WO2008156331A2 - Novel use of lignan compounds - Google Patents
Novel use of lignan compounds Download PDFInfo
- Publication number
- WO2008156331A2 WO2008156331A2 PCT/KR2008/003525 KR2008003525W WO2008156331A2 WO 2008156331 A2 WO2008156331 A2 WO 2008156331A2 KR 2008003525 W KR2008003525 W KR 2008003525W WO 2008156331 A2 WO2008156331 A2 WO 2008156331A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- formula
- compound represented
- diabetes
- preventing
- treating
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/075—Ethers or acetals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/04—Anorexiants; Antiobesity agents
Definitions
- the present invention relates to novel use of lignan compounds, and more particularly, the present invention relates to novel use of an extract of the aril of nutmeg, 2- (4-allyl-2 , 6-dimethoxyphenoxy) -1- (4-hydroxy-
- PPAR peroxisome proliferator activated receptor
- peroxisome proliferator activated receptor is nuclear receptor which bind with the compound increasing number of peroxisome, named as peroxisome proliferator as a ligand, and PPAR ⁇ , PPAR ⁇ , isoform of PPARyhas been known (J. Steroid Biochem. Molec. Biol., 51, 157, 1994; Gene Expression, 4, 281, 1995; Biochem. Biophys. Res. Commun . , 224, 431, 1996).
- PPAR mainly regulates expression of genes which are related to lipid metabolism or differentiation of adipocyte (J “ . Invest. Dermatol. Ill, 1116-1121, 1998; J “ . Med. Chem. , 43, 527-550, 2000), and PPAR ⁇ which is an isoform of PPAR mainly expressed in liver, retina, adipose tissue, and related to oxidation of fatty acid or neutralization of toxic materials, and inflammation.
- PPAR ⁇ is not expressed in the manner of tissue-specific, rather it is expressed broadly and its function is not identified. (Endocrinology., 137, 354, 1996).
- the diabetes may be classified into type 1 and type 2.
- the type 1 diabetes is autoimmune disease which pancreas induce immunological reaction by genetic susceptibility and viral infaction, and ⁇ -cells are selectively destroyed.
- the type 2 diabetes is the type which insulin resistance is priory occurred and reported that caused by complicated factors such as obesity, reduction of insulin receptor, reduction of tyrosine kinase activity, reduction of muscle/adipose tissue type transporter in muscle and fat tissues, deficiency of insulin receptor substrate-1 (IRS-I) in the cells.
- the type 2 diabetes is mainly occurred in adult and it occupies 90% of diabetes (Drugs, 65: 433-445, 2005).
- the present invention provides method comprising administering an effective amount of C1-C6 organic solvent extract of the aril of nutmeg to a subject in need thereof.
- the present invention provides a method comprising administering an effective amount of one which is selected from the group consisting of a compound represented by Formula 1, a compound represented by Formula 2, and a compound represented by Formula 3, or their pharmaceutically acceptable salts for preventing or treating diabetes.
- the present invention provides a method comprising administering an effective amount of one which is selected from the group consisting of a compound represented by Formula 1, a compound represented by Formula 2 , and a compound represented by Formula 3 , or their pharmaceutically acceptable salts for preventing or treating PPARY mediated diseases.
- various solvents including purified water, methanol, ethanol , propanol , isopropanol, butanol, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, hexane, cyclohexane, petroleum ether and the like, may be used alone or in a mixture thereof.
- the extract obtained as described above is subjected to silica gel column chromatography to obtain fractions according to polarity, and the separated specific fraction is subjected to reverse phase column chromatography and high-performance liquid chromatography (HPLC), thus separating 2- (4-allyl-2 , 6-dimethoxyphenoxy) - 1- (4-hydroxy-3-methoxyphenyl) -propane, austrobailignan-7 and licarin E from the fraction.
- HPLC high-performance liquid chromatography
- the method for extracting and separating the active ingredients is not necessarily limited to the above-described method.
- a known method for finding a ligand, which activates a gene having a PPAR response element (PPRE) , by binding to PPAR ⁇ was used to confirm that the inventive 2- (4-allyl- 2, 6-dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) - propane, austrobailignan-7 and licarin E bind to PPAR, particularly PPAR ⁇ , to activate PPAR (FIGS. 12 and 20) .
- mice continually ingest excessive food because their appetite is not regulated due to the deletion of a leptin gene. As a result, fat is excessively accumulated in the body, and at about 3 months after birth, the mice maintain a weight of about
- mice become type 2 diabetic models having a blood glucose level higher than that of wild-type mice
- this invention provides a use of C1-C6 organic solvent extracts of the aril of nutmug for preparing diabetes treating reagent.
- the method of extraction and isolation for preparing extracts of the aril of nut is well described above, and it may be used to those skilled in the art according method which is well known in the art for preparing diabetes treating reagent .
- 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3 -methoxyphenyl) -propane and austrobailignan-7 increased PPARy activity in a concentration-dependent manner and showed a significant difference (**, p ⁇ 0.01) from the control group at all the treatment concentrations.
- RNA of the cells was isolated using TRIZOL (Invitrogen, USA) .
- the isolated total RNA was quantified, and then the RNA in the same amount for each sample was synthesized into cDNA at 42 ° C for 20 minutes using reverse transcriptase.
Landscapes
- Health & Medical Sciences (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Engineering & Computer Science (AREA)
- Alternative & Traditional Medicine (AREA)
- Biotechnology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Medical Informatics (AREA)
- Botany (AREA)
- General Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Child & Adolescent Psychology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Diabetes (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Obesity (AREA)
- Hematology (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention relates to novel use of lignan compounds, and more particularly, the present invention relates to novel use of an extract of the aril of nutmeg, 2- (4-allyl-2, 6-dimethoxyphenoxy) -1- (4-hydroxy- 3 -methoxyphenyl) -propane, austrobailignan 7 or licarin E, for preventing or treating diabetes or PPARγ-mediated diseases. The said compound and extract of the aril of nutmeg act as ligands for PPARy, and they may be used for preventing or treating PPARγ-mediated diseases, not limited thereto, such as diabetes and diabetic complication. Accordingly, 2- (4-allyl-2, 6- dimethoxyphenoxy) -1- (4 -hydroxy-3 -methoxyphenyl) -propane, austrobailignan 7 or licarin E and extract of the aril of nutmeg may be useful as preventing or treating agent for PPARγ-mediated diseases, not limited thereto, such as diabetes and diabetic complication.
Description
Invention Title
NOVEL USE OF LIGNAN COMPOUNDS Technical Field
The present invention relates to novel use of lignan compounds, and more particularly, the present invention relates to novel use of an extract of the aril of nutmeg, 2- (4-allyl-2 , 6-dimethoxyphenoxy) -1- (4-hydroxy-
3-methoxyphenyl) -propane, austrobailignan 7 or licarin E, for preventing or treating diabetes or PPARγ-mediated diseases.
Background Art
PPAR (peroxisome proliferator activated receptor) is nuclear receptor which bind with the compound increasing number of peroxisome, named as peroxisome proliferator as a ligand, and PPARα, PPARδ, isoform of PPARyhas been known (J. Steroid Biochem. Molec. Biol., 51, 157, 1994; Gene Expression, 4, 281, 1995; Biochem. Biophys. Res. Commun . , 224, 431, 1996).
PPAR mainly regulates expression of genes which are related to lipid metabolism or differentiation of adipocyte (J". Invest. Dermatol. Ill, 1116-1121, 1998; J". Med. Chem. , 43, 527-550, 2000), and PPARαwhich is an isoform of PPAR mainly expressed in liver, retina, adipose tissue, and related to oxidation of fatty acid or neutralization of toxic materials, and inflammation.
PPARyis expressed mainly in fat cell, immune cell, adrenal gland, spleen, and intestine, and it is known as core regulator of fat cell differentiation. PPARδ is not expressed in the manner of tissue-specific, rather it is expressed broadly and its function is not identified. (Endocrinology., 137, 354, 1996).
Since PPAR plays an important role in fat metabolism, a lot of researches about developing treatment reagent for PPAR mediated metabolic diseases are in progress. If PPARγis activated, sugar acceptability of fat cell become maximized, and differentiation of fat cell is promoted, and then insulin resistance is reduced (Tren. Pharmacol. Sci . , 25: 331-336, 2004) . Accordingly, ligand of PPARvmay play a role as a treating reagent for diabetes which is caused by insulin resistance. The TZD reagents such as pioglitazone and rosiglitazone are typical ligands of PPARy and used as treating reagents for diabetes mellitus.
The diabetes may be classified into type 1 and type 2. The type 1 diabetes is autoimmune disease which pancreas induce immunological reaction by genetic susceptibility and viral infaction, and β-cells are selectively destroyed. The type 2 diabetes is the type which insulin resistance is priory occurred and reported
that caused by complicated factors such as obesity, reduction of insulin receptor, reduction of tyrosine kinase activity, reduction of muscle/adipose tissue type transporter in muscle and fat tissues, deficiency of insulin receptor substrate-1 (IRS-I) in the cells. The type 2 diabetes is mainly occurred in adult and it occupies 90% of diabetes (Drugs, 65: 433-445, 2005).
Meanwhile, the nutmeg is a nut of Myristica fragrans which is a perennial plant cultured in tropical regions, and has been used as spices for a long time. In addition, the extract of the aril of nutmeg is peel region of the said fruit of Myristica fragrans and is reported that it has inhibition of proliferation of Helicobacter pylori (In Vivo., 17;541-4, 2003), activation of detoxification in liver (Food Chem. Toxicol., 31;517-21, 1993), chemical prevention of skin verruca (Cancer Lett., 56;59-63, 1991), anti-inflammation activity (Jpn. J. Pharmacol., 49/155-63, 1999). However, the relationship between the nutmeg or the extract of the aril of nutmeg and PPAR or anti-diabetic use thereof have never been reported as yet .
Therefore, the inventors of the present invention have screened many kind of natural materials to find active component which preventing or treating insulin
resistance diabetes, and then identified that 2-(4-allyl- 2, 6-dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) - propane, austrobailignan 7, licarin E which are isolated from the extract of the aril of nutmeg have activity in preventing or treating diabetes or PPARY mediated diseases, thereby completing the present invention.
Disclosure Technical Problem Accordingly, it is an object of the present invention to provide a novel use of 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane, austrobailignan 7, and licarin E which are isolated from the aril of nutmeg for preventing or treating diabetes or PPARY mediated diseases.
Technical Solution
To achieve the above objects, the present invention provides a pharmaceutical composition comprising a C1-C6 organic solvent extract of the aril of nutmeg as an effective component for preventing or treating diabetes.
In another aspect, the present invention provides a pharmaceutical composition comprising one which is selected from the group consisting of a compound represented by Formula 1, a compound represented by
Formula 2, and a compound represented by Formula 3, or
their pharmaceutically acceptable salts as an effective component for preventing or treating diabetes. <Formula 1>
< Formula 2 >
<Formula 3>
In another aspect, the present invention provides a pharmaceutical composition comprising one which is selected from the group consisting of a compound represented by Formula 1, a compound represented by Formula 2, and a compound represented by Formula 3, or their pharmaceutically acceptable salts as an effective component for preventing or treating PPARy (peroxisome
proliferator activated receptor γ) mediated diseases.
In another aspect, the present invention provides a use of a Cl-C6 organic solvent extract of the aril of nutmeg for preparing a treating reagent of diabetes.
In another aspect, the present invention provides method comprising administering an effective amount of C1-C6 organic solvent extract of the aril of nutmeg to a subject in need thereof.
In another aspect, the present invention provides a use of one which is selected from the group consisting of a compound represented by Formula 1, a compound represented by Formula 2, and a compound represented by Formula 3, or their pharmaceutically acceptable salts for preparing a treating reagent of diabetes.
In another aspect, the present invention provides a method comprising administering an effective amount of one which is selected from the group consisting of a compound represented by Formula 1, a compound represented by Formula 2, and a compound represented by Formula 3, or their pharmaceutically acceptable salts for preventing or treating diabetes.
In another aspect, the present invention provides a
use of one which is selected from the group consisting of a compound represented by Formula 1, a compound represented by Formula 2 , and a compound represented by Formula 3, or their pharmaceutically acceptable salts for preparing a treating reagent of PPARy mediated diseases.
In another aspect, the present invention provides a method comprising administering an effective amount of one which is selected from the group consisting of a compound represented by Formula 1, a compound represented by Formula 2 , and a compound represented by Formula 3 , or their pharmaceutically acceptable salts for preventing or treating PPARY mediated diseases.
Hereafter, the present invention will be described in detail.
The present invention relates to novel use of an extract of the aril of nutmeg, and more particularly to novel use of 2- (4-allyl-2 , 6-dimethoxyphenoxy) -1- (4- hydroxy-3 -methoxyphenyl) -propane, austrobailignan-7 and licarin E, separated from the extract of the aril of nutmeg .
The inventive 2- (4-allyl-2, 6-dimethoxyphenoxy) -1- (4 -hydroxy-3 -methoxyphenyl) -propane, austrobailignan-7 and licarin E, which have antidiabetic activity, are compounds having structures of the following formulas 1,
2 and 3, respectively, and can be separated and purified from nutmeg or the aril of nutmeg using a prior method for extracting and separating material: <Formula 1>
<Formula 2>
<Formula 3>
Preferably, the 2- (4-allyl-2 , 6-dimethoxyphenoxy) -1-
(4-hydroxy-3-methoxyphenyl) -propane, austrobailignan-7 and licarin E of the present invention can be obtained using a conventional extraction and separation method. For example, an extract of the aril of nutmeg is obtained by placing the dried aril of nutmeg in an extractor
together with a 4-10 fold volume of an extraction solvent, allowing the plant to stand for 2 days to obtain an extract, and concentrating and drying the extract in a concentrator. As the extraction solvent for separation in the present invention, water or a C1-C6 organic solvent may be used. Preferably, various solvents, including purified water, methanol, ethanol , propanol , isopropanol, butanol, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, hexane, cyclohexane, petroleum ether and the like, may be used alone or in a mixture thereof. The extract obtained as described above is subjected to silica gel column chromatography to obtain fractions according to polarity, and the separated specific fraction is subjected to reverse phase column chromatography and high-performance liquid chromatography (HPLC), thus separating 2- (4-allyl-2 , 6-dimethoxyphenoxy) - 1- (4-hydroxy-3-methoxyphenyl) -propane, austrobailignan-7 and licarin E from the fraction. However, the method for extracting and separating the active ingredients is not necessarily limited to the above-described method.
The aril of nutmeg that is used in the present invention indicates the aril of the fruit of Myristica fra.gra.ns, and the inventive 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane, austrobailignan-7 and licarin E, separated from the extract of the aril of nutmeg, act as ligands for PPARY
to activate PPARγ. This fact has been found for the first time by the present inventors.
In one Example of the present invention, a known method for finding a ligand, which activates a gene having a PPAR response element (PPRE) , by binding to PPARγ, was used to confirm that the inventive 2- (4-allyl- 2, 6-dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) - propane, austrobailignan-7 and licarin E bind to PPAR, particularly PPARγ, to activate PPAR (FIGS. 12 and 20) . When PPARγ is activated, it binds to a DNA sequence, PPRE (PPAR response element) , to regulate the expression of the target genes of PPARy, and the expression of the target genes of PPARγ, which are mainly involved in lipid metabolism, is increased. Thus, in another Example of the present invention, it was examined whether the expression of aP2 , LPL, PEPCK and GLUT4 , known as the target genes of PPAR, is increased. As a result, it could be seen that the expression of the target genes of PPARγ was significantly increased upon treatment with 2- (4-allyl-2, 6-dimethoxyphenoxy) -1- (4-hydroxy-3- methoxyphenyl) -propane, austrobailignan-7 and licarin E (see FIGS. 13 and 21) .
Thus, the present inventors have found for the first time that the inventive 2- (4 -allyl -2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane, austrobailignan-7, licarin E, or pharmaceutically acceptable salts thereof, have an activity to prevent or
treat PPARγ-mediated diseases. Accordingly, the inventive 2- (4-allyl-2 , 6-dimethoxyphenoxy) -1- (4-hydroxy- 3 -methoxyphenyl) -propane, austrobailignan-7, licarin E, or pharmaceutically acceptable salts thereof, can be effectively used as active ingredients in pharmaceutical compositions for preventing or treating PPARγ-mediated diseases .
As used herein, PPARγ-mediated diseases means the diseases which symptoms are prevented, treated, or relieved by activation of PPARy. Preferably, the said
PPARγ-mediated diseases may comprise, but not limited thereto, type 2 diabetes (NIDDM; non-insulin-dependent diabetes mellitus) , hyperinsulinemia, obesity, hyperglycemia, hyperlipidemia, syndrome X, hypercholesterolemia, hyperlipoproteinemia, atherosclerosis, hypertension, insulin resistance, dysmetabolic syndrome, diabetic complications, impaired glucose homeostasis, impaired glucose tolerance, hypertriglyceridemia, osteoporosis (J". Biol. Chem. 275:
14388-14393, 2000), glomerulonephritis (Kidney Int., 60:
14-30, 2001) or kidney diseases caused by diabetes (Kidney
Int. , 60: 14-30, 2001) .
Meanwhile, it is known that, as PPARy becomes activated, the sugar absorption of adipocytes is maximized and adipocyte differentiation is stimulated
{Trends in Pharmacological Sciences, 25: 331-336, 2004). Thus, in another Example of the present invention, it was examined whether the inventive 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane and austrobailignan-7 activate PPARy to stimulate adipocyte differentiation. As a result, it was seen that the inventive 2- (4-allyl-2 , 6-dimethoxyphenoxy) -1- (4- hydroxy-3-methoxyphenyl) -propane and austrobailignan-7 stimulated the differentiation of preadipocytes 3T3-L1 cells into adipocytes (see FIG. 14) .
Meanwhile, ob/ob mice continually ingest excessive food because their appetite is not regulated due to the deletion of a leptin gene. As a result, fat is excessively accumulated in the body, and at about 3 months after birth, the mice maintain a weight of about
50 g, reaching about 2 times the weight of wild-type mice.
Also, the mice become type 2 diabetic models having a blood glucose level higher than that of wild-type mice
{Exp. Clin. Endocrinol. Diabetes, 109: 307-319, 2001). Such ob/ob mice are typical experimental animal models which are used to investigate anti-obesity agents and anti-diabetic agents or to evaluate anti-obesity and anti-diabetic effects. Thus, the action of the inventive 2- (4 -allyl -2, 6-dimethoxyphenoxy) -1- (4-hydroxy-3- methoxyphenyl) -propane, austrobailignan-7 and licarin E was examined in an ob/ob mouse model. As a result, the inventive 2- (4 -allyl-2, 6-dimethoxyphenoxy) -1- (4 -hydroxy-
3 -methoxyphenyl) -propane, austrobailignan-7 and licarin E significantly reduced a blood glucose level in the ob/ob mouse model, suggesting that they have the effect of preventing diabetes, particularly type 2 diabetes. Accordingly, it could be found that the inventive 2- (4-allyl-2, 6-dimethoxyphenoxy) -1- (4-hydroxy-3- methoxyphenyl) -propane, austrobailignan-7 and licarin E were PPAR ligands, particularly PPARy ligands increasing insulin sensitivity, had the effect of preventing obesity, that is a PPARγ-mediated disease, metabolic diseases hyperlipidemia and cardiovascular diseases by significantly reducing weight and blood triglyceride levels in the ob/ob mice model, and had the effect of preventing diabetes, particularly type 2 diabetes, by reducing blood glucose levels.
Accordingly, the present invention provides a pharmaceutical composition comprising, 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4 -hydroxy-3 -methoxyphenyl) -propane, austrobailignan-7 and licarin E or their pharmaceutically acceptable salts as an effective component for preventing or treating diabetes.
The compounds according to the present invention may be used in the form of itself or a salt, and preferably a pharmaceutically acceptable salt. As used herein, the term "pharmaceutically acceptable" means what
is physiologically acceptable and, when administered to human beings, generally does not cause allergic reactions, or similar reactions thereto. Preferably, the salt is the acid-addition salt formed by a pharmaceutically acceptable free acid. The free acid used in the present invention may be organic acids and inorganic acids. The organic acids include, but are not limited to, citric acid, acetic acid, lactic acid, tartar acid, maleic acid, fumaric acid, formic acid, propionic acid, oxalic acid, trifluoroacetic acid, benzoic acid, gluconic acid, methane sulfonic acid, glycolic acid, succinic acid, 4 -toluene sulfonic acid, glutamic acid and aspartic acid. Also, the inorganic acids include, but are not limited to, hydrochloric acid, bromic acid, sulfuric acid and phosphoric acid.
As used herein, diabetes means, but not limited thereto, type 2 diabetes, and when it administered for the purpose of treating diabetes, it may be administered by oral or parenteral routes with proper types of individual dose composition. The common drug formulations may be prepared using diluents such as fillers, thickeners, binders, wetting agents, disintegrants, or excipients. Solid formulations for oral administration include tablets, pills, powders, granules, and capsules and the said Solid formulations are manufactured by mixing one or more excipient, for example, starch,
calcium carbonate, sucrose or lactose and gelatin, with 2- (4-allyl-2, 6-dimethoxyphenoxy) -1- (4-hydroxy-3- methoxyphenyl) -propane, austrobailignan-7 or licarin E. Also, except the simple excipient, lubricant such as magnesium stearate or talc may be used. Examples of liquid formulations for oral administration include suspensions, liquids, emulsions and syrups. The liquid formulations may comprise a simple diluent such as water, liquid paraffin, and various excipients, for example, humectants, sweet agents, aromatic agents and preservatives. Examples of pharmaceutical formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, ointments and creams. The non- aqueous solutions and suspensions may be prepared using propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyloleate.
Also, the composition of the present invention may be administered via the parenteral administration and the parenteral administration includes subcutaneous, intravenous, intramuscular or intraperitoneal injection. For parenteral administration, 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane, austrobailignan-7 or licarin E of the present invention may be mixed with a stabilizer or buffer in water to
prepare a solution or suspension, which may then be provided as ampoules or vials each containing a unit dosage form. The dosage units can contain, for example, 1, 2, 3, or 4 times of an individual dose or 1/2, 1/3 or 1/4 times of an individual dose. An individual dose preferably contains the amount of an effective drug which is given in one administration and which usually corresponds to all, 1/2, 1/3 or 1/4 times a daily dose. Suitable administration dose may be changed by considering various factors, such as body weight, age, sex, health condition, diet, administration time, administration route, excretion of a subject and mixture of component, and disease severity.
The said pharmaceutical compositions are well described in Remington's Pharmaceutical Science, 15th Edition, 1975. Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour which is general prescription book in chemical pharmacology.
2- (4-allyl-2, 6-dimethoxyphenoxy) -1- (4-hydroxy-3- methoxyphenyl) -propane, austrobailignan-7 or licarin E of the present invention are orally administered to rats for toxicology test, and it is shown that 50% Lethal dose (LD 50) is 2,000mg/kg.
In another aspect, this invention provides a use of
C1-C6 organic solvent extracts of the aril of nutmug for preparing diabetes treating reagent. The method of extraction and isolation for preparing extracts of the aril of nut is well described above, and it may be used to those skilled in the art according method which is well known in the art for preparing diabetes treating reagent .
In addition, the present invention provides a method comprising administering C1-C6 organic solvent extracts of the aril of nutmug for preventing or treating PPARY mediated diseases.
The method of extraction and isolation for preparing extracts of the aril of nut is the same as described above. In addition, administration method of the said organic solvent extract is the same as described and it is not limited thereto, as far as it sustain effect on preventing or treating diabetes.
In another aspect, the present invention provides a use of one which is selected from the group consisting of a compound represented by Formula 1, a compound represented by Formula 2, and a compound represented by Formula 3, or their pharmaceutically acceptable salts for preparing a treating reagent of diabetes.
Because a compound represented by Formula 1, a
compound represented by Formula 2, and a compound represented by Formula 3 have excellent effect on treating diabetes, it may be used for preparing diabetes treating reagent by those skilled in the art with well known skills thereof.
In addition, the present invention provides a method comprising administering an effective amount of one which is selected from the group consisting of a compound represented by Formula 1, a compound represented by Formula 2 , and a compound represented by Formula 3 , or their pharmaceutically acceptable salts for preventing or treating diabetes.
The administration method of the said a compound represented by Formula 1, a compound represented by Formula 2, and a compound represented by Formula 3 is the same as described and it is not limited thereto, as far as it sustain effect on preventing or treating diabetes.
In another aspect, the present invention provides a use of one which is selected from the group consisting of a compound represented by Formula 1, a compound represented by Formula 2, and a compound represented by Formula 3, or their pharmaceutically acceptable salts for preparing a treating reagent of PPARγ-mediated diseases.
Because a compound represented by Formula 1, a compound represented by Formula 2 , and a compound
represented by Formula 3 have excellent effect on PPARY- mediated diseases, it may be used for preparing PPARY- mediated diseases treating reagent by those skilled in the art with well known skills thereof. The PPARY- mediated disease means the disease which is prevented, cured, reduced, or moderated by PPARY activation.
In addition, the present invention provides a method comprising administering an effective amount of one which is selected from the group consisting of a compound represented by Formula 1, a compound represented by Formula 2, and a compound represented by Formula 3, or their pharmaceutically acceptable salts for preventing or treating PPARγ-mediated disease. The administration method of the said a compound represented by Formula 1, a compound represented by Formula 2, and a compound represented by Formula 3 is the same as described and it is not limited thereto, as far as it sustain effect on preventing or treating PPARγ~ mediated disease.
As used herein, the term "subject in need" means mammals, which need prevention and treatment of PPARy- mediated disease, but not limited thereto, diabetes, and preferably it means human beings.
The inventive compositions may be administered to patients with the amount of single dose and may be
administered with the amount of multiple doses in fractionated treatment protocol and the dose level may- vary according to disease condition. Preferably, the effective amount of the inventive composition is about 0.01Mg to l,000mg/kg body weight/day, and most Preferably it may be 0. IMS to 100mg/kg body weight/day. However, because it may be suitably determined by considering various factors, such as age, body weight, health condition, sex, disease severity, diet and excretion of a subject in need of treatment, as well as administration time and administration route, if he is skilled in the art, he could determine proper effective amount for administration for preventing or treating diabetes or PPARγ-mediated disease. However, the pharmaceutical composition, administration route, and administration method is not limited as far as it shows effect of the present invention.
Advantageous Effects 2- (4-allyl-2, 6-dimethoxyphenoxy) -1- (4 -hydroxy-3- methoxyphenyl) -propane, austrobailignan-7 and licarin E of the present invention are compounds which are isolated from the aril of nutmug extract, and the said compound and the aril of nutmug extract act as ligand of PPARY and activated PPARy. Therefore, they may be used for preventing and treating PPARγ-mediated diseases, preferably, but not limited thereto, such as diabetes and
diabetic complication. Accordingly, 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane, austrobailignan-7, licarin E, and the aril of nutmug extract may be used as preventing and treating reagent for PPARγ-mediated diseases, preferably, but not limited thereto, such as diabetes and diabetic complication.
Description of Drawings
FIG.l shows isolation scheme of 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane, austrobailignan-7 from the aril of nutmug.
FIG.2 shows 13C-NMR spectrum of 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane.
FIG.3 shows 1H-NMR spectrum of 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane.
FIG.4 shows 1H-1H-COSY spectrum of 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane.
FIG.5 shows 1H-13C-HMBC spectrum of 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane. FIG.6 shows FAB/Mass spectrum of 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane. FIG.7 shows 13C-NMR spectrum of austrobailignan-7. FIG.8 shows 1H-NMR spectrum of austrobailignan-7. FIG.9 shows 1H-1H-COSY spectrum of austrobailignan- 7.
FIG.10 shows 1H-13C-HMBC spectrum of austrobailignan-7.
FIG.11 shows FAB/Mass spectrum of austrobailignan- 7.
FIG.12 is a graph showing PPARY activating effect of 2- (4-allyl-2 , 6-dimethoxyphenoxy) -1- (4-hydroxy-3- methoxyphenyl) -propane and austrobailignan-7 in dose- dependant manner.
FIG. 13 shows effect of 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4 -hydroxy-3 -methoxyphenyl) -propane and austrobailignan-7 on activating target gene expression.
A : aP2 B : LPL C : PEPCK D : GLUT4 FIG.14 shows effect of 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3 -methoxyphenyl) -propane and austrobailignan-7 on activating fat cell differentiation in 3T3-L1 mouse fibroblast cells.
FIG.15 shows isolation scheme of licarin E 7 from the aril of nutmug.
FIG.16 shows FAB/Mass spectrum of licarin E 7. FIG.17 shows 13C-NMR spectrum of licarin E 7. FIG.18 shows 1H-NMR spectrum of licarin E 7. FIG.19 shows 13C -DEPT spectrum of licarin E 7. FIG.20 is a graph showing PPARy activating effect of licarin E 7 in dose-dependant manner.
FIG.21 shows effect of licarin E 7 on activating
target gene expression. A : LPL B : aP2
Mode for Invention
Hereinafter, the present invention will be described in detail by examples. It is to be understood, however, that these examples are for illustrative purpose only and are not constructed to limit the scope of the present invention. In addition, every activity analysis were performed 3 times and the results are shown as Means±SD.
Example 1: Separation and purification of 2- (4- allyl-2, 6-dimethoxyphenoxy) -1- (4-hydroxy-3- methoxyphenyl ) -propane and austrobailignan-7 from aril of nutmeg and determination of structures thereof
<!-!> Separation and purification of 2- (4-allyl- 2, 6-dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) - propane and austrobailignan-7
100 g of the dried and ground aril of nutmeg was added to 400 ml of 75% methanol and left to stand at room temperature for 2 days. The extracted solution was filtered and concentrated in a vacuum, thus preparing 13.26 g of a methanol extract of the aril of nutmeg. The extracted solution was fractionated with ethylacetate, butanol and water. The ethylacetate fraction (10.29 g)
was eluted by silica gel column chromatography with a mixed solution of chloroform and ethylacetate (9:1 (v/v) ) to obtain fraction V (0.52 g) and fraction VI (0.19 g) . The fraction V was subjected to column chromatography with a mixed solvent of chloroform, ethylacetate and acetone (24:0.3:1 (v/v/v) ) to obtain fraction V-C (0.05 g) . Then, the fraction V-C was eluted by recycling high- performance liquid chromatography with 100% methanol to obtain single material fraction V-C-2 (0.03 g; found to be 2- (4-allyl-2, 6-dimethoxyphenoxy) -1- (4-hydroxy-3- methoxyphenyl) -propane in Example 1-2 below) . Also, the fraction V was subjected to column chromatography with a mixed solvent of chloroform, ethylacetate and acetone
(30:1:2 (v/v/v)) to obtain fraction VI-B (0.52 g) . Then, the fraction VI-B was eluted by recycling high- performance liquid chromatography with 100% methanol to obtain single material fraction VI -B-5 (0.011 g; found to be austrobailignan-7 in Example 1-3 below) . This separation process is shown in FIG. 1. <l-2> Structural analysis of single material V-C-2
To determine the structure of the separated single material V-C-2, the 1H-NMR spectrum and 13C-NMR spectrum of the material were measured at 600 MHz and 150 MHz (solvent: CDCl3), respectively. The measurement results are shown in FIGS. 2 and 3. The results of comprehensive analysis of 1H-NMR and 13C-NMR are shown in Table 1 blow. [Table 1]
In order to "measure 1H-1H correlation and 1H-13C correlation on the basis of the results of the 13 C-NMR spectrum and the 1H-NMR spectrum, the 1H-1H COSY spectrum and the 1H-13C HMBC spectrum were measured. The measurement results are shown in FIGS. 4 and 5,
respectively. The results of FAB/MS measured for the mass spectrometry of the separated single material are shown in FIG. 6. The [M]+ of the single material was observed at m/z 358 in FAB/MS, suggesting that the material had a molecular weight of 358 and a molecular formula of C2iH26θ5.
Through the above results of 1H-NMR, 13C-NMR, 1H-1H COSY, 1H-13C HMBC and FAB/MS and the prior reference {Chem. Pharm. Bull., 35: 668, 1987), the separated single material was found to be 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane represented by the following formula 1: <Formula 1>
<l-3> Structural analysis of single material VI-B-5 To determine the structure of the separated single material VI-B-5, the 1H-NMR spectrum and 13C-NMR spectrum of the single material were measured at 600 MHz and 150 MHz (solvent: CDCl3). The measurement results are shown in FIGS. 7 and 8, respectively. The results of comprehensive analysis of 1H-NMR and 13C-NMR are shown in Table 2 below.
[Table 2]
Position 13C-NMR 1H-NMR
1 137.4
2 108.9 6.92 (IH, d)
3 148.1
4 147.1
5 106.7 6.78 (IH, d)
6 119.8 6.82 (IH, dd) α 85.9 4.61 (IH, d) β 43.7 2.39-2.43 (2H, m)
Y 12.0 1.00 (3H, d)
1' 132.7
2' 119.0 6.91 (IH, d)
3 ' 114.2
4 ' 144.5 5.54 (IH, s, -OH)
5' 146.5 6.88 (IH, d)
6' 108.2 6.77 (IH, dd) α1 85.0 5.42 (IH, d) β' 47.9 2.39-2.43 (2H, m)
Y1 9.6 0.61 (3H, d)
-OMe 56.2 3.89 (3H, s)
5.94 (IH, d)
-OCH2O- 101.1 5.95 (IH, d)
To measure 1H-1H correlation and 1H-13C correlation on the basis of the results of the 13C-NMR spectrum and the 1H-NMR spectrum, the 1H-1H COSY spectrum and the 1H-13C HMBC spectrum were measured. The measurement results are shown in FIGS. 9 and 10, respectively. The results of
FAB/MS measured for the mass spectrometry of the separated single material are shown in FIG. 11. The [M] + of the separated single material was observed at m/z 342 in FAB/MS, suggesting that the material had a molecular weight of 342 and a molecular formula of C20H22O5.
Through the above results of 1H-NMR, 13C-NMR, 1H-1H COSY, 1H-13C HMBC and FAB/MS and the prior reference {Aust. J. Chem. , 28: 81, 1975), the separated single material was found to be austrobailignan-7 represented by the following formula 2 : <Formula 2>
<l-4> Separation and purification of licarin E 100 g of the dried and ground aril of nutmeg was added to 400 ml of 100% ethanol and left to stand at room temperature for 5 days. The extracted solution was filtered and concentrated in a vacuum, thus preparing 26.61 g of an ethanol -extract of the aril of nutmeg. The extract was fractionated with ethylacetate, butanol and water. The ethylacetate fraction (18.44 g) was eluted by silica gel column chromatography with a mixed solvent of chloroform and ethylacetate (9:1 (v/v) ) to obtain
fraction II (3.04 g) . The fraction II was subjected to column chromatography with a mixed solvent of chloroform, hexane, ethylacetate and acetone (15:10:0.1:0.1
(v/v/v/v) ) to obtain fraction H-B (0.4 g) . Then, the fraction H-B was eluted by recycling high-performance liquid chromatography with 100% methanol to obtain protein fraction II-B-2 (0.016 g; found to be licarin E in Example 1-5 below) . This separation process is shown in FIG. 15. <l-5> Structural analysis of single material II-B-2
To determine the structure of the separated single material II-B-2, the 1H-NMR spectrum and 13C-NMR spectrum of the separated material were measured at 600 MHz
(solvent: CDCl3) . The measurement results are shown in FIGS. 17 and 18, respectively. The results of comprehensive analysis of 1H-NMR and 13C-NMR are shown in Table 3 below. [Table 3]
Carbon No . v δc δH
1
2 93.0
3 45.5 1.35 (3H, d, 7-OMe)
3a 132.7 5.48 (IH, s, -OH)
4 113.0 6.82 (IH, d)
5 131.8 6.70 (IH, dd)
6 109.2 5.15 (d, 9)
7 143.7 3.2-3 .7 (m)
7a 146.2 1.35 ( 3H , d, 7)
3 -Me 17.6 5.92
OMe 55.7
I1 134.0
2 ' 106.3 3.80 (6H, S)
3 • 147.5 3.88 (S)
4' 147.2
5 ' 107.7 6.40 (2H, 31, 5 '-H)
6' 119.7 3.80 (6H, s, 21 -OMe, 6'-OMe) α 130.6 3.34 (2H, d) β 122.9 5.92 -6.02 (IH m)
Y 18.1 1.84 (3H7 d, 5)
Based on the 13C-NMR spectrum and the 1H-NMR spectrum, the 13C-DEPT spectrum of the separated material was measured. The measurement results are shown in FIG. 19. The results of FAB/MS measured for the mass spectrometry of the separated single material are shown in FIG. 16. The [M]+ of the separated material was observed at m/z 324 in FAB/MS, suggesting that the separated material had a molecular weight of 324 and a molecular formula of C2oH2o04.
Through the above results of 1H-NMR, 13C-NMR, 13C- DEPT and FAB/MS and the prior reference {J. Chromatogr. 110, 91-102), the separated material was found to be licarin E represented by the following formula 3: <Formula 3>
Example 2: Activation of peroxisome proliferator activated receptor γ (PPARy) by 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane and austrobailignan-7
In order to confirm whether 2- (4-allyl-2, 6- dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane and austrobailignan-7 act as ligands for PPARy, a test was carried out according to a known method using a vector, having a PPARy expression plasmid and a luciferase gene under the control of PPRE (peroxisome proliferator responsive element) {Cell, 68: 879-887, 1992; J". Biol. Chem. , 272: 25252-25259, 1997). The activation of luciferase expression was measured by transfecting COS-7 monkey kidney cells (ATCC CRL-1651) with a PPARy plasmid and a pFR-luciferase vector (Stratagene, USA) , and then treating the cells with 2- (4-allyl-2, 6-dimethoxyphenoxy) -1- (4-hydroxy-3- methoxyphenyl) -propane and austrobailignan-7, separated in Example 1, for 24 hours. The PPARy plasmid was prepared by performing RT-PCR with primers of SEQ ID NO: 1 (TCGGTTTAAGATTCATCTTTATT) and SEQ ID NO: 2
(GTCTCCGGTACCTTGATCACCTGC) to obtain a PCR product encoding amino acids 176-477 (PPARY ligand binding domain) of the entire amino acid sequence of human PPARY
(Genbank Accession No. NM_138712) , and then by cloning the PCR product into the Xbal and Kpnl restriction enzyme sites of a pFA vector (Stratagene, USA) . RT-PCR was performed by synthesizing cDNA at 42 °C for 60 minutes using reverse transcriptase, and then by performing PCR using Taq polymerase in the following conditions: 30 cycles of 1 min at 95 °C , 30 sec at 54 °C and 2 min at 72 °C . Herein, test groups treated with each of the inventive 2- (4-allyl-2 , 6-dimethoxyphenoxy) -1- (4-hydroxy- 3 -methoxyphenyl) -propane and austrobailignan-7 at varying concentrations of 3 μM, 5 μM and 10 μM were compared with a control group treated with 0.01% DMSO (dimethyl sulfoxide) and a group treated with 5 μM troglitazone (Sigma, USA) , a compound known as a PPARγ ligand.
As a result, as shown in FIG. 12, 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3 -methoxyphenyl) -propane and austrobailignan-7 increased PPARy activity in a concentration-dependent manner and showed a significant difference (**, p < 0.01) from the control group at all the treatment concentrations. For example, at a treatment concentration of 5 μM, the activity of the comparative compound troglitazone was about 10-fold higher than that of the control group, and luciferase activities induced by the inventive 2- (4-allyl-2 , 6-
dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane and austrobailignan-7 were higher than that of the control group by about 6.6 times and about 3.1 times, respectively. This suggests that the inventive natural materials, 2- (4-allyl-2 , 6-dimethoxyphenoxy) -1- (4-hydroxy- 3 -methoxyphenyl) -propane and austrobailignan-7, acted as PPARY ligands to activate PPARy, and additionally showed activity similar to that of the synthetic material troglitazone that is a known PPARy ligand, thus effectively activating PPARγ.
Example 3 : Examination of expression of target gene resulting from PPARy activation caused by 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4 -hydroxy-3 -methoxyphenyl) -propane and austrobailignan-7 3T3-L1 mouse preadipocytes (ATCC CL-173) , cultured in 10% FBS (fetal bovine serum) -containing DMEM
(Dulbeccos Modified Eagles Medium) medium, were plated at a concentration of 1 x 106 cells/well and were additionally cultured for 5 hours. To the medium of the cultured cells, 2- (4-allyl-2 , 6-dimethoxyphenoxy) -1- (4- hydroxy-3 -methoxyphenyl) -propane and austrobailignan-7 were added at concentrations of 5 μM and 10 μM, and the cells were left to stand for 24 hours. The medium of the cultured cells was replaced with MDI (0.5 mM 3-isobutyl- 1-metylxanthine, 0.5 uM dexamethasone , 10 ug/ml insulin) medium to induce the differentiation of the adipocyte cells (Am. J. Physiol. Cell Physiol., 280: C807-C813,
2001) . After 2 days from the time of replacement with the MDI medium, the cells were collected, and the total RNA of the cells was isolated using TRIZOL (Invitrogen, USA) . The isolated total RNA was quantified, and then the RNA in the same amount for each sample was synthesized into cDNA at 42 "C for 20 minutes using reverse transcriptase. The synthesized cDNA was subjected to RT-PCR using Taq polymerase with each of an aP2 amplification primer pair (SEQ ID NO: 3 (ACAGCTCCTCCTCGAAGG) and SEQ ID NO: 4
(GCGTAAATGGGGATTTGGTCA) ) , an LPL amplification primer pair (SEQ ID NO: 5 (TATCCGCGTGATTGCAGAGA) and SEQ ID NO:
6 (AGAGAGTCGATGAAGAGATGAATGG) ) , a PEPCK amplification primer pair (SEQ ID NO: 7 (CAGGCGGCTGAAGAAGTATGA) and SEQ ID NO: δ(AACCGTCTTGCTTTCGATCCT)) and a GLUT4 amplification primer pair (SEQ ID NO: 9 (ATCCATGGATGGACGGTAACG) and SEQ ID NO: 10 (CTGGATCCCAATACTTCGACCA)) in the following conditions: 30 cycles of 1 min at 95 °C , 30 sec at 56 °C and 2 min at 72 "C .
As a result, as shown in FIG. 13, the mRNA expressions of the target genes aP2 , LPL, PEPCK and GLUT4 , the expressions of which are increased due to PPARy, were significantly (**, p < 0.01; *, p < 0.05) increased in all the test groups compared to the control group in proportion to the concentrations of 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane
and austrobailignan-7. This suggests that the inventive 2- (4-allyl-2 , 6-dimethoxyphenoxy) -1- (4 -hydroxy-3- methoxyphenyl ) -propane and austrobailignan-7 can activate PPARY to regulate the expression of the target genes of PPARy.
Example 4: Examination of stimulation of adipocyte differentiation resulting from PPARy activation caused by 2- (4 -allyl-2, 6-dimethoxyphenoxy) -1- (4-hydroxy-3- methoxyphenyl) -propane and austrobailignan-7 3T3-L1 mouse preadipocytes, cultured in 10% FBS- containing DMEM medium, were plated at a concentration of 1 x 106 cells and cultured for 5 hours. To the cultured cells, each of the inventive 2- (4-allyl-2, 6- dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane and austrobailignan-7 was added at a concentration of 10 μM, and the cells were left to stand for 24 hours. The medium of the cultured cells was replaced with an MDI
(0.5 mM 3-isobutyl-l-metylxanthine, 0.5 uM dexamethasone and 10 ug/ml insulin) medium to induce adipocyte differentiation {Am. J Physiol. Cell Physiol., 280: C807- C813, 2001). After 2 days from the time of replacement with the MDI medium, the morphology of the cells was observed with an optical microscope.
As a result, as can be seen in FIG. 14, adipocyte differentiation in the groups treated with each of 10 μM 2- (4 -allyl -2, 6-dimethoxyphenoxy) -1- (4 -hydroxy-3- methoxyphenyl) -propane and 10 μM austrobailignan-7,
respectively, was stimulated compared to the control group treated with 0.01% DMSO and the group treated with lOμM troglitazone. This suggests that the inventive 2- (4-allyl-2 , 6-dimethoxyphenoxy) -1- (4-hydroxy-3- methoxyphenyl) -propane and austrobailignan-7 activated PPARY to maximize the sugar absorption of adipocytes, thus stimulating adipocyte differentiation.
Example 5: Examination of anti-diabetic effect of 2- (4 -allyl -2 , 6-dimethoxyphenoxy) -1- (4 -hydroxy-3- methoxyphenyl) -propane in ob/ob mouse model
Ob/ob mice used as diabetic model animals continually ingest excessive food because their appetite is not regulated due to the deletion of a leptin gene. As a result, fat is excessively accumulated in the body, and the ob/ob mice become typical type 2 diabetic models, in which fat is excessively accumulated in the body and which have blood glucose levels higher than those of wild-type mice. Thus, in order to examine the effect of preventing and treating diabetes, four 10 -week-old ob/ob mice were used in each of a test group and a control group. In the case of the test group, 2- (4-allyl-2, 6- dimethoxyphenoxy) -1- (4 -hydroxy-3 -methoxyphenyl) -propane was diluted in corn oil and administered to the mice at a dosage of 20 mg/kg one time a day for 10 days, and in the case of the control group, only the same amount of corn oil was administered. At 10 days after the start of
administration, the blood glucose levels of the test group and the control group were measured and analyzed.
As a result, the control group was maintained at a blood glucose level of 456.23 ± 15.27 mg/dl, which was higher than a blood glucose level of 226.68 ± 13.26 mg/dl for normal mice, whereas the group treated with 2- (4- allyl-2 , 6-dimethoxyphenoxy) -1- (4 -hydroxy-3 - methoxyphenyl) -propane showed a blood glucose level of 316.95 ± 22.76 mg/dl, which was significantly (*, p < 0.01) lower than that of the control group by 30.53%, suggesting that 2- (4 -alIyI -2 , 6-dimethoxyphenoxy) -1- (4- hydroxy-3 -methoxyphenyl) -propane had the effect of preventing and treating diabetes.
Example 6: Examination of anti-diabetic effect of austrobailignan-7 in ob/ob mouse model
In order to examine the effect of preventing and treating diabetes, four 10-week-old ob/ob mice were used in each of a test group and a control group. In the case of the test group, austrobailignan-7 was diluted in corn oil and administered to the mice at a dosage of 20 mg/kg one time a day for 10 days, and in the case of the control group, only the same amount of corn oil was administered to the mice. At 10 days after the start of administration, the blood glucose levels of the test group and the control group were measured and analyzed.
As a result, the control group was maintained at a blood glucose level of 456.23 ± 15.27 mg/dl, which was
higher than a blood glucose level of 226.68 ± 13.26 mg/dl for normal mice, whereas the group treated with austrobailignan-7 showed a blood glucose level of 352.95 ± 19.54mg/dl, which was significantly (*, p < 0.01) lower than that of the control group by 22.64%, suggesting that austrobailignan-7 had the effect of preventing and treating diabetes.
Example 7: Activation of PPARy by licarin E
In order to examine whether licarin E acts as a PPARy ligand, a test was carried out according to the method of Example 2 and a known method using a vector, having a PPARy expression plasmid and a luciferase gene under the control of PPRE (Cell, 68: 879-887, 1992; J". Biol. Chem., 272: 25252-25259, 1997). The activation of luciferase expression was measured by COS-7 monkey kidney cells (ATCC CRL-1651) transfected with a PPARy plasmid and a pFR-luciferase vector (Stratagene, USA) , and then treating the cells with licarin E, separated in Example 1, for 24 hours. RT-PCR was performed by synthesizing cDNA using reverse transcriptase at 42 °C for 60 minutes, and then performing PCR in the following conditions using Taq polymerase: 30 cycles of 1 min at 95 °C , 30 sec at 54 °C and 2 min at 72 °C Herein, test groups treated with licarin E of the present invention at varying concentrations of 5 μM, 10 μM and 25 μM were compared with a control group treated with 0.01% DMSO and a group
treated with 10 μM troglitazone (Sigma, USA) , a compound known as a PPARγ ligand.
As a result, as shown in FIG. 20, licarin E increased PPARY activity in a concentration-dependent manner and showed a significant difference (**, p < 0.05) from the control group at all the treatment concentrations. For example, at a treatment concentration of 5 μM, the activity of the comparative compound troglitazone was about 10 times higher than that of the control group, and luciferase activities induced by licarin E of the present invention were higher than that of the control group by about 5 times and about 8 times. This suggests that the natural material licarin E of the present invention acted as a PPARy ligand to activate PPARY, and additionally showed activity similar to that of the synthetic material troglitazone that is a known PPARy ligand, thus effectively activating PPARy.
Example 8 : Examination of expression of target genes resulting from PPARy activation induced by licarin E_
3T3-L1 mouse preadipocytes (ATCC CL-173) , cultured in 10% FBS-containing DMEM medium, were plated at a concentration of 1 x 106 cells and additionally cultured for 5 hours. To the medium of the cultured cells, 10 μM licarin E was added, and the cells were left to stand for 24 hours. The medium of the cultured cells was replaced with MDI (0.5 mM 3-isobutyl-l-metylxanthine, 0.5 μM
dexamethasone and 10 μg/ml insulin) medium to induce adipocyte differentiation (Am. J. Physiol. Cell Physiol., 280: C807-C813, 2001). After 2 days from the time of replacement with the MDI medium, the cells were collected, and the total RNA of the cells was isolated using TRIZOL (Invitrogen, USA) . The isolated total RNA was quantified, and then the RNA in the same amount for each sample was synthesized into cDNA at 42 °C for 20 minutes using reverse transcriptase. The synthesized cDNA was subjected to RT-PCR using Taq polymerase with each of an aP2 amplification primer pair of SEQ ID NO: 3 and SEQ ID NO: 4 and an LPL amplification primer pair of SEQ ID NO: 5 and SEQ ID NO: 6 in the following conditions: 30 cycles of 1 min at 95 °C 30 sec at 56 °Cand 2 min at 72 °C As a result, as shown in FIG. 21, the mRNA expressions of the target genes aP2 and LPL, the expressions of which are increased due to PPARY, were significantly (**, p < 0.01) increased in all the test groups compared to the control group in proportion to the treatment concentration of II-B-2. This suggests that licarin E of the present invention can activate PPARγ to regulate the expression of the target genes of PPARγ.
Example 9: Examination of anti-diabetic effect of licarin E in ob/ob mouse model In order to examine the effect of preventing and treating diabetes, four 10 -week-old ob/ob mice were used in each test group. In the case of the test group,
licarin E was diluted in corn oil and administered to the mice at a dosage of 20 mg/kg one time a day for 10 days, and in the case of the control group, only the same amount of corn oil was administered to the mice. At 10 days after the start of administration, the blood glucose levels of the test group and the control group were measured and analyzed.
As a result, the control group was maintained at a blood glucose level of 456.23 ± 15.27 mg/dl, which was higher than 226.68 ± 13.26 mg/dl for normal mice, whereas the group treated with licarin E showed a blood glucose level of 316.95 ± 22.76 mg/dl, which was significantly (*, p < 0.01) lower than that of the control group by 30.53%, suggesting that licarin had the effect of preventing and treating diabetes.
Example 10: Examination of anti-diabetic effect of ethanol extract of aril of nutmeg in ob/ob mouse model
100 g of the dried and ground aril of nutmeg was added to 400 ml of ethanol and left to stand at room temperature for 2 days. The extracted solution was filtered and concentrated in a vacuum, thus preparing
14.29 g of an ethanol extract of the aril of nutmeg.
The anti-diabetic effect of the prepared ethanol extract was examined in an ob/ob mouse model according to the same method as in Example 5, and as a result, the blood glucose level of the group treated with the ethanol
extract was reduced by 37.6% compared to that of the control group.
Example 11: Examination of anti-diabetic effect of hexane extract of aril of nutmeg in ob/ob mouse model 100 g of the dried and ground aril of nutmeg was added to 400 ml of hexane and left to stand at room temperature for 2 days. The extracted solution was filtered and concentrated in a vacuum, thus preparing 16.78 g of a hexane extract of the aril of nutmeg. The anti-diabetic effect of the prepared hexane extract was examined in an ob/ob mouse model according to the same method as in Example 5, and as a result, the blood glucose level of the group treated with the ethanol extract was reduced by 32.9% compared to that of the control group.
Preparative example 1
Preparation of medicine comprising pharmaceutical composition for preventing and treating diabetes according to the present invention <1-1> Preparation of Tablets
First, 25mg of 2- (4-allyl-2 , 6-dimethoxyphenoxy) -1- (4-hydroxy-3-methoxyphenyl) -propane, austrobailignan 7, licarin E or an extract of the aril of nutmeg of the present invention was introduced into a U-shaped mixer together with 26mg of lactose and 3.5mg of Avicel (amorphous cellulose) as excipients for direct tablet
making, 1.5mg of sodium starch glyconate as a supplementary disintegrating agent, and 8mg of L-HPC
(low-hydroxypropylcellulose) as a binder, and then the mixture were mixed for 20 minutes. After the mixing, lmg of magnesium stearate as a lubricant was further added thereto, followed by mixing for additional 3 minutes. The mixture was subjected to a weight determination test and an anti-humidity test. Then, tablets were made from the mixture and coated with a film to provide finished tablets.
<l-2> Preparation of Syrup
Syrup comprising 2- (4-allyl -2 , 6-dimethoxyphenoxy) - 1- (4-hydroxy-3-methoxyphenyl) -propane, austrobailignan 7, licarin E or a pharmaceutically acceptable salt thereof in an amount of 2% (W/V) as an active component was prepared by the following process: 2g of an acid addition salt of 2- (4-allyl-2 , 6-dimethoxyphenoxy) -1- (4-hydroxy-3- methoxyphenyl) -propane, austrobailignan 7 of the present invention, 0.8g of saccharin and 25.4 g of sugar were dissolved into 8Og of hot water. After cooling the solution, 8.Og of glycerin, 0.04g of a perfume, 4.0g of ethanol , 0 , 4g of sorbic acid and an adequate amount of distilled water were mixed with the solution. Water was added to the resultant mixture to the final volume of 100ml.
<l-3> Preparation of Capsule
50mg of 2- (4-allyl-2 , 6-dimethoxyphenoxy) -1- (4- hydroxy-3 -methoxyphenyl) -propane, austrobailignan 7, licarin E or an extract of the aril of nutmeg of the present invention, 50mg of lactose, 46.5mg of starch, lmg of talc and an adequate amount of magnesium stearate were mixed. Then, the mixture was filled into hard gelatin capsules to provide finished capsules.
<l-4> Preparation of Injection Solution
An injection solution comprising lOmg of the active component was prepared by the following process: Ig of hydrochloride salt of 2- (4 -allyl-2 , 6-dimethoxyphenoxy) -1-
(4 -hydroxy-3 -methoxyphenyl) -propane, austrobailignan 7, or licarin E of the present invention, 0.6g of sodium chloride and 0. Ig of ascorbic acid were dissolved in distilled water to the final volume of 100ml. The solution was introduced into ampoules, and the ampoules were heated and sterilized at 120 "C for 30 minutes.
Industrial Applicability
As can be seen from the foregoing, 2- (4-allyl-2 , 6- dimethoxyphenoxy) -1- (4 -hydroxy-3 -methoxyphenyl) -propane, austrobailignan 7 or licarin E are the compounds isolated from an extract of the aril of nutmeg. The said compound and extract of the aril of nutmeg acts as ligands for
PPARY, and they may be used for preventing or treating PPARγ-mediated diseases, not limited thereto, such as diabetes and diabetic complication. Accordingly, 2- (4- allyl-2 , 6-dimethoxyphenoxy) -1- (4 -hydroxy-3- methoxyphenyl) -propane, austrobailignan 7 or licarin E and extract of the aril of nutmeg may be useful as preventing or treating reagent for PPARγ-mediated diseases, not limited thereto, such as diabetes and diabetic complication.
Claims
CLAIMS Claim 1
A pharmaceutical composition for preventing or treating diabetes comprising a C1-C6 organic solvent extract of an aril of nutmug as an active ingredient.
Claim 2
The composition according to claim 1, wherein the C1-C6 organic solvent is selected from the group consisting of methanol, ethanol, propanol, isopropanol, butanol, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, hexane, cyclohexane and petroleum ether.
Claim 3
A pharmaceutical composition for preventing or treating diabetes comprising a compound selected from the group consisting of a compound represented by Formula 1, a compound represented by Formula 2 , and a compound represented by Formula 3, or pharmaceutically acceptable salts thereof as an active ingredient.
<Formula 1>
<Formula 3>
Claim 4
The composition according to claim 3, wherein the diabetes is 2 type 2 diabetes.
Claim 5
A pharmaceutical composition for preventing a treating PPARY (peroxisome proliferator activated receptor γ) -mediated diseases comprising a compound selected from the group consisting of a compound represented by Formula 1, a compound represented by Formula 2, and a compound represented by Formula 3, or pharmaceutically acceptable salts thereof as an active ingredient .
Claim 6
The composition according to claim 5, wherein the PPARγ-mediated diseases are selected from the group consisting of type 2 diabetes (NIDDM; non-insulin- dependent diabetes mellitus) , hyperinsulinemia, obesity, hyperglycemia, hyperlipidemia, syndrome X, hypercholesterolemia, hyperlipoproteinemia, atherosclerosis, hypertension, insulin resistance, dysmetabolic syndrome, diabetic complications, impaired glucose homeostasis, impaired glucose tolerance, hypertriglyceridemia, osteoporosis, glomerulonephritis and glycosurian nephropathy.
Claim 7
Use of a C1-C6 organic solvent extract of a aril of nutmug for the manufacture of an agent for treating diabetes .
Claim 8
A method for preventing or treating diabetes comprising administering a C1-C6 organic solvent extract of an aril of nutmug with an effective amount to subject in need thereof .
Claim 9
Use of a compound selected from the group
consisting of a compound represented by Formula 1, a compound represented by Formula 2 , and a compound represented by Formula 3, or pharmaceutically acceptable salts thereof for the manufacture of an agent for treating diabetes.
Claim 10
A method for preventing or treating diabetes comprising administering a compound selected from the group consisting of a compound represented by Formula 1, a compound represented by Formula 2, and a compound represented by Formula 3, or pharmaceutically acceptable salts thereof with an effective amount to subject in need thereof.
Claim 11
Use of a compound is selected from the group consisting of a compound represented by Formula 1, a compound represented by Formula 2, and a compound represented by Formula 3, or pharmaceutically acceptable salts thereof for the manufacture of an agent for treating PPARy-mediated diseases.
Claim 12 A method for preventing or treating PPARγ-mediated diseases comprising administering a compound selected from the group consisting of a compound represented by
Formula 1, a compound represented by Formula 2, and a compound represented by Formula 3, or pharmaceutically acceptable salts thereof with an effective amount to subject in need thereof.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2007-0060176 | 2007-06-20 | ||
| KR20070060176 | 2007-06-20 | ||
| KR1020080019147A KR100959557B1 (en) | 2007-06-20 | 2008-02-29 | Pharmaceutical composition for the prevention and treatment of diabetes or PIA-gamma-mediated diseases comprising nutmeg adenocarcinoma extract compound |
| KR10-2008-0019147 | 2008-02-29 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2008156331A2 true WO2008156331A2 (en) | 2008-12-24 |
| WO2008156331A3 WO2008156331A3 (en) | 2009-02-26 |
Family
ID=40156812
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2008/003525 Ceased WO2008156331A2 (en) | 2007-06-20 | 2008-06-20 | Novel use of lignan compounds |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2008156331A2 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2438923A4 (en) * | 2009-06-01 | 2012-11-28 | Univ Chosun Iacf | COMPOSITION FOR THE PREVENTION OR TREATMENT OF OBESITY-RELATED DISORDERS MEDIATED BY AMPK ACTIVATION AND THE ACTIVE INGREDIENTS OF WHICH HAVE 2,5-BIS-ARYL-3,4-DIMETHYLTETRAHYDROFURAN LIGNANS |
| CN113440517A (en) * | 2021-06-07 | 2021-09-28 | 江南大学 | Application of licarin B in preparation of medicine for preventing or/and treating non-alcoholic fatty liver disease |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2006273788A (en) * | 2005-03-30 | 2006-10-12 | Kaneka Corp | Composition originating from ppar ligand activity-having plant |
| KR100830192B1 (en) * | 2005-09-22 | 2008-05-19 | (주)바이오케어 | Composition for the prophylaxis or treatment of diseases mediated by PPAR containing mayis lignan or a pharmaceutically acceptable salt thereof as an active ingredient |
-
2008
- 2008-06-20 WO PCT/KR2008/003525 patent/WO2008156331A2/en not_active Ceased
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2438923A4 (en) * | 2009-06-01 | 2012-11-28 | Univ Chosun Iacf | COMPOSITION FOR THE PREVENTION OR TREATMENT OF OBESITY-RELATED DISORDERS MEDIATED BY AMPK ACTIVATION AND THE ACTIVE INGREDIENTS OF WHICH HAVE 2,5-BIS-ARYL-3,4-DIMETHYLTETRAHYDROFURAN LIGNANS |
| CN103936698A (en) * | 2009-06-01 | 2014-07-23 | 朝鲜大学校产学协力团 | Composition For Preventing Or Treating Adiposity Or Metabolism Syndrome |
| CN113440517A (en) * | 2021-06-07 | 2021-09-28 | 江南大学 | Application of licarin B in preparation of medicine for preventing or/and treating non-alcoholic fatty liver disease |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2008156331A3 (en) | 2009-02-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR100818586B1 (en) | Obesity and Metabolic syndrome treatment with tanshinone derivatives which increase metabolic activity | |
| Kwon et al. | Platyconic acid, a saponin from Platycodi radix, improves glucose homeostasis by enhancing insulin sensitivity in vitro and in vivo | |
| US7902254B1 (en) | Method for treating conditions mediated by PPAR using macelignan | |
| Saravanan et al. | Lipolytic and antiadipogenic effects of (3, 3-dimethylallyl) halfordinol on 3T3-L1 adipocytes and high fat and fructose diet induced obese C57/BL6J mice | |
| KR101034624B1 (en) | Chalcone compound derived from licorice that activates DY and its composition for preventing or treating pancreatic beta cell death and diabetic nephropathy using the same as an active ingredient | |
| KR20100088634A (en) | Extract of fraxinus excelsior seeds and therapeutic applications therefor | |
| KR20140100117A (en) | Compositions comprising the extract of Alnus japonica or the compounds derived therefrom for inhibiting adipogenesis | |
| CN1902189A (en) | Plant-origin beta3-adrenoceptor agonist and use of the same | |
| KR100999317B1 (en) | Insulin resistance improvers | |
| KR100959557B1 (en) | Pharmaceutical composition for the prevention and treatment of diabetes or PIA-gamma-mediated diseases comprising nutmeg adenocarcinoma extract compound | |
| US10183048B2 (en) | Composition for promoting the activity of peroxisome proliferator-activated receptor-delta | |
| WO2016048005A2 (en) | Novel pentadienoyl piperidine derivative and use thereof | |
| JP4165658B2 (en) | Insulin resistance improving agent | |
| JP2005503381A (en) | Sesquiterpenoid derivatives with adipocyte differentiation inhibitory action | |
| CN1901900A (en) | Treatment of Obesity and Metabolic Syndrome with Salvia Derivatives with Enhanced Metabolic Activity | |
| CN114246873A (en) | Use of compounds and extracts derived from antrodia camphorata as FGF21 agonists and therapeutics or prophylactics for related diseases | |
| KR100892120B1 (en) | Pharmaceutical composition for treating or preventing type 2 diabetes | |
| KR20070033938A (en) | Composition for the prophylaxis or treatment of diseases mediated by PPAR containing mayis lignan or a pharmaceutically acceptable salt thereof as an active ingredient | |
| HK40063310A (en) | Use of compounds and extracts derived from antrodia camphorata as fgf21 agonists and therapeutic or preventive agents for related diseases | |
| KR102009219B1 (en) | A composition for preventing or improving obesity or obesity-related disease comprising gentiopicroside | |
| KR20070001326A (en) | Novel Ligands of the Nuclear Receptor PIA Gamma | |
| HK40017504B (en) | Composition comprising ginsenoside | |
| HK1120806B (en) | Agent for improving insulin resistance | |
| HK1122985A1 (en) | Agent for improving insulin resistance | |
| HK1123975A (en) | Agent for improving insulin resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08766484 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 32PN | Ep: public notification in the ep bulletin as address of the adressee cannot be established |
Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 07.04.2010). |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 08766484 Country of ref document: EP Kind code of ref document: A2 |












