supplier's instructions (Active Motif, Carlsbad, CA). All buffers, solutions, antibodies, and 96-well plates were supplied by the supplier, and all incubations were performed at room temperature. Briefly, nuclear extracts (2.5 μg) were mixed with complete lysis buffer to a final volume of 20 μl. The sample was then added to 30 μl of complete binding buffer in the wells of a 96-well plate on which the NF-κB consensus oligonucleotide was immobilized. After a one-hour binding incubation, the samples were washed and incubated with NF-κB p65 antibody for one hour. The samples were then washed and incubated with anti-rabbit Horseradish Peroxidase- conjugated IgG for one hour. After washing, developing solution was added to each well, and the plate was protected from light for approximately 5 minutes (the time varied according to the lot of antibody). Stop solution was then added and the plate was read immediately on a Versamax tunable microplate reader (Molecular Devices).

4. Additional functional characterization A. MCP-I

[0136] Monocyte chemoattractant protein- 1 (MCP-I) is an endogenous immune response gene and, like IL-8, MCP-I is highly expressed in states of inflammation and its expression depends on NF-kB activation. To determine the effect of L. plantarum-CM on MCP-I expression, YAMC cells were grown and pretreated with L. plantarum-CM for one hour and subsequently treated with TNF-α as described above, to induce NF-kB. Supernatants were harvested and assayed for the production of MCP-I using a mouse MCP-I ELISA kit (Pierce Endogen, Rockford, IL) according to the manufacturer's instructions. Treatment of intestinal epithelial cells with L. plantarum-CM was able to attenuate the release of MCP-I in response to NF-kB stimulation by TNF-α (Figure 3 A, compare columns 2 and 4). Interestingly, L. plantarum-CM treatment alone also decreased even the basal level of NF-kB activation normally seen in YAMC cells (compare columns 1 and 3 of Figure 3B).

B. CTL-like activity

[0137] The proteasome activity of cell lysates was determined using a 2OS Proteasome assay kit (Calbiochem, San Diego, CA). Lysate containing 20 μg of protein was added to proteasome assay reaction buffer (25 mM HEPES, 0.5 mM EDTA, pH 7.6) activated with 0.03% (wt/vol) SDS, then 10 μM of the substrate suc-leu-leu-val-tyr-AMC (SLLVY-AMC) was added. Proteasome chymotrypsin-like activity was determined by measuring the fluorogenic signal generated by cleavage of AMC (7-amino-4-methylcoumarin) from the peptide moiety of the SLLVY-AMC proteasome substrate. Fluorescence (excitation 380 nm, emission 460 nm) was measured for the first 5 minutes, then every 15 minutes thereafter in a Hitachi F- 2000 fluorometer (Hitachi, Japan). Proteasome activity was determined by calculating the rate (slope) of AMC production over time. Cells were treated with MG132 as a positive inhibitor control at a concentration of 25μM and untreated cells were exposed to DMSO as a vehicle control for MG132. Experiments were performed in triplicate, a minimum of three separate experiments.

[0138] For proteasome assay from purified liver preparations, assays were performed as described above except that a 96-well plate reader was used to screen fractions and fluorescence measurements were taken every 3 minutes. Using KC4 software, the slope (proteasome activity) was then calculated. Epoxomicin, a highly specific proteasome inhibitor, was used as a positive inhibitor control to ensure that preparations contained pure proteasome activity.

[0139] Extracts from YAMC cells, treated with L. plantarum-CM for varying times as indicated (10 minutes, 30 minutes, or overnight (16 hours)), were compared with untreated cells for proteasome activity. Epithelial cells treated with L. plantarum-CM displayed markedly lower levels of proteasome activity as compared to untreated controls, and the majority of this effect was seen within the first 30 minutes, indicating that the effect of L. plantarum-CM on proteasome inhibition was very rapid.

Isolation and purification of proteasome (20S)

[0140] Purified proteasomes were prepared based on the method described by Hirano, et al., Methods Enzymol., 399:233 (2005), with several modifications as follows: each excised mouse liver was immersed in 2 ml ice-cold homogenizing buffer (25 mM Tris-HCl, pH 7.5, 0.25 M sucrose, 1 mM DTT) and homogenized using a Pyrex-Tenbroeck tissue grinder on ice. The homogenate was centrifuged at 70,000 x g for one hour at 4°C (Sorvall Ultra Pro 80 centrifuge with T-865). The supernatant was made 10% glycerol, and mixed with approximately 20 ml of Q-Sepharose which was equilibrated with Buffer A (25 mM Tris- HCl, pH 7.5, containing 10% glycerol and 1 mM DTT) for 30 minutes, then gently centrifuged at 3,000 rpm for 10 minutes (Sorvall RC 5C centrifuge with SS-34 rotor). The supernatant was discarded, Q-Sepharose (Amersham Bioscience) was suspended in Buffer A, and packed into a glass chromatography column (2 x 15 cm, Pharmacia). Proteins were eluted by a linear gradient of NaCl from 0 M to 0.8 M using 100 ml each of Buffers A and B (buffer A plus 0.8 M NaCl); fraction of 1.5 ml each were collected in a test tube using a fraction collector (Gilson). The protein was monitored at 280 nm (Beckman -Coulter DU 530) and salt concentration was checked by a conductivity meter (Radiometer CDM 210). Eluted peaks were tested for proteasomal activity using the substrate, suc-LLVY-AMC as described above. Active fractions were combined and polyethylene glycol was added to a final concentration of 15% while stirring gently. After 15 minutes, the mixture was centrifuged at 10,000 x g for 20 minutes, the supernatant was discarded, and the precipitate was dissolved in Buffer A. The solution was centrifuged again and the supernatant was applied to a column (1 x 50 cm) of Bio-Gel A (Bio-Rad), and proteasomes eluted using Buffer A. The proteasomal activity of separated fractions was checked using the substrate SLLVY-AMC and by its ability to be inhibited by epoxomicin, a highly specific proteasome inhibitor. The active fractions were combined and further purified by ammonium sulfate fractionation between about 20-60% saturation. This fraction was collected by centrifugation (10,000 x g for 20 minutes) and the pellet was dissolved in 500 μl of Buffer A, then dialyzed against one L of Buffer A overnight at 4°C. The final protein concentration was determined by a micro-bicinchoninic acid (Smith, et al., Anal. Biochem. 150:76 (1985). BSA was used as a calibration standard.

Example 3

Conditioned media from L. plantarum inhibits binding of NF-kB

[0141] NF-κB is inactive when located in the cytosol and complexed to its inhibitor, IκBα. Under a stimulus such as TNFα, IκBα is degraded, NF- KB is released and then translocates to the nucleus where it binds to and initiates transcription of pro-inflammatory genes. YAMC cells were treated with conditioned media from the commensal bacteria Lactobacillus plantarum (Lp-CM) for the times indicated, then treated with TNFα to stimulate NF- KB. Cell nuclear extracts were harvested for analysis by electrophoretic mobility shift assay (EMSA), which examines binding of NF- KB to its target DNA consensus sequence. DNA- protein complexes migrate slower than unbound DNA and appear as a distinct pattern, permitting identification of NF- κB-to-DNA binding. Treatment with Lp-CM blocked binding of NF- KB normally induced by stimulation with TNFα (Figure IA). The p50/p65 isoform of NF- KB was identified, but because many bands were visualized on EMSA and several isoforms of NF- KB have been described, antibodies to NF- KB p50 and NF- KB p65 subunits were preincubated with the nuclear extract and used to confirm identification of the p50/p65 isoform of NF- KB. Results for Lp-CM were compared to the inhibitor MG132, which inhibits proteasome function and NF- KB activity. Maximal inhibition is seen when Lp-CM is given prior to TNFα, indicating that optimal inhibition results from pre-treatment (i.e., given before TNF stimulation). This suggests that probiotic-CM is most effective when given as prophylactic treatment and is unable to block NF- KB once its activation has already been initiated. This observation was confirmed by NF- KB ELISA (Figure IB).

Example 4

Inhibition of NF-kB binding is specific to Lp-CM

[0142] Using the NF-κB ELISA as a rapid throughput screen, conditioned media from several other known commensal bacteria was screened for the presence NF-κB-inhibiting activity. Lactobacillus plantarum is a lactic acid-producing gram positive bacillus, and in addition to conditioned media from commensal organisms such as E. coli strain Fl 8 (a Gram- negative bacillus, originally isolated from human, conditioned media from other Lactobacilli were examined as well (Figure 2). YAMC cells were pretreated with conditioned media from different intestinal bacteria, stimulated with TNF, and then nuclear extracts were harvested and tested for NF- KB binding activity. Of those screened, only Lp-CM displayed NF- KB inhibitory capabilities. Conditioned media from several other gut-derived strains of bacteria (e.g., Bacteroides fragilis, Bifidobacterium brevis, Lactobacillus rhamnosus GG, other strains of E. coli) similarly showed no signs of NF-κB-inhibiting ability, indicating that this NF-κB inhibitory property is relatively specific to conditioned media derived from Lactobacillus plantarum.

Example 5

Lp-CM inhibits MCP-I release from different cell types

[0143] In order to confirm that Lp-CM inhibits inflammation, the release of MCP-I (monocyte chemotactic protein- 1), an inflammatory cytokine and well-described downstream gene target of NF-κB, was measured. MCP-I is a strong chemoattractant of white blood cells and is expressed in many cell types such as macrophages and epithelial cells of human colonic mucosa. It is found in high levels in areas of active inflammation such as in enterocolitis, active Crohn's disease and ulcerative colitis. YAMC cells were pretreated with Lp-CM for one hour and subsequently treated with TNF-α to activate NF-κB. Supernatants were harvested and tested for the production of MCP-I using a mouse MCP-I ELISA kit (Pierce Endogen) according to manufacturer's instructions. Treatment of intestinal epithelial cells with Lp-CM attenuated the release of MCP-I in response to TNFα compared to both untreated control and L. paracasei and E. coli-CM treated controls (Figure 3A, compare Lp- CM column 4 with columns 2, 6 and 8). A similar blockade of MCP-I release was seen in a murine macrophage cell line treated with Lp-CM and then stimulated with TNF (Figure 3B).

Example 6

Lp-CM inhibits IL-6 release and MCP-I release from murine dendritic cells in primary culture

[0144] Dendritic cells are antigen-presenting cells which form an important component of the mammalian immune system and play a critical role in host defense. Given the inhibitory effects of Lp-CM on activation of macrophages and the NF-κB-inhibiting effects observed in intestinal epithelial cells treated with Lp-CM, the effect of Lp-CM on dendritic cell activation was investigated. Dendritic cells were isolated from murine bone marrow using conventional techniques. After 7 days, dendritic cells were collected, pretreated with either Lp-CM, E. coli-CM, L. paracasei-CM or HBS control for 30 minutes and then exposed to LPS for 30 minutes. Supernatants were collected and samples were tested by ELISA for the presence of IL-6, a marker of dendritic cell activation (Figure 4A). Although the effects of Lp-CM were not as pronounced in these mouse primary cultures, pretreatment of dendritic cells with Lp- CM still resulted in a 50% decrease in IL-6 release compared to those treated with LPS. The other bacteria conditioned media showed no such anti-inflammatory ability, displaying an increase in IL-6 release in response to LPS that was statistically no different from LPS treatment alone. Interestingly, Lp-Cm treatment alone resulted in a mild stimulation of dendritic cell function, as evidenced by a mild elevation of IL-6 release after exposure to Lp- CM. This mild stimulation was observed to a lesser extent by L. paracasei-CM and to a larger degree by exposure to E. coli-CM alone. The data are consistent with the data showing MCP-I release (see Figure 4B).

[0145] The experiments reported herein also establish that Lp-CM inhibits TLR signaling pathways. Thus far, only NF- KB activation through the TNF pathway had been investigated. Like TNF, the activation of Toll-Like Receptor (TLR) pathways resulted in activation of NF- KB, notwithstanding the slight differences between the pathways. TLRs play a key role in innate immunity, forming the first line of defense in protecting the host against pathogens. These receptors recognize various bacterial and viral components, or PAMPs (pattern recognition motifs), but do not discriminate between normal enteric flora or pathogens. Because L. plantarum is a commensal bacterium and the conditioned media must therefore contain a myriad of bacterial products, the effect of Lp-CM on TLR pathways was investigated. Three different types of ligands, all known to activate MyD88-dependent TLRs, were chosen in an attempt to capture a broad scope of effects. The first ligand was the protein flagellin (ligand for TLR5), the second was the cell wall component LPS (lipopolysaccharide, ligand for TLR4), and the third ligand was oligonucleic acid CpG DNA (DNA, activates TLR9). Two different intestinal epithelial cell lines and a macrophage cell line were tested with these bacterial ligands, in order to determine whether the effects of Lp- CM were cell type- specific.

Example 7

Lp-CM inhibits NF-kB activation by LPS and CpG DNA stimuli

[0146] Lipopolysaccharide (LPS) is a component of Gram-negative bacterial cell walls and plays an important role in the development of Gram-negative sepsis. LPS is the ligand for TLR4 and, like TLR5, activates NF-κB via a MyD88-dependent pathway. Attempts to activate NF-κB using LPS treatment were unsuccessful in each of the intestinal epithelial cell lines (IEC- 18 or YAMC) and, therefore, inhibition of NF- KB activation by Lp-CM could not be assessed. Intestinal epithelial cells can be somewhat refractory to stimulation by LPS, as known in the art.

[0147] In contrast, RAW cells exhibited a robust NF-κB response to LPS exposure. Pretreatment of RAW cells with Lp-CM inhibited LPS-mediated NF-κB binding activity (Figure 5). The same phenomenon was observed for CpG DNA, a bacterial DNA that acts through TLR9 to activate a MyD88-dependent NF-κB response. These effects were seen only with Lp-CM; other bacteria conditioned media were unable to block NF- KB binding stimulated by these TLR ligands.

Example 8

Lp-CM inhibits TLR3-mediated NF-kB activation in a macrophage cell line

[0148] The majority of TLR pathways are mediated through the adaptor molecule MyD88 and are, thus, MyD88-dependent pathways. However, one TLR has been described that recognizes RNA as its ligand and is thought to play an important role in innate immunity of viral infections. This receptor, TLR3, can by activated by treating cells with the oligonucleotide poly dI:dC. RAW cells were pretreated with Lp-CM, exposed to poly dLdC and then tested for NF-κB activation using by NF-κB ELISA. Although the level of activation achievable with poly dLdC was less than that obtained with the other TLR ligands, it can be seen that Lp-CM inhibited TLR3-mediated NF-κB binding activity (Figure 6). Conditioned media from L. paracasei failed to inhibit NF-κB, again indicating that the effect is specific to L. plantarum conditioned media.

Example 9

Lp-CM inhibits NF-κB activation by flagellin in both intestinal epithelial cell and macrophage cell line

[0149] Flagellin is a bacterial protein found in all motile bacteria and is the ligand for TLR5. Binding of flagellin to TLR5 activates NF-κB through a MyD88-dependent pathway. IEC- 18 cells were treated with Lp-CM and then stimulated with flagellin to activate TLR5. Once again, NF-κB binding activity was inhibited in those cells pretreated with Lp-CM only. Cells pretreated with control-conditioned media from other commensal bacteria, such as L. paracasei, displayed no attenuation of the NF-κB response (Figure 7B). This same effect was observed in a murine macrophage (RAW) cell line (Figure 7C) and in YAMC cells (Figure 7A).

Example 10

Lp-CM does not induce increased cell death (necrosis or apoptosis) at the concentrations used in either intestinal epithelial cell lines or macrophage cell line

[0150] It is known that NF-κB, while an important mediator of inflammation, also serves an important anti-apoptotic role in the gut. Knockout mice lacking ReIA, IKKgamma or IKKbeta undergo death secondary to massive apoptosis. Therefore, a blockade of NF-κB by Lp-CM was expected to affect cell viability and apoptosis. Effects of Lp-CM on cell death were determined using a cell death assay which measures apoptosis (Figure 8). Increasing concentrations of Lp-CM were administered to RAW 264.7 macrophage cells (Figure 8B), IEC- 18 intestinal epithelial cells (Figure 8A) and YAMC cells (Figure 8C). In the case of the macrophage cell line, there was some toxicity observed at higher concentrations, but not at physiologically relevant concentrations. There was very little toxicity observed in IEC- 18 cells, even at the higher concentrations used. YAMC cells were also tested and no toxicity was observed in that intestinal epithelial cell line, indicating that despite widespread inhibition of NF-κB through multiple pathways (TNF, Myd88-dependent, MyD88- independent), Lp-CM does not lead to increased apoptosis in macrophage or intestinal epithelial cells (Figure 8 A and B). Example 11

Lp-CM inhibits degradation of IKB

[0151] IKK (I Kappa Kinase) is responsible for phosphorylating IKB, which acts as a signal for IKB to be targeted for ubiquitination and subsequent degradation by the proteasome. This loss of IKB, in turn, allows the release and activation of NF-κB. All of the pathways of NF-κB activation examined thus far (TNF, MyD88-dependent, MyD88- independent) converge on IKK, and the subsequent steps in the NF-κB activation pathway are common to all. Therefore, the effect of Lp-CM on IKB was investigated. Cells were either pre-treated with Lp-CM or HBSS, then stimulated with TNF and harvested over a 90-minute time course for Western blot analysis of IKB (Figure 9A). Lp-CM pretreatment inhibited degradation of IKB (Figure 9B), providing an explanation for the widespread phenomenon of NF-κB inhibition observed in Lp-CM-treated cells.

Example 12

Lp-CM inhibits proteasome activity both in intestinal cell lysates and in proteasome preparations from mouse liver

[0152] Lp-CM treatment appeared to be causing a blockade of IKB degradation, and IKB α is normally degraded by the chymotrypsin-like (CTL-like) activity of the proteasome. Therefore, to determine whether Lp-CM may affect proteasome function, intestinal epithelial cells were treated with Lp-CM and then the CTL-like activity of the proteasome was measured using the proteasome substrate suc-leu-leu-val-tyr-AMC (SLLVY-AMC), as previously described (Petrof, et al., Gastroenterology 127:1474-1487 (2004)). Cell lysates were treated with protease inhibitors to prevent non-specific protease cleavage of the SLLVY-AMC substrate. The proteasome substrate SLLVY-AMC, which is cleaved by the same CTL-like enzymatic activity responsible for IKB degradation, was added to cell lysates and the fluorogenic signal generated by cleavage of AMC (7-amino-4-methylcoumarin) from the SLLVY-AMC proteasome substrate was measured. YAMC cells were treated with Lp- CM, E. coli-CM, L. paracasei-CM or the synthetic proteasome inhibitor MG132 for one hour, then cells were harvested for proteasome assay and the results were compared to untreated cells (Figure 1OA, column 1) for proteasome activity. Lp-CM inhibited the CTL- like activity of the proteasome (Figure 1OA, column 2) and no inhibitory effect was seen with either E. coli-CM (Figure 1OA, column 3)or L. paracasei-CM (Figure 1OA, column 4), indicating the effect is specific to Lp-CM. The known proteasome inhibitor MG 132 showed inhibition (Figure 1OA, column 5), demonstrating that the assay was functional. Consistent with the preceding study, conditioned media from Lactobacillus GG, Lactobacillus acidophilus, Lactobacillus paracasei_n E. coli Nissle, Bifidobacterium brevis, Bacteroides fragilis, Pediococcus, E. coli strain DH5α, and E. coli strain Fl 8 have been tested without proteasomal effect.

[0153] An additional investigation revealed a direct effect of Lp-CM on the proteasomes of liver cells. Initially, proteasomes were purified from mouse liver cells. Subsequently, conditioned media was added directly to purified proteasome samples and the proteasome assay substrate, SLLVY-AMC, was added to initiate the proteasome assay. Results are shown in Figure 1OB and reveal that the inhibitory effect of Lp-CM (1:20 dilution) (Figure 1OB, column 1) is direct and specific in that a 1:20 dilution of lactic acid (Figure 1OB, column 3) did not inhibit proteasome function. Controls were included to demonstrate that the results were not artifactual, with a failure to inhibit proteasome activity seen when no treatment was applied (Figure 1OB, column 2) and strong inhibition of proteasome activity seen with MG 132, a known proteasome inhibitor (Figure 1OB, column 4).

Example 13

In vivo animal model

[0154] To determine whether probiotic CM could induce heat shock proteins in an animal model, C57/BL6 mice were gavaged daily with L. plantarum conditioned media (Lp-CM) for 5 days and then sacrificed. Small intestines were harvested and tested for Hsp70 induction by Western blot analysis (Hsc73 was used as a loading control). The results showed that Lp-CM strongly induced Hsp70 expression, in contrast to vehicle-gavaged control. In addition, the data established that conditioned media from L. paracasei and E. coli do not induce HSP expression in intestinal epithelial cells, demonstrating the specificity of heat shock induction by Lp-CM. These data indicate that soluble factors produced by L. plantarum can induce cytoprotective heat shock proteins in vivo. This demonstrates the feasibility of using a NEC animal model, as described below.

[0155] In order to establish that probiotic conditioned media, as opposed to live probiotic bacteria, are required to decrease the incidence and severity of intestinal disorders such as necrotizing enterocolitis (NEC), experiments are performed using animal models. In the NEC animal model experiments conditioned media from L. paracasei and E. coli are used as control groups.

[0156] A neonatal NEC animal model is used to determine the protective effect of orally administered conditioned media. Due to the fact that the etiology of NEC is unknown, there are currently no diagnostic markers for NEC. Therefore, in order to diagnose NEC, clinical observations and radiography findings may be used, or alternatively, histopathology may be used. Protection against NEC pathology will therefore be evaluated in Lp-CM-treated and in untreated animals by histologic grading of intestinal tissue damage.

REFERENCES

1. Hooper, L.V., M.H. Wong, A. Thelin, L. Hansson, P.G. FaIk, and J.I. Gordon. 2001. Molecular analysis of commensal host-microbial relationships in the intestine. Science 291:881-884.

2. Rakoff-Nahoum, S., J. Paglino, F. Eslami-Varzaneh, S. Edberg, and R. Medzhitov. 2004. Recognition of commensal microflora by toll-like receptors is required for intestinal homeostasis. Cell 118:229-241.

3. Backhed, F., H. Ding, T. Wang, L.V. Hooper, G.Y. Koh, A. Nagy, CF. Semenkovich, and J.I. Gordon. 2004. The gut microbiota as an environmental factor that regulates fat storage. Proc Natl Acad Sci U S A 101:15718-15723.

4. Backhed, F., R.E. Ley, J.L. Sonnenburg, D.A. Peterson, and J.I. Gordon. 2005. Host- bacterial mutualism in the human intestine. Science 307:1915-1920.

5. Petrof, E.O., K. Kojima, MJ. Ropeleski, M.W. Musch, Y. Tao, C. De Simone, and E.B. Chang. 2004. Probiotics inhibit nuclear factor-kappaB and induce heat shock proteins in colonic epithelial cells through proteasome inhibition. Gastroenterology

127:1474-1487.

6. Tao, Y., K.A. Drabik, T.S. Waypa, M.W. Musch, J.C. Alverdy, O. Schneewind, E.B. Chang, and E.O. Petrof. 2006. Soluble factors from Lactobacillus GG activate MAPKs and induce cytoprotective heat shock proteins in intestinal epithelial cells. Am J Physiol Cell Physiol 290:C1018-1030.

7. Ahrne, S., S. Nobaek, B. Jeppsson, I. Adlerberth, A.E. Wold, and G. Molin. 1998. The normal Lactobacillus flora of healthy human rectal and oral mucosa. J Appl Microbiol 85:88-94.

8. Schultz, M., C. Veltkamp, L.A. Dieleman, W.B. Grenther, P.B. Wyrick, S.L. Tonkonogy, and R.B. Sartor. 2002. Lactobacillus plantarum 299V in the treatment and prevention of spontaneous colitis in interleukin-10-deficient mice. Inflamm Bowel Dis 8:71-80.

9. Osman, N., D. Adawi, S. Ahrne, B. Jeppsson, and G. Molin. 2004. Modulation of the effect of dextran sulfate sodium-induced acute colitis by the administration of different probiotic strains of Lactobacillus and Bifidobacterium. Dig Dis Sci 49:320-

327.

10. Whitehead, R.H., P.E. VanEeden, M.D. Noble, P. Ataliotis, and P.S. Jat. 1993. Establishment of conditionally immortalized epithelial cell lines from both colon and small intestine of adult H-2Kb-tsA58 transgenic mice. Proc Natl Acad Sci U SA 90:587-591. 11. Inan, M.S., RJ. Rasoulpour, L. Yin, A.K. Hubbard, D.W. Rosenberg, and C. Giardina. 2000. The luminal short-chain fatty acid butyrate modulates NF-kappaB activity in a human colonic epithelial cell line. Gastroenterology 118:724-734.

12. Kojima, K., M.W. Musch, H. Ren, D.L. Boone, B.A. Hendrickson, A. Ma, and E.B. Chang. 2003. Enteric flora and lymphocyte-derived cytokines determine expression of heat shock proteins in mouse colonic epithelial cells. Gastroenterology 124:1395-

1407.

13. Smith, P.K., R.I. Krohn, G.T. Hermanson, A.K. Mallia, F.H. Gartner, M.D. Provenzano, E.K. Fujimoto, N.M. Goeke, BJ. Olson, and D.C. Klenk. 1985. Measurement of protein using bicinchoninic acid. Anal Biochem 150:76-85.

14. Meng, L., R. Mohan, B.H. Kwok, M. Elofsson, N. Sin, and CM. Crews. 1999. Epoxomicin, a potent and selective proteasome inhibitor, exhibits in vivo antiinflammatory activity. Proc Natl Acad Sci U SA 96:10403-10408.

15. Reinecker, H.C., E.Y. Loh, DJ. Ringler, A. Mehta, J.L. Rombeau, and R.P. MacDermott. 1995. Monocyte-chemoattractant protein 1 gene expression in intestinal epithelial cells and inflammatory bowel disease mucosa. Gastroenterology 108:40-50.

16. MacDermott, R.P. 1999. Chemokines in the inflammatory bowel diseases. / CHn Immunol 19:266-272.

17. Grimm, M.C., S. K. Elsbury, P. Pavli, and W.F. Doe. 1996. Enhanced expression and production of monocyte chemoattractant protein- 1 in inflammatory bowel disease mucosa. J Leukoc Biol 59:804-812.

Each of the above-cited references is incorporated herein in its entirety.

From the foregoing it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention.

Claims

WHAT IS CLAIMED IS:

1. A composition comprising an isolated, soluble, anti-inflammatory, cytoprotective compound derived from Lactobacillus plantarum.

2. The composition of claim 1, wherein the compound is present in the conditioned medium from an L. plantarum culture.

3. The composition of claim 2, wherein the compound is a nucleic acid.

4. The composition of claim 1, wherein the compound induces the expression of at least one heat shock protein.

5. The composition of claim 4, wherein the heat shock protein is selected from the group consisting of Hsp25/27 and Hsp70.

6. The composition of claim 1, wherein the compound is an inhibitor of NF-κB activation.

7. The composition of claim 6, wherein the compound inhibits NF-κB activation by stabilizing IKB.

8. The composition of claim 1, wherein the compound is a proteasome inhibitor.

9. The composition of claim 8, wherein the proteasome inhibitor selectively inhibits the chymotrypsin-like activity of the proteasome.

10. The composition of claim 8, wherein the proteasome inhibitor selectively inhibits the proteasome in an epithelial cell.

11. The composition of claim 10, wherein the epithelial cell is an intestinal epithelial cell.

12. The composition of claim 1, wherein the compound is less than 10 kilodaltons, is refractory to pepsin cleavage and is sensitive to nuclease degradation.

13. A method for treating a patient with an inflammatory disorder comprising administering to the patient an effective amount of an isolated antiinflammatory, cytoprotective compound derived from an L. plantarum-condiύoned medium.

14. The method of claim 13, wherein the inflammatory disorder is an inflammatory bowel disease.

15. The method of claim 14, wherein the inflammatory bowel disease is enterocolitis.

16. The method of claim 15, wherein the enterocolitis is necrotizing enterocolitis.

17. The method of claim 16, wherein the necrotizing enterocolitis is neonatal necrotizing enterocolitis.

18. The method of claim 13, wherein the compound is less than 10 kilodaltons.

19. The method of claim 18, wherein the compound is a nucleic acid.

20. The method of claim 13, wherein the compound induces the expression of at least one heat shock protein.

21. The method of claim 20, wherein the heat shock protein is selected from the group consisting of Hsp25/27 and Hsp70.

22. The method of claim 13, wherein the compound is an inhibitor of NF- KB activation.

23. The method of claim 22, wherein NF-κB activation is inhibited by stabilizing IKB.

24. The method of claim 13, wherein the compound is an inhibitor of a protease activity.

25. The method of claim 24, wherein the inhibitor selectively inhibits a protease activity of a proteasome in an epithelial cell.

26. The method of claim 25, wherein the inhibitor selectively inhibits the chymotrypsin-like activity of the proteasome.

27. The method of claim 26, wherein the epithelial cell is an intestinal epithelial cell.

28. A pharmaceutical composition comprising an isolated antiinflammatory, cytoprotective compound derived from an L. plantarum-condiύoned medium and at least one pharmaceutically acceptable excipient.

29. The pharmaceutical composition of claim 28, wherein the compound is less than 10 kilodaltons.

30. The pharmaceutical composition of claim 29, wherein the compound is a nucleic acid.

31. The pharmaceutical composition of claim 28, wherein the compound induces the expression of at least one heat shock protein.

32. The pharmaceutical composition of claim 31, wherein the heat shock protein is selected from the group consisting of Hsp25/27 and Hsp70.

33. The pharmaceutical composition of claim 28, wherein the compound is an inhibitor of NF-κB activation.

34. The pharmaceutical composition of claim 33, wherein the compound inhibits NF-κB activation by stabilizing IKB.

35. The pharmaceutical composition of claim 28, wherein the compound is a proteasome inhibitor.

36. The pharmaceutical composition of claim 35, wherein the proteasome inhibitor selectively inhibits a protease activity of a proteasome in an epithelial cell.

37. The pharmaceutical composition of claim 35, wherein the proteasome inhibitor selectively inhibits the chymotrypsin-like activity of the proteasome.

38. The pharmaceutical composition of claim 37, wherein the epithelial cell is an intestinal epithelial cell.

39. A method of producing an isolated, anti-inflammatory, cytoprotective compound comprising, obtaining an L. plantarum-condiύoned medium; and isolating an anti-inflammatory, cytoprotective compound from the L. plantarum-condiύoned medium, thereby producing an isolated, anti-inflammatory, cytoprotective compound.

40. A method of screening for a modulator of monocyte chemoattractant protein - 1 (MCP-I) release, comprising:

(a) combining a candidate modulator, an L. plantarum-condiύoned medium, and an epithelial cell;

(b) measuring MCP-I release by said cell; and

(c) comparing the MCP-I release in the presence, and absence, of said candidate modulator, wherein a difference in said MCP-I release identifies the candidate modulator as a modulator of MCP-I release.

41. The composition of claim 7, wherein the stabilized IKB is phosphorylated IκBα.

42. A method of preventing an inflammatory disorder comprising administering an effective amount of an isolated, anti-inflammatory, cytoprotective compound derived from an L. plantarum-condiύoned medium.

43. A method of screening for a modulator of heat shock protein expression, comprising

(a) combining a candidate modulator, an L. plantarum-conditioned medium, and an epithelial cell;

(b) measuring heat shock protein expression in said cell; and

(c) comparing the heat shock protein expression in the presence, and absence, of said candidate modulator, wherein a difference in said heat shock protein expression identifies the candidate modulator as a modulator of heat shock protein expression.

44. The method of claim 43 wherein said heat shock protein is selected from the group consisting of Hsp25/27 and Hsp70.

45. The method of claim 43 wherein said modulator alters the activity of Heat Shock Transcription Factor-1 (HSF-I).

46. A kit for treating or preventing an inflammatory disorder comprising a pharmaceutical composition according to claim 28 and instructions for administration of said composition to treat or prevent said disorder.

47. A method for treating a patient with an autoimmune disorder comprising administering to the patient an effective amount of an isolated antiinflammatory, cytoprotective compound derived from an L. plantarum-conditioned medium.

48. The method according to claim 47 wherein the autoimmune disorder is selected from the group consisting of rheumatoid arthritis, systemic lupus erythematosus, Sjogren's syndrome, multiple sclerosis, myasthenia gravis, psoriasis, Graves' disease and Hashimoto's disease.

49. A method of preventing an autoimmune disorder comprising administering an effective amount of an isolated, anti-inflammatory, cytoprotective compound derived from an L. plantarum-conditioned medium.

50. A kit for treating or preventing an autoimmune disorder comprising a pharmaceutical composition according to claim 28 and instructions for administration of said composition to treat or prevent said disorder.